WorldWideScience

Sample records for pre main sequence

  1. Additional measurements of pre-main-sequence stellar rotation

    International Nuclear Information System (INIS)

    Hartmann, L.; Stauffer, J.R.

    1989-01-01

    New rotational-velocity measurements for pre-main-sequence stars in the Taurus-Auriga molecular cloud are reported. Rotational velocities or upper limits of 10 km/s are now available for 90 percent of the T Tauri stars with V less than 14.7 in the catalog of Cohen and Kuhi. Measurements of 'continuum emission' stars, thought to be accreting high-angular-momentum material from a circumstellar disk, show that these objects are not especially rapid rotators. The results confirm earlier findings that angular-momentum loss proceeds very efficiently in the earliest stages of star formation, and suggest that stars older than about one million yr contract to the main sequence at nearly constant angular momentum. The slow rotation of T Tauri stars probably requires substantial angular-momentum loss via a magnetically coupled wind. 35 references

  2. Photometric monitoring of pre-main sequence stars - 2

    International Nuclear Information System (INIS)

    Evans, A.; Davies, J.K.; Kilkenny, D.; Bode, M.F.

    1989-01-01

    A discussion is presented of the infrared and optical photometric variability of the pre-main sequence stars BF Ori and UX Ori. In the former case, the reddening that occurs during decline, at both optical and infrared wavelengths, is consistent with variable extinction by circumstellar grains having an interstellar-like reddening law. While in the case of UX Ori, the data suggest variability due to starspots. In both cases, a study of the polarimetric variability would be valuable to confirm these conclusions. (author)

  3. Pre-main sequence sun: a dynamic approach

    International Nuclear Information System (INIS)

    Newman, M.J.; Winkler, K.H.A.

    1979-01-01

    The classical pre-main sequence evolutionary behavior found by Hayashi and his coworkers for the Sun depends crucially on the choice of initial conditions. The Hayashi picture results from beginning the calculation with an already centrally condensed, highly Jeans unstable object not terribly far removed from the stellar state initially. The present calculation follows the work of Larson in investigating the hydrodynamic collapse and self-gravitational accretion of an initially uniform, just Jeans unstable interstellar gas-dust cloud. The resulting picture for the early history of the Sun is quite different from that found by Hayashi. A rather small (R approx. = 2 R/sub sun/), low-luminosity (L greater than or equal to L/sub sun/) protostellar core develops. A fully convective stellar core, characteristic of Hayashi's work, is not found during the accretion process, and can only develop, if at all, in the subsequent pre-main sequence Kelvin-Helmholtz contraction of the core. 3 figures, 1 table

  4. Pre-main-sequence disk accretion in Z Canis Majoris

    International Nuclear Information System (INIS)

    Hartmann, L.; Kenyon, S.J.; Hewett, R.; Edwards, S.; Strom, K.M.; Strom, S.E.; Stauffer, J.R.

    1989-01-01

    It is suggested that the pre-main-sequence object Z CMa is a luminous accretion disk, similar in many respects to the FU Orionis variables. Z CMa shows the broad, doubled optical absorption lines expected from a rapidly rotating accretion disk. The first overtone CO absorption detected in Z CMa is blue-shifted, suggesting line formation in a disk wind. Accretion at rates about 0.001 solar mass/yr over 100 yr is required to explain the luminosity of Z CMa. The large amount of material accreted (0.1 solar mass/yr) indicates that Z CMa is in a very early stage of stellar evolution, possibly in an initial phase of massive disk accretion. 41 references

  5. Orbital motion in pre-main sequence binaries

    Energy Technology Data Exchange (ETDEWEB)

    Schaefer, G. H. [The CHARA Array of Georgia State University, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Simon, M. [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States); Patience, J., E-mail: schaefer@chara-array.org [Astrophysics Group, School of Physics, University of Exeter, Exeter, EX4 4QL (United Kingdom)

    2014-06-01

    We present results from our ongoing program to map the visual orbits of pre-main sequence (PMS) binaries in the Taurus star forming region using adaptive optics imaging at the Keck Observatory. We combine our results with measurements reported in the literature to analyze the orbital motion for each binary. We present preliminary orbits for DF Tau, T Tau S, ZZ Tau, and the Pleiades binary HBC 351. Seven additional binaries show curvature in their relative motion. Currently, we can place lower limits on the orbital periods for these systems; full solutions will be possible with more orbital coverage. Five other binaries show motion that is indistinguishable from linear motion. We suspect that these systems are bound and might show curvature with additional measurements in the future. The observations reported herein lay critical groundwork toward the goal of measuring precise masses for low-mass PMS stars.

  6. Pre-main-sequence disk accretion in Z Canis Majoris

    Science.gov (United States)

    Hartmann, L.; Kenyon, S. J.; Hewett, R.; Edwards, S.; Strom, K. M.; Strom, S. E.; Stauffer, J. R.

    1989-01-01

    It is suggested that the pre-main-sequence object Z CMa is a luminous accretion disk, similar in many respects to the FU Orionis variables. Z CMa shows the broad, doubled optical absorption lines expected from a rapidly rotating accretion disk. The first overtone CO absorption detected in Z CMa is blue-shifted, suggesting line formation in a disk wind. Accretion at rates about 0.001 solar mass/yr over 100 yr is required to explain the luminosity of Z CMa. The large amount of material accreted (0.1 solar mass/yr) indicates that Z CMa is in a very early stage of stellar evolution, possibly in an initial phase of massive disk accretion.

  7. Pre-main-sequence evolution of the sun

    International Nuclear Information System (INIS)

    Gough, D.

    1980-01-01

    The phase of solar evolution after the dynamical collapse is considered. The physics of the Kelvin-Helmholtz phase of gravitational collapse is described, attention being given to the early stages of the star when it was completely convective. It is noted that subsequently, a radiative core developed and evolution was controlled by the rate at which heat can diffuse through it by radiative transfer. Since the study of the Kelvin-Helmholtz contraction alone does not give enough information regarding the state of the sun when it first settled down to approximate hydrostatic equilibrium, other stars are studied, and information on the sun is obtained by analogy. Many young solar-type stars, such as the T Tauri stars, are not in the completely convective Hayashi (1961) phase hence it is proposed that the sun was completely mixed soon after its formation, which has some bearing on the sun's chemical structure. It is suggested that the surface of the sun was very nonuniform compared with the photosphere of today. The simple solar evolution model presented gives a good guide to the general way in which the sun contracted to the main sequence

  8. Tracing early stellar evolution with asteroseismology: pre-main sequence stars in NGC 2264

    Directory of Open Access Journals (Sweden)

    Zwintz Konstanze

    2015-01-01

    Full Text Available Asteroseismology has been proven to be a successful tool to unravel details of the internal structure for different types of stars in various stages of their main sequence and post-main sequence evolution. Recently, we found a relation between the detected pulsation properties in a sample of 34 pre-main sequence (pre-MS δ Scuti stars and the relative phase in their pre-MS evolution. With this we are able to demonstrate that asteroseismology is similarly powerful if applied to stars in the earliest stages of evolution before the onset of hydrogen core burning.

  9. Lithium evolution in metal-poor stars: from Pre-Main Sequence to the Spite plateau

    OpenAIRE

    Fu, Xiaoting; Bressan, Alessandro; Molaro, Paolo; Marigo, Paola

    2015-01-01

    Lithium abundance derived in metal-poor main sequence stars is about three times lower than the value of primordial Li predicted by the standard Big Bang nucleosynthesis when the baryon density is taken from the CMB or the deuterium measurements. This disagreement is generally referred as the lithium problem. We here reconsider the stellar Li evolution from the pre-main sequence to the end of the main sequence phase by introducing the effects of convective overshooting and residual mass accre...

  10. A near-infrared survey for pre-main sequence stars in Taurus

    Science.gov (United States)

    Gomez, Mercedes; Kenyon, Scott J.; Hartmann, Lee

    1994-01-01

    We present a near-infrared survey of approximately 2 sq deg covering parts of L1537, L1538, and Heiles cloud 2 in the Taurus-Auriga molecular cloud. Although this study is more sensitive than previous attempts to identify pre-main sequence stars in Taurus-Auriga, our survey regions contain only one new optically visible, young star. We did find several candidate embedded protostars; additional 10 micrometer photometry is necessary to verify the pre-main sequence nature of these sources. Our results--combined with those of previous surveys--show that the L1537/L1538 clouds contain no pre-main sequence stars. These two clouds are less dense than the active star formation sites in Taurus-Auriga, which suggests a cloud must achieve a threshold density to form stars.

  11. AK Sco: a tidally induced atmospheric dynamo in a pre-main sequence binary?

    Science.gov (United States)

    Gómez de Castro, A. I.

    2009-02-01

    AK Sco is a unique source: a 10-30 Myrs old pre-main sequence spectroscopic binary composed by two nearly equal F5 stars that at periastron are separated by barely eleven stellar radii so, the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes of AK Sco, the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during pre-main sequence evolution. Evidence of this effect is reported in this contribution.

  12. 13-colour photometry of pre-main sequence stars: preliminary report and results

    Energy Technology Data Exchange (ETDEWEB)

    Chavarria-K, C; de Lara, E [Universidad Nacional Autonoma de Mexico, Mexico City. Inst. de Astronomia

    1981-01-01

    Broad (UBVRI) and intermediate (13-colour) band photometry of 160 stars selected mainly from the Herbig Rao catalogue are being carried on currently, mainly to complement the published data of these stars in the optical window (for example shortward of the Balmer and longward of the Paschen discontinuities). The 13-colour photometric system and its applications to pre-main sequences stars are briefly discussed. First results are presented.

  13. Pre-main sequence masses and the age spread in the Orion cluster

    International Nuclear Information System (INIS)

    McNamara, B.J.

    1975-01-01

    The spread in formation times for stars earlier than GO in the Orion cluster is investigated. The range of stellar ages in this cluster is found to extend from at least 10 6 years to about 10 7 years. On the basis of this evidence and the similarity of the color--magnitude diagrams of other young clusters to the Orion cluster, it is suggested that the current method of dating these clusters (from the point at which the most massive stars just reach the zero-age main sequence) might not be valid. The masses of forty-one pre-main sequence stars within the ranges 4.05 less than or equal to log(Te) less than or equal to 3.77 and 0.6 less than or equal to log (L/L/sub sun/) less than or equal to 2.1 are determined from observed effective temperatures, luminosities, and gravities. These masses were then compared with those expected from Iben's (1965) pre-main sequence evolutionary calculations. In most cases, the agreement between these values was found to be within the observational errors. Finally, the pre-main sequence stars possessing infrared excesses are found to be apparently among the most massive and youngest stars still contracting toward the zero-age main sequence

  14. IRAS IDENTIFICATION OF PRE-MAIN-SEQUENCE STARS IN THE CHAMELEON-II ASSOCIATION

    NARCIS (Netherlands)

    PRUSTI, T; WHITTET, DCB; ASSENDORP, R; WESSELIUS, PR

    We report the results of a search for new pre-main sequence candidates in the Chamaeleon II dark cloud based on three IRAS catalogues (the Point Source Catalog, the Serendipitous Survey Catalog and the Faint Source Survey). A total of 30 sources were selected. Twelve of these display IRAS colours

  15. Radio emission from pre-main-sequence stars in Corona Australis

    International Nuclear Information System (INIS)

    Brown, A.

    1987-01-01

    The central region of the Corona Australis molecular cloud surrounding the stars R and TY CrA has been studied using the VLA at 6 cm. Eleven radio sources are detected including five associated with pre-main-sequence objects. The most striking is associated with the near-IR source IRS 7 and shows a complex structure comprising two strong pointlike sources positioned either side of the deeply embedded IR source and two extended lobes of radio emission. The IRS 7 radio source appears to be similar to that associated with Lynds 1551 IRS 5 but has a considerably larger angular size. The other detected sources include the massive pre-main-sequence star TY CrA, the near-IR sources IRS 1 and IRS 5, and the Herbig-Haro object HH 101. The stars R and T CrA were not detected. 35 references

  16. Mass loss from pre-main-sequence accretion disks. I - The accelerating wind of FU Orionis

    Science.gov (United States)

    Calvet, Nuria; Hartmann, Lee; Kenyon, Scott J.

    1993-01-01

    We present evidence that the wind of the pre-main-sequence object FU Orionis arises from the surface of the luminous accretion disk. A disk wind model calculated assuming radiative equilibrium explains the differential behavior of the observed asymmetric absorption-line profiles. The model predicts that strong lines should be asymmetric and blueshifted, while weak lines should be symmetric and double-peaked due to disk rotation, in agreement with observations. We propose that many blueshifted 'shell' absorption features are not produced in a true shell of material, but rather form in a differentially expanding wind that is rapidly rotating. The inference of rapid rotation supports the proposal that pre-main-sequence disk winds are rotationally driven.

  17. Relation of chromospheric activity to convection, rotation, and pre-main-sequence evolution

    International Nuclear Information System (INIS)

    Gilliland, R.L.

    1986-01-01

    Pre-main-sequence, or T Tauri, stars are characterized by much larger fluxes of nonradiative origin than their main-sequence counterparts. As a class, the T Tauri stars have only moderate rotation rates, making an explanation of their chromospheric properties based on rapid rotation problematic. The recent success of correlating nonradiative fluxes to the Rossby number, Ro = P/sub rot//tau/sub conv/, a central parameter of simple dynamo theories of magnetic field generation, has led to the suggestion that the same relation might be of use in explaining the pre-main-sequence (PMS) stars if tau/sub conv/ is very large. We show that tau/sub conv/ does depend strongly on evolutionary effects above the main sequence (MS), but that this dependence alone cannot account for the high observed nonradiative fluxes. The acoustic flux is also strongly dependent on PMS evolutionary state, and when coupled to the parameterization of magnetic activity based on Ro, these two mechanisms seem capable of explaining the high observed level of chromospheric activity in T Tauri stars. The moment of inertia decreases by two to three order of magnitude during PMS evolution. Since young MS stars do not rotate two to three orders of magnitude faster than PMS stars, rapid loss or redistribution of angular momentum must occur

  18. Discovery of three x-ray luminous pre-main-sequence stars

    International Nuclear Information System (INIS)

    Feigelson, E.D.; Kriss, G.A.

    1981-01-01

    Three X-ray sources found serendipitously in Einstein images of the Taurus-Auriga cloud complex were observed at the McGraw-Hill Observatory and are found to be associated with approx.12 mag stars with weak Hα emission. The stars lie on the edges of dark clouds and are spectroscopically similar to the least active emission-line pre-main-sequence stars. Although they lie well above the ZAMS in the H-R diagram, they do not exhibit ultraviolet excess, strong optical variability, or evidence for mass outflow/inflow characteristics of the more active T Tauri stars. Their only unusual property is high X-ray luminosity (approx.10 30 ergs s1). It is suggested that the X-ray emission from pre-main-sequence stars is not closely linked to the conditions giving rise to their unusual spectroscopic properties. The emission may instead represent an enhanced form of the coronal activity producing X-rays observed in late-type main-sequence stars

  19. Rotation in moderate-mass pre-main-sequence radiative track G stars

    International Nuclear Information System (INIS)

    Mcnamara, B.

    1990-01-01

    Recent studies suggest that the observed high-mass radiative track velocity histograms for pre-main-sequence stars differ significantly. In the Vogel and Kuhi (1981) study, these stars were found to possess a rather broad distribution of rotational velocities with a moderate peak at low velocities. In contrast, Smith et al. (1983), found a very sharply peaked distribution located at low values of v sin i. The difference in these velocity distributions is shown to be due to inadequate allowance for field stars in the Smith, et al., work. Once these stars are removed, the high-mass velocity distributions of the two regions are remarkably similar. This result suggests that a unique velocity distribution might be used in modeling very young stars. Assuming that the Orion Ic proto-F stars continue to contract in a homologous fashion, their average current rotational velocity is in agreement with that expected for zero-age main sequence F stars. 27 refs

  20. INTRINSIC COLORS, TEMPERATURES, AND BOLOMETRIC CORRECTIONS OF PRE-MAIN-SEQUENCE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Pecaut, Mark J.; Mamajek, Eric E. [University of Rochester, Department of Physics and Astronomy, Rochester, NY 14627-0171 (United States)

    2013-09-01

    We present an analysis of the intrinsic colors and temperatures of 5-30 Myr old pre-main-sequence (pre-MS) stars using the F0- through M9-type members of nearby, negligibly reddened groups: the η Cha cluster, the TW Hydra Association, the β Pic Moving Group, and the Tucana-Horologium Association. To check the consistency of spectral types from the literature, we estimate new spectral types for 52 nearby pre-MS stars with spectral types F3 through M4 using optical spectra taken with the SMARTS 1.5 m telescope. Combining these new types with published spectral types and photometry from the literature (Johnson-Cousins BVI{sub C} , 2MASS JHK{sub S} and WISE W1, W2, W3, and W4), we derive a new empirical spectral type-color sequence for 5-30 Myr old pre-MS stars. Colors for pre-MS stars match dwarf colors for some spectral types and colors, but for other spectral types and colors, deviations can exceed 0.3 mag. We estimate effective temperatures (T {sub eff}) and bolometric corrections (BCs) for our pre-MS star sample through comparing their photometry to synthetic photometry generated using the BT-Settl grid of model atmosphere spectra. We derive a new T {sub eff} and BC scale for pre-MS stars, which should be a more appropriate match for T Tauri stars than often-adopted dwarf star scales. While our new T {sub eff} scale for pre-MS stars is within ≅100 K of dwarfs at a given spectral type for stars pre-MS stars are ∼250 K cooler than their MS counterparts. Lastly, we present (1) a modern T {sub eff}, optical/IR color, and BC sequence for O9V-M9V MS stars based on an extensive literature survey, (2) a revised Q-method relation for dereddening UBV photometry of OB-type stars, and (3) introduce two candidate spectral standard stars as representatives of spectral types K8V and K9V.

  1. New radio detections of early-type pre-main-sequence stars

    Science.gov (United States)

    Skinner, Stephen L.; Brown, Alexander; Linsky, Jeffrey L.

    1990-01-01

    Results of VLA radio continuum observations of 13 early-type pre-main-sequence stars selected from the 1984 catalog of Finkenzeller and Mundt are presented. The stars HD 259431 and MWC 1080 were detected at 3.6 cm, while HD 200775 and TY CrA were detected at both 3.6 and 6 cm. The flux density of HD 200775 has a frequency dependence consistent with the behavior expected for free-free emission originating in a fully ionized wind. However, an observation in A configuration suggests that the source geometry may not be spherically symmetric. In contrast, the spectral index of TY CrA is negative with a flux behavior implying nonthermal emission. The physical mechanism responsible for the nonthermal emission has not yet been identified, although gyrosynchrotron and synchrotron processes cannot be ruled out.

  2. New radio detections of early-type pre-main-sequence stars

    International Nuclear Information System (INIS)

    Skinner, S.L.; Brown, A.; Linsky, J.L.

    1990-01-01

    Results of VLA radio continuum observations of 13 early-type pre-main-sequence stars selected from the 1984 catalog of Finkenzeller and Mundt are presented. The stars HD 259431 and MWC 1080 were detected at 3.6 cm, while HD 200775 and TY CrA were detected at both 3.6 and 6 cm. The flux density of HD 200775 has a frequency dependence consistent with the behavior expected for free-free emission originating in a fully ionized wind. However, an observation in A configuration suggests that the source geometry may not be spherically symmetric. In contrast, the spectral index of TY CrA is negative with a flux behavior implying nonthermal emission. The physical mechanism responsible for the nonthermal emission has not yet been identified, although gyrosynchrotron and synchrotron processes cannot be ruled out. 32 refs

  3. Globules, dark clouds, and low mass pre-main sequence stars

    International Nuclear Information System (INIS)

    Hyland, A.R.

    1981-01-01

    The current observational and theoretical literature on Bok globules and their relationship to star formation is reviewed. Recent observations of globules at optical, infrared, and far infrared wavelengths are shown to provide important constraints on their structure and evolutionary status, and the suggestion that many globules are gravitationally unstable is seriously questioned. Dark clouds associated with T associations are well-known sites of recent and continuing star formation. In recent years molecular observations and far infrared surveys have provided maps of such regions from which possible sites of star formation may be identified. Optical (Hα) and near infrared surveys have enabled a clear identification of pre-main sequence (PMS) objects within the clouds. Methods of distinguishing these from background objects and the nature of their infrared excesses are examined in the light of recent observations in the near and far infrared. The perennial question as to the existence of anomalous reddening within dark clouds is also investigated. (Auth.)

  4. ABSOLUTE PROPERTIES OF THE PRE-MAIN-SEQUENCE ECLIPSING BINARY STAR NP PERSEI

    Energy Technology Data Exchange (ETDEWEB)

    Lacy, Claud H. Sandberg [Physics Department, University of Arkansas, Fayetteville, AR 72701 (United States); Fekel, Francis C.; Muterspaugh, Matthew W. [Center of Excellence in Information Systems, Tennessee State University, Nashville, TN 37209 (United States); Pavlovski, Krešimir [Department of Physics, Faculty of Science, University of Zagreb, Bijenička cesta 32, 10000 Zagreb (Croatia); Torres, Guillermo, E-mail: clacy@uark.edu, E-mail: fekel@evans.tsuniv.edu, E-mail: pavlovski@phy.hr, E-mail: gtorres@cfa.harvard.edu, E-mail: matthew1@coe.tsuniv.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2016-07-01

    NP Per is a well-detached, 2.2 day eclipsing binary whose components are both pre-main-sequence stars that are still contracting toward the main-sequence phase of evolution. We report extensive photometric and spectroscopic observations with which we have determined their properties accurately. Their surface temperatures are quite different: 6420 ± 90 K for the larger F5 primary star and 4540 ± 160 K for the smaller K5e star. Their masses and radii are 1.3207 ± 0.0087 solar masses and 1.372 ± 0.013 solar radii for the primary, and 1.0456 ± 0.0046 solar masses and 1.229 ± 0.013 solar radii for the secondary. The orbital period is variable over long periods of time. A comparison of the observations with current stellar evolution models from MESA indicates that the stars cannot be fit at a single age: the secondary appears significantly younger than the primary. If the stars are assumed to be coeval and to have the age of the primary (17 Myr), then the secondary is larger and cooler than predicted by current models. The H α spectral line of the secondary component is completely filled by, presumably, chromospheric emission due to a magnetic activity cycle.

  5. Characterizing Intermediate-Mass, Pre-Main-Sequence Stars via X-Ray Emision

    Science.gov (United States)

    Haze Nunez, Evan; Povich, Matthew Samuel; Binder, Breanna Arlene; Broos, Patrick; Townsley, Leisa K.

    2018-01-01

    The X-ray emission from intermediate-mass, pre-main-sequence stars (IMPS) can provide useful constraints on the ages of very young (${getting power from the gravitational contraction of the star. Main-sequence late-B and A-type stars are not expected to be strong X-ray emitters, because they lack the both strong winds of more massive stars and the magneto-coronal activity of lower-mass stars. There is, however, mounting evidence that IMPS are powerful intrinsic x-ray emitters during their convection-dominated early evolution, before the development and rapid growth of a radiation zone. We present our prime candidates for intrinsic, coronal X-ray emission from IMPS identified in the Chandra Carina Complex Project. The Carina massive star-forming complex is of special interest due to the wide variation of star formation stages within the region. Candidate IMPS were identified using infrared spectral energy distribution (SED) models. X-ray properties, including thermal plasma temperatures and absorption-corrected fluxes, were derived from XSPEC fits performed using absorption ($N_{H}$) constrained by the extinction values returned by the infrared SED fits. We find that IMPS have systematically higher X-ray luminosities compared to their lower-mass cousins, the TTauri stars.This work is supported by the National Science Foundation under grant CAREER-1454334 and by NASA through Chandra Award 18200040.

  6. Hubble Tarantula Treasury Project - VI. Identification of Pre-Main-Sequence Stars using Machine Learning techniques

    Science.gov (United States)

    Ksoll, Victor F.; Gouliermis, Dimitrios A.; Klessen, Ralf S.; Grebel, Eva K.; Sabbi, Elena; Anderson, Jay; Lennon, Daniel J.; Cignoni, Michele; de Marchi, Guido; Smith, Linda J.; Tosi, Monica; van der Marel, Roeland P.

    2018-05-01

    The Hubble Tarantula Treasury Project (HTTP) has provided an unprecedented photometric coverage of the entire star-burst region of 30 Doradus down to the half Solar mass limit. We use the deep stellar catalogue of HTTP to identify all the pre-main-sequence (PMS) stars of the region, i.e., stars that have not started their lives on the main-sequence yet. The photometric distinction of these stars from the more evolved populations is not a trivial task due to several factors that alter their colour-magnitude diagram positions. The identification of PMS stars requires, thus, sophisticated statistical methods. We employ Machine Learning Classification techniques on the HTTP survey of more than 800,000 sources to identify the PMS stellar content of the observed field. Our methodology consists of 1) carefully selecting the most probable low-mass PMS stellar population of the star-forming cluster NGC2070, 2) using this sample to train classification algorithms to build a predictive model for PMS stars, and 3) applying this model in order to identify the most probable PMS content across the entire Tarantula Nebula. We employ Decision Tree, Random Forest and Support Vector Machine classifiers to categorise the stars as PMS and Non-PMS. The Random Forest and Support Vector Machine provided the most accurate models, predicting about 20,000 sources with a candidateship probability higher than 50 percent, and almost 10,000 PMS candidates with a probability higher than 95 percent. This is the richest and most accurate photometric catalogue of extragalactic PMS candidates across the extent of a whole star-forming complex.

  7. An extensive VLT/X-shooter library of photospheric templates of pre-main sequence stars

    Science.gov (United States)

    Manara, C. F.; Frasca, A.; Alcalá, J. M.; Natta, A.; Stelzer, B.; Testi, L.

    2017-09-01

    Context. Studies of the formation and evolution of young stars and their disks rely on knowledge of the stellar parameters of the young stars. The derivation of these parameters is commonly based on comparison with photospheric template spectra. Furthermore, chromospheric emission in young active stars impacts the measurement of mass accretion rates, a key quantity for studying disk evolution. Aims: Here we derive stellar properties of low-mass (M⋆≲ 2 M⊙) pre-main sequence stars without disks, which represent ideal photospheric templates for studies of young stars. We also use these spectra to constrain the impact of chromospheric emission on the measurements of mass accretion rates. The spectra are reduced, flux-calibrated, and corrected for telluric absorption, and are made available to the community. Methods: We derive the spectral type for our targets by analyzing the photospheric molecular features present in their VLT/X-shooter spectra by means of spectral indices and comparison of the relative strength of photospheric absorption features. We also measure effective temperature, gravity, projected rotational velocity, and radial velocity from our spectra by fitting them with synthetic spectra with the ROTFIT tool. The targets have negligible extinction (AVpresented in our previous publication. We perform synthetic photometry on the spectra to derive the typical colors of young stars in different filters. We measure the luminosity of the emission lines present in the spectra and estimate the noise due to chromospheric emission in the measurements of accretion luminosity in accreting stars. Results: We provide a calibration of the photospheric colors of young pre-main sequence stars as a function of their spectral type in a set of standard broad-band optical and near-infrared filters. The logarithm of the noise on the accretion luminosity normalized to the stellar luminosity is roughly constant and equal to -2.3 for targets with masses larger than 1 solar

  8. Pre-main-sequence depletion of Li-6 and Li-7

    International Nuclear Information System (INIS)

    Proffitt, C.R.; Michaud, G.

    1989-01-01

    Depletion of Li-6 and Li-7 during premain-sequence contraction has been calculated for several evolutionary sequences. Slightly greater Li-7 depletion was found than by other recent workers. On the premain sequence, Li-6 is depleted by a factor of at least 10 in the present models for stars with T(eff) lower than 6800 K on the main sequence. Because of the shorter destruction time scale for Li-6 as compared to Li-7, the determination of the abundances of these two isotopes would place strict constraints on the structure of premain-sequence stars. 39 refs

  9. THE MULTIPLE PRE-MAIN-SEQUENCE SYSTEM HBC 515 IN L1622

    International Nuclear Information System (INIS)

    Reipurth, Bo; Aspin, Colin; Herbig, George

    2010-01-01

    The bright pre-main-sequence star HBC 515 (HD 288313) located in the L1622 cometary cloud in Orion has been studied extensively with optical/infrared imaging and ultraviolet/optical/infrared spectroscopy. The spectra indicate that HBC 515 is a weakline T Tauri star (TTS) of spectral type K2V. Adaptive optics imaging in the K band reveals that HBC 515 is a binary with two equally bright components separated by 0.''5. A very faint third component is found 5'' to the northwest. Spitzer IRAC and MIPS observations show that at mid-infrared wavelengths this third source dominates the system, suggesting that it is a protostar still embedded in the nascent cloud of HBC 515. The close association of a weakline TTS with a newborn protostar in a multiple system is noteworthy. Two nearby TTSs are likely associated with the HBC 515 multiple system, and the dynamical evolution of the complex that would lead to such a configuration is considered.

  10. YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

    Energy Technology Data Exchange (ETDEWEB)

    Morales-Calderon, M.; Stauffer, J. R.; Rebull, L. M. [Spitzer Science Center, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Stassun, K. G. [Physics and Astronomy Department, Vanderbilt University, 1807 Station B, Nashville, TN 37235 (United States); Vrba, F. J. [U. S. Naval Observatory, Flagstaff Station, 10391 W. Naval Observatory Road, Flagstaff, AZ 86001-8521 (United States); Prato, L. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Hillenbrand, L. A.; Carpenter, J. M. [Astronomy Department, California Institute of Technology, 1200 E California Blvd., Pasadena, CA 91125 (United States); Terebey, S.; Angione, J. [Department of Physics and Astronomy, California State University at Los Angeles, Los Angeles, CA 90032 (United States); Covey, K. R. [Department of Astronomy, Cornell University, 226 Space Sciences Building, Ithaca, NY 14853 (United States); Terndrup, D. M. [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Gutermuth, R. [Department of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Song, I. [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States); Plavchan, P. [NASA Exoplanet Science Institute, California Institute of Technology, Pasadena, CA 91125 (United States); Marchis, F. [SETI Institute, Carl Sagan Center, 189 N San Bernado Av, Mountain View, CA 94043 (United States); Garcia, E. V. [Department of Physics, Fisk University, 1000 17th Ave. N, Nashville, TN 37208 (United States); Margheim, S. [Gemini Observatory, Southern Operations Center, Casilla 603, La Serena (Chile); Luhman, K. L. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Irwin, J. M., E-mail: mariamc@cab.inta-csic.es [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States)

    2012-07-10

    Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for {approx}2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass ({theta}{sup 1} Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M{sub Sun }) and longest-period (ISOY J053505.71-052354.1, P {approx} 20 days) PMS EBs currently known. In two cases ({theta}{sup 1} Ori E and ISOY J053526.88-044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

  11. Time Variability of the Dust Sublimation Zones in Pre-Main Sequence Disk Systems

    Science.gov (United States)

    Sitko, Michael L.; Carpenter, W. J.; Grady, C. A.; Russel, R. W.; Lynch, D. K.; Rudy, R. J.; Mazuk, S. M.; Venturini, C. C.; Kimes, R. L.; Beerman, L. C.; hide

    2007-01-01

    The dust sublimation zone (DSZ) is the region of pre-main sequence (PMS) disks where dust grains most easily anneal, sublime, and condense out of the gas. Because of this, it is a location where crystalline material may be enhanced and redistributed throughout the rest of the disk. A decade-long program to monitor the thermal emission of the grains located in this region demonstrates that large changes in emitted flux occur in many systems. Changes in the thermal emission between 3 and 13.5 microns were observed in HD 31648 (MWC 480), HD 163296 (MWC 275), and DG Tau. This emission is consistent with it being produced at the DSZ, where the transition from a disk of gas to one of gas+dust occurs. In the case of DG Tau, the outbursts were accompanied by increased emission on the 10 micron silicate band on one occasion, while on another occasion it went into absorption. This requires lofting of the material above the disk into the line of sight. Such changes will affect the determination of the inner disk structure obtained through interferometry measurements, and this has been confirmed in the case of HD 163296. Cyclic variations in the heating of the DSZ will lead to the annealing of large grains, the sublimation of smaller grains, possibly followed by re-condensation as the zone enters a cooling phase. Lofting of dust above the disk plane, and outward acceleration by stellar winds and radiation pressure, can re-distribute the processed material to cooler regions of the disk, where cometesimals form. This processing is consistent with the detection of the preferential concentration of large crystalline grains in the inner few AU of PMS disks using interferometric spectroscopy with the VLTI.

  12. THE QUADRUPLE PRE-MAIN-SEQUENCE SYSTEM LkCa 3: IMPLICATIONS FOR STELLAR EVOLUTION MODELS

    International Nuclear Information System (INIS)

    Torres, Guillermo; Latham, David W.; Ruíz-Rodríguez, Dary; Prato, L.; Wasserman, Lawrence H.; Badenas, Mariona; Schaefer, G. H.; Mathieu, Robert D.

    2013-01-01

    We report the discovery that the pre-main-sequence (PMS) object LkCa 3 in the Taurus-Auriga star-forming region is a hierarchical quadruple system of M stars. It was previously known to be a close (∼0.''5) visual pair, with one component being a moderately eccentric 12.94 day single-lined spectroscopic binary. A re-analysis of archival optical spectra complemented by new near-infrared (NIR) spectroscopy shows both visual components to be double lined; the second one has a period of 4.06 days and a circular orbit. In addition to the orbital elements, we determine optical and NIR flux ratios, effective temperatures, and projected rotational velocities for all four stars. Using existing photometric monitoring observations of the system that had previously revealed the rotational period of the primary in the longer-period binary, we also detect the rotational signal of the primary in the 4.06 day binary, which is synchronized with the orbital motion. With only the assumption of coevality, a comparison of all of these constraints with current stellar evolution models from the Dartmouth series points to an age of 1.4 Myr and a distance of 133 pc, consistent with previous estimates for the region and suggesting that the system is on the near side of the Taurus complex. Similar comparisons of the properties of LkCa 3 and the well-known quadruple PMS system GG Tau with the widely used models from the Lyon series for a mixing length parameter of α ML = 1.0 strongly favor the Dartmouth models

  13. YSOVAR: SIX PRE-MAIN-SEQUENCE ECLIPSING BINARIES IN THE ORION NEBULA CLUSTER

    International Nuclear Information System (INIS)

    Morales-Calderón, M.; Stauffer, J. R.; Rebull, L. M.; Stassun, K. G.; Vrba, F. J.; Prato, L.; Hillenbrand, L. A.; Carpenter, J. M.; Terebey, S.; Angione, J.; Covey, K. R.; Terndrup, D. M.; Gutermuth, R.; Song, I.; Plavchan, P.; Marchis, F.; García, E. V.; Margheim, S.; Luhman, K. L.; Irwin, J. M.

    2012-01-01

    Eclipsing binaries (EBs) provide critical laboratories for empirically testing predictions of theoretical models of stellar structure and evolution. Pre-main-sequence (PMS) EBs are particularly valuable, both due to their rarity and the highly dynamic nature of PMS evolution, such that a dense grid of PMS EBs is required to properly calibrate theoretical PMS models. Analyzing multi-epoch, multi-color light curves for ∼2400 candidate Orion Nebula Cluster (ONC) members from our Warm Spitzer Exploration Science Program YSOVAR, we have identified 12 stars whose light curves show eclipse features. Four of these 12 EBs are previously known. Supplementing our light curves with follow-up optical and near-infrared spectroscopy, we establish two of the candidates as likely field EBs lying behind the ONC. We confirm the remaining six candidate systems, however, as newly identified ONC PMS EBs. These systems increase the number of known PMS EBs by over 50% and include the highest mass (θ 1 Ori E, for which we provide a complete set of well-determined parameters including component masses of 2.807 and 2.797 M ☉ ) and longest-period (ISOY J053505.71–052354.1, P ∼ 20 days) PMS EBs currently known. In two cases (θ 1 Ori E and ISOY J053526.88–044730.7), enough photometric and spectroscopic data exist to attempt an orbit solution and derive the system parameters. For the remaining systems, we combine our data with literature information to provide a preliminary characterization sufficient to guide follow-up investigations of these rare, benchmark systems.

  14. On precise ZAMSs, the solar color, and pre-main-sequence lithium depletion

    International Nuclear Information System (INIS)

    Vandenberg, D.A.; Poll, H.E.

    1989-01-01

    This paper describes a semiempirical main-sequence-fitting method for the determination of distances to stellar systems, which uses a ZAMS locus carefully normalized to the sun, and whose shape is defined by a quartic over the color range for (B-V)0 values between 0.2 and 1.0 such that the morphology of the Pleiades C-M diagram is accurately reproduced. Using this technique, distances were derived for a number of star clusters. It was found that the observed depletion of lithium among cool main-sequence stars in the Hyades and Pleiades can be matched quite well by the present models. Calculations also show that the depletion of Li at a fixed T(eff) along the main sequence is a sensitive function of Fe/H. 98 refs

  15. Empirical tests of pre-main-sequence stellar evolution models with eclipsing binaries

    Science.gov (United States)

    Stassun, Keivan G.; Feiden, Gregory A.; Torres, Guillermo

    2014-06-01

    We examine the performance of standard pre-main-sequence (PMS) stellar evolution models against the accurately measured properties of a benchmark sample of 26 PMS stars in 13 eclipsing binary (EB) systems having masses 0.04-4.0 M⊙ and nominal ages ≈1-20 Myr. We provide a definitive compilation of all fundamental properties for the EBs, with a careful and consistent reassessment of observational uncertainties. We also provide a definitive compilation of the various PMS model sets, including physical ingredients and limits of applicability. No set of model isochrones is able to successfully reproduce all of the measured properties of all of the EBs. In the H-R diagram, the masses inferred for the individual stars by the models are accurate to better than 10% at ≳1 M⊙, but below 1 M⊙ they are discrepant by 50-100%. Adjusting the observed radii and temperatures using empirical relations for the effects of magnetic activity helps to resolve the discrepancies in a few cases, but fails as a general solution. We find evidence that the failure of the models to match the data is linked to the triples in the EB sample; at least half of the EBs possess tertiary companions. Excluding the triples, the models reproduce the stellar masses to better than ∼10% in the H-R diagram, down to 0.5 M⊙, below which the current sample is fully contaminated by tertiaries. We consider several mechanisms by which a tertiary might cause changes in the EB properties and thus corrupt the agreement with stellar model predictions. We show that the energies of the tertiary orbits are comparable to that needed to potentially explain the scatter in the EB properties through injection of heat, perhaps involving tidal interaction. It seems from the evidence at hand that this mechanism, however it operates in detail, has more influence on the surface properties of the stars than on their internal structure, as the lithium abundances are broadly in good agreement with model predictions. The

  16. ULTRAVIOLET-SELECTED FIELD AND PRE-MAIN-SEQUENCE STARS TOWARD TAURUS AND UPPER SCORPIUS

    International Nuclear Information System (INIS)

    Findeisen, K.; Hillenbrand, L.

    2010-01-01

    We have carried out a Galaxy Evolution Explorer (GALEX) Cycle 1 guest investigator program covering 56 deg 2 near the Taurus T association and 12 deg 2 along the northern edge of the Upper Scorpius OB association. We combined photometry in the GALEX far-ultraviolet and near-ultraviolet bands with data from the Two Micron All Sky Survey to identify candidate young (∼<100 Myr old) stars as those with an ultraviolet excess relative to older main-sequence stars. Follow-up spectroscopy of a partial sample of these candidates suggests five new members of Taurus, with 8-20 expected from additional observations, and five new members of Upper Scorpius, with three to six expected from additional observations. These candidate new members appear to represent a distributed, non-clustered population in either region, although our sample statistics are as of yet too poor to constrain the nature or extent of this population. Rather, our study demonstrates the ability of GALEX observations to identify young stellar populations distributed over a wide area of the sky. We also highlight the necessity of a better understanding of the Galactic ultraviolet source population to support similar investigations. In particular, we report a large population of stars with an ultraviolet excess but no optical indicators of stellar activity or accretion, and briefly argue against several interpretations of these sources.

  17. A catalog of pre-main-sequence emission-line stars with IRAS source associations

    International Nuclear Information System (INIS)

    Weintraub, D.A.

    1990-01-01

    To aid in finding premain-sequence (PMS) emission-line stars that might have dusty circumstellar environments, 361 PMS stars that are associated with 304 separate IRAS sources were identified. These stars include 200 classical T Tauri stars, 25 weak-lined (naked) T Tauri stars, 56 Herbig Ae/Be stars, six FU Orionis stars, and two SU Aurigae stars. All six of the FU Orionis stars surveyed by IRAS were detected. Of the PMS-IRAS Point Source Catalog (PSC) associations, 90 are new and are not noted in the PSC. The other 271 entries include 104 that are correctly identified in the PSC but have not yet appeared in the literature, 56 more that can be found in both the PSC and in the published and unpublished iterature, and 111 that are in the literature but not in the PSC. Spectral slope diagrams constructed from the 12-, 25-, and 60-micron flux densities reveal unique distributions for the different PMS subclasses; these diagrams may help identify the best candidate PMS stars for observations of circumstellar dust. 30 refs

  18. Main sequence mass loss

    International Nuclear Information System (INIS)

    Brunish, W.M.; Guzik, J.A.; Willson, L.A.; Bowen, G.

    1987-01-01

    It has been hypothesized that variable stars may experience mass loss, driven, at least in part, by oscillations. The class of stars we are discussing here are the δ Scuti variables. These are variable stars with masses between about 1.2 and 2.25 M/sub θ/, lying on or very near the main sequence. According to this theory, high rotation rates enhance the rate of mass loss, so main sequence stars born in this mass range would have a range of mass loss rates, depending on their initial rotation velocity and the amplitude of the oscillations. The stars would evolve rapidly down the main sequence until (at about 1.25 M/sub θ/) a surface convection zone began to form. The presence of this convective region would slow the rotation, perhaps allowing magnetic braking to occur, and thus sharply reduce the mass loss rate. 7 refs

  19. Radio-emission of pre-main sequence stars of the Rho Ophiuchi cloud: observations and interpretation

    International Nuclear Information System (INIS)

    Andre, P.

    1987-11-01

    Observations of the radio continuum emission of a young star population have been made at VLA on the whole molecular cloud Rho Ophiuchi, one of the closest site of star formation. A dozen of stellar sources have been detected. Radio emission of some identified objects seems to have a magnetic nature and be produced by gyrosynchrotron mechanism. In particular, one of the sources shows a radio radiation circularly polarized; two other stars have a radiation strongly variable probably due to magnetic eruptions more important than those detected in X radiation. More generally, radio observations select probably a specific population of young stars characterized by magnetic field presence extended on several stellar radii and by absence of dense circumstellar environment. Spatial distribution of these objects suggest, they are younger than most of the pre-main sequence stars [fr

  20. X-ray sources in regions of star formation. II. The pre-main-sequence G star HDE 283572

    International Nuclear Information System (INIS)

    Walter, F.M.; Brown, A.; Linsky, J.L.; Rydgren, A.E.; Vrba, F.; Joint Institute for Laboratory Astrophysics, Boulder, CO; Computer Sciences Corp., El Segundo, CA; Naval Observatory, Flagstaff, AZ)

    1987-01-01

    This paper reports the detection of HDE 283572, a ninth-magnitude G star 8 arcmin south of RY Tau, as a bright X-ray source. The observations reveal this object to be a fairly massive (about 2 solar masses) pre-main-sequence star associated with the Taurus-Auriga star formation complex. It exhibits few of the characteristics of the classical T Tauri stars and is a good example of a naked T Tauri star. The star is a mid-G subgiant, of about three solar radii and rotates with a period of 1.5 d. The coronal and chromospheric surface fluxes are similar to those of the most active late type stars (excluding T Tauri stars). The X-ray and UV lines most likely arise in different atmospheric structures. Radiative losses are some 1000 times the quiet solar value and compare favorably with those of T Tauri stars. 49 references

  1. PRE-MAIN-SEQUENCE TURN-ON AS A CHRONOMETER FOR YOUNG CLUSTERS: NGC 346 AS A BENCHMARK

    International Nuclear Information System (INIS)

    Cignoni, M.; Tosi, M.; Sabbi, E.; Nota, A.; Degl'Innocenti, S.; Moroni, P. G. Prada; Gallagher, J. S.

    2010-01-01

    We present a novel approach to deriving the age of very young star clusters, by using the Turn-On (TOn). The TOn is the point in the color-magnitude diagram (CMD) where the pre-main sequence (PMS) joins the main sequence (MS). In the MS luminosity function (LF) of the cluster, the TOn is identified as a peak followed by a dip. We propose that by combining the CMD analysis with the monitoring of the spatial distribution of MS stars it is possible to reliably identify the TOn in extragalactic star-forming regions. Compared to alternative methods, this technique is complementary to the turnoff dating and avoids the systematic biases affecting the PMS phase. We describe the method and its uncertainties and apply it to the star-forming region NGC 346, which has been extensively imaged with the Hubble Space Telescope (HST). This study extends the LF approach in crowded extragalactic regions and opens the way for future studies with HST/WFC3, the James Webb Space Telescope and from the ground with adaptive optics.

  2. MASS LOSS IN PRE-MAIN-SEQUENCE STARS VIA CORONAL MASS EJECTIONS AND IMPLICATIONS FOR ANGULAR MOMENTUM LOSS

    Energy Technology Data Exchange (ETDEWEB)

    Aarnio, Alicia N. [Astronomy Department, University of Michigan, 830 Dennison Building, 500 Church Street, Ann Arbor, MI 48109 (United States); Matt, Sean P. [Laboratoire AIM Paris-Saclay, CEA/Irfu Universite Paris-Diderot CNRS/INSU, F-91191 Gif-sur-Yvette (France); Stassun, Keivan G., E-mail: aarnio@umich.edu [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States)

    2012-11-20

    We develop an empirical model to estimate mass-loss rates via coronal mass ejections (CMEs) for solar-type pre-main-sequence (PMS) stars. Our method estimates the CME mass-loss rate from the observed energies of PMS X-ray flares, using our empirically determined relationship between solar X-ray flare energy and CME mass: log (M {sub CME}[g]) = 0.63 Multiplication-Sign log (E {sub flare}[erg]) - 2.57. Using masses determined for the largest flaring magnetic structures observed on PMS stars, we suggest that this solar-calibrated relationship may hold over 10 orders of magnitude in flare energy and 7 orders of magnitude in CME mass. The total CME mass-loss rate we calculate for typical solar-type PMS stars is in the range 10{sup -12}-10{sup -9} M {sub Sun} yr{sup -1}. We then use these CME mass-loss rate estimates to infer the attendant angular momentum loss leading up to the main sequence. Assuming that the CME outflow rate for a typical {approx}1 M {sub Sun} T Tauri star is <10{sup -10} M {sub Sun} yr{sup -1}, the resulting spin-down torque is too small during the first {approx}1 Myr to counteract the stellar spin-up due to contraction and accretion. However, if the CME mass-loss rate is {approx}> 10{sup -10} M {sub Sun} yr{sup -1}, as permitted by our calculations, then the CME spin-down torque may influence the stellar spin evolution after an age of a few Myr.

  3. AK SCO, FIRST DETECTION OF A HIGHLY DISTURBED ATMOSPHERE IN A PRE-MAIN-SEQUENCE CLOSE BINARY

    International Nuclear Information System (INIS)

    Gomez de Castro, Ana I.

    2009-01-01

    AK Sco is a unique source: a ∼10 Myr old pre-main-sequence (PMS) spectroscopic binary composed of two nearly equal F5 stars that at periastron are separated by barely 11 stellar radii, so the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes AK Sco the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during PMS evolution. In this Letter, the detection of a highly disturbed (σ ≅ 100 km s -1 ) and very dense atmosphere (n e = 1.6 x 10 10 cm -3 ) is reported. Significant line broadening blurs any signs of ion belts or bow shocks in the spectrum of the atmospheric plasma. The radiative losses cannot be accounted for solely by the dissipation of energy from the tidal wave propagating in the stellar atmosphere or by the accreting material. The release of internal energy from the star seems to be the most likely source of the plasma heating. This is the first clear indication of a highly disturbed atmosphere surrounding a PMS close binary.

  4. AK Sco, First Detection of a Highly Disturbed Atmosphere in a Pre-Main-Sequence Close Binary

    Science.gov (United States)

    Gómez de Castro, Ana I.

    2009-06-01

    AK Sco is a unique source: a ~10 Myr old pre-main-sequence (PMS) spectroscopic binary composed of two nearly equal F5 stars that at periastron are separated by barely 11 stellar radii, so the stellar magnetospheres fill the Roche lobe at periastron. The orbit is not yet circularized (e = 0.47) and very strong tides are expected. This makes AK Sco the ideal laboratory to study the effect of gravitational tides in the stellar magnetic field building up during PMS evolution. In this Letter, the detection of a highly disturbed (σ sime 100 km s-1) and very dense atmosphere (n e = 1.6 × 1010 cm-3) is reported. Significant line broadening blurs any signs of ion belts or bow shocks in the spectrum of the atmospheric plasma. The radiative losses cannot be accounted for solely by the dissipation of energy from the tidal wave propagating in the stellar atmosphere or by the accreting material. The release of internal energy from the star seems to be the most likely source of the plasma heating. This is the first clear indication of a highly disturbed atmosphere surrounding a PMS close binary.

  5. ON THE RELIABILITY OF STELLAR AGES AND AGE SPREADS INFERRED FROM PRE-MAIN-SEQUENCE EVOLUTIONARY MODELS

    International Nuclear Information System (INIS)

    Hosokawa, Takashi; Offner, Stella S. R.; Krumholz, Mark R.

    2011-01-01

    We revisit the problem of low-mass pre-main-sequence stellar evolution and its observational consequences for where stars fall on the Hertzsprung-Russell diagram (HRD). In contrast to most previous work, our models follow stars as they grow from small masses via accretion, and we perform a systematic study of how the stars' HRD evolution is influenced by their initial radius, by the radiative properties of the accretion flow, and by the accretion history, using both simple idealized accretion histories and histories taken from numerical simulations of star cluster formation. We compare our numerical results to both non-accreting isochrones and to the positions of observed stars in the HRD, with a goal of determining whether both the absolute ages and the age dispersions inferred from non-accreting isochrones are reliable. We show that non-accreting isochrones can sometimes overestimate stellar ages for more massive stars (those with effective temperatures above ∼3500 K), thereby explaining why non-accreting isochrones often suggest a systematic age difference between more and less massive stars in the same cluster. However, we also find the only way to produce a similar overestimate for the ages of cooler stars is if these stars grow from ∼0.01 M sun seed protostars that are an order of magnitude smaller than predicted by current theoretical models, and if the size of the seed protostar correlates systematically with the final stellar mass at the end of accretion. We therefore conclude that, unless both of these conditions are met, inferred ages and age spreads for cool stars are reliable, at least to the extent that the observed bolometric luminosities and temperatures are accurate. Finally, we note that the time dependence of the mass accretion rate has remarkably little effect on low-mass stars' evolution on the HRD, and that such time dependence may be neglected for all stars except those with effective temperatures above ∼4000 K.

  6. EXTENDED MAGNETOSPHERES IN PRE-MAIN-SEQUENCE EVOLUTION: FROM T TAURI STARS TO THE BROWN DWARF LIMIT

    Energy Technology Data Exchange (ETDEWEB)

    Gomez de Castro, Ana I.; Marcos-Arenal, Pablo [Grupo de Investigacion Complutense AEGORA, Universidad Complutense de Madrid, 28040 Madrid (Spain)

    2012-04-20

    Low-mass pre-main-sequence stars, i.e., T Tauri stars (TTSs), strongly radiate at high energies, from X-rays to the ultraviolet (UV). This excess radiation with respect to main-sequence cool stars (MSCSs) is associated with the accretion process, i.e., it is produced in the extended magnetospheres, in the accretion shocks on the stellar surface, and in the outflows. Although evidence of accretion shocks and outflow contribution to the high-energy excess have been recently addressed, there is not an updated revision of the magnetospheric contribution. This article addresses this issue. The UV observations of the TTSs in the well-known Taurus region have been analyzed together with the XMM-Newton observations compiled in the XEST survey. For the first time the high sensitivity of the Hubble Space Telescope UV instrumentation has allowed measurement of the UV line fluxes of TTSs to M8 type. UV- and X-ray-normalized fluxes have been determined to study the extent and properties of the TTS magnetospheres as a class. They have been compared with the atmospheres of the MSCSs. The main results from this analysis are (1) the normalized fluxes of all the tracers are correlated; this correlation is independent of the broad mass range and the hardness of the X-ray radiation field; (2) the TTS correlations are different than the MSCS correlations; (3) there is a very significant excess emission in O I in the TTSs compared with MSCSs that seems to be caused by recombination radiation from the disk atmosphere after photoionization by extreme UV radiation; the Fe II/Mg II recombination continuum has also been detected in several TTSs and most prominently in AA Tau; and (4) the normalized flux of the UV tracers anticorrelates with the strength of the X-ray flux, i.e., the stronger the X-ray surface flux is, the weaker the observed UV flux. This last behavior is counterintuitive within the framework of stellar dynamo theory and suggests that UV emission can be produced in the

  7. A search for pre-main sequence stars in the high-latitude molecular clouds. II - A survey of the Einstein database

    Science.gov (United States)

    Caillault, Jean-Pierre; Magnani, Loris

    1990-01-01

    The preliminary results are reported of a survey of every EINSTEIN image which overlaps any high-latitude molecular cloud in a search for X-ray emitting pre-main sequence stars. This survey, together with complementary KPNO and IRAS data, will allow the determination of how prevalent low mass star formation is in these clouds in general and, particularly, in the translucent molecular clouds.

  8. A search for pre-main-sequence stars in high-latitude molecular clouds. 3: A survey of the Einstein database

    Science.gov (United States)

    Caillault, Jean-Pierre; Magnani, Loris; Fryer, Chris

    1995-01-01

    In order to discern whether the high-latitude molecular clouds are regions of ongoing star formation, we have used X-ray emission as a tracer of youthful stars. The entire Einstein database yields 18 images which overlap 10 of the clouds mapped partially or completely in the CO (1-0) transition, providing a total of approximately 6 deg squared of overlap. Five previously unidentified X-ray sources were detected: one has an optical counterpart which is a pre-main-sequence (PMS) star, and two have normal main-sequence stellar counterparts, while the other two are probably extragalactic sources. The PMS star is located in a high Galactic latitude Lynds dark cloud, so this result is not too suprising. The translucent clouds, though, have yet to reveal any evidence of star formation.

  9. The Pisa pre-main sequence tracks and isochrones. A database covering a wide range of Z, Y, mass, and age values

    Science.gov (United States)

    Tognelli, E.; Prada Moroni, P. G.; Degl'Innocenti, S.

    2011-09-01

    Context. In recent years new observations of pre-main sequence stars (pre-MS) with Z ≤ Z⊙ have been made available. To take full advantage of the continuously growing amount of data of pre-MS stars in different environments, we need to develop updated pre-MS models for a wide range of metallicity to assign reliable ages and masses to the observed stars. Aims: We present updated evolutionary pre-MS models and isochrones for a fine grid of mass, age, metallicity, and helium values. Methods: We use a standard and well-tested stellar evolutionary code (i.e. FRANEC), that adopts outer boundary conditions from detailed and realistic atmosphere models. In this code, we incorporate additional improvements to the physical inputs related to the equation of state and the low temperature radiative opacities essential to computing low-mass stellar models. Results: We make available via internet a large database of pre-MS tracks and isochrones for a wide range of chemical compositions (Z = 0.0002-0.03), masses (M = 0.2-7.0 M⊙), and ages (1-100 Myr) for a solar-calibrated mixing length parameter α (i.e. 1.68). For each chemical composition, additional models were computed with two different mixing length values, namely α = 1.2 and 1.9. Moreover, for Z ≥ 0.008, we also provided models with two different initial deuterium abundances. The characteristics of the models have been discussed in detail and compared with other work in the literature. The main uncertainties affecting theoretical predictions have been critically discussed. Comparisons with selected data indicate that there is close agreement between theory and observation. Tracks and isochrones are available on the web at the http://astro.df.unipi.it/stellar-models/Tracks and isochrones are also available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/533/A109

  10. A tale of two anomalies: Depletion, dispersion, and the connection between the stellar lithium spread and inflated radii on the pre-main sequence

    Energy Technology Data Exchange (ETDEWEB)

    Somers, Garrett; Pinsonneault, Marc H., E-mail: somers@astronomy.ohio-state.edu, E-mail: pinsono@astronomy.ohio-state.edu [Department of Astronomy, The Ohio State University, 140 West 18th Avenue, Columbus, OH 43201 (United States)

    2014-07-20

    We investigate lithium depletion in standard stellar models (SSMs) and main sequence (MS) open clusters, and explore the origin of the Li dispersion in young, cool stars of equal mass, age, and composition. We first demonstrate that SSMs accurately predict the Li abundances of solar analogs at the zero-age main sequence (ZAMS) within theoretical uncertainties. We then measure the rate of MS Li depletion by removing the [Fe/H]-dependent ZAMS Li pattern from three well-studied clusters, and comparing the detrended data. MS depletion is found to be mass-dependent, in the sense of more depletion at low mass. A dispersion in Li abundance at fixed T{sub eff} is nearly universal, and sets in by ∼200 Myr. We discuss mass and age dispersion trends, and the pattern is mixed. We argue that metallicity impacts the ZAMS Li pattern, in agreement with theoretical expectations but contrary to the findings of some previous studies, and suggest Li as a test of cluster metallicity. Finally, we argue that a radius dispersion in stars of fixed mass and age, during the epoch of pre-MS Li destruction, is responsible for the spread in Li abundances and the correlation between rotation and Li in young cool stars, most well known in the Pleiades. We calculate stellar models, inflated to match observed radius anomalies in magnetically active systems, and the resulting range of Li abundances reproduces the observed patterns of young clusters. We discuss ramifications for pre-MS evolutionary tracks and age measurements of young clusters, and suggest an observational test.

  11. A tale of two anomalies: Depletion, dispersion, and the connection between the stellar lithium spread and inflated radii on the pre-main sequence

    International Nuclear Information System (INIS)

    Somers, Garrett; Pinsonneault, Marc H.

    2014-01-01

    We investigate lithium depletion in standard stellar models (SSMs) and main sequence (MS) open clusters, and explore the origin of the Li dispersion in young, cool stars of equal mass, age, and composition. We first demonstrate that SSMs accurately predict the Li abundances of solar analogs at the zero-age main sequence (ZAMS) within theoretical uncertainties. We then measure the rate of MS Li depletion by removing the [Fe/H]-dependent ZAMS Li pattern from three well-studied clusters, and comparing the detrended data. MS depletion is found to be mass-dependent, in the sense of more depletion at low mass. A dispersion in Li abundance at fixed T eff is nearly universal, and sets in by ∼200 Myr. We discuss mass and age dispersion trends, and the pattern is mixed. We argue that metallicity impacts the ZAMS Li pattern, in agreement with theoretical expectations but contrary to the findings of some previous studies, and suggest Li as a test of cluster metallicity. Finally, we argue that a radius dispersion in stars of fixed mass and age, during the epoch of pre-MS Li destruction, is responsible for the spread in Li abundances and the correlation between rotation and Li in young cool stars, most well known in the Pleiades. We calculate stellar models, inflated to match observed radius anomalies in magnetically active systems, and the resulting range of Li abundances reproduces the observed patterns of young clusters. We discuss ramifications for pre-MS evolutionary tracks and age measurements of young clusters, and suggest an observational test.

  12. VARIABILITY OF DISK EMISSION IN PRE-MAIN SEQUENCE AND RELATED STARS. III. EXPLORING STRUCTURAL CHANGES IN THE PRE-TRANSITIONAL DISK IN HD 169142

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, Kevin R.; Sitko, Michael L.; Swearingen, Jeremy R.; Champney, Elizabeth H.; Johnson, Alexa N.; Werren, Chelsea [Department of Physics, University of Cincinnati, Cincinnati, OH 45221 (United States); Grady, Carol A. [Eureka Scientific, 2452 Delmer, Suite 100, Oakland, CA 96002 (United States); Whitney, Barbara A. [Department of Astronomy, University of Wisconsin, 475 North CharterStreet, Madison, WI 53706-1582 (United States); Russell, Ray W. [The Aerospace Corporation, Los Angeles, CA 90009 (United States); Schneider, Glenn H. [Steward Observatory, 933 North Cherry Avenue, University of Arizona, Tucson, AZ 85721 (United States); Momose, Munetake [Ibaraki University, 310-0056 Ibaraki, Mito, Bunkyo, 11 (Japan); Muto, Takayuki [Kogakuin University, 1-24-2 Nishishinjuku, Shinjuku, Tokyo 163-8677 (Japan); Inoue, Akio K. [Osaka Sangyo University, College of General Education, 3-1-1 Nakagaito, Daito, Osaka 574-8530 (Japan); Lauroesch, James T.; Hornbeck, Jeremy [University of Louisville Research Foundation, Inc., 2301 South 3rd Street, Louisville, KY 40292 (United States); Brown, Alexander [Center for Astrophysics and Space Astronomy, Astrophysics Research Laboratory, 593 UCB, University of Colorado, Boulder, CO 80309-0593 (United States); Fukagawa, Misato [Department of Earth and Space Science, Graduate School of Science, Osaka University, 1-1, Machikaneyama, Toyonaka, Osaka 560-0043 (Japan); Currie, Thayne M. [Oak Ridge Associated Universities, 100 ORAU Way, Oak Ridge, TN 37830-6218 (United States); Wisniewski, John P. [University of Oklahoma, 660 Parrington Oval, Norman, OK 73019 (United States); Woodgate, Bruce E., E-mail: wagnekr@mail.uc.edu, E-mail: sitkoml@ucmail.uc.edu, E-mail: swearijr@mail.uc.edu, E-mail: ehchampney@gmail.com, E-mail: astefank@andrew.cmu.edu, E-mail: ccwerren@yahoo.com, E-mail: carol.a.grady@nasa.gov, E-mail: bwhitney@astro.wisc.edu, E-mail: Ray.W.Russell@aero.org [NASA Goddard Space Flight Center, 8800 Greenbelt Road, Greenbelt, MD 20771 (United States)

    2015-01-10

    We present near-IR (NIR) and far-UV observations of the pre-transitional (gapped) disk in HD 169142 using NASA's Infrared Telescope Facility and Hubble Space Telescope. The combination of our data along with existing data sets into the broadband spectral energy distribution reveals variability of up to 45% between ∼1.5-10 μm over a maximum timescale of 10 yr. All observations known to us separate into two distinct states corresponding to a high near-IR state in the pre-2000 epoch and a low state in the post-2000 epoch, indicating activity within the ≲1 AU region of the disk. Through analysis of the Pa β and Br γ lines in our data we derive a mass accretion rate in 2013 May of M-dot ≈ (1.5-2.7) × 10{sup –9} M {sub ☉} yr{sup –1}. We present a theoretical modeling analysis of the disk in HD 169142 using Monte-Carlo radiative transfer simulation software to explore the conditions and perhaps signs of planetary formation in our collection of 24 yr of observations. We find that shifting the outer edge (r ≈ 0.3 AU) of the inner disk by 0.05 AU toward the star (in simulation of accretion and/or sculpting by forming planets) successfully reproduces the shift in NIR flux. We establish that the ∼40-70 AU dark ring imaged in the NIR by Quanz et al. and Momose et al. and at 7 mm by Osorio et al. may be reproduced with a 30% scaled density profile throughout the region, strengthening the link to this structure being dynamically cleared by one or more planetary mass bodies.

  13. VARIABILITY OF DISK EMISSION IN PRE-MAIN SEQUENCE AND RELATED STARS. III. EXPLORING STRUCTURAL CHANGES IN THE PRE-TRANSITIONAL DISK IN HD 169142

    International Nuclear Information System (INIS)

    Wagner, Kevin R.; Sitko, Michael L.; Swearingen, Jeremy R.; Champney, Elizabeth H.; Johnson, Alexa N.; Werren, Chelsea; Grady, Carol A.; Whitney, Barbara A.; Russell, Ray W.; Schneider, Glenn H.; Momose, Munetake; Muto, Takayuki; Inoue, Akio K.; Lauroesch, James T.; Hornbeck, Jeremy; Brown, Alexander; Fukagawa, Misato; Currie, Thayne M.; Wisniewski, John P.; Woodgate, Bruce E.

    2015-01-01

    We present near-IR (NIR) and far-UV observations of the pre-transitional (gapped) disk in HD 169142 using NASA's Infrared Telescope Facility and Hubble Space Telescope. The combination of our data along with existing data sets into the broadband spectral energy distribution reveals variability of up to 45% between ∼1.5-10 μm over a maximum timescale of 10 yr. All observations known to us separate into two distinct states corresponding to a high near-IR state in the pre-2000 epoch and a low state in the post-2000 epoch, indicating activity within the ≲1 AU region of the disk. Through analysis of the Pa β and Br γ lines in our data we derive a mass accretion rate in 2013 May of M-dot ≈ (1.5-2.7) × 10 –9 M ☉ yr –1 . We present a theoretical modeling analysis of the disk in HD 169142 using Monte-Carlo radiative transfer simulation software to explore the conditions and perhaps signs of planetary formation in our collection of 24 yr of observations. We find that shifting the outer edge (r ≈ 0.3 AU) of the inner disk by 0.05 AU toward the star (in simulation of accretion and/or sculpting by forming planets) successfully reproduces the shift in NIR flux. We establish that the ∼40-70 AU dark ring imaged in the NIR by Quanz et al. and Momose et al. and at 7 mm by Osorio et al. may be reproduced with a 30% scaled density profile throughout the region, strengthening the link to this structure being dynamically cleared by one or more planetary mass bodies

  14. A main sequence for quasars

    Science.gov (United States)

    Marziani, Paola; Dultzin, Deborah; Sulentic, Jack W.; Del Olmo, Ascensión; Negrete, C. A.; Martínez-Aldama, Mary L.; D'Onofrio, Mauro; Bon, Edi; Bon, Natasa; Stirpe, Giovanna M.

    2018-03-01

    The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  15. A Main Sequence for Quasars

    Directory of Open Access Journals (Sweden)

    Paola Marziani

    2018-03-01

    Full Text Available The last 25 years saw a major step forward in the analysis of optical and UV spectroscopic data of large quasar samples. Multivariate statistical approaches have led to the definition of systematic trends in observational properties that are the basis of physical and dynamical modeling of quasar structure. We discuss the empirical correlates of the so-called “main sequence” associated with the quasar Eigenvector 1, its governing physical parameters and several implications on our view of the quasar structure, as well as some luminosity effects associated with the virialized component of the line emitting regions. We also briefly discuss quasars in a segment of the main sequence that includes the strongest FeII emitters. These sources show a small dispersion around a well-defined Eddington ratio value, a property which makes them potential Eddington standard candles.

  16. Hydrodynamic ejection of bipolar flows from objects undergoing disk accretion: T Tauri stars, massive pre-main-sequence objects, and cataclysmic variables

    International Nuclear Information System (INIS)

    Torbett, M.V.

    1984-01-01

    A general mechanism is presented for generating pressure-driven winds that are intrinsically bipolar from objects undergoing disk accretion. The energy librated in a boundary layer shock as the disk matter impacts the central object is shown to be sufficient to eject a fraction βapprox.10 -2 to 10 -3 of the accreted mass. These winds are driven by a mechanism that accelerates the flow perpendicular to the plane of the disk and can therefore account for the bipolar geometry of the mass loss observed near young stars. The mass loss contained in these winds is comparable to that inferred for young stars. Thus, disk accretion-driven winds may constitute the T Tauri phase of stellar evolution. This mechanism is generally applicable, and thus massive pre-main-sequence objects as well as cataclysmic variables at times of enhanced accretion are predicted to eject bipolar outflows as well. Unmagnetized accreting neutron stas are also expected to eject bipolar flows. Since this mechanism requires stellar surfaces, however, it will not operate in disk accretion onto black holes

  17. The Gaia-ESO Survey: the present-day radial metallicity distribution of the Galactic disc probed by pre-main-sequence clusters

    Science.gov (United States)

    Spina, L.; Randich, S.; Magrini, L.; Jeffries, R. D.; Friel, E. D.; Sacco, G. G.; Pancino, E.; Bonito, R.; Bravi, L.; Franciosini, E.; Klutsch, A.; Montes, D.; Gilmore, G.; Vallenari, A.; Bensby, T.; Bragaglia, A.; Flaccomio, E.; Koposov, S. E.; Korn, A. J.; Lanzafame, A. C.; Smiljanic, R.; Bayo, A.; Carraro, G.; Casey, A. R.; Costado, M. T.; Damiani, F.; Donati, P.; Frasca, A.; Hourihane, A.; Jofré, P.; Lewis, J.; Lind, K.; Monaco, L.; Morbidelli, L.; Prisinzano, L.; Sousa, S. G.; Worley, C. C.; Zaggia, S.

    2017-05-01

    Context. The radial metallicity distribution in the Galactic thin disc represents a crucial constraint for modelling disc formation and evolution. Open star clusters allow us to derive both the radial metallicity distribution and its evolution over time. Aims: In this paper we perform the first investigation of the present-day radial metallicity distribution based on [Fe/H] determinations in late type members of pre-main-sequence clusters. Because of their youth, these clusters are therefore essential for tracing the current interstellar medium metallicity. Methods: We used the products of the Gaia-ESO Survey analysis of 12 young regions (age ages is not easily explained by the models. Our results reveal a complex interplay of several processes (e.g. star formation activity, initial mass function, supernova yields, gas flows) that controlled the recent evolution of the Milky Way. Based on observations made with the ESO/VLT, at Paranal Observatory, under program 188.B-3002 (The Gaia-ESO Public Spectroscopic Survey).Full Table 1 is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/601/A70

  18. THE CLUSTERED NATURE OF STAR FORMATION. PRE-MAIN-SEQUENCE CLUSTERS IN THE STAR-FORMING REGION NGC 602/N90 IN THE SMALL MAGELLANIC CLOUD

    International Nuclear Information System (INIS)

    Gouliermis, Dimitrios A.; Gennaro, Mario; Schmeja, Stefan; Dolphin, Andrew E.; Tognelli, Emanuele; Prada Moroni, Pier Giorgio

    2012-01-01

    Located at the tip of the wing of the Small Magellanic Cloud (SMC), the star-forming region NGC 602/N90 is characterized by the H II nebular ring N90 and the young cluster of pre-main-sequence (PMS) and early-type main-sequence stars NGC 602, located in the central area of the ring. We present a thorough cluster analysis of the stellar sample identified with Hubble Space Telescope/Advanced Camera for Surveys in the region. We show that apart from the central cluster low-mass PMS stars are congregated in 13 additional small, compact sub-clusters at the periphery of NGC 602, identified in terms of their higher stellar density with respect to the average background density derived from star counts. We find that the spatial distribution of the PMS stars is bimodal, with an unusually large fraction (∼60%) of the total population being clustered, while the remaining is diffusely distributed in the intercluster area, covering the whole central part of the region. From the corresponding color-magnitude diagrams we disentangle an age difference of ∼2.5 Myr between NGC 602 and the compact sub-clusters, which appear younger, on the basis of comparison of the brighter PMS stars with evolutionary models, which we accurately calculated for the metal abundance of the SMC. The diffuse PMS population appears to host stars as old as those in NGC 602. Almost all detected PMS sub-clusters appear to be centrally concentrated. When the complete PMS stellar sample, including both clustered and diffused stars, is considered in our cluster analysis, it appears as a single centrally concentrated stellar agglomeration, covering the whole central area of the region. Considering also the hot massive stars of the system, we find evidence that this agglomeration is hierarchically structured. Based on our findings, we propose a scenario according to which the region NGC 602/N90 experiences an active clustered star formation for the last ∼5 Myr. The central cluster NGC 602 was formed first

  19. EFFECT OF METALLICITY ON THE EVOLUTION OF THE HABITABLE ZONE FROM THE PRE-MAIN SEQUENCE TO THE ASYMPTOTIC GIANT BRANCH AND THE SEARCH FOR LIFE

    Energy Technology Data Exchange (ETDEWEB)

    Danchi, William C. [Exoplanets and Stellar Astrophysics Laboratory, NASA Goddard Space Flight Center, Code 667, Greenbelt, MD 20771 (United States); Lopez, Bruno, E-mail: william.c.danchi@nasa.gov, E-mail: bruno.lopez@oca.eu [Observatoire de la Cote d' Azur, Laboratoire Lagrange UMR 7293, BP 4229, F-06034 Nice Cedex 4 (France)

    2013-05-20

    During the course of stellar evolution, the location and width of the habitable zone changes as the luminosity and radius of the star evolves. The duration of habitability for a planet located at a given distance from a star is greatly affected by the characteristics of the host star. A quantification of these effects can be used observationally in the search for life around nearby stars. The longer the duration of habitability, the more likely it is that life has evolved. The preparation of observational techniques aimed at detecting life would benefit from the scientific requirements deduced from the evolution of the habitable zone. We present a study of the evolution of the habitable zone around stars of 1.0, 1.5, and 2.0 M{sub Sun} for metallicities ranging from Z = 0.0001 to Z = 0.070. We also consider the evolution of the habitable zone from the pre-main sequence until the asymptotic giant branch is reached. We find that metallicity strongly affects the duration of the habitable zone for a planet as well as the distance from the host star where the duration is maximized. For a 1.0 M{sub Sun} star with near solar metallicity, Z = 0.017, the duration of the habitable zone is >10 Gyr at distances 1.2-2.0 AU from the star, whereas the duration is >20 Gyr for high-metallicity stars (Z = 0.070) at distances of 0.7-1.8 AU, and {approx}4 Gyr at distances of 1.8-3.3 AU for low-metallicity stars (Z = 0.0001). Corresponding results have been obtained for stars of 1.5 and 2.0 solar masses.

  20. Photometric Determination of the Mass Accretion Rates of Pre-main-sequence Stars. V. Recent Star Formation in the 30 Dor Nebula

    Science.gov (United States)

    De Marchi, Guido; Panagia, Nino; Beccari, Giacomo

    2017-09-01

    We report on the properties of the low-mass stars that recently formed in the central ˜ 2\\buildrel{ \\prime}\\over{.} 7× 2\\buildrel{ \\prime}\\over{.} 7 of 30 Dor, including the R136 cluster. Using the photometric catalog of De Marchi et al., based on observations with the Hubble Space Telescope, and the most recent extinction law for this field, we identify 1035 bona fide pre-main-sequence (PMS) stars showing {{H}}α excess emission at the 4σ level with an {{H}}α equivalent width of 20 Å or more. We find a wide spread in age spanning the range ˜ 0.1{--}50 {Myr}. We also find that the older PMS objects are placed in front of the R136 cluster and are separated from it by a conspicuous amount of absorbing material, indicating that star formation has proceeded from the periphery into the interior of the region. We derive physical parameters for all PMS stars, including masses m, ages t, and mass accretion rates {\\dot{M}}{acc}. To identify reliable correlations between these parameters, which are intertwined, we use a multivariate linear regression fit of the type {log}{\\dot{M}}{acc}=a× {log}t+b× {log}m+c. The values of a and b for 30 Dor are compatible with those found in NGC 346 and NGC 602. We extend the fit to a uniform sample of 1307 PMS stars with 0.5contract NAS5-26555.

  1. EFFECT OF METALLICITY ON THE EVOLUTION OF THE HABITABLE ZONE FROM THE PRE-MAIN SEQUENCE TO THE ASYMPTOTIC GIANT BRANCH AND THE SEARCH FOR LIFE

    International Nuclear Information System (INIS)

    Danchi, William C.; Lopez, Bruno

    2013-01-01

    During the course of stellar evolution, the location and width of the habitable zone changes as the luminosity and radius of the star evolves. The duration of habitability for a planet located at a given distance from a star is greatly affected by the characteristics of the host star. A quantification of these effects can be used observationally in the search for life around nearby stars. The longer the duration of habitability, the more likely it is that life has evolved. The preparation of observational techniques aimed at detecting life would benefit from the scientific requirements deduced from the evolution of the habitable zone. We present a study of the evolution of the habitable zone around stars of 1.0, 1.5, and 2.0 M ☉ for metallicities ranging from Z = 0.0001 to Z = 0.070. We also consider the evolution of the habitable zone from the pre-main sequence until the asymptotic giant branch is reached. We find that metallicity strongly affects the duration of the habitable zone for a planet as well as the distance from the host star where the duration is maximized. For a 1.0 M ☉ star with near solar metallicity, Z = 0.017, the duration of the habitable zone is >10 Gyr at distances 1.2-2.0 AU from the star, whereas the duration is >20 Gyr for high-metallicity stars (Z = 0.070) at distances of 0.7-1.8 AU, and ∼4 Gyr at distances of 1.8-3.3 AU for low-metallicity stars (Z = 0.0001). Corresponding results have been obtained for stars of 1.5 and 2.0 solar masses.

  2. A Constraint on the Formation Timescale of the Young Open Cluster NGC 2264: Lithium Abundance of Pre-main Sequence Stars

    Science.gov (United States)

    Lim, Beomdu; Sung, Hwankyung; Kim, Jinyoung S.; Bessell, Michael S.; Hwang, Narae; Park, Byeong-Gon

    2016-11-01

    The timescale of cluster formation is an essential parameter in order to understand the formation process of star clusters. Pre-main sequence (PMS) stars in nearby young open clusters reveal a large spread in brightness. If the spread were considered to be a result of a real spread in age, the corresponding cluster formation timescale would be about 5-20 Myr. Hence it could be interpreted that star formation in an open cluster is prolonged for up to a few tens of Myr. However, difficulties in reddening correction, observational errors, and systematic uncertainties introduced by imperfect evolutionary models for PMS stars can result in an artificial age spread. Alternatively, we can utilize Li abundance as a relative age indicator of PMS star to determine the cluster formation timescale. The optical spectra of 134 PMS stars in NGC 2264 have been obtained with MMT/Hectochelle. The equivalent widths have been measured for 86 PMS stars with a detectable Li line (3500\\lt {T}{eff}[{{K}}]≤slant 6500). Li abundance under the condition of local thermodynamic equilibrium (LTE) was derived using the conventional curve of growth method. After correction for non-LTE effects, we find that the initial Li abundance of NGC 2264 is A({Li})=3.2+/- 0.2. From the distribution of the Li abundances, the underlying age spread of the visible PMS stars is estimated to be about 3-4 Myr and this, together with the presence of embedded populations in NGC 2264, suggests that the cluster formed on a timescale shorter than 5 Myr.

  3. XMM-NEWTON MONITORING OF THE CLOSE PRE-MAIN-SEQUENCE BINARY AK SCO. EVIDENCE OF TIDE-DRIVEN FILLING OF THE INNER GAP IN THE CIRCUMBINARY DISK

    Energy Technology Data Exchange (ETDEWEB)

    Gomez de Castro, Ana Ines [S. D. Astronomia y Geodesia and Instituto de Matematica Interdisciplinar, Fac. de CC Matematicas, Universidad Complutense, E-28040 Madrid (Spain); Lopez-Santiago, Javier [Departamento de Astrofisica, Fac de CC Fisicas, Universidad Complutense, E-28040 Madrid (Spain); Talavera, Antonio [European Space Astronomy Center, Villanueva de la Canada, E-28691, Madrid (Spain); Sytov, A. Yu.; Bisikalo, D. [Institute of Astronomy of the Russian Academy of Sciences, Pyatnitskaya St. 48, 109017 Moscow (Russian Federation)

    2013-03-20

    AK Sco stands out among pre-main-sequence binaries because of its prominent ultraviolet excess, the high eccentricity of its orbit, and the strong tides driven by it. AK Sco consists of two F5-type stars that get as close as 11 R{sub *} at periastron passage. The presence of a dense (n{sub e} {approx} 10{sup 11} cm{sup -3}) extended envelope has been unveiled recently. In this article, we report the results from an XMM-Newton-based monitoring of the system. We show that at periastron, X-ray and UV fluxes are enhanced by a factor of {approx}3 with respect to the apastron values. The X-ray radiation is produced in an optically thin plasma with T {approx} 6.4 Multiplication-Sign 10{sup 6} K and it is found that the N{sub H} column density rises from 0.35 Multiplication-Sign 10{sup 21} cm{sup -2} at periastron to 1.11 Multiplication-Sign 10{sup 21} cm{sup -2} at apastron, in good agreement with previous polarimetric observations. The UV emission detected in the Optical Monitor band seems to be caused by the reprocessing of the high-energy magnetospheric radiation on the circumstellar material. Further evidence of the strong magnetospheric disturbances is provided by the detection of line broadening of 278.7 km s{sup -1} in the N V line with Hubble Space Telescope/Space Telescope Imaging Spectrograph. Numerical simulations of the mass flow from the circumbinary disk to the components have been carried out. They provide a consistent scenario with which to interpret AK Sco observations. We show that the eccentric orbit acts like a gravitational piston. At apastron, matter is dragged efficiently from the inner disk border, filling the inner gap and producing accretion streams that end as ring-like structures around each component of the system. At periastron, the ring-like structures come into contact, leading to angular momentum loss, and thus producing an accretion outburst.

  4. Nitrogen chronology of massive main sequence stars

    NARCIS (Netherlands)

    Köhler, K.; Borzyszkowski, M.; Brott, I.; Langer, N.; de Koter, A.

    2012-01-01

    Context. Rotational mixing in massive main sequence stars is predicted to monotonically increase their surface nitrogen abundance with time. Aims. We use this effect to design a method for constraining the age and the inclination angle of massive main sequence stars, given their observed luminosity,

  5. The double main sequence of Omega Centauri

    Science.gov (United States)

    Bedin, L. R.; Piotto, G.; Anderson, J.; King, I. R.; Cassisi, S.; Momany, Y.

    Recent, high precision photometry of Omega Centauri, the biggest Galactic globular cluster, has been obtained with Hubble Space Telescope (HST). The color magnitude diagram reveals an unexpected bifurcation of colors in the main sequence (MS). The newly found double MS, the multiple turnoffs and subgiant branches, and other sequences discovered in the past along the red giant branch of this cluster add up to a fascinating but frustrating puzzle. Among the possible explanations for the blue main sequence an anomalous overabundance of helium is suggested. The hypothesis will be tested with a set of FLAMES@VLT data we have recently obtained (ESO DDT program), and with forthcoming ACS@HST images. Based on observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  6. Variability of Disk Emission in Pre-Main Sequence and Related Stars. II. Variability in the Gas and Dust Emission of the Herbig Fe Star SAO 206462

    Science.gov (United States)

    Sitko, Michael L.; Day, Amanda N.; Kimes, Robin L.; Beerman, Lori C.; Martus, Cameron; Lynch, David K.; Russell, Ray W.; Grady, Carol A.; Schneider, Glenn; Lisse, Carey M.; hide

    2011-01-01

    We present thirteen epochs of near-infrared (0.8-5 microns) spectroscopic observations of the pre-transitional, "gapped" disk system in SAO 206462 (=HD 135344B). In all, six gas emission lines (Br(alpha) , Br(gamma), Pa(beta), Pa(delta), Pa(epsilon), and the 0.8446 microns line of O I) along with continuum measurements made near the standard J, H, K, and L photometric bands were measured. A mass accretion rate of approximately 2 x 10(exp 8)Solar Mass/yr was derived from the Br(gamma) and Pa(beta) lines. However, the fluxes of these lines varied by a factor of over two during the course of a few months. The continuum also varied, but by only approx.30%, and even decreased at a time when the gas emission was increasing. The H I line at 1.083 microns was also found to vary in a manner inconsistent with that of either the hydrogen lines or the dust. Both the gas and dust variabilities indicate significant changes in the region of the inner gas and the inner dust belt that may be common to many young disk systems. If planets are responsible for defining the inner edge of the gap, they could interact with the material on time scales commensurate with what is observed for the variations in the dust, while other disk instabilities (thermal, magneto-rotational) would operate there on longer time scales than we observe for the inner dust belt. For SAO 206462, the orbital period would likely be 1-3 years. If the changes are being induced in the disk material closer to the star than the gap, a variety of mechanisms (disk instabilities, interactions via planets) might be responsible for the changes seen. The He I feature is most likely due to a wind whose orientation changes with respect to the observer on time scales of a day or less. To further constrain the origin of the gas and dust emission will require multiple spectroscopic and interferometric observations on both shorter and longer time scales that have been sampled so far.

  7. Post-main-sequence planetary system evolution

    Science.gov (United States)

    Veras, Dimitri

    2016-01-01

    The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries. PMID:26998326

  8. Main-sequence photometry in NGC 2808

    International Nuclear Information System (INIS)

    Buonanno, R.; Corsi, C.E.; Fusi Pecci, F.; Harris, W.E.

    1984-01-01

    We have obtained a color-magnitude diagram for the southern globular cluster NGC 2808, to V/sub lim/approx. =21 (about 2 mag below the main-sequence turnoff). The internal photographic errors are sigma/sub V/approx. =0.02, sigma/sub B/-Vapprox. =0.03, small enough to permit a precise definition of the turnoff region and an estimate of the ''cosmic scatter'' along the main sequence. Fitting of the CMD to VandenBerg's [Astrophys. J. Suppl. 51, 29 (1983)] isochrones shows that an excellent match to the observations is achieved for model parameters of Yapprox. =0.2, Zapprox. =0.003 ([Fe/H]approx. =-0.8), and an age of (16 +- 2) billion years. All these characteristics are within the expected range from other observational constraints; no new clues from the main-sequence data alone have arisen to help explain the presence of the anomalous blue horizontal-branch stars

  9. The evolution of coronal activity in main sequence cool stars

    International Nuclear Information System (INIS)

    Stern, R.A.

    1984-01-01

    Stars spend most of their lifetime and show the least amount of nuclear evolution on the main sequence. However, the x-ray luminosities of cool star coronas change by orders of magnitude as a function of main sequence age. Such coronal evolution is discussed in relation to our knowledge of the solar corona, solar and stellar flares, stellar rotation and binarity. The relevance of X-ray observations to current speculations on stellar dynamos is also considered

  10. Main sequences defined by Hyades and field stars

    International Nuclear Information System (INIS)

    Upgren, A.R.

    1978-01-01

    The author reviews the main sequences defined by members of the Hyades cluster and by the field stars in the solar neighborhood. For this purpose, the discussion is limited primarily to the stars of the lower portions of the main sequence, especially those of spectral classes K and early M. There are two reasons for emphasis on the faint red dwarf stars. First, the value of a parallax depends on its size or, more accurately, on the error in parallax divided by the parallax itself. Large parallaxes of high precision occur in large numbers only for stars inhabiting the lower main sequence. Furthermore, brighter stars of earlier spectral classes are more likely to be influenced by evolutionary effects which may differ between the Hyades and field stars, and which are difficult to calibrate. (Auth.)

  11. Stochastically excited oscillations on the upper main sequence

    DEFF Research Database (Denmark)

    Antoci, Victoria

    2013-01-01

    Convective envelopes in stars on the main sequence are usually connected only with stars of spectral types F5 or later. However, observations as well as theory indicate that the convective outer layers in earlier stars, despite being shallow, are still effective and turbulent enough to stochastic......Convective envelopes in stars on the main sequence are usually connected only with stars of spectral types F5 or later. However, observations as well as theory indicate that the convective outer layers in earlier stars, despite being shallow, are still effective and turbulent enough...... Pulsating B and Be stars, all in the context of solar-like oscillations....

  12. Circumstellar Material on and off the Main Sequence

    Science.gov (United States)

    Steele, Amy; Debes, John H.; Deming, Drake

    2017-06-01

    There is evidence of circumstellar material around main sequence, giant, and white dwarf stars that originates from the small-body population of planetary systems. These bodies tell us something about the chemistry and evolution of protoplanetary disks and the planetary systems they form. What happens to this material as its host star evolves off the main sequence, and how does that inform our understanding of the typical chemistry of rocky bodies in planetary systems? In this talk, I will discuss the composition(s) of circumstellar material on and off the main sequence to begin to answer the question, “Is Earth normal?” In particular, I look at three types of debris disks to understand the typical chemistry of planetary systems—young debris disks, debris disks around giant stars, and dust around white dwarfs. I will review the current understanding on how to infer dust composition for each class of disk, and present new work on constraining dust composition from infrared excesses around main sequence and giant stars. Finally, dusty and polluted white dwarfs hold a unique key to our understanding of the composition of rocky bodies around other stars. In particular, I will discuss WD1145+017, which has a transiting, disintegrating planetesimal. I will review what we know about this system through high speed photometry and spectroscopy and present new work on understanding the complex interplay of physics that creates white dwarf pollution from the disintegration of rocky bodies.

  13. Domino effect in chemical accidents: main features and accident sequences.

    Science.gov (United States)

    Darbra, R M; Palacios, Adriana; Casal, Joaquim

    2010-11-15

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes are external events (31%) and mechanical failure (29%). Storage areas (35%) and process plants (28%) are by far the most common settings for domino accidents. Eighty-nine per cent of the accidents involved flammable materials, the most frequent of which was LPG. The domino effect sequences were analyzed using relative probability event trees. The most frequent sequences were explosion→fire (27.6%), fire→explosion (27.5%) and fire→fire (17.8%). Copyright © 2010 Elsevier B.V. All rights reserved.

  14. Solar Luminosity on the Main Sequence, Standard Model and Variations

    Science.gov (United States)

    Ayukov, S. V.; Baturin, V. A.; Gorshkov, A. B.; Oreshina, A. V.

    2017-05-01

    Our Sun became Main Sequence star 4.6 Gyr ago according Standard Solar Model. At that time solar luminosity was 30% lower than current value. This conclusion is based on assumption that Sun is fueled by thermonuclear reactions. If Earth's albedo and emissivity in infrared are unchanged during Earth history, 2.3 Gyr ago oceans had to be frozen. This contradicts to geological data: there was liquid water 3.6-3.8 Gyr ago on Earth. This problem is known as Faint Young Sun Paradox. We analyze luminosity change in standard solar evolution theory. Increase of mean molecular weight in the central part of the Sun due to conversion of hydrogen to helium leads to gradual increase of luminosity with time on the Main Sequence. We also consider several exotic models: fully mixed Sun; drastic change of pp reaction rate; Sun consisting of hydrogen and helium only. Solar neutrino observations however exclude most non-standard solar models.

  15. Solar-Type Activity in Main-Sequence Stars

    CERN Document Server

    Gershberg, Roald E

    2005-01-01

    Solar-type activity over the whole range of the electromagnetic spectrum is a phenomenon inherent in the majority of low- and moderate-mass main sequence stars. In this monograph observational results are summarized in a systematic and comprehensive fashion. The analysis of the various manifestations of such stellar activity leads to the identification of these phenomena with macroscopic non-linear processes in a magnetized plasma. Comparative study of flare stars and the Sun has become increasingly fruitful and is presently an active field of research involving stellar and solar physicists, experts in plasma physics and high-energy astrophysicists. This book will provide them with both an introduction and overview of observational results from the first optical photometry and spectroscopy, from the satellite telescopes International Ultraviolet Explorer to Hubble Space Telescope, XMM-Newton and Chandra, as well as with the present physical interpretation of solar-type activity in main sequence stars. Gershbe...

  16. On the Roche constants for main-sequence binaries

    International Nuclear Information System (INIS)

    Giannuzzi, M.A.

    1979-01-01

    The ratios C 1 /C 2 of the constants defining the equipotential surfaces which describe the external forms of the components of a close binary system have been calculated on the basis of evolutionary models. Theoretical systems have been considered allowing for a wide range of input parameters (masses and separation) and taking into account the evolutionary effects on the radii of the stars during their Main-Sequence lifetime. The systems have not undergone any transfer of matter and are representative of detached binaries with Main-sequence components. The ratios of the constants are confined in limited intervals and, for the highest values of the mass-ratios, they are clustered around the unit. (Auth.)

  17. Domino effect in chemical accidents: main features and accident sequences

    OpenAIRE

    Casal Fàbrega, Joaquim; Darbra Roman, Rosa Maria

    2010-01-01

    The main features of domino accidents in process/storage plants and in the transportation of hazardous materials were studied through an analysis of 225 accidents involving this effect. Data on these accidents, which occurred after 1961, were taken from several sources. Aspects analyzed included the accident scenario, the type of accident, the materials involved, the causes and consequences and the most common accident sequences. The analysis showed that the most frequent causes a...

  18. Three aspects of stellar evolution near the main sequence

    International Nuclear Information System (INIS)

    Morgan, J.C.

    1979-05-01

    Three problems of stellar evolution are considered: the gap in the HR diagram of M67, the evolutionary status of RS CVn binaries and the solar neutrino problem. The physical basis of the Eggleton stellar evolution computer program is described. The program was used to calculate a grid of evolutionary tracks for models with masses between 0.7 and 1.29 solar masses. The more massive stars considered here have expanding convective cores during their main sequence evolution. The isochrone of the old galactic cluster M67 has a gap at the top of its main sequence because of the rapid evolution of stars at hydrogen exhaustion. RS CVn binaries present a complex collection of observational phenomena although they appear to be detached binaries. Their evolutionary status has remained controversial because of their high space density. Here it is shown that a post main sequence interpretation is satisfactory. Models of the Sun with metal poor interiors have been proposed in an attempt to resolve the solar neutrino problem. Here the evolution of two such models is calculated in detail, including a gradual contamination of the surface convection zone to produce the observed metal abundance, giving fully consistent models of the Sun as it is observed. (author)

  19. Lithium depletion and rotation in main-sequence stars

    International Nuclear Information System (INIS)

    Balachandran, S.

    1990-01-01

    Lithium abundances were measured in nearly 200 old disk-population F stars to examine the effects of rotational braking on the depletion of Li. The sample was selected to be slightly evolved off the main sequence so that the stars have completed all the Li depletion they will undergo on the main sequence. A large scatter in Li abundances in the late F stars is found, indicating that the Li depletion is not related to age and spectral type alone. Conventional depletion mechanisms like convective overshoot and microscopic diffusion are unable to explain Li depletion in F stars with thin convective envelopes and are doubly taxed to explain such a scatter. No correlation is found between Li abundance and the present projected rotational velocity and some of the most rapid rotators are undepleted, ruling out meridional circulation as the cause of Li depletion. There is a somewhat larger spread in Li abundances in the spun-down late F stars compared to the early F stars which should remain rotationally unaltered on the main sequence. 85 refs

  20. Infrared photometry of upper main sequence stars in M39

    International Nuclear Information System (INIS)

    Manteiga, M.; Martinez-Roger, C.; Morales, C.; Sabau, L.

    1991-01-01

    Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10 8 years

  1. Infrared photometry of upper main sequence stars in M39

    Energy Technology Data Exchange (ETDEWEB)

    Manteiga, M.; Martinez-Roger, C. (Instituto de Astrofisica de Canarias, Tenerife, (ES)); Morales, C.; Sabau, L. (Instituto de Tecnica Aeroespacial, Madrid, (ES))

    1991-03-01

    Infrared photometry of 19 Main sequence stars in the open cluster M39 is presented. Infrared-infrared and optical-infrared colour-colour and colour-magnitude diagrams are presented and compared with mean intrinsic colours for Population I stars. An interstellar reddening of E(B - V) = 0.01 is obtained by analysis of the colour-colour diagrams. Comparison with a set of theoretical isochrones leads to an age estimate for the cluster between 2.4 and 4.8 x 10{sup 8} years.

  2. Environmental impact analysis for the main accidental sequences of ignitor

    International Nuclear Information System (INIS)

    Carpignano, A.; Francabandiera, S.; Vella, R.; Zucchetti, M.

    1996-01-01

    A safety analysis study has been applied to the Ignitor machine using Probabilistic Safety Assessment. The main initiating events have been identified, and accident sequences have been studied by means of traditional methods such as Failure Mode and Effect Analysis (FMEA), Fault Trees (FT) and Event Trees (ET). The consequences of the radioactive environmental releases have been assessed in terms of Effective Dose Equivalent (EDEs) to the Most Exposed Individuals (MEI) of the chosen site, by means of a population dose code. Results point out the low enviromental impact of the machine. 13 refs., 1 fig., 3 tabs

  3. DISSECTING THE QUASAR MAIN SEQUENCE: INSIGHT FROM HOST GALAXY PROPERTIES

    International Nuclear Information System (INIS)

    Sun, Jiayi; Shen, Yue

    2015-01-01

    The diverse properties of broad-line quasars appear to follow a well-defined main sequence along which the optical Fe ii strength increases. It has been suggested that this sequence is mainly driven by the Eddington ratio (L/L Edd ) of the black hole (BH) accretion. Shen and Ho demonstrated with quasar clustering analysis that the average BH mass decreases with increasing Fe ii strength when quasar luminosity is fixed, consistent with this suggestion. Here we perform an independent test by measuring the stellar velocity dispersion σ * (hence, the BH mass via the M–σ * relation) from decomposed host spectra in low-redshift Sloan Digital Sky Survey quasars. We found that at fixed quasar luminosity, σ * systematically decreases with increasing Fe ii strength, confirming that the Eddington ratio increases with Fe ii strength. We also found that at fixed luminosity and Fe ii strength, there is little dependence of σ * on the broad Hβ FWHM. These new results reinforce the framework that the Eddington ratio and orientation govern most of the diversity seen in broad-line quasar properties

  4. Main-sequence turnoff of the Draco dwarf galaxy

    International Nuclear Information System (INIS)

    Stetson, P.B.; Mcclure, R.D.; Vandenberg, D.A.; Victoria Univ., Canada)

    1985-01-01

    Deep photometry on the B,V system for 182 stars in the dwarf spheroidal galaxy in Draco was obtained with a CCD camera at the Cassegrain focus of the Canada-France-Hawaii 3.6-m telescope. Draco's main-sequence turnoff if found near V(to) = 23.5, which is about 3.4 magnitudes below the galaxy's horizontal branch. This leads to the interpretation that Draco is not measurably younger than the clusters or Ursa Minor: the age of Draco is about 18 Gyr according to current star-revolution chronologies. No blue stragglers are definitely detected in Draco, and it is concluded that any young population in Draco probably represents less than 10 percent of the total. 30 references

  5. Metallicity and ultraviolet excesses of late main sequence stars

    International Nuclear Information System (INIS)

    Suchkov, A.A.; Marsakov, V.A.; Shevelev, Yu.G.

    1987-01-01

    The comparison of the characteristics of ultraviolet (UV) excesses δ(U-B) and metallicity [Fe/H] distributions of F, G, and K dwarfs reveals a number of discrepancies. It is shown that they can be eliminated if we assume that UV excesses of K and late G dwarfs, and [Fe/H] values from detailed analysis for F dwarfs are underestimated. Such an assumption enables to account for low values of for F, K and late G dwarfs, and for the difference of the free terms in the metallicity - UV-excess relation for these stars as compared to early G dwarfs. In this case the F5-F9 dwarfs turn out to be more metal-rich (by 0.1 in [Fe/H]) than G and K dwarfs, and the metallicity of the Hyades cluster turns out to be larger than the solar one, [Fe/H] Hyades =+0.1. The ''conditional'' metallicity - UV-excess calibrations are obtained for four groups of main-sequence stars: F5-F9, G0-G4, G5-G9, K0-K5

  6. On the Statistical Properties of the Lower Main Sequence

    International Nuclear Information System (INIS)

    Angelou, George C.; Bellinger, Earl P.; Hekker, Saskia; Basu, Sarbani

    2017-01-01

    Astronomy is in an era where all-sky surveys are mapping the Galaxy. The plethora of photometric, spectroscopic, asteroseismic, and astrometric data allows us to characterize the comprising stars in detail. Here we quantify to what extent precise stellar observations reveal information about the properties of a star, including properties that are unobserved, or even unobservable. We analyze the diagnostic potential of classical and asteroseismic observations for inferring stellar parameters such as age, mass, and radius from evolutionary tracks of solar-like oscillators on the lower main sequence. We perform rank correlation tests in order to determine the capacity of each observable quantity to probe structural components of stars and infer their evolutionary histories. We also analyze the principal components of classic and asteroseismic observables to highlight the degree of redundancy present in the measured quantities and demonstrate the extent to which information of the model parameters can be extracted. We perform multiple regression using combinations of observable quantities in a grid of evolutionary simulations and appraise the predictive utility of each combination in determining the properties of stars. We identify the combinations that are useful and provide limits to where each type of observable quantity can reveal information about a star. We investigate the accuracy with which targets in the upcoming TESS and PLATO missions can be characterized. We demonstrate that the combination of observations from GAIA and PLATO will allow us to tightly constrain stellar masses, ages, and radii with machine learning for the purposes of Galactic and planetary studies.

  7. HABITABLE ZONES OF POST-MAIN SEQUENCE STARS

    International Nuclear Information System (INIS)

    Ramirez, Ramses M.; Kaltenegger, Lisa

    2016-01-01

    Once a star leaves the main sequence and becomes a red giant, its Habitable Zone (HZ) moves outward, promoting detectable habitable conditions at larger orbital distances. We use a one-dimensional radiative-convective climate and stellar evolutionary models to calculate post-MS HZ distances for a grid of stars from 3700 to 10,000 K (∼M1 to A5 stellar types) for different stellar metallicities. The post-MS HZ limits are comparable to the distances of known directly imaged planets. We model the stellar as well as planetary atmospheric mass loss during the Red Giant Branch (RGB) and Asymptotic Giant Branch (AGB) phases for super-Moons to super-Earths. A planet can stay between 200 million years up to 9 Gyr in the post-MS HZ for our hottest and coldest grid stars, respectively, assuming solar metallicity. These numbers increase for increased stellar metallicity. Total atmospheric erosion only occurs for planets in close-in orbits. The post-MS HZ orbital distances are within detection capabilities of direct imaging techniques.

  8. HABITABLE ZONES OF POST-MAIN SEQUENCE STARS

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez, Ramses M.; Kaltenegger, Lisa [Carl Sagan Institute, Cornell University, Ithaca, NY (United States)

    2016-05-20

    Once a star leaves the main sequence and becomes a red giant, its Habitable Zone (HZ) moves outward, promoting detectable habitable conditions at larger orbital distances. We use a one-dimensional radiative-convective climate and stellar evolutionary models to calculate post-MS HZ distances for a grid of stars from 3700 to 10,000 K (∼M1 to A5 stellar types) for different stellar metallicities. The post-MS HZ limits are comparable to the distances of known directly imaged planets. We model the stellar as well as planetary atmospheric mass loss during the Red Giant Branch (RGB) and Asymptotic Giant Branch (AGB) phases for super-Moons to super-Earths. A planet can stay between 200 million years up to 9 Gyr in the post-MS HZ for our hottest and coldest grid stars, respectively, assuming solar metallicity. These numbers increase for increased stellar metallicity. Total atmospheric erosion only occurs for planets in close-in orbits. The post-MS HZ orbital distances are within detection capabilities of direct imaging techniques.

  9. On the Statistical Properties of the Lower Main Sequence

    Energy Technology Data Exchange (ETDEWEB)

    Angelou, George C.; Bellinger, Earl P.; Hekker, Saskia [Max-Planck-Institut für Sonnensystemforschung, Justus-von-Liebig-Weg 3, D-37077 Göttingen (Germany); Basu, Sarbani [Department of Astronomy, Yale University, New Haven, CT 06520 (United States)

    2017-04-20

    Astronomy is in an era where all-sky surveys are mapping the Galaxy. The plethora of photometric, spectroscopic, asteroseismic, and astrometric data allows us to characterize the comprising stars in detail. Here we quantify to what extent precise stellar observations reveal information about the properties of a star, including properties that are unobserved, or even unobservable. We analyze the diagnostic potential of classical and asteroseismic observations for inferring stellar parameters such as age, mass, and radius from evolutionary tracks of solar-like oscillators on the lower main sequence. We perform rank correlation tests in order to determine the capacity of each observable quantity to probe structural components of stars and infer their evolutionary histories. We also analyze the principal components of classic and asteroseismic observables to highlight the degree of redundancy present in the measured quantities and demonstrate the extent to which information of the model parameters can be extracted. We perform multiple regression using combinations of observable quantities in a grid of evolutionary simulations and appraise the predictive utility of each combination in determining the properties of stars. We identify the combinations that are useful and provide limits to where each type of observable quantity can reveal information about a star. We investigate the accuracy with which targets in the upcoming TESS and PLATO missions can be characterized. We demonstrate that the combination of observations from GAIA and PLATO will allow us to tightly constrain stellar masses, ages, and radii with machine learning for the purposes of Galactic and planetary studies.

  10. Common Warm Dust Temperatures Around Main Sequence Stars

    Science.gov (United States)

    Morales, Farisa; Rieke, George; Werner, Michael; Stapelfeldt, Karl; Bryden, Geoffrey; Su, Kate

    2011-01-01

    We compare the properties of warm dust emission from a sample of main-sequence A-type stars (B8-A7) to those of dust around solar-type stars (F5-KO) with similar Spitzer Space Telescope Infrared Spectrograph/MIPS data and similar ages. Both samples include stars with sources with infrared spectral energy distributions that show evidence of multiple components. Over the range of stellar types considered, we obtain nearly the same characteristic dust temperatures (∼ 190 K and ∼60 K for the inner and outer dust components, respectively)-slightly above the ice evaporation temperature for the inner belts. The warm inner dust temperature is readily explained if populations of small grains are being released by sublimation of ice from icy planetesimals. Evaporation of low-eccentricity icy bodies at ∼ 150 K can deposit particles into an inner/warm belt, where the small grains are heated to dust Temperatures of -190 K. Alternatively, enhanced collisional processing of an asteroid belt-like system of parent planetesimals just interior to the snow line may account for the observed uniformity in dust temperature. The similarity in temperature of the warmer dust across our B8-KO stellar sample strongly suggests that dust-producing planetesimals are not found at similar radial locations around all stars, but that dust production is favored at a characteristic temperature horizon.

  11. Automated cleaning and pre-processing of immunoglobulin gene sequences from high-throughput sequencing

    Directory of Open Access Journals (Sweden)

    Miri eMichaeli

    2012-12-01

    Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.

  12. Constraining the magnitude of the largest event in a foreshock-main shock-aftershock sequence

    Science.gov (United States)

    Shcherbakov, Robert; Zhuang, Jiancang; Ogata, Yosihiko

    2018-01-01

    Extreme value statistics and Bayesian methods are used to constrain the magnitudes of the largest expected earthquakes in a sequence governed by the parametric time-dependent occurrence rate and frequency-magnitude statistics. The Bayesian predictive distribution for the magnitude of the largest event in a sequence is derived. Two types of sequences are considered, that is, the classical aftershock sequences generated by large main shocks and the aftershocks generated by large foreshocks preceding a main shock. For the former sequences, the early aftershocks during a training time interval are used to constrain the magnitude of the future extreme event during the forecasting time interval. For the latter sequences, the earthquakes preceding the main shock are used to constrain the magnitudes of the subsequent extreme events including the main shock. The analysis is applied retrospectively to past prominent earthquake sequences.

  13. AN OBJECTIVE DEFINITION FOR THE MAIN SEQUENCE OF STAR-FORMING GALAXIES

    Energy Technology Data Exchange (ETDEWEB)

    Renzini, Alvio [INAF—Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy); Peng, Ying-jie, E-mail: alvio.renzini@oapd.inaf.it, E-mail: y.peng@mrao.cam.ac.uk [Cavendish Laboratory, University of Cambridge, 19 J. J. Thomson Avenue, Cambridge CB3 0HE (United Kingdom)

    2015-03-10

    The main sequence (MS) of star-forming (SF) galaxies plays a fundamental role in driving galaxy evolution and our efforts to understand it. However, different studies find significant differences in the normalization, slope, and shape of the MS. These discrepancies arise mainly from the different selection criteria adopted to isolate SF galaxies, which may include or exclude galaxies with a specific star formation rate (SFR) substantially below the MS value. To obviate this limitation of all current criteria, we propose an objective definition of the MS that does not rely at all on a pre-selection of SF galaxies. Constructing the 3D SFR–mass–number plot, the MS is then defined as the ridge line of the SF peak, as illustrated with various figures. The advantages of such a definition are manifold. If generally adopted, it will facilitate the inter-comparison of results from different groups using the same SFR and stellar mass diagnostics, or it will highlight the relative systematics of different diagnostics. All of this could help to understand MS galaxies as systems in a quasi-steady state equilibrium and would also provide a more objective criterion for identifying quenching galaxies.

  14. AN OBJECTIVE DEFINITION FOR THE MAIN SEQUENCE OF STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Renzini, Alvio; Peng, Ying-jie

    2015-01-01

    The main sequence (MS) of star-forming (SF) galaxies plays a fundamental role in driving galaxy evolution and our efforts to understand it. However, different studies find significant differences in the normalization, slope, and shape of the MS. These discrepancies arise mainly from the different selection criteria adopted to isolate SF galaxies, which may include or exclude galaxies with a specific star formation rate (SFR) substantially below the MS value. To obviate this limitation of all current criteria, we propose an objective definition of the MS that does not rely at all on a pre-selection of SF galaxies. Constructing the 3D SFR–mass–number plot, the MS is then defined as the ridge line of the SF peak, as illustrated with various figures. The advantages of such a definition are manifold. If generally adopted, it will facilitate the inter-comparison of results from different groups using the same SFR and stellar mass diagnostics, or it will highlight the relative systematics of different diagnostics. All of this could help to understand MS galaxies as systems in a quasi-steady state equilibrium and would also provide a more objective criterion for identifying quenching galaxies

  15. Magnetic fields in O-, B- and A-type stars on the main sequence

    Directory of Open Access Journals (Sweden)

    Briquet Maryline

    2015-01-01

    Full Text Available In this review, the latest observational results on magnetic fields in main-sequence stars with radiative envelopes are summarised together with the theoretical works aimed at explaining them.

  16. Evolution Models of Helium White Dwarf–Main-sequence Star Merger Remnants

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xianfei; Bi, Shaolan [Department of Astronomy, Beijing Normal University, Beijing, 100875 (China); Hall, Philip D.; Jeffery, C. Simon, E-mail: zxf@bnu.edu.cn [Armagh Observatory, College Hill, Armagh BT61 9DG (United Kingdom)

    2017-02-01

    It is predicted that orbital decay by gravitational-wave radiation and tidal interaction will cause some close binary stars to merge within a Hubble time. The merger of a helium-core white dwarf with a main-sequence (MS) star can produce a red giant branch star that has a low-mass hydrogen envelope when helium is ignited and thus become a hot subdwarf. Because detailed calculations have not been made, we compute post-merger models with a stellar evolution code. We find the evolutionary paths available to merger remnants and find the pre-merger conditions that lead to the formation of hot subdwarfs. We find that some such mergers result in the formation of stars with intermediate helium-rich surfaces. These stars later develop helium-poor surfaces owing to diffusion. Combining our results with a model population and comparing to observed stars, we find that some observed intermediate helium-rich hot subdwarfs can be explained as the remnants of the mergers of helium-core white dwarfs with low-mass MS stars.

  17. Evolution Models of Helium White Dwarf–Main-sequence Star Merger Remnants

    International Nuclear Information System (INIS)

    Zhang, Xianfei; Bi, Shaolan; Hall, Philip D.; Jeffery, C. Simon

    2017-01-01

    It is predicted that orbital decay by gravitational-wave radiation and tidal interaction will cause some close binary stars to merge within a Hubble time. The merger of a helium-core white dwarf with a main-sequence (MS) star can produce a red giant branch star that has a low-mass hydrogen envelope when helium is ignited and thus become a hot subdwarf. Because detailed calculations have not been made, we compute post-merger models with a stellar evolution code. We find the evolutionary paths available to merger remnants and find the pre-merger conditions that lead to the formation of hot subdwarfs. We find that some such mergers result in the formation of stars with intermediate helium-rich surfaces. These stars later develop helium-poor surfaces owing to diffusion. Combining our results with a model population and comparing to observed stars, we find that some observed intermediate helium-rich hot subdwarfs can be explained as the remnants of the mergers of helium-core white dwarfs with low-mass MS stars.

  18. Did A Planet Survive A Post-Main Sequence Evolutionary Event?

    Science.gov (United States)

    Sorber, Rebecca; Jang-Condell, Hannah; Zimmerman, Mara

    2018-06-01

    The GL86 is star system approximately 10 pc away with a main sequence K- type ~ 0.77 M⊙ star (GL 86A) with a white dwarf ~0.49 M⊙ companion (GL86 B). The system has a ~ 18.4 AU semi-major axis, an orbital period of ~353 yrs, and an eccentricity of ~ 0.39. A 4.5 MJ planet orbits the main sequence star with a semi-major axis of 0.113 AU, an orbital period of 15.76 days, in a near circular orbit with an eccentricity of 0.046. If we assume that this planet was formed during the time when the white dwarf was a main sequence star, it would be difficult for the planet to have remained in a stable orbit during the post-main sequence evolution of GL86 B. The post-main sequence evolution with planet survival will be examined by modeling using the program Mercury (Chambers 1999). Using the model, we examine the origins of the planet: whether it formed before or after the post-main sequence evolution of GL86B. The modeling will give us insight into the dynamical evolution of, not only, the binary star system, but also the planet’s life cycle.

  19. Central limit theorems for sequences with m(n)-dependent main part

    NARCIS (Netherlands)

    Nieuwenhuis, G.

    1992-01-01

    Let (Xi(n); n ϵ N, 1⩽i⩽h(n)) be a double sequence of random variables with h(n)→∞ as n→∞. Suppose that the sequence can be split into two parts: an m(n)-dependent sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of main terms and a sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of residual terms. Here (m(n)) may be

  20. Effects of main-sequence mass loss on stellar and galactic chemical evolution

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1988-01-01

    L.A. Willson, G.H. Bowen and C. Struck-Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10 -9 M mass of sun/yr, diminishing over several times 10 8 years. The author attempts to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M 0 , and mass-loss rates decreasing exponentially over 2-3 x 10 8 years. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 M mass of sun and mass loss timescales 0.2 to 2.0 Gry. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M mass of sun and a metallicity-dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus-remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main sequence to the present

  1. Effects of mass loss on the evolution of massive stars. I. Main-sequence evolution

    International Nuclear Information System (INIS)

    Dearborn, D.S.P.; Blake, J.B.; Hainebach, K.L.; Schramm, D.N.

    1978-01-01

    The effect of mass loss on the evolution and surface composition of massive stars during main-sequence evolution are examined. While some details of the evolutionary track depend on the formula used for the mass loss, the results appear most sensitive to the total mass removed during the main-sequence lifetime. It was found that low mass-loss rates have very little effect on the evolution of a star; the track is slightly subluminous, but the lifetime is almost unaffected. High rates of mass loss lead to a hot, high-luminosity stellar model with a helium core surrounded by a hydrogen-deficient (Xapprox.0.1) envelope. The main-sequence lifetime is extended by a factor of 2--3. These models may be identified with Wolf-Rayet stars. Between these mass-loss extremes are intermediate models which appear as OBN stars on the main sequence. The mass-loss rates required for significant observable effects range from 8 x 10 -7 to 10 -5 M/sub sun/ yr -1 , depending on the initial stellar mass. It is found that observationally consistent mass-loss rates for stars with M> or =30 M/sub sun/ may be sufficiently high that these stars lose mass on a time scale more rapidly than their main-sequence core evolution time. This result implies that the helium cores resulting from the main-sequence evolution of these massive stars may all be very similar to that of a star of Mapprox.30 M/sub sun/ regardless of the zero-age mass

  2. The Star-forming Main Sequence of Dwarf Low Surface Brightness Galaxies

    Science.gov (United States)

    McGaugh, Stacy S.; Schombert, James M.; Lelli, Federico

    2017-12-01

    We explore the star-forming properties of late-type, low surface brightness (LSB) galaxies. The star-forming main sequence ({SFR}-{M}* ) of LSB dwarfs has a steep slope, indistinguishable from unity (1.04 ± 0.06). They form a distinct sequence from more massive spirals, which exhibit a shallower slope. The break occurs around {M}* ≈ {10}10 {M}⊙ , and can also be seen in the gas mass—stellar mass plane. The global Kennicutt-Schmidt law ({SFR}-{M}g) has a slope of 1.47 ± 0.11 without the break seen in the main sequence. There is an ample supply of gas in LSB galaxies, which have gas depletion times well in excess of a Hubble time, and often tens of Hubble times. Only ˜ 3 % of this cold gas needs be in the form of molecular gas to sustain the observed star formation. In analogy with the faint, long-lived stars of the lower stellar main sequence, it may be appropriate to consider the main sequence of star-forming galaxies to be defined by thriving dwarfs (with {M}* {10}10 {M}⊙ ) are weary giants that constitute more of a turn-off population.

  3. Reconciling mass functions with the star-forming main sequence via mergers

    Science.gov (United States)

    Steinhardt, Charles L.; Yurk, Dominic; Capak, Peter

    2017-06-01

    We combine star formation along the 'main sequence', quiescence and clustering and merging to produce an empirical model for the evolution of individual galaxies. Main-sequence star formation alone would significantly steepen the stellar mass function towards low redshift, in sharp conflict with observation. However, a combination of star formation and merging produces a consistent result for correct choice of the merger rate function. As a result, we are motivated to propose a model in which hierarchical merging is disconnected from environmentally independent star formation. This model can be tested via correlation functions and would produce new constraints on clustering and merging.

  4. Sequence of decommissioning of the main equipment in a central type VVER 440 V-230

    International Nuclear Information System (INIS)

    Andres, E.; Garcia Ruiz, R.

    2014-01-01

    IBERDROLA Ingenieria y Construccion S.A.U., leader of consortium with Empresarios Agrupados and INDRA, has developed the Basic Engineering for the decommissioning of contaminated systems and building of a VVER 440 V-230 Nuclear Power Plant, establishing the sequence and methodology for the main equipment fragmentation. For that, it has been designed dry and wet cutting zones to be set up in the area where steam generators, main cooling pumps and pressurizer are located; these components will be dismantled previously. (Author)

  5. The Lower Main Sequence of Stars in the Solar Neighborhood: Model Predictions Versus Observation

    Directory of Open Access Journals (Sweden)

    Bartašiūtė S.

    2012-09-01

    Full Text Available We have used the Simbad database and VizieR catalogue access tools to construct the observational color-absolute magnitude diagrams of nearby K-M dwarfs with precise Hipparcos parallaxes (σπ/π ≤ 0:05. Particular attention has been paid to removing unresolved double/multiple stars and variables. In addition to archival data, we have made use of nearly 2000 new radial-velocity measurements of K-M dwarfs to identify spectroscopic binary candidates. The main sequences, cleaned from unresolved binaries, variable stars, and old population stars which can also widen the sequence due to their presumably lower metallicity, were compared to available solar-metallicity models. Significant offsets of most of the model main-sequence lines are seen with respect to observational data, especially for the lower-mass stars. Only the location and slope of the Victoria-Regina and, partly, BaSTI isochrones match the data quite well.

  6. The main sequence of NGC 6231 and the calibration of absolute magnitudes

    International Nuclear Information System (INIS)

    Garrison, R.F.

    1978-01-01

    The author presents a discussion of a new approach to the calibration of absolute magnitudes for MK spectral types. With the addition of the NGC 6231 main sequence down to A0, the material for the cluster fitting method using very carefully determined MK types is complete. (Auth.)

  7. Oscillation mode linewidths of main-sequence and subgiant stars observed by Kepler

    DEFF Research Database (Denmark)

    Appourchaux, T.; Benomar, O.; Gruberbauer, M.

    2012-01-01

    Solar-like oscillations have been observed by {{\\it Kepler}} and CoRoT in several solar-type stars. We study the variations of stellar p-mode linewidth as a function of effective temperature. Time series of 9 months of Kepler data have been used. The power spectra of 42 cool main-sequence stars a...

  8. The SAMI Galaxy Survey: spatially resolving the main sequence of star formation

    Science.gov (United States)

    Medling, Anne M.; Cortese, Luca; Croom, Scott M.; Green, Andrew W.; Groves, Brent; Hampton, Elise; Ho, I.-Ting; Davies, Luke J. M.; Kewley, Lisa J.; Moffett, Amanda J.; Schaefer, Adam L.; Taylor, Edward; Zafar, Tayyaba; Bekki, Kenji; Bland-Hawthorn, Joss; Bloom, Jessica V.; Brough, Sarah; Bryant, Julia J.; Catinella, Barbara; Cecil, Gerald; Colless, Matthew; Couch, Warrick J.; Drinkwater, Michael J.; Driver, Simon P.; Federrath, Christoph; Foster, Caroline; Goldstein, Gregory; Goodwin, Michael; Hopkins, Andrew; Lawrence, J. S.; Leslie, Sarah K.; Lewis, Geraint F.; Lorente, Nuria P. F.; Owers, Matt S.; McDermid, Richard; Richards, Samuel N.; Sharp, Robert; Scott, Nicholas; Sweet, Sarah M.; Taranu, Dan S.; Tescari, Edoardo; Tonini, Chiara; van de Sande, Jesse; Walcher, C. Jakob; Wright, Angus

    2018-04-01

    We present the ˜800 star formation rate maps for the Sydney-AAO Multi-object Integral field spectrograph (SAMI) Galaxy Survey based on H α emission maps, corrected for dust attenuation via the Balmer decrement, that are included in the SAMI Public Data Release 1. We mask out spaxels contaminated by non-stellar emission using the [O III]/H β, [N II]/H α, [S II]/H α, and [O I]/H α line ratios. Using these maps, we examine the global and resolved star-forming main sequences of SAMI galaxies as a function of morphology, environmental density, and stellar mass. Galaxies further below the star-forming main sequence are more likely to have flatter star formation profiles. Early-type galaxies split into two populations with similar stellar masses and central stellar mass surface densities. The main-sequence population has centrally concentrated star formation similar to late-type galaxies, while galaxies >3σ below the main sequence show significantly reduced star formation most strikingly in the nuclear regions. The split populations support a two-step quenching mechanism, wherein halo mass first cuts off the gas supply and remaining gas continues to form stars until the local stellar mass surface density can stabilize the reduced remaining fuel against further star formation. Across all morphologies, galaxies in denser environments show a decreased specific star formation rate from the outside in, supporting an environmental cause for quenching, such as ram-pressure stripping or galaxy interactions.

  9. CLIC main beam quadrupole active pre-alignment based on cam movers

    CERN Document Server

    Kemppinen, J; Leuxe, R; Mainaud Durand, H; Sandomierski, J; Sosin, M

    2012-01-01

    Compact Linear Collider (CLIC) is a study for a future 48 km long linear electron-positron collider in the multi TeV range. Its target luminosity can only be reached if the main beam quadrupoles (MB quads) are actively pre-aligned within 17 µm in sliding windows of 200 m with respect to a straight reference line. In addition to the positioning requirement, the pre-alignment system has to provide a rigid support for the nano-stabilization system to ensure that the first eigenfrequency is above 100 Hz. Re-adjustment based on cam movers was chosen for detailed studies to meet the stringent pre-alignment requirements. There are four different types of MB quads in CLIC. Their lengths and masses vary so that at least two types of cam movers have to be developed. The validation of the cams with less stringent space restrictions has proceeded to a test setup in 5 degrees of freedom (DOF). Prototypes of the more demanding, smaller cams have been manufactured and they are under tests in 1 DOF. This paper describes the...

  10. A consistency test of white dwarf and main sequence ages: NGC 6791

    Directory of Open Access Journals (Sweden)

    Córsico A.H.

    2013-03-01

    Full Text Available NGC 6791 is an open cluster that it is so close to us that can be imaged down to very faint luminosities. The main sequence turn-off age (∼8 Gyr and the age derived from the cut-off of the white dwarf luminosity function (∼6 Gyr were found to be significantly different. Here we demonstrate that the origin of this age discrepancy lies in an incorrect evaluation of the white dwarf cooling ages, and we show that when the relevant physical separation processes are included in the calculation of white dwarf sequences both ages are coincident.

  11. Effects of Main-Sequence Mass Loss on Stellar and Galactic Chemical Evolution.

    Science.gov (United States)

    Guzik, Joyce Ann

    1988-06-01

    L. A. Willson, G. H. Bowen and C. Struck -Marcell have proposed that 1 to 3 solar mass stars may experience evolutionarily significant mass loss during the early part of their main-sequence phase. The suggested mass-loss mechanism is pulsation, facilitated by rapid rotation. Initial mass-loss rates may be as large as several times 10^{-9}M o/yr, diminishing over several times 10^8 years. We attempted to test this hypothesis by comparing some theoretical implications with observations. Three areas are addressed: Solar models, cluster HR diagrams, and galactic chemical evolution. Mass-losing solar models were evolved that match the Sun's luminosity and radius at its present age. The most extreme viable models have initial mass 2.0 M o, and mass-loss rates decreasing exponentially over 2-3 times 10^8 years. Compared to a constant -mass model, these models require a reduced initial ^4He abundance, have deeper envelope convection zones and higher ^8B neutrino fluxes. Early processing of present surface layers at higher interior temperatures increases the surface ^3He abundance, destroys Li, Be and B, and decreases the surface C/N ratio following first dredge-up. Evolution calculations incorporating main-sequence mass loss were completed for a grid of models with initial masses 1.25 to 2.0 Mo and mass loss timescales 0.2 to 2.0 Gyr. Cluster HR diagrams synthesized with these models confirm the potential for the hypothesis to explain observed spreads or bifurcations in the upper main sequence, blue stragglers, anomalous giants, and poor fits of main-sequence turnoffs by standard isochrones. Simple closed galactic chemical evolution models were used to test the effects of main-sequence mass loss on the F and G dwarf distribution. Stars between 3.0 M o and a metallicity -dependent lower mass are assumed to lose mass. The models produce a 30 to 60% increase in the stars to stars-plus -remnants ratio, with fewer early-F dwarfs and many more late-F dwarfs remaining on the main

  12. SDSS-IV MaNGA: Spatially Resolved Star Formation Main Sequence and LI(N)ER Sequence

    Science.gov (United States)

    Hsieh, B. C.; Lin, Lihwai; Lin, J. H.; Pan, H. A.; Hsu, C. H.; Sánchez, S. F.; Cano-Díaz, M.; Zhang, K.; Yan, R.; Barrera-Ballesteros, J. K.; Boquien, M.; Riffel, R.; Brownstein, J.; Cruz-González, I.; Hagen, A.; Ibarra, H.; Pan, K.; Bizyaev, D.; Oravetz, D.; Simmons, A.

    2017-12-01

    We present our study on the spatially resolved Hα and M * relation for 536 star-forming and 424 quiescent galaxies taken from the MaNGA survey. We show that the star formation rate surface density ({{{Σ }}}{SFR}), derived based on the Hα emissions, is strongly correlated with the M * surface density ({{{Σ }}}* ) on kiloparsec scales for star-forming galaxies and can be directly connected to the global star-forming sequence. This suggests that the global main sequence may be a consequence of a more fundamental relation on small scales. On the other hand, our result suggests that ∼20% of quiescent galaxies in our sample still have star formation activities in the outer region with lower specific star formation rate (SSFR) than typical star-forming galaxies. Meanwhile, we also find a tight correlation between {{{Σ }}}{{H}α } and {{{Σ }}}* for LI(N)ER regions, named the resolved “LI(N)ER” sequence, in quiescent galaxies, which is consistent with the scenario that LI(N)ER emissions are primarily powered by the hot, evolved stars as suggested in the literature.

  13. BVI CCD photometry of the broad main-sequence globular cluster NGC 1851

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.; Alvarado, F.; Wenderoth, E.

    1990-01-01

    Three-color CCD C-M diagrams are presented for the globular cluster NGC 1851, showing an extreme breadth of the main-sequence, similar to that of Omega Centauri. It is found that the main-sequence turnoff points are located at V(TO) = 19.44 + or - 0.10, with colors at B-V = 0.54 + or - 0.02, V-I = 0.61 + or - 0.02, and B-I = 1.15 + or - 0.03. The best fit to the VandenBerg and Bell (1985) isochrones is shown to be all C-M diagrams with Y = 0.20, Fe/H abundance ratio = -1.27, and (m-M)v = 15.45. It is concluded that NGC 1851 has a Delta V(TO - HB) = 3.34 + or - 0.10 and an age of 16 + or - 2 Gyr. 29 refs

  14. Turbulence and the Li abundance in main sequence and giant stars

    International Nuclear Information System (INIS)

    Charbonneau, P.; Michaud, G.

    1990-01-01

    Calculations of Li burning via turbulent transport are conducted to determine the extent to which observed Li abundances in first ascent giants constrain the various turbulence parameterizations used to model the main-sequence surface Li abundance evolution. A full time-dependent solution to the transport equation is performed, including nuclear reaction terms and evolutionary effects. It is found that turbulence can lead to the extreme Li underabundances observed in giants of M67 and NGC 752. Consideration is given to the possibility of using observations of Li abundances to discriminate between turbulent particle transport and meridional circulation transport. Numerical solutions of the turbulent diffusion coefficient of Vauclair (1988) is used to model the Hyades Li abundance gap. The astrophysical implications of the results for main-sequence and giant stars are discussed. 36 refs

  15. RADIO AND MID-INFRARED PROPERTIES OF COMPACT STARBURSTS: DISTANCING THEMSELVES FROM THE MAIN SEQUENCE

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, E. J. [Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Stierwalt, S.; Armus, L. [Spitzer Science Center, California Institute of Technology, MC 314-6, Pasadena, CA 91125 (United States); Condon, J. J. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903 (United States); Evans, A. S., E-mail: emurphy@obs.carnegiescience.edu [Department of Astronomy, University of Virginia, 530 McCormick Road, Charlottesville, VA 22904 (United States)

    2013-05-01

    We investigate the relationship between 8.44 GHz brightness temperatures and 1.4 to 8.44 GHz radio spectral indices with 6.2 {mu}m polycyclic aromatic hydrocarbon (PAH) emission and 9.7 {mu}m silicate absorption features for a sample of 36 local luminous and ultraluminous infrared galaxies. We find that galaxies having small 6.2 {mu}m PAH equivalent widths (EQWs), which signal the presence of weak PAH emission and/or an excess of very hot dust, also have flat spectral indices. The three active galactic nuclei (AGN) identified through their excessively large 8.44 GHz brightness temperatures are also identified as AGN via their small 6.2 {mu}m PAH EQWs. We also find that the flattening of the radio spectrum increases with increasing silicate optical depth, 8.44 GHz brightness temperature, and decreasing size of the radio source even after removing potential AGN, supporting the idea that compact starbursts show spectral flattening as the result of increased free-free absorption. These correlations additionally suggest that the dust obscuration in these galaxies must largely be coming from the vicinity of the compact starburst itself, and is not distributed throughout the (foreground) disk of the galaxy. Finally, we investigate the location of these infrared-bright systems relative to the main sequence (star formation rate versus stellar mass) of star-forming galaxies in the local universe. We find that the radio spectral indices of galaxies flatten with increasing distance above the main sequence, or in other words, with increasing specific star formation rate. This indicates that galaxies located above the main sequence, having high specific star formation rates, are typically compact starbursts hosting deeply embedded star formation that becomes more optically thick in the radio and infrared with increased distance above the main sequence.

  16. On the mass-spectrum relation for the main sequence stars

    International Nuclear Information System (INIS)

    Svechnikov, M.A.; Tajdakova, T.A.

    1984-01-01

    From 240 main-sequence stars with well-determined masses, a new mass-spectrum relation is obtained, which differs appreciably in certain intervals of spectral types from the mass-spectrum relations of Allen and Trimble. The accuracy of mass determination for the components of eclipsing binary systems of different types from their spectra given in the General Catalogue of Variable Stars (3rd edition) and in its supplements is evaluated

  17. Possible evidence for metal accretion onto the surfaces of metal-poor main-sequence stars

    Energy Technology Data Exchange (ETDEWEB)

    Hattori, Kohei; Yoshii, Yuzuru [Institute of Astronomy, School of Science, University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Beers, Timothy C. [National Optical Astronomy Observatories, Tucson, AZ 85719 (United States); Carollo, Daniela [Department of Physics and Astronomy, Macquarie University, Sydney, 2109 NSW (Australia); Lee, Young Sun, E-mail: khattori@ioa.s.u-tokyo.ac.jp [Department of Astronomy, New Mexico State University, Las Cruces, NM 88003 (United States)

    2014-04-01

    The entire evolution of the Milky Way, including its mass-assembly and star-formation history, is imprinted onto the chemo-dynamical distribution function of its member stars, f(x, v, [X/H]), in the multi-dimensional phase space spanned by position, velocity, and elemental abundance ratios. In particular, the chemo-dynamical distribution functions for low-mass stars (e.g., G- or K-type dwarfs) are precious tracers of the earliest stages of the Milky Way's formation, since their main-sequence lifetimes approach or exceed the age of the universe. A basic tenet of essentially all previous analyses is that the stellar metallicity, usually parameterized as [Fe/H], is conserved over time for main-sequence stars (at least those that have not been polluted due to mass transfer from binary companions). If this holds true, any correlations between metallicity and kinematics for long-lived main-sequence stars of different masses, effective temperatures, or spectral types must strictly be the same, since they reflect the same mass-assembly and star-formation histories. By analyzing a sample of nearby metal-poor halo and thick-disk stars on the main sequence, taken from Data Release 8 of the Sloan Digital Sky Survey, we find that the median metallicity of G-type dwarfs is systematically higher (by about 0.2 dex) than that of K-type dwarfs having the same median rotational velocity about the Galactic center. If it can be confirmed, this finding may invalidate the long-accepted assumption that the atmospheric metallicities of long-lived stars are conserved over time.

  18. Carbon, nitrogen, and oxygen abundances in main-sequence stars. II. 20 F and G stars

    International Nuclear Information System (INIS)

    Clegg, R.E.S.; Lambert, D.L.; Tomkin, J.

    1981-01-01

    High-resolution Reticon spectra of red and near-infrared C I, N I, and O I lines have been analyzed to determine C, N, and O abundances in a sample of 20 F and G main-sequence stars. Their iron abundances, which have been determined from analysis of additional Reticon spectra of red Fe I lines, cover the range -0.9< or =[Fe/H]< or =+0.4. Sulfur abundances have also been obtained

  19. Spectroscopic and asteroseismic analysis of the remarkable main-sequence A star KIC 11145123

    DEFF Research Database (Denmark)

    Takada-Hidai, Masahide; Kurtz, Donald W.; Shibahashi, Hiromoto

    2017-01-01

    A spectroscopic analysis was carried out to clarify the properties of KIC 11145123 - the first main-sequence star with a directly measured core-to-surface rotation profile - based on spectra observed with the High Dispersion Spectrograph (HDS) of the Subaru telescope. The atmospheric parameters (T......-eff = 7600 K, log g = 4.2, xi = 3.1 kms(-1) and [Fe/H] = -0.71 dex), the radial and rotation velocities, and elemental abundances were obtained by analysing line strengths and fitting line profiles, which were calculated with a 1D LTE model atmosphere. The main properties of KIC 11145123 are: (1) a low [Fe...

  20. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    Energy Technology Data Exchange (ETDEWEB)

    Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov

    2009-08-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  1. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    International Nuclear Information System (INIS)

    Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

    2009-01-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  2. Elevation or Suppression? The Resolved Star Formation Main Sequence of Galaxies with Two Different Assembly Modes

    Science.gov (United States)

    Liu, Qing; Wang, Enci; Lin, Zesen; Gao, Yulong; Liu, Haiyang; Berhane Teklu, Berzaf; Kong, Xu

    2018-04-01

    We investigate the spatially resolved star formation main sequence in star-forming galaxies using Integral Field Spectroscopic observations from the Mapping Nearby Galaxies at the Apache Point Observatory survey. We demonstrate that the correlation between the stellar mass surface density (Σ*) and star formation rate surface density (ΣSFR) holds down to the sub-galactic scale, leading to the sub-galactic main sequence (SGMS). By dividing galaxies into two populations based on their recent mass assembly modes, we find the resolved main sequence in galaxies with the “outside-in” mode is steeper than that in galaxies with the “inside-out” mode. This is also confirmed on a galaxy-by-galaxy level, where we find the distributions of SGMS slopes for individual galaxies are clearly separated for the two populations. When normalizing and stacking the SGMS of individual galaxies on one panel for the two populations, we find that the inner regions of galaxies with the “inside-out” mode statistically exhibit a suppression in star formation, with a less significant trend in the outer regions of galaxies with the “outside-in” mode. In contrast, the inner regions of galaxies with “outside-in” mode and the outer regions of galaxies with “inside-out” mode follow a slightly sublinear scaling relation with a slope ∼0.9, which is in good agreement with previous findings, suggesting that they are experiencing a universal regulation without influences of additional physical processes.

  3. Binary pulsar PSR 1718-19 contains a stripped main-sequence turn-off star

    International Nuclear Information System (INIS)

    Zwitter, T.

    1993-05-01

    Lyne et al. (1993) have recently announced the discovery of a 1-second globular cluster pulsar, 1718-19, in a 6.2-hour binary system which is embedded in a cloud of material originating from the companion star. However the incident flux of the pulsar's radiation on the companion is too low to ablate it and a main sequence companion is too small to fill its Roche lobe. Here I argue that the companion is a stripped turn-off star of 0.2-0.4 solar masses (M sun ) and with approx. 0.1M sun helium core. It has approx. 1.8-times larger radius than a main sequence star of equal mass. Its position in the Hertzsprung-Russell diagram overlaps that of a ∼ 0.65M sun main-sequence star. The evolutionary state of the companion and the highly magnetized slowly rotating neutron star place the system on the verge of the low mass X-ray binary phase. (author). 19 refs, 2 figs

  4. Reconstruction of the pre-compactional thickness of the Zechstein Main Dolomite in northwest Poland

    Directory of Open Access Journals (Sweden)

    Semyrka Grażyna

    2015-12-01

    Full Text Available Our reconstruction of the pre-compactional thickness of the Main Dolomite strata from the so-called Grotów Peninsula (northwest Poland was based on macroscopic observations of drill cores from three wells: Mokrzec-1, Sieraków-4 and Międzychód-5. These wells are located in various palaeogeographical zones of the Main Dolomite and cored rocks represent a range of microfacies. The amount of compactional reduction in thickness of the Main Dolomite was estimated by summing the total heights (Wst of all stylolites encountered in logs of these wells. For calculations, a generalised model of a drill core was developed, which embraced all types of stylolite seams present in the Main Dolomite succession studied. Also the method of stylolite dimensioning was demonstrated. The number of stylolites in the drill cores studied varied from 511 in the Sieraków-4 well to 1,534 in the Międzychód-5 well. In all cores studied low-amplitude macrostylolites predominated, but the reduction of thickness was controlled mostly by the low- and medium-amplitude macrostylolites. The largest number of stylolites was found in the grainstone/packstone microfacies. The turnout of stylolites depends of microfacies. The highest density of stylolites was documented in mudstones/wackestones (24 stylolites per metre of rock thickness and the lowest in boundstones (14 stylolites per metre of rock thickness. The low-amplitude stylolites appear most frequently in the mudstone/wackestone microfacies (15 stylolites per metre of rock thickness; in grainstones/packstones, rudstones/floatstones and boundstones middle-amplitude stylolites are rare (3 stylolites per metre of rock thickness. The degree of compaction of the Main Dolomite succession studied varied from 6 to 10%; hence, its calculated initial thickness also varied in the wells studied: from 41.3 m in the Sieraków-4 well to 56.9 m in the Mokrzec-1 well and to 97.1 m in the Międzychód-5 well. The volumes of reservoir

  5. The V Band Empirical Mass-Luminosity Relation for Main Sequence Stars

    Science.gov (United States)

    Xia, F.; Fu, Y. N.

    2010-01-01

    Stellar mass is an indispensable parameter in the studies of stellar physics and stellar dynamics. On the one hand, the most reliable way to determine the stellar dynamical mass is via orbital determination of binaries. On the other hand, however, most stellar masses have to be estimated by using the mass-luminosity relation (MLR). Therefore, it is important to obtain the empirical MLR through fitting the data of stellar dynamical mass and luminosity. The effect of metallicity can make this relation disperse in the V-band, but studies show that this is mainly limited to the case when the stellar mass is less than 0.6M⊙. Recently, many relevant data have been accumulated for main sequence stars with larger mass, which make it possible to significantly improve the corresponding MLR. Using a fitting method which can reasonably assign weight to the observational data including two quantities with different dimensions, we obtain a V-band MLR based on the dynamical masses and luminosities of 203 main sequence stars. Compared with the previous work, the improved MLR is statistically significant, and the relative error of mass estimation reaches about 5%. Therefore, our MLR is useful not only in studies of statistical nature, but also in studies of concrete stellar systems, such as the long-term dynamical study and the short-term positioning study of a specific multiple star system.

  6. The V-band Empirical Mass-luminosity Relation for Main Sequence Stars

    Science.gov (United States)

    Xia, Fang; Fu, Yan-Ning

    2010-07-01

    Stellar mass is an indispensable parameter in the studies of stellar physics and stellar dynamics. On the one hand, the most reliable way to determine the stellar dynamical mass is via orbital determinations of binaries. On the other hand, however, most stellar masses have to be estimated by using the mass luminosity relation (MLR). Therefore, it is important to obtain the empirical MLR through fitting the data of stellar dynamical mass and luminosity. The effect of metallicity can make this relation disperse in the V-band, but studies show that this is mainly limited to the case when the stellar mass is less than 0.6M⊙ Recently, many relevant data have been accumulated for main sequence stars with larger masses, which make it possible to significantly improve the corresponding MLR. Using a fitting method which can reasonably assign weights to the observational data including two quantities with different dimensions, we obtain a V-band MLR based on the dynamical masses and luminosities of 203 main sequence stars. In comparison with the previous work, the improved MLR is statistically significant, and the relative error of mass estimation reaches about 5%. Therefore, our MLR is useful not only in the studies of statistical nature, but also in the studies of concrete stellar systems, such as the long-term dynamical study and the short-term positioning study of a specific multiple star system.

  7. BVRI main-sequence photometry of the globular cluster M4

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1984-01-01

    We present BV and RI photographic photometry of 1421 and 189 stars, respectively, in the intermediate metallicity globular cluster M4 (NGC 6121). This investigation includes the first results of RI main-sequence photometry of a globular cluster. The use of longer wavelengths and longer color baselines provides the potential of improved isochrone fittings and underscores the urgent need for calculations of RI synthetic isochrones to be compared with observations. The Pickering-Racine wedge was used with the ESO 3.6 m telescope, the Las Campanas 2.5 m du Pont telescope, and the CTIO 1 m Yale telescope to extend the photoelectric limit from Vroughly-equal16.1 to Vroughly-equal19.1. We have determined the position of the main-sequence turnoff to lie at V = 16.6 +- 0.2 (m.e.) and B-V = 0.80 +- 0.03 (m.e.). A comparison of our BV observations with the CCD data of Richer and Fahlman shows excellent agreement: the two fifucial main sequences agree at all points to within 0.025 mag and, on average, to 0.013 mag. For the cluster we derive a distance modulus (m-M)/sub V/ = 12.52 +- 0.2 and reddening E(B-V) = 0.44 +- 0.03, results which confirm that at a distance of 2 kpc, M4 is the closest globular clusters to the Sun. Using the isochrones of VandenBerg, we deduce an age 13 +- 2 Gyr. As noted in several other investigations, there is a striking deficiency of stars in certain parts of the color-magnitude diagram; in M4 we find a pronounced gap over approx.0.6 mag at the base of the subgiant branch

  8. Discovery and characterization of 3000+ main-sequence binaries from APOGEE spectra

    Science.gov (United States)

    El-Badry, Kareem; Ting, Yuan-Sen; Rix, Hans-Walter; Quataert, Eliot; Weisz, Daniel R.; Cargile, Phillip; Conroy, Charlie; Hogg, David W.; Bergemann, Maria; Liu, Chao

    2018-05-01

    We develop a data-driven spectral model for identifying and characterizing spatially unresolved multiple-star systems and apply it to APOGEE DR13 spectra of main-sequence stars. Binaries and triples are identified as targets whose spectra can be significantly better fit by a superposition of two or three model spectra, drawn from the same isochrone, than any single-star model. From an initial sample of ˜20 000 main-sequence targets, we identify ˜2500 binaries in which both the primary and secondary stars contribute detectably to the spectrum, simultaneously fitting for the velocities and stellar parameters of both components. We additionally identify and fit ˜200 triple systems, as well as ˜700 velocity-variable systems in which the secondary does not contribute detectably to the spectrum. Our model simplifies the process of simultaneously fitting single- or multi-epoch spectra with composite models and does not depend on a velocity offset between the two components of a binary, making it sensitive to traditionally undetectable systems with periods of hundreds or thousands of years. In agreement with conventional expectations, almost all the spectrally identified binaries with measured parallaxes fall above the main sequence in the colour-magnitude diagram. We find excellent agreement between spectrally and dynamically inferred mass ratios for the ˜600 binaries in which a dynamical mass ratio can be measured from multi-epoch radial velocities. We obtain full orbital solutions for 64 systems, including 14 close binaries within hierarchical triples. We make available catalogues of stellar parameters, abundances, mass ratios, and orbital parameters.

  9. Systematic main sequence photometry of globular cluster stars for age determination

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1984-01-01

    The individual photometric study of the coeval stars in globular clusters presents one of the best observational tests of the stellar evolution theory. Our own globular cluster system provides fundamental clues to the dynamical and chemical evolutionary history of the galaxy, and the study of their ages give a lower limit to the age of the galaxy as well as to that of the universe. The authors have undertaken a systematic research program, and discuss the ages deduced by fitting main sequence photometry to theoretical isochrones of six galactic globular clusters: M4, M22, M30, NGC 288, NGC 3201 and NGC 6397. (Auth.)

  10. Asteroseismic measurement of surface-to-core rotation in a main-sequence star*

    Directory of Open Access Journals (Sweden)

    Kurtz Donald W.

    2015-01-01

    Full Text Available We have discovered rotationally split core g-mode triplets and surface p-mode triplets and quintuplets in a terminal age main-sequence A star, KIC 11145123, that shows both δ Sct p-mode pulsations and γ Dor g-mode pulsations. This gives the first robust determination of the rotation of the deep core and surface of a main-sequence star, essentially model-independently. We find its rotation to be nearly uniform with a period near 100 d, but we show with high confidence that the surface rotates slightly faster than the core. A strong angular momentum transfer mechanism must be operating to produce the nearly rigid rotation, and a mechanism other than viscosity must be operating to produce a more rapidly rotating surface than core. Our asteroseismic result, along with previous asteroseismic constraints on internal rotation in some B stars, and measurements of internal rotation in some subgiant, giant and white dwarf stars, has made angular momentum transport in stars throughout their lifetimes an observational science.

  11. Impacts of WIMP dark matter upon stellar evolution: main-sequence stars

    CERN Document Server

    Scott, Pat; Edsjo, Joakim

    2008-01-01

    The presence of large amounts of WIMP dark matter in stellar cores has been shown to have significant effects upon models of stellar evolution. We present a series of detailed grids of WIMP-influenced stellar models for main sequence stars, computed using the DarkStars code. We describe the changes in stellar structure and main sequence evolution which occur for masses ranging from 0.3 to 2.0 solar masses and metallicities from Z = 0.0003-0.02, as a function of the rate of energy injection by WIMPs. We then go on to show what rates of energy injection can be obtained using realistic orbital parameters for stars near supermassive black holes, including detailed considerations of dark matter halo velocity and density profiles. Capture and annihilation rates are strongly boosted when stars follow elliptical rather than circular orbits, causing WIMP annihilation to provide up to 100 times the energy of hydrogen fusion in stars at the Galactic centre.

  12. Effects of main-sequence mass loss on the turnoff ages of globular clusters

    International Nuclear Information System (INIS)

    Guzik, J.A.

    1989-01-01

    Willson, Bowen, and Struck-Marcell have proposed that globular cluster main-sequence turnoff ages can be reconciled with the lower ages of the Galaxy and universe deduced from other methods by incorporating an epoch of early main-sequence mass-loss by stars of spectral types A through early-F. The proposed mass loss is pulsation-driven, and facilitated by rapid rotation. This paper presents stellar evolution calculations of Pop. II (Z = 0.001) mass-losing stars of initial mass 0.8 to 1.6 M circle dot , with exponentially-decreasing mass loss rates of e-folding times 0.5 to 2.0 Gyr, evolving to a final mass of 0.7 M circle dot . The calculations indicate that a globular cluster with apparent turnoff age 18 Gyr could have an actual age as low as ∼12 Gyr. Observational implications that may help to verify the hypothesis, e.g. low C/N abundance ratios among red giants following first dredge-up, blue stragglers, red giant deficiencies, and signatures in cluster mass/luminosity functions, are also discussed.25 refs., 4 figs., 3 tabs

  13. Discovery of Extended Main-sequence Turnoffs in Four Young Massive Clusters in the Magellanic Clouds

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chengyuan [Department of Physics and Astronomy, Macquarie University, Sydney, NSW 2109 (Australia); De Grijs, Richard [Kavli Institute for Astronomy and Astrophysics and Department of Astronomy, Peking University, Yi He Yuan Lu 5, Hai Dian District, Beijing 100871 (China); Deng, Licai [Key Laboratory for Optical Astronomy, National Astronomical Observatories, Chinese Academy of Sciences, 20A Datun Road, Chaoyang District, Beijing 100012 (China); Milone, Antonino P. [Research School of Astronomy and Astrophysics, Australian National University, Mt. Stromlo Observatory, Cotter Road, Weston, ACT 2611 (Australia)

    2017-08-01

    An increasing number of young massive clusters (YMCs) in the Magellanic Clouds have been found to exhibit bimodal or extended main sequences (MSs) in their color–magnitude diagrams (CMDs). These features are usually interpreted in terms of a coeval stellar population with different stellar rotational rates, where the blue and red MS stars are populated by non- (or slowly) and rapidly rotating stellar populations, respectively. However, some studies have shown that an age spread of several million years is required to reproduce the observed wide turnoff regions in some YMCs. Here we present the ultraviolet–visual CMDs of four Large and Small Magellanic Cloud YMCs, NGC 330, NGC 1805, NGC 1818, and NGC 2164, based on high-precision Hubble Space Telescope photometry. We show that they all exhibit extended main-sequence turnoffs (MSTOs). The importance of age spreads and stellar rotation in reproducing the observations is investigated. The observed extended MSTOs cannot be explained by stellar rotation alone. Adopting an age spread of 35–50 Myr can alleviate this difficulty. We conclude that stars in these clusters are characterized by ranges in both their ages and rotation properties, but the origin of the age spread in these clusters remains unknown.

  14. The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence

    Energy Technology Data Exchange (ETDEWEB)

    Panda, Swayamtrupta; Czerny, Bożena [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland); Nicolaus Copernicus Astronomical Center, Polish Academy of Sciences, Warsaw (Poland); Wildy, Conor, E-mail: panda@cft.edu.pl [Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland)

    2017-11-07

    Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992) used Principal Component Analysis (PCA), and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1) was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR) diagram (Sulentic et al., 2001). The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle) is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED). We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.

  15. The Physical Driver of the Optical Eigenvector 1 in Quasar Main Sequence

    Directory of Open Access Journals (Sweden)

    Swayamtrupta Panda

    2017-11-01

    Full Text Available Quasars are complex sources, characterized by broad band spectra from radio through optical to X-ray band, with numerous emission and absorption features. This complexity leads to rich diagnostics. However, Boroson and Green (1992 used Principal Component Analysis (PCA, and with this analysis they were able to show significant correlations between the measured parameters. The leading component, related to Eigenvector 1 (EV1 was dominated by the anticorrelation between the FeII optical emission and [OIII] line and EV1 alone contained 30% of the total variance. It opened a way in defining a quasar main sequence, in close analogy to the stellar main sequence on the Hertzsprung-Russel (HR diagram (Sulentic et al., 2001. The question still remains which of the basic theoretically motivated parameters of an active nucleus (Eddington ratio, black hole mass, accretion rate, spin, and viewing angle is the main driver behind the EV1. Here we limit ourselves to the optical waveband, and concentrate on theoretical modeling the FeII to Hβ ratio, and we test the hypothesis that the physical driver of EV1 is the maximum of the accretion disk temperature, reflected in the shape of the spectral energy distribution (SED. We performed computations of the Hβ and optical FeII for a broad range of SED peak position using CLOUDY photoionisation code. We assumed that both Hβ and FeII emission come from the Broad Line Region represented as a constant density cloud in a plane-parallel geometry. We expected that a hotter disk continuum will lead to more efficient production of FeII but our computations show that the FeII to Hβ ratio actually drops with the rise of the disk temperature. Thus either hypothesis is incorrect, or approximations used in our paper for the description of the line emissivity is inadequate.

  16. A Population Study of Wide-Separation Brown Dwarf Companions to Main Sequence Stars

    Science.gov (United States)

    Smith, Jeffrey J.

    2005-01-01

    Increased interest in infrared astronomy has opened the frontier to study cooler objects that shed significant light on the formation of planetary systems. Brown dwarf research provides a wealth of information useful for sorting through a myriad of proposed formation theories. Our study combines observational data from 2MASS with rigorous computer simulations to estimate the true population of long-range (greater than 1000 AU) brown dwarf companions in the solar neighborhood (less than 25 pc from Earth). Expanding on Gizis et al. (2001), we have found the margin of error in previous estimates to be significantly underestimated after we included orbit eccentricity, longitude of pericenter, angle of inclination, field star density, and primary and secondary luminosities as parameters influencing the companion systems in observational studies. We apply our simulation results to current L- and T-dwarf catalogs to provide updated estimates on the frequency of wide-separation brown dwarf companions to main sequence stars.

  17. Effect of Generalized Uncertainty Principle on Main-Sequence Stars and White Dwarfs

    Directory of Open Access Journals (Sweden)

    Mohamed Moussa

    2015-01-01

    Full Text Available This paper addresses the effect of generalized uncertainty principle, emerged from different approaches of quantum gravity within Planck scale, on thermodynamic properties of photon, nonrelativistic ideal gases, and degenerate fermions. A modification in pressure, particle number, and energy density are calculated. Astrophysical objects such as main-sequence stars and white dwarfs are examined and discussed as an application. A modification in Lane-Emden equation due to a change in a polytropic relation caused by the presence of quantum gravity is investigated. The applicable range of quantum gravity parameters is estimated. The bounds in the perturbed parameters are relatively large but they may be considered reasonable values in the astrophysical regime.

  18. THE DISCOVERY OF SOLAR-LIKE ACTIVITY CYCLES BEYOND THE END OF THE MAIN SEQUENCE?

    Energy Technology Data Exchange (ETDEWEB)

    Route, Matthew, E-mail: mroute@purdue.edu [Research Computing, Information Technology at Purdue, Purdue University, 155 S. Grant Street, West Lafayette, IN 47907 (United States)

    2016-10-20

    The long-term magnetic behavior of objects near the cooler end of the stellar main sequence is poorly understood. Most theoretical work on the generation of magnetism in these ultracool dwarfs (spectral type ≥M7 stars and brown dwarfs) suggests that their magnetic fields should not change in strength and direction. Using polarized radio emission measurements of their magnetic field orientations, I demonstrate that these cool, low-mass, fully convective objects appear to undergo magnetic polarity reversals analogous to those that occur on the Sun. This powerful new technique potentially indicates that the patterns of magnetic activity displayed by the Sun continue to exist, despite the fully convective interiors of these objects, in contravention of several leading theories of the generation of magnetic fields by internal dynamos.

  19. ON THE MULTIPLICITY OF THE ZERO-AGE MAIN-SEQUENCE O STAR HERSCHEL 36

    International Nuclear Information System (INIS)

    Arias, Julia I.; Barba, Rodolfo H.; Gamen, Roberto C.; Morrell, Nidia I.; Apellaniz, Jesus MaIz; Alfaro, Emilio J.; Sota, Alfredo; Walborn, Nolan R.; Bidin, Christian Moni

    2010-01-01

    We present the analysis of high-resolution optical spectroscopic observations of the zero-age main-sequence O star Herschel 36 spanning six years. This star is definitely a multiple system, with at least three components detected in its spectrum. Based on our radial-velocity (RV) study, we propose a picture of a close massive binary and a more distant companion, most probably in wide orbit about each other. The orbital solution for the binary, whose components we identify as O9 V and B0.5 V, is characterized by a period of 1.5415 ± 0.0006 days. With a spectral type O7.5 V, the third body is the most luminous component of the system and also presents RV variations with a period close to 498 days. Some possible hypotheses to explain the variability are briefly addressed and further observations are suggested.

  20. Making Sense of Atmospheric Models and Fundamental Stellar Properties at the Bottom of the Main Sequence

    Science.gov (United States)

    Dieterich, Sergio; Henry, Todd; Jao, W.-C.; Washington, Robert; Silverstein, Michele; Winters, J.; RECONS

    2018-01-01

    We present a detailed comparison of atmospheric model predictions and photometric observations for late M and L dwarfs. We discuss which wavelength regions are best for determining the fundamental properties of these cool stellar and substellar atmospheres and use this analysis to refine the HR diagram for the hydrogen burning limit first presented in 2014. We also add several new objects to the HR diagram and find little qualitative difference in the HR diagram's overall morphology when compared to our 2014 results. The L2 dwarf 2MASS 0523-1403 remains the smallest hydrogen burning star for which we calculated a radius, thus likely indicating the end of the stellar main sequence. This work is supported by the NSF Astronomy and Astrophysics Postdoctoral Fellowship program through grant AST-1400680.

  1. New Insights into the Formation of the Blue Main Sequence in NGC 1850

    Science.gov (United States)

    Yang, Yujiao; Li, Chengyuan; Deng, Licai; de Grijs, Richard; Milone, Antonino P.

    2018-06-01

    Recent discoveries of bimodal main sequences (MSs) associated with young clusters (with ages ≲1 Gyr) in the Magellanic Clouds have drawn a lot of attention. One of the prevailing formation scenarios attributes these split MSs to a bimodal distribution in stellar rotation rates, with most stars belonging to a rapidly rotating population. In this scenario, only a small fraction of stars populating a secondary blue sequence are slowly or non-rotating stars. Here, we focus on the blue MS in the young cluster NGC 1850. We compare the cumulative number fraction of the observed blue-MS stars to that of the high-mass-ratio binary systems at different radii. The cumulative distributions of both populations exhibit a clear anti-correlation, characterized by a highly significant Pearson coefficient of ‑0.97. Our observations are consistent with the possibility that blue-MS stars are low-mass-ratio binaries, and therefore their dynamical disruption is still ongoing. High-mass-ratio binaries, on the other hand, are more centrally concentrated.

  2. Chemically Dissected Rotation Curves of the Galactic Bulge from Main-sequence Proper Motions

    Science.gov (United States)

    Clarkson, William I.; Calamida, Annalisa; Sahu, Kailash C.; Brown, Thomas M.; Gennaro, Mario; Avila, Roberto J.; Valenti, Jeff; Debattista, Victor P.; Rich, R. Michael; Minniti, Dante; Zoccali, Manuela; Aufdemberge, Emily R.

    2018-05-01

    We report results from an exploratory study implementing a new probe of Galactic evolution using archival Hubble Space Telescope imaging observations. Precise proper motions are combined with photometric relative metallicity and temperature indices, to produce the proper-motion rotation curves of the Galactic bulge separately for metal-poor and metal-rich main-sequence samples. This provides a “pencil-beam” complement to large-scale wide-field surveys, which to date have focused on the more traditional bright giant branch tracers. We find strong evidence that the Galactic bulge rotation curves drawn from “metal-rich” and “metal-poor” samples are indeed discrepant. The “metal-rich” sample shows greater rotation amplitude and a steeper gradient against line-of-sight distance, as well as possibly a stronger central concentration along the line of sight. This may represent a new detection of differing orbital anisotropy between metal-rich and metal-poor bulge objects. We also investigate selection effects that would be implied for the longitudinal proper-motion cut often used to isolate a “pure-bulge” sample. Extensive investigation of synthetic stellar populations suggests that instrumental and observational artifacts are unlikely to account for the observed rotation curve differences. Thus, proper-motion-based rotation curves can be used to probe chemodynamical correlations for main-sequence tracer stars, which are orders of magnitude more numerous in the Galactic bulge than the bright giant branch tracers. We discuss briefly the prospect of using this new tool to constrain detailed models of Galactic formation and evolution. Based on observations made with the NASA/ESA Hubble Space Telescope and obtained from the data archive at the Space Telescope Science Institute. STScI is operated by the Association of Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555.

  3. VizieR Online Data Catalog: Pisa pre-main sequence tracks and isochrones (Tognelli+, 2011)

    Science.gov (United States)

    Tognelli, E.; Prada Moroni, P. G.; Degl'Innocenti, S.

    2011-07-01

    Evolutionary tracks and Isochrones in the log L vs log Te plane, for the following chemical compositions: Z Y Y Y 2.00E-04 0.230 0.249 0.250 1.00E-03 0.232 0.251 0.254 2.00E-03 0.234 0.253 0.259 3.00E-03 0.236 0.254 0.263 4.00E-03 0.238 0.256 0.269 5.00E-03 0.240 0.258 0.273 6.00E-03 0.242 0.260 0.279 7.00E-03 0.244 0.262 0.283 8.00E-03 0.246 0.265 0.289 9.00E-03 0.248 0.267 0.294 1.00E-02 0.250 0.268 0.299 1.25E-02 0.255 0.274 0.311 1.50E-02 0.260 0.278 0.323 1.75E-02 0.265 0.284 0.336 2.00E-02 0.270 0.288 0.349 2.25E-02 0.275 0.294 0.361 2.50E-02 0.280 0.299 0.374 2.75E-02 0.285 0.304 0.386 3.00E-02 0.290 0.308 0.398 Each model is calculated with an initial Deuterium abundance XD=4.0E-05. For Z>=0.008, models with XD=2.0E-05 are available, too. Each model is calculated with three different values of the mixing length parameter alpha = 1.20, 1.68 (solar calibrated), 1.90. There is also a dataset for our Standard Solar Model parameters (Z=0.01377, Y=0.2533, alpha=1.68, XD=2.0E-05). (5 data files).

  4. Extreme value statistics for two-dimensional convective penetration in a pre-main sequence star

    Science.gov (United States)

    Pratt, J.; Baraffe, I.; Goffrey, T.; Constantino, T.; Viallet, M.; Popov, M. V.; Walder, R.; Folini, D.

    2017-08-01

    Context. In the interior of stars, a convectively unstable zone typically borders a zone that is stable to convection. Convective motions can penetrate the boundary between these zones, creating a layer characterized by intermittent convective mixing, and gradual erosion of the density and temperature stratification. Aims: We examine a penetration layer formed between a central radiative zone and a large convection zone in the deep interior of a young low-mass star. Using the Multidimensional Stellar Implicit Code (MUSIC) to simulate two-dimensional compressible stellar convection in a spherical geometry over long times, we produce statistics that characterize the extent and impact of convective penetration in this layer. Methods: We apply extreme value theory to the maximal extent of convective penetration at any time. We compare statistical results from simulations which treat non-local convection, throughout a large portion of the stellar radius, with simulations designed to treat local convection in a small region surrounding the penetration layer. For each of these situations, we compare simulations of different resolution, which have different velocity magnitudes. We also compare statistical results between simulations that radiate energy at a constant rate to those that allow energy to radiate from the stellar surface according to the local surface temperature. Results: Based on the frequency and depth of penetrating convective structures, we observe two distinct layers that form between the convection zone and the stable radiative zone. We show that the probability density function of the maximal depth of convective penetration at any time corresponds closely in space with the radial position where internal waves are excited. We find that the maximal penetration depth can be modeled by a Weibull distribution with a small shape parameter. Using these results, and building on established scalings for diffusion enhanced by large-scale convective motions, we propose a new form for the diffusion coefficient that may be used for one-dimensional stellar evolution calculations in the large Péclet number regime. These results should contribute to the 321D link.

  5. YSOVAR: Six Pre-main-sequence Eclipsing Binaries in the Orion Nebula Cluster

    Science.gov (United States)

    2012-06-25

    ISOY J053446.01−044922.1i V1448 Ori 17.43c 15.61c 13.88 13.26 12.95 12.73 12.66 12.91 . . . K5c 0.5424125 ISOY J053605.95−050041.2i 2MASS J05360595...identified 12 EB candidates. Four of them, 2MASS 05352184−0546085 (Stassun et al. 2006), V1174 Ori (Stassun et al. 2004), Par1802 (Cargile et al. 2008...Zero points for the photometry were established by reference to data for non-variable stars in our FOV from the Two Micron All Sky Survey ( 2MASS

  6. Galactic chemical evolution with main-sequence mass loss and the distribution of F and G dwarfs

    International Nuclear Information System (INIS)

    Guzik, J.A.; Struck-Marcell, C.

    1988-01-01

    Simple closed galactic chemical-evolution models incorporating early main-sequence stellar mass loss have been developed for disk ages of 5, 10, and 15 Gyr. Relative to models without stellar mass loss, the models are shown to produce a 30-60 percent increase in the present mass ratio of dwarfs to dwarfs plus remnants, and a 200-250 percent increase in the total mass of late F dwarfs remaining on the main sequence at the current disk age. For present disk ages 5 and 10 Gyr, the total mass of mid-F dwarfs remaining on the main sequence is also shown to increase by 90-120 percent. It is concluded that models with main-sequence mass loss have a slightly reduced gas metallicity and slightly increased gas fraction midway through the evolution. 30 references

  7. Spectroscopic and asteroseismic analysis of the remarkable main-sequence A star KIC 11145123

    Science.gov (United States)

    Takada-Hidai, Masahide; Kurtz, Donald W.; Shibahashi, Hiromoto; Murphy, Simon J.; Takata, Masao; Saio, Hideyuki; Sekii, Takashi

    2017-10-01

    A spectroscopic analysis was carried out to clarify the properties of KIC 11145123 - the first main-sequence star with a directly measured core-to-surface rotation profile - based on spectra observed with the High Dispersion Spectrograph (HDS) of the Subaru telescope. The atmospheric parameters (Teff = 7600 K, log g = 4.2, ξ = 3.1 km s-1 and [Fe/H] = -0.71 dex), the radial and rotation velocities, and elemental abundances were obtained by analysing line strengths and fitting line profiles, which were calculated with a 1D LTE model atmosphere. The main properties of KIC 11145123 are: (1) a low [Fe/H] = -0.71 ± 0.11 dex and a high radial velocity of -135.4 ± 0.2 km s-1. These are remarkable among late-A stars. Our best asteroseismic models with this low [Fe/H] have slightly high helium abundance and low masses of 1.4 M⊙. All of these results strongly suggest that KIC 11145123 is a Population II blue straggler; (2) the projected rotation velocity confirms the asteroseismically predicted slow rotation of the star; (3) comparisons of abundance patterns between KIC 11145123 and Am, Ap, and blue stragglers show that KIC 11145123 is neither an Am star nor an Ap star, but has abundances consistent with a blue straggler. We conclude that the remarkably long 100-d rotation period of this star is a consequence of it being a blue straggler, but both pathways for the formation of blue stragglers - merger and mass loss in a binary system - pose difficulties for our understanding of the exceedingly slow rotation. In particular, we show that there is no evidence of any secondary companion star, and we put stringent limits on the possible mass of any such purported companion through the phase modulation technique.

  8. WHITE-DWARF-MAIN-SEQUENCE BINARIES IDENTIFIED FROM THE LAMOST PILOT SURVEY

    International Nuclear Information System (INIS)

    Ren Juanjuan; Luo Ali; Li Yinbi; Wei Peng; Zhao Jingkun; Zhao Yongheng; Song Yihan; Zhao Gang

    2013-01-01

    We present a set of white-dwarf-main-sequence (WDMS) binaries identified spectroscopically from the Large sky Area Multi-Object fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) pilot survey. We develop a color selection criteria based on what is so far the largest and most complete Sloan Digital Sky Survey (SDSS) DR7 WDMS binary catalog and identify 28 WDMS binaries within the LAMOST pilot survey. The primaries in our binary sample are mostly DA white dwarfs except for one DB white dwarf. We derive the stellar atmospheric parameters, masses, and radii for the two components of 10 of our binaries. We also provide cooling ages for the white dwarf primaries as well as the spectral types for the companion stars of these 10 WDMS binaries. These binaries tend to contain hot white dwarfs and early-type companions. Through cross-identification, we note that nine binaries in our sample have been published in the SDSS DR7 WDMS binary catalog. Nineteen spectroscopic WDMS binaries identified by the LAMOST pilot survey are new. Using the 3σ radial velocity variation as a criterion, we find two post-common-envelope binary candidates from our WDMS binary sample

  9. Verifying reddening and extinction for Gaia DR1 TGAS main sequence stars

    Science.gov (United States)

    Gontcharov, George A.; Mosenkov, Aleksandr V.

    2017-12-01

    We compare eight sources of reddening and extinction estimates for approximately 60 000 Gaia DR1 Tycho-Gaia Astrometric Solution (TGAS) main sequence stars younger than 3 Gyr with a relative error of the Gaia parallax less than 0.1. For the majority of the stars, the best 2D dust emission-based reddening maps show considerable differences between the reddening to infinity and the one calculated to the stellar distance using the barometric law of the dust distribution. This proves that the majority of the TGAS stars are embedded in the Galactic dust layer and a proper 3D treatment of the reddening/extinction is required to calculate their dereddened colours and absolute magnitudes reliably. Sources with 3D estimates of reddening are tested in their ability to put the stars among the PARSEC and MIST theoretical isochrones in the Hertzsprung-Russell diagram based on the precise Gaia, Tycho-2, 2MASS and WISE photometry. Only the reddening/extinction estimates by Arenou et al. and Gontcharov, being appropriate for nearby stars within 280 pc, provide both the minimal number of outliers bluer than any reasonable isochrone and the correct number of stars younger than 3 Gyr in agreement with the Besançon Galaxy model.

  10. MAGNETIC ACTIVITY ANALYSIS FOR A SAMPLE OF G-TYPE MAIN SEQUENCE KEPLER TARGETS

    Energy Technology Data Exchange (ETDEWEB)

    Mehrabi, Ahmad [Department of Physics, Bu Ali Sina University, 65178, 016016, Hamedan (Iran, Islamic Republic of); He, Han [National Astronomical Observatories, Chinese Academy of Sciences, Beijing (China); Khosroshahi, Habib, E-mail: mehrabi@basu.ac.ir [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), 19395-5531, Tehran (Iran, Islamic Republic of)

    2017-01-10

    The variation of a stellar light curve owing to rotational modulation by magnetic features (starspots and faculae) on the star’s surface can be used to investigate the magnetic properties of the host star. In this paper, we use the periodicity and magnitude of the light-curve variation as two proxies to study the stellar magnetic properties for a large sample of G-type main sequence Kepler targets, for which the rotation periods were recently determined. By analyzing the correlation between the two magnetic proxies, it is found that: (1) the two proxies are positively correlated for most of the stars in our sample, and the percentages of negative, zero, and positive correlations are 4.27%, 6.81%, and 88.91%, respectively; (2) negative correlation stars cannot have a large magnitude of light-curve variation; and (3) with the increase of rotation period, the relative number of positive correlation stars decreases and the negative correlation one increases. These results indicate that stars with shorter rotation period tend to have positive correlation between the two proxies, and a good portion of the positive correlation stars have a larger magnitude of light-curve variation (and hence more intense magnetic activities) than negative correlation stars.

  11. Main sequence of the metal-poor globular cluster M30 (NGC 7099)

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1980-01-01

    We present photographic photometry for 673 stars in the metal-poor globular cluster M30 (NGC 7099). The Racine wedge was used with the CTIO 1-m Yale telescope (Δm=3/sup m/.60), the CTIO 4-m telescope (Δm=6/sup m/.83), and the ESO 3.6-m telescope (Δm=4/sup m/.12) to extend the photoelectric limit from Vapprox. =16.3 to Vapprox. =20.4. For the main-sequence turn-off, we have determined its position to lie at V=18.4 +- 0.1 (m.e.) and B-V=0.49 +- 0.03 (m.e.). From these values, we calculate the intrinsic values M/sub v/ =3.87 and (B-V) 0 =0.47. For the cluster as a whole, we derive a distance modulus (m-M)/sub V/=14.53 +- 0.15 and reddening E(B-V)=0.02 +- 0.02. Using the models of Iben and Rood [Astrophys. J. 159, 605 (1970)] and the isochrones of Demarque and McClure [(1977), in Evolution of Galaxies and Stellar Populations, edited by B. Tinsley and R. B. Larson (Yale University Observatory, New Haven), p. 199], we deduce the cluster's age to be 14.5( +- 4.0) x 10 9 yr. The large uncertainty in this value emphasizes the dire need for more work on cluster evolution

  12. Phylogenetic reconstruction of Bantu kinship challenges Main Sequence Theory of human social evolution.

    Science.gov (United States)

    Opie, Christopher; Shultz, Susanne; Atkinson, Quentin D; Currie, Thomas; Mace, Ruth

    2014-12-09

    Kinship provides the fundamental structure of human society: descent determines the inheritance pattern between generations, whereas residence rules govern the location a couple moves to after they marry. In turn, descent and residence patterns determine other key relationships such as alliance, trade, and marriage partners. Hunter-gatherer kinship patterns are viewed as flexible, whereas agricultural societies are thought to have developed much more stable kinship patterns as they expanded during the Holocene. Among the Bantu farmers of sub-Saharan Africa, the ancestral kinship patterns present at the beginning of the expansion are hotly contested, with some arguing for matrilineal and matrilocal patterns, whereas others maintain that any kind of lineality or sex-biased dispersal only emerged much later. Here, we use Bayesian phylogenetic methods to uncover the history of Bantu kinship patterns and trace the interplay between descent and residence systems. The results suggest a number of switches in both descent and residence patterns as Bantu farming spread, but that the first Bantu populations were patrilocal with patrilineal descent. Across the phylogeny, a change in descent triggered a switch away from patrifocal kinship, whereas a change in residence triggered a switch back from matrifocal kinship. These results challenge "Main Sequence Theory," which maintains that changes in residence rules precede change in other social structures. We also indicate the trajectory of kinship change, shedding new light on how this fundamental structure of society developed as farming spread across the globe during the Neolithic.

  13. THE ORIGIN OF HVS17, AN UNBOUND MAIN SEQUENCE B STAR AT 50 kpc

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Warren R.; Geller, Margaret J.; Kenyon, Scott J. [Smithsonian Astrophysical Observatory, 60 Garden Street, Cambridge, MA 02138 (United States); Cohen, Judith G., E-mail: wbrown@cfa.harvard.edu, E-mail: mgeller@cfa.harvard.edu, E-mail: skenyon@cfa.harvard.edu, E-mail: jlc@astro.caltech.edu [Palomar Observatory, Mail Stop 249-17, California Institute of Technology, Pasadena, CA 91125 (United States)

    2013-09-20

    We analyze Keck Echellette Spectrograph and Imager spectroscopy of HVS17, a B-type star traveling with a Galactic rest frame radial velocity of +445 km s{sup –1} in the outer halo of the Milky Way. HVS17 has the projected rotation of a main sequence B star and is chemically peculiar, with solar iron abundance and sub-solar alpha abundance. Comparing measured T{sub eff} and log g with stellar evolution tracks implies that HVS17 is a 3.91 ± 0.09 M{sub ☉}, 153 ± 9 Myr old star at a Galactocentric distance of r = 48.5 ± 4.6 kpc. The time between its formation and ejection significantly exceeds 10 Myr and thus is difficult to reconcile with any Galactic disk runaway scenario involving massive stars. The observations are consistent, on the other hand, with a hypervelocity star ejection from the Galactic center. We show that Gaia proper motion measurements will easily discriminate between a disk and Galactic center origin, thus allowing us to use HVS17 as a test particle to probe the shape of the Milky Way's dark matter halo.

  14. THE ORIGIN OF HVS17, AN UNBOUND MAIN SEQUENCE B STAR AT 50 kpc

    International Nuclear Information System (INIS)

    Brown, Warren R.; Geller, Margaret J.; Kenyon, Scott J.; Cohen, Judith G.

    2013-01-01

    We analyze Keck Echellette Spectrograph and Imager spectroscopy of HVS17, a B-type star traveling with a Galactic rest frame radial velocity of +445 km s –1 in the outer halo of the Milky Way. HVS17 has the projected rotation of a main sequence B star and is chemically peculiar, with solar iron abundance and sub-solar alpha abundance. Comparing measured T eff and log g with stellar evolution tracks implies that HVS17 is a 3.91 ± 0.09 M ☉ , 153 ± 9 Myr old star at a Galactocentric distance of r = 48.5 ± 4.6 kpc. The time between its formation and ejection significantly exceeds 10 Myr and thus is difficult to reconcile with any Galactic disk runaway scenario involving massive stars. The observations are consistent, on the other hand, with a hypervelocity star ejection from the Galactic center. We show that Gaia proper motion measurements will easily discriminate between a disk and Galactic center origin, thus allowing us to use HVS17 as a test particle to probe the shape of the Milky Way's dark matter halo

  15. THE EVOLVED MAIN-SEQUENCE CHANNEL: HST AND LBT OBSERVATIONS OF CSS 120422:111127+571239

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, M.; Callanan, P. [Department of Physics, University College Cork, Cork (Ireland); Garnavich, P.; Littlefield, C. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Szkody, P. [Department of Astronomy, University of Washington, Seattle, WA (United States); Pogge, R. [Department of Astronomy, The Ohio State University, 140 W. 18th Avenue, Columbus, OH 43202 (United States)

    2015-12-20

    The “evolved main-sequence (EMS)” channel is thought to contribute significantly to the population of AM CVn-type systems in the Galaxy, and also to the number of cataclysmic variables (CVs) detected below the period minimum for hydrogen rich systems. CSS 120422:J111127+571239 was discovered by the Catalina Sky Survey in 2012 April. Its period was found to be 56 minutes, well below the minimum, and the optical spectrum is clearly depleted in hydrogen relative to helium, but still has two orders of magnitude more hydrogen than AM CVn stars. Doppler tomography of the Hα line hinted at a spiral structure existing in the disk. Here we present spectroscopy of CSS 120422:J111127+571239 using the Cosmic Origins Spectrograph FUV instrument on the Hubble Space Telescope and using the MODS spectrograph on the Large Binocular Telescope. The UV spectrum shows Si iv, N v, and He ii, but no detectable C iv. The anomalous nitrogen/carbon ratio is seen in a small number of other CVs and confirms a unique binary evolution. We also present and compare the optical spectrum of V418 Ser and advocate that it is also an EMS system.

  16. Domain general sequence operations contribute to pre-SMA involvement in visuo-spatial processing

    Directory of Open Access Journals (Sweden)

    E. Charles eLeek

    2016-01-01

    Full Text Available This study used 3T MRI to elucidate the functional role of supplementary motor area (SMA in relation to visuo-spatial processing. A localizer task contrasting sequential number subtraction and repetitive button pressing was used to functionally delineate non-motor sequence processing in pre-SMA, and activity in SMA-proper associated with motor sequencing. Patterns of BOLD responses in these regions were then contrasted to those from two tasks of visuo-spatial processing. In one task participants performed mental rotation in which recognition memory judgments were made to previously memorized 2D novel patterns across image-plane rotations. The other task involved abstract grid navigation in which observers computed a series of imagined location shifts in response to directional (arrow cues around a mental grid. The results showed overlapping activation in pre-SMA for sequential subtraction and both visuo-spatial tasks. These results suggest that visuo-spatial processing is supported by non-motor sequence operations that involve pre-SMA. More broadly, these data further highlight the functional heterogeneity of pre-SMA, and show that its role extends to processes beyond the planning and online control of movement.

  17. STELLAR DIAMETERS AND TEMPERATURES. II. MAIN-SEQUENCE K- AND M-STARS

    Energy Technology Data Exchange (ETDEWEB)

    Boyajian, Tabetha S.; McAlister, Harold A.; Jones, Jeremy; White, Russel; Henry, Todd; Gies, Douglas; Jao, Wei-Chun; Parks, J. Robert [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 4106, Atlanta, GA 30302-4106 (United States); Von Braun, Kaspar; Kane, Stephen R.; Ciardi, David [NASA Exoplanet Science Institute, California Institute of Technology, MC 100-22, Pasadena, CA 91125 (United States); Van Belle, Gerard [Lowell Observatory, Flagstaff, AZ 86001 (United States); Ten Brummelaar, Theo A.; Schaefer, Gail; Sturmann, Laszlo; Sturmann, Judit [The CHARA Array, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Muirhead, Philip S. [Department of Astronomy, California Institute of Technology, 1200 East California Boulevard, MC 249-17, Pasadena, CA 91125 (United States); Lopez-Morales, Mercedes [Institut de Ciencies de L' Espai (CSIC-IEEC), E-08193 Bellaterra (Spain); Ridgway, Stephen [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726-6732 (United States); Rojas-Ayala, Barbara [Department of Astrophysics, Division of Physical Sciences, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); and others

    2012-10-01

    We present interferometric angular diameter measurements of 21 low-mass, K- and M-dwarfs made with the CHARA Array. This sample is enhanced by adding a collection of radius measurements published in the literature to form a total data set of 33 K-M-dwarfs with diameters measured to better than 5%. We use these data in combination with the Hipparcos parallax and new measurements of the star's bolometric flux to compute absolute luminosities, linear radii, and effective temperatures for the stars. We develop empirical relations for {approx}K0 to M4 main-sequence stars that link the stellar temperature, radius, and luminosity to the observed (B - V), (V - R), (V - I), (V - J), (V - H), and (V - K) broadband color index and stellar metallicity [Fe/H]. These relations are valid for metallicities ranging from [Fe/H] = -0.5 to +0.1 dex and are accurate to {approx}2%, {approx}5%, and {approx}4% for temperature, radius, and luminosity, respectively. Our results show that it is necessary to use metallicity-dependent transformations in order to properly convert colors into stellar temperatures, radii, and luminosities. Alternatively, we find no sensitivity to metallicity on relations we construct to the global properties of a star omitting color information, e.g., temperature-radius and temperature-luminosity. Thus, we are able to empirically quantify to what order the star's observed color index is impacted by the stellar iron abundance. In addition to the empirical relations, we also provide a representative look-up table via stellar spectral classifications using this collection of data. Robust examinations of single star temperatures and radii compared to evolutionary model predictions on the luminosity-temperature and luminosity-radius planes reveal that models overestimate the temperatures of stars with surface temperatures <5000 K by {approx}3%, and underestimate the radii of stars with radii <0.7 R{sub Sun} by {approx}5%. These conclusions additionally

  18. White dwarf-main sequence binaries from LAMOST: the DR5 catalogue

    Science.gov (United States)

    Ren, J.-J.; Rebassa-Mansergas, A.; Parsons, S. G.; Liu, X.-W.; Luo, A.-L.; Kong, X.; Zhang, H.-T.

    2018-03-01

    We present the data release (DR) 5 catalogue of white dwarf-main sequence (WDMS) binaries from the Large Area Multi-Object fiber Spectroscopic Telescope (LAMOST). The catalogue contains 876 WDMS binaries, of which 757 are additions to our previous LAMOST DR1 sample and 357 are systems that have not been published before. We also describe a LAMOST-dedicated survey that aims at obtaining spectra of photometrically-selected WDMS binaries from the Sloan Digital Sky Survey (SDSS) that are expected to contain cool white dwarfs and/or early type M dwarf companions. This is a population under-represented in previous SDSS WDMS binary catalogues. We determine the stellar parameters (white dwarf effective temperatures, surface gravities and masses, and M dwarf spectral types) of the LAMOST DR5 WDMS binaries and make use of the parameter distributions to analyse the properties of the sample. We find that, despite our efforts, systems containing cool white dwarfs remain under-represented. Moreover, we make use of LAMOST DR5 and SDSS DR14 (when available) spectra to measure the Na I λλ 8183.27, 8194.81 absorption doublet and/or Hα emission radial velocities of our systems. This allows identifying 128 binaries displaying significant radial velocity variations, 76 of which are new. Finally, we cross-match our catalogue with the Catalina Surveys and identify 57 systems displaying light curve variations. These include 16 eclipsing systems, two of which are new, and nine binaries that are new eclipsing candidates. We calculate periodograms from the photometric data and measure (estimate) the orbital periods of 30 (15) WDMS binaries.

  19. Variations of the ISM conditions accross the Main Sequence of star forming galaxies: observations and simulations.

    Science.gov (United States)

    Martinez Galarza, Juan R.; Smith, Howard Alan; Lanz, Lauranne; Hayward, Christopher C.; Zezas, Andreas; Hung, Chao-Ling; Rosenthal, Lee; Weiner, Aaron

    2015-01-01

    A significant amount of evidence has been gathered that leads to the existence of a main sequence (MS) of star formation in galaxies. This MS is expressed in terms of a correlation between the SFR and the stellar mass of the form SFR ∝ M* and spans a few orders of magnitude in both quantities. Several ideas have been suggested to explain fundamental properties of the MS, such as its slope, its dispersion, and its evolution with redshift, but no consensus has been reached regarding its true nature, and whether the membership or not of particular galaxies to this MS underlies the existence of two different modes of star formation. In order to advance in the understanding of the MS, here we use a statistically robust Bayesian SED analysis method (CHIBURST) to consistently analyze the star-forming properties of a set of hydro-dynamical simulations of mergers, as well as observations of real mergers, both local and at intermediate redshift. We find a remarkable, very tight correlation between the specific star formation rate (sSFR) of galaxies, and the typical ISM conditions near their inernal star-forming regions, parametrized via a novel quantity: the compactness parameter (C). The evolution of mergers along this correlation explains the spread of the MS, and implies that the physical conditions of the ISM smoothly evolve between on-MS (secular) conditions and off-MS (coalescence/starburst) conditions. Furthermore, we show that the slope of the correlation can be interpreted in terms of the efficiency in the conversion of gas into stars, and that this efficiency remains unchanged along and across the MS. Finally, we discuss differences in the normalization of the correlation as a function of merger mass and redshift, and conclude that these differences imply the existence of two different modes of star formation, unrelated to the smooth evolution across the MS: a disk-like, low pressure mode and a compact nuclear-starburst mode.

  20. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: DEPENDENCE ON PLANETARY MASS

    International Nuclear Information System (INIS)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kasting, James F.; SchottelKotte, James; Domagal-Goldman, Shawn; Eymet, Vincent

    2014-01-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1 M ⊕ and 5 M ⊕ . Assuming H 2 O-(inner HZ) and CO 2 -(outer HZ) dominated atmospheres, and scaling the background N 2 atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (∼10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H 2 O column depth. For larger planets, the H 2 O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing longwave radiation. Hence the inner edge moves inward (∼7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs

  1. Lithium abundances for 185 main-sequence stars: Galactic evolution and stellar depletion of lithium

    Science.gov (United States)

    Chen, Y. Q.; Nissen, P. E.; Benoni, T.; Zhao, G.

    2001-06-01

    We present a survey of lithium abundances in 185 main-sequence field stars with 5600 interesting result from this study is the presence of a large gap in the log varepsilon (Li) - Teff plane, which distinguishes ``Li-dip'' stars like those first identified in the Hyades cluster by Boesgaard & Tripicco (\\cite{Boesgaard86}) from other stars with a much higher Li abundance. The Li-dip stars concentrate on a certain mass, which decreases with metallicity from about 1.4 Msun at solar metallicity to 1.1 Msun at [Fe/H] =~ -1.0. Excluding the Li-dip stars and a small group of lower mass stars with Teff rate of angular momentum loss. It cannot be excluded, however, that a cosmic scatter of the Li abundance in the Galaxy at a given metallicity contributes to the dispersion in Li abundance. These problems make it difficult to determine the Galactic evolution of Li from the data, but a comparison of the upper envelope of the distribution of stars in the log varepsilon (Li) - [Fe/H] plane with recent Galactic evolutionary models by Romano et al. (\\cite{Romano99}) suggests that novae are a major source for the Li production in the Galactic disk; their occurrence seems to be the explanation for the steep increase of Li abundance at [Fe/H] =~ -0.4. Based on observations carried out at Beijing Astronomical Observatory (Xinglong, PR China) and European Southern Observatory, La Silla, Chile. Table 1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/371/943 and at http://www.edpsciences.org

  2. The Star Formation Main Sequence in the Hubble Space Telescope Frontier Fields

    Science.gov (United States)

    Santini, Paola; Fontana, Adriano; Castellano, Marco; Di Criscienzo, Marcella; Merlin, Emiliano; Amorin, Ricardo; Cullen, Fergus; Daddi, Emanuele; Dickinson, Mark; Dunlop, James S.; Grazian, Andrea; Lamastra, Alessandra; McLure, Ross J.; Michałowski, Michał. J.; Pentericci, Laura; Shu, Xinwen

    2017-09-01

    We investigate the relation between star formation rate (SFR) and stellar mass (M), I.e., the main sequence (MS) relation of star-forming galaxies, at 1.3≤slant zFrontier Fields, on the basis of rest-frame UV observations. Gravitational lensing combined with deep HST observations allows us to extend the analysis of the MS down to {log} M/{M}⊙ ˜ 7.5 at z≲ 4 and {log} M/{M}⊙ ˜ 8 at higher redshifts, a factor of ˜10 below most previous results. We perform an accurate simulation to take into account the effect of observational uncertainties and correct for the Eddington bias. This step allows us to reliably measure the MS and in particular its slope. While the normalization increases with redshift, we fit an unevolving and approximately linear slope. We nicely extend to lower masses the results of brighter surveys. Thanks to the large dynamic range in mass and by making use of the simulation, we analyzed any possible mass dependence of the dispersion around the MS. We find tentative evidence that the scatter decreases with increasing mass, suggesting a larger variety of star formation histories in low-mass galaxies. This trend agrees with theoretical predictions and is explained as either a consequence of the smaller number of progenitors of low-mass galaxies in a hierarchical scenario and/or of the efficient but intermittent stellar feedback processes in low-mass halos. Finally, we observe an increase in the SFR per unit stellar mass with redshift milder than predicted by theoretical models, implying a still incomplete understanding of the processes responsible for galaxy growth.

  3. Habitable Zones Around Main-Sequence Stars: Dependence on Planetary Mass

    Science.gov (United States)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kotte, James Schottel; Kasting, James F.; Domagal-Goldman, Shawn; Eymet, Vincent

    2014-01-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1M and 5M. Assuming H2O-(inner HZ) and CO2-(outer HZ) dominated atmospheres, and scaling the background N2 atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (approx.10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H2O column depth. For larger planets, the H2O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing long-wave radiation. Hence the inner edge moves inward (approx.7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs.

  4. On the Use of the Main-sequence Knee (Saddle) to Measure Globular Cluster Ages

    Science.gov (United States)

    Saracino, S.; Dalessandro, E.; Ferraro, F. R.; Lanzoni, B.; Origlia, L.; Salaris, M.; Pietrinferni, A.; Geisler, D.; Kalirai, J. S.; Correnti, M.; Cohen, R. E.; Mauro, F.; Villanova, S.; Moni Bidin, C.

    2018-06-01

    In this paper, we review the operational definition of the so-called main-sequence knee (MS-knee), a feature in the color-magnitude diagram (CMD) occurring at the low-mass end of the MS. The magnitude of this feature is predicted to be independent of age at fixed chemical composition. For this reason, its difference in magnitude with respect to the MS turn-off (MS-TO) point has been suggested as a possible diagnostic to estimate absolute globular cluster (GC) ages. We first demonstrate that the operational definition of the MS-knee currently adopted in the literature refers to the inflection point of the MS (which we here more appropriately named MS-saddle), a feature that is well distinct from the knee and which cannot be used as its proxy. The MS-knee is only visible in near-infrared CMDs, while the MS-saddle can be also detected in optical–NIR CMDs. By using different sets of isochrones, we then demonstrate that the absolute magnitude of the MS-knee varies by a few tenths of a dex from one model to another, thus showing that at the moment stellar models may not capture the full systematic error in the method. We also demonstrate that while the absolute magnitude of the MS-saddle is almost coincident in different models, it has a systematic dependence on the adopted color combinations which is not predicted by stellar models. Hence, it cannot be used as a reliable reference for absolute age determination. Moreover, when statistical and systematic uncertainties are properly taken into account, the difference in magnitude between the MS-TO and the MS-saddle does not provide absolute ages with better accuracy than other methods like the MS-fitting.

  5. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: DEPENDENCE ON PLANETARY MASS

    Energy Technology Data Exchange (ETDEWEB)

    Kopparapu, Ravi Kumar; Ramirez, Ramses M.; Kasting, James F. [Department of Geosciences, Penn State University, 443 Deike Building, University Park, PA 16802 (United States); SchottelKotte, James [Department of Astronomy and Astrophysics, The Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Domagal-Goldman, Shawn [NASA Astrobiology Institute' s Virtual Planetary Laboratory, P.O. Box 351580, Seattle, WA 98195 (United States); Eymet, Vincent, E-mail: ruk15@psu.edu [Laboratoire d' Astrophysique de Bordeaux, Universite de Bordeaux 1, UMR 5804, F-33270 Floirac (France)

    2014-06-01

    The ongoing discoveries of extra-solar planets are unveiling a wide range of terrestrial mass (size) planets around their host stars. In this Letter, we present estimates of habitable zones (HZs) around stars with stellar effective temperatures in the range 2600 K-7200 K, for planetary masses between 0.1 M {sub ⊕} and 5 M {sub ⊕}. Assuming H{sub 2}O-(inner HZ) and CO{sub 2}-(outer HZ) dominated atmospheres, and scaling the background N{sub 2} atmospheric pressure with the radius of the planet, our results indicate that larger planets have wider HZs than do smaller ones. Specifically, with the assumption that smaller planets will have less dense atmospheres, the inner edge of the HZ (runaway greenhouse limit) moves outward (∼10% lower than Earth flux) for low mass planets due to larger greenhouse effect arising from the increased H{sub 2}O column depth. For larger planets, the H{sub 2}O column depth is smaller, and higher temperatures are needed before water vapor completely dominates the outgoing longwave radiation. Hence the inner edge moves inward (∼7% higher than Earth's flux). The outer HZ changes little due to the competing effects of the greenhouse effect and an increase in albedo. New, three-dimensional climate model results from other groups are also summarized, and we argue that further, independent studies are needed to verify their predictions. Combined with our previous work, the results presented here provide refined estimates of HZs around main-sequence stars and provide a step toward a more comprehensive analysis of HZs.

  6. Evolution models of helium white dwarf--main-sequence star merger remnants: the mass distribution of single low-mass white dwarfs

    OpenAIRE

    Zhang, Xianfei; Hall, Philip D.; Jeffery, C. Simon; Bi, Shaolan

    2017-01-01

    It is not known how single white dwarfs with masses less than 0.5Msolar -- low-mass white dwarfs -- are formed. One way in which such a white dwarf might be formed is after the merger of a helium-core white dwarf with a main-sequence star that produces a red giant branch star and fails to ignite helium. We use a stellar-evolution code to compute models of the remnants of these mergers and find a relation between the pre-merger masses and the final white dwarf mass. Combining our results with ...

  7. Matrix based method for synthesis of main intensified and integrated distillation sequences

    International Nuclear Information System (INIS)

    Khalili-Garakani, Amirhossein; Kasiri, Norollah; Ivakpour, Javad

    2016-01-01

    The objective of many studies in this area has involved access to a column-sequencing algorithm enabling designers and researchers alike to generate a wide range of sequences in a broad search space, and be as mathematically and as automated as possible for programing purposes and with good generality. In the present work an algorithm previously developed by the authors, called the matrix method, has been developed much further. The new version of the algorithm includes thermally coupled, thermodynamically equivalent, intensified, simultaneous heat and mass integrated and divided-wall column sequences which are of gross application and provide vast saving potential both on capital investment, operating costs and energy usage in industrial applications. To demonstrate the much wider searchable space now accessible, a three component separation has been thoroughly examined as a case study, always resulting in an integrated sequence being proposed as the optimum.

  8. Evolution models of helium white dwarf-main-sequence star merger remnants: the mass distribution of single low-mass white dwarfs

    Science.gov (United States)

    Zhang, Xianfei; Hall, Philip D.; Jeffery, C. Simon; Bi, Shaolan

    2018-02-01

    It is not known how single white dwarfs with masses less than 0.5Msolar -- low-mass white dwarfs -- are formed. One way in which such a white dwarf might be formed is after the merger of a helium-core white dwarf with a main-sequence star that produces a red giant branch star and fails to ignite helium. We use a stellar-evolution code to compute models of the remnants of these mergers and find a relation between the pre-merger masses and the final white dwarf mass. Combining our results with a model population, we predict that the mass distribution of single low-mass white dwarfs formed through this channel spans the range 0.37 to 0.5Msolar and peaks between 0.45 and 0.46Msolar. Helium white dwarf--main-sequence star mergers can also lead to the formation of single helium white dwarfs with masses up to 0.51Msolar. In our model the Galactic formation rate of single low-mass white dwarfs through this channel is about 8.7X10^-3yr^-1. Comparing our models with observations, we find that the majority of single low-mass white dwarfs (<0.5Msolar) are formed from helium white dwarf--main-sequence star mergers, at a rate which is about $2$ per cent of the total white dwarf formation rate.

  9. Transit detections of extrasolar planets around main-sequence stars. I. Sky maps for hot Jupiters

    Science.gov (United States)

    Heller, R.; Mislis, D.; Antoniadis, J.

    2009-12-01

    Context: The findings of more than 350 extrasolar planets, most of them nontransiting Hot Jupiters, have revealed correlations between the metallicity of the main-sequence (MS) host stars and planetary incidence. This connection can be used to calculate the planet formation probability around other stars, not yet known to have planetary companions. Numerous wide-field surveys have recently been initiated, aiming at the transit detection of extrasolar planets in front of their host stars. Depending on instrumental properties and the planetary distribution probability, the promising transit locations on the celestial plane will differ among these surveys. Aims: We want to locate the promising spots for transit surveys on the celestial plane and strive for absolute values of the expected number of transits in general. Our study will also clarify the impact of instrumental properties such as pixel size, field of view (FOV), and magnitude range on the detection probability. Methods: We used data of the Tycho catalog for ≈1 million objects to locate all the stars with 0^m~≲~m_V~≲~11.5m on the celestial plane. We took several empirical relations between the parameters listed in the Tycho catalog, such as distance to Earth, m_V, and (B-V), and those parameters needed to account for the probability of a star to host an observable, transiting exoplanet. The empirical relations between stellar metallicity and planet occurrence combined with geometrical considerations were used to yield transit probabilities for the MS stars in the Tycho catalog. Magnitude variations in the FOV were simulated to test whether this fluctuations would be detected by BEST, XO, SuperWASP and HATNet. Results: We present a sky map of the expected number of Hot Jupiter transit events on the basis of the Tycho catalog. Conditioned by the accumulation of stars towards the galactic plane, the zone of the highest number of transits follows the same trace, interrupted by spots of very low and high

  10. The SFR-M∗ main sequence archetypal star-formation history and analytical models

    Science.gov (United States)

    Ciesla, L.; Elbaz, D.; Fensch, J.

    2017-12-01

    The star-formation history (SFH) of galaxies is a key assumption to derive their physical properties and can lead to strong biases. In this work, we derive the SFH of main sequence (MS) galaxies and show how the peak SFH of a galaxy depends on its seed mass at, for example, z = 5. This seed mass reflects the galaxy's underlying dark matter (DM) halo environment. We show that, following the MS, galaxies undergo a drastic slow down of their stellar mass growth after reaching the peak of their SFH. According to abundance matching, these masses correspond to hot and massive DM halos which state could result in less efficient gas inflows on the galaxies and thus could be the origin of limited stellar mass growth. As a result, we show that galaxies, still on the MS, can enter the passive region of the UVJ diagram while still forming stars. The best fit to the MS SFH is provided by a right skew peak function for which we provide parameters depending on the seed mass of the galaxy. The ability of the classical analytical SFHs to retrieve the star-formation rate (SFR) of galaxies from spectral energy distribution (SED) fitting is studied. Due to mathematical limitations, the exponentially declining and delayed SFH struggle to model high SFR, which starts to be problematic at z > 2. The exponentially rising and log-normal SFHs exhibit the opposite behavior with the ability to reach very high SFR, and thus model starburst galaxies, but they are not able to model low values such as those expected at low redshift for massive galaxies. By simulating galaxies SED from the MS SFH, we show that these four analytical forms recover the SFR of MS galaxies with an error dependent on the model and the redshift. They are, however, sensitive enough to probe small variations of SFR within the MS, with an error ranging from 5 to 40% depending on the SFH assumption and redshift; but all the four fail to recover the SFR of rapidly quenched galaxies. However, these SFHs lead to an artificial

  11. Luminosity and Intrinsic Color Calibration of Main-Sequence Stars With 2Mass Photometry: All Sky Local Extinction

    Directory of Open Access Journals (Sweden)

    Knude Jens

    2003-12-01

    Full Text Available We present a new color index vs. absolute magnitude calibration of 2MASS JHK photometry. For the A0 to ~G5 and M segments of the main sequence information on the amount of interstellar extinction and its location in space may be obtained.

  12. Development of an Eccentric CAM Based Active Pre-Alignment System for the CLIC Main Beam Quadrupole Magnet

    CERN Document Server

    Lackner, F; Collette, C; Mainaud Durand, H; Hauviller, C; Kemppinen, J; Leuxe, R

    2010-01-01

    CLIC (Compact Linear Collider) is a study for a future electron-positron collider that would allow physicists to explore a new energy region beyond the capabilities of today's particle accelerators. The demanding transverse and vertical beam sizes and emittance specifications are resulting in stringent alignment and a nanometre stability requirement. In the current feasibility study, the main beam quadrupole magnets have to be actively pre-aligned with a precision of 1 µm in 5 degrees of freedom (d.o.f.) before being mechanically stabilized to the nm scale above 1 Hz. This contribution describes the approach of performing this active pre-alignment based on an eccentric cam system. In order to limit the amplification of the vibration sources at resonant frequencies a sufficiently high Eigenfrequency is required. Therefore the contact region between cam and support was optimized for adequate stiffness based on the Hertzian theory. Furthermore, practical tests performed on a single degree of freedom mock-up wil...

  13. Influence of pre-harvest red light irradiation on main phytochemicals and antioxidant activity of Chinese kale sprouts.

    Science.gov (United States)

    Deng, Mingdan; Qian, Hongmei; Chen, Lili; Sun, Bo; Chang, Jiaqi; Miao, Huiying; Cai, Congxi; Wang, Qiaomei

    2017-05-01

    The effects of pre-harvest red light irradiation on main healthy phytochemicals as well as antioxidant activity of Chinese kale sprouts during postharvest storage were investigated. 6-day-old sprouts were treated by red light for 24h before harvest and sampled for further analysis of nutritional quality on the first, second and third day after harvest. The results indicated that red light exposure notably postponed the degradation of aliphatic, indole, and total glucosinolates during postharvest storage. The vitamin C level was remarkably higher in red light treated sprouts on the first and second day after harvest when compared with the control. In addition, red light treatment also enhanced the accumulation of total phenolics and maintained higher level of antioxidant activity than the control. All above results suggested that pre-harvest red light treatment might provide a new strategy to maintain the nutritive value of Chinese kale sprouts during postharvest storage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Pre-feasibility study for final disposal of radioactive waste. Disposal concepts. Main report

    International Nuclear Information System (INIS)

    Andersen, L.; Skov, C.; Kueter, A.; Schepper, L.; Gottberg Roemer, H.; Refsgaard, A.; Utko, M.; Kristiansen, Torben

    2011-05-01

    contains the recommendations that are the result of the preliminary design and the preliminary safety assessment. These are divided into three subparts: General recommendations with respect to site selection etc., recommendations that are a result of the preliminary safety assessment (other than the suggestions for waste conditioning described in part II), and recommendations for the process forward including supplementary investigations. The main report is supplemented by a number of annexes containing details about specific issues, data basis and more detailed results and outcomes of the prefeasibility study. (LN)

  15. Pre-feasibility study for final disposal of radioactive waste. Disposal concepts. Main report

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, L.; Skov, C.; Kueter, A.; Schepper, L.; Gottberg Roemer, H.; Refsgaard, A.; Utko, M.; Kristiansen, Torben (COWI A/S, Kgs. Lyngby (Denmark))

    2011-05-15

    report contains the recommendations that are the result of the preliminary design and the preliminary safety assessment. These are divided into three subparts: General recommendations with respect to site selection etc., recommendations that are a result of the preliminary safety assessment (other than the suggestions for waste conditioning described in part II), and recommendations for the process forward including supplementary investigations. The main report is supplemented by a number of annexes containing details about specific issues, data basis and more detailed results and outcomes of the prefeasibility study. (LN)

  16. The main challenges that remain in applying high-throughput sequencing to clinical diagnostics.

    Science.gov (United States)

    Loeffelholz, Michael; Fofanov, Yuriy

    2015-01-01

    Over the last 10 years, the quality, price and availability of high-throughput sequencing instruments have improved to the point that this technology may be close to becoming a routine tool in the diagnostic microbiology laboratory. Two groups of challenges, however, have to be resolved in order to move this powerful research technology into routine use in the clinical microbiology laboratory. The computational/bioinformatics challenges include data storage cost and privacy concerns, requiring analysis to be performed without access to cloud storage or expensive computational infrastructure. The logistical challenges include interpretation of complex results and acceptance and understanding of the advantages and limitations of this technology by the medical community. This article focuses on the approaches to address these challenges, such as file formats, algorithms, data collection, reporting and good laboratory practices.

  17. Testing Scaling Relations for Solar-like Oscillations from the Main Sequence to Red Giants Using Kepler Data

    DEFF Research Database (Denmark)

    Huber, D.; Bedding, T.R.; Stello, D.

    2011-01-01

    ), and oscillation amplitudes. We show that the difference of the Δν-νmax relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M) s......We have analyzed solar-like oscillations in ~1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power (νmax), the large frequency separation (Δν...... scaling nor the revised scaling relation by Kjeldsen & Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of ~25%. The residuals show...

  18. On the determination of the He abundance distribution in globular clusters from the width of the main sequence

    Science.gov (United States)

    Cassisi, Santi; Salaris, Maurizio; Pietrinferni, Adriano; Hyder, David

    2017-01-01

    One crucial piece of information to study the origin of multiple stellar populations in globular clusters is the range of initial helium abundances ΔY amongst the sub-populations hosted by each cluster. These estimates are commonly obtained by measuring the width in colour of the unevolved main sequence in an optical colour-magnitude diagram (CMD). The measured colour spread is then compared with predictions from theoretical stellar isochrones with varying initial He abundances to determine ΔY. The availability of UV/optical magnitudes, thanks to the Hubble Space Telescope UV Legacy Survey of Galactic GCs project, will allow the homogeneous determination of ΔY for a large Galactic globular cluster sample. From a theoretical point of view, accurate UV CMDs can efficiently disentangle the various sub-populations, and main sequence colour differences in the ACS F606W - (F606W - F814W) diagram allow an estimate of ΔY. We demonstrate that from a theoretical perspective, the (F606W - F814W) colour is an extremely reliable He-abundance indicator. The derivative dY/d(F606W - F814W), computed at a fixed luminosity along the unevolved main sequence, is largely insensitive to the physical assumptions made in stellar model computations, being more sensitive to the choice of the bolometric correction scale, and is only slightly dependent on the adopted set of stellar models. From a theoretical point of view, the (F606W - F814W) colour width of the cluster main sequence is therefore a robust diagnostic of the ΔY range.

  19. The age-metallicity relation in the solar neighbourhood from a pilot sample of white dwarf-main sequence binaries

    OpenAIRE

    Rebassa-Mansergas, A.; Anguiano, B.; García-Berro, E.; Freeman, K. C.; Cojocaru, R.; Manser, C. J.; Pala, A. F.; Gänsicke, B. T.; Liu, X. -W.

    2016-01-01

    The age–metallicity relation (AMR) is a fundamental observational constraint for understanding how the Galactic disc formed and evolved chemically in time. However, there is not yet an agreement on the observational properties of the AMR for the solar neighbourhood, primarily due to the difficulty in obtaining accurate stellar ages for individual field stars. We have started an observational campaign for providing the much needed observational input by using wide white-dwarf–main-sequence (WD...

  20. Magnetic inhibition of convection and the fundamental properties of low-mass stars. II. Fully convective main-sequence stars

    Energy Technology Data Exchange (ETDEWEB)

    Feiden, Gregory A. [Department of Physics and Astronomy, Uppsala University, Box 516, SE-751 20 Uppsala (Sweden); Chaboyer, Brian, E-mail: gregory.a.feiden@gmail.com, E-mail: brian.chaboyer@dartmouth.edu [Department of Physics and Astronomy, Dartmouth College, 6127 Wilder Laboratory, Hanover, NH 03755 (United States)

    2014-07-01

    We examine the hypothesis that magnetic fields are inflating the radii of fully convective main-sequence stars in detached eclipsing binaries (DEBs). The magnetic Dartmouth stellar evolution code is used to analyze two systems in particular: Kepler-16 and CM Draconis. Magneto-convection is treated assuming stabilization of convection and also by assuming reductions in convective efficiency due to a turbulent dynamo. We find that magnetic stellar models are unable to reproduce the properties of inflated fully convective main-sequence stars, unless strong interior magnetic fields in excess of 10 MG are present. Validation of the magnetic field hypothesis given the current generation of magnetic stellar evolution models therefore depends critically on whether the generation and maintenance of strong interior magnetic fields is physically possible. An examination of this requirement is provided. Additionally, an analysis of previous studies invoking the influence of star spots is presented to assess the suggestion that star spots are inflating stars and biasing light curve analyses toward larger radii. From our analysis, we find that there is not yet sufficient evidence to definitively support the hypothesis that magnetic fields are responsible for the observed inflation among fully convective main-sequence stars in DEBs.

  1. STELLAR AGES AND CONVECTIVE CORES IN FIELD MAIN-SEQUENCE STARS: FIRST ASTEROSEISMIC APPLICATION TO TWO KEPLER TARGETS

    Energy Technology Data Exchange (ETDEWEB)

    Silva Aguirre, V.; Christensen-Dalsgaard, J.; Chaplin, W. J. [Stellar Astrophysics Centre, Department of Physics and Astronomy, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Basu, S.; Deheuvels, S. [Department of Astronomy, Yale University, P.O. Box 208101, New Haven, CT 06520-8101 (United States); Brandao, I. M.; Cunha, M. S.; Sousa, S. G. [Centro de Astrofisica and Faculdade de Ciencias, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Dogan, G. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Metcalfe, T. S. [Space Science Institute, Boulder, CO 80301 (United States); Serenelli, A. M.; Garcia, R. A. [Kavli Institute for Theoretical Physics, Santa Barbara, CA 93106 (United States); Ballot, J. [Institut de Recherche en Astrophysique et Planetologie, CNRS, 14 avenue Edouard Belin, F-31400 Toulouse (France); Weiss, A. [Max Planck Institute for Astrophysics, Karl-Schwarzschild-Str. 1, D-85748 Garching bei Muenchen (Germany); Appourchaux, T. [Institut d' Astrophysique Spatiale, Universite Paris Sud-CNRS (UMR8617) Batiment 121, F-91405 Orsay Cedex (France); Casagrande, L. [Research School of Astronomy and Astrophysics, Mount Stromlo Observatory, The Australian National University, ACT 2611 (Australia); Cassisi, S. [INAF-Astronomical Observatory of Teramo, Via M. Maggini sn, I-64100 Teramo (Italy); Creevey, O. L. [Laboratoire Lagrange, Universite de Nice Sophia-Antipolis, CNRS, I-06300 Nice, France. (France); Lebreton, Y. [Observatoire de Paris, GEPI, CNRS UMR 8111, F-92195 Meudon (France); Noels, A. [Institute of Astrophysics and Geophysics, University of Liege, B-4000 Liege (Belgium); and others

    2013-06-01

    Using asteroseismic data and stellar evolution models we obtain the first detection of a convective core in a Kepler field main-sequence star, putting a stringent constraint on the total size of the mixed zone and showing that extra mixing beyond the formal convective boundary exists. In a slightly less massive target the presence of a convective core cannot be conclusively discarded, and thus its remaining main-sequence lifetime is uncertain. Our results reveal that best-fit models found solely by matching individual frequencies of oscillations corrected for surface effects do not always properly reproduce frequency combinations. Moreover, slightly different criteria to define what the best-fit model is can lead to solutions with similar global properties but very different interior structures. We argue that the use of frequency ratios is a more reliable way to obtain accurate stellar parameters, and show that our analysis in field main-sequence stars can yield an overall precision of 1.5%, 4%, and 10% in radius, mass, and age, respectively. We compare our results with those obtained from global oscillation properties, and discuss the possible sources of uncertainties in asteroseismic stellar modeling where further studies are still needed.

  2. Fast selection of miRNA candidates based on large-scale pre-computed MFE sets of randomized sequences.

    Science.gov (United States)

    Warris, Sven; Boymans, Sander; Muiser, Iwe; Noback, Michiel; Krijnen, Wim; Nap, Jan-Peter

    2014-01-13

    Small RNAs are important regulators of genome function, yet their prediction in genomes is still a major computational challenge. Statistical analyses of pre-miRNA sequences indicated that their 2D structure tends to have a minimal free energy (MFE) significantly lower than MFE values of equivalently randomized sequences with the same nucleotide composition, in contrast to other classes of non-coding RNA. The computation of many MFEs is, however, too intensive to allow for genome-wide screenings. Using a local grid infrastructure, MFE distributions of random sequences were pre-calculated on a large scale. These distributions follow a normal distribution and can be used to determine the MFE distribution for any given sequence composition by interpolation. It allows on-the-fly calculation of the normal distribution for any candidate sequence composition. The speedup achieved makes genome-wide screening with this characteristic of a pre-miRNA sequence practical. Although this particular property alone will not be able to distinguish miRNAs from other sequences sufficiently discriminative, the MFE-based P-value should be added to the parameters of choice to be included in the selection of potential miRNA candidates for experimental verification.

  3. POST-MAIN SEQUENCE EVOLUTION OF ICY MINOR PLANETS: IMPLICATIONS FOR WATER RETENTION AND WHITE DWARF POLLUTION

    Energy Technology Data Exchange (ETDEWEB)

    Malamud, Uri; Perets, Hagai B., E-mail: uri.mal@tx.technion.ac.il, E-mail: hperets@physics.technion.ac.il [Department of Physics, Technion (Israel)

    2016-12-01

    Most observations of polluted white dwarf atmospheres are consistent with accretion of water-depleted planetary material. Among tens of known cases, merely two involve accretion of objects that contain a considerable mass fraction of water. The purpose of this study is to investigate the relative scarcity of these detections. Based on a new and highly detailed model, we evaluate the retention of water inside icy minor planets during the high-luminosity stellar evolution that follows the main sequence. Our model fully considers the thermal, physical, and chemical evolution of icy bodies, following their internal differentiation as well as water depletion, from the moment of their birth and through all stellar evolution phases preceding the formation of the white dwarf. We also account for different initial compositions and formation times. Our results differ from previous studies, which have either underestimated or overestimated water retention. We show that water can survive in a variety of circumstances and in great quantities, and therefore other possibilities are discussed in order to explain the infrequency of water detection. We predict that the sequence of accretion is such that water accretes earlier, and more rapidly, than the rest of the silicate disk, considerably reducing the chance of its detection in H-dominated atmospheres. In He-dominated atmospheres, the scarcity of water detections could be observationally biased. It implies that the accreted material is typically intrinsically dry, which may be the result of the inside-out depopulation sequence of minor planets.

  4. POST-MAIN SEQUENCE EVOLUTION OF ICY MINOR PLANETS: IMPLICATIONS FOR WATER RETENTION AND WHITE DWARF POLLUTION

    International Nuclear Information System (INIS)

    Malamud, Uri; Perets, Hagai B.

    2016-01-01

    Most observations of polluted white dwarf atmospheres are consistent with accretion of water-depleted planetary material. Among tens of known cases, merely two involve accretion of objects that contain a considerable mass fraction of water. The purpose of this study is to investigate the relative scarcity of these detections. Based on a new and highly detailed model, we evaluate the retention of water inside icy minor planets during the high-luminosity stellar evolution that follows the main sequence. Our model fully considers the thermal, physical, and chemical evolution of icy bodies, following their internal differentiation as well as water depletion, from the moment of their birth and through all stellar evolution phases preceding the formation of the white dwarf. We also account for different initial compositions and formation times. Our results differ from previous studies, which have either underestimated or overestimated water retention. We show that water can survive in a variety of circumstances and in great quantities, and therefore other possibilities are discussed in order to explain the infrequency of water detection. We predict that the sequence of accretion is such that water accretes earlier, and more rapidly, than the rest of the silicate disk, considerably reducing the chance of its detection in H-dominated atmospheres. In He-dominated atmospheres, the scarcity of water detections could be observationally biased. It implies that the accreted material is typically intrinsically dry, which may be the result of the inside-out depopulation sequence of minor planets.

  5. AN M DWARF COMPANION TO AN F-TYPE STAR IN A YOUNG MAIN-SEQUENCE BINARY

    Energy Technology Data Exchange (ETDEWEB)

    Eigmüller, Ph.; Csizmadia, Sz.; Erikson, A.; Fridlund, M.; Pasternacki, Th.; Rauer, H. [Institute of Planetary Research, German Aerospace Center Rutherfordstr. 2, D-12489 Berlin (Germany); Eislöffel, J.; Lehmann, H.; Hartmann, M.; Hatzes, A. [Thüringer Landessternwarte Tautenburg Sternwarte 5, D-07778 Tautenburg (Germany); Tkachenko, A. [Instituut voor Sterrenkunde, KU Leuven Celestijnenlaan 200D, 3001 Leuven (Belgium); Voss, H., E-mail: philipp.eigmueller@dlr.de [Universitat de Barcelona, Department of Astronomy and Meteorology Martí i Franquès, 1, E-08028 Barcelona (Spain)

    2016-03-15

    Only a few well characterized very low-mass M dwarfs are known today. Our understanding of M dwarfs is vital as these are the most common stars in our solar neighborhood. We aim to characterize the properties of a rare F+dM stellar system for a better understanding of the low-mass end of the Hertzsprung–Russel diagram. We used photometric light curves and radial velocity follow-up measurements to study the binary. Spectroscopic analysis was used in combination with isochrone fitting to characterize the primary star. The primary star is an early F-type main-sequence star with a mass of (1.493 ± 0.073) M{sub ⊙} and a radius of (1.474 ± 0.040) R{sub ⊙}. The companion is an M dwarf with a mass of (0.188 ± 0.014) M{sub ⊙} and a radius of (0.234 ± 0.009) R{sub ⊙}. The orbital period is (1.35121 ± 0.00001) days. The secondary star is among the lowest-mass M dwarfs known to date. The binary has not reached a 1:1 spin–orbit synchronization. This indicates a young main-sequence binary with an age below ∼250 Myr. The mass–radius relation of both components are in agreement with this finding.

  6. TESTING SCALING RELATIONS FOR SOLAR-LIKE OSCILLATIONS FROM THE MAIN SEQUENCE TO RED GIANTS USING KEPLER DATA

    Energy Technology Data Exchange (ETDEWEB)

    Huber, D.; Bedding, T. R.; Stello, D. [Sydney Institute for Astronomy (SIfA), School of Physics, University of Sydney, NSW 2006 (Australia); Hekker, S. [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, Science Park 904, 1098 XH Amsterdam (Netherlands); Mathur, S. [High Altitude Observatory, NCAR, P.O. Box 3000, Boulder, CO 80307 (United States); Mosser, B. [LESIA, CNRS, Universite Pierre et Marie Curie, Universite Denis, Diderot, Observatoire de Paris, 92195 Meudon cedex (France); Verner, G. A.; Elsworth, Y. P.; Hale, S. J.; Chaplin, W. J. [School of Physics and Astronomy, University of Birmingham, Birmingham B15 2TT (United Kingdom); Bonanno, A. [INAF Osservatorio Astrofisico di Catania (Italy); Buzasi, D. L. [Eureka Scientific, 2452 Delmer Street Suite 100, Oakland, CA 94602-3017 (United States); Campante, T. L. [Centro de Astrofisica da Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal); Kallinger, T. [Department of Physics and Astronomy, University of British Columbia, Vancouver (Canada); Silva Aguirre, V. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Str. 1, 85748 Garching (Germany); De Ridder, J. [Instituut voor Sterrenkunde, K.U.Leuven (Belgium); Garcia, R. A. [Laboratoire AIM, CEA/DSM-CNRS, Universite Paris 7 Diderot, IRFU/SAp, Centre de Saclay, 91191, Gif-sur-Yvette (France); Appourchaux, T. [Institut d' Astrophysique Spatiale, UMR 8617, Universite Paris Sud, 91405 Orsay Cedex (France); Frandsen, S. [Danish AsteroSeismology Centre (DASC), Department of Physics and Astronomy, Aarhus University, DK-8000 Aarhus C (Denmark); Houdek, G., E-mail: dhuber@physics.usyd.edu.au [Institute of Astronomy, University of Vienna, 1180 Vienna (Austria); and others

    2011-12-20

    We have analyzed solar-like oscillations in {approx}1700 stars observed by the Kepler Mission, spanning from the main sequence to the red clump. Using evolutionary models, we test asteroseismic scaling relations for the frequency of maximum power ({nu}{sub max}), the large frequency separation ({Delta}{nu}), and oscillation amplitudes. We show that the difference of the {Delta}{nu}-{nu}{sub max} relation for unevolved and evolved stars can be explained by different distributions in effective temperature and stellar mass, in agreement with what is expected from scaling relations. For oscillation amplitudes, we show that neither (L/M){sup s} scaling nor the revised scaling relation by Kjeldsen and Bedding is accurate for red-giant stars, and demonstrate that a revised scaling relation with a separate luminosity-mass dependence can be used to calculate amplitudes from the main sequence to red giants to a precision of {approx}25%. The residuals show an offset particularly for unevolved stars, suggesting that an additional physical dependency is necessary to fully reproduce the observed amplitudes. We investigate correlations between amplitudes and stellar activity, and find evidence that the effect of amplitude suppression is most pronounced for subgiant stars. Finally, we test the location of the cool edge of the instability strip in the Hertzsprung-Russell diagram using solar-like oscillations and find the detections in the hottest stars compatible with a domain of hybrid stochastically excited and opacity driven pulsation.

  7. The evolution of surface magnetic fields in young solar-type stars II: the early main sequence (250-650 Myr)

    Science.gov (United States)

    Folsom, C. P.; Bouvier, J.; Petit, P.; Lèbre, A.; Amard, L.; Palacios, A.; Morin, J.; Donati, J.-F.; Vidotto, A. A.

    2018-03-01

    There is a large change in surface rotation rates of sun-like stars on the pre-main sequence and early main sequence. Since these stars have dynamo-driven magnetic fields, this implies a strong evolution of their magnetic properties over this time period. The spin-down of these stars is controlled by interactions between stellar and magnetic fields, thus magnetic evolution in turn plays an important role in rotational evolution. We present here the second part of a study investigating the evolution of large-scale surface magnetic fields in this critical time period. We observed stars in open clusters and stellar associations with known ages between 120 and 650 Myr, and used spectropolarimetry and Zeeman Doppler Imaging to characterize their large-scale magnetic field strength and geometry. We report 15 stars with magnetic detections here. These stars have masses from 0.8 to 0.95 M⊙, rotation periods from 0.326 to 10.6 d, and we find large-scale magnetic field strengths from 8.5 to 195 G with a wide range of geometries. We find a clear trend towards decreasing magnetic field strength with age, and a power law decrease in magnetic field strength with Rossby number. There is some tentative evidence for saturation of the large-scale magnetic field strength at Rossby numbers below 0.1, although the saturation point is not yet well defined. Comparing to younger classical T Tauri stars, we support the hypothesis that differences in internal structure produce large differences in observed magnetic fields, however for weak-lined T Tauri stars this is less clear.

  8. Grain temperature, radiation pressure and electric potential in the vicinity of main sequence and white dwarf stars

    Energy Technology Data Exchange (ETDEWEB)

    Leiknes, J.; Havnes, O. (University of Tromso, Auroral Observatory (Norway))

    1984-08-01

    We present results of calculations of the grain physical parameters temperature, lifetime against evaporation, radiation pressure and electric potential for spherical grains near main sequence stars, hydrogen type (DA) white dwarfs and helium type (DB) white dwarfs. These parameters are essential in determining the behaviour of grains near such stars. The grain temperature as a function of stellar distance is calculated for grains of sizes 0.1 and 1 ..mu.. (micron) for grain materials of silicate (obsidian), iron and graphite. The lifetime due to thermal evaporation as a function of grain temperature of these materials is also given. The radiation pressure is given for grain sizes from 0.01 to 10 ..mu.. for the same three grain materials. Grain potentials have been calculated as functions of stellar distance for one photoelectron high yield material (silicate) and one low yield material (graphite) for grains of radius 0.1 ..mu.. embedded in a thermal plasma of temperature T = 10/sup 4/ K.

  9. The Solar Neighborhood. XLI. A Study of the Wide Main Sequence for M Dwarfs—Long-term Photometric Variability

    Energy Technology Data Exchange (ETDEWEB)

    Clements, Tiffany D.; Jao, Wei-Chun; Silverstein, Michele L. [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30303 (United States); Henry, Todd J.; Hosey, Altonio D. [RECONS Institute, Chambersburg, PA 17201 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Dieterich, Sergio B. [Carnegie Institution for Science, Washington, DC 20015 (United States); Riedel, Adric R., E-mail: pewett@astro.gsu.edu, E-mail: jao@astro.gsu.edu, E-mail: silverstein@astro.gsu.edu, E-mail: toddhenry28@gmail.com, E-mail: altoniohosey@gmail.com, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: sdieterich@carnegiescience.edu, E-mail: adric.riedel@gmail.com [Space Telescope Science Institute, Baltimore, MD 21218 (United States)

    2017-09-01

    We report findings from a long-term photometric variability study of M dwarfs carried out at the SMARTS 0.9 m telescope at the Cerro Tololo Inter-American Observatory. As part of a multi-faceted effort to investigate the range of luminosities of M dwarfs of a given color on the Hertzsprung–Russell Diagram, 76 M dwarfs have been observed for 3–17 years in the Johnson–Kron–Cousins V band. We find that stars elevated above the center of the main sequence distribution tend to have higher levels of variability, likely caused by magnetic activity, than their fainter counterparts below the center. This study provides insight into how the long-term magnetic activity of these stars may be affecting their sizes, luminosities, and thus positions on the H-R Diagram.

  10. Lithium abundances and metallicities in stars near the main-sequence turnoff and a giant in M67

    International Nuclear Information System (INIS)

    Garcia Lopez, R.J.; Rebolo, R.; Beckman, J.E.

    1988-01-01

    The iron abundance of seven stars near the main-sequence (MS) turnoff and a giant in M67 are spectroscopically derived, and the results are discussed. The resulting mean iron abundance of the turnoff stars is (Fe/H) = 0.04 + or - 0.04. Taken together with previous determinations for younger clusters, this shows that there has been relatively little change of the iron abundance in the solar neighborhood during the last 5 Gyr. Lithium was detected in one unevolved star and marginally in the giant, while in the other MS stars only upper limits were found. The considerable differences in Li abundances for stars with similar surface temperature imply that there is at least one parameter affecting Li depletion apart from stellar mass and metallicity. Nonsimultaneous star formation in the cluster cloud explain the scatter in lithium abundances. 50 references

  11. Stellar Variability at the Main-sequence Turnoff of the Intermediate-age LMC Cluster NGC 1846

    Science.gov (United States)

    Salinas, R.; Pajkos, M. A.; Vivas, A. K.; Strader, J.; Contreras Ramos, R.

    2018-04-01

    Intermediate-age (IA) star clusters in the Large Magellanic Cloud (LMC) present extended main-sequence turn-offs (MSTO) that have been attributed to either multiple stellar populations or an effect of stellar rotation. Recently it has been proposed that these extended main sequences can also be produced by ill-characterized stellar variability. Here we present Gemini-S/Gemini Multi-Object Spectrometer (GMOS) time series observations of the IA cluster NGC 1846. Using differential image analysis, we identified 73 new variable stars, with 55 of those being of the Delta Scuti type, that is, pulsating variables close the MSTO for the cluster age. Considering completeness and background contamination effects, we estimate the number of δ Sct belonging to the cluster between 40 and 60 members, although this number is based on the detection of a single δ Sct within the cluster half-light radius. This amount of variable stars at the MSTO level will not produce significant broadening of the MSTO, albeit higher-resolution imaging will be needed to rule out variable stars as a major contributor to the extended MSTO phenomenon. Though modest, this amount of δ Sct makes NGC 1846 the star cluster with the highest number of these variables ever discovered. Lastly, our results present a cautionary tale about the adequacy of shallow variability surveys in the LMC (like OGLE) to derive properties of its δ Sct population. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the National Research Council (Canada), CONICYT (Chile), Ministerio de Ciencia, Tecnología e Innovación Productiva (Argentina), and Ministério da Ciência, Tecnologia e Inovação (Brazil).

  12. De novo Transcriptome Sequencing Reveals a Considerable Bias in the Incidence of Simple Sequence Repeats towards the Downstream of ‘Pre-miRNAs’ of Black Pepper

    Science.gov (United States)

    Joy, Nisha; Asha, Srinivasan; Mallika, Vijayan; Soniya, Eppurathu Vasudevan

    2013-01-01

    Next generation sequencing has an advantageon transformational development of species with limited available sequence data as it helps to decode the genome and transcriptome. We carried out the de novo sequencing using illuminaHiSeq™ 2000 to generate the first leaf transcriptome of black pepper (Piper nigrum L.), an important spice variety native to South India and also grown in other tropical regions. Despite the economic and biochemical importance of pepper, a scientifically rigorous study at the molecular level is far from complete due to lack of sufficient sequence information and cytological complexity of its genome. The 55 million raw reads obtained, when assembled using Trinity program generated 2,23,386 contigs and 1,28,157 unigenes. Reports suggest that the repeat-rich genomic regions give rise to small non-coding functional RNAs. MicroRNAs (miRNAs) are the most abundant type of non-coding regulatory RNAs. In spite of the widespread research on miRNAs, little is known about the hair-pin precursors of miRNAs bearing Simple Sequence Repeats (SSRs). We used the array of transcripts generated, for the in silico prediction and detection of ‘43 pre-miRNA candidates bearing different types of SSR motifs’. The analysis identified 3913 different types of SSR motifs with an average of one SSR per 3.04 MB of thetranscriptome. About 0.033% of the transcriptome constituted ‘pre-miRNA candidates bearing SSRs’. The abundance, type and distribution of SSR motifs studied across the hair-pin miRNA precursors, showed a significant bias in the position of SSRs towards the downstream of predicted ‘pre-miRNA candidates’. The catalogue of transcripts identified, together with the demonstration of reliable existence of SSRs in the miRNA precursors, permits future opportunities for understanding the genetic mechanism of black pepper and likely functions of ‘tandem repeats’ in miRNAs. PMID:23469176

  13. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  14. Detection of [O III] at z ∼ 3: A Galaxy Above the Main Sequence, Rapidly Assembling Its Stellar Mass

    Science.gov (United States)

    Vishwas, Amit; Ferkinhoff, Carl; Nikola, Thomas; Parshley, Stephen C.; Schoenwald, Justin P.; Stacey, Gordon J.; Higdon, Sarah J. U.; Higdon, James L.; Weiss, Axel; Güsten, Rolf; Menten, Karl M.

    2018-04-01

    We detect bright emission in the far-infrared (far-IR) fine structure [O III] 88 μm line from a strong lensing candidate galaxy, H-ATLAS J113526.3-014605, hereafter G12v2.43, at z = 3.127, using the second-generation Redshift (z) and Early Universe Spectrometer (ZEUS-2) at the Atacama Pathfinder Experiment Telescope (APEX). This is only the fifth detection of this far-IR line from a submillimeter galaxy at the epoch of galaxy assembly. The observed [O III] luminosity of 7.1 × 109 ≤ft(\\tfrac{10}{μ }\\right) L ⊙ likely arises from H II regions around massive stars, and the amount of Lyman continuum photons required to support the ionization indicate the presence of (1.2–5.2) × 106 ≤ft(\\tfrac{10}{μ }\\right) equivalent O5.5 or higher stars, where μ would be the lensing magnification factor. The observed line luminosity also requires a minimum mass of ∼2 × 108 ≤ft(\\tfrac{10}{μ }\\right) M ⊙ in ionized gas, that is 0.33% of the estimated total molecular gas mass of 6 × 1010 ≤ft(\\tfrac{10}{μ }\\right) M ⊙. We compile multi-band photometry tracing rest-frame ultraviolet to millimeter continuum emission to further constrain the properties of this dusty high-redshift, star-forming galaxy. Via SED modeling we find G12v2.43 is forming stars at a rate of 916 ≤ft(\\tfrac{10}{μ }\\right) M ⊙ yr‑1 and already has a stellar mass of 8 × 1010 ≤ft(\\tfrac{10}{μ }\\right) M ⊙. We also constrain the age of the current starburst to be ≤slant 5 Myr, making G12v2.43 a gas-rich galaxy lying above the star-forming main sequence at z ∼ 3, undergoing a growth spurt, and it could be on the main sequence within the derived gas depletion timescale of ∼66 Myr.

  15. Post-main-sequence Evolution of Icy Minor Planets. II. Water Retention and White Dwarf Pollution around Massive Progenitor Stars

    Energy Technology Data Exchange (ETDEWEB)

    Malamud, Uri; Perets, Hagai B., E-mail: uri.mal@tx.technion.ac.il, E-mail: hperets@physics.technion.ac.il [Department of Physics, Technion (Israel)

    2017-06-10

    Most studies suggest that the pollution of white dwarf (WD) atmospheres arises from the accretion of minor planets, but the exact properties of polluting material, and in particular the evidence for water in some cases, are not yet understood. Here we study the water retention of small icy bodies in exo-solar planetary systems, as their respective host stars evolve through and off the main sequence and eventually become WDs. We explore, for the first time, a wide range of star masses and metallicities. We find that the mass of the WD progenitor star is of crucial importance for the retention of water, while its metallicity is relatively unimportant. We predict that minor planets around lower-mass WD progenitors would generally retain more water and would do so at closer distances from the WD than compared with high-mass progenitors. The dependence of water retention on progenitor mass and other parameters has direct implications for the origin of observed WD pollution, and we discuss how our results and predictions might be tested in the future as more observations of WDs with long cooling ages become available.

  16. Rotation-induced YORP break-up of small bodies to produce post-main-sequence debris

    Science.gov (United States)

    Veras, D.; Jacobson, S. A.; Gänsicke, B. T.

    2017-09-01

    We hypothesize that the in situ break-up of small bodies such as asteroids spun to fission during the giant branch phases of stellar evolution provides an important contribution to the debris orbiting and ultimately polluting white dwarfs. The YORP (Yarkovsky-O'Keefe-Radviesvki-Paddock) effect, which arises from radiation pressure, accelerates the spin rate of asymmetric asteroids, which can eventually shear themselves apart. This pressure is maintained and enhanced around dying stars because the outward push of an asteroid due to stellar mass loss is insignificant compared to the resulting stellar luminosity increase. Consequently, giant star radiation will destroy nearly all bodies with radii in the range 100 m-10 km that survive their parent star's main-sequence lifetime within a distance of about 7 au; smaller bodies are spun apart to their strongest, competent components. This estimate is conservative and would increase for highly asymmetric shapes or incorporation of the inward drag due to giant star stellar wind. The resulting debris field, which could extend to thousands of au, may be perturbed by remnant planetary systems to reproduce the observed dusty and gaseous discs which accompany polluted white dwarfs.

  17. THE EXTENDED MAIN-SEQUENCE TURNOFF CLUSTERS OF THE LARGE MAGELLANIC CLOUD-MISSING LINKS IN GLOBULAR CLUSTER EVOLUTION

    International Nuclear Information System (INIS)

    Keller, Stefan C.; Mackey, A. Dougal; Da Costa, Gary S.

    2011-01-01

    Recent observations of intermediate-age (1-3 Gyr) massive star clusters in the Large Magellanic Cloud have revealed that the majority possess bifurcated or extended main-sequence turnoff (EMSTO) morphologies. This effect can be understood to arise from subsequent star formation among the stellar population with age differences between constituent stars amounting to 50-300 Myr. Age spreads of this order are similarly invoked to explain the light-element abundance variations witnessed in ancient globular clusters (GCs). In this paper, we explore the proposition that the clusters exhibiting the EMSTO phenomenon are a general phase in the evolution of massive clusters, one that naturally leads to the particular chemical properties of the ancient GC population. We show that the isolation of EMSTO clusters to intermediate ages is the consequence of observational selection effects. In our proposed scenario, the EMSTO phenomenon is identical to that which establishes the light-element abundance variations that are ubiquitous in the ancient GC population. Our scenario makes a strong prediction: EMSTO clusters will exhibit abundance variations in the light-elements characteristic of the ancient GC population.

  18. 2D and 3D Models of Convective Turbulence and Oscillations in Intermediate-Mass Main-Sequence Stars

    Science.gov (United States)

    Guzik, Joyce Ann; Morgan, Taylor H.; Nelson, Nicholas J.; Lovekin, Catherine; Kitiashvili, Irina N.; Mansour, Nagi N.; Kosovichev, Alexander

    2015-08-01

    We present multidimensional modeling of convection and oscillations in main-sequence stars somewhat more massive than the sun, using three separate approaches: 1) Applying the spherical 3D MHD ASH (Anelastic Spherical Harmonics) code to simulate the core convection and radiative zone. Our goal is to determine whether core convection can excite low-frequency gravity modes, and thereby explain the presence of low frequencies for some hybrid gamma Dor/delta Sct variables for which the envelope convection zone is too shallow for the convective blocking mechanism to drive g modes; 2) Using the 3D planar ‘StellarBox’ radiation hydrodynamics code to model the envelope convection zone and part of the radiative zone. Our goals are to examine the interaction of stellar pulsations with turbulent convection in the envelope, excitation of acoustic modes, and the role of convective overshooting; 3) Applying the ROTORC 2D stellar evolution and dynamics code to calculate evolution with a variety of initial rotation rates and extents of core convective overshooting. The nonradial adiabatic pulsation frequencies of these nonspherical models will be calculated using the 2D pulsation code NRO of Clement. We will present new insights into gamma Dor and delta Sct pulsations gained by multidimensional modeling compared to 1D model expectations.

  19. The pre- versus post-main sequence evolutionary phase of B[e] stars. Constraints from 13CO band emission

    Czech Academy of Sciences Publication Activity Database

    Kraus, Michaela

    2009-01-01

    Roč. 494, č. 1 (2009), s. 253-262 ISSN 0004-6361 R&D Projects: GA AV ČR KJB300030701 Institutional research plan: CEZ:AV0Z10030501 Keywords : star s * winds * circumstellar matter Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.179, year: 2009

  20. Variable extinction in HD 45677 and the evolution of dust grains in pre-main-sequence disks

    Science.gov (United States)

    Sitko, Michael L.; Halbedel, Elaine M.; Lawrence, Geoffrey F.; Smith, J. Allyn; Yanow, Ken

    1994-01-01

    Changes in the UV extinction and IR emission were sought in the Herbig Ae/Be star candidate HD 45677 (= FS CMa) by comparing UV, optical, and IR observations made approximately 10 yr apart. HD 45677 varied significantly, becoming more than 50% brighter in the UV and optical than it was a decade ago. A comparison of the observations between epochs indicates that if the variations are due to changes in dust obscuration, the dust acts as a gray absorber into the near-IR and must be depleted in grains smaller than 1 micron. This is similar to the results obtained on the circumstellar disks of stars like Vega and Beta Pic, and suggests that radiation pressure may be responsible for the small-grain depletion. In addition, the total IR flux seems to have declined, indicating a decrease in the total mass of the dust envelope that contributes to the IR emission in this part of the spectrum. Due to the anomalous nature of the extinction, the use of normal extinction curves to deredden the spectral energy distributions of stars with circumstellar dust may lead to significant errors and should be used with great caution.

  1. Explaining the luminosity spread in young clusters: proto and pre-main sequence stellar evolution in a molecular cloud environment

    Science.gov (United States)

    Jensen, Sigurd S.; Haugbølle, Troels

    2018-02-01

    Hertzsprung-Russell diagrams of star-forming regions show a large luminosity spread. This is incompatible with well-defined isochrones based on classic non-accreting protostellar evolution models. Protostars do not evolve in isolation of their environment, but grow through accretion of gas. In addition, while an age can be defined for a star-forming region, the ages of individual stars in the region will vary. We show how the combined effect of a protostellar age spread, a consequence of sustained star formation in the molecular cloud, and time-varying protostellar accretion for individual protostars can explain the observed luminosity spread. We use a global magnetohydrodynamic simulation including a sub-scale sink particle model of a star-forming region to follow the accretion process of each star. The accretion profiles are used to compute stellar evolution models for each star, incorporating a model of how the accretion energy is distributed to the disc, radiated away at the accretion shock, or incorporated into the outer layers of the protostar. Using a modelled cluster age of 5 Myr, we naturally reproduce the luminosity spread and find good agreement with observations of the Collinder 69 cluster, and the Orion Nebular Cluster. It is shown how stars in binary and multiple systems can be externally forced creating recurrent episodic accretion events. We find that in a realistic global molecular cloud model massive stars build up mass over relatively long time-scales. This leads to an important conceptual change compared to the classic picture of non-accreting stellar evolution segmented into low-mass Hayashi tracks and high-mass Henyey tracks.

  2. INSPIRE Project (IoNospheric Sounding for Pre-seismic anomalies Identification REsearch): Main Results and Future Prospects

    Science.gov (United States)

    Pulinets, S. A.; Andrzej, K.; Hernandez-Pajares, M.; Cherniak, I.; Zakharenkova, I.; Rothkaehl, H.; Davidenko, D.

    2017-12-01

    The INSPIRE project is dedicated to the study of physical processes and their effects in ionosphere which could be determined as earthquake precursors together with detailed description of the methodology of ionospheric pre-seismic anomalies definition. It was initiated by ESA and carried out by international consortium. The physical mechanisms of the ionospheric pre-seismic anomalies generation from ground to the ionosphere altitudes were formulated within framework of the Lithosphere-Atmosphere-Ionosphere-Magnetosphere Coupling (LAIMC) model (Pulinets et al., 2015). The general algorithm for the identification of the ionospheric precursors was formalized which also takes into account the external Space Weather factors able to generate the false alarms. Importance of the special stable pattern called the "precursor mask" was highlighted which is based on self-similarity of pre-seismic ionospheric variations. The role of expert decision in pre-seismic anomalies interpretation for generation of seismic warning is important as well. The algorithm performance of the LAIMC seismo-ionospheric effect detection module has been demonstrated using the L'Aquila 2009 earthquake as a case study. The results of INSPIRE project have demonstrated that the ionospheric anomalies registered before the strong earthquakes could be used as reliable precursors. The detailed classification of the pre-seismic anomalies was presented in different regions of the ionosphere and signatures of the pre-seismic anomalies as detected by ground and satellite based instruments were described what clarified methodology of the precursor's identification from ionospheric multi-instrumental measurements. Configuration for the dedicated multi-observation experiment and satellite payload was proposed for the future implementation of the INSPIRE project results. In this regard the multi-instrument set can be divided by two groups: space equipment and ground-based support, which could be used for real

  3. Dominance of pre-analytical over analytical variation for measurement of methadone and its main metabolite in postmortem femoral blood

    DEFF Research Database (Denmark)

    Linnet, Kristian; Johansen, Sys Stybe; Buchard, Anders

    2008-01-01

    cases comprising mainly drug addicts. A chiral LC-MS/MS method was used for measurement of the R- and S-enantiomers of methadone and its main metabolite 2-ethyl-1,5-dimethyl-3,3-diphenylpyrrolinium (EDDP). The analytical CV% was determined to be in the range 3-4% for methadone enantiomers and 4...

  4. Analysis of Pre-Analytic Factors Affecting the Success of Clinical Next-Generation Sequencing of Solid Organ Malignancies

    International Nuclear Information System (INIS)

    Chen, Hui; Luthra, Rajyalakshmi; Goswami, Rashmi S.; Singh, Rajesh R.; Roy-Chowdhuri, Sinchita

    2015-01-01

    Application of next-generation sequencing (NGS) technology to routine clinical practice has enabled characterization of personalized cancer genomes to identify patients likely to have a response to targeted therapy. The proper selection of tumor sample for downstream NGS based mutational analysis is critical to generate accurate results and to guide therapeutic intervention. However, multiple pre-analytic factors come into play in determining the success of NGS testing. In this review, we discuss pre-analytic requirements for AmpliSeq PCR-based sequencing using Ion Torrent Personal Genome Machine (PGM) (Life Technologies), a NGS sequencing platform that is often used by clinical laboratories for sequencing solid tumors because of its low input DNA requirement from formalin fixed and paraffin embedded tissue. The success of NGS mutational analysis is affected not only by the input DNA quantity but also by several other factors, including the specimen type, the DNA quality, and the tumor cellularity. Here, we review tissue requirements for solid tumor NGS based mutational analysis, including procedure types, tissue types, tumor volume and fraction, decalcification, and treatment effects

  5. Analysis of Pre-Analytic Factors Affecting the Success of Clinical Next-Generation Sequencing of Solid Organ Malignancies

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Hui [Department of Pathology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030 (United States); Luthra, Rajyalakshmi, E-mail: rluthra@mdanderson.org; Goswami, Rashmi S.; Singh, Rajesh R. [Department of Hematopathology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030 (United States); Roy-Chowdhuri, Sinchita [Department of Pathology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030 (United States)

    2015-08-28

    Application of next-generation sequencing (NGS) technology to routine clinical practice has enabled characterization of personalized cancer genomes to identify patients likely to have a response to targeted therapy. The proper selection of tumor sample for downstream NGS based mutational analysis is critical to generate accurate results and to guide therapeutic intervention. However, multiple pre-analytic factors come into play in determining the success of NGS testing. In this review, we discuss pre-analytic requirements for AmpliSeq PCR-based sequencing using Ion Torrent Personal Genome Machine (PGM) (Life Technologies), a NGS sequencing platform that is often used by clinical laboratories for sequencing solid tumors because of its low input DNA requirement from formalin fixed and paraffin embedded tissue. The success of NGS mutational analysis is affected not only by the input DNA quantity but also by several other factors, including the specimen type, the DNA quality, and the tumor cellularity. Here, we review tissue requirements for solid tumor NGS based mutational analysis, including procedure types, tissue types, tumor volume and fraction, decalcification, and treatment effects.

  6. Analysis of Pre-Analytic Factors Affecting the Success of Clinical Next-Generation Sequencing of Solid Organ Malignancies

    Directory of Open Access Journals (Sweden)

    Hui Chen

    2015-08-01

    Full Text Available Application of next-generation sequencing (NGS technology to routine clinical practice has enabled characterization of personalized cancer genomes to identify patients likely to have a response to targeted therapy. The proper selection of tumor sample for downstream NGS based mutational analysis is critical to generate accurate results and to guide therapeutic intervention. However, multiple pre-analytic factors come into play in determining the success of NGS testing. In this review, we discuss pre-analytic requirements for AmpliSeq PCR-based sequencing using Ion Torrent Personal Genome Machine (PGM (Life Technologies, a NGS sequencing platform that is often used by clinical laboratories for sequencing solid tumors because of its low input DNA requirement from formalin fixed and paraffin embedded tissue. The success of NGS mutational analysis is affected not only by the input DNA quantity but also by several other factors, including the specimen type, the DNA quality, and the tumor cellularity. Here, we review tissue requirements for solid tumor NGS based mutational analysis, including procedure types, tissue types, tumor volume and fraction, decalcification, and treatment effects.

  7. The Problem of Hipparcos Distances to Open Clusters. Report 1; Constraints from Multicolor a Main-Sequence Fitting

    Science.gov (United States)

    Pinsonneault, Marc H.; Stauffer, John; Soderblom, David R.; King, Jeremy R.; Hanson, Robert B.

    1998-01-01

    Parallax data from the Hipparcos mission allow the direct distance to open clusters to be compared with the distance inferred from main-sequence (MS) fitting. There are surprising differences between the two distance measurements. indicating either the need for changes in the cluster compositions or reddening, underlying problems with the technique of MS fitting, or systematic errors in the Hipparcos parallaxes at the 1 mas level. We examine the different possibilities, focusing on MS fitting in both metallicity-sensitive B-V and metallicity-insensitive V-I for five well-studied systems (the Hyades, Pleiades, alpha Per, Praesepe, and Coma Ber). The Hipparcos distances to the Hyades and alpha Per are within 1 sigma of the MS-fitting distance in B-V and V-I, while the Hipparcos distances to Coma Ber and the Pleiades are in disagreement with the MS-fitting distance at more than the 3 sigma level. There are two Hipparcos measurements of the distance to Praesepe; one is in good agreement with the MS-fitting distance and the other disagrees at the 2 sigma level. The distance estimates from the different colors are in conflict with one another for Coma but in agreement for the Pleiades. Changes in the relative cluster metal abundances, age related effects, helium, and reddening are shown to be unlikely to explain the puzzling behavior of the Pleiades. We present evidence for spatially dependent systematic errors at the 1 mas level in the parallaxes of Pleiades stars. The implications of this result are discussed.

  8. Percutaneous Coronary Intervention of Left Main Disease: Pre- and Post-EXCEL (Evaluation of XIENCE Everolimus Eluting Stent Versus Coronary Artery Bypass Surgery for Effectiveness of Left Main Revascularization) and NOBLE (Nordic-Baltic-British Left Main Revascularization Study) Era.

    Science.gov (United States)

    Park, Duk-Woo; Park, Seung-Jung

    2017-06-01

    For nearly half a century, coronary artery bypass grafting has been the standard treatment for patients with obstructive left main coronary artery (LMCA) disease. However, there has been considerable evolution in the field of percutaneous coronary intervention, and especially, percutaneous coronary intervention for LMCA disease has been rapidly expanded with adoption of drug-eluting stents. Some, but not all randomized trials, have shown that percutaneous coronary intervention with drug-eluting stents might be a suitable alternative for selected patients with LMCA disease instead of bypass surgery. However, none of previous trials involving early-generation drug-eluting stents was sufficiently powered and comparative trials using contemporary drug-eluting stents were limited. Recently, primary results of 2 new trials of EXCEL (Evaluation of XIENCE Everolimus Eluting Stent Versus Coronary Artery Bypass Surgery for Effectiveness of Left Main Revascularization) and NOBLE (Nordic-Baltic-British Left Main Revascularization Study) were reported. However, these trials showed conflicting results, which might pose uncertainty on the optimal revascularization strategy for LMCA disease. In this article, with the incorporation of a key review on evolution of LMCA treatment, we summarize the similarity or disparity of the EXCEL and NOBLE trials, focus on how they relate to previous trials in the field, and finally speculate on how the treatment strategy may be changed or recommended for LMCA treatment. © 2017 American Heart Association, Inc.

  9. OLD MAIN-SEQUENCE TURNOFF PHOTOMETRY IN THE SMALL MAGELLANIC CLOUD. II. STAR FORMATION HISTORY AND ITS SPATIAL GRADIENTS

    International Nuclear Information System (INIS)

    Noel, Noelia E. D.; Gallart, Carme; Hidalgo, Sebastian L.; Aparicio, Antonio; Costa, Edgardo; Mendez, Rene A.

    2009-01-01

    We present a quantitative analysis of the star formation history (SFH) of 12 fields in the Small Magellanic Cloud (SMC) based on unprecedented deep [(B - R), R] color-magnitude diagrams (CMDs). Our fields reach down to the oldest main-sequence turnoff with a high photometric accuracy, which is vital for obtaining accurate SFHs, particularly at intermediate and old ages. We use the IAC-pop code to obtain the SFH, using synthetic CMDs generated with IAC-star. We obtain the SFH as a function ψ(t, z) of age and metallicity. We also consider several auxiliary functions: the initial mass function (IMF), φ(m), and a function accounting for the frequency and relative mass distribution of binary stars, β(f, q). We find that there are several main periods of enhancement of star formation: a young one peaked at ∼0.2-0.5 Gyr old, only present in the eastern and in the central-most fields; two at intermediate ages present in all fields: a conspicuous one peaked at ∼4-5 Gyr, and a less significant one peaked at ∼1.5-2.5; and an old one, peaked at ∼10 Gyr in all fields but the western ones. In the western fields, this old enhancement splits into two, one peaked at ∼8 Gyr old and another at ∼12 Gyr old. This 'two-enhancement' zone is unaffected by our choice of stellar evolutionary library but more data covering other fields of the SMC are necessary in order to ascertain its significancy. Correlation between star formation rate enhancements and SMC-Milky Way encounters is not clear. Some correlation could exist with encounters taken from the orbit determination of Kallivayalil et al. But our results would also fit in a first pericenter passage scenario like the one claimed by Besla et al. For SMC-Large Magellanic Cloud encounters, we find a correlation only for the most recent encounter ∼0.2 Gyr ago. This coincides with the youngest ψ(t) enhancement peaked at these ages in our eastern fields. The population younger than 1 Gyr represents ∼7%-12% of the total

  10. A Lagrangian identification of the main sources of moisture affecting northeastern Brazil during its pre-rainy and rainy seasons.

    Directory of Open Access Journals (Sweden)

    Anita Drumond

    Full Text Available This work examines the sources of moisture affecting the semi-arid Brazilian Northeast (NEB during its pre-rainy and rainy season (JFMAM through a Lagrangian diagnosis method. The FLEXPART model identifies the humidity contributions to the moisture budget over a region through the continuous computation of changes in the specific humidity along back or forward trajectories up to 10 days period. The numerical experiments were done for the period that spans between 2000 and 2004 and results were aggregated on a monthly basis. Results show that besides a minor local recycling component, the vast majority of moisture reaching NEB area is originated in the south Atlantic basin and that the nearby wet Amazon basin bears almost no impact. Moreover, although the maximum precipitation in the "Poligono das Secas" region (PS occurs in March and the maximum precipitation associated with air parcels emanating from the South Atlantic towards PS is observed along January to March, the highest moisture contribution from this oceanic region occurs slightly later (April. A dynamical analysis suggests that the maximum precipitation observed in the PS sector does not coincide with the maximum moisture supply probably due to the combined effect of the Walker and Hadley cells in inhibiting the rising motions over the region in the months following April.

  11. A Pre-Bridge Course: The Natural Role of Sequences and Series

    Science.gov (United States)

    Beaver, Scott

    2011-01-01

    The Sequences and Series calculus course (S&S) can be structured to provide students with a unique opportunity to build their proofs skills prior to or concurrently with a bridge course. This article offers a framework for S&S which places logical reasoning on equal footing with content, by employing the theorems and convergence tests as axioms,…

  12. How Dusty Is Alpha Centauri? Excess or Non-excess over the Infrared Photospheres of Main-sequence Stars

    Science.gov (United States)

    Wiegert, J.; Liseau, R.; Thebault, P.; Olofsson, G.; Mora, A.; Bryden, G.; Marshall, J. P.; Eiroa, C.; Montesinos, B.; Ardila, D.; hide

    2014-01-01

    Context. Debris discs around main-sequence stars indicate the presence of larger rocky bodies. The components of the nearby, solar-type binary Centauri have metallicities that are higher than solar, which is thought to promote giant planet formation. Aims. We aim to determine the level of emission from debris around the stars in the Cen system. This requires knowledge of their photospheres.Having already detected the temperature minimum, Tmin, of CenA at far-infrared wavelengths, we here attempt to do the same for the moreactive companion Cen B. Using the Cen stars as templates, we study the possible eects that Tmin may have on the detectability of unresolveddust discs around other stars. Methods.We used Herschel-PACS, Herschel-SPIRE, and APEX-LABOCA photometry to determine the stellar spectral energy distributions in thefar infrared and submillimetre. In addition, we used APEX-SHeFI observations for spectral line mapping to study the complex background around Cen seen in the photometric images. Models of stellar atmospheres and of particulate discs, based on particle simulations and in conjunctionwith radiative transfer calculations, were used to estimate the amount of debris around these stars. Results. For solar-type stars more distant than Cen, a fractional dust luminosity fd LdustLstar 2 107 could account for SEDs that do not exhibit the Tmin eect. This is comparable to estimates of fd for the Edgeworth-Kuiper belt of the solar system. In contrast to the far infrared,slight excesses at the 2:5 level are observed at 24 m for both CenA and B, which, if interpreted as due to zodiacal-type dust emission, wouldcorrespond to fd (13) 105, i.e. some 102 times that of the local zodiacal cloud. Assuming simple power-law size distributions of the dustgrains, dynamical disc modelling leads to rough mass estimates of the putative Zodi belts around the Cen stars, viz.4106 M$ of 4 to 1000 msize grains, distributed according to n(a) a3:5. Similarly, for filled-in Tmin

  13. A ChIP-Seq benchmark shows that sequence conservation mainly improves detection of strong transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Tony Håndstad

    Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.

  14. The environmental impacts on the star formation main sequence: An Hα study of the newly discovered rich cluster at z = 1.52

    Energy Technology Data Exchange (ETDEWEB)

    Koyama, Yusei; Kodama, Tadayuki; Tadaki, Ken-ichi; Hayashi, Masao [National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Tanaka, Ichi [Subaru Telescope, National Astronomical Observatory of Japan, 650 North A' ohoku Place, Hilo, HI 96720 (United States); Shimakawa, Rhythm, E-mail: koyama.yusei@nao.ac.jp [Department of Astronomical Science, The Graduate University for Advanced Studies, Mitaka, Tokyo 181-8588 (Japan)

    2014-07-01

    We report the discovery of a strong over-density of galaxies in the field of a radio galaxy at z = 1.52 (4C 65.22) based on our broadband and narrow-band (Hα) photometry with the Subaru Telescope. We find that Hα emitters are located in the outskirts of the density peak (cluster core) dominated by passive red-sequence galaxies. This resembles the situation in lower-redshift clusters, suggesting that the newly discovered structure is a well-evolved rich galaxy cluster at z = 1.5. Our data suggest that the color-density and stellar mass-density relations are already in place at z ∼ 1.5, mostly driven by the passive red massive galaxies residing within r{sub c} ≲ 200 kpc from the cluster core. These environmental trends almost disappear when we consider only star-forming (SF) galaxies. We do not find SFR-density or SSFR-density relations amongst SF galaxies, and the location of the SF main sequence does not significantly change with environment. Nevertheless, we find a tentative hint that star-bursting galaxies (up-scattered objects from the main sequence) are preferentially located in a small group at ∼1 Mpc away from the main body of the cluster. We also argue that the scatter of the SF main sequence could be dependent on the distance to the nearest neighboring galaxy.

  15. Comparison of Pre-Analytical FFPE Sample Preparation Methods and Their Impact on Massively Parallel Sequencing in Routine Diagnostics

    Science.gov (United States)

    Heydt, Carina; Fassunke, Jana; Künstlinger, Helen; Ihle, Michaela Angelika; König, Katharina; Heukamp, Lukas Carl; Schildhaus, Hans-Ulrich; Odenthal, Margarete; Büttner, Reinhard; Merkelbach-Bruse, Sabine

    2014-01-01

    Over the last years, massively parallel sequencing has rapidly evolved and has now transitioned into molecular pathology routine laboratories. It is an attractive platform for analysing multiple genes at the same time with very little input material. Therefore, the need for high quality DNA obtained from automated DNA extraction systems has increased, especially to those laboratories which are dealing with formalin-fixed paraffin-embedded (FFPE) material and high sample throughput. This study evaluated five automated FFPE DNA extraction systems as well as five DNA quantification systems using the three most common techniques, UV spectrophotometry, fluorescent dye-based quantification and quantitative PCR, on 26 FFPE tissue samples. Additionally, the effects on downstream applications were analysed to find the most suitable pre-analytical methods for massively parallel sequencing in routine diagnostics. The results revealed that the Maxwell 16 from Promega (Mannheim, Germany) seems to be the superior system for DNA extraction from FFPE material. The extracts had a 1.3–24.6-fold higher DNA concentration in comparison to the other extraction systems, a higher quality and were most suitable for downstream applications. The comparison of the five quantification methods showed intermethod variations but all methods could be used to estimate the right amount for PCR amplification and for massively parallel sequencing. Interestingly, the best results in massively parallel sequencing were obtained with a DNA input of 15 ng determined by the NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). No difference could be detected in mutation analysis based on the results of the quantification methods. These findings emphasise, that it is particularly important to choose the most reliable and constant DNA extraction system, especially when using small biopsies and low elution volumes, and that all common DNA quantification techniques can be used for

  16. Comparison of pre-analytical FFPE sample preparation methods and their impact on massively parallel sequencing in routine diagnostics.

    Directory of Open Access Journals (Sweden)

    Carina Heydt

    Full Text Available Over the last years, massively parallel sequencing has rapidly evolved and has now transitioned into molecular pathology routine laboratories. It is an attractive platform for analysing multiple genes at the same time with very little input material. Therefore, the need for high quality DNA obtained from automated DNA extraction systems has increased, especially to those laboratories which are dealing with formalin-fixed paraffin-embedded (FFPE material and high sample throughput. This study evaluated five automated FFPE DNA extraction systems as well as five DNA quantification systems using the three most common techniques, UV spectrophotometry, fluorescent dye-based quantification and quantitative PCR, on 26 FFPE tissue samples. Additionally, the effects on downstream applications were analysed to find the most suitable pre-analytical methods for massively parallel sequencing in routine diagnostics. The results revealed that the Maxwell 16 from Promega (Mannheim, Germany seems to be the superior system for DNA extraction from FFPE material. The extracts had a 1.3-24.6-fold higher DNA concentration in comparison to the other extraction systems, a higher quality and were most suitable for downstream applications. The comparison of the five quantification methods showed intermethod variations but all methods could be used to estimate the right amount for PCR amplification and for massively parallel sequencing. Interestingly, the best results in massively parallel sequencing were obtained with a DNA input of 15 ng determined by the NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA. No difference could be detected in mutation analysis based on the results of the quantification methods. These findings emphasise, that it is particularly important to choose the most reliable and constant DNA extraction system, especially when using small biopsies and low elution volumes, and that all common DNA quantification techniques can

  17. THE CONTRIBUTIONS OF INTERACTIVE BINARY STARS TO DOUBLE MAIN-SEQUENCE TURNOFFS AND DUAL RED CLUMP OF INTERMEDIATE-AGE STAR CLUSTERS

    International Nuclear Information System (INIS)

    Yang Wuming; Bi Shaolan; Tian Zhijia; Li Tanda; Liu Kang; Meng Xiangcun

    2011-01-01

    Double or extended main-sequence turnoffs (DMSTOs) and dual red clump (RC) were observed in intermediate-age clusters, such as in NGC 1846 and 419. The DMSTOs are interpreted as that the cluster has two distinct stellar populations with differences in age of about 200-300 Myr but with the same metallicity. The dual RC is interpreted as a result of a prolonged star formation. Using a stellar population-synthesis method, we calculated the evolution of a binary-star stellar population. We found that binary interactions and merging can reproduce the dual RC in the color-magnitude diagrams of an intermediate-age cluster, whereas in actuality only a single population exists. Moreover, the binary interactions can lead to an extended main-sequence turnoff (MSTO) rather than DMSTOs. However, the rest of the main sequence, subgiant branch, and first giant branch are hardly spread by the binary interactions. Part of the observed dual RC and extended MSTO may be the results of binary interactions and mergers.

  18. STELLAR DIAMETERS AND TEMPERATURES. III. MAIN-SEQUENCE A, F, G, AND K STARS: ADDITIONAL HIGH-PRECISION MEASUREMENTS AND EMPIRICAL RELATIONS

    International Nuclear Information System (INIS)

    Boyajian, Tabetha S.; Jones, Jeremy; White, Russel; McAlister, Harold A.; Gies, Douglas; Von Braun, Kaspar; Van Belle, Gerard; Farrington, Chris; Schaefer, Gail; Ten Brummelaar, Theo A.; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm; Ridgway, Stephen

    2013-01-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR J I J JHK), Cousins (R C I C ), Kron (R K I K ), Sloan (griz), and WISE (W 3 W 4 ) photometric systems. These relations have an average standard deviation of ∼3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T eff > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only ∼2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  19. LINEAR RELATION FOR WIND-BLOWN BUBBLE SIZES OF MAIN-SEQUENCE OB STARS IN A MOLECULAR ENVIRONMENT AND IMPLICATION FOR SUPERNOVA PROGENITORS

    Energy Technology Data Exchange (ETDEWEB)

    Chen Yang; Zhou Ping [Department of Astronomy, Nanjing University, Nanjing 210093 (China); Chu Youhua [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States)

    2013-05-20

    We find a linear relationship between the size of a massive star's main-sequence bubble in a molecular environment and the star's initial mass: R{sub b} Almost-Equal-To 1.22 M/M{sub Sun} - 9.16 pc, assuming a constant interclump pressure. Since stars in the mass range of 8 to 25-30 M{sub Sun} will end their evolution in the red supergiant phase without launching a Wolf-Rayet wind, the main-sequence wind-blown bubbles are mainly responsible for the extent of molecular gas cavities, while the effect of the photoionization is comparatively small. This linear relation can thus be used to infer the masses of the massive star progenitors of supernova remnants (SNRs) that are discovered to evolve in molecular cavities, while few other means are available for inferring the properties of SNR progenitors. We have used this method to estimate the initial masses of the progenitors of eight SNRs: Kes 69, Kes 75, Kes 78, 3C 396, 3C 397, HC 40, Vela, and RX J1713-3946.

  20. STELLAR DIAMETERS AND TEMPERATURES. III. MAIN-SEQUENCE A, F, G, AND K STARS: ADDITIONAL HIGH-PRECISION MEASUREMENTS AND EMPIRICAL RELATIONS

    Energy Technology Data Exchange (ETDEWEB)

    Boyajian, Tabetha S.; Jones, Jeremy; White, Russel; McAlister, Harold A.; Gies, Douglas [Center for High Angular Resolution Astronomy and Department of Physics and Astronomy, Georgia State University, P.O. Box 4106, Atlanta, GA 30302-4106 (United States); Von Braun, Kaspar [NASA Exoplanet Science Institute, California Institute of Technology, MC 100-22, Pasadena, CA 91125 (United States); Van Belle, Gerard [Lowell Observatory, Flagstaff, AZ 86001 (United States); Farrington, Chris; Schaefer, Gail; Ten Brummelaar, Theo A.; Sturmann, Laszlo; Sturmann, Judit; Turner, Nils H.; Goldfinger, P. J.; Vargas, Norm [CHARA Array, Mount Wilson Observatory, Mount Wilson, CA 91023 (United States); Ridgway, Stephen [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726-6732 (United States)

    2013-07-01

    Based on CHARA Array measurements, we present the angular diameters of 23 nearby, main-sequence stars, ranging from spectral types A7 to K0, 5 of which are exoplanet host stars. We derive linear radii, effective temperatures, and absolute luminosities of the stars using Hipparcos parallaxes and measured bolometric fluxes. The new data are combined with previously published values to create an Angular Diameter Anthology of measured angular diameters to main-sequence stars (luminosity classes V and IV). This compilation consists of 125 stars with diameter uncertainties of less than 5%, ranging in spectral types from A to M. The large quantity of empirical data is used to derive color-temperature relations to an assortment of color indices in the Johnson (BVR{sub J} I{sub J} JHK), Cousins (R{sub C} I{sub C}), Kron (R{sub K} I{sub K}), Sloan (griz), and WISE (W{sub 3} W{sub 4}) photometric systems. These relations have an average standard deviation of {approx}3% and are valid for stars with spectral types A0-M4. To derive even more accurate relations for Sun-like stars, we also determined these temperature relations omitting early-type stars (T{sub eff} > 6750 K) that may have biased luminosity estimates because of rapid rotation; for this subset the dispersion is only {approx}2.5%. We find effective temperatures in agreement within a couple of percent for the interferometrically characterized sample of main-sequence stars compared to those derived via the infrared flux method and spectroscopic analysis.

  1. IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

    Science.gov (United States)

    Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

    2017-04-01

    We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

  2. Mitochondrial import of human and yeast fumarase in live mammalian cells: Retrograde translocation of the yeast enzyme is mainly caused by its poor targeting sequence

    International Nuclear Information System (INIS)

    Singh, Bhag; Gupta, Radhey S.

    2006-01-01

    Studies on yeast fumarase provide the main evidence for dual localization of a protein in mitochondria and cytosol by means of retrograde translocation. We have examined the subcellular targeting of yeast and human fumarase in live cells to identify factors responsible for this. The cDNAs for mature yeast or human fumarase were fused to the gene for enhanced green fluorescent protein (eGFP) and they contained, at their N-terminus, a mitochondrial targeting sequence (MTS) derived from either yeast fumarase, human fumarase, or cytochrome c oxidase subunit VIII (COX) protein. Two nuclear localization sequences (2x NLS) were also added to these constructs to facilitate detection of any cytosolic protein by its targeting to nucleus. In Cos-1 cells transfected with these constructs, human fumarase with either the native or COX MTSs was detected exclusively in mitochondria in >98% of the cells, while the remainder 1-2% of the cells showed varying amounts of nuclear labeling. In contrast, when human fumarase was fused to the yeast MTS, >50% of the cells showed nuclear labeling. Similar studies with yeast fumarase showed that with its native MTS, nuclear labeling was seen in 80-85% of the cells, but upon fusion to either human or COX MTS, nuclear labeling was observed in only 10-15% of the cells. These results provide evidence that extramitochondrial presence of yeast fumarase is mainly caused by the poor mitochondrial targeting characteristics of its MTS (but also affected by its primary sequence), and that the retrograde translocation mechanism does not play a significant role in the extramitochondrial presence of mammalian fumarase

  3. A trans-activator function is generated by integration of hepatitis B virus preS/S sequences in human hepatocellular carcinoma DNA

    International Nuclear Information System (INIS)

    Caselmann, W.H.; Meyer, M.; Kekule, A.S.; Lauer, U.; Hofschneider, P.H.; Koshy, R.

    1990-01-01

    The X gene of wild-type hepatitis B virus or integrated DNA has recently been shown to stimulate transcription of a variety of enhancers and promoters. To further delineate the viral sequences responsible for trans-activation in hepatomas, the authors cloned the single hepatitis B virus insert from human hepatocellular carcinoma DNA M1. The plasmid pM1 contains 2004 base of hepatitis B virus DNA subtype adr, including truncated preS/S sequences and the enhancer element. The X promoter and 422 nucleotides of the X coding region are present. The entire preC/C gene is deleted. In transient cotransfection assays using Chang liver cells (CCL 13), pM1 DNA exerts a 6- to 10-fold trans-activating effect on the expression of the pSV2CAT reporter plasmid. The transactivation occurs by stimulation of transcription and is dependent on the simian virus 40 enhancer in the reporter plasmid. Deletion analysis of pM1 subclones reveals that the transactivator is encoded by preS/S and not by X sequences. A frameshift mutation within the preS2 open reading frame shows that this portion is indispensable for the trans-activating function. Initiation of transcription has been mapped to the S1 promoter. A comparable trans-activating effect is also observed with cloned wild-type hepatitis B virus sequences similarly truncated. These results show that a transcriptional trans-activator function not present in the intact gene is generated by 3' truncation of integrated hepatitis B virus DNA preS/S sequences

  4. Stress rotations due to the M6.5 foreshock and M7.3 main shock in the 2016 Kumamoto, SW Japan, earthquake sequence

    Science.gov (United States)

    Yoshida, Keisuke; Hasegawa, Akira; Saito, Tatsuhiko; Asano, Youichi; Tanaka, Sachiko; Sawazaki, Kaoru; Urata, Yumi; Fukuyama, Eiichi

    2016-10-01

    A shallow M7.3 event with a M6.5 foreshock occurred along the Futagawa-Hinagu fault zone in Kyushu, SW Japan. We investigated the spatiotemporal variation of the stress orientations in and around the source area of this 2016 Kumamoto earthquake sequence by inverting 1218 focal mechanisms. The results show that the σ3 axis in the vicinity of the fault plane significantly rotated counterclockwise after the M6.5 foreshock and rotated clockwise after the M7.3 main shock in the Hinagu fault segment. This observation indicates that a significant portion of the shear stress was released both by the M6.5 foreshock and M7.3 main shock. It is estimated that the stress release by the M6.5 foreshock occurred in the shallower part of the Hinagu fault segment, which brought the stress concentration in its deeper part. This might have caused the M7.3 main shock rupture mainly along the deeper part of the Hinagu fault segment after 28 h.

  5. POPULATION PARAMETERS OF INTERMEDIATE-AGE STAR CLUSTERS IN THE LARGE MAGELLANIC CLOUD. II. NEW INSIGHTS FROM EXTENDED MAIN-SEQUENCE TURNOFFS IN SEVEN STAR CLUSTERS

    International Nuclear Information System (INIS)

    Goudfrooij, Paul; Kozhurina-Platais, Vera; Puzia, Thomas H.; Chandar, Rupali

    2011-01-01

    We discuss new photometry from high-resolution images of seven intermediate-age (1-2 Gyr) star clusters in the Large Magellanic Cloud taken with the Advanced Camera for Surveys on board the Hubble Space Telescope. We fit color-magnitude diagrams (CMDs) with several different sets of theoretical isochrones and determine systematic uncertainties for population parameters when derived using any one set of isochrones. The cluster CMDs show several interesting features, including extended main-sequence turnoff (MSTO) regions, narrow red giant branches, and clear sequences of unresolved binary stars. We show that the extended MSTOs are not caused by photometric uncertainties, contamination by field stars, or the presence of binary stars. Enhanced helium abundances in a fraction of cluster stars are also ruled out as the reason for the extended MSTOs. Quantitative comparisons with simulations indicate that the MSTO regions are better described by a spread in ages than by a bimodal age distribution, although we cannot formally rule out the latter for the three lowest-mass clusters in our sample (which have masses lower than ∼3 x 10 4 M sun ). This conclusion differs from that of some previous works which suggested that the age distribution in massive clusters in our sample is bimodal. This suggests that any secondary star formation occurred in an extended fashion rather than through short bursts. We discuss these results in the context of the nature of multiple stellar populations in star clusters.

  6. Extended Main-sequence Turn-offs in Intermediate-age Star Clusters: Stellar Rotation Diminishes, but Does Not Eliminate, Age Spreads

    Energy Technology Data Exchange (ETDEWEB)

    Goudfrooij, Paul; Correnti, Matteo [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Girardi, Léo, E-mail: goudfroo@stsci.edu [Osservatorio Astronomico di Padova—INAF, Vicolo dell’Osservatorio 5, I-35122 Padova (Italy)

    2017-09-01

    Extended main-sequence turn-off (eMSTO) regions are a common feature in color–magnitude diagrams of young- and intermediate-age star clusters in the Magellanic Clouds. The nature of eMSTOs remains debated in the literature. The currently most popular scenarios are extended star formation activity and ranges of stellar rotation rates. Here we study details of differences in main-sequence turn-off (MSTO) morphology expected from spreads in age versus spreads in rotation rates, using Monte Carlo simulations with the Geneva syclist isochrone models that include the effects of stellar rotation. We confirm a recent finding of Niederhofer et al. that a distribution of stellar rotation velocities yields an MSTO extent that is proportional to the cluster age, as observed. However, we find that stellar rotation yields MSTO crosscut widths that are generally smaller than observed ones at a given age. We compare the simulations with high-quality Hubble Space Telescope data of NGC 1987 and NGC 2249, which are the two only relatively massive star clusters with an age of ∼1 Gyr for which such data is available. We find that the distribution of stars across the eMSTOs of these clusters cannot be explained solely by a distribution of stellar rotation velocities, unless the orientations of rapidly rotating stars are heavily biased toward an equator-on configuration. Under the assumption of random viewing angles, stellar rotation can account for ∼60% and ∼40% of the observed FWHM widths of the eMSTOs of NGC 1987 and NGC 2249, respectively. In contrast, a combination of distributions of stellar rotation velocities and stellar ages fits the observed eMSTO morphologies very well.

  7. PHIBSS: MOLECULAR GAS CONTENT AND SCALING RELATIONS IN z ∼ 1-3 MASSIVE, MAIN-SEQUENCE STAR-FORMING GALAXIES

    International Nuclear Information System (INIS)

    Tacconi, L. J.; Genzel, R.; Wuyts, S.; Förster Schreiber, N. M.; Gracia-Carpio, J.; Lutz, D.; Saintonge, A.; Neri, R.; Cox, P.; Combes, F.; Bolatto, A.; Cooper, M. C.; Bournaud, F.; Burkert, A.; Comerford, J.; Davis, M.; Newman, S.; García-Burillo, S.; Naab, T.; Omont, A.

    2013-01-01

    We present PHIBSS, the IRAM Plateau de Bure high-z blue sequence CO 3-2 survey of the molecular gas properties in massive, main-sequence star-forming galaxies (SFGs) near the cosmic star formation peak. PHIBSS provides 52 CO detections in two redshift slices at z ∼ 1.2 and 2.2, with log(M * (M ☉ )) ≥ 10.4 and log(SFR(M ☉ /yr)) ≥ 1.5. Including a correction for the incomplete coverage of the M * -SFR plane, and adopting a ''Galactic'' value for the CO-H 2 conversion factor, we infer average gas fractions of ∼0.33 at z ∼ 1.2 and ∼0.47 at z ∼ 2.2. Gas fractions drop with stellar mass, in agreement with cosmological simulations including strong star formation feedback. Most of the z ∼ 1-3 SFGs are rotationally supported turbulent disks. The sizes of CO and UV/optical emission are comparable. The molecular-gas-star-formation relation for the z = 1-3 SFGs is near-linear, with a ∼0.7 Gyr gas depletion timescale; changes in depletion time are only a secondary effect. Since this timescale is much less than the Hubble time in all SFGs between z ∼ 0 and 2, fresh gas must be supplied with a fairly high duty cycle over several billion years. At given z and M * , gas fractions correlate strongly with the specific star formation rate (sSFR). The variation of sSFR between z ∼ 0 and 3 is mainly controlled by the fraction of baryonic mass that resides in cold gas.

  8. An assessment of time involved in pre-test case review and counseling for a whole genome sequencing clinical research program.

    Science.gov (United States)

    Williams, Janet L; Faucett, W Andrew; Smith-Packard, Bethanny; Wagner, Monisa; Williams, Marc S

    2014-08-01

    Whole genome sequencing (WGS) is being used for evaluation of individuals with undiagnosed disease of suspected genetic origin. Implementing WGS into clinical practice will place an increased burden upon care teams with regard to pre-test patient education and counseling about results. To quantitate the time needed for appropriate pre-test evaluation of participants in WGS testing, we documented the time spent by our clinical research group on various activities related to program preparation, participant screening, and consent prior to WGS. Participants were children or young adults with autism, intellectual or developmental disability, and/or congenital anomalies, who have remained undiagnosed despite previous evaluation, and their biologic parents. Results showed that significant time was spent in securing allocation of clinical research space to counsel participants and families, and in acquisition and review of participant's medical records. Pre-enrollment chart review identified two individuals with existing diagnoses resulting in savings of $30,000 for the genome sequencing alone, as well as saving hours of personnel time for genome interpretation and communication of WGS results. New WGS programs should plan for costs associated with additional pre-test administrative planning and patient evaluation time that will be required to provide high quality care.

  9. Background reduction of the KATRIN spectrometers. Transmission function of the pre-spectrometer and systematic tests of the main-spectrometer wire electrode

    Energy Technology Data Exchange (ETDEWEB)

    Prall, Matthias

    2011-07-04

    The KArlsruhe TRItium Neutrino experiment, KATRIN will determine the mass of the anti {nu}{sub e} with a sensitivity of 0.2 eV (90% C.L.) via a measurement of the {beta}-spectrum of tritium decaying in a windowless gaseous molecular tritium source near its endpoint of 18.57 keV. This approach relies exclusively on the relativistic kinematics of the decay products rendering the experiment model independent and reducing the systematic uncertainty. An ultra-low background of a few mHz and an energy resolution of 0.93 eV are among the requirements to reach the sensitivity. These demands are fulfilled with the main spectrometer (MS). While the {beta}-decay electrons are guided by a magnetic field through the experiment, the MS acts as a high-pass filter for the {beta}-decay electrons. Only those above an energy barrier, the retarding potential, are transmitted to the detector. The last about 30 eV of the T{sub 2} {beta}-spectrum will be scanned in this way. The MS is equipped with a 650 m{sup 2}, two-layered, UHV compatible and quasi-massless wire electrode suppressing secondary electron background originating at the main-spectrometer walls and caused by residual radioactivity and cosmic muons. Its energy resolution of 0.93 eV is only achieved, if a large part of the 248 wire electrode modules, which determine the electric field inside the MS, has a mechanical precision of 0.2 mm. Not a single of the about 28.000 wires of the electrode must break during the lifetime of KATRIN. A 2-dimensional laser sensor for contact-less position (precision about 0.01 mm) and tension (precision about 0.04 N) measurements was developed and applied, to firstly, verify the mechanical precision of the electrode modules and secondly, to examine their reliability. A 3-dimensional coordinate measurement table was automated to perform these measurements in a clean room. This table was also used to verify the precision of components using a camera system and image recognition methods (0.05 mm

  10. GOODS-HERSCHEL: STAR FORMATION, DUST ATTENUATION, AND THE FIR–RADIO CORRELATION ON THE MAIN SEQUENCE OF STAR-FORMING GALAXIES UP TO z ≃ 4

    Energy Technology Data Exchange (ETDEWEB)

    Pannella, M.; Elbaz, D.; Daddi, E.; Hwang, H. S.; Schreiber, C.; Strazzullo, V.; Aussel, H.; Bethermin, M.; Cibinel, A.; Juneau, S.; Floc’h, E. Le; Leiton, R. [Laboratoire AIM-Paris-Saclay, CEA/DSM/Irfu—CNRS—Université Paris Diderot, CEA-Saclay, F-91191 Gif-sur-Yvette (France); Dickinson, M. [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Buat, V. [Aix-Marseille Université, CNRS, LAM (Laboratoire d’Astrophysique de Marseille) UMR7326, F-13388, Marseille (France); Charmandaris, V.; Magdis, G. [Institute for Astronomy, Astrophysics, Space Applications and Remote Sensing, National Observatory of Athens, 15236, Penteli (Greece); Ivison, R. J. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching (Germany); Borgne, D. Le [Institut d’Astrophysique de Paris, UMR 7095, CNRS, 98bis boulevard Arago, F-75005 Paris (France); Lin, L. [Institute of Astronomy and Astrophysics, Academia Sinica, Taipei 106, Taiwan (China); Morrison, G. E. [Institute for Astronomy, University of Hawaii, Honolulu, Hawaii, HI-96822 (United States); and others

    2015-07-10

    We use deep panchromatic data sets in the GOODS-N field, from GALEX to the deepest Herschel far-infrared (FIR) and VLA radio continuum imaging, to explore the evolution of star-formation activity and dust attenuation properties of star-forming galaxies to z ≃ 4, using mass-complete samples. Our main results can be summarized as follows: (i) the slope of the star-formation rate–M{sub *} correlation is consistent with being constant ≃0.8 up to z ≃ 1.5, while its normalization keeps increasing with redshift; (ii) for the first time we are able to explore the FIR–radio correlation for a mass-selected sample of star-forming galaxies: the correlation does not evolve up to z ≃ 4; (iii) we confirm that galaxy stellar mass is a robust proxy for UV dust attenuation in star-forming galaxies, with more massive galaxies being more dust attenuated. Strikingly, we find that this attenuation relation evolves very weakly with redshift, with the amount of dust attenuation increasing by less than 0.3 mag over the redshift range [0.5–4] for a fixed stellar mass; (iv) the correlation between dust attenuation and the UV spectral slope evolves with redshift, with the median UV slope becoming bluer with redshift. By z ≃ 3, typical UV slopes are inconsistent, given the measured dust attenuations, with the predictions of commonly used empirical laws. (v) Finally, building on existing results, we show that gas reddening is marginally larger (by a factor of around 1.3) than the stellar reddening at all redshifts probed. Our results support a scenario where the ISM conditions of typical star-forming galaxies evolve with redshift, such that at z ≥ 1.5 Main Sequence galaxies have ISM conditions moving closer to those of local starbursts.

  11. RADIO PROPERTIES OF THE BAT AGNs: THE FIR–RADIO RELATION, THE FUNDAMENTAL PLANE, AND THE MAIN SEQUENCE OF STAR FORMATION

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Krista Lynne; Mushotzky, Richard F.; Vogel, Stuart; Shimizu, Thomas T. [Department of Astronomy, University of Maryland, College Park, MD 20742 (United States); Miller, Neal, E-mail: klsmith@astro.umd.edu [Department of Mathematics and Physics, Stevenson University, Stevenson, MD 21117 (United States)

    2016-12-01

    We conducted 22 GHz 1″ JVLA imaging of 70 radio-quiet active galactic nuclei (AGNs) from the Swift -BAT survey. We find radio cores in all but three objects. The radio morphologies of the sample fall into three groups: compact and core-dominated, extended, and jet-like. We spatially decompose each image into core flux and extended flux, and compare the extended radio emission with that predicted from previous Herschel observations using the canonical FIR–radio relation. After removing the AGN contribution to the FIR and radio flux densities, we find that the relation holds remarkably well despite the potentially different star formation physics in the circumnuclear environment. We also compare our core radio flux densities with predictions of coronal models and scale-invariant jet models for the origin of radio emission in radio-quiet AGNs, and find general consistency with both models. However, we find that the L {sub R}/ L {sub X} relation does not distinguish between star formation and non-relativistic AGN-driven outflows as the origin of radio emission in radio-quiet AGNs. Finally, we examine where objects with different radio morphologies fall in relation to the main sequence (MS) of star formation, and conclude that those AGNs that fall below the MS, as X-ray selected AGNs have been found to do, have core-dominated or jet-like 22 GHz morphologies.

  12. Connecting Pre-Service Teachers with Contemporary Mathematics Practices: Selecting and Sequencing Students' Work Samples

    Science.gov (United States)

    Livy, Sharyn; Muir, Tracey; Downton, Ann

    2017-01-01

    One of the challenges facing teacher educators is providing our pre-service teachers (PSTs) with authentic experiences that cross the boundaries between Initial Teacher Education (ITE) and the classroom. An additional challenge facing the mathematics teacher educator, is addressing and deepening PSTs' mathematical content knowledge (MCK), which…

  13. Escherichia coli Sequence Type 131 H30 Is the Main Driver of Emerging Extended-Spectrum-β-Lactamase-Producing E. coli at a Tertiary Care Center.

    Science.gov (United States)

    Johnson, James R; Johnston, Brian; Thuras, Paul; Launer, Bryn; Sokurenko, Evgeni V; Miller, Loren G

    2016-01-01

    The H 30 strain of Escherichia coli sequence type 131 (ST131- H 30) is a recently emerged, globally disseminated lineage associated with fluoroquinolone resistance and, via its H 30Rx subclone, the CTX-M-15 extended-spectrum beta-lactamase (ESBL). Here, we studied the clonal background and resistance characteristics of 109 consecutive recent E. coli clinical isolates (2015) and 41 historical ESBL-producing E. coli blood isolates (2004 to 2011) from a public tertiary care center in California with a rising prevalence of ESBL-producing E. coli isolates. Among the 2015 isolates, ST131, which was represented mainly by ST131- H 30, was the most common clonal lineage (23% overall). ST131- H 30 accounted for 47% (8/17) of ESBL-producing, 47% (14/30) of fluoroquinolone-resistant, and 33% (11/33) of multidrug-resistant isolates. ST131- H 30 also accounted for 53% (8/14) of dually fluoroquinolone-resistant, ESBL-producing isolates, with the remaining 47% comprised of diverse clonal groups that contributed a single isolate each. ST131- H 30Rx, with CTX-M-15, was the major ESBL producer (6/8) among ST131- H 30 isolates. ST131- H 30 and H 30Rx also dominated (46% and 37%, respectively) among the historical ESBL-producing isolates (2004 to 2011), without significant temporal shifts in relative prevalence. Thus, this medical center's recently emerging ESBL-producing E. coli strains, although multiclonal, are dominated by ST131- H 30 and H 30Rx, which are the only clonally expanded fluoroquinolone-resistant, ESBL-producing lineages. Measures to rapidly and effectively detect, treat, and control these highly successful lineages are needed. IMPORTANCE The ever-rising prevalence of resistance to first-line antibiotics among clinical Escherichia coli isolates leads to worse clinical outcomes and higher health care costs, thereby creating a need to discover its basis so that effective interventions can be developed. We found that the H 30 subset within E. coli sequence type 131

  14. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Energy Technology Data Exchange (ETDEWEB)

    Bellini, A.; Anderson, J.; Van der Marel, R. P. [Space Telescope Science Institute, 3700 San Martin Dr., Baltimore, MD 21218 (United States); Milone, A. P.; Marino, A. F. [Research School of Astronomy and Astrophysics, Australian National University, Mt Stromlo Observatory, via Cotter Rd, Weston, ACT 2611 (Australia); Piotto, G.; Bedin, L. R. [Istituto Nazionale di Astrofisica, Osservatorio Astronomico di Padova, Vicolo dell’Osservatorio 5, Padova, I-35122 (Italy); King, I. R., E-mail: bellini@stsci.edu [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States)

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with.

  15. A HIGHLY CONSISTENT FRAMEWORK FOR THE EVOLUTION OF THE STAR-FORMING ''MAIN SEQUENCE'' FROM z ∼ 0-6

    Energy Technology Data Exchange (ETDEWEB)

    Speagle, J. S. [Harvard University Department of Astronomy, 60 Garden Street, MS 46, Cambridge, MA 02138 (United States); Steinhardt, C. L.; Silverman, J. D. [Kavli IPMU, University of Tokyo, Kashiwanoha 5-1-5, Kashiwa-shi, Chiba 277-8583 (Japan); Capak, P. L., E-mail: jspeagle@cfa.harvard.edu [California Institute of Technology, MC 105-24, 1200 East California Boulevard, Pasadena, CA 91125 (United States)

    2014-10-01

    Using a compilation of 25 studies from the literature, we investigate the evolution of the star-forming galaxy (SFG) main sequence (MS) in stellar mass and star formation rate (SFR) out to z ∼ 6. After converting all observations to a common set of calibrations, we find a remarkable consensus among MS observations (∼0.1 dex 1σ interpublication scatter). By fitting for time evolution of the MS in bins of constant mass, we deconvolve the observed scatter about the MS within each observed redshift bin. After accounting for observed scatter between different SFR indicators, we find the width of the MS distribution is ∼0.2 dex and remains constant over cosmic time. Our best fits indicate the slope of the MS is likely time-dependent, with our best-fit log SFR(M {sub *}, t) = (0.84 ± 0.02 – 0.026 ± 0.003 × t)log M {sub *} – (6.51 ± 0.24 – 0.11 ± 0.03 × t), where t is the age of the universe in Gyr. We use our fits to create empirical evolutionary tracks in order to constrain MS galaxy star formation histories (SFHs), finding that (1) the most accurate representations of MS SFHs are given by delayed-τ models, (2) the decline in fractional stellar mass growth for a ''typical'' MS galaxy today is approximately linear for most of its lifetime, and (3) scatter about the MS can be generated by galaxies evolving along identical evolutionary tracks assuming an initial 1σ spread in formation times of ∼1.4 Gyr.

  16. The State-of-the-art HST Astro-photometric Analysis of the Core of ω Centauri. III. The Main Sequence's Multiple Populations Galore

    Science.gov (United States)

    Bellini, A.; Milone, A. P.; Anderson, J.; Marino, A. F.; Piotto, G.; van der Marel, R. P.; Bedin, L. R.; King, I. R.

    2017-08-01

    We take advantage of the exquisite quality of the Hubble Space Telescope 26-filter astro-photometric catalog of the core of ω Cen presented in the first paper of this series and the empirical differential-reddening correction presented in the second paper in order to distill the main sequence into its constituent populations. To this end, we restrict ourselves to the five most useful filters: the magic “trio” of F275W, F336W, and F438W, along with F606W and F814W. We develop a strategy for identifying color systems where different populations stand out most distinctly, then we isolate those populations and examine them in other filters where their subpopulations also come to light. In this way, we have identified at least 15 subpopulations, each of which has a distinctive fiducial curve through our five-dimensional photometric space. We confirm the MSa to be split into two subcomponents, and find that both the bMS and the rMS are split into three subcomponents. Moreover, we have discovered two additional MS groups: the MSd (which has three subcomponents) shares similar properties with the bMS, and the MSe (which has four subcomponents) has properties more similar to those of the rMS. We examine the fiducial curves together and use synthetic spectra to infer relative heavy-element, light-element, and helium abundances for the populations. Our findings show that the stellar populations and star formation history of ω Cen are even more complex than inferred previously. Finally, we provide as a supplement to the original catalog a list that identifies for each star which population it is most likely associated with. Based on archival observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by AURA, Inc., under NASA contract NAS 5-26555.

  17. A HIGHER EFFICIENCY OF CONVERTING GAS TO STARS PUSHES GALAXIES AT z ∼ 1.6 WELL ABOVE THE STAR-FORMING MAIN SEQUENCE

    Energy Technology Data Exchange (ETDEWEB)

    Silverman, J. D.; Rujopakarn, W. [Kavli Institute for the Physics and Mathematics of the Universe (WPI), The University of Tokyo Institutes for Advanced Study, The University of Tokyo, Kashiwa, Chiba 277-8583 (Japan); Daddi, E.; Liu, D. [Laboratoire AIM, CEA/DSM-CNRS-Universite Paris Diderot, Irfu/Service d’Astrophysique, CEA Saclay (France); Rodighiero, G. [Dipartimento di Fisica e Astronomia, Universita di Padova, vicolo Osservatorio, 3, I-35122 Padova (Italy); Sargent, M. [Astronomy Centre, Department of Physics and Astronomy, University of Sussex, Brighton BN1 9QH (United Kingdom); Renzini, A. [Instituto Nazionale de Astrofisica, Osservatorio Astronomico di Padova, v.co dell’Osservatorio 5, I-35122 Padova (Italy); Feruglio, C. [IRAM—Institut de RadioAstronomie Millimétrique, 300 rue de la Piscine, F-38406 Saint Martin d’Hères (France); Kashino, D. [Division of Particle and Astrophysical Science, Graduate School of Science, Nagoya University, Nagoya 464-8602 (Japan); Sanders, D. [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Kartaltepe, J. [National Optical Astronomy Observatory, 950 N. Cherry Avenue, Tucson, AZ 85719 (United States); Nagao, T. [Graduate School of Science and Engineering, Ehime University, 2-5 Bunkyo-cho, Matsuyama 790-8577 (Japan); Arimoto, N. [Subaru Telescope, 650 North A’ohoku Place, Hilo, HI-96720 (United States); Berta, S.; Lutz, D. [Max-Planck-Institut für extraterrestrische Physik, D-84571 Garching (Germany); Béthermin, M. [European Southern Observatory, Karl-Schwarzschild-Strasse 2, D-85748 Garching (Germany); Koekemoer, A., E-mail: john.silverman@ipmu.jp [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD, 21218 (United States); and others

    2015-10-20

    Local starbursts have a higher efficiency of converting gas into stars, as compared to typical star-forming galaxies at a given stellar mass, possibly indicative of different modes of star formation. With the peak epoch of galaxy formation occurring at z > 1, it remains to be established whether such an efficient mode of star formation is occurring at high redshift. To address this issue, we measure the molecular gas content of seven high-redshift (z ∼ 1.6) starburst galaxies with the Atacama Large Millimeter/submillimeter Array and IRAM/Plateau de Bure Interferometer. Our targets are selected from the sample of Herschel far-infrared-detected galaxies having star formation rates (∼300–800 M{sub ⊙} yr{sup −1}) elevated (≳4×) above the star-forming main sequence (MS) and included in the FMOS-COSMOS near-infrared spectroscopic survey of star-forming galaxies at z ∼ 1.6 with Subaru. We detect CO emission in all cases at high levels of significance, indicative of high gas fractions (∼30%–50%). Even more compelling, we firmly establish with a clean and systematic selection that starbursts, identified as MS outliers, at high redshift generally have a lower ratio of CO to total infrared luminosity as compared to typical MS star-forming galaxies, although with a smaller offset than expected based on past studies of local starbursts. We put forward a hypothesis that there exists a continuous increase in star formation efficiency with elevation from the MS with galaxy mergers as a possible physical driver. Along with a heightened star formation efficiency, our high-redshift sample is similar in other respects to local starbursts, such as being metal rich and having a higher ionization state of the interstellar medium.

  18. Pre-Carboniferous sedimentary sequences of the northeastern flank of the Parana basin and southwestern of the Parnaiba basin and its uraniferous possibilites

    International Nuclear Information System (INIS)

    Andrade, S.M. de; Camarco, P.E.N.

    1982-01-01

    The analyses of the already existent geological data of the northeastern flank of the Parana Basin and the Southwestern flank of the Parnaiba Basin, added to new data from drilling and geological mapping allowed a better knowledge of the stratigraphy of the pre-carboniferous sedimentary sequences (silurian and devonian ages) as well as provided subsidies for the definition of its uranium possibilites. Besides the already known uranium deposits of the Ponta Grossa Formation, is should be considered as worth while of prospecting the Pimenteiras Formation. (Author) [pt

  19. LUMINOSITY DISCREPANCY IN THE EQUAL-MASS, PRE-MAIN-SEQUENCE ECLIPSING BINARY PAR 1802: NON-COEVALITY OR TIDAL HEATING?

    International Nuclear Information System (INIS)

    Gómez Maqueo Chew, Yilen; Stassun, Keivan G.; Hebb, Leslie; Prša, Andrej; Stempels, Eric; Barnes, Rory; Heller, René; Mathieu, Robert D.

    2012-01-01

    Parenago 1802, a member of the ∼1 Myr Orion Nebula Cluster, is a double-lined, detached eclipsing binary in a 4.674 day orbit, with equal-mass components (M 2 /M 1 = 0.985 ± 0.029). Here we present extensive VI C JHK S light curves (LCs) spanning ∼15 yr, as well as a Keck/High Resolution Echelle Spectrometer (HIRES) optical spectrum. The LCs evince a third light source that is variable with a period of 0.73 days, and is also manifested in the high-resolution spectrum, strongly indicating the presence of a third star in the system, probably a rapidly rotating Classical T Tauri star. We incorporate this third light into our radial velocity and LC modeling of the eclipsing pair, measuring accurate masses (M 1 = 0.391 ± 0.032 and M 2 = 0.385 ± 0.032 M ☉ ), radii (R 1 = 1.73 ± 0.02 and R 2 = 1.62 ± 0.02 R ☉ ), and temperature ratio (T eff,1 /T eff,2 = 1.0924 ± 0.0017). Thus, the radii of the eclipsing stars differ by 6.9% ± 0.8%, the temperatures differ by 9.2% ± 0.2%, and consequently the luminosities differ by 62% ± 3%, despite having masses equal to within 3%. This could be indicative of an age difference of ∼3 × 10 5 yr between the two eclipsing stars, perhaps a vestige of the binary formation history. We find that the eclipsing pair is in an orbit that has not yet fully circularized, e = 0.0166 ± 0.003. In addition, we measure the rotation rate of the eclipsing stars to be 4.629 ± 0.006 days; they rotate slightly faster than their 4.674 day orbit. The non-zero eccentricity and super-synchronous rotation suggest that the eclipsing pair should be tidally interacting, so we calculate the tidal history of the system according to different tidal evolution theories. We find that tidal heating effects can explain the observed luminosity difference of the eclipsing pair, providing an alternative to the previously suggested age difference.

  20. LUMINOSITY DISCREPANCY IN THE EQUAL-MASS, PRE-MAIN-SEQUENCE ECLIPSING BINARY PAR 1802: NON-COEVALITY OR TIDAL HEATING?

    Energy Technology Data Exchange (ETDEWEB)

    Gomez Maqueo Chew, Yilen; Stassun, Keivan G.; Hebb, Leslie [Department of Physics and Astronomy, Vanderbilt University, Nashville, TN 37235 (United States); Prsa, Andrej [Department of Astronomy and Astrophysics, Villanova University, Villanova, PA 19085 (United States); Stempels, Eric [Department of Astronomy and Space Physics, Uppsala University, SE-752 67 Uppsala (Sweden); Barnes, Rory [Department of Astronomy, University of Washington, Seattle, WA 98195 (United States); Heller, Rene [Leibniz-Institut fuer Astrophysik Potsdam (AIP), An der Sternwarte 16, 14482 Potsdam (Germany); Mathieu, Robert D., E-mail: yilen.gomez@vanderbilt.edu [Department of Astronomy, University of Wisconsin-Madison, Madison, WI 53706 (United States)

    2012-01-20

    Parenago 1802, a member of the {approx}1 Myr Orion Nebula Cluster, is a double-lined, detached eclipsing binary in a 4.674 day orbit, with equal-mass components (M{sub 2}/M{sub 1} = 0.985 {+-} 0.029). Here we present extensive VI{sub C} JHK{sub S} light curves (LCs) spanning {approx}15 yr, as well as a Keck/High Resolution Echelle Spectrometer (HIRES) optical spectrum. The LCs evince a third light source that is variable with a period of 0.73 days, and is also manifested in the high-resolution spectrum, strongly indicating the presence of a third star in the system, probably a rapidly rotating Classical T Tauri star. We incorporate this third light into our radial velocity and LC modeling of the eclipsing pair, measuring accurate masses (M{sub 1} = 0.391 {+-} 0.032 and M{sub 2} = 0.385 {+-} 0.032 M{sub Sun }), radii (R{sub 1} = 1.73 {+-} 0.02 and R{sub 2} = 1.62 {+-} 0.02 R{sub Sun }), and temperature ratio (T{sub eff,1}/T{sub eff,2} = 1.0924 {+-} 0.0017). Thus, the radii of the eclipsing stars differ by 6.9% {+-} 0.8%, the temperatures differ by 9.2% {+-} 0.2%, and consequently the luminosities differ by 62% {+-} 3%, despite having masses equal to within 3%. This could be indicative of an age difference of {approx}3 Multiplication-Sign 10{sup 5} yr between the two eclipsing stars, perhaps a vestige of the binary formation history. We find that the eclipsing pair is in an orbit that has not yet fully circularized, e = 0.0166 {+-} 0.003. In addition, we measure the rotation rate of the eclipsing stars to be 4.629 {+-} 0.006 days; they rotate slightly faster than their 4.674 day orbit. The non-zero eccentricity and super-synchronous rotation suggest that the eclipsing pair should be tidally interacting, so we calculate the tidal history of the system according to different tidal evolution theories. We find that tidal heating effects can explain the observed luminosity difference of the eclipsing pair, providing an alternative to the previously suggested age difference.

  1. Variability of Disk Emission in Pre-main-sequence and Related Stars. IV. Investigating the Structural Changes in the Inner Disk Region of MWC 480

    Science.gov (United States)

    Fernandes, Rachel B.; Long, Zachary C.; Pikhartova, Monika; Sitko, Michael L.; Grady, Carol A.; Russell, Ray W.; Luria, David M.; Tyler, Dakotah B.; Bayyari, Ammar; Danchi, William; Wisniewski, John P.

    2018-04-01

    We present five epochs of near-IR observations of the protoplanetary disk around MWC 480 (HD 31648) obtained with the SpeX spectrograph on NASA’s Infrared Telescope Facility between 2007 and 2013, inclusive. Using the measured line fluxes in the Pa β and Br γ lines, we found the mass accretion rates to be (1.26–2.30) × 10‑7 M ⊙ yr‑1 and (1.4–2.01) × 10‑7 M ⊙ yr‑1, respectively, but which varied by more than 50% from epoch to epoch. The spectral energy distribution reveals a variability of about 30% between 1.5 and 10 μm during this same period of time. We investigated the variability using of the continuum emission of the disk in using the Monte-Carlo Radiative Transfer Code HOCHUNK3D. We find that varying the height of the inner rim successfully produces a change in the NIR flux but lowers the far-IR emission to levels below all measured fluxes. Because the star exhibits bipolar flows, we utilized a structure that simulates an inner disk wind to model the variability in the near-IR, without producing flux levels in the far-IR that are inconsistent with existing data. For this object, variable near-IR emission due to such an outflow is more consistent with the data than changing the scale height of the inner rim of the disk.

  2. A CENSUS OF ROTATION AND VARIABILITY IN L1495: A UNIFORM ANALYSIS OF TRANS-ATLANTIC EXOPLANET SURVEY LIGHT CURVES FOR PRE-MAIN-SEQUENCE STARS IN TAURUS

    International Nuclear Information System (INIS)

    Xiao Hongyu; Covey, Kevin R.; Lloyd, James P.; Rebull, Luisa; Charbonneau, David; Mandushev, Georgi; O'Donovan, Francis; Slesnick, Catherine

    2012-01-01

    We analyze light curves obtained by the Trans-atlantic Exoplanet Survey (TrES) for a field centered on the L1495 dark cloud in Taurus. The Spitzer Taurus Legacy Survey catalog identifies 179 bona fide Taurus members within the TrES field; 48 of the known Taurus members are detected by TrES, as well as 26 candidate members identified by the Spitzer Legacy team. We quantify the variability of each star in our sample using the ratio of the standard deviation of the original light curve (σ orig. ) to the standard deviation of a light curve that has been smoothed by 9 or 1001 epochs (σ 9 and σ 1001 , respectively). Known Taurus members typically demonstrate (σ orig. /σ 9 ) orig. /σ 1001 ) orig. /σ 9 ) ∼ 3.0 and (σ orig. /σ 1001 ) ∼ 10, as expected for light curves dominated by unstructured white noise. Of the 74 Taurus members/candidates with TrES light curves, we detect significant variability in 49 sources. Adapting a quantitative metric originally developed to assess the reliability of transit detections, we measure the amount of red and white noise in each light curve and identify 18 known or candidate Taurus members with highly significant period measurements. These appear to be the first periods measured for four of these sources (HD 282276, CX Tau, FP Tau, TrES J042423+265008), and in two other cases, the first non-aliased periods (LkCa 21 and DK Tau AB). For the remainder, the TrES measurements typically agree very well (δP < 1%) with previously reported values. Including periods measured at lower confidence for 15 additional sources, we report periods for 11 objects where no previous periods were found, including 8 confirmed Taurus members. We also identify 10 of the 26 candidate Taurus members that demonstrate variability levels consistent with being bona fide T Tauri stars. A Kolomgorov-Smirnov (K-S) test confirms that these new periods confirm the distinction between the rotation period distributions of stars with and without circumstellar disks, with only a 10% probability of the two populations sharing the same parent period distribution. K-S tests do suggest, however, that the updated Taurus period distribution now more closely resembles those measured in other young star-forming clusters (i.e., NGC 2264, NGC 6530, and the ONC). This improved agreement may reflect the exclusion of long rotation periods which are detected in Taurus at lower significance, and which may be beyond the limits of detectability in more distant star-forming regions.

  3. IN-SYNC. II. VIRIAL STARS FROM SUBVIRIAL CORES—THE VELOCITY DISPERSION OF EMBEDDED PRE-MAIN-SEQUENCE STARS IN NGC 1333

    International Nuclear Information System (INIS)

    Foster, Jonathan B.; Cottaar, Michiel; Meyer, Michael R.; Covey, Kevin R.; Arce, Héctor G.; Nidever, David L.; Stassun, Keivan G.; Tan, Jonathan C.; Da Rio, Nicola; Chojnowski, S. Drew; Majewski, Steven R.; Skrutskie, Michael; Wilson, John C.; Flaherty, Kevin M.; Rebull, Luisa; Frinchaboy, Peter M.; Zasowski, Gail

    2015-01-01

    The initial velocity dispersion of newborn stars is a major unconstrained aspect of star formation theory. Using near-infrared spectra obtained with the APOGEE spectrograph, we show that the velocity dispersion of young (1-2 Myr) stars in NGC 1333 is 0.92 ± 0.12 km s –1 after correcting for measurement uncertainties and the effect of binaries. This velocity dispersion is consistent with the virial velocity of the region and the diffuse gas velocity dispersion, but significantly larger than the velocity dispersion of the dense, star-forming cores, which have a subvirial velocity dispersion of 0.5 km s –1 . Since the NGC 1333 cluster is dynamically young and deeply embedded, this measurement provides a strong constraint on the initial velocity dispersion of newly formed stars. We propose that the difference in velocity dispersion between stars and dense cores may be due to the influence of a 70 μG magnetic field acting on the dense cores or be the signature of a cluster with initial substructure undergoing global collapse

  4. IN-SYNC I: Homogeneous stellar parameters from high-resolution apogee spectra for thousands of pre-main sequence stars

    International Nuclear Information System (INIS)

    Cottaar, Michiel; Meyer, Michael R.; Covey, Kevin R.; Nidever, David L.; Stassun, Keivan G.; Foster, Jonathan B.; Tan, Jonathan C.; Da Rio, Nicola; Chojnowski, S. Drew; Skrutskie, Michael; Majewski, Steven R.; Wilson, John C.; Zasowski, Gail; Flaherty, Kevin M.; Frinchaboy, Peter M.

    2014-01-01

    Over two years, 8859 high-resolution H-band spectra of 3493 young (1-10 Myr) stars were gathered by the multi-object spectrograph of the APOGEE project as part of the IN-SYNC ancillary program of the SDSS-III survey. Here we present the forward modeling approach used to derive effective temperatures, surface gravities, radial velocities, rotational velocities, and H-band veiling from these near-infrared spectra. We discuss in detail the statistical and systematic uncertainties in these stellar parameters. In addition, we present accurate extinctions by measuring the E(J – H) of these young stars with respect to the single-star photometric locus in the Pleiades. Finally, we identify an intrinsic stellar radius spread of about 25% for late-type stars in IC 348 using three (nearly) independent measures of stellar radius, namely, the extinction-corrected J-band magnitude, the surface gravity, and the Rsin i from the rotational velocities and literature rotation periods. We exclude that this spread is caused by uncertainties in the stellar parameters by showing that the three estimators of stellar radius are correlated, so that brighter stars tend to have lower surface gravities and larger Rsin i than fainter stars at the same effective temperature. Tables providing the spectral and photometric parameters for the Pleiades and IC 348 have been provided online.

  5. TIME-SERIES PHOTOMETRY OF STARS IN AND AROUND THE LAGOON NEBULA. I. ROTATION PERIODS OF 290 LOW-MASS PRE-MAIN-SEQUENCE STARS IN NGC 6530

    International Nuclear Information System (INIS)

    Henderson, Calen B.; Stassun, Keivan G.

    2012-01-01

    We have conducted a long-term, wide-field, high-cadence photometric monitoring survey of ∼50,000 stars in the Lagoon Nebula H II region. This first paper presents rotation periods for 290 low-mass stars in NGC 6530, the young cluster illuminating the nebula, and for which we assemble a catalog of infrared and spectroscopic disk indicators, estimated masses and ages, and X-ray luminosities. The distribution of rotation periods we measure is broadly uniform for 0.5 days X /L bol ≈ –3.3). However, we find a significant positive correlation between L X /L bol and corotation radius, suggesting that the observed X-ray luminosities are regulated by centrifugal stripping of the stellar coronae. The period-mass relationship in NGC 6530 is broadly similar to that of the Orion Nebula Cluster (ONC), but the slope of the relationship among the slowest rotators differs from that in the ONC and other young clusters. We show that the slope of the period-mass relationship for the slowest rotators can be used as a proxy for the age of a young cluster, and we argue that NGC 6530 may be slightly younger than the ONC, making it a particularly important touchstone for models of angular momentum evolution in young, low-mass stars.

  6. Evaluation of two main RNA-seq approaches for gene quantification in clinical RNA sequencing: polyA+ selection versus rRNA depletion.

    Science.gov (United States)

    Zhao, Shanrong; Zhang, Ying; Gamini, Ramya; Zhang, Baohong; von Schack, David

    2018-03-19

    To allow efficient transcript/gene detection, highly abundant ribosomal RNAs (rRNA) are generally removed from total RNA either by positive polyA+ selection or by rRNA depletion (negative selection) before sequencing. Comparisons between the two methods have been carried out by various groups, but the assessments have relied largely on non-clinical samples. In this study, we evaluated these two RNA sequencing approaches using human blood and colon tissue samples. Our analyses showed that rRNA depletion captured more unique transcriptome features, whereas polyA+ selection outperformed rRNA depletion with higher exonic coverage and better accuracy of gene quantification. For blood- and colon-derived RNAs, we found that 220% and 50% more reads, respectively, would have to be sequenced to achieve the same level of exonic coverage in the rRNA depletion method compared with the polyA+ selection method. Therefore, in most cases we strongly recommend polyA+ selection over rRNA depletion for gene quantification in clinical RNA sequencing. Our evaluation revealed that a small number of lncRNAs and small RNAs made up a large fraction of the reads in the rRNA depletion RNA sequencing data. Thus, we recommend that these RNAs are specifically depleted to improve the sequencing depth of the remaining RNAs.

  7. The evolution of stellar metallicity gradients of the Milky Way disk from LSS-GAC main sequence turn-off stars: a two-phase disk formation history?

    International Nuclear Information System (INIS)

    Xiang, Mao-Sheng; Liu, Xiao-Wei; Huang, Yang; Wang, Chun; Ren, Juan-Juan; Chen, Bing-Qiu; Sun, Ning-Chen; Zhang, Hua-Wei; Yuan, Hai-Bo; Rebassa-Mansergas, Alberto; Huo, Zhi-Ying

    2015-01-01

    Accurate measurements of stellar metallicity gradients in the radial and vertical directions of the disk and their temporal variations provide important constraints on the formation and evolution of the Milky Way disk. We use 297 042 main sequence turn-off stars selected from the LAMOST Spectroscopic Survey of the Galactic Anti-center (LSS-GAC) to determine the radial and vertical gradients of stellar metallicity, Δ[Fe/H]/ΔR and Δ[Fe/H]/Δ|Z| of the Milky Way disk in the direction of the anticenter. We determine ages of those turn-off stars by isochrone fitting and measure the temporal variations of metallicity gradients. We have carried out a detailed analysis of the selection effects resulting from the selection, observation and data reduction of LSS-GAC targets and the potential biases of a magnitude limited sample on the determinations of metallicity gradients. Our results show that the gradients, both in the radial and vertical directions, exhibit significant spatial and temporal variations. The radial gradients yielded by stars with the oldest ages (≳ 11 Gyr) are essentially zero at all heights from the disk midplane, while those given by younger stars are always negative. The vertical gradients deduced from stars with the oldest ages (≳ 11 Gyr) are negative and only show very weak variations with Galactocentric distance in the disk plane, R, while those yielded by younger stars show strong variations with R. After being essentially flat at the earliest epochs of disk formation, the radial gradients steepen as age decreases, reaching a maximum (steepest) at age 7–8 Gyr, and then they flatten again. Similar temporal trends are also found for the vertical gradients. We infer that the assembly of the Milky Way disk may have experienced at least two distinct phases. The earlier phase is probably related to a slow, pressure-supported collapse of gas, when the gas settles down to the disk mainly in the vertical direction. In the later phase, there are

  8. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-02-15

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

  9. Blind pre-analysis of the main building complex WWER-440/213 Paks for comparison of analytical and experimental results obtained by explosive testing (task 7a of workplan 95/96)

    International Nuclear Information System (INIS)

    1999-01-01

    Within the research programme on Benchmark studies of seismic analysis of WWER type reactors the blind pre-analysis must be prepared for the main building complex of Paks NPP, based on given excitations derived from explosion tests. The aim of the investigation was to validate different idealization concepts (mathematical models for the idealization of the structures and the soil) as well as investigation procedures (time domain and frequency domain analysis) and finally the software tools by comparing dynamic properties (eigenfrequencies, eigenmodes, modal values) and structural response results (time histories and response spectra). This report contains results of the blind pre-analysis performed by using three dimensional idealization of the main building complex (reactor building, turbine house, galleries) by means of time and frequency domian calculation procedures

  10. Making the most of RNA-seq: Pre-processing sequencing data with Opossum for reliable SNP variant detection [version 2; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Laura Oikkonen

    2017-03-01

    Full Text Available Identifying variants from RNA-seq (transcriptome sequencing data is a cost-effective and versatile complement to whole-exome (WES and whole-genome sequencing (WGS analysis. RNA-seq (transcriptome sequencing is primarily considered a method of gene expression analysis but it can also be used to detect DNA variants in expressed regions of the genome. However, current variant callers do not generally behave well with RNA-seq data due to reads encompassing intronic regions. We have developed a software programme called Opossum to address this problem. Opossum pre-processes RNA-seq reads prior to variant calling, and although it has been designed to work specifically with Platypus, it can be used equally well with other variant callers such as GATK HaplotypeCaller. In this work, we show that using Opossum in conjunction with either Platypus or GATK HaplotypeCaller maintains precision and improves the sensitivity for SNP detection compared to the GATK Best Practices pipeline. In addition, using it in combination with Platypus offers a substantial reduction in run times compared to the GATK pipeline so it is ideal when there are only limited time or computational resources available.

  11. Estimating usual intakes mainly affects the micronutrient distribution among infants, toddlers and pre-schoolers from the 2012 Mexican National Health and Nutrition Survey.

    Science.gov (United States)

    Piernas, Carmen; Miles, Donna R; Deming, Denise M; Reidy, Kathleen C; Popkin, Barry M

    2016-04-01

    To compare estimates from one day with usual intake estimates to evaluate how the adjustment for within-person variability affected nutrient intake and adequacy in Mexican children. In order to obtain usual nutrient intakes, the National Cancer Institute's method was used to correct the first 24 h dietary recall collected in the entire sample (n 2045) with a second 24 h recall collected in a sub-sample (n 178). We computed estimates of one-day and usual intakes of total energy, fat, Fe, Zn and Na. 2012 Mexican National Health and Nutrition Survey. A total of 2045 children were included: 0-5·9 months old (n 182), 6-11·9 months old (n 228), 12-23·9 months old (n 537) and 24-47·9 months old (n 1098). From these, 178 provided an additional dietary recall. Although we found small or no differences in energy intake (kJ/d and kcal/d) between one-day v. usual intake means, the prevalence of inadequate and excessive energy intake decreased somewhat when using measures of usual intake relative to one day. Mean fat intake (g/d) was not different between one-day and usual intake among children >6 months old, but the prevalence of inadequate and excessive fat intake was overestimated among toddlers and pre-schoolers when using one-day intake (P6 months. There was overall low variability in energy and fat intakes but higher for micronutrients. Because the usual intake distributions are narrower, the prevalence of inadequate/excessive intakes may be biased when estimating nutrient adequacy if one day of data is used.

  12. 3D surface rendering of images from multiple MR pulse sequences in the pre-operative evaluation of hepatic lesions

    International Nuclear Information System (INIS)

    Bjerner, T.; Johansson, L.; Ahlstroem, H.; Haglund, U.

    1998-01-01

    Purpose: To develop a method for making three-dimensional (3D) reconstructions of liver vessels and hepatic lesions from different MR data sets. Material and Methods: To reduce the time required for segmentation and reconstructions, we used T1, T2 and phase contrast angiography, optimised for liver, lesion and vessels respectively. Following segmentation and reconstruction, the different volumes were combined on the same workstation and presented to the surgeon. Results and Conclusion: Segmentation and reconstruction took 1-2 h. To be able to combine the volumes from the different data sets, certain criteria had to be fulfilled: (a) the field of view had to be constant; (b) the same volume had to be scanned every time which meant that the slice thickness and the number of slices could be adjusted as long as the volume covered was the same; and (c) the positioning of each volume had to be identical between every scan. The resulting 3D reconstruction gave the surgeon a clear appreciation of the different lesions and their relation to the different liver segments in the pre-operative planning of hepatic resections. (orig.)

  13. Sequencing of mitochondrial genomes of nine Aspergillus and Penicillium species identifies mobile introns and accessory genes as main sources of genome size variability.

    Science.gov (United States)

    Joardar, Vinita; Abrams, Natalie F; Hostetler, Jessica; Paukstelis, Paul J; Pakala, Suchitra; Pakala, Suman B; Zafar, Nikhat; Abolude, Olukemi O; Payne, Gary; Andrianopoulos, Alex; Denning, David W; Nierman, William C

    2012-12-12

    The genera Aspergillus and Penicillium include some of the most beneficial as well as the most harmful fungal species such as the penicillin-producer Penicillium chrysogenum and the human pathogen Aspergillus fumigatus, respectively. Their mitochondrial genomic sequences may hold vital clues into the mechanisms of their evolution, population genetics, and biology, yet only a handful of these genomes have been fully sequenced and annotated. Here we report the complete sequence and annotation of the mitochondrial genomes of six Aspergillus and three Penicillium species: A. fumigatus, A. clavatus, A. oryzae, A. flavus, Neosartorya fischeri (A. fischerianus), A. terreus, P. chrysogenum, P. marneffei, and Talaromyces stipitatus (P. stipitatum). The accompanying comparative analysis of these and related publicly available mitochondrial genomes reveals wide variation in size (25-36 Kb) among these closely related fungi. The sources of genome expansion include group I introns and accessory genes encoding putative homing endonucleases, DNA and RNA polymerases (presumed to be of plasmid origin) and hypothetical proteins. The two smallest sequenced genomes (A. terreus and P. chrysogenum) do not contain introns in protein-coding genes, whereas the largest genome (T. stipitatus), contains a total of eleven introns. All of the sequenced genomes have a group I intron in the large ribosomal subunit RNA gene, suggesting that this intron is fixed in these species. Subsequent analysis of several A. fumigatus strains showed low intraspecies variation. This study also includes a phylogenetic analysis based on 14 concatenated core mitochondrial proteins. The phylogenetic tree has a different topology from published multilocus trees, highlighting the challenges still facing the Aspergillus systematics. The study expands the genomic resources available to fungal biologists by providing mitochondrial genomes with consistent annotations for future genetic, evolutionary and population

  14. Making the most of RNA-seq: Pre-processing sequencing data with Opossum for reliable SNP variant detection [version 1; referees: 2 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Laura Oikkonen

    2017-01-01

    Full Text Available Identifying variants from RNA-seq (transcriptome sequencing data is a cost-effective and versatile alternative to whole-genome sequencing. However, current variant callers do not generally behave well with RNA-seq data due to reads encompassing intronic regions. We have developed a software programme called Opossum to address this problem. Opossum pre-processes RNA-seq reads prior to variant calling, and although it has been designed to work specifically with Platypus, it can be used equally well with other variant callers such as GATK HaplotypeCaller. In this work, we show that using Opossum in conjunction with either Platypus or GATK HaplotypeCaller maintains precision and improves the sensitivity for SNP detection compared to the GATK Best Practices pipeline. In addition, using it in combination with Platypus offers a substantial reduction in run times compared to the GATK pipeline so it is ideal when there are only limited time or computational resources available.

  15. Pattern of phylogenetic diversification of the Cychrini ground beetles in the world as deduced mainly from sequence comparisons of the mitochondrial genes.

    Science.gov (United States)

    Su, Zhi-Hui; Imura, Yûki; Okamoto, Munehiro; Osawa, Syozo

    2004-02-04

    The phylogenetic position of the tribe Cychrini within the subfamily Carabinae (the family Carabidae) was estimated by comparing the nucleotide sequences of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and the nuclear 28S ribosomal DNA (rDNA). The phylogenetic trees suggest that the Cychrini would most probably be the oldest line within the Carabinae. Phylogenetic trees were constructed by comparing the mitochondrial cytochrome C oxidase subunit I (COI) gene sequences from 33 species of the Cychrini from various localities that include the whole distribution ranges of the representative species within all the known genera in the world. The trees suggest that the Cychrini members radiated into a number of phylogenetic lineages within a short period, starting about 44 million years ago (MYA). Most of the phylogenetic lineages or sublineages are geographically linked, each consisting of a single or only a few species without scarce morphological differentiation in spite of their long evolutionary histories (silent or near-silent evolution [see Adv. Biophys. 36 (1999) 65; J. Mol. Evol. 53 (2001) 517]). The fact suggests that the geographic isolation per se did not bring about conspicuous morphological differentiation. The phylogenetic lineages of the Cychrini well correspond to the taxonomically defined genera and the subgenera.

  16. Blind pre-analysis of the main building complex WWER-1000 Kozloduy. Comparison of analytical and experimental results obtained by explosive testing (task 8a of workplan 96/97)

    International Nuclear Information System (INIS)

    Krutzik, N.J.

    1999-01-01

    In accordance with the 96/97 workplan of the Research Programme on 'Benchmark Studies for Seismic Analysis and Testing of WWER-Type Nuclear Power Plants', blind pre analyses were prepared for the main building complex of the WWER-1000 based on given excitations derived from explosive tests. The investigations were performed by several institutions based on various mathematical models and procedures for consideration of soil-structure interaction effects, but on the same explosive test input data recently obtained. The methods of calculation and software tools used will also be different. The aim of this investigation is to validate different idealization concepts (mathematical models for the idealization of the structures and the soil) as well as investigation procedures (time domain and frequency domain analysis) and finally the software tools by comparing structural response results (time histories and response spectra). This report contains the results of the blind pre analysis performed by Siemens using an equivalent beam model of the main building of the WWER 1000. The calculations were performed by means of a frequency domain calculation

  17. Atypical yeasts identified as Saccharomyces cerevisiae by MALDI-TOF MS and gene sequencing are the main responsible of fermentation of chicha, a traditional beverage from Peru.

    Science.gov (United States)

    Vallejo, Juan Andrés; Miranda, Patricia; Flores-Félix, José David; Sánchez-Juanes, Fernando; Ageitos, José M; González-Buitrago, José Manuel; Velázquez, Encarna; Villa, Tomás G

    2013-12-01

    Chicha is a drink prepared in several Andean countries from Inca's times by maize fermentation. Currently this fermentation is carried out in familiar artesanal "chicherías" that make one of the most known types of chicha, the "chicha de jora". In this study we isolate and identify the yeasts mainly responsible of the fermentation process in this type of chicha in 10 traditional "chicherías" in Cusco region in Peru. We applied by first time MALDI-TOF MS analysis for the identification of yeast of non-clinic origin and the results showed that all of yeast strains isolated belong to the species Saccharomyces cerevisiae. These results agree with those obtained after the analysis of the D1/D2 and 5.8S-ITS regions. However the chicha strains have a phenotypic profile that differed in more than 40% as compared to that of current S. cerevisiae strains. To the best of our knowledge this is the first report concerning the yeasts involved in chicha fermentation. Copyright © 2013 Elsevier GmbH. All rights reserved.

  18. RNA Sequencing of Contaminated Seeds Reveals the State of the Seed Permissive for Pre-Harvest Aflatoxin Contamination and Points to a Potential Susceptibility Factor

    Directory of Open Access Journals (Sweden)

    Josh Clevenger

    2016-11-01

    Full Text Available Pre-harvest aflatoxin contamination (PAC is a major problem facing peanut production worldwide. Produced by the ubiquitous soil fungus, Aspergillus flavus, aflatoxin is the most naturally occurring known carcinogen. The interaction between fungus and host resulting in PAC is complex, and breeding for PAC resistance has been slow. It has been shown that aflatoxin production can be induced by applying drought stress as peanut seeds mature. We have implemented an automated rainout shelter that controls temperature and moisture in the root and peg zone to induce aflatoxin production. Using polymerase chain reaction (PCR and high performance liquid chromatography (HPLC, seeds meeting the following conditions were selected: infected with Aspergillus flavus and contaminated with aflatoxin; and not contaminated with aflatoxin. RNA sequencing analysis revealed groups of genes that describe the transcriptional state of contaminated vs. uncontaminated seed. These data suggest that fatty acid biosynthesis and abscisic acid (ABA signaling are altered in contaminated seeds and point to a potential susceptibility factor, ABR1, as a repressor of ABA signaling that may play a role in permitting PAC.

  19. RNA Sequencing of Contaminated Seeds Reveals the State of the Seed Permissive for Pre-Harvest Aflatoxin Contamination and Points to a Potential Susceptibility Factor

    Science.gov (United States)

    Clevenger, Josh; Marasigan, Kathleen; Liakos, Vasileios; Sobolev, Victor; Vellidis, George; Holbrook, Corley; Ozias-Akins, Peggy

    2016-01-01

    Pre-harvest aflatoxin contamination (PAC) is a major problem facing peanut production worldwide. Produced by the ubiquitous soil fungus, Aspergillus flavus, aflatoxin is the most naturally occurring known carcinogen. The interaction between fungus and host resulting in PAC is complex, and breeding for PAC resistance has been slow. It has been shown that aflatoxin production can be induced by applying drought stress as peanut seeds mature. We have implemented an automated rainout shelter that controls temperature and moisture in the root and peg zone to induce aflatoxin production. Using polymerase chain reaction (PCR) and high performance liquid chromatography (HPLC), seeds meeting the following conditions were selected: infected with Aspergillus flavus and contaminated with aflatoxin; and not contaminated with aflatoxin. RNA sequencing analysis revealed groups of genes that describe the transcriptional state of contaminated vs. uncontaminated seed. These data suggest that fatty acid biosynthesis and abscisic acid (ABA) signaling are altered in contaminated seeds and point to a potential susceptibility factor, ABR1, as a repressor of ABA signaling that may play a role in permitting PAC. PMID:27827875

  20. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  1. Main Memory

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractPrimary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random

  2. Main Memory

    OpenAIRE

    Boncz, Peter; Liu, Lei; Özsu, M.

    2008-01-01

    htmlabstractPrimary storage, presently known as main memory, is the largest memory directly accessible to the CPU in the prevalent Von Neumann model and stores both data and instructions (program code). The CPU continuously reads instructions stored there and executes them. It is also called Random Access Memory (RAM), to indicate that load/store instructions can access data at any location at the same cost, is usually implemented using DRAM chips, which are connected to the CPU and other per...

  3. Main findings

    International Nuclear Information System (INIS)

    2014-01-01

    Licensing regimes vary from country to country. When the license regime involves several regulators and several licenses, this may lead to complex situations. Identifying a leading organisation in charge of overall coordination including preparation of the licensing decision is a useful practice. Also, if a stepwise licensing process is implemented, it is important to fix in legislation decisions and/or time points and to identify the relevant actors. There is considerable experience in civil and mining engineering that can be applied when constructing a deep geological disposal facility. Specific challenges are, however, the minimization of disturbances to the host rock and the understanding of its long-term behavior. Construction activities may affect the geo-hydraulic and geochemical properties of the various system components which are important safety features of the repository system. Clearly defined technical specifications and an effective quality management plan are important in ensuring successful repository implementation which is consistent with safety requirements. Monitoring plan should also be defined in advance. The regulatory organization should prepare itself to the licensing review before construction by allocating sufficient resources. It should increase its competence, e.g., by interacting early with the implementer and through its own R and D. This will allow the regulator to define appropriate technical conditions associated to the construction license and to elaborate a relevant inspection plan of the construction work. After construction, obtaining the operational license is the most important and crucial step. Main challenges include (a) establishing sufficient confidence so that the methods for closing the individual disposal units comply with the safety objectives and (b) addressing the issue of ageing of materials during a 50-100 years operational period. This latter challenge is amplified when reversibility/retrievability is required

  4. Stellar evolution IV: evolution of a star of 1.5 M(S) from the main-sequence to the red-giant branch with and without overshooting from convective core

    International Nuclear Information System (INIS)

    Maeder, A.

    1975-01-01

    For a star of 1.5 M(S) with an initial composition given by X=0.70 and Z=0.03, three sets of evolutionary models are computed with different assumptions on the non-local effects characterizing the turbulent motions in the convective core. Some overshooting from the convective core may occur during Main-sequence evolution. The changes in the stellar structure, lifetimes and evolutionary tracks brought about by this process are studied. Some characteristics of the evolutionary tracks in the theoretical HR diagram have a very high sensitivity to the exact extent of the convective core, and this may provide powerful tests of events occurring in the deep stellar interior. (orig./BJ) [de

  5. Microbial survey of ready-to-eat salad ingredients sold at retail reveals the occurrence and the persistence of Listeria monocytogenes Sequence Types 2 and 87 in pre-packed smoked salmon.

    Science.gov (United States)

    Chau, Man Ling; Aung, Kyaw Thu; Hapuarachchi, Hapuarachchige Chanditha; Lee, Pei Sze Valarie; Lim, Pei Ying; Kang, Joanne Su Lin; Ng, Youming; Yap, Hooi Ming; Yuk, Hyun-Gyun; Gutiérrez, Ramona Alikiiteaga; Ng, Lee Ching

    2017-02-28

    As the preparation of salads involves extensive handling and the use of uncooked ingredients, they are particularly vulnerable to microbial contamination. This study aimed to determine the microbial safety and quality of pre-packed salads and salad bar ingredients sold in Singapore, so as to identify public health risks that could arise from consuming salads and to determine areas for improvement in the management of food safety. The most frequently encountered organism in pre-packed salad samples was B. cereus, particularly in pasta salads (33.3%, 10/30). The most commonly detected organism in salad bar ingredients was L. monocytogenes, in particular seafood ingredients (44.1%, 15/34), largely due to contaminated smoked salmon. Further investigation showed that 21.6% (37/171) of the pre-packed smoked salmon sold in supermarkets contained L. monocytogenes. Significantly higher prevalence of L. monocytogenes and higher Standard Plate Count were detected in smoked salmon at salad bars compared to pre-packed smoked salmon in supermarkets, which suggested multiplication of the organism as the products move down the supply chain. Further molecular analysis revealed that L. monocytogenes Sequence Type (ST) 2 and ST87 were present in a particular brand of pre-packed salmon products over a 4-year period, implying a potential persistent contamination problem at the manufacturing level. Our findings highlighted a need to improve manufacturing and retail hygiene processes as well as to educate vulnerable populations to avoid consuming food prone to L. monocytogenes contamination.

  6. Next-generation sequencing using a pre-designed gene panel for the molecular diagnosis of congenital disorders in pediatric patients.

    Science.gov (United States)

    Lim, Eileen C P; Brett, Maggie; Lai, Angeline H M; Lee, Siew-Peng; Tan, Ee-Shien; Jamuar, Saumya S; Ng, Ivy S L; Tan, Ene-Choo

    2015-12-14

    Next-generation sequencing (NGS) has revolutionized genetic research and offers enormous potential for clinical application. Sequencing the exome has the advantage of casting the net wide for all known coding regions while targeted gene panel sequencing provides enhanced sequencing depths and can be designed to avoid incidental findings in adult-onset conditions. A HaloPlex panel consisting of 180 genes within commonly altered chromosomal regions is available for use on both the Ion Personal Genome Machine (PGM) and MiSeq platforms to screen for causative mutations in these genes. We used this Haloplex ICCG panel for targeted sequencing of 15 patients with clinical presentations indicative of an abnormality in one of the 180 genes. Sequencing runs were done using the Ion 318 Chips on the Ion Torrent PGM. Variants were filtered for known polymorphisms and analysis was done to identify possible disease-causing variants before validation by Sanger sequencing. When possible, segregation of variants with phenotype in family members was performed to ascertain the pathogenicity of the variant. More than 97% of the target bases were covered at >20×. There was an average of 9.6 novel variants per patient. Pathogenic mutations were identified in five genes for six patients, with two novel variants. There were another five likely pathogenic variants, some of which were unreported novel variants. In a cohort of 15 patients, we were able to identify a likely genetic etiology in six patients (40%). Another five patients had candidate variants for which further evaluation and segregation analysis are ongoing. Our results indicate that the HaloPlex ICCG panel is useful as a rapid, high-throughput and cost-effective screening tool for 170 of the 180 genes. There is low coverage for some regions in several genes which might have to be supplemented by Sanger sequencing. However, comparing the cost, ease of analysis, and shorter turnaround time, it is a good alternative to exome

  7. A Search for Coronal Emission at the Bottom of the Main-Sequence: Stars and Brown Dwarf Candidates with Spectral Types Later than M7 and the Rotation-Activity Relation

    Science.gov (United States)

    Stringfellow, Guy

    2004-01-01

    This program intended to test whether the lowest mass stars at the bottom end of the main sequence and the lower mass brown dwarfs have coronae. If they have coronae, what are the coronal characteristics and what drives them? In the classical dynamo picture, the closed magnetic loop structure is generated near the boundary of the convective envelope and the radiative core. Stars with mass below 0.30 Msun however are fully convective, and the nature of the dynamo responsible for the generation of the coronae in this regime is poorly understood. Previous results from the ROSAT mission (e.g., Fleming et al. 1993, 1995; Schmitt et al. 1995) had confirmed three very important characteristics of M-star coronae: (1) a very high percentage of all M dwarfs have coronae (of order 85% in the local 7 pc sample), (2) those M dwarfs showing high chromospheric activity, such as having the Balmer series in emission or large/numerous optical flaring, indeed exhibit the highest coronal activity, and (3) that the maximum saturation boundary in X-ray luminosity, which amounts to 0.0001-0.001 for Lx/Lbol for the dMe stars, extends down to the current detection limit, through spectral types M7. It was likely that the incompleteness noted for result (1) above was simply a detection limit problem; for more distant sources, the X-ray fainter dM stars will drop below detection thresholds before the more X-ray luminous dMe stars. The latest stars for which direct detection of the corona had been successful were of spectral type dM7 (e.g., VB8, LHS 3003). This program proposed to obtain ROSAT HRI observations for a large number of the coolest known (at that time) stars at the bottom of the main-sequence, which had spectral types of M9 or later. Three stars were approved for observations with ROSAT-HRI totaling 180 ksec. The goal was to obtain X-ray detections or low upper limits for the three approved stars.

  8. Pre-earthquake multiparameter analysis of the 2016 Amatrice-Norcia (Central Italy) seismic sequence: a case study for the application of the SAFE project concepts

    Science.gov (United States)

    De Santis, A.

    2017-12-01

    The SAFE (Swarm for Earthquake study) project (funded by European Space Agency in the framework "STSE Swarm+Innovation", 2014-2016) aimed at applying the new approach of geosystemics to the analysis of Swarm satellite (ESA) electromagnetic data for investigating the preparatory phase of earthquakes. We present in this talk the case study of the most recent seismic sequence in Italy. First a M6 earthquake on 24 August 2016 and then a M6.5 earthquake on 30 October 2016 shocked almost in the same region of Central Italy causing about 300 deaths in total (mostly on 24 August), with a revival of other significant seismicity on January 2017. Analysing both geophysical and climatological satellite and ground data preceding the major earthquakes of the sequence we present results that confirm a complex solid earth-atmosphere coupling in the preparation phase of the whole sequence.

  9. College Readiness: The Evaluation of Students Participating in the Historically Black College and University Program in Pre-Calculus and the Calculus Sequence

    Science.gov (United States)

    Hall, Angela Renee

    2011-01-01

    This investigative research focuses on the level of readiness of Science, Technology, Engineering, and Mathematics (STEM) students entering Historically Black Colleges and Universities (HBCU) in the college Calculus sequence. Calculus is a fundamental course for STEM courses. The level of readiness of the students for Calculus can very well play a…

  10. Secuencia constructiva de las plazas en el Grupo Principal de El Palmar, Campeche, México Constructive Sequence of Plazas in the Main Group of El Palmar, Campeche, México

    Directory of Open Access Journals (Sweden)

    Kenichiro Tsukamoto

    2012-01-01

    Full Text Available La ubicación y dimensión de los espacios abiertos fueron aspectos considerados al planificar las ciudades de las Tierras Bajas Mayas en el periodo prehispánico. Las plazas eran los espacios políticos donde las élites gobernantes legitimaban a sus autoridades y manifestaban a otros participantes sus capacidades para comunicarse con los ancestros o deidades. Este trabajo se centra en la secuencia constructiva de ocho plazas en el Grupo Principal del sitio arqueológico de El Palmar, Campeche, México. Los resultados obtenidos durante las temporadas de campo en el 2007 y el 2009 indican que las grandes plazas fueron construidas durante la segunda mitad del Clásico Temprano (400-600 d.C. y que en ellas se celebraron ceremonias públicas inscritas en los monumentos conmemorativos.The location and dimension of open spaces were important aspects involved in Maya Lowlands planning during the prehispanic period. Plazas were political spaces in which ruling elites legitimated their authorities and manifested to other participants their capacities of communication with ancestors or deities. This paper focuses on the construction sequence of eight plazas at the Main Group of El Palmar, Campeche, Mexico. The results recovered from the 2007 and 2009 fieldwork seasons indicate that large plazas were build during the second part of the Early Classic period (400-600 AD, with the erection of commemorative monuments narrating public ceremonies.

  11. The Intrinsic Characteristics of Galaxies on the SFR–M ∗ Plane at 1.2 < z < 4: I. The Correlation between Stellar Age, Central Density, and Position Relative to the Main Sequence

    Science.gov (United States)

    Lee, Bomee; Giavalisco, Mauro; Whitaker, Katherine; Williams, Christina C.; Ferguson, Henry C.; Acquaviva, Viviana; Koekemoer, Anton M.; Straughn, Amber N.; Guo, Yicheng; Kartaltepe, Jeyhan S.; Lotz, Jennifer; Pacifici, Camilla; Croton, Darren J.; Somerville, Rachel S.; Lu, Yu

    2018-02-01

    We use the deep CANDELS observations in the GOODS North and South fields to revisit the correlations between stellar mass (M *), star formation rate (SFR) and morphology, and to introduce a fourth dimension, the mass-weighted stellar age, in galaxies at 1.2history for each galaxy. Like others, we find that the slope of the main sequence (MS) of star formation in the ({M}* ;{SFR}) plane bends at high mass. We observe clear morphological differences among galaxies across the MS, which also correlate with stellar age. At all redshifts, galaxies that are quenching or quenched, and thus old, have high {{{Σ }}}1 (the projected density within the central 1 kpc), while younger, star-forming galaxies span a much broader range of {{{Σ }}}1, which includes the high values observed for quenched galaxies, but also extends to much lower values. As galaxies age and quench, the stellar age and the dispersion of {{{Σ }}}1 for fixed values of M * shows two different regimes: one at the low-mass end, where quenching might be driven by causes external to the galaxies; the other at the high-mass end, where quenching is driven by internal causes, very likely the mass given the low scatter of {{{Σ }}}1 (mass quenching). We suggest that the monotonic increase of central density as galaxies grow is one manifestation of a more general phenomenon of structural transformation that galaxies undergo as they evolve.

  12. Pre-Analytical Considerations for Successful Next-Generation Sequencing (NGS: Challenges and Opportunities for Formalin-Fixed and Paraffin-Embedded Tumor Tissue (FFPE Samples

    Directory of Open Access Journals (Sweden)

    Gladys Arreaza

    2016-09-01

    Full Text Available In cancer drug discovery, it is important to investigate the genetic determinants of response or resistance to cancer therapy as well as factors that contribute to adverse events in the course of clinical trials. Despite the emergence of new technologies and the ability to measure more diverse analytes (e.g., circulating tumor cell (CTC, circulating tumor DNA (ctDNA, etc., tumor tissue is still the most common and reliable source for biomarker investigation. Because of its worldwide use and ability to preserve samples for many decades at ambient temperature, formalin-fixed, paraffin-embedded tumor tissue (FFPE is likely to be the preferred choice for tissue preservation in clinical practice for the foreseeable future. Multiple analyses are routinely performed on the same FFPE samples (such as Immunohistochemistry (IHC, in situ hybridization, RNAseq, DNAseq, TILseq, Methyl-Seq, etc.. Thus, specimen prioritization and optimization of the isolation of analytes is critical to ensure successful completion of each assay. FFPE is notorious for producing suboptimal DNA quality and low DNA yield. However, commercial vendors tend to request higher DNA sample mass than what is actually required for downstream assays, which restricts the breadth of biomarker work that can be performed. We evaluated multiple genomics service laboratories to assess the current state of NGS pre-analytical processing of FFPE. Significant differences in pre-analytical capabilities were observed. Key aspects are highlighted and recommendations are made to improve the current practice in translational research.

  13. Sequence analysis of measles virus strains collected during the pre- and early-vaccination era in Denmark reveals a considerable diversity of ancient strains

    DEFF Research Database (Denmark)

    Christensen, Laurids Siig; Schöller, S.; Schierup, M. H.

    2002-01-01

    A total of 199 serum samples from patients with measles collected in Denmark, Greenland and the Faroe Islands from 1964 to 1983 were analysed by PCR. Measles virus (MV) RNA could be detected in 38 (19%) of the samples and a total of 18 strains were subjected to partial sequence analysis of the he......A total of 199 serum samples from patients with measles collected in Denmark, Greenland and the Faroe Islands from 1964 to 1983 were analysed by PCR. Measles virus (MV) RNA could be detected in 38 (19%) of the samples and a total of 18 strains were subjected to partial sequence analysis...... of the hemagglutinin gene. The strains exhibited a considerable genomic diversity, which is at odds with the assumption that one genome type prevailed among globally circulating MV strains prior to the advent of live-attenuated vaccines. Our data indicate that the similarity of the various vaccine strains...... is attributed to their having originated from the same primary isolate. Consequently, it is implied that a small number of clinical manifestations of MV worldwide from which strains similar to the vaccine strain were identified were vaccine related rather than being caused by members of a persistently...

  14. GENERACIÓN DEL DIAGRAMA DE SECUENCIAS DE UML 2.1.1 DESDE ESQUEMAS PRECONCEPTUALES GENERATION OF UML 2.1.1 SEQUENCE DIAGRAM FROM PRE-CONCEPTUAL SCHEMES

    Directory of Open Access Journals (Sweden)

    Carlos Mario Zapata

    2008-12-01

    the sequence diagram (including combined fragments from pre-conceptual schemas. These heuristic rules are implemented in the AToM³ tool and applied in a case study.

  15. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  16. Main Memory DBMS

    NARCIS (Netherlands)

    P.A. Boncz (Peter); L. Liu (Lei); M. Tamer Özsu

    2008-01-01

    htmlabstractA main memory database system is a DBMS that primarily relies on main memory for computer data storage. In contrast, normal database management systems employ hard disk based persisntent storage.

  17. Cyanogen strengths of globular cluster post-main-sequence stars

    International Nuclear Information System (INIS)

    Hesser, J.E.; Hartwick, F.D.A.; McClure, R.D.

    1976-01-01

    CN strengths in the peculiar clusters ω Cen and M22 and the metal-rich clusters 47 Tuc, M71, and NGC 6352 are found to vary markedly from star to star. The strong variations in CN strength found earlier for ω Cen by Norris and Bessell and by Dickens and Bell are shown to extend to fainter stars, although expected correlations of CN strength with position in the color-magnitude (C-M) diagram are less evident in our sample. Several CN and metal-strong stars were also observed in M22. We conclude that CN, once it appears in globular clusters, can vary much more than it does in equivalent Population I samples, a result we briefly examine in light of current understanding regarding physical processes in the stars themselves and of models of galactic chemical evolution

  18. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: NEW ESTIMATES

    Energy Technology Data Exchange (ETDEWEB)

    Kopparapu, Ravi Kumar; Ramirez, Ramses; Kasting, James F. [Department of Geosciences, Penn State University, 443 Deike Building, University Park, PA 16802 (United States); Eymet, Vincent [Laboratoire d' Astrophysique de Bordeaux, Universite de Bordeaux 1, UMR 5804, F-33270 Floirac (France); Robinson, Tyler D.; Domagal-Goldman, Shawn; Meadows, Victoria [NASA Astrobiology Institute' s Virtual Planetary Laboratory (United States); Mahadevan, Suvrath; Terrien, Ryan C.; Deshpande, Rohit [Center for Exoplanets and Habitable Worlds, The Pennsylvania State University, University Park, PA 16802 (United States)

    2013-03-10

    Identifying terrestrial planets in the habitable zones (HZs) of other stars is one of the primary goals of ongoing radial velocity (RV) and transit exoplanet surveys and proposed future space missions. Most current estimates of the boundaries of the HZ are based on one-dimensional (1D), cloud-free, climate model calculations by Kasting et al. However, this model used band models that were based on older HITRAN and HITEMP line-by-line databases. The inner edge of the HZ in the Kasting et al. model was determined by loss of water, and the outer edge was determined by the maximum greenhouse provided by a CO{sub 2} atmosphere. A conservative estimate for the width of the HZ from this model in our solar system is 0.95-1.67 AU. Here an updated 1D radiative-convective, cloud-free climate model is used to obtain new estimates for HZ widths around F, G, K, and M stars. New H{sub 2}O and CO{sub 2} absorption coefficients, derived from the HITRAN 2008 and HITEMP 2010 line-by-line databases, are important improvements to the climate model. According to the new model, the water-loss (inner HZ) and maximum greenhouse (outer HZ) limits for our solar system are at 0.99 and 1.70 AU, respectively, suggesting that the present Earth lies near the inner edge. Additional calculations are performed for stars with effective temperatures between 2600 and 7200 K, and the results are presented in parametric form, making them easy to apply to actual stars. The new model indicates that, near the inner edge of the HZ, there is no clear distinction between runaway greenhouse and water-loss limits for stars with T{sub eff} {approx}< 5000 K, which has implications for ongoing planet searches around K and M stars. To assess the potential habitability of extrasolar terrestrial planets, we propose using stellar flux incident on a planet rather than equilibrium temperature. This removes the dependence on planetary (Bond) albedo, which varies depending on the host star's spectral type. We suggest that conservative estimates of the HZ (water-loss and maximum greenhouse limits) should be used for current RV surveys and Kepler mission to obtain a lower limit on {eta}{sub Circled-Plus }, so that future flagship missions like TPF-C and Darwin are not undersized. Our model does not include the radiative effects of clouds; thus, the actual HZ boundaries may extend further in both directions than the estimates just given.

  19. HABITABLE ZONES AROUND MAIN-SEQUENCE STARS: NEW ESTIMATES

    International Nuclear Information System (INIS)

    Kopparapu, Ravi Kumar; Ramirez, Ramses; Kasting, James F.; Eymet, Vincent; Robinson, Tyler D.; Domagal-Goldman, Shawn; Meadows, Victoria; Mahadevan, Suvrath; Terrien, Ryan C.; Deshpande, Rohit

    2013-01-01

    Identifying terrestrial planets in the habitable zones (HZs) of other stars is one of the primary goals of ongoing radial velocity (RV) and transit exoplanet surveys and proposed future space missions. Most current estimates of the boundaries of the HZ are based on one-dimensional (1D), cloud-free, climate model calculations by Kasting et al. However, this model used band models that were based on older HITRAN and HITEMP line-by-line databases. The inner edge of the HZ in the Kasting et al. model was determined by loss of water, and the outer edge was determined by the maximum greenhouse provided by a CO 2 atmosphere. A conservative estimate for the width of the HZ from this model in our solar system is 0.95-1.67 AU. Here an updated 1D radiative-convective, cloud-free climate model is used to obtain new estimates for HZ widths around F, G, K, and M stars. New H 2 O and CO 2 absorption coefficients, derived from the HITRAN 2008 and HITEMP 2010 line-by-line databases, are important improvements to the climate model. According to the new model, the water-loss (inner HZ) and maximum greenhouse (outer HZ) limits for our solar system are at 0.99 and 1.70 AU, respectively, suggesting that the present Earth lies near the inner edge. Additional calculations are performed for stars with effective temperatures between 2600 and 7200 K, and the results are presented in parametric form, making them easy to apply to actual stars. The new model indicates that, near the inner edge of the HZ, there is no clear distinction between runaway greenhouse and water-loss limits for stars with T eff ∼ ⊕ , so that future flagship missions like TPF-C and Darwin are not undersized. Our model does not include the radiative effects of clouds; thus, the actual HZ boundaries may extend further in both directions than the estimates just given.

  20. Be ABUNDANCES IN COOL MAIN-SEQUENCE STARS WITH EXOPLANETS

    Energy Technology Data Exchange (ETDEWEB)

    Delgado Mena, E.; Israelian, G.; Gonzalez Hernandez, J. I.; Rebolo, R. [Instituto de Astrofisica de Canarias, 38200 La Laguna, Tenerife (Spain); Santos, N. C., E-mail: edm@iac.es [Centro de Astrofisica, Universidade do Porto, Rua das Estrelas, 4150-762 Porto (Portugal)

    2012-02-10

    We present new Ultraviolet and Visual Echelle Spectrograph (UVES) spectra of a sample of 15 cool unevolved stars with and without detected planetary companions. Together with previous determinations, we study Be depletion and possible differences in Be abundances between the two groups of stars. We obtain a final sample of 89 and 40 stars with and without planets, respectively, which covers a wide range of effective temperatures, from 4700 K to 6400 K, and includes several cool dwarf stars for the first time. We determine Be abundances for these stars and find that for most of them (the coolest ones) the Be II resonance lines are often undetectable, implying significant Be depletion. While for hot stars Be abundances are approximately constant, with a slight fall as T{sub eff} decreases and the Li-Be gap around 6300 K, we find a steep drop of Be content as T{sub eff} decreases for T{sub eff} < 5500 K, confirming the results of previous papers. Therefore, for these stars there is an unknown mechanism destroying Be that is not reflected in current models of Be depletion. Moreover, this strong Be depletion in cool objects takes place for all the stars regardless of the presence of planets; thus, the effect of extra Li depletion in solar-type stars with planets when compared with stars without detected planets does not seem to be present for Be, although the number of stars at those temperatures is still small to reach a final conclusion.

  1. Pleiades and the zero-age main sequence

    International Nuclear Information System (INIS)

    McNamara, B.J.

    1976-01-01

    New four-color uvby observations of the Pleiades are used to calibrate the ZAMS in the spectral range A2 to F5. Although the Pleiades c 0 versus (b - y) 0 calibration is in good agreement with the ZAMS calibration presented by Crawford, its m 0 versus (b - y) 0 relation shows a systematic difference from his values. This difference is believed to be caused by the higher mean rotational velocity of the Pleiades stars in comparison to field stars

  2. Dust discs around low-mass main-sequence stars

    International Nuclear Information System (INIS)

    Wolstencroft, R.D.; Walker, H.J.

    1988-01-01

    Current understanding of the formation of circumstellar discs as a natural accompaniment to the process of low-mass star formation is briefly reviewed. Models of the thermal emission from the dust discs around the prototype stars α Lyr, α PsA, β Pic and ε Eri are discussed, which indicate that the central regions of three of these discs are almost devoid of dust within radii ranging between 17 and 26 AU, with the temperature of the hottest dust lying between about 115 and 210 K. One possible explanation of the dust-free zones is the presence of a planet at the inner boundary of each cloud that sweeps up grains crossing its orbit. The colour, diameter and thickness of the optical image of β Pic, obtained by coronagraphic techniques, have provided further information on the size, radial distribution of number density and orbital inclination of the grains. The difference in surface brightness on the two sides of the disc is puzzling, but might be explained if the grains are elongated and aligned by the combined effects of a stellar wind and a magnetic field of spiral configuration. Finally, we discuss the orbital evolution and lifetimes of particles in these discs, which are governed primarily by radiation pressure, Poynting-Robertson drag and grain-grain collisions. (author)

  3. Effects of magnetic fields on main sequence stars

    International Nuclear Information System (INIS)

    Hubbard, E.N.

    1981-01-01

    A number of effects of low to medium strength ( 2 /8π) magnetic field pressure term so that the only effect of such a field may come from its inhibiting convection in the core. Isochrones of both convective and radiative core models of 2-5 M are presented. In the deep envelope, mixing of partially nuclear processed material driven by rising and falling magnetic flux tubes may be seen. The effects of this mixing will be brought to the surface during the deep convection phase of the star's tenure as a red giant. This model is used to predict a signature for magnetic mixing based on the CNO isotope and abundance ratios. In the outer envelope the gas pressure is low enough that one might expect to see a perturbation of the stellar structure due to the magnetic field pressure itself. This perturbation is calculated under several physical models for intermediate and high mass stars and it is determined that sufficient magnetic field energy may be available in the outer envelope to expand a star by about 20% over its unperturbed radius. Finally the evidence for the existence of non-magnetic neutron stars is considered, concluding that while no non-magnetic neutron stars have ever been positively identified, there is no evidence that prevents the existence of at least as many non-magnetic as magnetic neutron stars

  4. Acne at The Bottom Of The Main Sequence

    Science.gov (United States)

    Barnes, John; Haswell, C.; Jenkins, J.; Jeffers, S.; Jones, H. R. A.; Lohr, M.; Pavlenko, Y.

    2016-08-01

    Starspots are an important manifestation of stellar activity and yet their distribution patterns on the lowest mass stars is not well known. Time series spectra of fully convective M dwarfs taken in the red-optical with UVES reveal numerous line profile distortions which are interpreted as starspots. We derive Doppler images for four M4.5V - M9V stars and find that contrast ratios corresponding to photosphere-spot temperature differences of only 200-300 K are sufficient to model the timeseries spectra. Although more starspot structure is found at high latitudes, spots are reconstructed at a range of phases and latitudes with mean spot filling factors of only a few per cent. The occurrence of low-contrast spots at predominantly high latitudes is in general likely to be responsible for the low amplitude photometric variability seen in late-M dwarfs. The recovered starspot patterns are used to assess their effect on precision radial velocity surveys aimed at detecting planets around this population of stars.

  5. Be ABUNDANCES IN COOL MAIN-SEQUENCE STARS WITH EXOPLANETS

    International Nuclear Information System (INIS)

    Delgado Mena, E.; Israelian, G.; González Hernández, J. I.; Rebolo, R.; Santos, N. C.

    2012-01-01

    We present new Ultraviolet and Visual Echelle Spectrograph (UVES) spectra of a sample of 15 cool unevolved stars with and without detected planetary companions. Together with previous determinations, we study Be depletion and possible differences in Be abundances between the two groups of stars. We obtain a final sample of 89 and 40 stars with and without planets, respectively, which covers a wide range of effective temperatures, from 4700 K to 6400 K, and includes several cool dwarf stars for the first time. We determine Be abundances for these stars and find that for most of them (the coolest ones) the Be II resonance lines are often undetectable, implying significant Be depletion. While for hot stars Be abundances are approximately constant, with a slight fall as T eff decreases and the Li-Be gap around 6300 K, we find a steep drop of Be content as T eff decreases for T eff < 5500 K, confirming the results of previous papers. Therefore, for these stars there is an unknown mechanism destroying Be that is not reflected in current models of Be depletion. Moreover, this strong Be depletion in cool objects takes place for all the stars regardless of the presence of planets; thus, the effect of extra Li depletion in solar-type stars with planets when compared with stars without detected planets does not seem to be present for Be, although the number of stars at those temperatures is still small to reach a final conclusion.

  6. Maine's Employability Skills Program

    Science.gov (United States)

    McMahon, John M.; Wolffe, Karen E.; Wolfe, Judy; Brooker, Carrie

    2013-01-01

    This Practice Report describes the development and implementation of the "Maine Employability Skills Program," a model employment program developed by the Maine Division for the Blind and Visually Impaired (DBVI). The program was designed to support the efforts of the chronically unemployed or underemployed. These consumers were either…

  7. Turbine main engines

    CERN Document Server

    Main, John B; Herbert, C W; Bennett, A J S

    1965-01-01

    Turbine Main Engines deals with the principle of operation of turbine main engines. Topics covered include practical considerations that affect turbine design and efficiency; steam turbine rotors, blades, nozzles, and diaphragms; lubricating oil systems; and gas turbines for use with nuclear reactors. Gas turbines for naval boost propulsion, merchant ship propulsion, and naval main propulsion are also considered. This book is divided into three parts and begins with an overview of the basic mode of operation of the steam turbine engine and how it converts the pressure energy of the ingoing ste

  8. Maine highway safety plan

    Science.gov (United States)

    2010-01-01

    Each September 1, the MeBHS must provide NHTSA a comprehensive plan to reduce : traffic crashes and resulting deaths, injuries and property damage. The Highway Safety : Plan (HSP) serves as Maines application for available federal funds for these ...

  9. Maine Field Station

    Data.gov (United States)

    Federal Laboratory Consortium — In 2000 NOAA's National Marine Fisheries Service established the Maine Field Station in Orono, ME to have more direct involvement in the conservation of the living...

  10. Maine's forests 2008

    Science.gov (United States)

    George L. McCaskill; William H. McWilliams; Charles J. Barnett; Brett J. Butler; Mark A. Hatfield; Cassandra M. Kurtz; Randall S. Morin; W. Keith Moser; Charles H. Perry; Christopher W. Woodall

    2011-01-01

    The second annual inventory of Maine's forests was completed in 2008 after more than 3,160 forested plots were measured. Forest land occupies almost 17.7 million acres, which represents 82 percent of the total land area of Maine. The dominant forest-type groups are maple/beech/yellow birch, spruce/fir, white/red/jack pine, and aspen/white birch. Statewide volume...

  11. Maine Forests 2013

    Science.gov (United States)

    George L. McCaskill; Thomas Albright; Charles J. Barnett; Brett J. Butler; Susan J. Crocker; Cassandra M. Kurtz; William H. McWilliams; Patrick D. Miles; Randall S. Morin; Mark D. Nelson; Richard H. Widmann; Christopher W. Woodall

    2016-01-01

    The third 5-year annualized inventory of Maine's forests was completed in 2013 after more than 3170 forested plots were measured. Maine contains more than 17.6 million acres of forest land, an area that has been quite stable since 1960, covering more than 82 percent of the total land area. The number of live trees greater than 1 inch in diameter are approaching 24...

  12. FERMILAB: Main Injector

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10 31 cm -2 s -1 in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction

  13. FERMILAB: Main Injector

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1993-06-15

    The Fermilab Main Injector (FMI) project is the centerpiece of the Laboratory's Fermilab III programme for the 1990s. Designed to support a luminosity of at least 5x10{sup 31} cm{sup -2} s{sup -1} in the Tevatron collider, it will also provide new capabilities for rare neutral kaon decay and neutrino oscillation studies. The Fermilab Main Injector 8-150 GeV synchrotron is designed to replace the existing Main Ring which seriously limits beam intensities for the Tevatron and the antiproton production target. The project has passed several significant milestones and is now proceeding rapidly towards construction. The project received a $11.65M appropriation in 1992 and has been given $15M for the current fiscal year. Through the Energy Systems Acquisition Advisory Board (ESAAB) process, the US Department of Energy (DoE) has authorized funds for construction of the underground enclosure and service building where the Main Injector will touch the Tevatron, and to the preparation of bids for remaining project construction.

  14. Main facts 1995

    International Nuclear Information System (INIS)

    1996-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, monitoring and plants operations

  15. Main designations and attributions

    International Nuclear Information System (INIS)

    2010-01-01

    The chapter presents the main designations and attributions of the LNMRI - Brazilian National Laboratory of Metrology of Ionizing Radiation, the Cooperative Center in Radiation Protection and Medical Preparations for Accidents with Radiation; the Treaty for fully banning of nuclear tests and the Regional Center for Training of IAEA

  16. Maine Bouguer Gravity Grid

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — A 2 kilometer Bouguer anomaly grid for the state of Maine. Number of columns is 197 and number of rows is 292. The order of the data is from the lower left to the...

  17. Main facts 1993

    International Nuclear Information System (INIS)

    1994-01-01

    This report presents the main facts of the studies carried out by the Direction des Etudes et Recherches (DER) of Electricite de France: new applications of electricity, classical and nuclear thermal power plants, electrical equipment, environment protection, network analysis, information and informatic equipment

  18. Renovating the Main Building

    CERN Multimedia

    CERN Bulletin

    2010-01-01

    CERN's "Main Building" is exactly that. The Organization's central hub, with hundreds of staff and visitors passing through its doors every day, will soon be getting a well-earned facelift. Refurbishment work will proceed in phases, starting with the Salle des Pas Perdus, the concourse between the Council Chamber and the Main Auditorium. By the end of August, informal seating areas will be installed, electronic display panels will provide practical information and improved sound insulation will enhance conditions in the auditoria and surrounding meeting rooms.   In light green the area that will undergo the facelift. Work will start in July. The ground floor is home to the entrance to Restaurant No. 1, the bank, the post office, the travel agent, the Users Office, the Staff Association, the notice boards etc. Step up to the first floor to access CERN's largest lecture theatre, the Council Chamber and its "Pas Perdus" lobby. Everyone who works at or visits CERN i...

  19. Fermilab Main Injector plan

    Energy Technology Data Exchange (ETDEWEB)

    Anon.

    1990-07-15

    The Fermilab Main Injector is the centrepiece of the 'Fermilab III' scheme to significantly upgrade the Laboratory's existing accelerator complex. The new accelerator is designed to provide increased particle beam levels to boost the collision rate in the Tevatron proton-antiproton collider (luminosity in excess of 5 x 10{sup 31} per sq cm per s) and, if approved, would provide increased flexibility in all areas of high energy physics research.

  20. Fermilab Main Injector plan

    International Nuclear Information System (INIS)

    Anon.

    1990-01-01

    The Fermilab Main Injector is the centrepiece of the 'Fermilab III' scheme to significantly upgrade the Laboratory's existing accelerator complex. The new accelerator is designed to provide increased particle beam levels to boost the collision rate in the Tevatron proton-antiproton collider (luminosity in excess of 5 x 10 31 per sq cm per s) and, if approved, would provide increased flexibility in all areas of high energy physics research

  1. Maine coast winds

    Energy Technology Data Exchange (ETDEWEB)

    Avery, Richard

    2000-01-28

    The Maine Coast Winds Project was proposed for four possible turbine locations. Significant progress has been made at the prime location, with a lease-power purchase contract for ten years for the installation of turbine equipment having been obtained. Most of the site planning and permitting have been completed. It is expect that the turbine will be installed in early May. The other three locations are less suitable for the project, and new locations are being considered.

  2. Project evaluation: main characteristics

    OpenAIRE

    Moutinho, Nuno

    2010-01-01

    — The evaluation process of real investment projects must consider not only the traditional financial approach, but also non-financial aspects. Non financial analysis can provide additional relevant information about projects. We investigate financial and non-financial areas most relevant in project appraisal. We present main critical success factors and areas of analysis that lead to the perception of project success. Finally, companies are segmented to verify its financial and non-financial...

  3. Marketing Maine Tablestock Potatoes

    OpenAIRE

    Berney, Gerald; Grajewski, Gregory; Hinman, Don; Prater, Marvin E.; Taylor, April

    2010-01-01

    The Marketing Services Division of USDA’s Agricultural Marketing Service (AMS) was asked by USDA’s Agricultural Research Service (ARS) National Program Leader and ARS’s New England Soil and Water Research Laboratory personnel to help with existing efforts to assist Maine fresh potato farmers in their search for alternative marketing strategies, and reverse the recent decline in the profitability of their operations. ARS researchers previously had conducted an exhaustive study defining possibl...

  4. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  5. The hydrophobic core of twin-arginine signal sequences orchestrates specific binding to Tat-pathway related chaperones.

    Directory of Open Access Journals (Sweden)

    Anitha Shanmugham

    Full Text Available Redox enzyme maturation proteins (REMPs bind pre-proteins destined for translocation across the bacterial cytoplasmic membrane via the twin-arginine translocation system and enable the enzymatic incorporation of complex cofactors. Most REMPs recognize one specific pre-protein. The recognition site usually resides in the N-terminal signal sequence. REMP binding protects signal peptides against degradation by proteases. REMPs are also believed to prevent binding of immature pre-proteins to the translocon. The main aim of this work was to better understand the interaction between REMPs and substrate signal sequences. Two REMPs were investigated: DmsD (specific for dimethylsulfoxide reductase, DmsA and TorD (specific for trimethylamine N-oxide reductase, TorA. Green fluorescent protein (GFP was genetically fused behind the signal sequences of TorA and DmsA. This ensures native behavior of the respective signal sequence and excludes any effects mediated by the mature domain of the pre-protein. Surface plasmon resonance analysis revealed that these chimeric pre-proteins specifically bind to the cognate REMP. Furthermore, the region of the signal sequence that is responsible for specific binding to the corresponding REMP was identified by creating region-swapped chimeric signal sequences, containing parts of both the TorA and DmsA signal sequences. Surprisingly, specificity is not encoded in the highly variable positively charged N-terminal region of the signal sequence, but in the more similar hydrophobic C-terminal parts. Interestingly, binding of DmsD to its model substrate reduced membrane binding of the pre-protein. This property could link REMP-signal peptide binding to its reported proofreading function.

  6. Summary of main points

    International Nuclear Information System (INIS)

    2006-01-01

    In conjunction with its 6. annual meeting, the WPDD in close co-operation with the FSC held a Topical session on 'Stakeholder Involvement in Decommissioning' on November 14, 2005. The session was attended by 36 participants totally representing 14 NEA member countries and 2 international organisations. Two keynote addresses were given at the Topical Session. The first one treated of what is needed for robust decisions and how to bring all stakeholders into the debate. In the second keynote address a summary was made on what have been said on stakeholder involvement in decommissioning during earlier meetings of the WPDD. The main part of the session was then devoted to views from different stakeholders regarding their role and their involvement. This part contained viewpoints from local communities (Kaevlinge in Sweden and Port Hope in Canada), authorities (Scottish Executive and CSNC) and operators (EDF from France and EWN from Germany). Case studies from the decommissioning of Dounrey in the UK and from Trojan and Main Yankee in the USA were presented in the end part of the Topical session followed by a summary and lessons learnt report by the Rapporteur. A detailed programme of the Topical session can be seen in Appendix 1

  7. Pre-aspiration in Welsh English: a case study of Aberystwyth

    DEFF Research Database (Denmark)

    Hejná, Michaela

    -aspiration would be manifested as a h sound inserted in the following words as indicated: paht, peht, piht, poht, puht, mahp, mahtt, mahck, ohff, mohth, mahss, mahsh. Because the sound is understudied in English, the work focuses on what other sounds condition the presence of the phenomenon and its duration......Lay abstract This thesis examines pre-aspiration in English spoken in Aberystwyth, mid Wales. Pre-aspiration is a sound very similar to h (as in honey), and it can be found mainly in the sequences of vowels (a, e, i, o, u, etc.) and certain consonants (p, t, k, f, th, s, sh). In English, pre......, if it is sensitive to social factors such as age or gender as well, and it suggests some implications for sound changes including pre-aspiration. Chapter 1 summarises the questions addressed in this thesis and outlines where this work is positioned with respect to our current knowledge of the phenomenon...

  8. TRIGA reactor main systems

    International Nuclear Information System (INIS)

    Boeck, H.; Villa, M.

    2007-01-01

    This module describes the main systems of low power (<2 MW) and higher power (≥2 MW) TRIGA reactors. The most significant difference between the two is that forced reactor cooling and an emergency core cooling system are generally required for the higher power TRIGA reactors. However, those TRIGA reactors that are designed to be operated above 3 MW also use a TRIGA fuel that is specifically designed for those higher power outputs (3 to 14 MW). Typical values are given for the respective systems although each TRIGA facility will have unique characteristics that may only be determined by the experienced facility operators. Due to the inherent wide scope of these research reactor facilities construction and missions, this training module covers those systems found at most operating TRIGA reactor facilities but may also discuss non-standard equipment that was found to be operationally useful although not necessarily required. (author)

  9. Pre-metastatic niches

    DEFF Research Database (Denmark)

    Peinado, Héctor; Zhang, Haiying; Matei, Irina R.

    2017-01-01

    It is well established that organs of future metastasis are not passive receivers of circulating tumour cells, but are instead selectively and actively modified by the primary tumour before metastatic spread has even occurred. Sowing the 'seeds' of metastasis requires the action of tumour......-secreted factors and tumour-shed extracellular vesicles that enable the 'soil' at distant metastatic sites to encourage the outgrowth of incoming cancer cells. In this Review, we summarize the main processes and new mechanisms involved in the formation of the pre-metastatic niche....

  10. Pre-Processing and Modeling Tools for Bigdata

    Directory of Open Access Journals (Sweden)

    Hashem Hadi

    2016-09-01

    Full Text Available Modeling tools and operators help the user / developer to identify the processing field on the top of the sequence and to send into the computing module only the data related to the requested result. The remaining data is not relevant and it will slow down the processing. The biggest challenge nowadays is to get high quality processing results with a reduced computing time and costs. To do so, we must review the processing sequence, by adding several modeling tools. The existing processing models do not take in consideration this aspect and focus on getting high calculation performances which will increase the computing time and costs. In this paper we provide a study of the main modeling tools for BigData and a new model based on pre-processing.

  11. Neural mechanisms of sequence generation in songbirds

    Science.gov (United States)

    Langford, Bruce

    Animal models in research are useful for studying more complex behavior. For example, motor sequence generation of actions requiring good muscle coordination such as writing with a pen, playing an instrument, or speaking, may involve the interaction of many areas in the brain, each a complex system in itself; thus it can be difficult to determine causal relationships between neural behavior and the behavior being studied. Birdsong, however, provides an excellent model behavior for motor sequence learning, memory, and generation. The song consists of learned sequences of notes that are spectrographically stereotyped over multiple renditions of the song, similar to syllables in human speech. The main areas of the songbird brain involve in singing are known, however, the mechanisms by which these systems store and produce song are not well understood. We used a custom built, head-mounted, miniature motorized microdrive to chronically record the neural firing patterns of identified neurons in HVC, a pre-motor cortical nucleus which has been shown to be important in song timing. These were done in Bengalese finch which generate a song made up of stereotyped notes but variable note sequences. We observed song related bursting in neurons projecting to Area X, a homologue to basal ganglia, and tonic firing in HVC interneurons. Interneuron had firing rate patterns that were consistent over multiple renditions of the same note sequence. We also designed and built a light-weight, low-powered wireless programmable neural stimulator using Bluetooth Low Energy Protocol. It was able to generate perturbations in the song when current pulses were administered to RA, which projects to the brainstem nucleus responsible for syringeal muscle control.

  12. Sequencing Events: Exploring Art and Art Jobs.

    Science.gov (United States)

    Stephens, Pamela Geiger; Shaddix, Robin K.

    2000-01-01

    Presents an activity for upper-elementary students that correlates the actions of archaeologists, patrons, and artists with the sequencing of events in a logical order. Features ancient Egyptian art images. Discusses the preparation of materials, motivation, a pre-writing activity, and writing a story in sequence. (CMK)

  13. Design and control of integrated chromatography column sequences.

    Science.gov (United States)

    Andersson, Niklas; Löfgren, Anton; Olofsson, Marianne; Sellberg, Anton; Nilsson, Bernt; Tiainen, Peter

    2017-07-01

    To increase the productivity in biopharmaceutical production, a natural step is to introduce integrated continuous biomanufacturing which leads to fewer buffer and storage tanks, smaller sizes of integrated unit operations, and full automation of the operation. The main contribution of this work is to illustrate a methodology for design and control of a downstream process based on integrated column sequences. For small scale production, for example, pre-clinical studies, integrated column sequences can be implemented on a single chromatography system. This makes for a very efficient drug development platform. The proposed methodology is composed of four steps and is governed by a set of tools, that is presented, that makes the transition from batch separations to a complete integrated separation sequence as easy as possible. This methodology, its associated tools and the physical implementation is presented and illustrated on a case study where the target protein is separated from impurities through an integrated four column sequence. This article shows that the design and control of an integrated column sequence was successfully implemented for a tertiary protein separation problem. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:923-930, 2017. © 2017 American Institute of Chemical Engineers.

  14. Meso and microscopic characterization of deformation bands in porous sandstones: an example on the Paleozoic, Pre- and Sin-rift sequences of the Araripe Basin, Northeast of Brazil; Caracterizacao meso e microscopica de bandas de deformacao em arenitos porosos: um exemplo nas tectonossequencias Paleozoica, Pre- e Sin-rifte da Bacia do Araripe, Nordeste do Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Araujo Neto, Joao Marculino de; Silva, Fernando Cesar Alves da; Sa, Emanuel Ferraz Jardim de [Universidade Federal do Rio Grande do Norte (UFRN), Natal, RN (Brazil). Programa de Pos-Graduacao em Geodinamica e Geofisica], e-mails: jota_ex2@hotmail.com, fernando@geologia.ufrn.br, emanuel@ccet.ufrn.br

    2012-04-15

    Deformation bands are narrow tabular volumes developed in porous sandstones. Although these structures are a product of brittle deformation, they may have internally a continuous displacement gradient. When granular cataclasis is the dominant deformation mechanism, the initial properties of their host rocks (i.e., porosity and permeability) can change significantly. The deformation bands in sandstones from the pre- and syn-rift of the Araripe Basin were studied in meso and microscale in order to classify them and to understand the deformation mechanisms involved during their nucleation and development. Their geometric-spatial, kinematic, and rheological criteria allowed establishing relations between the origin of deformation bands and lithification of their host rocks. Additionally, some inferences on their influence to the fluid flow in the reservoir-scale were outlined. Moreover, the study of deformation bands contributed to the understanding of the tectonic evolution of the studied basin. Accordingly, the study of deformation bands can support research on local and regional aspects of the tectonosedimentary evolution of sedimentary basins. (author)

  15. Taxonomic and predicted metabolic profiles of the human gut microbiome in pre-Columbian mummies.

    Science.gov (United States)

    Santiago-Rodriguez, Tasha M; Fornaciari, Gino; Luciani, Stefania; Dowd, Scot E; Toranzos, Gary A; Marota, Isolina; Cano, Raul J

    2016-11-01

    Characterization of naturally mummified human gut remains could potentially provide insights into the preservation and evolution of commensal and pathogenic microorganisms, and metabolic profiles. We characterized the gut microbiome of two pre-Columbian Andean mummies dating to the 10-15th centuries using 16S rRNA gene high-throughput sequencing and metagenomics, and compared them to a previously characterized gut microbiome of an 11th century AD pre-Columbian Andean mummy. Our previous study showed that the Clostridiales represented the majority of the bacterial communities in the mummified gut remains, but that other microbial communities were also preserved during the process of natural mummification, as shown with the metagenomics analyses. The gut microbiome of the other two mummies were mainly comprised by Clostridiales or Bacillales, as demonstrated with 16S rRNA gene amplicon sequencing, many of which are facultative anaerobes, possibly consistent with the process of natural mummification requiring low oxygen levels. Metagenome analyses showed the presence of other microbial groups that were positively or negatively correlated with specific metabolic profiles. The presence of sequences similar to both Trypanosoma cruzi and Leishmania donovani could suggest that these pathogens were prevalent in pre-Columbian individuals. Taxonomic and functional profiling of mummified human gut remains will aid in the understanding of the microbial ecology of the process of natural mummification. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Installation Strategy for the LHC Main Dipoles

    CERN Multimedia

    Fartoukh, Stephane David

    2004-01-01

    All positions in the LHC machine are not equivalent in terms of beam requirements on the geometry and the field quality of the main dipoles. In the presence of slightly or strongly out-of tolerance magnets, a well-defined installation strategy will therefore contribute to preserve or even optimize the performance of the machine. Based on the present status of the production, we have anticipated a list of potential issues (geometry, transfer function, field direction and random b3) which, combined by order of priority, have been taken into account to define a simple but efficient installation algorithm for the LHC main dipoles. Its output is a prescription for installing the available dipoles in sequence while reducing to an absolute minimum the number of holes required by geometry or FQ issues.

  17. Main: AS1CAMV [PLACE

    Lifescience Database Archive (English)

    Full Text Available MV 35S promoter; from -85 to -58 (subdomain AI); Binding with ASF-1 (activation sequence factor 1) from pea ...and tobacco; Expression in root and leaf; CaMV 35S promoter; ASF-1; leaf; root; as-1; Cauliflower mosaic virus; CaMV; CCACTGACGTAAGGGATGACGCACAATCC ...

  18. Pre-crastination in the pigeon.

    Science.gov (United States)

    Wasserman, Edward A; Brzykcy, Stephen J

    2015-08-01

    Procrastination is the tendency to delay initiating or completing tasks. Rosenbaum et al. (Psychological Science, May 8, 2014) recently documented the opposite of procrastination: pre-crastination, the tendency to begin or to finish tasks as soon as possible. We devised a simple two-alternative forced-choice task, in which pigeons could choose to switch response location either sooner or later in a sequence of actions eventuating in food reward. Even though there was no economic advantage for doing so, pigeons chose to switch response location sooner rather than later in the sequence, showing pre-crastination to be quite general. Pre-crastination thus joins other anticipatory learning phenomena in challenging rational or optimal accounts of behavioral adaptation.

  19. Estudo qualitativo dos principais atributos que determinam a percepção de qualidade e de preço dos consumidores de restaurantes a la carte Qualitative study of main attributes that determine the consumer quality and price perceptions of a la carte restaurants

    Directory of Open Access Journals (Sweden)

    Maria Auxiliadora Cannarozzo Tinoco

    2008-04-01

    Full Text Available Este trabalho apresenta um estudo qualitativo dos principais determinantes da qualidade e do preço percebidos por clientes de restaurantes a la carte. Para isto, foram realizadas entrevistas em grupos focados, contemplando quatro tipos de consumidores avaliados (casais sem filhos, grupos de amigos, família e executivos. Os principais determinantes da qualidade percebida identificados foram: atributos da comida, atendimento, ambiente, tempo de espera, limpeza, segurança, instalações de apoio, cardápio, atributos da bebida, privacidade, exatidão, decoração e confirmação de expectativas. Realizou-se uma comparação com o modelo das dimensões da qualidade de Parasuraman et al. (1985 e propuseram-se algumas modificações baseadas nos resultados obtidos para o serviço de restaurantes a la carte e em outras pesquisas da literatura. Por outro lado, os determinantes mais importantes do preço percebido obtidos foram: qualidade da comida, decoração, ambiente, atendimento, instalações de apoio, cardápio, limpeza, atributos da bebida, quantidade das porções, expectativas prévias e privacidade. Os resultados obtidos sugerem a existência de relação entre os determinantes da qualidade percebida e preço percebido. Os resultados são comparados com outras pesquisas da literatura.This paper presents a qualitative study of the determinants of perceived quality and price for la carte restaurant customers. For this, four focus group interviews were conducted joining customers categorized as: couples without children, friends' group, families, and executives. The most important identified determinants of perceived quality were: food attributes, service, ambient, wait time, cleaning, safety, support facilities, menu, drink attributes, privacy, accuracy, decoration, and confirmation of expectations. These determinants were compared with the perceived quality model suggested by Parasuraman et al. (1985 and some modifications were proposed

  20. Diagnosing in building main pipelines

    Energy Technology Data Exchange (ETDEWEB)

    Telegin, L.G.; Gorelov, A.S.; Kurepin, B.N.; Orekhov, V.I.; Vasil' yev, G.G.; Yakovlev, Ye. I.

    1984-01-01

    General principles are examined for technical diagnosis in building main pipelines. A technique is presented for diagnosis during construction, as well as diagnosis of the technical state of the pipeline-construction machines and mechanisms. The survey materials could be used to set up construction of main pipelines.

  1. Maine Agricultural Foods. Project SEED.

    Science.gov (United States)

    Beaulieu, Peter; Ossenfort, Pat

    This paper describes an activity-based program that teaches students in grades 4-12 about the importance of Maine agriculture in their lives. Specifically, the goal is to increase student awareness of how the foods they eat are planted, harvested, and processed. The emphasis is on crops grown in Maine such as potatoes, broccoli, peas, blueberries,…

  2. Main Propulsion Test Article (MPTA)

    Science.gov (United States)

    Snoddy, Cynthia

    2010-01-01

    Scope: The Main Propulsion Test Article integrated the main propulsion subsystem with the clustered Space Shuttle Main Engines, the External Tank and associated GSE. The test program consisted of cryogenic tanking tests and short- and long duration static firings including gimbaling and throttling. The test program was conducted on the S1-C test stand (Position B-2) at the National Space Technology Laboratories (NSTL)/Stennis Space Center. 3 tanking tests and 20 hot fire tests conducted between December 21 1 1977 and December 17, 1980 Configuration: The main propulsion test article consisted of the three space shuttle main engines, flightweight external tank, flightweight aft fuselage, interface section and a boilerplate mid/fwd fuselage truss structure.

  3. Geology of the Cupsuptic quadrangle, Maine

    Science.gov (United States)

    Harwood, David S.

    1966-01-01

    The Cupsuptic quadrangle, in west-central Maine, lies in a relatively narrow belt of pre-Silurian rocks extending from the Connecticut River valley across northern New Hampshire to north-central Maine. The Albee Formation, composed of green, purple, and black phyllite with interbedded-quartzite, is exposed in the core of a regional anticlinorium overlain to the southeast by greenstone of the Oquossoc Formation which in turn is overlain by black slate of the Kamankeag Formation. In the northern part of the quadrangle the Albee Formation is overlain by black slate, feldspathic graywacke, and minor greenstone of the Dixville Formation. The Kamankeag Formation is dated as 1-ate Middle Ordovician by graptolites (zone 12) found near the base of the unit. The Dixville Formation is correlated with the Kamankeag Formation and Oquossoc Formation and is considered to be Middle Ordovician. The Albee Formation is considered to be Middle to Lower Ordovician from correlations with similar rocks in northeastern and southwestern Vermont. The Oquossoc and Kamankeag Formations are correlated with the Amonoosuc and Partridge Formations of northern New Hampshire. The pre-Silurian rocks are unconformably overlain by unnamed rocks of Silurian age in the southeast, west-central, and northwest ninths of the quadrangle. The basal Silurian units are boulder to cobble polymict conglomerate and quartz-pebble conglomerate of late Lower Silurian (Upper Llandovery) age. The overlying rocks are either well-bedded slate and quartzite, silty limestone, or arenaceous limestone. Thearenaceous limestone contains Upper Silurian (Lower Ludlow) brachiopods. The stratified rocks have been intruded by three stocks of biotite-muscovite quartz monzonite, a large body of metadiorite and associated serpentinite, smaller bodies of gabbro, granodiorite, and intrusive felsite, as well as numerous diabase and quartz monzonite dikes. The metadiorite and serpentinite, and possibly the gabbro and granodiorite are Late

  4. Left main percutaneous coronary intervention.

    Science.gov (United States)

    Teirstein, Paul S; Price, Matthew J

    2012-10-23

    The introduction of drug-eluting stents and advances in catheter techniques have led to increasing acceptance of percutaneous coronary intervention (PCI) as a viable alternative to coronary artery bypass graft (CABG) for unprotected left main disease. Current guidelines state that it is reasonable to consider unprotected left main PCI in patients with low to intermediate anatomic complexity who are at increased surgical risk. Data from randomized trials involving patients who are candidates for either treatment strategy provide novel insight into the relative safety and efficacy of PCI for this lesion subset. Herein, we review the current data comparing PCI with CABG for left main disease, summarize recent guideline recommendations, and provide an update on technical considerations that may optimize clinical outcomes in left main PCI. Copyright © 2012 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  5. DIARRHEA IN CHILDREN: MAIN CAUSES AND WAYS OF TREATMENT

    Directory of Open Access Journals (Sweden)

    S.V. Bel’mer

    2010-01-01

    Full Text Available The article discusses main questions of diagnostics of diarrhea in children. Main cause of acute diarrhea is infection, mainly viral (rotavirus, etc.. Chronic diarrhea frequently has non-infectious origin. The need of multi-aspect diagnostics of diarrhea cause in children is related to the significance of treatment of main disease. Besides, treatment of chronic and acute diarrhea include major component: adsorbents based on smectite. In total treatment of diarrhea has to be complex with the use of dietotherapy and medications: mucocytoprotectors, regulators of motoric, pre- and probiotics.Key words: children, diarrhea, treatment.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2010;9(6:135-138

  6. Main: FEB3 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available nt to sterilization and rinsing - One of the main components of biofilms is polysaccharides - Some pit-formi...ng bacteria such as Sphingomonas species A1 possess superchannels that directly incorporate and decompose polysaccharides - Detai...e entrance of the superchannel have been elucidated - We have obtained the crystals of ABC importer complexe...of water pipes and dental plaque are examples of biofilms. One of the main components of biofilms is polysac

  7. Decontamination of main coolant pumps

    International Nuclear Information System (INIS)

    Roofthooft, R.

    1988-01-01

    Last year a number of main coolant pumps in Belgian nuclear power plants were decontaminated. A new method has been developed to reduce the time taken for decontamination and the volume of waste to be treated. The method comprises two phases: Oxidation with permanganate in nitric acid and dissolution in oxalic acid. The decontamination of main coolant pumps can now be achieved in less than one day. The decontamination factors attained range between 15 and 150. (orig.) [de

  8. PRE-RETIREMENT PROGRAMME

    CERN Multimedia

    2001-01-01

    Special Meeting concerning the TAXATION OF PENSIONS IN FRANCE Following the pre-retirement seminar held at CERN in March 2001, the Human Resources Division and the CERN Pensioners Association (GAC) are organising a special information session on the Taxation of CERN pensions in France The speaker will be S. Agarrat, a barrister specialising in tax law (practising in Lyon) and the meeting will take the form of a general presentation of the subject, followed by a question-and-answer session. This meeting is intended for CERN pensioners residing in France, as well as for staff due to retire from the Organization in 2001/2002. Registration is not necessary. The meeting will take place on Wednesday, 28 November 2001, from 4.30 p.m. to 6.30 p.m., in the Main Auditorium N.B.: Questions concerning the taxation rules applicable to salaries paid by CERN, in particular questions relating to the CRDS tax, will not be dealt with during this meeting.

  9. Dog Y chromosomal DNA sequence: identification, sequencing and SNP discovery

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen

    2006-10-01

    Full Text Available Abstract Background Population genetic studies of dogs have so far mainly been based on analysis of mitochondrial DNA, describing only the history of female dogs. To get a picture of the male history, as well as a second independent marker, there is a need for studies of biallelic Y-chromosome polymorphisms. However, there are no biallelic polymorphisms reported, and only 3200 bp of non-repetitive dog Y-chromosome sequence deposited in GenBank, necessitating the identification of dog Y chromosome sequence and the search for polymorphisms therein. The genome has been only partially sequenced for one male dog, disallowing mapping of the sequence into specific chromosomes. However, by comparing the male genome sequence to the complete female dog genome sequence, candidate Y-chromosome sequence may be identified by exclusion. Results The male dog genome sequence was analysed by Blast search against the human genome to identify sequences with a best match to the human Y chromosome and to the female dog genome to identify those absent in the female genome. Candidate sequences were then tested for male specificity by PCR of five male and five female dogs. 32 sequences from the male genome, with a total length of 24 kbp, were identified as male specific, based on a match to the human Y chromosome, absence in the female dog genome and male specific PCR results. 14437 bp were then sequenced for 10 male dogs originating from Europe, Southwest Asia, Siberia, East Asia, Africa and America. Nine haplotypes were found, which were defined by 14 substitutions. The genetic distance between the haplotypes indicates that they originate from at least five wolf haplotypes. There was no obvious trend in the geographic distribution of the haplotypes. Conclusion We have identified 24159 bp of dog Y-chromosome sequence to be used for population genetic studies. We sequenced 14437 bp in a worldwide collection of dogs, identifying 14 SNPs for future SNP analyses, and

  10. Cloning and characterization of pre-miR159a and pre-miR1123 from ...

    African Journals Online (AJOL)

    Although many miRNA genes are conserved across the plant species, the same gene family varies significantly in size and genomic organization in different species. ... Sequence identity matrix suggests 43-82% variation in precursor of Tae AL pre-miR159a (Tae Agra local pre-miR159a) across the species. On the other ...

  11. Pre: Surgical orthopedic pre-maxillary alignment in bilateral cleft lip and palate patient

    Directory of Open Access Journals (Sweden)

    Vijaya Prasad Kamavaram Ellore

    2012-01-01

    Full Text Available Pre-surgical orthopedic appliances are mainly used to retract and align the protruded and deviated pre-maxilla and to facilitate initial lip repair. This article presents a case report of a five year old male child patient with bilateral cleft lip and palate in whom a special custom made pre-surgical orthopedic appliance was delivered. Use of a special custom made presurgical orthopedic appliance for repositioning pre-maxilla in bilateral cleft lip and palate patient is discussed in this article.

  12. New Main Ring control system

    International Nuclear Information System (INIS)

    Seino, K.; Anderson, L.; Ducar, R.; Franck, A.; Gomilar, J.; Hendricks, B.; Smedinghoff, J.

    1990-03-01

    The Fermilab Main Ring control system has been operational for over sixteen years. Aging and obsolescence of the equipment make the maintenance difficult. Since the advent of the Tevatron, considerable upgrades have been made to the controls of all the Fermilab accelerators except the Main Ring. Modernization of the equipment and standardization of the hardware and software have thus become inevitable. The Tevatron CAMAC serial system has been chosen as a basic foundation in order to make the Main Ring control system compatible with the rest of the accelerator complex. New hardware pieces including intelligent CAMAC modules have been designed to satisfy unique requirements. Fiber optic cable and repeaters have been installed in order to accommodate new channel requirements onto the already saturated communication medium system. 8 refs., 2 figs

  13. Approach to the E-ELT dome and main structure challenges

    Science.gov (United States)

    Bilbao, Armando; Murga, Gaizka; Gómez, Celia; Llarena, Javier

    2014-07-01

    The E-ELT as a whole could be classified as an extremely challenging project. More precisely, it should be defined as an array of many different sub-challenges, which comprise technical, logistical and managerial matters. This paper reviews some of these critical challenges, in particular those related to the Dome and the Main Structure, suggesting ways to face them in the most pragmatic way possible. Technical challenges for the Dome and the Main Structure are mainly related to the need to upscale current design standards to an order of magnitude larger design. Trying a direct design escalation is not feasible; it would not work. A design effort is needed to cross hybridize current design standards with technologies coming from other different applications. Innovative design is therefore not a wish but a must. And innovative design comes along with design risk. Design risk needs to be tackled from two angles: on the one hand through thorough design validation analysis and on the other hand through extensive pre-assembly and testing. And, once again, full scale integrated pre-assembly and testing of extremely large subsystems is not always possible. Therefore, defining a comprehensive test plan for critical components, critical subsystems and critical subassemblies becomes essential. Logistical challenges are linked to the erection site. Cerro Armazones is a remote site and this needs to be considered when evaluating transport and erection requirements. But it is not only the remoteness of the site that needs to be considered. The size of both Dome and Main Structure require large construction cranes and a well defined erection plan taking into account pre-assembly strategies, limited plan area utilization, erection sequence, erection stability during intermediate stages and, very specifically, efficient coordination between the Dome and the Main Structure erection processes. Managerial issues pose another set of challenges in this project. Both the size of the

  14. Sequence Factorization with Multiple References.

    Directory of Open Access Journals (Sweden)

    Sebastian Wandelt

    Full Text Available The success of high-throughput sequencing has lead to an increasing number of projects which sequence large populations of a species. Storage and analysis of sequence data is a key challenge in these projects, because of the sheer size of the datasets. Compression is one simple technology to deal with this challenge. Referential factorization and compression schemes, which store only the differences between input sequence and a reference sequence, gained lots of interest in this field. Highly-similar sequences, e.g., Human genomes, can be compressed with a compression ratio of 1,000:1 and more, up to two orders of magnitude better than with standard compression techniques. Recently, it was shown that the compression against multiple references from the same species can boost the compression ratio up to 4,000:1. However, a detailed analysis of using multiple references is lacking, e.g., for main memory consumption and optimality. In this paper, we describe one key technique for the referential compression against multiple references: The factorization of sequences. Based on the notion of an optimal factorization, we propose optimization heuristics and identify parameter settings which greatly influence 1 the size of the factorization, 2 the time for factorization, and 3 the required amount of main memory. We evaluate a total of 30 setups with a varying number of references on data from three different species. Our results show a wide range of factorization sizes (optimal to an overhead of up to 300%, factorization speed (0.01 MB/s to more than 600 MB/s, and main memory usage (few dozen MB to dozens of GB. Based on our evaluation, we identify the best configurations for common use cases. Our evaluation shows that multi-reference factorization is much better than single-reference factorization.

  15. PRE-DIABETES

    OpenAIRE

    Akula Annapurna

    2013-01-01

    Pre-diabetes is a condition where the body's cells begin to show resistance to insulin. Glucose circulates in the blood instead of being used by the cells for energy. Blood sugar levels become elevated. Increased weight, unhealthy diet and a sedentary lifestyle can lead to pre-diabetes. WHAT IS PRE-DIABETES A diagnosis of pre-diabetes means that the cells in your body are becoming resistant to insulin and your blood glucose levels are higher than they should be. Since the levels aren't as hig...

  16. A random walk down Main Street

    Directory of Open Access Journals (Sweden)

    David Matthew Levinson

    2016-08-01

    Full Text Available US suburbs have often been characterized by their relatively low walk accessibility compared to more urban environments, and US urban environments have been char- acterized by low walk accessibility compared to cities in other countries. Lower overall density in the suburbs implies that activities, if spread out, would have a greater distance between them. But why should activities be spread out instead of developed contiguously? This brief research note builds a positive model for the emergence of contiguous development along “Main Street” to illustrate the trade-offs that result in the built environment we observe. It then suggests some policy interventions to place a “thumb on the scale” to choose which parcels will develop in which sequence to achieve socially preferred outcomes.

  17. Main: FBB2 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available ion of the c-ring - A subunit packing model of E. coli c-ring has been proposed - The main chain secondary s...tructure of thermophile c-ring has been obtained ATP synthase is a general term for an enzyme that can synth

  18. Main: FEA5 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available al or an anti-cancer drug, is the main cause of hospital-acquired infection - Dru...e will elucidate the entire structure of the transport machinery in action to understand its functions in detail. FEA5.csml ...

  19. Residential Energy Efficiency Potential: Maine

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Eric J [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-11-02

    Energy used by Maine single-family homes that can be saved through cost-effective improvements. Prepared by Eric Wilson and Noel Merket, NREL, and Erin Boyd, U.S. Department of Energy Office of Energy Policy and Systems Analysis.

  20. CENTRE OF THE MAIN INTERESTS

    Directory of Open Access Journals (Sweden)

    DIANA DELEANU

    2013-05-01

    Full Text Available The centre of the main interests of the debtor is a legal tool meant to settle conflicts that can arise between jurisdictions in cross-border insolvencies, based on the principles of mutual recognition and co-operation.

  1. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.

    2009-06-01

    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  2. (AGA) Pre Term Babies

    African Journals Online (AJOL)

    Haematological Indices in Healthy Appropriate For-Gestational-Age (AGA) Pre Term Babies. ... International Journal of Medicine and Health Development. Journal Home ... Patient and Methods: All consecutive healthy pre-term new born babies delivered at UNTH and admitted into the hospital NBSCU were included.

  3. Pre-Algebra Lexicon.

    Science.gov (United States)

    Hayden, Dunstan; Cuevas, Gilberto

    The pre-algebra lexicon is a set of classroom exercises designed to teach the technical words and phrases of pre-algebra mathematics, and includes the terms most commonly found in related mathematics courses. The lexicon has three parts, each with its own introduction. The first introduces vocabulary items in three groups forming a learning…

  4. Flashback resistant pre-mixer assembly

    Science.gov (United States)

    Laster, Walter R [Oviedo, FL; Gambacorta, Domenico [Oviedo, FL

    2012-02-14

    A pre-mixer assembly associated with a fuel supply system for mixing of air and fuel upstream from a main combustion zone in a gas turbine engine. The pre-mixer assembly includes a swirler assembly disposed about a fuel injector of the fuel supply system and a pre-mixer transition member. The swirler assembly includes a forward end defining an air inlet and an opposed aft end. The pre-mixer transition member has a forward end affixed to the aft end of the swirler assembly and an opposed aft end defining an outlet of the pre-mixer assembly. The aft end of the pre-mixer transition member is spaced from a base plate such that a gap is formed between the aft end of the pre-mixer transition member and the base plate for permitting a flow of purge air therethrough to increase a velocity of the air/fuel mixture exiting the pre-mixer assembly.

  5. ONKALO - Main drawings in 2007

    International Nuclear Information System (INIS)

    2008-05-01

    The first overall site characterisation programme for a Finnish repository of spent nuclear fuel was introduced in 1982. This programme already suggested that the site confirmation for a detailed repository design and safety assessment should include characterisation performed in an underground rock characterisation facility (URCF). This idea was confirmed during the detailed site characterisation. International views have also emphasised the importance of underground characterisation before the final decision to construct the repository is taken. The underground rock characterisation facility (ONKALO) is excavated at Olkiluoto in the municipality of Eurajoki. ONKALO should be constructed to allow characterisation work for site confirmation without jeopardising long-term safety of the repository site. It should also be possible to link ONKALO later to the repository as to a part of it. The construction of ONKALO was started in 2004 and will be completed in 2014. The characterisation work has started in ONKALO and will focus on the disposal depth. In the main drawings stage, ONKALO was described at the level of detail needed for a construction permit in 2003. This meant description of the location, final structures and final systems. This summary report describes the development of design to updated main drawings in 2007 at the same level of detail (no temporary arrangements are described). The main changes are the added exhaust air shaft and advancing the controlled area's inlet air shaft to the ONKALO phase. Also the layout and the depth of the characterisation levels have been updated according to the current bedrock information. Some buildings on the surface will house sets of equipment directly connected with underground facility and this equipment is described in this report. No buildings or other equipment are described in this report, because they are not directly connected with the underground facility. The main element of ONKALO is a system of

  6. The RNA world, automatic sequences and oncogenetics

    Energy Technology Data Exchange (ETDEWEB)

    Tahir Shah, K

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. (1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. (2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or ``accept`` other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs.

  7. The RNA world, automatic sequences and oncogenetics

    International Nuclear Information System (INIS)

    Tahir Shah, K.

    1993-04-01

    We construct a model of the RNA world in terms of naturally evolving nucleotide sequences assuming only Crick-Watson base pairing and self-cleaving/splicing capability. These sequences have the following properties. 1) They are recognizable by an automation (or automata). That is, to each k-sequence, there exist a k-automation which accepts, recognizes or generates the k-sequence. These are known as automatic sequences. Fibonacci and Morse-Thue sequences are the most natural outcome of pre-biotic chemical conditions. 2) Infinite (resp. large) sequences are self-similar (resp. nearly self-similar) under certain rewrite rules and consequently give rise to fractal (resp.fractal-like) structures. Computationally, such sequences can also be generated by their corresponding deterministic parallel re-write system, known as a DOL system. The self-similar sequences are fixed points of their respective rewrite rules. Some of these automatic sequences have the capability that they can read or 'accept' other sequences while others can detect errors and trigger error-correcting mechanisms. They can be enlarged and have block and/or palindrome structure. Linear recurring sequences such as Fibonacci sequence are simply Feed-back Shift Registers, a well know model of information processing machines. We show that a mutation of any rewrite rule can cause a combinatorial explosion of error and relates this to oncogenetical behavior. On the other hand, a mutation of sequences that are not rewrite rules, leads to normal evolutionary change. Known experimental results support our hypothesis. (author). Refs

  8. At ISR Main Control Room

    CERN Multimedia

    1983-01-01

    After 13 years the exploitation of the Intersecting Storage Rings as a beam-beam collider went to an end. In this last year the demands were very exacting, both in terms of operating time and diversified running conditions (Annual Report 1983 p. 123). Before dismantelement the photographer made a last tour, see photos 8310889X --> 8310667X. This photo shows the Main Control Room.

  9. Multimodal sequence learning.

    Science.gov (United States)

    Kemény, Ferenc; Meier, Beat

    2016-02-01

    While sequence learning research models complex phenomena, previous studies have mostly focused on unimodal sequences. The goal of the current experiment is to put implicit sequence learning into a multimodal context: to test whether it can operate across different modalities. We used the Task Sequence Learning paradigm to test whether sequence learning varies across modalities, and whether participants are able to learn multimodal sequences. Our results show that implicit sequence learning is very similar regardless of the source modality. However, the presence of correlated task and response sequences was required for learning to take place. The experiment provides new evidence for implicit sequence learning of abstract conceptual representations. In general, the results suggest that correlated sequences are necessary for implicit sequence learning to occur. Moreover, they show that elements from different modalities can be automatically integrated into one unitary multimodal sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Sequence Read Archive (SRA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Sequence Read Archive (SRA) stores raw sequencing data from the next generation of sequencing platforms including Roche 454 GS System®, Illumina Genome...

  11. Analysis of the Sequences, Structures, and Functions of Product-Releasing Enzyme Domains in Fungal Polyketide Synthases

    Directory of Open Access Journals (Sweden)

    Lu Liu

    2017-09-01

    Full Text Available Product-releasing enzyme (PRE domains in fungal non-reducing polyketide synthases (NR-PKSs play a crucial role in catalysis and editing during polyketide biosynthesis, especially accelerating final biosynthetic reactions accompanied with product offloading. However, up to date, the systematic knowledge about PRE domains is deficient. In the present study, the relationships between sequences, structures, and functions of PRE domains were analyzed with 574 NR-PKSs of eight groups (I–VIII. It was found that the PRE domains in NR-PKSs could be mainly classified into three types, thioesterase (TE, reductase (R, and metallo-β-lactamase-type TE (MβL-TE. The widely distributed TE or TE-like domains were involved in NR-PKSs of groups I–IV, VI, and VIII. The R domains appeared in NR-PKSs of groups IV and VII, while the physically discrete MβL-TE domains were employed by most NR-PKSs of group V. The changes of catalytic sites and structural characteristics resulted in PRE functional differentiations. The phylogeny revealed that the evolution of TE domains was accompanied by complex functional divergence. The diverse sequence lengths of TE lid-loops affected substrate specificity with different chain lengths. The volume diversification of TE catalytic pockets contributed to catalytic mechanisms with functional differentiations. The above findings may help to understand the crucial catalysis of fungal aromatic polyketide biosyntheses and govern recombination of NR-PKSs to obtain unnatural target products.

  12. Association of hepatitis B virus pre-S deletions with the development of hepatocellular carcinoma in Qidong, China.

    Directory of Open Access Journals (Sweden)

    Li-Shuai Qu

    Full Text Available BACKGROUND/AIM: To investigate the roles of mutations in pre-S and S regions of hepatitis B virus (HBV on the progression of hepatocellular carcinoma (HCC in Qidong, China. METHODS: We conducted an age matched case-control study within a cohort of 2387 male HBV carriers who were recruited from August, 1996. The HBV DNA sequence in pre-S/S regions was successfully determined in 96 HCC cases and 97 control subjects. In addition, a consecutive series of samples from 11 HCC cases were employed to evaluate the pre-S deletion patterns before and after the occurrence of HCC. RESULTS: After adjustment for age, history of cigarette smoking and alcohol consumption, HBeAg positivity, pre-S deletions, pre-S2 start codon mutations, and T53C mutation were significantly associated with HCC, showing adjusted odds ratios (ORs from 1.914 to 3.199. HCC patients also had a lower frequency of T31C mutation in pre-S2 gene, compared with control subjects (0.524; 95% CI 0.280-0.982. HBV pre-S deletions were clustered mainly in the 5' end of pre-S2 region. Multivariate analysis showed that pre-S deletions and pre-S2 start codon mutations were independent risk factors for HCC. The OR (95% CI were 2.434 (1.063-5.573 and 3.065 (1.099-8.547, respectively. The longitudinal observation indicated that the pre-S deletion mutations were not acquired at the beginning of HBV infection, but that the mutations occurred during the long course of liver disease. CONCLUSION: Pre-S deletions and pre-S2 start codon mutations were independently associated with the development of HCC. The results also provided direct evidence that pre-S deletion mutations were not acquired from the beginning of infection but arose de novo during the progression of liver disease.

  13. T1 Gd-enhanced compared with CISS sequences in retinoblastoma: superiority of T1 sequences in evaluation of tumour extension

    Energy Technology Data Exchange (ETDEWEB)

    Gizewski, Elke R.; Wanke, Isabel; Guengoer, Ali-Riza; Forsting, Michael [University Hospital, Department of Diagnostic and Interventional Neuroradiology, Essen (Germany); Jurklies, Christine [University Hospital Essen, Department of Ophthalmology (Germany)

    2005-01-01

    Background As adequate therapy for retinoblastoma in young children depends on infiltration of extra-retinal structures, diagnostic modalities play an essential role. Methods: In this widely extended study, 80 children with retinoblastoma were studied with MRI (standard fat-suppressed Gd-enhanced T1, T2 thin-slice sequences (additionally with small loop surface coil), constructive interference in steady state (CISS) sequence covering the orbita). The images were analysed by two blinded neuroradiologists. Histology was used as the gold standard. MRI assumed infiltration of extra-retinal structures in 13 of 80 patients of which ten were confirmed by histology. Affected extra-retinal structures were: optic nerve (five, of which two were on CISS and three on T1 with higher image resolution using the surface coil), scleral infiltration (five, of which four on CISS and T1) and ciliary body infiltration (one on CISS and T1). Another 61 enucleated patients did not have any extra-retinal infiltration in histology. The CISS sequence with multiplanar reconstruction was mainly helpful in revealing exact three-dimensional tumour extension with excellent clinical acceptance and pre-surgical planning but T1 fat-suppressed Gd-enhanced images were superior in revealing exact tumour extension. CISS sequences allow to produce excellent anatomical images and to perform multiplanar reconstruction to better demonstrate tumour extension. However, T1-weighted sequences after contrast application are more sensitive (60 versus 40%) in detecting infiltration of the optic nerve but equal in detecting scleral infiltration. (orig.)

  14. Sir Robert Sidney’s Poems Revisited: the alternative sequence

    OpenAIRE

    Relvas, Maria de Jesus C.

    1997-01-01

    The essay approaches the lyric sequence written by Sir Robert Sidney (1563-1626) in the Elizabethan age, by mainly exploring its unique formal structure, which encloses an alternative sequence formed by a re-numbering of several poems.

  15. Methods for otpimum and near optimum disassembly sequencing

    NARCIS (Netherlands)

    Lambert, A.J.D.; Gupta, S.M.

    2008-01-01

    This paper considers disassembly sequencing problems subjected to sequence dependent disassembly costs. In practice, the methods for dealing with such problems rely mainly on metaheuristic and heuristic methods, which intrinsically generate suboptimum solutions. Exact methods are NP-hard and

  16. JWST-MIRI spectrometer main optics design and main results

    Science.gov (United States)

    Navarro, Ramón; Schoenmaker, Ton; Kroes, Gabby; Oudenhuysen, Ad; Jager, Rieks; Venema, Lars

    2017-11-01

    MIRI ('Mid InfraRed Instrument') is the combined imager and integral field spectrometer for the 5-29 micron wavelength range under development for the James Webb Space Telescope JWST. The flight acceptance tests of the Spectrometer Main Optics flight models (SMO), part of the MIRI spectrometer, are completed in the summer of 2008 and the system is delivered to the MIRI-JWST consortium. The two SMO arms contain 14 mirrors and form the MIRI optical system together with 12 selectable gratings on grating wheels. The entire system operates at a temperature of 7 Kelvin and is designed on the basis of a 'no adjustments' philosophy. This means that the optical alignment precision depends strongly on the design, tolerance analysis and detailed knowledge of the manufacturing process. Because in principle no corrections are needed after assembly, continuous tracking of the alignment performance during the design and manufacturing phases is important. The flight hardware is inspected with respect to performance parameters like alignment and image quality. The stability of these parameters is investigated after exposure to various vibration levels and successive cryogenic cool downs. This paper describes the philosophy behind the acceptance tests, the chosen test strategy and reports the results of these tests. In addition the paper covers the design of the optical test setup, focusing on the simulation of the optical interfaces of the SMO. Also the relation to the SMO qualification and verification program is addressed.

  17. PreCam

    Energy Technology Data Exchange (ETDEWEB)

    Allam, Sahar S. [Fermilab; Tucker, Douglas L. [Fermilab

    2015-01-01

    The Dark Energy Survey (DES) will be taking the next step in probing the properties of Dark Energy and in understanding the physics of cosmic acceleration. A step towards the photometric calibration of DES is to have a quick, bright survey in the DES footprint (PreCam), using a pre-production set of the Dark Energy Camera (DECam) CCDs and a set of 100 mm×100 mm DES filters. The objective of the PreCam Survey is to create a network of calibrated DES grizY standard stars that will be used for DES nightly calibrations and to improve the DES global relative calibrations. Here, we describe the first year of PreCam observation, results, and photometric calibrations.

  18. Main ring transition crossing simulations

    International Nuclear Information System (INIS)

    Kourbanis, I.; Ng, King-Yuen.

    1990-10-01

    We used ESME to simulate transition crossing in the Main Ring (MR). For the simulations, we followed the MR 29 cycle used currently for bar p production with a flat top of 120 GeV. In Sect. II, some inputs are discussed. In Sect. III, we present simulations with space charge turned off so that the effect of nonlinearity can be studied independently. When space charge is turned on in Sect. IV, we are faced with the problem of statistical errors due to binning, an analysis of which is given in the Appendices. Finally in Sects. V and VI, the results of simulations with space charge are presented and compared with the experimental measurements. 7 refs., 6 figs

  19. Improvement of main control room

    International Nuclear Information System (INIS)

    Chae, Sung Ki; Ham, Chang Sik; Kwon, Ki Chun

    1991-07-01

    Information display system, advanced alarm system and fiber optical communication system were developed to improve the main control room in nuclear power plant. Establishing the new hierachical information structure of plant operation data, plant overview status board(POSB) and digital indicator(DI) were designed and manufactured. The prototype advanced alarm system which employed the new alarm logics and algorithm compared with the conventional alarm system were developed and its effectiveness was proved. Optical communication system which has multi-drop feature and capability of upgrading to large-scale system by using BITBUS communication protocol which is proven technology, were developed. Reliability of that system was enhanced by using distributed control. (Author)

  20. The role of Main Institutions

    DEFF Research Database (Denmark)

    Persson, H Thomas R; Chabanet, Didier; Rakar, Fredrik

    2017-01-01

    ), in many countries the need emerged to understand the best methods to promote their establishment and continued success. In order to understand these issues, to contribute to the academic debate on SEs and to give useful policy advice on a truly enabling ecosystem, in November 2013 a consortium of 11...... Entrepreneurship”; to identify the “New Generation” of Social Entrepreneurs; to build an “Evolutionary Theory of Social Entrepreneurship”; to provide effective policy advices to stakeholders. In order to pursue and achieve these research objectives, the consortium implemented a complex research design...... in the social economy; - In the fifth chapter the authors address the role of the main institutions in developing (or hindering) social enterprises; - In the sixth chapter, stakeholder network maps are used to identify four ‘ecosystem types’ across the 10 partner countries; - The seventh chapter gives...

  1. Exome sequencing and genetic testing for MODY.

    Directory of Open Access Journals (Sweden)

    Stefan Johansson

    Full Text Available Genetic testing for monogenic diabetes is important for patient care. Given the extensive genetic and clinical heterogeneity of diabetes, exome sequencing might provide additional diagnostic potential when standard Sanger sequencing-based diagnostics is inconclusive.The aim of the study was to examine the performance of exome sequencing for a molecular diagnosis of MODY in patients who have undergone conventional diagnostic sequencing of candidate genes with negative results.We performed exome enrichment followed by high-throughput sequencing in nine patients with suspected MODY. They were Sanger sequencing-negative for mutations in the HNF1A, HNF4A, GCK, HNF1B and INS genes. We excluded common, non-coding and synonymous gene variants, and performed in-depth analysis on filtered sequence variants in a pre-defined set of 111 genes implicated in glucose metabolism.On average, we obtained 45 X median coverage of the entire targeted exome and found 199 rare coding variants per individual. We identified 0-4 rare non-synonymous and nonsense variants per individual in our a priori list of 111 candidate genes. Three of the variants were considered pathogenic (in ABCC8, HNF4A and PPARG, respectively, thus exome sequencing led to a genetic diagnosis in at least three of the nine patients. Approximately 91% of known heterozygous SNPs in the target exomes were detected, but we also found low coverage in some key diabetes genes using our current exome sequencing approach. Novel variants in the genes ARAP1, GLIS3, MADD, NOTCH2 and WFS1 need further investigation to reveal their possible role in diabetes.Our results demonstrate that exome sequencing can improve molecular diagnostics of MODY when used as a complement to Sanger sequencing. However, improvements will be needed, especially concerning coverage, before the full potential of exome sequencing can be realized.

  2. Main injector synchronous timing system

    International Nuclear Information System (INIS)

    Blokland, W.; Steimel, J.

    1998-01-01

    The Synchronous Timing System is designed to provide sub-nanosecond timing to instrumentation during the acceleration of particles in the Main Injector. Increased energy of the beam particles leads to a small but significant increase in speed, reducing the time it takes to complete a full turn of the ring by 61 nanoseconds (or more than 3 rf buckets). In contrast, the reference signal, used to trigger instrumentation and transmitted over a cable, has a constant group delay. This difference leads to a phase slip during the ramp and prevents instrumentation such as dampers from properly operating without additional measures. The Synchronous Timing System corrects for this phase slip as well as signal propagation time changes due to temperature variations. A module at the LLRF system uses a 1.2 Gbit/s G-Link chip to transmit the rf clock and digital data (e.g. the current frequency) over a single mode fiber around the ring. Fiber optic couplers at service buildings split off part of this signal for a local module which reconstructs a synchronous beam reference signal. This paper describes the background, design and expected performance of the Synchronous Timing System. copyright 1998 American Institute of Physics

  3. Main injector synchronous timing system

    International Nuclear Information System (INIS)

    Blokland, Willem; Steimel, James

    1998-01-01

    The Synchronous Timing System is designed to provide sub-nanosecond timing to instrumentation during the acceleration of particles in the Main Injector. Increased energy of the beam particles leads to a small but significant increase in speed, reducing the time it takes to complete a full turn of the ring by 61 nanoseconds (or more than 3 rf buckets). In contrast, the reference signal, used to trigger instrumentation and transmitted over a cable, has a constant group delay. This difference leads to a phase slip during the ramp and prevents instrumentation such as dampers from properly operating without additional measures. The Synchronous Timing System corrects for this phase slip as well as signal propagation time changes due to temperature variations. A module at the LLRF system uses a 1.2 Gbit/s G-Link chip to transmit the rf clock and digital data (e.g. the current frequency) over a single mode fiber around the ring. Fiber optic couplers at service buildings split off part of this signal for a local module which reconstructs a synchronous beam reference signal. This paper describes the background, design and expected performance of the Synchronous Timing System

  4. Main technical topics in 1999

    International Nuclear Information System (INIS)

    2000-01-01

    This Safety Authority annual report strives to present current organizational provisions and future trends in nuclear safety supervision in France and to describe the most outstanding occurrences during the past year. A first part presents nine documents concerning the main topics of 1999: aging of nuclear installations, the Offsite Emergency Plans (PPI), the impact of nuclear activities on man and the environment, the criticality hazards, EDF in 1999, the EPR project, the Andra in 1999, the transport incidents, the nuclear safety in eastern Europe. The second part presents the missions and actions of the Nuclear Installations Safety in the domains of the liabilities, the organization of the nuclear safety control, the regulations of the INB, the public information, the international relations, the crisis management, the radioactive materials transportation, the radioactive wastes. The equipment, the radiation protection and the exploitation of the pressurized water reactors are also treated just as the experimental reactors, the fuel cycle installations and the the nuclear installations dismantling. (A.L.B.)

  5. Main challenges of residential areas

    Directory of Open Access Journals (Sweden)

    Oana Luca

    2017-06-01

    Full Text Available The present article is a position paper aiming to initiate a professional debate related to the aspects related to the urban dysfunctions leading to the wear of the residential areas. The paper proposes a definition of the wear process, identify the main causes leading to its occurrence and propose a number of solutions to neutralise the dysfunctions. The three wearing phases of residential areas components are emphasized, exploring their lifecycle. In order to perform the study of urban wear, the status of the residential areas components can be established and monitored, and also the variables of the function that can mathematically model the specific wear process may be considered. The paper is considered a first step for the model adjustment, to be tested and validated in the following steps. Based on the mathematical method and model, there can be created, in a potential future research, the possibility of determining the precarity degree for residential areas/neighbourhoods and cities, by minimising the subjective component of the analyses preceding the decision for renovation or regeneration.

  6. Research in auditing: main themes

    Directory of Open Access Journals (Sweden)

    Marcelo Porte

    Full Text Available ABSTRACT The passage of the Sarbanes-Oxley Act (SOX was a turning point in auditing and in auditors practice for the academic world. Research concerning the characterization of academic production related to auditing is in its third decade. Its analysis is accomplished by means of definition of keywords, abstracts or title, and information on thematic association within the academic production itself in auditing is undisclosed. In order to revise this gap in auditing literature, this study identified the main themes in auditing and their association in post-SOX era by analyzing the content of objectives and hypothesis of 1,650 publications in Web of Science (2002-2014. The findings in this study extended those from the study by Lesage and Wechtler (2012 from 16 auditing thematic typologies to 22. The results demonstrate that the themes audit report & financial statement users, corporate governance, audit market, external audit, socio-economic data of the company, international regulation, and fraud risk & audit risk were the most addressed in the publications about auditing. Corporate governance has a broader association with the other themes in the area. Future researches may use these themes and relate them to the methodologies applied to audit studies.

  7. Aristotelian pre-Socratics, A glance at Aristotle's Narrative from pre-Socratics

    OpenAIRE

    Mehdi Qavam Safari; M.B Ghomi

    2015-01-01

    In this article, it's tried to study Aristotle's narrative of  pre-Socratics on the base of Aristotle's texts and mainly using  metaphysics, physics, genesis and decadence books. It is also tried to show how Aristotle has interpreted all the pre-Socratics in one way and on the base of his own philosophy framework. He interprets pre-Socratic Arche as an element that means comprehensive matter which is nothing itself, but everything is combination of it and even considers that as substance and ...

  8. Nonparametric combinatorial sequence models.

    Science.gov (United States)

    Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa

    2011-11-01

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.

  9. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  10. MAIN PRINCIPLES OF RESEARCH OF THE OCCUPATIONAL STRUCTURE OF BUILDERS IN PRE-MONGOLIAN RUS

    Directory of Open Access Journals (Sweden)

    Gatsunaev Konstantin Nikolaevich

    2012-10-01

    A considerable amount of information can be obtained from ancient sources, such as monuments, although they do not constitute any accurate evidence of the construction process. We may identify the number of the so-called "artels" (construction gangs, as well as trace their routes from one construction centre to another. By the commencement of the Mongolian invasion, construction gangs had already established close connections with the prince in power, and their routes were always determined by dynastic relationships of princes. Their work was strongly influenced by Byzantine and West European countries. Therefore, the analysis of the whole construction industry is a vital constituent of the study of the history and culture of ancient Russians.

  11. Main sources of finance for development: retrospective view on the evolution of pre-crisis ideas.

    OpenAIRE

    Sherstnev, Mikhail

    2009-01-01

    The paper provides the overview of the ideas on the sources of finance for development which were widely discussed by international community before the crisis in order to achieve the Millennium Development Goals. This set of ideas remains the starting point for further discussion on the issue and political action in the post-crisis world.

  12. Long sequence correlation coprocessor

    Science.gov (United States)

    Gage, Douglas W.

    1994-09-01

    A long sequence correlation coprocessor (LSCC) accelerates the bitwise correlation of arbitrarily long digital sequences by calculating in parallel the correlation score for 16, for example, adjacent bit alignments between two binary sequences. The LSCC integrated circuit is incorporated into a computer system with memory storage buffers and a separate general purpose computer processor which serves as its controller. Each of the LSCC's set of sequential counters simultaneously tallies a separate correlation coefficient. During each LSCC clock cycle, computer enable logic associated with each counter compares one bit of a first sequence with one bit of a second sequence to increment the counter if the bits are the same. A shift register assures that the same bit of the first sequence is simultaneously compared to different bits of the second sequence to simultaneously calculate the correlation coefficient by the different counters to represent different alignments of the two sequences.

  13. Roles of repetitive sequences

    Energy Technology Data Exchange (ETDEWEB)

    Bell, G.I.

    1991-12-31

    The DNA of higher eukaryotes contains many repetitive sequences. The study of repetitive sequences is important, not only because many have important biological function, but also because they provide information on genome organization, evolution and dynamics. In this paper, I will first discuss some generic effects that repetitive sequences will have upon genome dynamics and evolution. In particular, it will be shown that repetitive sequences foster recombination among, and turnover of, the elements of a genome. I will then consider some examples of repetitive sequences, notably minisatellite sequences and telomere sequences as examples of tandem repeats, without and with respectively known function, and Alu sequences as an example of interspersed repeats. Some other examples will also be considered in less detail.

  14. Anomaly Detection in Sequences

    Data.gov (United States)

    National Aeronautics and Space Administration — We present a set of novel algorithms which we call sequenceMiner, that detect and characterize anomalies in large sets of high-dimensional symbol sequences that...

  15. DNA sequencing conference, 2

    Energy Technology Data Exchange (ETDEWEB)

    Cook-Deegan, R.M. [Georgetown Univ., Kennedy Inst. of Ethics, Washington, DC (United States); Venter, J.C. [National Inst. of Neurological Disorders and Strokes, Bethesda, MD (United States); Gilbert, W. [Harvard Univ., Cambridge, MA (United States); Mulligan, J. [Stanford Univ., CA (United States); Mansfield, B.K. [Oak Ridge National Lab., TN (United States)

    1991-06-19

    This conference focused on DNA sequencing, genetic linkage mapping, physical mapping, informatics and bioethics. Several were used to study this sequencing and mapping. This article also discusses computer hardware and software aiding in the mapping of genes.

  16. sequenceMiner algorithm

    Data.gov (United States)

    National Aeronautics and Space Administration — Detecting and describing anomalies in large repositories of discrete symbol sequences. sequenceMiner has been open-sourced! Download the file below to try it out....

  17. Linac pre-injector

    CERN Multimedia

    CERN PhotoLab

    1965-01-01

    New accelerating column of the linac pre-injector, supporting frame and pumping system. This new system uses two mercury diffusion pumps (in the centre) and forms part of the modifications intended to increase the intensity of the linac. View taken during assembly in the workshop.

  18. Warm pre-stressing

    International Nuclear Information System (INIS)

    Hedner, G.

    1983-01-01

    Literature survey and critical evaluation of the phenomenon of warm pre-stressing (WPS) is presented. It is found that the cause of it is not clear and a calculated control is missing. The effect of irradiation is unknown, and the influence of WPS on the behaviour of reactor vessels is discussed. (G.B.)

  19. pre-art guidelines

    African Journals Online (AJOL)

    Enrique

    2004-11-01

    Nov 1, 2004 ... As these guidelines address pre-ART issues, only conditions that occur at ... All HIV-infected adults who are immunosuppressed, i.e. ... therefore recommended that HIV-infected health care ... vaccine in severely immunosuppressed persons, i.e. those ... with residual insecticides, the use of larvicides, and.

  20. Challenging pre-galilean misconceptions through alternative visualizations

    OpenAIRE

    Blanquet, Estelle; Picholle, Eric

    2011-01-01

    International audience; While duly Copernican, a significant part of primary school teachers-in-training fail to see the point of the (Galilean) principle of relativity. Two inquiry based teaching sequences involving the notion of reference frame were designed to challenge the students' robust pre-Galilean misconceptions, without mathematical requirements. The first sequence makes use of an artist view ("Framed Earth", by Manchu, 1989) and literary representations of the Earth as seen from a ...

  1. Effectiveness of Ninth-Grade Physics in Maine: Conceptual Understanding

    OpenAIRE

    O'Brien, Michael; Thompson, John

    2009-01-01

    The Physics First movement - teaching a true physics course to ninth grade students - is gaining popularity in high schools. There are several different rhetorical arguments for and against this movement, and it is quite controversial in physics education. However, there is no actual evidence to assess the success, or failure, of this substantial shift in the science teaching sequence. We have undertaken a comparison study of physics classes taught in ninth- and 12th grade classes in Maine. C...

  2. Tinkering at the main-ring lattice

    Energy Technology Data Exchange (ETDEWEB)

    Ohnuma, S.

    1982-08-23

    To improve production of usable antiprotons using the proton beam from the main ring and the lossless injection of cooled antiprotons into the main ring, modifications of the main ring lattice are recommended.

  3. Generalized locally Toeplitz sequences theory and applications

    CERN Document Server

    Garoni, Carlo

    2017-01-01

    Based on their research experience, the authors propose a reference textbook in two volumes on the theory of generalized locally Toeplitz sequences and their applications. This first volume focuses on the univariate version of the theory and the related applications in the unidimensional setting, while the second volume, which addresses the multivariate case, is mainly devoted to concrete PDE applications. This book systematically develops the theory of generalized locally Toeplitz (GLT) sequences and presents some of its main applications, with a particular focus on the numerical discretization of differential equations (DEs). It is the first book to address the relatively new field of GLT sequences, which occur in numerous scientific applications and are especially dominant in the context of DE discretizations. Written for applied mathematicians, engineers, physicists, and scientists who (perhaps unknowingly) encounter GLT sequences in their research, it is also of interest to those working in the fields of...

  4. Pre-calculus essentials

    CERN Document Server

    Woodward, Ernest

    2012-01-01

    REA's Essentials provide quick and easy access to critical information in a variety of different fields, ranging from the most basic to the most advanced. As its name implies, these concise, comprehensive study guides summarize the essentials of the field covered. Essentials are helpful when preparing for exams, doing homework and will remain a lasting reference source for students, teachers, and professionals. Pre-Calculus reviews sets, numbers, operations and properties, coordinate geometry, fundamental algebraic topics, solving equations and inequalities, functions, trigonometry, exponents

  5. Pre-college education

    Science.gov (United States)

    Stein, Sylvia

    1990-01-01

    Pre-college education efforts are many and varied, involving the teachers, students, parents, museums, and youth groups. However, it is necessary to reach out to school administration at all levels if teachers are to be innovative in their approaches. This introductory meeting clearly indicated that more interaction between the participants would be profitable. It is clear that the science pipeline leading from kindergarten to college entry needs to be filled with students. What is not clear is how we can do it. The plethora of projects being pursued by the NASA Space Grant College Fellowship (NSGC) programs to accomplish that goal are heartening and exciting. However, this large gamut of programs may also indicate how new we are in this game and how little anyone knows about creating a pre-college interest in science and engineering. In a way, it resembles the situation of the common cold--there is no known cure yet, so there are many so-called remedies. Unfortunately, the time we had together was entirely too short to address the evaluation situation, so that we can in the future zero in on the most effective approaches. This report is a summary of the many ways the different NSGC' s are approaching pre-college education and a list of suggestions.

  6. Enhanced Dynamic Algorithm of Genome Sequence Alignments

    OpenAIRE

    Arabi E. keshk

    2014-01-01

    The merging of biology and computer science has created a new field called computational biology that explore the capacities of computers to gain knowledge from biological data, bioinformatics. Computational biology is rooted in life sciences as well as computers, information sciences, and technologies. The main problem in computational biology is sequence alignment that is a way of arranging the sequences of DNA, RNA or protein to identify the region of similarity and relationship between se...

  7. Pre-equilibrium complex particle emission

    International Nuclear Information System (INIS)

    Bĕták, E.

    2002-01-01

    Semi-classical (phenomenological) pre-equilibrium emission of clusters of nucleons (complex particles) such as deuterons, tritons, helions and α particles from reactions induced by light projectiles (nucleons to α’s) is addressed. The main attention is given to the hard components in the emission energetic spectra, which play an increasing role at incident energies above 20 MeV, and are currently attributed to a presence of some kind of pre-equilibrium processes. In addition, the mechanisms of cluster reactions show special features such as the competition between pickup and knockout processes and the contributions of several successive steps in the reaction. The main frame used here to illustrate the processes and interplays of the competing mechanisms of pre-equilibrium cluster formation and emission, namely the coalescence, pick-up and knock-out, is the pre-equilibrium exciton model. It obviously contains the process of clusterization itself as its organic part. The most important case of complex particles with the largest amount of experimental data is that of alpha emission, which therefore naturally attracts most of the attention and where the widest range of possible mechanisms is available on the market. The loosely bound ejectiles, on the other side, are usually not able to demonstrate all features of the whole spectrum of contributing mechanisms, but they are nevertheless an important link between the nucleon emission and the cluster one.

  8. Stars of type MS with evidence of white dwarf companions. [IUE, Main Sequence (MS)

    Science.gov (United States)

    Peery, Benjamin F., Jr.

    1986-01-01

    A search for white dwarf companions of MS-type stars was conducted, using IUE. The overendowments of these stars in typical S-process nuclides suggest that they, like the Ba II stars, may owe their peculiar compositions to earlier mass transfer. Short-wavelength IUE spectra show striking emission line variability in HD35155, HD61913, and 4 Ori; HD35155 and 4 Ori show evidence of white dwarf companions.

  9. Some aspects of cool main sequence star ages derived from stellar rotation (gyrochronology)

    Science.gov (United States)

    Barnes, S. A.; Spada, F.; Weingrill, J.

    2016-09-01

    Rotation periods for cool stars can be measured with good precision by monitoring starspot light modulation. Observations have shown that the rotation periods of dwarf stars of roughly solar metallicity have such systematic dependencies on stellar age and mass that they can be used to derive reliable ages, a procedure called gyrochronology. We review the method and show illustrative cases, including recent ground- and space-based data. The age uncertainties approach 10 % in the best cases, making them a valuable complement to, and constraint on, asteroseismic or other ages. Edited, updated, and refereed version of a presentation at the WE-Heraeus-Seminar in Bad Honnef, Germany: Reconstructing the Milky Way's History: Spectroscopic Surveys, Asteroseismology and Chemodynamical Models

  10. THE DUSTIEST POST-MAIN SEQUENCE STARS IN THE MAGELLANIC CLOUDS

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Olivia C.; Meixner, Margaret; Roman-Duval, Julia [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Sargent, Benjamin A. [Center for Imaging Science and Laboratory for Multiwavelength Astrophysics, Rochester Institute of Technology, 54 Lomb Memorial Drive, Rochester, NY 14623 (United States); Boyer, Martha L. [Observational Cosmology Lab, Code 665, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Sewiło, Marta [The Johns Hopkins University, Department of Physics and Astronomy, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Hony, Sacha [Institut für Theoretische Astrophysik, Zentrum für Astronomie, Universitt Heidelberg, Albert-Ueberle-Str. 2, D-69120 Heidelberg (Germany)

    2015-10-01

    Using observations from the Herschel Inventory of The Agents of Galaxy Evolution (HERITAGE) survey of the Magellanic Clouds (MC), we have found 35 evolved stars and stellar end products that are bright in the far-infrared. These 28 (LMC) and 7 (SMC) sources were selected from the 529 evolved star candidates in the HERITAGE far-infrared point source catalogs. Our source identification method is based on spectral confirmation, spectral energy distribution characteristics, careful examination of the multiwavelength images and includes constraints on the luminosity, resulting in a thoroughly vetted list of evolved stars. These sources span a wide range in luminosity and hence initial mass. We found 13 low- to intermediate-mass evolved stars, including asymptotic giant branch (AGB) stars, post-AGB stars, planetary nebulae, and a symbiotic star. We also identify 10 high mass stars, including 4 of the 15 known B[e] stars in the MC, 3 extreme red supergiants that are highly enshrouded by dust, a Luminous Blue Variable, a Wolf–Rayet star, and two supernova remnants. Further, we report the detection of 9 probable evolved objects which were previously undescribed in the literature. These sources are likely to be among the dustiest evolved objects in the MC. The Herschel emission may either be due to dust produced by the evolved star or it may arise from swept-up interstellar medium material.

  11. Prospects for detecting decreasing exoplanet frequency with main-sequence age using PLATO

    Science.gov (United States)

    Veras, D.; Brown, D. J. A.; Mustill, A. J.; Pollacco, D.

    2017-09-01

    The space mission PLATO will usher in a new era of exoplanetary science by expanding our current inventory of transiting systems and constraining host star ages, which are currently highly uncertain. This capability might allow PLATO to detect changes in planetary system architecture with time, particularly because planetary scattering due to Lagrange instability may be triggered long after the system was formed. Here, we utilize previously published instability time-scale prescriptions to determine PLATO's capability to detect a trend of decreasing planet frequency with age for systems with equal- mass planets. For two-planet systems, our results demonstrate that PLATO may detect a trend for planet masses which are at least as massive as super-Earths. For systems with three or more planets, we link their initial compactness to potentially detectable frequency trends in order to aid future investigations when these populations will be better characterized.

  12. Important consequences of atomic diffusion inside main-sequence stars: opacities, extra-mixing, oscillations

    Directory of Open Access Journals (Sweden)

    Deal M.

    2017-01-01

    Full Text Available Atomic diffusion, including the effects of radiative accelerations on individual elements, leads to important variations of the chemical composition inside stars. The accumulation of important elements in specific layers leads to a local increase of the average opacity and to hydrodynamic instabilities that modify the internal stellar structure. This can also have important consequences for asteroseismology.

  13. Intrinsic width and luminosity function of the M92 main sequence

    International Nuclear Information System (INIS)

    Sandage, A.; Katem, B.

    1983-01-01

    Measurements of B and V magnitudes of approx.475 identified stars in the magnitude interval 18.0 - 4 is too low. The luminosity function, obtained from the present data, is compared with that determined earlier by Tayler, by Hartwick, by van den Bergh, and with Fukuoka and Simoda, with good agreement. The evidence favors that phi(M/sub v/) flattens fainter than M/sub v/approx. =+6 as predicted in some dynamical models, due to loss of low mass stars

  14. Theory and evidence of global Rossby waves in upper main-sequence stars

    DEFF Research Database (Denmark)

    Saio, Hideyuki; Kurtz, Donald W.; Murphy, Simon J.

    2018-01-01

    in the observational frame by considering the visibility of these modes. We find that the frequencies of r modes of azimuthal order m appear as groups at slightly lower frequency than m times the rotation frequency. Comparing the visibility curves for r modes with Fourier amplitude spectra of Kepler light curves...

  15. Oscillation mode frequencies of 61 main-sequence and subgiant stars observed by Kepler

    DEFF Research Database (Denmark)

    Appourchaux, T.; Chaplin, W. J.; García, R. A.

    2012-01-01

    Solar-like oscillations have been observed by Kepler and CoRoT in several solar-type stars, thereby providing a way to probe the stars using asteroseismology Aims. We provide the mode frequencies of the oscillations of various stars required to perform a comparison with those obtained from stella...

  16. VizieR Online Data Catalog: Habitable zones around main-sequence stars (Kopparapu+, 2014)

    Science.gov (United States)

    Kopparapu, R. K.; Ramirez, R. M.; Schottelkotte, J.; Kasting, J. F.; Domagal-Goldman, S.; Eymet, V.

    2017-08-01

    Language: Fortran 90 Code tested under the following compilers/operating systems: ifort/CentOS linux Description of input data: No input necessary. Description of output data: Output files: HZs.dat, HZ_coefficients.dat System requirements: No major system requirement. Fortran compiler necessary. Calls to external routines: None. Additional comments: None (1 data file).

  17. Carbon Monoxide and the Potential for Prebiotic Chemistry on Habitable Planets Around Main Sequence M Stars

    Science.gov (United States)

    Nava-Sedeno, J. Manik; Ortiz-Cervantes, Adrian; Segura, Antigona; Domagal-Goldman, Shawn D.

    2016-01-01

    Lifeless planets with CO2 atmospheres produce CO by CO2 photolysis. On planets around M dwarfs, CO is a long-lived atmospheric compound, as long as UV emission due to the stars chromospheric activity lasts, and the sink of CO and O2 in seawater is small compared to its atmospheric production. Atmospheres containing reduced compounds, like CO, may undergo further energetic and chemical processing to give rise to organic compounds of potential importance for the origin of life. We calculated the yield of organic compounds from CO2-rich atmospheres of planets orbiting M dwarf stars, which were previously simulated by Domagal- Goldman et al. (2014) and Harman et al. (2015), by cosmic rays and lightning using results of experiments by Miyakawaet al. (2002) and Schlesinger and Miller (1983a, 1983b). Stellar protons from active stars may be important energy sources for abiotic synthesis and increase production rates of biological compounds by at least 2 orders of magnitude compared to cosmic rays. Simple compounds such as HCN and H2CO are more readily synthesized than more complex ones, such as amino acids and uracil (considered here as an example), resulting in higher yields for the former and lower yields for the latter. Electric discharges are most efficient when a reducing atmosphere is present. Nonetheless, atmospheres with high quantities of CO2 are capable of producing higher amounts of prebiotic compounds, given that CO is constantly produced in the atmosphere. Our results further support planetary systems around M dwarf stars as candidates for supporting life or its origin.

  18. Relative stellar occurrence of exoplanets in habitable zones of the main sequence F, G, K stars

    Czech Academy of Sciences Publication Activity Database

    Pintr, Pavel; Peřinová, V.; Lukš, A.; Pathak, A.

    2014-01-01

    Roč. 99, sept2014 (2014), s. 1-6 ISSN 0032-0633 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0079 Institutional support: RVO:61389021 Keywords : Exoplanets * Methods: statistical * Stars: planetary systems Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 1.875, year: 2014 http://www.sciencedirect.com/science/article/pii/S003206331400172X#

  19. Apparent Brecciation Gradient, Mount Desert Island, Maine

    Science.gov (United States)

    Hawkins, A. T.; Johnson, S. E.

    2004-05-01

    Mount Desert Island, Maine, comprises a shallow level, Siluro-Devonian igneous complex surrounded by a distinctive breccia zone ("shatter zone" of Gilman and Chapman, 1988). The zone is very well exposed on the southern and eastern shores of the island and provides a unique opportunity to examine subvolcanic processes. The breccia of the Shatter Zone shows wide variation in percent matrix and clast, and may represent a spatial and temporal gradient in breccia formation due to a single eruptive or other catastrophic volcanic event. The shatter zone was divided into five developmental stages based on the extent of brecciation: Bar Harbor Formation, Sols Cliffs breccia, Seeley Road breccia, Dubois breccia, and Great Head breccia. A digital camera was employed to capture scale images of representative outcrops using a 0.5 m square Plexiglas frame. Individual images were joined in Adobe Photoshop to create a composite image of each outcrop. The composite photo was then exported to Adobe Illustrator, which was used to outline the clasts and produce a digital map of the outcrop for analysis. The fractal dimension (Fd) of each clast was calculated using NIH Image and a Euclidean distance mapping method described by Bérubé and Jébrak (1999) to quantify the morphology of the fragments, or the complexity of the outline. The more complex the fragment outline, the higher the fractal dimension, indicating that the fragment is less "mature" or has had less exposure to erosional processes, such as the injection of an igneous matrix. Sols Cliffs breccia has an average Fd of 1.125, whereas Great Head breccia has an average Fd of 1.040, with the stages between having intermediate values. The more complex clasts of the Sols Cliffs breccia with a small amount (26.38%) of matrix material suggests that it is the first stage in a sequence of brecciation ending at the more mature, matrix-supported (71.37%) breccia of Great Head. The results of this study will be used to guide isotopic

  20. 75 FR 27863 - Savings Bank of Maine, MHC and Savings Bank of Maine, Gardiner, Maine; Approval of Conversion...

    Science.gov (United States)

    2010-05-18

    ... DEPARTMENT OF THE TREASURY Office of Thrift Supervision [AC-38: OTS Nos. 06947 and H 4709] Savings Bank of Maine, MHC and Savings Bank of Maine, Gardiner, Maine; Approval of Conversion Application Notice is hereby given that on May 7, 2010, the Office of Thrift Supervision approved the application of...

  1. Sequences for Student Investigation

    Science.gov (United States)

    Barton, Jeffrey; Feil, David; Lartigue, David; Mullins, Bernadette

    2004-01-01

    We describe two classes of sequences that give rise to accessible problems for undergraduate research. These problems may be understood with virtually no prerequisites and are well suited for computer-aided investigation. The first sequence is a variation of one introduced by Stephen Wolfram in connection with his study of cellular automata. The…

  2. Quasi-periodic latitudinal shift of Saturn's main auroral emission

    Science.gov (United States)

    Roussos, E.; Palmaerts, B.; Grodent, D. C.; Radioti, K.; Krupp, N.; Yao, Z.

    2017-12-01

    The main component of the ultraviolet auroral emissions at Saturn consists in a ring of emission around each pole of the planet. This main ring of emission has been revealed to oscillate by a few degrees in the prenoon-premidnight direction with a period of 10.8h. This auroral oscillation is thought to be induced by a rotating external magnetospheric current system associated with the planetary period oscillations. Here we report, by means of auroral imaging sequences obtained with the Ultraviolet Imaging Spectrograph (UVIS) on board the Cassini spacecraft, the first direct observation of an additional motion of the main emission superimposed to this oscillation. The whole main emission ring exhibits step-like displacements in latitude mainly towards dayside, decoupled from the 10.8h oscillation. These latitude shifts recur around every hour, which is a typical short periodicity at Saturn previously identified in the aurora intensity, in the charged particle fluxes and in the magnetic field. This unique observation directly demonstrates what has been inferred from past in-situ and remote measurements: the 1-hour periodicities reveal a global and fundamental magnetospheric oscillation mode that acts independently of the local magnetospheric conditions. However, the magnetospheric mechanism responsible for these 1-hour auroral shifts is still unknown. It is possible that Alfvén waves inducing hourly magnetic fluctuations might also modify the place where the field-aligned electrons precipitate in the ionosphere and produce the main emission.

  3. Sequence History Update Tool

    Science.gov (United States)

    Khanampompan, Teerapat; Gladden, Roy; Fisher, Forest; DelGuercio, Chris

    2008-01-01

    The Sequence History Update Tool performs Web-based sequence statistics archiving for Mars Reconnaissance Orbiter (MRO). Using a single UNIX command, the software takes advantage of sequencing conventions to automatically extract the needed statistics from multiple files. This information is then used to populate a PHP database, which is then seamlessly formatted into a dynamic Web page. This tool replaces a previous tedious and error-prone process of manually editing HTML code to construct a Web-based table. Because the tool manages all of the statistics gathering and file delivery to and from multiple data sources spread across multiple servers, there is also a considerable time and effort savings. With the use of The Sequence History Update Tool what previously took minutes is now done in less than 30 seconds, and now provides a more accurate archival record of the sequence commanding for MRO.

  4. Aristotelian pre-Socratics, A glance at Aristotle's Narrative from pre-Socratics

    Directory of Open Access Journals (Sweden)

    Mehdi Qavam Safari

    2015-02-01

    Full Text Available In this article, it's tried to study Aristotle's narrative of  pre-Socratics on the base of Aristotle's texts and mainly using  metaphysics, physics, genesis and decadence books. It is also tried to show how Aristotle has interpreted all the pre-Socratics in one way and on the base of his own philosophy framework. He interprets pre-Socratic Arche as an element that means comprehensive matter which is nothing itself, but everything is combination of it and even considers that as substance and the other things as accident. He interprets the distinction of Arche and other things on the basis of this contrast in his philosophy. Aristotle, also analyzes pre-Socratics' viewpoint to change on the base of his distinction among change, genesis and corruption. All these cases show that Aristotle has interpreted the pre-Socratics on the basis of his thought, as Aristotelians. On this basis, since Aristotle's thoughts are the first and the most important sources of pre-Socratic philosophy, Aristotle's role should be considered in studies.

  5. Sequence Classification: 891556 [

    Lifescience Database Archive (English)

    Full Text Available nvolved in asymmetric localization of ASH1 mRNA; binds double-stranded RNA in vitro; constituent of 66S pre-ribosomal particles; Loc1p || http://www.ncbi.nlm.nih.gov/protein/14318523 ...

  6. Sequence Classification: 893067 [

    Lifescience Database Archive (English)

    Full Text Available tuent of 66S pre-ribosomal particles, involved in 60S ribosomal subunit biogenesis; localizes to both nucleolus and cytoplasm; Nop15p || http://www.ncbi.nlm.nih.gov/protein/6324219 ...

  7. Sequence complexity and work extraction

    International Nuclear Information System (INIS)

    Merhav, Neri

    2015-01-01

    We consider a simplified version of a solvable model by Mandal and Jarzynski, which constructively demonstrates the interplay between work extraction and the increase of the Shannon entropy of an information reservoir which is in contact with a physical system. We extend Mandal and Jarzynski’s main findings in several directions: first, we allow sequences of correlated bits rather than just independent bits. Secondly, at least for the case of binary information, we show that, in fact, the Shannon entropy is only one measure of complexity of the information that must increase in order for work to be extracted. The extracted work can also be upper bounded in terms of the increase in other quantities that measure complexity, like the predictability of future bits from past ones. Third, we provide an extension to the case of non-binary information (i.e. a larger alphabet), and finally, we extend the scope to the case where the incoming bits (before the interaction) form an individual sequence, rather than a random one. In this case, the entropy before the interaction can be replaced by the Lempel–Ziv (LZ) complexity of the incoming sequence, a fact that gives rise to an entropic meaning of the LZ complexity, not only in information theory, but also in physics. (paper)

  8. 30 CFR 57.6160 - Main facilities.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Main facilities. 57.6160 Section 57.6160...-Underground Only § 57.6160 Main facilities. (a) Main facilities used to store explosive material underground... facilities will not prevent escape from the mine, or cause detonation of the contents of another storage...

  9. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  10. Mapping sequences by parts

    Directory of Open Access Journals (Sweden)

    Guziolowski Carito

    2007-09-01

    Full Text Available Abstract Background: We present the N-map method, a pairwise and asymmetrical approach which allows us to compare sequences by taking into account evolutionary events that produce shuffled, reversed or repeated elements. Basically, the optimal N-map of a sequence s over a sequence t is the best way of partitioning the first sequence into N parts and placing them, possibly complementary reversed, over the second sequence in order to maximize the sum of their gapless alignment scores. Results: We introduce an algorithm computing an optimal N-map with time complexity O (|s| × |t| × N using O (|s| × |t| × N memory space. Among all the numbers of parts taken in a reasonable range, we select the value N for which the optimal N-map has the most significant score. To evaluate this significance, we study the empirical distributions of the scores of optimal N-maps and show that they can be approximated by normal distributions with a reasonable accuracy. We test the functionality of the approach over random sequences on which we apply artificial evolutionary events. Practical Application: The method is illustrated with four case studies of pairs of sequences involving non-standard evolutionary events.

  11. The Colliding Beams Sequencer

    International Nuclear Information System (INIS)

    Johnson, D.E.; Johnson, R.P.

    1989-01-01

    The Colliding Beam Sequencer (CBS) is a computer program used to operate the pbar-p Collider by synchronizing the applications programs and simulating the activities of the accelerator operators during filling and storage. The Sequencer acts as a meta-program, running otherwise stand alone applications programs, to do the set-up, beam transfers, acceleration, low beta turn on, and diagnostics for the transfers and storage. The Sequencer and its operational performance will be described along with its special features which include a periodic scheduler and command logger. 14 refs., 3 figs

  12. Phylogenetic Trees From Sequences

    Science.gov (United States)

    Ryvkin, Paul; Wang, Li-San

    In this chapter, we review important concepts and approaches for phylogeny reconstruction from sequence data.We first cover some basic definitions and properties of phylogenetics, and briefly explain how scientists model sequence evolution and measure sequence divergence. We then discuss three major approaches for phylogenetic reconstruction: distance-based phylogenetic reconstruction, maximum parsimony, and maximum likelihood. In the third part of the chapter, we review how multiple phylogenies are compared by consensus methods and how to assess confidence using bootstrapping. At the end of the chapter are two sections that list popular software packages and additional reading.

  13. Isolators Including Main Spring Linear Guide Systems

    Science.gov (United States)

    Goold, Ryan (Inventor); Buchele, Paul (Inventor); Hindle, Timothy (Inventor); Ruebsamen, Dale Thomas (Inventor)

    2017-01-01

    Embodiments of isolators, such as three parameter isolators, including a main spring linear guide system are provided. In one embodiment, the isolator includes first and second opposing end portions, a main spring mechanically coupled between the first and second end portions, and a linear guide system extending from the first end portion, across the main spring, and toward the second end portion. The linear guide system expands and contracts in conjunction with deflection of the main spring along the working axis, while restricting displacement and rotation of the main spring along first and second axes orthogonal to the working axis.

  14. When technological affordances meet interactional norms: the value of pre-screening in online chat counseling

    NARCIS (Netherlands)

    Stommel, Wyke; te Molder, Hedwig Frederica Maria

    2016-01-01

    We present a conversation analysis of openings sequences of online text-based chat counseling. Particular about this chat counseling is that the clients made available their help question through pre-screening. The data consisted of 40 chat sessions with pre-screening and 34 sessions without

  15. Supervised Sequence Labelling with Recurrent Neural Networks

    CERN Document Server

    Graves, Alex

    2012-01-01

    Supervised sequence labelling is a vital area of machine learning, encompassing tasks such as speech, handwriting and gesture recognition, protein secondary structure prediction and part-of-speech tagging. Recurrent neural networks are powerful sequence learning tools—robust to input noise and distortion, able to exploit long-range contextual information—that would seem ideally suited to such problems. However their role in large-scale sequence labelling systems has so far been auxiliary.    The goal of this book is a complete framework for classifying and transcribing sequential data with recurrent neural networks only. Three main innovations are introduced in order to realise this goal. Firstly, the connectionist temporal classification output layer allows the framework to be trained with unsegmented target sequences, such as phoneme-level speech transcriptions; this is in contrast to previous connectionist approaches, which were dependent on error-prone prior segmentation. Secondly, multidimensional...

  16. Inverted temperature sequences: role of deformation partitioning

    Science.gov (United States)

    Grujic, D.; Ashley, K. T.; Coble, M. A.; Coutand, I.; Kellett, D.; Whynot, N.

    2015-12-01

    The inverted metamorphism associated with the Main Central thrust zone in the Himalaya has been historically attributed to a number of tectonic processes. Here we show that there is actually a composite peak and deformation temperature sequence that formed in succession via different tectonic processes. The deformation partitioning seems to the have played a key role, and the magnitude of each process has varied along strike of the orogen. To explain the formation of the inverted metamorphic sequence across the Lesser Himalayan Sequence (LHS) in eastern Bhutan, we used Raman spectroscopy of carbonaceous material (RSCM) to determine the peak metamorphic temperatures and Ti-in-quartz thermobarometry to determine the deformation temperatures combined with thermochronology including published apatite and zircon U-Th/He and fission-track data and new 40Ar/39Ar dating of muscovite. The dataset was inverted using 3D-thermal-kinematic modeling to constrain the ranges of geological parameters such as fault geometry and slip rates, location and rates of localized basal accretion, and thermal properties of the crust. RSCM results indicate that there are two peak temperature sequences separated by a major thrust within the LHS. The internal temperature sequence shows an inverted peak temperature gradient of 12 °C/km; in the external (southern) sequence, the peak temperatures are constant across the structural sequence. Thermo-kinematic modeling suggest that the thermochronologic and thermobarometric data are compatible with a two-stage scenario: an Early-Middle Miocene phase of fast overthrusting of a hot hanging wall over a downgoing footwall and inversion of the synkinematic isotherms, followed by the formation of the external duplex developed by dominant underthrusting and basal accretion. To reconcile our observations with the experimental data, we suggest that pervasive ductile deformation within the upper LHS and along the Main Central thrust zone at its top stopped at

  17. Gomphid DNA sequence data

    Data.gov (United States)

    U.S. Environmental Protection Agency — DNA sequence data for several genetic loci. This dataset is not publicly accessible because: It's already publicly available on GenBank. It can be accessed through...

  18. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  19. A comparative evaluation of sequence classification programs

    Directory of Open Access Journals (Sweden)

    Bazinet Adam L

    2012-05-01

    Full Text Available Abstract Background A fundamental problem in modern genomics is to taxonomically or functionally classify DNA sequence fragments derived from environmental sampling (i.e., metagenomics. Several different methods have been proposed for doing this effectively and efficiently, and many have been implemented in software. In addition to varying their basic algorithmic approach to classification, some methods screen sequence reads for ’barcoding genes’ like 16S rRNA, or various types of protein-coding genes. Due to the sheer number and complexity of methods, it can be difficult for a researcher to choose one that is well-suited for a particular analysis. Results We divided the very large number of programs that have been released in recent years for solving the sequence classification problem into three main categories based on the general algorithm they use to compare a query sequence against a database of sequences. We also evaluated the performance of the leading programs in each category on data sets whose taxonomic and functional composition is known. Conclusions We found significant variability in classification accuracy, precision, and resource consumption of sequence classification programs when used to analyze various metagenomics data sets. However, we observe some general trends and patterns that will be useful to researchers who use sequence classification programs.

  20. Dynamic Sequence Assignment.

    Science.gov (United States)

    1983-12-01

    D-136 548 DYNAMIIC SEQUENCE ASSIGNMENT(U) ADVANCED INFORMATION AND 1/2 DECISION SYSTEMS MOUNTAIN YIELW CA C A 0 REILLY ET AL. UNCLSSIIED DEC 83 AI/DS...I ADVANCED INFORMATION & DECISION SYSTEMS Mountain View. CA 94040 84 u ,53 V,..’. Unclassified _____ SCURITY CLASSIFICATION OF THIS PAGE REPORT...reviews some important heuristic algorithms developed for fas- ter solution of the sequence assignment problem. 3.1. DINAMIC MOGRAMUNIG FORMULATION FOR

  1. HIV Sequence Compendium 2010

    Energy Technology Data Exchange (ETDEWEB)

    Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2010-12-31

    This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  2. General LTE Sequence

    OpenAIRE

    Billal, Masum

    2015-01-01

    In this paper,we have characterized sequences which maintain the same property described in Lifting the Exponent Lemma. Lifting the Exponent Lemma is a very powerful tool in olympiad number theory and recently it has become very popular. We generalize it to all sequences that maintain a property like it i.e. if p^{\\alpha}||a_k and p^\\b{eta}||n, then p^{{\\alpha}+\\b{eta}}||a_{nk}.

  3. Pairwise Sequence Alignment Library

    Energy Technology Data Exchange (ETDEWEB)

    2015-05-20

    Vector extensions, such as SSE, have been part of the x86 CPU since the 1990s, with applications in graphics, signal processing, and scientific applications. Although many algorithms and applications can naturally benefit from automatic vectorization techniques, there are still many that are difficult to vectorize due to their dependence on irregular data structures, dense branch operations, or data dependencies. Sequence alignment, one of the most widely used operations in bioinformatics workflows, has a computational footprint that features complex data dependencies. The trend of widening vector registers adversely affects the state-of-the-art sequence alignment algorithm based on striped data layouts. Therefore, a novel SIMD implementation of a parallel scan-based sequence alignment algorithm that can better exploit wider SIMD units was implemented as part of the Parallel Sequence Alignment Library (parasail). Parasail features: Reference implementations of all known vectorized sequence alignment approaches. Implementations of Smith Waterman (SW), semi-global (SG), and Needleman Wunsch (NW) sequence alignment algorithms. Implementations across all modern CPU instruction sets including AVX2 and KNC. Language interfaces for C/C++ and Python.

  4. Bootstrapping pre-averaged realized volatility under market microstructure noise

    DEFF Research Database (Denmark)

    Hounyo, Ulrich; Goncalves, Sílvia; Meddahi, Nour

    The main contribution of this paper is to propose a bootstrap method for inference on integrated volatility based on the pre-averaging approach of Jacod et al. (2009), where the pre-averaging is done over all possible overlapping blocks of consecutive observations. The overlapping nature of the pre......-averaged returns implies that these are kn-dependent with kn growing slowly with the sample size n. This motivates the application of a blockwise bootstrap method. We show that the "blocks of blocks" bootstrap method suggested by Politis and Romano (1992) (and further studied by Bühlmann and Künsch (1995......)) is valid only when volatility is constant. The failure of the blocks of blocks bootstrap is due to the heterogeneity of the squared pre-averaged returns when volatility is stochastic. To preserve both the dependence and the heterogeneity of squared pre-averaged returns, we propose a novel procedure...

  5. Marine sources influence fog bioaerosol composition in Namibia and Maine

    Science.gov (United States)

    Evans, S. E.; Dueker, E.; Logan, J. R. V.; Weathers, K. C.

    2017-12-01

    Organic aerosol particles act as condensation nuclei for fogs and clouds (CCN) and are main determinants of fog evolution, chemical processing, and overall aerosol-fog-cloud interactions. Recent work has confirmed the presence of marine bioaerosols, but little is known about their sources, transport, taxonomic diversity or viability. The few studies that have characterized bioaerosols in fog have been limited to culture-based approaches that capture only a fraction of microbial diversity. We characterized fungal and bacterial communities in the fog in two iconic fog systems, the Coast of Maine (USA) and the Namib Desert (Namibia). The biology of fog in both systems was diverse and distinct, by geography, from dry aerosols, and from local sources. The local environment had a dominant influence on fog in both the Namib and Maine; in particular, the biology of fog in Maine, which was collected near the coast, was more similar to microbial communities from the ocean surface. In both systems, differences between pre- and post-fog aerosol communities suggest that fog events can significantly alter microbial aerosol diversity and composition. This insight into the microbial composition of fog indicates that its origin and frequency has the potential to influence the number and diversity of microorganisms that settle in a given environment, and the composition of microbial aerosol communities in ambient or clear conditions. Here we suggest that fog microbes can possess specific traits that enhance nucleation, altering the transport and deposition of marine- and soil-derived organic matter in terrestrial systems.

  6. Pre-operative optimisation of lung function

    Directory of Open Access Journals (Sweden)

    Naheed Azhar

    2015-01-01

    Full Text Available The anaesthetic management of patients with pre-existing pulmonary disease is a challenging task. It is associated with increased morbidity in the form of post-operative pulmonary complications. Pre-operative optimisation of lung function helps in reducing these complications. Patients are advised to stop smoking for a period of 4–6 weeks. This reduces airway reactivity, improves mucociliary function and decreases carboxy-haemoglobin. The widely used incentive spirometry may be useful only when combined with other respiratory muscle exercises. Volume-based inspiratory devices have the best results. Pharmacotherapy of asthma and chronic obstructive pulmonary disease must be optimised before considering the patient for elective surgery. Beta 2 agonists, inhaled corticosteroids and systemic corticosteroids, are the main drugs used for this and several drugs play an adjunctive role in medical therapy. A graded approach has been suggested to manage these patients for elective surgery with an aim to achieve optimal pulmonary function.

  7. Main: OPAQUE2ZM22Z [PLACE

    Lifescience Database Archive (English)

    Full Text Available OPAQUE2ZM22Z S000017 17-May-2001 (last modified) uchi Opaque-2 (O2) target sequence...ene: maize 22-kD zein; transacting factor: 02; O2; opaque; 22-kD zein; seed; ACGT; opaque-2; maize (Zea mays) TCCACGTAGA ...

  8. On pre-test sensitisation and peer assessment to enhance learning gain in science education

    NARCIS (Netherlands)

    Bos, Floor/Floris

    2009-01-01

    *The main part of this thesis focuses on designing, optimising, and studying the embedding of two types of interventions: pre-testing and peer assessment, both supported by or combined with ICT-tools. * Pre-test sensitisation is used intentionally to boost the learning gain of the main intervention,

  9. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.; Bonny, Talal; Salama, Khaled N.

    2012-01-01

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  10. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.

    2012-01-26

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  11. Main approaches to the study of loss

    Directory of Open Access Journals (Sweden)

    Burina E. A.

    2016-07-01

    Full Text Available this article presents the main approaches to the concepts of grief and loss study. The article describes the contribution of E. Lindemann, Z. Freud, J. Bowlby, F.E. Vasiluk, and E. Kubler-Ross. The research also contains the main forms of grief and some stadial models within the scope of problematics.

  12. Engineering Design of KSTAR tokamak main structure

    International Nuclear Information System (INIS)

    Im, K.H.; Cho, S.; Her, N.I.

    2001-01-01

    The main components of the KSTAR (Korea Superconducting Tokamak Advanced Research) tokamak including vacuum vessel, plasma facing components, cryostat, thermal shield and magnet supporting structure are in the final stage of engineering design. Hundai Heavy Industries (HHI) has been involved in the engineering design of these components. The current configuration and the final engineering design results for the KSTAR main structure are presented. (author)

  13. Riigikogu maine ja armastus / Aune Past

    Index Scriptorium Estoniae

    Past, Aune, 1954-

    2007-01-01

    Autor arutleb Riigikogu maine üle, toetudes TÜ ajakirjanduse ja kommunikatsiooni osakonna 2007. aastal tehtud uuringu tulemustele. Riigikogu liikmete maine paraneks, kui neil endil oleks selge, mis eesmärgil Toompeale mindi ja sellest siis ka rahvale kõneldaks

  14. Alternative splicing affects the targeting sequence of peroxisome proteins in Arabidopsis.

    Science.gov (United States)

    An, Chuanjing; Gao, Yuefang; Li, Jinyu; Liu, Xiaomin; Gao, Fuli; Gao, Hongbo

    2017-07-01

    A systematic analysis of the Arabidopsis genome in combination with localization experiments indicates that alternative splicing affects the peroxisomal targeting sequence of at least 71 genes in Arabidopsis. Peroxisomes are ubiquitous eukaryotic cellular organelles that play a key role in diverse metabolic functions. All peroxisome proteins are encoded by nuclear genes and target to peroxisomes mainly through two types of targeting signals: peroxisomal targeting signal type 1 (PTS1) and PTS2. Alternative splicing (AS) is a process occurring in all eukaryotes by which a single pre-mRNA can generate multiple mRNA variants, often encoding proteins with functional differences. However, the effects of AS on the PTS1 or PTS2 and the targeting of the protein were rarely studied, especially in plants. Here, we systematically analyzed the genome of Arabidopsis, and found that the C-terminal targeting sequence PTS1 of 66 genes and the N-terminal targeting sequence PTS2 of 5 genes are affected by AS. Experimental determination of the targeting of selected protein isoforms further demonstrated that AS at both the 5' and 3' region of a gene can affect the inclusion of PTS2 and PTS1, respectively. This work underscores the importance of AS on the global regulation of peroxisome protein targeting.

  15. Gradient waveform pre-emphasis based on the gradient system transfer function.

    Science.gov (United States)

    Stich, Manuel; Wech, Tobias; Slawig, Anne; Ringler, Ralf; Dewdney, Andrew; Greiser, Andreas; Ruyters, Gudrun; Bley, Thorsten A; Köstler, Herbert

    2018-02-25

    The gradient system transfer function (GSTF) has been used to describe the distorted k-space trajectory for image reconstruction. The purpose of this work was to use the GSTF to determine the pre-emphasis for an undistorted gradient output and intended k-space trajectory. The GSTF of the MR system was determined using only standard MR hardware without special equipment such as field probes or a field camera. The GSTF was used for trajectory prediction in image reconstruction and for a gradient waveform pre-emphasis. As test sequences, a gradient-echo sequence with phase-encoding gradient modulation and a gradient-echo sequence with a spiral read-out trajectory were implemented and subsequently applied on a structural phantom and in vivo head measurements. Image artifacts were successfully suppressed by applying the GSTF-based pre-emphasis. Equivalent results are achieved with images acquired using GSTF-based post-correction of the trajectory as a part of image reconstruction. In contrast, the pre-emphasis approach allows reconstruction using the initially intended trajectory. The artifact suppression shown for two sequences demonstrates that the GSTF can serve for a novel pre-emphasis. A pre-emphasis based on the GSTF information can be applied to any arbitrary sequence type. © 2018 International Society for Magnetic Resonance in Medicine.

  16. Sequence Classification: 891686 [

    Lifescience Database Archive (English)

    Full Text Available TMB Non-TMH Non-TMB TMB Non-TMB Non-TMB >gi|6320838|ref|NP_010917.1| Constituent of 66S pre-ribosomal partic...les, involved in 60S ribosomal subunit biogenesis; Nop16p || http://www.ncbi.nlm.nih.gov/protein/6320838 ...

  17. Sequence Classification: 894064 [

    Lifescience Database Archive (English)

    Full Text Available al protein; intron of RPL18A pre-mRNA forms stem-loop structures that are a target for Rnt1p cleavage leading to degradation; Rpl18ap || http://www.ncbi.nlm.nih.gov/protein/6324452 ...

  18. Developmental ossification sequences of the appendicular and axial ...

    African Journals Online (AJOL)

    A pre-hatch developmental study on ossification sequences of axial and appendicular skeletal system in Kuttanad duck embryos was undertaken using 78 viable embryos. From day 3 to day 7 of incubation no ossification densities were seen both by alizarin red staining and computerized radiography. The first indication of ...

  19. Advanced CANDU reactor pre-licensing progress

    International Nuclear Information System (INIS)

    Popov, N.K.; West, J.; Snell, V.G.; Ion, R.; Archinoff, G.; Xu, C.

    2005-01-01

    The Advanced CANDU Reactor (ACR) is an evolutionary advancement of the current CANDU 6 reactor, aimed at producing electrical power for a capital cost and at a unit-energy cost significantly less than that of the current reactor designs. The Canadian Nuclear Safety Commission (CNSC) staff are currently reviewing the ACR design to determine whether, in their opinion, there are any fundamental barriers that would prevent the licensing of the design in Canada. This CNSC licensability review will not constitute a licence, but is expected to reduce regulatory risk. The CNSC pre-licensing review started in September 2003, and was focused on identifying topics and issues for ACR-700 that will require a more detailed review. CNSC staff reviewed about 120 reports, and issued to AECL 65 packages of questions and comments. Currently CNSC staff is reviewing AECL responses to all packages of comments. AECL has recently refocused the design efforts to the ACR-1000, which is a larger version of the ACR design. During the remainder of the pre-licensing review, the CNSC review will be focused on the ACR-1000. AECL Technologies Inc. (AECLT), a wholly-owned US subsidiary of AECL, is engaged in a pre-application process for the ACR-700 with the US Nuclear Regulatory Commission (USNRC) to identify and resolve major issues prior to entering a formal process to obtain standard design certification. To date, the USNRC has produced a Pre-Application Safety Assessment Report (PASAR), which contains their reviews of key focus topics. During the remainder of the pre-application phase, AECLT will address the issues identified in the PASAR. Pursuant to the bilateral agreement between AECL and the Chinese nuclear regulator, the National Nuclear Safety Administration (NNSA) and its Nuclear Safety Center (NSC), NNSA/NSC are reviewing the ACR in seven focus areas. The review started in September 2004, and will take three years. The main objective of the review is to determine how the ACR complies

  20. Electricity sequence control

    International Nuclear Information System (INIS)

    Shin, Heung Ryeol

    2010-03-01

    The contents of the book are introduction of control system, like classification and control signal, introduction of electricity power switch, such as push-button and detection switch sensor for induction type and capacitance type machinery for control, solenoid valve, expression of sequence and type of electricity circuit about using diagram, time chart, marking and term, logic circuit like Yes, No, and, or and equivalence logic, basic electricity circuit, electricity sequence control, added condition, special program control about choice and jump of program, motor control, extra circuit on repeat circuit, pause circuit in a conveyer, safety regulations and rule about classification of electricity disaster and protective device for insulation.

  1. Next-generation sequencing

    DEFF Research Database (Denmark)

    Rieneck, Klaus; Bak, Mads; Jønson, Lars

    2013-01-01

    , Illumina); several millions of PCR sequences were analyzed. RESULTS: The results demonstrated the feasibility of diagnosing the fetal KEL1 or KEL2 blood group from cell-free DNA purified from maternal plasma. CONCLUSION: This method requires only one primer pair, and the large amount of sequence...... information obtained allows well for statistical analysis of the data. This general approach can be integrated into current laboratory practice and has numerous applications. Besides DNA-based predictions of blood group phenotypes, platelet phenotypes, or sickle cell anemia, and the determination of zygosity...

  2. On the Convexity of Step out - Step in Sequencing Games

    NARCIS (Netherlands)

    Musegaas, Marieke; Borm, Peter; Quant, Marieke

    2016-01-01

    The main result of this paper is the convexity of Step out - Step in (SoSi) sequencing games, a class of relaxed sequencing games first analyzed by Musegaas, Borm, and Quant (2015). The proof makes use of a polynomial time algorithm determining the value and an optimal processing order for an

  3. [Management of pre-analytical nonconformities].

    Science.gov (United States)

    Berkane, Z; Dhondt, J L; Drouillard, I; Flourié, F; Giannoli, J M; Houlbert, C; Surgat, P; Szymanowicz, A

    2010-12-01

    The main nonconformities enumerated to facilitate consensual codification. In each case, an action is defined: refusal to realize the examination with request of a new sample, request of information or correction, results cancellation, nurse or physician information. A traceability of the curative, corrective and preventive actions is needed. Then, methodology and indicators are proposed to assess nonconformity and to follow the quality improvements. The laboratory information system can be used instead of dedicated software. Tools for the follow-up of nonconformities scores are proposed. Finally, we propose an organization and some tools allowing the management and control of the nonconformities occurring during the pre-examination phase.

  4. Output-Sensitive Pattern Extraction in Sequences

    DEFF Research Database (Denmark)

    Grossi, Roberto; Menconi, Giulia; Pisanti, Nadia

    2014-01-01

    Genomic Analysis, Plagiarism Detection, Data Mining, Intrusion Detection, Spam Fighting and Time Series Analysis are just some examples of applications where extraction of recurring patterns in sequences of objects is one of the main computational challenges. Several notions of patterns exist...... or extend them causes a loss of significant information (where the number of occurrences changes). Output-sensitive algorithms have been proposed to enumerate and list these patterns, taking polynomial time O(nc) per pattern for constant c > 1, which is impractical for massive sequences of very large length...

  5. Ancestral sequence reconstruction with Maximum Parsimony

    OpenAIRE

    Herbst, Lina; Fischer, Mareike

    2017-01-01

    One of the main aims in phylogenetics is the estimation of ancestral sequences based on present-day data like, for instance, DNA alignments. One way to estimate the data of the last common ancestor of a given set of species is to first reconstruct a phylogenetic tree with some tree inference method and then to use some method of ancestral state inference based on that tree. One of the best-known methods both for tree inference as well as for ancestral sequence inference is Maximum Parsimony (...

  6. Main: 1QN6 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Ap*Tp*Ap*Ap*Tp*Ap*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Tp*Ap*Tp*Tp*Ap*Tp*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  7. Main: 1QNB [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Ap*Tp*Ap*Ap*Ap*Tp*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Ap*Tp*Tp*Tp*Ap*Tp*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  8. Main: 1QN5 [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Ap*Tp*Ap*Ap*Gp*Ap*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Tp*Cp*Tp*Tp*Ap*Tp*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  9. Main: 1QNA [RPSD[Archive

    Lifescience Database Archive (English)

    Full Text Available itiation Factor Tfiid-1; Chain: A, B; Synonym: Tata-Box Factor 1, Tata Sequence-Binding Protein 1, Tbp1; Eng...ineered: Yes; Molecule: Dna (5'-D(*Gp*Cp*Tp*Tp*Tp*Ap*Ap*Ap*Ap*Gp*Gp*Gp*Cp*A)-3'); Chai...n: C, E; Molecule: Dna (5'-D(*Tp*Gp*Cp*Cp*Cp*Tp*Tp*Tp*Tp*Ap*Ap*Ap*Gp*C)-3'); Chain: D, F Tata Box-Bindi

  10. The 2016 Kumamoto earthquake sequence.

    Science.gov (United States)

    Kato, Aitaro; Nakamura, Kouji; Hiyama, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An M j 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an M j 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest.

  11. The 2016 Kumamoto earthquake sequence

    Science.gov (United States)

    KATO, Aitaro; NAKAMURA, Kouji; HIYAMA, Yohei

    2016-01-01

    Beginning in April 2016, a series of shallow, moderate to large earthquakes with associated strong aftershocks struck the Kumamoto area of Kyushu, SW Japan. An Mj 7.3 mainshock occurred on 16 April 2016, close to the epicenter of an Mj 6.5 foreshock that occurred about 28 hours earlier. The intense seismicity released the accumulated elastic energy by right-lateral strike slip, mainly along two known, active faults. The mainshock rupture propagated along multiple fault segments with different geometries. The faulting style is reasonably consistent with regional deformation observed on geologic timescales and with the stress field estimated from seismic observations. One striking feature of this sequence is intense seismic activity, including a dynamically triggered earthquake in the Oita region. Following the mainshock rupture, postseismic deformation has been observed, as well as expansion of the seismicity front toward the southwest and northwest. PMID:27725474

  12. A neurocomputational model of automatic sequence production.

    Science.gov (United States)

    Helie, Sebastien; Roeder, Jessica L; Vucovich, Lauren; Rünger, Dennis; Ashby, F Gregory

    2015-07-01

    Most behaviors unfold in time and include a sequence of submovements or cognitive activities. In addition, most behaviors are automatic and repeated daily throughout life. Yet, relatively little is known about the neurobiology of automatic sequence production. Past research suggests a gradual transfer from the associative striatum to the sensorimotor striatum, but a number of more recent studies challenge this role of the BG in automatic sequence production. In this article, we propose a new neurocomputational model of automatic sequence production in which the main role of the BG is to train cortical-cortical connections within the premotor areas that are responsible for automatic sequence production. The new model is used to simulate four different data sets from human and nonhuman animals, including (1) behavioral data (e.g., RTs), (2) electrophysiology data (e.g., single-neuron recordings), (3) macrostructure data (e.g., TMS), and (4) neurological circuit data (e.g., inactivation studies). We conclude with a comparison of the new model with existing models of automatic sequence production and discuss a possible new role for the BG in automaticity and its implication for Parkinson's disease.

  13. Leakage detection in underground gas mains with radioaktive argon

    International Nuclear Information System (INIS)

    Schmitz, J.

    1975-01-01

    In the field of gas supply, radionuclide techniques are suitable for the routine monitoring of transport mains by means of highly active tracer clouds and a measuring scraper as well as for exact leakage detection in local gas distribution systems. Very good results are obtained in the case of mains lying lower than 1.5 m if the length and alignment of the pipe section allow a towing probe to be pulled through. This was investigated systematically on a model stretch under practical conditions. The attempts to detect leakages were made with the aid of the radioactive isotope 41 Ar. Under conditions close to practice concerning pipe bedding, branching, pre-pressure, and leakage diameter, a leak with leakage rates as small as approx. 1 l/min could be measured with the aid of a towing probe with a precision of +-0.5 m. This accuracy is another advantage of this method. Branching and fittings with a big dead volume do not interfere with the evaluation. The investment for this method can be compared to other physical/technical investigations on mains, e.g. weld seam tests. (orig./LN) [de

  14. Tools for integrated sequence-structure analysis with UCSF Chimera

    Directory of Open Access Journals (Sweden)

    Huang Conrad C

    2006-07-01

    Full Text Available Abstract Background Comparing related structures and viewing the structures in the context of sequence alignments are important tasks in protein structure-function research. While many programs exist for individual aspects of such work, there is a need for interactive visualization tools that: (a provide a deep integration of sequence and structure, far beyond mapping where a sequence region falls in the structure and vice versa; (b facilitate changing data of one type based on the other (for example, using only sequence-conserved residues to match structures, or adjusting a sequence alignment based on spatial fit; (c can be used with a researcher's own data, including arbitrary sequence alignments and annotations, closely or distantly related sets of proteins, etc.; and (d interoperate with each other and with a full complement of molecular graphics features. We describe enhancements to UCSF Chimera to achieve these goals. Results The molecular graphics program UCSF Chimera includes a suite of tools for interactive analyses of sequences and structures. Structures automatically associate with sequences in imported alignments, allowing many kinds of crosstalk. A novel method is provided to superimpose structures in the absence of a pre-existing sequence alignment. The method uses both sequence and secondary structure, and can match even structures with very low sequence identity. Another tool constructs structure-based sequence alignments from superpositions of two or more proteins. Chimera is designed to be extensible, and mechanisms for incorporating user-specific data without Chimera code development are also provided. Conclusion The tools described here apply to many problems involving comparison and analysis of protein structures and their sequences. Chimera includes complete documentation and is intended for use by a wide range of scientists, not just those in the computational disciplines. UCSF Chimera is free for non-commercial use and is

  15. Geoseq: a tool for dissecting deep-sequencing datasets

    Directory of Open Access Journals (Sweden)

    Homann Robert

    2010-10-01

    Full Text Available Abstract Background Datasets generated on deep-sequencing platforms have been deposited in various public repositories such as the Gene Expression Omnibus (GEO, Sequence Read Archive (SRA hosted by the NCBI, or the DNA Data Bank of Japan (ddbj. Despite being rich data sources, they have not been used much due to the difficulty in locating and analyzing datasets of interest. Results Geoseq http://geoseq.mssm.edu provides a new method of analyzing short reads from deep sequencing experiments. Instead of mapping the reads to reference genomes or sequences, Geoseq maps a reference sequence against the sequencing data. It is web-based, and holds pre-computed data from public libraries. The analysis reduces the input sequence to tiles and measures the coverage of each tile in a sequence library through the use of suffix arrays. The user can upload custom target sequences or use gene/miRNA names for the search and get back results as plots and spreadsheet files. Geoseq organizes the public sequencing data using a controlled vocabulary, allowing identification of relevant libraries by organism, tissue and type of experiment. Conclusions Analysis of small sets of sequences against deep-sequencing datasets, as well as identification of public datasets of interest, is simplified by Geoseq. We applied Geoseq to, a identify differential isoform expression in mRNA-seq datasets, b identify miRNAs (microRNAs in libraries, and identify mature and star sequences in miRNAS and c to identify potentially mis-annotated miRNAs. The ease of using Geoseq for these analyses suggests its utility and uniqueness as an analysis tool.

  16. THE PROGENITOR DEPENDENCE OF THE PRE-EXPLOSION NEUTRINO EMISSION IN CORE-COLLAPSE SUPERNOVAE

    International Nuclear Information System (INIS)

    O'Connor, Evan; Ott, Christian D.

    2013-01-01

    We perform spherically symmetric general-relativistic simulations of core collapse and the postbounce pre-explosion phase in 32 presupernova stellar models of solar metallicity with zero-age main-sequence masses of 12-120 M ☉ . Using energy-dependent three-species neutrino transport in the two-moment approximation with an analytic closure, we show that the emitted neutrino luminosities and spectra follow very systematic trends that are correlated with the compactness (∼M/R) of the progenitor star's inner regions via the accretion rate in the pre-explosion phase. We find that these qualitative trends depend only weakly on the nuclear equation of state (EOS), but quantitative observational statements will require independent constraints on the EOS and the rotation rate of the core as well as a more complete understanding of neutrino oscillations. We investigate the simulated response of water Cherenkov detectors to the electron antineutrino fluxes from our models and find that the large statistics of a galactic core collapse event may allow robust conclusions on the inner structure of the progenitor star.

  17. THE PROGENITOR DEPENDENCE OF THE PRE-EXPLOSION NEUTRINO EMISSION IN CORE-COLLAPSE SUPERNOVAE

    Energy Technology Data Exchange (ETDEWEB)

    O' Connor, Evan; Ott, Christian D., E-mail: evanoc@tapir.caltech.edu, E-mail: cott@tapir.caltech.edu [TAPIR, California Institute of Technology, Mailcode 350-17, Pasadena, CA 91125 (United States)

    2013-01-10

    We perform spherically symmetric general-relativistic simulations of core collapse and the postbounce pre-explosion phase in 32 presupernova stellar models of solar metallicity with zero-age main-sequence masses of 12-120 M {sub Sun }. Using energy-dependent three-species neutrino transport in the two-moment approximation with an analytic closure, we show that the emitted neutrino luminosities and spectra follow very systematic trends that are correlated with the compactness ({approx}M/R) of the progenitor star's inner regions via the accretion rate in the pre-explosion phase. We find that these qualitative trends depend only weakly on the nuclear equation of state (EOS), but quantitative observational statements will require independent constraints on the EOS and the rotation rate of the core as well as a more complete understanding of neutrino oscillations. We investigate the simulated response of water Cherenkov detectors to the electron antineutrino fluxes from our models and find that the large statistics of a galactic core collapse event may allow robust conclusions on the inner structure of the progenitor star.

  18. Hillshades for the main 8 Hawaiian Islands

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These hillshade datasets were derived from USGS 7.5' DEM Quads for the main 8 Hawaiian Islands. Individual DEM quads were first converted to a common datum, and...

  19. Nuclear power station main control room habitability

    International Nuclear Information System (INIS)

    Paschal, W.B.; Knous, W.S.

    1989-01-01

    The main control room at a nuclear power station must remain habitable during a variety of plant conditions and postulated events. The control room habitability requirement and the function of the heating, ventilating, air-conditioning, and air treatment system are to control environmental factors, such as temperature, pressure, humidity, radiation, and toxic gas. Habitability requirements provide for the safety of personnel and enable operation of equipment required to function in the main control room. Habitability as an issue has been gaining prominence with the Advisor Committee of Reactor Safeguards and the Nuclear Regulatory Commission since the incident at Three Mile Island. Their concern is the ability of the presently installed habitability systems to control the main control room environment after an accident. This paper discusses main control room HVAC systems; the concern, requirements, and results of NRC surveys and notices; and an approach to control room habitability reviews

  20. Seasonal Composite Chlorophyll Concentrations - Gulf of Maine

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This personal geodatabase contains raster images of chlorophyll concentrations in the Gulf of Maine. These raster images are seasonal composites, and were calculated...

  1. Collins' bypass for the main ring

    International Nuclear Information System (INIS)

    Ohnuma, S.

    1982-01-01

    Design of the bypass for the main ring at Fermilab is discussed. Specific design features discussed include space, path length, geometric closure, matching of betatron functions, and external dispersion. Bypass parameters are given

  2. Monthly Composite Chlorophyll Concentrations - Gulf of Maine

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This personal geodatabase contains raster images of chlorophyll concentrations in the Gulf of Maine. These raster images are monthly composites, and were calculated...

  3. 2015 City of Portland, Maine, Lidar

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — 2015 City of Portland Maine Lidar Data Acquisition and Processing Woolpert Order No. 75564 Contractor: Woolpert, Inc. This task is for a high resolution data set of...

  4. 2016 USGS Lidar DEM: Maine QL2

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Product: These are Digital Elevation Model (DEM) data for Franklin, Oxford, Piscataquis, and Somerset Counties, Maine as part of the required deliverables for the...

  5. Complete Genome Sequences of Isolates of Enterococcus faecium Sequence Type 117, a Globally Disseminated Multidrug-Resistant Clone

    Science.gov (United States)

    Tedim, Ana P.; Lanza, Val F.; Manrique, Marina; Pareja, Eduardo; Ruiz-Garbajosa, Patricia; Cantón, Rafael; Baquero, Fernando; Tobes, Raquel

    2017-01-01

    ABSTRACT The emergence of nosocomial infections by multidrug-resistant sequence type 117 (ST117) Enterococcus faecium has been reported in several European countries. ST117 has been detected in Spanish hospitals as one of the main causes of bloodstream infections. We analyzed genome variations of ST117 strains isolated in Madrid and describe the first ST117 closed genome sequences. PMID:28360174

  6. Biological sequence analysis

    DEFF Research Database (Denmark)

    Durbin, Richard; Eddy, Sean; Krogh, Anders Stærmose

    This book provides an up-to-date and tutorial-level overview of sequence analysis methods, with particular emphasis on probabilistic modelling. Discussed methods include pairwise alignment, hidden Markov models, multiple alignment, profile searches, RNA secondary structure analysis, and phylogene...

  7. THE RHIC SEQUENCER

    International Nuclear Information System (INIS)

    VAN ZEIJTS, J.; DOTTAVIO, T.; FRAK, B.; MICHNOFF, R.

    2001-01-01

    The Relativistic Heavy Ion Collider (RHIC) has a high level asynchronous time-line driven by a controlling program called the ''Sequencer''. Most high-level magnet and beam related issues are orchestrated by this system. The system also plays an important task in coordinated data acquisition and saving. We present the program, operator interface, operational impact and experience

  8. Twin anemia polycythemia sequence

    NARCIS (Netherlands)

    Slaghekke, Femke

    2014-01-01

    In this thesis we describe that Twin Anemia Polycythemia Sequence (TAPS) is a form of chronic feto-fetal transfusion in monochorionic (identical) twins based on a small amount of blood transfusion through very small anastomoses. For the antenatal diagnosis of TAPS, Middle Cerebral Artery – Peak

  9. simple sequence repeat (SSR)

    African Journals Online (AJOL)

    In the present study, 78 mapped simple sequence repeat (SSR) markers representing 11 linkage groups of adzuki bean were evaluated for transferability to mungbean and related Vigna spp. 41 markers amplified characteristic bands in at least one Vigna species. The transferability percentage across the genotypes ranged ...

  10. Molecular clusters of the main group elements

    CERN Document Server

    Driess, Matthias

    2008-01-01

    ""To summarize, Molecular Clusters of the Main Group Elements is certainly not a popular science book, nor is it a textbook; it is a very good, up-to-date collection of articles for the specialist. Als Fazit bleibt: Molecular Clusters of the Main Group Elements ist sicher kein populissenschaftliches Werk, auch kein Lehrbuch, aber eine gelungene, hoch aktuelle Zusammenstellung fen interessierten Fachmann."" -Michael Ruck, TU Dresden, Angewandte Chemie, 2004 - 116/36 + International Edition 2004 - 43/36

  11. Revisiting Reuse in Main Memory Database Systems

    OpenAIRE

    Dursun, Kayhan; Binnig, Carsten; Cetintemel, Ugur; Kraska, Tim

    2016-01-01

    Reusing intermediates in databases to speed-up analytical query processing has been studied in the past. Existing solutions typically require intermediate results of individual operators to be materialized into temporary tables to be considered for reuse in subsequent queries. However, these approaches are fundamentally ill-suited for use in modern main memory databases. The reason is that modern main memory DBMSs are typically limited by the bandwidth of the memory bus, thus query execution ...

  12. The intermediate-age pre-cataclysmic variables SDSS J172406+562003 and RE J2013+4002

    Science.gov (United States)

    Shimansky, V. V.; Borisov, N. V.; Nurtdinova, D. N.; Mitrofanova, A. A.; Vlasyuk, V. V.; Spiridonova, O. I.

    2012-06-01

    We have analyzed the physical status of the pre-cataclysmic variables SDSSJ172406+562003 and RE J2013+4002, which have evolved after their common-envelope stage a time t = 106-107 years. Spectroscopy and photometry of these systems were performed with the 6-m and 1-m telescopes of the Special Astrophysical Observatory. We demonstrate that emission lines in the spectra were formed solely by the reflection of radiation emitted by the white dwarfs on the surfaces of their cool companions, under conditions close to local thermodynamic equilibrium. These effects are also responsible for most of the objects' photometric variability amplitude. However, comparing the light curves of SDSS 172406 from different epochs, we find aperiodic brightness variations, probably due to spottedness of the surface of the secondary. Jointly analyzing the spectra, radial-velocity curves, and light curves of the pre-cataclysmic variables and modeling the reflection effects, we have derived their fundamental parameters. We demonstrate that the secondaries in these systems are consistent with evolutionary models for main-sequence stars and do not have the luminosity excesses characteristic of cool stars in young pre-cataclysmic variables.

  13. Maine Tidal Power Initiative: Environmental Impact Protocols For Tidal Power

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, Michael Leroy [Univ. of Maine, Orono, ME; Zydlewski, Gayle Barbin [Univ. of Maine, Orono, ME; Xue, Huijie [Univ. of Maine, Orono, ME; Johnson, Teresa R. [Univ. of Maine, Orono, ME

    2014-02-02

    The Maine Tidal Power Initiative (MTPI), an interdisciplinary group of engineers, biologists, oceanographers, and social scientists, has been conducting research to evaluate tidal energy resources and better understand the potential effects and impacts of marine hydro-kinetic (MHK) development on the environment and local community. Project efforts include: 1) resource assessment, 2) development of initial device design parameters using scale model tests, 3) baseline environmental studies and monitoring, and 4) human and community responses. This work included in-situ measurement of the environmental and social response to the pre-commercial Turbine Generator Unit (TGU®) developed by Ocean Renewable Power Company (ORPC) as well as considering the path forward for smaller community scale projects.

  14. Targeted sequencing of plant genomes

    Science.gov (United States)

    Mark D. Huynh

    2014-01-01

    Next-generation sequencing (NGS) has revolutionized the field of genetics by providing a means for fast and relatively affordable sequencing. With the advancement of NGS, wholegenome sequencing (WGS) has become more commonplace. However, sequencing an entire genome is still not cost effective or even beneficial in all cases. In studies that do not require a whole-...

  15. Almost convergence of triple sequences

    OpenAIRE

    Ayhan Esi; M.Necdet Catalbas

    2013-01-01

    In this paper we introduce and study the concepts of almost convergence and almost Cauchy for triple sequences. Weshow that the set of almost convergent triple sequences of 0's and 1's is of the first category and also almost everytriple sequence of 0's and 1's is not almost convergent.Keywords: almost convergence, P-convergent, triple sequence.

  16. A few Smarandache Integer Sequences

    OpenAIRE

    Ibstedt, Henry

    2010-01-01

    This paper deals with the analysis of a few Smarandache Integer Sequences which first appeared in Properties or the Numbers, F. Smarandache, University or Craiova Archives, 1975. The first four sequences are recurrence generated sequences while the last three are concatenation sequences.

  17. CHARACTERIZATIONS OF FUZZY SOFT PRE SEPARATION AXIOMS

    OpenAIRE

    El-Latif, Alaa Mohamed Abd

    2015-01-01

    − The notions of fuzzy pre open soft sets and fuzzy pre closed soft sets were introducedby Abd El-latif et al. [2]. In this paper, we continue the study on fuzzy soft topological spaces andinvestigate the properties of fuzzy pre open soft sets, fuzzy pre closed soft sets and study variousproperties and notions related to these structures. In particular, we study the relationship betweenfuzzy pre soft interior fuzzy pre soft closure. Moreover, we study the properties of fuzzy soft pre regulars...

  18. Pre-Calculus For Dummies

    CERN Document Server

    Kuang, Yang

    2012-01-01

    The fun and easy way to learn pre-calculus Getting ready for calculus but still feel a bit confused? Have no fear. Pre-Calculus For Dummies is an un-intimidating, hands-on guide that walks you through all the essential topics, from absolute value and quadratic equations to logarithms and exponential functions to trig identities and matrix operations. With this guide's help you'll quickly and painlessly get a handle on all of the concepts - not just the number crunching - and understand how to perform all pre-calc tasks, from graphing to tackling proofs. You'll also get a new appreciation for

  19. Allele Re-sequencing Technologies

    DEFF Research Database (Denmark)

    Byrne, Stephen; Farrell, Jacqueline Danielle; Asp, Torben

    2013-01-01

    The development of next-generation sequencing technologies has made sequencing an affordable approach for detection of genetic variations associated with various traits. However, the cost of whole genome re-sequencing still remains too high to be feasible for many plant species with large...... alternative to whole genome re-sequencing to identify causative genetic variations in plants. One challenge, however, will be efficient bioinformatics strategies for data handling and analysis from the increasing amount of sequence information....

  20. In-service inspection robot for PFBR main vessel- concept

    Energy Technology Data Exchange (ETDEWEB)

    Rajendran, S; Ramakumar, M S [Bhabha Atomic Research Centre, Mumbai (India). Div. of Remote Handling and Robotics

    1994-12-31

    In-service inspection (ISI) of critical components in a nuclear reactor is one of the foremost and important tasks which reveals the state of health of the system, thereby ensuring the safety of the plant, personnel and environment. Prototype Fast Breeder Reactor (PFBR) is designed as a pool type reactor. A safety vessel is provided in the design which envelopes the main reactor vessel. The ISI of the main vessel is mandatory and will be carried out by a robot which will operate on this annular gap. The design of the robot is such that it can crawl around the vessel and into the gap at the bottom of the vessel relying on friction grip. The mobile robot will carry a CCTV camera and the inspection technique packages into the interspace, position and orient these to carry out the ISI of the main vessel. The paper discusses about the design features of the robot including the gripping mechanism and the crawling sequence to perform ISI of the reactor vessel. 3 figs.

  1. In-service inspection robot for PFBR main vessel- concept

    International Nuclear Information System (INIS)

    Rajendran, S.; Ramakumar, M.S.

    1994-01-01

    In-service inspection (ISI) of critical components in a nuclear reactor is one of the foremost and important tasks which reveals the state of health of the system, thereby ensuring the safety of the plant, personnel and environment. Prototype Fast Breeder Reactor (PFBR) is designed as a pool type reactor. A safety vessel is provided in the design which envelopes the main reactor vessel. The ISI of the main vessel is mandatory and will be carried out by a robot which will operate on this annular gap. The design of the robot is such that it can crawl around the vessel and into the gap at the bottom of the vessel relying on friction grip. The mobile robot will carry a CCTV camera and the inspection technique packages into the interspace, position and orient these to carry out the ISI of the main vessel. The paper discusses about the design features of the robot including the gripping mechanism and the crawling sequence to perform ISI of the reactor vessel. 3 figs

  2. Main building fire drill safely concluded

    CERN Document Server

    CERN Bulletin

    2015-01-01

    Last week, a simulated fire in the stairwell of the Main Building put CERN’s emergency response procedures to the test.   Firefighters descend the stairwell in the Main Building as the simulated fire rises.   At 2 p.m. on 22 September, alarms sounded around CERN’s Main Building as an evacuation exercise got underway. A simulated fire in the  stairwell, complete with very realistic smoke, led to the evacuation of one of the busiest places at CERN. The Main Building complex includes the Carlson Wagonlit travel agency, the post office, UBS, Uniqa, the Users Office, the Staff Association and the Novae restaurant as well as the Main Auditorium, the Council Chamber and the Charpak meeting room. It was impressive to see how quickly the smoke propagated in the staircase as well as into the corridors, and equally impressive to see how smoothly, quickly and efficiently the evacuation proceeded. The...

  3. Guide to the Main Ring DO overpass

    International Nuclear Information System (INIS)

    Turkot, F.

    1985-01-01

    The DO overpass is a modification of the beam orbit in Main Ring in order to better accommodate a Tevatron collider detector at DO. The orbit is moved up approx. 51 inches over most of the long straight section at DO, thus making the Main Ring the world's first non-planar proton synchrotron. A similar overpass, but with four times the displacement, is planned for the CDF detector at the BO straight section. The nominal separation between the beam orbit in the Main Ring and the orbit in the Tevatron is 25.5 inches. Early in the design study of a detector that would utilize the Tevatron is a anti pp collider, it was apparent that a larger separation at the detector was highly desirable. In 1981, Tom Collins proposed a specific lattice geometry in the Main Ring for achieving larger separation, called ''the screw beam''. His proposal has served as the basis for the design of both the BO and DO overpasses. The main purpose of this report is to describe in some detail the implementation of the DO overpass. Topics to be covered include: (a) geometry of the overpass orbit, (b) the new hardware in the tunnel, (c) the power supply system, (d) the control facility, (e) accelerator beam dynamics ramifications, and (f) commissioning experience. A secondary purpose is to provide a fairly complete ''bibliography'' to the sources of information on the overpass. 17 refs., 17 figs

  4. Serum 8-isoprostane increased in pre-eclampsia

    Directory of Open Access Journals (Sweden)

    Besari Adi Pramono

    2012-04-01

    Full Text Available Background The main causes of maternal mortality in Indonesia are pre-eclampsia, hemorrhage, and infection. Oxidative stress has a primary role in pre-eclampsia and one of its parameters is 8-isoprostane serum level. The objective of this study is to measure 8-isoprostane and to analyze the relationship between 8-isoprostane level and birth weight in pre-eclampsia. Methods A cross-sectional study involving 23 pre-eclampsia and 29 normotensive pregnant women with normal or cesarean delivery at Dr. Kariadi Hospital Semarang from January to May 2011. Collected maternal blood samples were assessed for 8-Isoprostane levels by means of a specific ELISA kit. Neonatal birth weight was measured immediately after delivery by means of calibrated baby scales. Differences in 8-isoprostane levels between pre-eclampsia and normotensive women were assessed using independent t-test for normal distributed data, and the Mann-Whitney test for non-normally distributed data. Results Mean 8-isoprostane level was significantly higher in women with pre-eclampsia than in normotensive women (62.52 ± 12.19 pg/mL vs 28.64 ± 8.81 pg/mL (p<0.05. Low birth weight was twice as frequent in pre-eclampsia than in normotensives. There was no correlation between 8-isoprostane serum level and neonatal birth weight in pre-eclampsia. Conclusion The level of 8-isoprostane was higher in pre-eclampsia than in normotensives. It is recommended to conduct further studies to determine whether 8-isoprostane may be used as a predictive marker of pre-eclampsia.

  5. Main Coast Winds - Final Scientific Report

    Energy Technology Data Exchange (ETDEWEB)

    Jason Huckaby; Harley Lee

    2006-03-15

    The Maine Coast Wind Project was developed to investigate the cost-effectiveness of small, distributed wind systems on coastal sites in Maine. The restructuring of Maine's electric grid to support net metering allowed for the installation of small wind installations across the state (up to 100kW). The study performed adds insight to the difficulties of developing cost-effective distributed systems in coastal environments. The technical hurdles encountered with the chosen wind turbine, combined with the lower than expected wind speeds, did not provide a cost-effective return to make a distributed wind program economically feasible. While the turbine was accepted within the community, the low availability has been a negative.

  6. Space Shuttle main engine product improvement

    Science.gov (United States)

    Lucci, A. D.; Klatt, F. P.

    1985-01-01

    The current design of the Space Shuttle Main Engine has passed 11 certification cycles, amassed approximately a quarter million seconds of engine test time in 1200 tests and successfully launched the Space Shuttle 17 times of 51 engine launches through May 1985. Building on this extensive background, two development programs are underway at Rocketdyne to improve the flow of hot gas through the powerhead and evaluate the changes to increase the performance margins in the engine. These two programs, called Phase II+ and Technology Test Bed Precursor program are described. Phase II+ develops a two-tube hot-gas manifold that improves the component environment. The Precursor program will evaluate a larger throat main combustion chamber, conduct combustion stability testing of a baffleless main injector, fabricate an experimental weld-free heat exchanger tube, fabricate and test a high pressure oxidizer turbopump with an improved inlet, and develop and test methods for reducing temperature transients at start and shutdown.

  7. The red deer Cervus elaphus genome CerEla1.0: sequencing, annotating, genes, and chromosomes.

    Science.gov (United States)

    Bana, Nóra Á; Nyiri, Anna; Nagy, János; Frank, Krisztián; Nagy, Tibor; Stéger, Viktor; Schiller, Mátyás; Lakatos, Péter; Sugár, László; Horn, Péter; Barta, Endre; Orosz, László

    2018-01-02

    We present here the de novo genome assembly CerEla1.0 for the red deer, Cervus elaphus, an emblematic member of the natural megafauna of the Northern Hemisphere. Humans spread the species in the South. Today, the red deer is also a farm-bred animal and is becoming a model animal in biomedical and population studies. Stag DNA was sequenced at 74× coverage by Illumina technology. The ALLPATHS-LG assembly of the reads resulted in 34.7 × 10 3 scaffolds, 26.1 × 10 3 of which were utilized in Cer.Ela1.0. The assembly spans 3.4 Gbp. For building the red deer pseudochromosomes, a pre-established genetic map was used for main anchor points. A nearly complete co-linearity was found between the mapmarker sequences of the deer genetic map and the order and orientation of the orthologous sequences in the syntenic bovine regions. Syntenies were also conserved at the in-scaffold level. The cM distances corresponded to 1.34 Mbp uniformly along the deer genome. Chromosomal rearrangements between deer and cattle were demonstrated. 2.8 × 10 6 SNPs, 365 × 10 3 indels and 19368 protein-coding genes were identified in CerEla1.0, along with positions for centromerons. CerEla1.0 demonstrates the utilization of dual references, i.e., when a target genome (here C. elaphus) already has a pre-established genetic map, and is combined with the well-established whole genome sequence of a closely related species (here Bos taurus). Genome-wide association studies (GWAS) that CerEla1.0 (NCBI, MKHE00000000) could serve for are discussed.

  8. Review on pre-eclampsia

    OpenAIRE

    Schlembach, Dietmar

    2003-01-01

    Pre-eclampsia is still one of the leading causes of maternal and fetal morbidity and mortality. Despite active research for many decades, the etiology of this disorder exclusive to human pregnancy is an enigma. Recent evidence suggests there may be several underlying causes or predispositions leading to endothelial dysfunction and causing the signs of hypertension, proteinuria, and edema--findings that allow us to make the diagnosis of the "syndrome" of pre-eclampsia. It is obvious that a sin...

  9. Pre-prosthetic surgery: Mandible

    Directory of Open Access Journals (Sweden)

    Veeramalai Naidu Devaki

    2012-01-01

    Full Text Available Pre-prosthetic surgery is that part of oral and maxillofacial surgery which restores oral function and facial form. This is concerned with surgical modification of the alveolar process and its surrounding structures to enable the fabrication of a well-fitting, comfortable, and esthetic dental prosthesis. The ultimate goal of pre-prosthetic surgery is to prepare a mouth to receive a dental prosthesis by redesigning and smoothening bony edges.

  10. Transition crossing in the main injector

    International Nuclear Information System (INIS)

    Wei, J.

    1990-01-01

    This report summarizes the study of various longitudinal problems pertaining to the transition-energy crossing in the proposed Fermi Lab Main Injector. The theory indicates that the beam loss and bunch-area growth are mainly caused by the chromatic non-linear effect, which is enhanced by the space-charge force near transition. Computer simulation using the program TIBETAN shows that a ''γ T jump'' of about 1.5 unit within 1 ms is adequate to achieve a ''clean'' crossing in the currently proposed h=588 scenario. 19 refs., 4 figs

  11. The Fermilab Main Injector Technical Design Handbook

    Energy Technology Data Exchange (ETDEWEB)

    None, None

    1994-08-01

    This report contains a description of the design, cost estimate, and construction schedule of the Fermilab Main Injector (FMI) Project. The technical, cost, and schedule baselines for the FMI Project have already been established and may be found in the Fermilab Main Injector Title I Design Report, issued in August 1992. This report updates and expands upon the design and schedule for construction of all subsystem components and associated civil construction described in the Title I Design Report. The facilities described have been designed in conformance with DOE 6430.1A, "United States Department of Energy General Design Criteria."

  12. Current Russian patriotism: matter, features, main directions

    Directory of Open Access Journals (Sweden)

    Lutovinov Vladimir Ilich

    2013-11-01

    Full Text Available The article considers understanding and the main point of patriotism as one of high cultural values. The main approaches that reveal different sides of this phenomenon, its role and importance in a history of Russia in the 21st century are inferred from the analysis of viewpoints of Russian thinkers and contemporary researchers. The patriotism formation problems in Russian society and their condition are defined, the need of patriotic level rise as one of the conditions for great Russia rebirth is substantiated.

  13. Bunch coalescing in the Fermilab Main Ring

    International Nuclear Information System (INIS)

    Wildman, D.; Martin, P.; Meisner, K.; Miller, H.W.

    1987-01-01

    A new RF system has been installed in the Fermilab Main Ring to coalesce up to 13 individual bunches of protons or antiprotons into a single high-intensity bunch. The coalescing process consists of adiabatically reducing the h=1113 Main Ring RF voltage from 1 MV to less than 1 kV, capturing the debunched beam in a linearized h=53 and h=106 bucket, rotating for a quarter of a synchrotron oscillation period, and then recapturing the beam in a single h=1113 bucket. The new system is described and the results of recent coalescing experiments are compared with computer-generated particle tracking simulations

  14. Multilocus Sequence Typing

    OpenAIRE

    Belén, Ana; Pavón, Ibarz; Maiden, Martin C.J.

    2009-01-01

    Multilocus sequence typing (MLST) was first proposed in 1998 as a typing approach that enables the unambiguous characterization of bacterial isolates in a standardized, reproducible, and portable manner using the human pathogen Neisseria meningitidis as the exemplar organism. Since then, the approach has been applied to a large and growing number of organisms by public health laboratories and research institutions. MLST data, shared by investigators over the world via the Internet, have been ...

  15. Achalasia Carcinoma Sequence

    OpenAIRE

    Makmun, Dadang

    2001-01-01

    We report a case of carcinoma of the esophagus in a 58 years old woman with achalasia, who has been diagnosed since 30 years ago, which initiated by surgical treatment (myotomy) and the symptoms recurred since 3 years ago. According to the progress of the disease, Malignancy was strongly suspected due to prolonged stasis and mucosal irritation caused by achalasia (achalasia carcinoma sequence). Because of these contributing factors for the development of serious complications such as Malignan...

  16. Sequencing BPS spectra

    Energy Technology Data Exchange (ETDEWEB)

    Gukov, Sergei [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Max-Planck-Institut für Mathematik,Vivatsgasse 7, D-53111 Bonn (Germany); Nawata, Satoshi [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Centre for Quantum Geometry of Moduli Spaces, University of Aarhus,Nordre Ringgade 1, DK-8000 (Denmark); Saberi, Ingmar [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Stošić, Marko [CAMGSD, Departamento de Matemática, Instituto Superior Técnico,Av. Rovisco Pais, 1049-001 Lisbon (Portugal); Mathematical Institute SANU,Knez Mihajlova 36, 11000 Belgrade (Serbia); Sułkowski, Piotr [Walter Burke Institute for Theoretical Physics, California Institute of Technology,1200 E California Blvd, Pasadena, CA 91125 (United States); Faculty of Physics, University of Warsaw,ul. Pasteura 5, 02-093 Warsaw (Poland)

    2016-03-02

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  17. Sequencing BPS spectra

    International Nuclear Information System (INIS)

    Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; Stošić, Marko; Sułkowski, Piotr

    2016-01-01

    This paper provides both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explain from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincaré polynomials in numerous examples. Among these structural properties is a novel “sliding” property, which can be explained by using (refined) modular S-matrix. This leads to the identification of modular transformations in Chern-Simons theory and 3d N=2 theory via the 3d/3d correspondence. Lastly, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.

  18. Image sequence analysis

    CERN Document Server

    1981-01-01

    The processing of image sequences has a broad spectrum of important applica­ tions including target tracking, robot navigation, bandwidth compression of TV conferencing video signals, studying the motion of biological cells using microcinematography, cloud tracking, and highway traffic monitoring. Image sequence processing involves a large amount of data. However, because of the progress in computer, LSI, and VLSI technologies, we have now reached a stage when many useful processing tasks can be done in a reasonable amount of time. As a result, research and development activities in image sequence analysis have recently been growing at a rapid pace. An IEEE Computer Society Workshop on Computer Analysis of Time-Varying Imagery was held in Philadelphia, April 5-6, 1979. A related special issue of the IEEE Transactions on Pattern Anal­ ysis and Machine Intelligence was published in November 1980. The IEEE Com­ puter magazine has also published a special issue on the subject in 1981. The purpose of this book ...

  19. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  20. Main principles of development stationary training facilities

    International Nuclear Information System (INIS)

    Tsiptsyura, R.D.

    1986-01-01

    The designation of stationary training facilities is shown and the main requirements for them are formulated. When considering the above-mentioned requirements, special attention was paid to obligatory correspondence between training experience and practical skill of an operator. It is shown, that the switchboard block is the major unit of the training facility, which should develop skills and habits of an operator