High-voltage direct current (HVDC) transmission - a key technology for our power supply

International Nuclear Information System (INIS)

Dorn, J.

2016-01-01

The phasing-out of nuclear power in some countries and the aspirations of reducing carbon dioxide emissions have far-reaching implications for electric power generation in Europe. In the future, renewable electricity generation will account for a considerable share of the energy mix, but this type of production is often far from the load centers. In Germany, for example, large quantities of wind energy are already generated in the north and in the North Sea, but large load centers are located several hundred kilometers south of there. This requires an expansion of the transmission network with innovative solutions. High-voltage direct-current (HVDC) transmission plays an important role, since it brings a number of advantages over conventional AC technology and makes certain requirements feasible, for example Cable transmission over longer distances. The lecture presents the advantages of HVDC, the semiconductors used as well as the basic functions and typical performance of the used converter topopologies. The plant configurations and main components are illustrated using current projects. (rössner) [de

E-beam high voltage switching power supply

Science.gov (United States)

Shimer, Daniel W.; Lange, Arnold C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

E-beam high voltage switching power supply

International Nuclear Information System (INIS)

Shimer, D.W.; Lange, A.C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs

Structure-property relationships in an Al matrix Ca nanofilamentary composite conductor with potential application in high-voltage power transmission

Science.gov (United States)

Tian, Liang

This study investigated the processing-structure-properties relationships in an Al/Ca composites using both experiments and modeling/simulation. A particular focus of the project was understanding how the strength and electrical conductivity of the composite are related to its microstructure in the hope that a conducting material with light weight, high strength, and high electrical conductivity can be developed to produce overhead high-voltage power transmission cables. The current power transmission cables (e.g., Aluminum Conductor Steel Reinforced (ACSR)) have acceptable performance for high-voltage AC transmission, but are less well suited for high-voltage DC transmission due to the poorly conducting core materials that support the cable weight. This Al/Ca composite was produced by powder metallurgy and severe plastic deformation by extrusion and swaging. The fine Ca metal powders have been produced by centrifugal atomization with rotating liquid oil quench bath, and a detailed study about the atomization process and powder characteristics has been conducted. The microstructure of Al/Ca composite was characterized by electron microscopy. Microstructure changes at elevated temperature were characterized by thermal analysis and indirect resistivity tests. The strength and electrical conductivity were measured by tensile tests and four-point probe resistivity tests. Predicting the strength and electrical conductivity of the composite was done by micro-mechanics-based analytical modeling. Microstructure evolution was studied by mesoscale-thermodynamics-based phase field modeling and a preliminary atomistic molecular dynamics simulation. The application prospects of this composite was studied by an economic analysis. This study suggests that the Al/Ca (20 vol. %) composite shows promise for use as overhead power transmission cables. Further studies are needed to measure the corrosion resistance, fatigue properties and energized field performance of this composite.

Concept design of the high voltage transmission system for the collider tunnel

International Nuclear Information System (INIS)

Norman, L.S.

1992-03-01

In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations -- such as the Channel Tunnel -- demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design

Concept design of the high-voltage transmission system for the collider tunnel

International Nuclear Information System (INIS)

Norman, L.S.

1992-01-01

In order to provide electrical service to the Superconducting Super Collider Laboratory (SSCL) 54-mile-circumference collider of 125 MVA at 69 kV or 155 MVA at 138 kV of distributed power, it must be demonstrated that the concept design for a high-voltage transmission system can meet the distribution requirements of the collider electrical system with its cryogenic system's large motor loads and its pulsed power technical systems. It is a practical design, safe for operating personnel and cost-effective. The normal high-voltage transmission techniques of overhead and underground around the 54-mile collider tunnel could not be applied because of technical and physical constraints, or was environmentally unacceptable. The approach taken to solve these problems is the installation of 69-kV or 138-kV exposed solid dielectric transmission cable inside the collider tunnel with the superconducting magnets, cryogenic piping, electrical medium, and low-voltage distribution systems, and electronic/instrumentation wiring systems. This mixed-use approach has never been attempted in a collider tunnel. Research into all aspects of the engineering and installation problems and consultation with transmission cable manufacturers, electrical utilities, and European entities with similar installations-such as the Channel Tunnel-demonstrate that the concept design is feasible and practical. This paper presents a history of the evolution of the concept design. Design studies are underway to determine the system configuration and voltages. Included in this report are tunnel transmission cable system considerations and evaluation of solid dielectric high-voltage cable design

Radio and television interference caused by corona discharges from high-voltage transmission lines

International Nuclear Information System (INIS)

Sarmadi, M.

1996-01-01

Increase in power utility loads in industrialized countries, as well as developing countries, demands a higher level of transmission line voltage. Radio interference (RI) problems have been determined to be a limiting factor in selecting the size of transmission line conductors. Transmission line noise is primarily caused by corona discharges in the immediate vicinity of the conductor. It has been observed that discharges occur during both half-cycles of the applied voltage, but positive corona is usually predominant at AM radio frequencies range with practical high-voltage and extra high-voltage transmission lines. The corona radio noise effect is highly dependent upon the presence of particles on the surface of the conductor and the increase of the electrical gradient beyond the breakdown value of the air. Therefore, corona radio noise varies significantly with the weather and atmospheric conditions and generally increases by 10 to 30 dB in foul weather

Electrical Power Supply to Offshore Oil Installations by High Voltage Direct Current Transmission

Energy Technology Data Exchange (ETDEWEB)

Myhre, Joergen Chr.

2001-07-01

This study was initiated to investigate if it could be feasible to supply offshore oil installations in the North Sea with electrical power from land. A prestudy of alternative converter topologies indicated that the most promising solution would be to investigate a conventional system with reduced synchronous compensator rating. The study starts with a summary of the state of power supply to offshore installations today, and a short review of classical HVDC transmission. It goes on to analyse how a passive network without sources influences the inverter. The transmission, with its current controlled rectifier and large inductance, is simulated as a current source. Under these circumstances the analysis shows that the network frequency has to adapt in order to keep the active and reactive power balance until the controllers are able to react. The concept of firing angle for a thyristor is limited in a system with variable frequency, the actual control parameter is the firing delay time. Sensitivity analysis showed some astonishing consequences. The frequency rises both by an increase in the active and in the reactive load. The voltage falls by an increase in the active load, but rises by an increase in the inductive load. Two different control principles for the system of inverter, synchronous compensator and load are defined. The first takes the reference for the firing delay time from the fundamental voltage at the point of common coupling. The second takes the reference for the firing delay time from the simulated EMF of the synchronous compensator. Of these, the second is the more stable and should be chosen as the basis for a possible control system. Two simulation tools are applied. The first is a quasi-phasor model running on Matlab with Simulink. The other is a time domain model in KREAN. The time domain model is primarily used for the verification of the quasi-phasor model, and shows that quasi-phasors is still a valuable tool for making a quick analysis

Market Report : The high-voltage transmission market in Poland

Energy Technology Data Exchange (ETDEWEB)

NONE

2002-06-01

In order to meet the accession requirements for membership to the European Union, Poland is currently restructuring its energy sector, and the initiative to privatise the electric power industry to full competition by 2005 is on course. This report describes the opportunities for foreign investors and suppliers of electrical equipment and services, particularly at this time when power demand is growing, the power grid infrastructure is ageing and obsolete components must be replaced. The total installed capacity in Poland is about 33,000 megawatts. This includes all installations of power plants and combined heat and power plants. An investment of $23 billion is anticipated by 2010 in order to modernize the electricity power industry and to meet the growing energy demand. Polski Siece Elektroenergetyczne, S.A. (PSE) is the state-owned company which controls Poland's high-voltage transmission grid. It operates a 220 kilovolt and 40 kV grid and holds the monopoly on acquiring and transmitting electricity in the country. Poland maintains grid interconnections with several other European countries and is looking to expand its network. Opportunities for Canadian suppliers lie in the areas of high-voltage power transmission equipment and services. Other opportunities lie in commercial prospects in sales of equipment and services. The report includes a section on international competition, and the Canadian position for both private- and public-sector companies. A section on market logistics describes distribution channels, market-entry considerations, import regulations, and export credit risks. A list of key contacts and support services is included with this report. refs., tabs.

Topologically protected loop flows in high voltage AC power grids

International Nuclear Information System (INIS)

Coletta, T; Delabays, R; Jacquod, Ph; Adagideli, I

2016-01-01

Geographical features such as mountain ranges or big lakes and inland seas often result in large closed loops in high voltage AC power grids. Sizable circulating power flows have been recorded around such loops, which take up transmission line capacity and dissipate but do not deliver electric power. Power flows in high voltage AC transmission grids are dominantly governed by voltage angle differences between connected buses, much in the same way as Josephson currents depend on phase differences between tunnel-coupled superconductors. From this previously overlooked similarity we argue here that circulating power flows in AC power grids are analogous to supercurrents flowing in superconducting rings and in rings of Josephson junctions. We investigate how circulating power flows can be created and how they behave in the presence of ohmic dissipation. We show how changing operating conditions may generate them, how significantly more power is ohmically dissipated in their presence and how they are topologically protected, even in the presence of dissipation, so that they persist when operating conditions are returned to their original values. We identify three mechanisms for creating circulating power flows, (i) by loss of stability of the equilibrium state carrying no circulating loop flow, (ii) by tripping of a line traversing a large loop in the network and (iii) by reclosing a loop that tripped or was open earlier. Because voltages are uniquely defined, circulating power flows can take on only discrete values, much in the same way as circulation around vortices is quantized in superfluids. (paper)

High Efficiency Power Converter for Low Voltage High Power Applications

DEFF Research Database (Denmark)

Nymand, Morten

The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based......, and remote power generation for light towers, camper vans, boats, beacons, and buoys etc. A review of current state-of-the-art is presented. The best performing converters achieve moderately high peak efficiencies at high input voltage and medium power level. However, system dimensioning and cost are often...

Suppressing voltage transients in high voltage power supplies

International Nuclear Information System (INIS)

Lickel, K.F.; Stonebank, R.

1979-01-01

A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

Literature Survey on Operational Voltage Control and Reactive Power Management on Transmission and Sub-Transmission Networks

Energy Technology Data Exchange (ETDEWEB)

Elizondo, Marcelo A.; Samaan, Nader A.; Makarov, Yuri V.; Holzer, Jesse T.; Vallem, Mallikarjuna R.; Huang, Renke; Vyakaranam, Bharat GNVSR; Ke, Xinda; Pan, Feng

2017-10-02

Voltage and reactive power system control is generally performed following usual patterns of loads, based on off-line studies for daily and seasonal operations. This practice is currently challenged by the inclusion of distributed renewable generation, such as solar. There has been focus on resolving this problem at the distribution level; however, the transmission and sub-transmission levels have received less attention. This paper provides a literature review of proposed methods and solution approaches to coordinate and optimize voltage control and reactive power management, with an emphasis on applications at transmission and sub-transmission level. The conclusion drawn from the survey is that additional research is needed in the areas of optimizing switch shunt actions and coordinating all available resources to deal with uncertain patterns from increasing distributed renewable generation in the operational time frame. These topics are not deeply explored in the literature.

High voltage superconducting switch for power application

International Nuclear Information System (INIS)

Mawardi, O.; Ferendeci, A.; Gattozzi, A.

1983-01-01

This paper reports the development of a novel interrupter which meets the requirements of a high voltage direct current (HVDC) power switch and at the same time doubles as a current limiter. The basic concept of the interrupter makes use of a fast superconducting, high capacity (SHIC) switch that carries the full load current while in the superconducting state and reverts to the normal resistive state when triggered. Typical design parameters are examined for the case of a HVDC transmission line handling 2.5KA at 150KVDC. The result is a power switch with superior performance and smaller size than the ones reported to date

Calculation of Voltages in Electric Power Transmission Lines During Historic Geomagnetic Storms: An Investigation Using Realistic Earth Impedances

Science.gov (United States)

Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna

2018-02-01

Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

High Efficiency Power Converter for Low Voltage High Power Applications

DEFF Research Database (Denmark)

Nymand, Morten

The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based...

Method and system for a gas tube switch-based voltage source high voltage direct current transmission system

Science.gov (United States)

She, Xu; Chokhawala, Rahul Shantilal; Zhou, Rui; Zhang, Di; Sommerer, Timothy John; Bray, James William

2016-12-13

A voltage source converter based high-voltage direct-current (HVDC) transmission system includes a voltage source converter (VSC)-based power converter channel. The VSC-based power converter channel includes an AC-DC converter and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and a DC-AC inverter include at least one gas tube switching device coupled in electrical anti-parallel with a respective gas tube diode. The VSC-based power converter channel includes a commutating circuit communicatively coupled to one or more of the at least one gas tube switching devices. The commutating circuit is configured to "switch on" a respective one of the one or more gas tube switching devices during a first portion of an operational cycle and "switch off" the respective one of the one or more gas tube switching devices during a second portion of the operational cycle.

Multi-Port High Voltage Gain Modular Power Converter for Offshore Wind Farms

Directory of Open Access Journals (Sweden)

Sen Song

2018-06-01

Full Text Available In high voltage direct current (HVDC power transmission of offshore wind power systems, DC/DC converters are applied to transfer power from wind generators to HVDC terminals, and they play a crucial role in providing a high voltage gain, high efficiency, and high fault tolerance. This paper introduces an innovative multi-port DC/DC converter with multiple modules connected in a scalable matrix configuration, presenting an ultra-high voltage step-up ratio and low voltage/current rating of components simultaneously. Additionally, thanks to the adoption of active clamping current-fed push–pull (CFPP converters as sub-modules (SMs, soft-switching is obtained for all power switches, and the currents of series-connected CFPP converters are auto-balanced, which significantly reduce switching losses and control complexity. Furthermore, owing to the expandable matrix structure, the output voltage and power of a modular converter can be controlled by those of a single SM, or by adjusting the column and row numbers of the matrix. High control flexibility improves fault tolerance. Moreover, due to the flexible control, the proposed converter can transfer power directly from multiple ports to HVDC terminals without bus cable. In this paper, the design of the proposed converter is introduced, and its functions are illustrated by simulation results.

An Annotated Bibliography of High-Voltage Direct-Current Transmission and Flexible AC Transmission (FACTS) Devices, 1991-1993.

Energy Technology Data Exchange (ETDEWEB)

Litzenberger, Wayne; Lava, Val

1994-08-01

References are contained for HVDC systems, converter stations and components, overhead transmission lines, cable transmission, system design and operations, simulation of high voltage direct current systems, high-voltage direct current installations, and flexible AC transmission system (FACTS).

Calculation of voltages in electric power transmission lines during historic geomagnetic storms: An investigation using realistic earth impedances

Science.gov (United States)

Lucas, Greg M.; Love, Jeffrey J.; Kelbert, Anna

2018-01-01

Commonly, one-dimensional (1-D) Earth impedances have been used to calculate the voltages induced across electric power transmission lines during geomagnetic storms under the assumption that much of the three-dimensional structure of the Earth gets smoothed when integrating along power transmission lines. We calculate the voltage across power transmission lines in the mid-Atlantic region with both regional 1-D impedances and 64 empirical 3-D impedances obtained from a magnetotelluric survey. The use of 3-D impedances produces substantially more spatial variance in the calculated voltages, with the voltages being more than an order of magnitude different, both higher and lower, than the voltages calculated utilizing regional 1-D impedances. During the March 1989 geomagnetic storm 62 transmission lines exceed 100 V when utilizing empirical 3-D impedances, whereas 16 transmission lines exceed 100 V when utilizing regional 1-D impedances. This demonstrates the importance of using realistic impedances to understand and quantify the impact that a geomagnetic storm has on power grids.

High voltage transmission of electrical energy over long distances

Energy Technology Data Exchange (ETDEWEB)

Tewari, S W

1962-07-01

Technical aspects of ac transmission lines, additional means of improving stability ac transmisson lines, insulation problems, ac transmission by cables, high voltage dc transmission, advantages of dc over ac transmission, disadvantages of dc transmission, use of underground cables for dc transmission, history of the development of conversion equipment; transmission schemes adopted on Gotland Island, Sweden; and economics of ac and dc transmission are discussed.

High voltage engineering

CERN Document Server

Rizk, Farouk AM

2014-01-01

Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

Technical and economic data for overhead lines in high-voltage a. c. and d. c. transmission

Energy Technology Data Exchange (ETDEWEB)

1977-11-01

For the study of 'High-power electricity transmission and distribution in densely populated areas' technical and economic data were compiled for high-voltage alternating current and direct current transmission. A modification of the overhead lines for transmitting higher powers is possible as required by means of higher rated transmission voltages, larger conductor cross-sections and a larger number of circuits installed on each mast. For the use of larger partial conductor cross-sections and of bundle conductors with more than 4 partial conductors, and also to use voltages higher than 380 kV, development work is requisite from the points of view of construction, installation, insulators and fittings. Further possible developments result from the use of new materials such as plastic insulators which make possible the use of more versatile shapes for application in heavy pollution, particulary for direct current overhead lines. By using insulating crossarms the width of path can be considerably reduced. Economic efficiency investigations show even today higher cost for such techniques compared with lines of earlier construction.

High voltage transmission lines studies with the use of artificial intelligence

Energy Technology Data Exchange (ETDEWEB)

Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)

2009-12-15

The paper presents an alternative approach for the studies of high voltage transmission lines based on artificial intelligence and more specifically artificial neural networks (ANNs). In contrast to the existing conventional-analytical techniques and simulations which are using in the calculations empirical and/or approximating equations, this approach is based only on actual field data and actual measurements. The proposed approach is applied on high voltage transmission lines in order to calculate the lightning outages, on grounding systems in order to assess the grounding resistance and on high voltage transmission lines' polluted insulators in order to estimate the critical flashover voltage. The obtained results are very close to the actual ones for all three case studies, something which clearly implies that the ANN approach is well working and has an acceptable accuracy, constituting an additional tool of electric engineers. (author)

A comprehensive analysis and hardware implementation of control strategies for high output voltage DC-DC boost power converter

OpenAIRE

Padmanaban, Sanjeevikumar; Grandi, Gabriele; Blaabjerg, Frede; Wheeler, Patrick; Siano, Pierluigi; Hammami, Manel

2017-01-01

Classical DC-DC converters used in high voltage direct current (HVDC) power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current) numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV) dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned defic...

Modular high voltage power supply for chemical analysis

Science.gov (United States)

Stamps, James F [Livermore, CA; Yee, Daniel D [Dublin, CA

2008-07-15

A high voltage power supply for use in a system such as a microfluidics system, uses a DC-DC converter in parallel with a voltage-controlled resistor. A feedback circuit provides a control signal for the DC-DC converter and voltage-controlled resistor so as to regulate the output voltage of the high voltage power supply, as well as, to sink or source current from the high voltage supply.

Facts and feelings : Framing effects in responses to uncertainties about high-voltage power lines

NARCIS (Netherlands)

de Vries, G.; de Bruijn, J.A.

2017-01-01

To ensure power supply security, electricity transmission system operators (TSOs) have to upscale high-voltage overhead power lines. However, upscaling frequently meets opposition. Opposition can be caused by uncertainties about risks and benefits and might lead to costly delays (Linder, 1995;

High-frequency high-voltage high-power DC-to-DC converters

Science.gov (United States)

Wilson, T. G.; Owen, H. A.; Wilson, P. M.

1982-09-01

A simple analysis of the current and voltage waveshapes associated with the power transistor and the power diode in an example current-or-voltage step-up (buck-boost) converter is presented. The purpose of the analysis is to provide an overview of the problems and design trade-offs which must be addressed as high-power high-voltage converters are operated at switching frequencies in the range of 100 kHz and beyond. Although the analysis focuses on the current-or-voltage step-up converter as the vehicle for discussion, the basic principles presented are applicable to other converter topologies as well.

Propagation of disturbances as voltage fluctuations in transmission networks

Directory of Open Access Journals (Sweden)

Albert Hermina

2016-08-01

Full Text Available Significant changes occurred in the power system in Romania in recent years by reducing the power used in the system, the number of classic power sources in operation as well as by implementing renewable energy sources, have determined short circuit power reduction (node rigidity in the points where disturbing users are connected, that in the absence of adequate measures, result in disturbances above acceptable levels. The paper analyzes two power systems areas in which are connected users that cause voltage fluctuation. Disturbances as voltage fluctuations resulting in these nodes may exceed the acceptable values and can spread in the transmission network affecting power quality over large system areas. The analysis conducted reveals the influence of short circuit power in nodes where these users are connected and highlights the fact that in some cases (e.g. lines out of operation for maintenance, shutdown of classic units in the area the disturbances in the transmission network sent to the users at lower voltages may have values above those allowed. Technical Code of existing power transmission network makes no reference to voltage fluctuations, as a rule, in the electricity transmission network was considered that this phenomenon should not exist.

Voltage generators of high voltage high power accelerators

International Nuclear Information System (INIS)

Svinin, M.P.

1981-01-01

High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

Impact of distributed generators on the power loss and voltage profile of sub-transmission network

Directory of Open Access Journals (Sweden)

A.S.O. Ogunjuyigbe

2016-05-01

Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.

New schemes for high-voltage pulsed generators based on stepped transmission lines

International Nuclear Information System (INIS)

Bossamykin, V.S.; Gordeev, V.S.; Pavlovskii, A.I.

1993-01-01

Wave processes were analyzed from the point of effective energy delivery in pulsed power systems based on transmission lines. A series of new schemes for the pulsed generators based on multistage stepped transmission lines both with the capacitive and inductive energy storage was found. These devices can provide voltage or current transformation up to 5-10 times due to wave processes if stage's characteristic impedances are in a certain correlation. The schemes suggested can be widely applied in the new powerful pulsed power accelerators. The theoretical conclusions are justified experimentally

PI and Fuzzy Control Strategies for High Voltage Output DC-DC Boost Power Converter - Hardware Implementation and Analysis

DEFF Research Database (Denmark)

Padmanaban, Sanjeevi Kumar; Blaabjerg, Frede; Siano, Pierluigi

2016-01-01

This paper presents the control strategies by Proportional-Integral (P-I) and Fuzzy Logic (FL) for a DC-DC boost power converter for high output voltage configuration. Standard DC-DC converters are traditionally used for high voltage direct current (HVDC) power transmission systems. But, lack its...... converter with inbuilt voltage-lift technique and overcome the aforementioned deficiencies. Further, the control strategy is adapted based on proportional-integral (P-I) and fuzzy logic, closed-loop controller to regulate the outputs and ensure the performances. Complete hardware prototype of EHV converter...... performances in terms of efficiency, reduced transfer gain and increased cost with sensor units. Moreover, the internal self-parasitic components reduce the output voltage and efficiency of classical high voltage converters (HVC). This investigation focused on extra high-voltage (EHV) DC-DC boost power...

A Novel High-Frequency Voltage Standing-Wave Ratio-Based Grounding Electrode Line Fault Supervision in Ultra-High Voltage DC Transmission Systems

Directory of Open Access Journals (Sweden)

Yufei Teng

2017-03-01

Full Text Available In order to improve the fault monitoring performance of grounding electrode lines in ultra-high voltage DC (UHVDC transmission systems, a novel fault monitoring approach based on the high-frequency voltage standing-wave ratio (VSWR is proposed in this paper. The VSWR is defined considering a lossless transmission line, and the characteristics of the VSWR under different conditions are analyzed. It is shown that the VSWR equals 1 when the terminal resistance completely matches the characteristic impedance of the line, and when a short circuit fault occurs on the grounding electrode line, the VSWR will be greater than 1. The VSWR will approach positive infinity under metallic earth fault conditions, whereas the VSWR in non-metallic earth faults will be smaller. Based on these analytical results, a fault supervision criterion is formulated. The effectiveness of the proposed VSWR-based fault supervision technique is verified with a typical UHVDC project established in Power Systems Computer Aided Design/Electromagnetic Transients including DC(PSCAD/EMTDC. Simulation results indicate that the proposed strategy can reliably identify the grounding electrode line fault and has strong anti-fault resistance capability.

The account of sagging of wires at definition of specific potential factors of air High-Voltage Power Transmission Lines

Directory of Open Access Journals (Sweden)

Suslov V.M.

2005-12-01

Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.

High frequency relay protection channels on super high voltage lines

Energy Technology Data Exchange (ETDEWEB)

Mikutskii, G V

1964-08-01

General aspects of high voltage transmission line design are discussed. The relationships between line voltage and length and line dimensions and power losses are explained. Electrical interference in the line is classified under three headings: interference under normal operating conditions, interference due to insulation faults, and interference due to variations in operating conditions of the high-voltage network.

Modular High Voltage Power Supply

Energy Technology Data Exchange (ETDEWEB)

Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

2017-05-18

The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

High Voltage AC underground cable systems for power transmission

DEFF Research Database (Denmark)

Bak, Claus Leth; Silva, Filipe Miguel Faria da

2016-01-01

researching electrical engineering topics related to using underground cables for power transmission at EHV level and including the 420 kV level. The research topics were laid down by ET/AAU and Energinet.dk in the DANPAC (DANish Power systems with AC Cables) research project. The main topics are discussed...... on the basis of 39 references published by ET/AAU and Energinet.dk. Part I of the paper explains the events that lead to the research project, reactive power compensation, modelling for transient studies, including field measurements and improvements to the existing models, and temporary overvoltages due...... to resonances. Part II covers transient phenomena, harmonics in cables, system modelling for different phenomena, main and backup protections in cable-based networks, online fault detection and future trends....

High Voltage AC underground cable systems for power transmission

DEFF Research Database (Denmark)

Bak, Claus Leth; Silva, Filipe Miguel Faria da

2016-01-01

researching electrical engineering topics related to using underground cables for power transmission at EHV level and including the 420 kV level. The research topics were laid down by ET/AAU and Energinet.dk in the DANPAC (DANish Power systems with Ac Cables) research project. The main topics are discussed...... on the basis of 39 references published by ET/AAU and Energinet.dk. Part I of the paper explains the events that lead to the research project, reactive power compensation, modelling for transient studies, including field measurements and improvements to the existing models, and temporary overvoltages due...... to resonances. Part II covers transient phenomena, harmonics in cables, system modelling for different phenomena, main and backup protections in cable-based networks, online fault detection and future trends....

Adaptive Modulation for DFIG and STATCOM With High-Voltage Direct Current Transmission.

Science.gov (United States)

Tang, Yufei; He, Haibo; Ni, Zhen; Wen, Jinyu; Huang, Tingwen

2016-08-01

This paper develops an adaptive modulation approach for power system control based on the approximate/adaptive dynamic programming method, namely, the goal representation heuristic dynamic programming (GrHDP). In particular, we focus on the fault recovery problem of a doubly fed induction generator (DFIG)-based wind farm and a static synchronous compensator (STATCOM) with high-voltage direct current (HVDC) transmission. In this design, the online GrHDP-based controller provides three adaptive supplementary control signals to the DFIG controller, STATCOM controller, and HVDC rectifier controller, respectively. The mechanism is to observe the system states and their derivatives and then provides supplementary control to the plant according to the utility function. With the GrHDP design, the controller can adaptively develop an internal goal representation signal according to the observed power system states, therefore, to achieve more effective learning and modulating. Our control approach is validated on a wind power integrated benchmark system with two areas connected by HVDC transmission lines. Compared with the classical direct HDP and proportional integral control, our GrHDP approach demonstrates the improved transient stability under system faults. Moreover, experiments under different system operating conditions with signal transmission delays are also carried out to further verify the effectiveness and robustness of the proposed approach.

High voltage generator circuit with low power and high efficiency applied in EEPROM

International Nuclear Information System (INIS)

Liu Yan; Zhang Shilin; Zhao Yiqiang

2012-01-01

This paper presents a low power and high efficiency high voltage generator circuit embedded in electrically erasable programmable read-only memory (EEPROM). The low power is minimized by a capacitance divider circuit and a regulator circuit using the controlling clock switch technique. The high efficiency is dependent on the zero threshold voltage (V th ) MOSFET and the charge transfer switch (CTS) charge pump. The proposed high voltage generator circuit has been implemented in a 0.35 μm EEPROM CMOS process. Measured results show that the proposed high voltage generator circuit has a low power consumption of about 150.48 μW and a higher pumping efficiency (83.3%) than previously reported circuits. This high voltage generator circuit can also be widely used in low-power flash devices due to its high efficiency and low power dissipation. (semiconductor integrated circuits)

Development of large high-voltage pressure insulators for the Princeton TFTR [Tokamak Fusion Test Reactor] flexible transmission lines

International Nuclear Information System (INIS)

Scalise, D.T.; Fong, E.; Haughian, J.; Prechter, R.

1986-10-01

Specially formulated insulator materials with improved strength and high-voltage properties were developed and used for critical components of the flexible transmission lines to the TFTR neutral beam ion sources. These critical components are plates which support central conductors as they exit the high-voltage power supply and enter the ion source enclosure. Each plate acts both as a high-voltage insulator and as a pressure barrier to the SF 6 insulating gas. The original plate was made of commercial glass-epoxy laminate which limited the plate voltage capacity. The newly developed insulator is made of specially-formulated cycloalphatic Di-epoxide whose isotropic properties exhibit increased arc resistance. It is cast in one piece with skirts which greatly increase the breakdown voltage. This paper discusses the design, fabrication and testing of the new insulator

High Input Voltage, Silicon Carbide Power Processing Unit Performance Demonstration

Science.gov (United States)

Bozak, Karin E.; Pinero, Luis R.; Scheidegger, Robert J.; Aulisio, Michael V.; Gonzalez, Marcelo C.; Birchenough, Arthur G.

2015-01-01

A silicon carbide brassboard power processing unit has been developed by the NASA Glenn Research Center in Cleveland, Ohio. The power processing unit operates from two sources: a nominal 300 Volt high voltage input bus and a nominal 28 Volt low voltage input bus. The design of the power processing unit includes four low voltage, low power auxiliary supplies, and two parallel 7.5 kilowatt (kW) discharge power supplies that are capable of providing up to 15 kilowatts of total power at 300 to 500 Volts (V) to the thruster. Additionally, the unit contains a housekeeping supply, high voltage input filter, low voltage input filter, and master control board, such that the complete brassboard unit is capable of operating a 12.5 kilowatt Hall effect thruster. The performance of the unit was characterized under both ambient and thermal vacuum test conditions, and the results demonstrate exceptional performance with full power efficiencies exceeding 97%. The unit was also tested with a 12.5kW Hall effect thruster to verify compatibility and output filter specifications. With space-qualified silicon carbide or similar high voltage, high efficiency power devices, this would provide a design solution to address the need for high power electric propulsion systems.

Proximity effects of high voltage electric power transmission lines on ...

African Journals Online (AJOL)

Yomi

2010-08-18

Aug 18, 2010 ... transmission lines on ornamental plant growth. Zeki Demir ... The effects of proximity to power-line on specific leaf area and seedling dbh were tested .... during vegetation season is about 72% and common wind blow.

Advances in high voltage power switching with GTOs

International Nuclear Information System (INIS)

Podlesak, T.F.

1990-01-01

The control of high voltage at high power, particularly opening switches, has been difficult in the past. Using gate turnoff thyristors (GTOs) arranged in series enables large currents to be switched at high voltage. The authors report a high voltage opening switch has been successfully demonstrated. This switch uses GTOs in series and successfully operates at voltages higher than the rated voltage of the individual devices. It is believed that this is the first time this has been successfully demonstrated, in that GTOs have been operated in series before, but always in a manner as to not exceed the voltage capability of the individual devices. In short, the devices have not worked together, sharing the voltage, but one device has been operated using several backup devices. Of particular interest is how well the individual devices share the voltage applied to them. Equal voltage sharing between devices is absolutely essential, in order to not exceed the voltage rating of any of the devices in the series chain. This is accomplished at high (microsecond) switching speeds. Thus, the system is useful for high frequency applications as well as high power, making for a flexible circuit system element. This demonstration system is rated at 5 KV and uses 1 KV devices. A larger 24 KV system is under design and will use 4.5 KV devices. In order to design the 24 KV switch, the safe operating area of the large devices must be known thoroughly

Temperature Stabilized Characterization of High Voltage Power Supplies

CERN Document Server

Krarup, Ole

2017-01-01

High precision measurements of the masses of nuclear ions in the ISOLTRAP experiment relies on an MR-ToF. A major source of noise and drift is the instability of the high voltage power supplies employed. Electrical noise and temperature changes can broaden peaks in time-of-flight spectra and shift the position of peaks between runs. In this report we investigate how the noise and drift of high-voltage power supplies can be characterized. Results indicate that analog power supplies generally have better relative stability than digitally controlled ones, and that the high temperature coefficients of all power supplies merit efforts to stabilize them.

Highly efficient solutions for smart and bulk power transmission of 'green energy'

Energy Technology Data Exchange (ETDEWEB)

Breuer, Wilfried; Retzmann, Dietmar; Uecker, Karl

2010-09-15

Environmental constraints, loss minimization and CO2 reduction will play an increasingly more important role in future. Security and sustainability of power supply as well as economic efficiency needs application of advanced technologies. Innovative solutions with HVDC (High Voltage Direct Current) and FACTS (Flexible AC Transmission Systems) have the potential to cope with these challenges. They provide the features which are necessary to avoid technical problems in power systems, they increase the transmission capacity and system stability very efficiently and help prevent cascading outages. Furthermore, they are essential for Grid Access of Renewable Energy Sources such as Hydro, Wind and Solar-Energy.

High Voltage Hybrid Electric Propulsion - Multilayered Functional Insulation System (MFIS) NASA-GRC

Science.gov (United States)

Lizcano, M.

2017-01-01

High power transmission cables pose a key challenge in future Hybrid Electric Propulsion Aircraft. The challenge arises in developing safe transmission lines that can withstand the unique environment found in aircraft while providing megawatts of power. High voltage AC, variable frequency cables do not currently exist and present particular electrical insulation challenges since electrical arcing and high heating are more prevalent at higher voltages and frequencies. Identifying and developing materials that maintain their dielectric properties at high voltage and frequencies is crucial.

Facts and feelings: Framing effects in responses to uncertainties about high-voltage power lines

OpenAIRE

de Vries, G.; de Bruijn, J.A.

2017-01-01

To ensure power supply security, electricity transmission system operators (TSOs) have to upscale high-voltage overhead power lines. However, upscaling frequently meets opposition. Opposition can be caused by uncertainties about risks and benefits and might lead to costly delays (Linder, 1995; Wiedemann, Boerner,& Claus, 2016). To minimize opposition, TSOs and related public services need to respond to these uncertainties in a credible and convincing (effective) way. Effective risk commun...

A new algorithm for optimum voltage and reactive power control for minimizing transmission lines losses

International Nuclear Information System (INIS)

Ghoudjehbaklou, H.; Danai, B.

2001-01-01

Reactive power dispatch for voltage profile modification has been of interest to power utilities. Usually local bus voltages can be altered by changing generator voltages, reactive shunts, ULTC transformers and SVCs. Determination of optimum values for control parameters, however, is not simple for modern power system networks. Heuristic and rather intelligent algorithms have to be sought. In this paper a new algorithm is proposed that is based on a variant of a genetic algorithm combined with simulated annealing updates. In this algorithm a fuzzy multi-objective a approach is used for the fitness function of the genetic algorithm. This fuzzy multi-objective function can efficiently modify the voltage profile in order to minimize transmission lines losses, thus reducing the operating costs. The reason for such a combination is to utilize the best characteristics of each method and overcome their deficiencies. The proposed algorithm is much faster than the classical genetic algorithm and cna be easily integrated into existing power utilities software. The proposed algorithm is tested on an actual system model of 1284 buses, 799 lines, 1175 fixed and ULTC transformers, 86 generators, 181 controllable shunts and 425 loads

OPC Server and BridgeView Application for High Voltage Power Supply Lecroy 1458

CERN Document Server

Swoboda, D; CERN. Geneva

2000-01-01

Abstract The aim of this project was to develop an OPC server to communicate over an RS232 serial line. This communication media is commonly used with commercial instruments. The development was made for a High Voltage power supply in the context of the Alice [1] experiment. In addition, the structured modular concept will allow changing the transmission media or power supply type with little effort. The high voltage power supply should be accessible remotely through a network. OPC[2] is an acronym for OLE[3] for Process Control. OPC is based on the DCOM [3] communication protocol, which allows communication with any computer running a Windows based OS. This standard is widely used in industry to access device data through Windows applications. The concept is based on the client-server architecture. The hardware and the software architecture are described. Subsequently details of the implemented programs are given with emphasis on the possibility to replace parts of the software in order to use differ...

An Integrated Chip High-Voltage Power Receiver for Wireless Biomedical Implants

Directory of Open Access Journals (Sweden)

Vijith Vijayakumaran Nair

2015-06-01

Full Text Available In near-field wireless-powered biomedical implants, the receiver voltage largely overrides the compliance of low-voltage power receiver systems. To limit the induced voltage, generally, low-voltage topologies utilize limiter circuits, voltage clippers or shunt regulators, which are power-inefficient methods. In order to overcome the voltage limitation and improve power efficiency, we propose an integrated chip high-voltage power receiver based on the step down approach. The topology accommodates voltages as high as 30 V and comprises a high-voltage semi-active rectifier, a voltage reference generator and a series regulator. Further, a battery management circuit that enables safe and reliable implant battery charging based on analog control is proposed and realized. The power receiver is fabricated in 0.35-μm high-voltage Bipolar-CMOS-DMOStechnology based on the LOCOS0.35-μm CMOS process. Measurement results indicate 83.5% power conversion efficiency for a rectifier at 2.1 mA load current. The low drop-out regulator based on the current buffer compensation and buffer impedance attenuation scheme operates with low quiescent current, reduces the power consumption and provides good stability. The topology also provides good power supply rejection, which is adequate for the design application. Measurement results indicate regulator output of 4 ± 0.03 V for input from 5 to 30 V and 10 ± 0.05 V output for input from 11 to 30 V with load current 0.01–100 mA. The charger circuit manages the charging of the Li-ion battery through all if the typical stages of the Li-ion battery charging profile.

Development of real-time voltage stability monitoring tool for power system transmission network using Synchrophasor data

Science.gov (United States)

Pulok, Md Kamrul Hasan

Intelligent and effective monitoring of power system stability in control centers is one of the key issues in smart grid technology to prevent unwanted power system blackouts. Voltage stability analysis is one of the most important requirements for control center operation in smart grid era. With the advent of Phasor Measurement Unit (PMU) or Synchrophasor technology, real time monitoring of voltage stability of power system is now a reality. This work utilizes real-time PMU data to derive a voltage stability index to monitor the voltage stability related contingency situation in power systems. The developed tool uses PMU data to calculate voltage stability index that indicates relative closeness of the instability by producing numerical indices. The IEEE 39 bus, New England power system was modeled and run on a Real-time Digital Simulator that stream PMU data over the Internet using IEEE C37.118 protocol. A Phasor data concentrator (PDC) is setup that receives streaming PMU data and stores them in Microsoft SQL database server. Then the developed voltage stability monitoring (VSM) tool retrieves phasor measurement data from SQL server, performs real-time state estimation of the whole network, calculate voltage stability index, perform real-time ranking of most vulnerable transmission lines, and finally shows all the results in a graphical user interface. All these actions are done in near real-time. Control centers can easily monitor the systems condition by using this tool and can take precautionary actions if needed.

High voltage power network construction

CERN Document Server

Harker, Keith

2018-01-01

This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

A Case Study Of Turkish Transmission System For VoltageDips

DEFF Research Database (Denmark)

Inan, E.; Alboyaci, B.; Bak, Claus Leth

2009-01-01

Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short-duration vo......Power quality problems usually appear in the form of voltage sags, transients and harmonics. From these three broad categories of power quality problems, voltage dips account the most disturbances experienced by industrial customers. Voltage dips generally refer to instantaneous short...... analysis of voltage dip performance of the whole transmission system, is used to compare with results constructed fault statics from SIMPOW DIPS analysis program real data. SIMPOW DIPS software enables to calculate dip frequency for all busses and lines....

Recommendation on the Environmental Effect Report for the high-voltage transmission line between Netherlands and Norway

International Nuclear Information System (INIS)

1998-01-01

The recommendation on the title subject was addressed to the Dutch Minister of Economic Affairs and concerns the environmental impact of the new high-voltage transmission line (NorNed cable) from Norway to the Eemshaven in Groningen, Netherlands. In planning this power cable the environmental impact on the Wadden Sea has to be taken into account. Therefore an environmental effect report (MER, abbreviated in Dutch) has been drafted by the Dutch cooperative of electric power generating companies, Sep, and commented by the WaddenAdviesRaad

Optimizing real power loss and voltage stability limit of a large transmission network using firefly algorithm

Directory of Open Access Journals (Sweden)

P. Balachennaiah

2016-06-01

Full Text Available This paper proposes a Firefly algorithm based technique to optimize the control variables for simultaneous optimization of real power loss and voltage stability limit of the transmission system. Mathematically, this issue can be formulated as nonlinear equality and inequality constrained optimization problem with an objective function integrating both real power loss and voltage stability limit. Transformers taps, unified power flow controller and its parameters have been included as control variables in the problem formulation. The effectiveness of the proposed algorithm has been tested on New England 39-bus system. Simulation results obtained with the proposed algorithm are compared with the real coded genetic algorithm for single objective of real power loss minimization and multi-objective of real power loss minimization and voltage stability limit maximization. Also, a classical optimization method known as interior point successive linear programming technique is considered here to compare the results of firefly algorithm for single objective of real power loss minimization. Simulation results confirm the potentiality of the proposed algorithm in solving optimization problems.

A 600kV 15mA Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage

International Nuclear Information System (INIS)

Su Tongling; Zhang Yimin; Chen Shangwen; Liu Yantong; Lv Huiyi; Liu Jiangtao

2006-01-01

A Cockcroft-Walton high-voltage power supply with high stability and low-ripple voltage has been developed. This power supply has been operated in a ns pulse neutron generator. The maximum non-load voltage is 600kV while the working voltage and load current are 550kV and 15mA, respectively. The tested results indicate that when the power supply is operated at 300kV, 6.7mA and the input voltage varies +/-10%, the long-term stability of the output voltage is S=(0.300-1.006)x10 -3 . The ripple voltage is δU P-P =6.2V at 300kV, 6.8-8.3mA and the ratio of δU P-P to the output voltage V H is δU P-P /V H =2.1x10 -5

Impact of Wind Power Plants on Voltage Control of Power System

DEFF Research Database (Denmark)

Sarkar, Moumita; Altin, Müfit; Hansen, Anca Daniela

High penetration of renewable energy sources poses numerous challenges on stability and security of power systems. Wind power plants (WPPs) of considerable size when connected to a weak grid by long transmission line results in low short circuit ratio at the point of connection. This may result...... control, during transient voltage dips. Steady-state analysis is performed for stressed system conditions. Results are validated through simulation in a detailed power system model....

Electrical Structure of Future Off-shore Wind Power Plant with a High Voltage Direct Current Power Transmission

DEFF Research Database (Denmark)

Sharma, Ranjan

The increasing demand of electric power and the growing consciousness towards the changing climate has led to a rapid development of renewable energy in the recent years. Among all, wind energy has been the fastest growing energy source in the last decade. But the growing size of wind power plants......, better wind conditions at off-shore and the general demand to put them out of sight have all contributed to the installation of large wind power plants in off-shore condition. However, moving wind power plants far out in the off-shore comes with many associated problems. One of the main challenges...... is the transmission of power over long distance. Historically, the power transmission from off-shore wind power plants has been done via HVAC submarine cables. This provides a simple solution, but AC cables cannot be arbitrarily long. It is shown in the report that major issues with HVAC cable transmission system...

The eGo grid model: An open source approach towards a model of German high and extra-high voltage power grids

Science.gov (United States)

Mueller, Ulf Philipp; Wienholt, Lukas; Kleinhans, David; Cussmann, Ilka; Bunke, Wolf-Dieter; Pleßmann, Guido; Wendiggensen, Jochen

2018-02-01

There are several power grid modelling approaches suitable for simulations in the field of power grid planning. The restrictive policies of grid operators, regulators and research institutes concerning their original data and models lead to an increased interest in open source approaches of grid models based on open data. By including all voltage levels between 60 kV (high voltage) and 380kV (extra high voltage), we dissolve the common distinction between transmission and distribution grid in energy system models and utilize a single, integrated model instead. An open data set for primarily Germany, which can be used for non-linear, linear and linear-optimal power flow methods, was developed. This data set consists of an electrically parameterised grid topology as well as allocated generation and demand characteristics for present and future scenarios at high spatial and temporal resolution. The usability of the grid model was demonstrated by the performance of exemplary power flow optimizations. Based on a marginal cost driven power plant dispatch, being subject to grid restrictions, congested power lines were identified. Continuous validation of the model is nescessary in order to reliably model storage and grid expansion in progressing research.

A Comprehensive Analysis and Hardware Implementation of Control Strategies for High Output Voltage DC-DC Boost Power Converter

Directory of Open Access Journals (Sweden)

Sanjeevikumar Padmanaban

2017-01-01

Full Text Available Classical DC-DC converters used in high voltage direct current (HVDC power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned deficiencies. The control strategy is based on classical proportional-integral (P-I and fuzzy logic closed-loop controller to get high and stable output voltage. Complete hardware prototype of EHV is implemented and experimental tasks are carried out with digital signal processor (DSP TMS320F2812. The control algorithms P-I, fuzzy logic and the pulse-width modulation (PWM signals for N-channel MOSFET device are performed by the DSP. The experimental results provided show good conformity with developed hypothetical predictions. Additionally, the presented study confirms that the fuzzy logic controller provides better performance than classical P-I controller under different perturbation conditions.

Highly efficient solutions for smart and bulk power transmission of 'green energy'

Energy Technology Data Exchange (ETDEWEB)

Breuer, Wilfried; Retzmann, Dietmar; Uecker, Karl

2010-09-15

Environmental constraints, loss minimization and CO2 reduction will play an increasingly more important role in future. Security and sustainability of power supply as well as economic efficiency needs application of advanced technologies. Innovative solutions with HVDC (High Voltage Direct Current) and FACTS (Flexible AC Transmission Systems) have the potential to cope with these challenges. They provide the features which are necessary to avoid technical problems in power systems, they increase the transmission capacity and system stability very efficiently and help prevent cascading outages. Furthermore, they are essential for Grid Access of Renewable Energy Sources such as Hydro, Wind and Solar-Energy.

High voltage systems

International Nuclear Information System (INIS)

Martin, M.

1991-01-01

Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

Characterization of high performance silicon-based VMJ PV cells for laser power transmission applications

Science.gov (United States)

Perales, Mico; Yang, Mei-huan; Wu, Cheng-liang; Hsu, Chin-wei; Chao, Wei-sheng; Chen, Kun-hsien; Zahuranec, Terry

2016-03-01

Continuing improvements in the cost and power of laser diodes have been critical in launching the emerging fields of power over fiber (PoF), and laser power beaming. Laser power is transmitted either over fiber (for PoF), or through free space (power beaming), and is converted to electricity by photovoltaic cells designed to efficiently convert the laser light. MH GoPower's vertical multi-junction (VMJ) PV cell, designed for high intensity photovoltaic applications, is fueling the emergence of this market, by enabling unparalleled photovoltaic receiver flexibility in voltage, cell size, and power output. Our research examined the use of the VMJ PV cell for laser power transmission applications. We fully characterized the performance of the VMJ PV cell under various laser conditions, including multiple near IR wavelengths and light intensities up to tens of watts per cm2. Results indicated VMJ PV cell efficiency over 40% for 9xx nm wavelengths, at laser power densities near 30 W/cm2. We also investigated the impact of the physical dimensions (length, width, and height) of the VMJ PV cell on its performance, showing similarly high performance across a wide range of cell dimensions. We then evaluated the VMJ PV cell performance within the power over fiber application, examining the cell's effectiveness in receiver packages that deliver target voltage, intensity, and power levels. By designing and characterizing multiple receivers, we illustrated techniques for packaging the VMJ PV cell for achieving high performance (> 30%), high power (> 185 W), and target voltages for power over fiber applications.

Transmission line pulse system for avalanche characterization of high power semiconductor devices

Science.gov (United States)

Riccio, Michele; Ascione, Giovanni; De Falco, Giuseppe; Maresca, Luca; De Laurentis, Martina; Irace, Andrea; Breglio, Giovanni

2013-05-01

Because of the increasing in power density of electronic devices for medium and high power application, reliabilty of these devices is of great interest. Understanding the avalanche behaviour of a power device has become very important in these last years because it gives an indication of the maximum energy ratings which can be seen as an index of the device ruggedness. A good description of this behaviour is given by the static IV blocking characteristc. In order to avoid self heating, very relevant in high power devices, very short pulses of current have to be used, whose value can change from few milliamps up to tens of amps. The most used method to generate short pulses is the TLP (Transmission Line Pulse) test, which is based on charging the equivalent capacitance of a transmission line to high value of voltage and subsequently discharging it onto a load. This circuit let to obtain very short square pulses but it is mostly used for evaluate the ESD capability of semiconductor and, in this environment, it generates pulses of low amplitude which are not high enough to characterize the avalanche behaviour of high power devices . Advanced TLP circuit able to generate high current are usually very expensive and often suffer of distorption of the output pulse. In this article is proposed a simple, low cost circuit, based on a boosted-TLP configuration, which is capable to produce very square pulses of about one hundreds of nanosecond with amplitude up to some tens of amps. A prototype is implemented which can produce pulses up to 20A of amplitude with 200 ns of duration which can characterize power devices up to 1600V of breakdown voltage. Usage of microcontroller based logic make the circuit very flexible. Results of SPICE simulation are provided, together with experimental results. To prove the effectiveness of the circuit, the I-V blocking characteristics of two commercial devices, namely a 600V PowerMOS and a 1200V Trench-IGBT, are measured at different

Expansion of the high-voltage direct current transmission systems; Netzausbau mit Hochspannungs-Gleichstrom-Uebertragung

Energy Technology Data Exchange (ETDEWEB)

Spahic, Ervin; Benz, Thomas; Goerner, Raphael; Sass, Florian [ABB AG, Mannheim (Germany)

2012-12-15

In September 2010 the German federal government announced its energy concept for an environmentally friendly, reliable and affordable energy supply. This concept describes a ''path into the era of renewable energy'' up to the year 2050, with electricity production from photovoltaics and wind power taking centre stage. Since the expansion of renewable energy production is mainly taking place in the North (wind power) and the South (PV), this poses a great challenge to the electricity networks. It necessitates the expansion of power transmission systems, notably for transporting electricity generated by wind power in the North to the consumer centres in Western and Southern Germany. However, progress to this end has been very slow. For this reason a technical question now presents itself, namely whether high-voltage direct current technology could possibly offer a solution to the electricity transport problems associated with the energy turnaround.

Transmission congestion and voltage profile management coordination in competitive electricity markets

International Nuclear Information System (INIS)

Yamin, H.Y.; Shahidehpour, S.M.

2003-01-01

This paper describes a generalized active/reactive iterative coordination process between GENCOs and the Independent System Operator (ISO) for active (transmission congestion) and reactive (voltage profile) management in the day-ahead market. GENCOs apply priced-based unit commitment without transmission and voltage security constraints, schedule their units and submit their initial bids to the ISO. The ISO executes congestion and voltage profile management for eliminating transmission and voltage profile violations. If violations are not eliminated, the ISO minimizes the transmission and voltage profile violations and sends a signal via the Internet to GENCOs. GENCOs reschedule their units taking into account the ISO signals and submit modified bids to the ISO. The voltage problem is addressed and a linear model is formulated and used in the proposed method. The voltage problem is formulated as a linear programming with a block-angular structure and Dantzig-Wolfe decomposition is applied to generate several smaller problems for a faster and easier solution of large-scale power systems. Two 36 unit GENCOs are used to demonstrate the performance of the proposed generalized active/reactive coordination algorithm. (author)

Transmission Line Adapted Analytical Power Charts Solution

Science.gov (United States)

Sakala, Japhet D.; Daka, James S. J.; Setlhaolo, Ditiro; Malichi, Alec Pulu

2017-08-01

The performance of a transmission line has been assessed over the years using power charts. These are graphical representations, drawn to scale, of the equations that describe the performance of transmission lines. Various quantities that describe the performance, such as sending end voltage, sending end power and compensation to give zero voltage regulation, may be deduced from the power charts. Usually required values are read off and then converted using the appropriate scales and known relationships. In this paper, the authors revisit this area of circle diagrams for transmission line performance. The work presented here formulates the mathematical model that analyses the transmission line performance from the power charts relationships and then uses them to calculate the transmission line performance. In this proposed approach, it is not necessary to draw the power charts for the solution. However the power charts may be drawn for the visual presentation. The method is based on applying derived equations and is simple to use since it does not require rigorous derivations.

Wind Power Plant Voltage Stability Evaluation: Preprint

Energy Technology Data Exchange (ETDEWEB)

Muljadi, E.; Zhang, Y. C.

2014-09-01

Voltage stability refers to the ability of a power system to maintain steady voltages at all buses in the system after being subjected to a disturbance from a given initial operating condition. Voltage stability depends on a power system's ability to maintain and/or restore equilibrium between load demand and supply. Instability that may result occurs in the form of a progressive fall or rise of voltages of some buses. Possible outcomes of voltage instability are the loss of load in an area or tripped transmission lines and other elements by their protective systems, which may lead to cascading outages. The loss of synchronism of some generators may result from these outages or from operating conditions that violate a synchronous generator's field current limit, or in the case of variable speed wind turbine generator, the current limits of power switches. This paper investigates the impact of wind power plants on power system voltage stability by using synchrophasor measurements.

High-voltage pulse generator for electron gun power supply

International Nuclear Information System (INIS)

Korenev, S.A.; Enchevich, I.B.; Mikhov, M.K.

1987-01-01

High-voltage pulse generator with combined capacitive and inductive energy storages for electron gun power supply is described. Hydrogen thyratron set in a short magnetic lense is a current breaker. Times of current interruption in thyratrons are in the range from 100 to 300 ns. With 1 kV charging voltage of capacitive energy storage 25 kV voltage pulse is obtained in the load. The given high-voltage pulse generator was used for supply of an electron gun generating 10-30 keV low-energy electron beam

High-Voltage, Low-Power BNC Feedthrough Terminator

Science.gov (United States)

Bearden, Douglas

2012-01-01

This innovation is a high-voltage, lowpower BNC (Bayonet Neill-Concelman) feedthrough that enables the user to terminate an instrumentation cable properly while connected to a high voltage, without the use of a voltage divider. This feedthrough is low power, which will not load the source, and will properly terminate the instrumentation cable to the instrumentation, even if the cable impedance is not constant. The Space Shuttle Program had a requirement to measure voltage transients on the orbiter bus through the Ground Lightning Measurement System (GLMS). This measurement has a bandwidth requirement of 1 MHz. The GLMS voltage measurement is connected to the orbiter through a DC panel. The DC panel is connected to the bus through a nonuniform cable that is approximately 75 ft (approximately equal to 23 m) long. A 15-ft (approximately equal to 5-m), 50-ohm triaxial cable is connected between the DC panel and the digitizer. Based on calculations and simulations, cable resonances and reflections due to mismatched impedances of the cable connecting the orbiter bus and the digitizer causes the output not to reflect accurately what is on the bus. A voltage divider at the DC panel, and terminating the 50-ohm cable properly, would eliminate this issue. Due to implementation issues, an alternative design was needed to terminate the cable properly without the use of a voltage divider. Analysis shows how the cable resonances and reflections due to the mismatched impedances of the cable connecting the orbiter bus and the digitizer causes the output not to reflect accurately what is on the bus. After simulating a dampening circuit located at the digitizer, simulations were performed to show how the cable resonances were dampened and the accuracy was improved significantly. Test cables built to verify simulations were accurate. Since the dampening circuit is low power, it can be packaged in a BNC feedthrough.

Intense neutron source: high-voltage power supply specifications

International Nuclear Information System (INIS)

Riedel, A.A.

1980-08-01

This report explains the need for and sets forth the electrical, mechanical and safety specifications for a high-voltage power supply to be used with the intense neutron source. It contains sufficient information for a supplier to bid on such a power supply

Harmonics in Offshore Wind Power Plants Employing Power Electronic Devices in the Transmission System

DEFF Research Database (Denmark)

Glasdam, Jakob Bærholm

Introduction The trend in power generation is to partly replace conventional power plants with renewable energy sources. Offshore wind power has been selected to take up a significant proportion of the renewable energy production. The grid codes have been updated to accommodate the rising share...... of wind power. The onshore as well as offshore wind power plants (OWPPs) therefore have to meet the same stringent requirement as the conventional power plants. This can be accommodated by employment of flexible alternating current transmission system (FACTS) devices, such as the static compensator...... gives rise to a number of challenges to the wind power industry with regard to construction, installation as well as transmission of the generated energy. The STATCOM and the voltage-sourced converter high-voltage direct current (VSC-HVDC) are attractive solutions for grid connection of remotely located...

High voltage power supplies for INDUS-2 RF system

International Nuclear Information System (INIS)

Badapanda, M.K.; Hannurkar, P.R.

2003-01-01

The RF system of Indus-2 employs klystron amplifiers operating at 505.812 MHz. A precession controlled high voltage DC supply of appropriate rating is needed for each klystron amplifier, as its bias supply. Since internal flashover and arcing are common with the operation of these klystrons and stored energies beyond particular limit inside its bias power supply is detrimental to this device, a properly designed crowbar is incorporated between each klystron and its power supply. This crowbar bypass these stored energies and helps protecting klystron under any of these unfavorable conditions. In either case, power supply sees a near short circuit across its load. So, its power circuit is designed to reduce the fault current level and its various components are also designed to withstand these fault currents, as and when it appears. Finally, operation of these high voltage power supplies (HVPS) generates lot of harmonics on the source side, which distort the input waveform substantially and reduces the input power factor also. Source multiplication between two power supplies are planned to improve upon above parameters and suitable detuned line filters are incorporated to keep the input voltage total harmonics distortion (THD) below 5 % and input power factor (IFF) near unity. (author)

AC transmission, with very high voltages and the 750 kV line

Energy Technology Data Exchange (ETDEWEB)

Bocker, H

1964-01-01

The economic case for adoption of extra-high voltages for transmitting electric power over distances of the order of 1000 km is discussed. Some special technical developments for solving the problems attached to such high voltages are briefly discussed, particularly in the fields of switching and transients suppression. The first 750-kV projects in Canada and Russia are mentioned. Equipment, e.g., bushings, transformers, etc., operating at such voltages are illustrated.

Index-based reactive power compensation scheme for voltage regulation

Science.gov (United States)

Dike, Damian Obioma

2008-10-01

Increasing demand for electrical power arising from deregulation and the restrictions posed to the construction of new transmission lines by environment, socioeconomic, and political issues had led to higher grid loading. Consequently, voltage instability has become a major concern, and reactive power support is vital to enhance transmission grid performance. Improved reactive power support to distressed grid is possible through the application of relatively unfamiliar emerging technologies of "Flexible AC Transmission Systems (FACTS)" devices and "Distributed Energy Resources (DERS)." In addition to these infrastructure issues, a lack of situational awareness by system operators can cause major power outages as evidenced by the August 14, 2003 widespread North American blackout. This and many other recent major outages have highlighted the inadequacies of existing power system indexes. In this work, a novel "Index-based reactive compensation scheme" appropriate for both on-line and off-line computation of grid status has been developed. A new voltage stability index (Ls-index) suitable for long transmission lines was developed, simulated, and compared to the existing two-machine modeled L-index. This showed the effect of long distance power wheeling amongst regional transmission organizations. The dissertation further provided models for index modulated voltage source converters (VSC) and index-based load flow analysis of both FACTS and microgrid interconnected power systems using the Newton-Raphson's load flow model incorporated with multi-FACTS devices. The developed package has been made user-friendly through the embodiment of interactive graphical user interface and implemented on the IEEE 14, 30, and 300 bus systems. The results showed reactive compensation has system wide-effect, provided readily accessible system status indicators, ensured seamless DERs interconnection through new islanding modes and enhanced VSC utilization. These outcomes may contribute

System for Relay Protection Command Transmission by High-Voltage Lines

Directory of Open Access Journals (Sweden)

D. A. Yenkov

2009-01-01

Full Text Available Development of a system for relay protection command transmission by high-voltage lines is shown in the paper. The paper describes an architecture of the system, main principles of its operation, engineering aspects of the development that is accomplishment of technical requirements, solution of trades-off. Justification of the selected design and an algorithm of the reliable detection of relay protection signals are given in the paper.

Technical and economic evaluation of voltage level in transmission network expansion planning using GA

International Nuclear Information System (INIS)

Jalilzadeh, S.; Kazemi, A.; Shayeghi, H.; Madavi, M.

2008-01-01

Transmission network expansion planning is an important part of power system planning. Its task is to determine an optimal network configuration according to load growth. It determines where, when and how many new transmission lines should be installed. Up to now, various methods have been presented to solve the static transmission network expansion planning (STNEP) problem, but in all of these methods, the STNEP problem has been solved regardless of voltage level of the lines. In this paper, due to different voltage levels in the transmission network, which cause different annual losses, STNEP has been studied considering the voltage level of the transmission lines and the network loss using the genetic algorithm (GA). Finally, the proposed idea has been examined on Garvers 6 bus network. The results show that considering the loss in a network with different voltage levels decreases the operational costs considerably, and the network satisfies the requirement of delivering electric power more safely and reliably to load centers

Analysis of transistor and snubber turn-off dynamics in high-frequency high-voltage high-power converters

Science.gov (United States)

Wilson, P. M.; Wilson, T. G.; Owen, H. A., Jr.

Dc to dc converters which operate reliably and efficiently at switching frequencies high enough to effect substantial reductions in the size and weight of converter energy storage elements are studied. A two winding current or voltage stepup (buck boost) dc-to-dc converter power stage submodule designed to operate in the 2.5-kW range, with an input voltage range of 110 to 180 V dc, and an output voltage of 250 V dc is emphasized. In order to assess the limitations of present day component and circuit technologies, a design goal switching frequency of 10 kHz was maintained. The converter design requirements represent a unique combination of high frequency, high voltage, and high power operation. The turn off dynamics of the primary circuit power switching transistor and its associated turn off snubber circuitry are investigated.

Evaluation of a microwave high-power reception-conversion array for wireless power transmission

Science.gov (United States)

Dickinson, R. M.

1975-01-01

Initial performance tests of a 24-sq m area array of rectenna elements are presented. The array is used as the receiving portion of a wireless microwave power transmission engineering verification test system. The transmitting antenna was located at a range of 1.54 km. Output dc voltage and power, input RF power, efficiency, and operating temperatures were obtained for a variety of dc load and RF incident power levels at 2388 MHz. Incident peak RF intensities of up to 170 mW/sq cm yielded up to 30.4 kW of dc output power. The highest derived collection-conversion efficiency of the array was greater than 80 percent.

Compact high voltage, high peak power, high frequency transformer for converter type modulator applications.

Science.gov (United States)

Reghu, T; Mandloi, V; Shrivastava, Purushottam

2016-04-01

The design and development of a compact high voltage, high peak power, high frequency transformer for a converter type modulator of klystron amplifiers is presented. The transformer has been designed to operate at a frequency of 20 kHz and at a flux swing of ±0.6 T. Iron (Fe) based nanocrystalline material has been selected as a core for the construction of the transformer. The transformer employs a specially designed solid Teflon bobbin having 120 kV insulation for winding the high voltage secondary windings. The flux swing of the core has been experimentally found by plotting the hysteresis loop at actual operating conditions. Based on the design, a prototype transformer has been built which is per se a unique combination of high voltage, high frequency, and peak power specifications. The transformer was able to provide 58 kV (pk-pk) at the secondary with a peak power handling capability of 700 kVA. The transformation ratio was 1:17. The performance of the transformer is also presented and discussed.

Solid-state high voltage modulator and its application to rf source high voltage power supplies

International Nuclear Information System (INIS)

Tooker, J.F.; Huynh, P.; Street, R.W.

2009-01-01

A solid-state high voltage modulator is described in which series-connected insulated-gate bipolar transistors (IGBTs) are switched at a fixed frequency by a pulse width modulation (PWM) regulator, that adjusts the pulse width to control the voltage out of an inductor-capacitor filter network. General Atomics proposed the HV power supply (HVPS) topology of multiple IGBT modulators connected to a common HVdc source for the large number of 1 MW klystrons in the linear accelerator of the Accelerator Production of Tritium project. The switching of 24 IGBTs to obtain 20 kVdc at 20 A for short pulses was successfully demonstrated. This effort was incorporated into the design of a -70 kV, 80 A, IGBT modulator, and in a short-pulse test 12 IGBTs regulated -5 kV at 50 A under PWM control. These two tests confirm the practicality of solid-state IGBT modulators to regulate high voltage at reasonable currents. Tokamaks such as ITER require large rf heating and current drive systems with multiple rf sources. A HVPS topology is presented that readily adapts to the three rf heating systems on ITER. To take advantage of the known economy of scale for power conversion equipment, a single HVdc source feeds multiple rf sources. The large power conversion equipment, which is located outside, converts the incoming utility line voltage directly to the HVdc needed for the class of rf sources connected to it, to further reduce cost. The HVdc feeds a set of IGBT modulators, one for each rf source, to independently control the voltage applied to each source, maximizing operational flexibility. Only the modulators are indoors, close to the rf sources, minimizing the use of costly near-tokamak floor space.

Maximal network reliability for a stochastic power transmission network

International Nuclear Information System (INIS)

Lin, Yi-Kuei; Yeh, Cheng-Ta

2011-01-01

Many studies regarded a power transmission network as a binary-state network and constructed it with several arcs and vertices to evaluate network reliability. In practice, the power transmission network should be stochastic because each arc (transmission line) combined with several physical lines is multistate. Network reliability is the probability that the network can transmit d units of electric power from a power plant (source) to a high voltage substation at a specific area (sink). This study focuses on searching for the optimal transmission line assignment to the power transmission network such that network reliability is maximized. A genetic algorithm based method integrating the minimal paths and the Recursive Sum of Disjoint Products is developed to solve this assignment problem. A real power transmission network is adopted to demonstrate the computational efficiency of the proposed method while comparing with the random solution generation approach.

A novel on-chip high to low voltage power conversion circuit

International Nuclear Information System (INIS)

Wang Hui; Wang Songlin; Mou Zaixin; Guo Baolong; Lai Xinquan; Ye Qiang; Li Xianrui

2009-01-01

A novel power supply transform technique for high voltage IC based on the TSMC 0.6 μm BCD process is achieved. An adjustable bandgap voltage reference is presented which is different from the traditional power supply transform technique. It can be used as an internal power supply for high voltage IC by using the push-pull output stage to enhance its load capability. High-order temperature compensated circuit is designed to ensure the precision of the reference. Only 0.01 mm 2 area is occupied using this novel power supply technique. Compared with traditional technique, 50% of the area is saved, 40% quiescent power loss is decreased, and the temperature coefficient of the reference is only 4.48 ppm/deg. C. Compared with the traditional LDO (low dropout) regulator, this power conversion architecture does not need external output capacitance and decreases the chip-pin and external components, so the PCB area and design cost are also decreased. The testing results show that this circuit works well.

A novel on-chip high to low voltage power conversion circuit

Energy Technology Data Exchange (ETDEWEB)

Wang Hui; Wang Songlin; Mou Zaixin; Guo Baolong [Institute of Mechano-electronic Engineering, Xidian University, Xi' an 71007 (China); Lai Xinquan; Ye Qiang; Li Xianrui, E-mail: whui94@126.co [Institute of Electronic CAD, Xidian University, Xi' an 710071 (China)

2009-03-15

A novel power supply transform technique for high voltage IC based on the TSMC 0.6 mum BCD process is achieved. An adjustable bandgap voltage reference is presented which is different from the traditional power supply transform technique. It can be used as an internal power supply for high voltage IC by using the push-pull output stage to enhance its load capability. High-order temperature compensated circuit is designed to ensure the precision of the reference. Only 0.01 mm{sup 2} area is occupied using this novel power supply technique. Compared with traditional technique, 50% of the area is saved, 40% quiescent power loss is decreased, and the temperature coefficient of the reference is only 4.48 ppm/deg. C. Compared with the traditional LDO (low dropout) regulator, this power conversion architecture does not need external output capacitance and decreases the chip-pin and external components, so the PCB area and design cost are also decreased. The testing results show that this circuit works well.

Risk Evaluation on UHV Power Transmission Construction Project Based on AHP and FCE Method

OpenAIRE

Huiru Zhao; Sen Guo

2014-01-01

Ultra high voltage (UHV) power transmission construction project is a high-tech power grid construction project which faces many risks and uncertainty. Identifying the risk of UHV power transmission construction project can help mitigate the risk loss and promote the smooth construction. The risk evaluation on “Zhejiang-Fuzhou” UHV power transmission construction project was performed based on analytic hierarchy process (AHP) and fuzzy comprehensive evaluation (FCE) method in this paper. Afte...

Self-commutated high-voltage direct current transmission with DC circuit breakers. Backbone for the energy policy turnaround; Selbstgefuehrte Hochspannungs-Gleichstromuebertragung mit DC-Leistungsschalter. Rueckgrat fuer die Energiewende

Energy Technology Data Exchange (ETDEWEB)

Goerner, Raphael [ABB AG, Mannheim (Germany). Marketing und Vertrieb, Geschaeftsbereich Grid Systems

2013-06-01

The 'current war' between direct current and alternating current is extended by a new location. In the future, both technologies work together in order to provide a reliable power transmission in Germany and long-term in Europe. This is based on the self-guided high-voltage direct current transmission. In conjunction with direct current circuit breakers (DC circuit breaker) the power circuit breakers may help to make the transmission grids more flexible and to minimize losses.

A Hybrid Optimization Method for Reactive Power and Voltage Control Considering Power Loss Minimization

DEFF Research Database (Denmark)

Liu, Chengxi; Qin, Nan; Bak, Claus Leth

2015-01-01

This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...

Design of high voltage power supply of miniature X-ray tube based on resonant Royer

International Nuclear Information System (INIS)

Liu Xiyao; Zeng Guoqiang; Tan Chengjun; Luo Qun; Gong Chunhui; Huang Rui

2013-01-01

Background: In recent years, X rays are widely used in various fields. With the rapid development of national economy, the demand of high quality, high reliability, and high stability miniature X-ray tube has grown rapidly. As an important core component of miniature X-ray tube, high voltage power supply has attracted wide attention. Purpose: To match miniature, the high voltage power supply should be small, lightweight, good quality, etc. Based on the basic performance requirements of existing micro-X-ray tube high voltage power supply, this paper designs an output from 0 to -30 kV adjustable miniature X-ray tube voltage DC power supply. Compared to half-bridge and full-bridge switching-mode power supply, its driving circuit is simple. With working on the linear condition, it has no switching noise. Methods: The main circuit makes use of DC power supply to provide the energy. The resonant Royer circuit supplies sine wave which drives to the high frequency transformer's primary winding with resultant sine-like high voltage appearing across the secondary winding. Then, the voltage doubling rectifying circuit would achieve further boost. In the regulator circuit, a feedback control resonant transistor base current is adopted. In order to insulate air, a silicone rubber is used for high pressure part packaging, and the output voltage is measured by the dividing voltage below -5 kV. Results: The stability of circuit is better than 0.2%/6 h and the percent of the output ripple voltage is less than 0.3%. Keeping the output voltage constant, the output current can reach 57 μA by changing the size of load resistor. This high voltage power supply based on resonant Royer can meet the requirement of miniature X-ray tube. Conclusions: The circuit can satisfy low noise, low ripple, low power and high voltage regulator power supply design. However, its efficiency is not high enough because of the linear condition. In the next design, to further reduce power consumption, we

Planning aspects of ac extra high voltage lines

Energy Technology Data Exchange (ETDEWEB)

Engelhardt, H

1964-01-01

The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.

An implantable neurostimulator with an integrated high-voltage inductive power-recovery frontend

International Nuclear Information System (INIS)

Wang Yuan; Zhang Xu; Liu Ming; Li Peng; Chen Hongda

2014-01-01

This paper present a highly-integrated neurostimulator with an on-chip inductive power-recovery frontend and high-voltage stimulus generator. In particular, the power-recovery frontend includes a high-voltage full-wave rectifier (up to 100 V AC input), high-voltage series regulators (24/5 V outputs) and a linear regulator (1.8/3.3 V output) with bandgap voltage reference. With the high voltage output of the series regulator, the proposed neurostimulator could deliver a considerably large current in high electrode-tissue contact impedance. This neurostimulator has been fabricated in a CSMC 1 μm 5/40/700 V BCD process and the total silicon area including pads is 5.8 mm 2 . Preliminary tests are successful as the neurostimulator shows good stability under a 13.56 MHz AC supply. Compared to previously reported works, our design has advantages of a wide induced voltage range (26–100 V), high output voltage (up to 24 V) and high-level integration, which are suitable for implantable neurostimulators. (semiconductor integrated circuits)

High-voltage, high-power architecture considerations

International Nuclear Information System (INIS)

Moser, R.L.

1985-01-01

Three basic EPS architectures, direct energy transfer, peak-power tracking, and a potential EPS architecture for a nuclear reactor are described and compared. Considerations for the power source and energy storage are discussed. Factors to be considered in selecting the operating voltage are pointed out. Other EPS architecture considerations are autonomy, solar array degrees of freedom, and EPS modularity. It was concluded that selection of the power source and energy storage has major impacts on the spacecraft architecture and mass

A novel concept of fault current limiter based on saturable core in high voltage DC transmission system

Science.gov (United States)

Yuan, Jiaxin; Zhou, Hang; Gan, Pengcheng; Zhong, Yongheng; Gao, Yanhui; Muramatsu, Kazuhiro; Du, Zhiye; Chen, Baichao

2018-05-01

To develop mechanical circuit breaker in high voltage direct current (HVDC) system, a fault current limiter is required. Traditional method to limit DC fault current is to use superconducting technology or power electronic devices, which is quite difficult to be brought to practical use under high voltage circumstances. In this paper, a novel concept of high voltage DC transmission system fault current limiter (DCSFCL) based on saturable core was proposed. In the DCSFCL, the permanent magnets (PM) are added on both up and down side of the core to generate reverse magnetic flux that offset the magnetic flux generated by DC current and make the DC winding present a variable inductance to the DC system. In normal state, DCSFCL works as a smoothing reactor and its inductance is within the scope of the design requirements. When a fault occurs, the inductance of DCSFCL rises immediately and limits the steepness of the fault current. Magnetic field simulations were carried out, showing that compared with conventional smoothing reactor, DCSFCL can decrease the high steepness of DC fault current by 17% in less than 10ms, which verifies the feasibility and effectiveness of this method.

Design of full digital 50 kV electronic gun high voltage power supply

International Nuclear Information System (INIS)

Ge Lei; Shang Lei

2014-01-01

The design of full digital electronic gun high voltage power supply based on DSP was introduced in this paper. This power supply has innovations of full digital feedback circuit and PID closed-loop control mode. The application of high frequency resonant converter circuit reduces the size of the resonant element and transformer. The current-coupling distributed high voltage transformer and rectifier circuit were employed in this power supply. By this way, the power supply efficiency is improved and the number of distributed parameters is reduced, and the rectifier circuit could work under the oil-free environment. This power supply has been used in electronic grid-control high voltage system of the irradiation accelerator. (authors)

LED-Based High-Voltage Lines Warning System

Directory of Open Access Journals (Sweden)

Eldar MUSA

2013-04-01

Full Text Available LED-based system, running with the current of high-voltage lines and converting the current flowing through the line into the light by using a toroid transformer, has been developed. The transformer’s primary winding is constituted by the high voltage power line. Toroidal core consists of two equal parts and the secondary windings are evenly placed on these two parts. The system is mounted on the high-voltage lines as a clamp. The secondary winding ends are connected in series by the connector on the clamp. LEDs are supplied by the voltage at the ends of secondary. Current flowing through highvoltage transmission lines is converted to voltage by the toroidal transformer and the light emitting LEDs are supplied with this voltage. The theory of the conversion of the current flowing through the line into the light is given. The system, running with the current of the line and converting the current into the light, has been developed. System has many application areas such as warning high voltage lines (warning winches to not hinder the high-voltage lines when working under the lines, warning planes to not touch the high-voltage lines, remote measurement of high-voltage line currents, and local illumination of the line area

Power MOSFET Linearizer of a High-Voltage Power Amplifier for High-Frequency Pulse-Echo Instrumentation.

Science.gov (United States)

Choi, Hojong; Woo, Park Chul; Yeom, Jung-Yeol; Yoon, Changhan

2017-04-04

A power MOSFET linearizer is proposed for a high-voltage power amplifier (HVPA) used in high-frequency pulse-echo instrumentation. The power MOSFET linearizer is composed of a DC bias-controlled series power MOSFET shunt with parallel inductors and capacitors. The proposed scheme is designed to improve the gain deviation characteristics of the HVPA at higher input powers. By controlling the MOSFET bias voltage in the linearizer, the gain reduction into the HVPA was compensated, thereby reducing the echo harmonic distortion components generated by the ultrasonic transducers. In order to verify the performance improvement of the HVPA implementing the power MOSFET linearizer, we measured and found that the gain deviation of the power MOSFET linearizer integrated with HVPA under 10 V DC bias voltage was reduced (-1.8 and -0.96 dB, respectively) compared to that of the HVPA without the power MOSFET linearizer (-2.95 and -3.0 dB, respectively) when 70 and 80 MHz, three-cycle, and 26 dB m input pulse waveforms are applied, respectively. The input 1-dB compression point (an index of linearity) of the HVPA with power MOSFET linearizer (24.17 and 26.19 dB m at 70 and 80 MHz, respectively) at 10 V DC bias voltage was increased compared to that of HVPA without the power MOSFET linearizer (22.03 and 22.13 dB m at 70 and 80 MHz, respectively). To further verify the reduction of the echo harmonic distortion components generated by the ultrasonic transducers, the pulse-echo responses in the pulse-echo instrumentation were compared when using HVPA with and without the power MOSFET linearizer. When three-cycle 26 dB m input power was applied, the second, third, fourth, and fifth harmonic distortion components of a 75 MHz transducer driven by the HVPA with power MOSFET linearizer (-48.34, -44.21, -48.34, and -46.56 dB, respectively) were lower than that of the HVPA without the power MOSFET linearizer (-45.61, -41.57, -45.01, and -45.51 dB, respectively). When five-cycle 20 dB m input

30 CFR 75.812-2 - High-voltage power centers and transformers; record of examination.

Science.gov (United States)

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage power centers and transformers; record of examination. 75.812-2 Section 75.812-2 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... High-Voltage Distribution § 75.812-2 High-voltage power centers and transformers; record of examination...

Evaluation of the probability of arrester failure in a high-voltage transmission line using a Q learning artificial neural network model

International Nuclear Information System (INIS)

Ekonomou, L; Karampelas, P; Vita, V; Chatzarakis, G E

2011-01-01

One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service

Evaluation of the probability of arrester failure in a high-voltage transmission line using a Q learning artificial neural network model

Science.gov (United States)

Ekonomou, L.; Karampelas, P.; Vita, V.; Chatzarakis, G. E.

2011-04-01

One of the most popular methods of protecting high voltage transmission lines against lightning strikes and internal overvoltages is the use of arresters. The installation of arresters in high voltage transmission lines can prevent or even reduce the lines' failure rate. Several studies based on simulation tools have been presented in order to estimate the critical currents that exceed the arresters' rated energy stress and to specify the arresters' installation interval. In this work artificial intelligence, and more specifically a Q-learning artificial neural network (ANN) model, is addressed for evaluating the arresters' failure probability. The aims of the paper are to describe in detail the developed Q-learning ANN model and to compare the results obtained by its application in operating 150 kV Greek transmission lines with those produced using a simulation tool. The satisfactory and accurate results of the proposed ANN model can make it a valuable tool for designers of electrical power systems seeking more effective lightning protection, reducing operational costs and better continuity of service.

MAGY: An innovative high voltage-low current power supply for gyrotron

International Nuclear Information System (INIS)

Siravo, Ugo; Alex, Juergen; Bader, Michael; Carpita, Mauro; Fasel, Damien; Gavin, Serge; Perez, Albert

2011-01-01

From the electrical point of view, the body and the anode of high power gyrotrons behave as capacitive loads. A highly dynamic power supply is, therefore, hard to achieve. The MAGY concept (Modulator for the Anode of a triode type GYrotron) embodies an innovative solution to manage the capacitive current ensuring a very low ripple on the output voltage. It consists of a series of independent, bi-directional and regulated DC sources. Compared to existing topologies, this solution requires a smaller number of power modules. It avoids internal high frequency modulation and simultaneously offers high resolution of the output voltage and a wide range of operating scenarios.

An integrated low-voltage rated HTS DC power system with multifunctions to suit smart grids

Energy Technology Data Exchange (ETDEWEB)

Jin, Jian Xun, E-mail: jxjin@uestc.edu.cn [Center of Applied Superconductivity, School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China); Center of Applied Superconductivity and Electrical Engineering, School of Automation Engineering, University of Electronic Science and Technology of China, Chengdu 611731 (China); Chen, Xiao Yuan [School of Engineering, Sichuan Normal University, Chengdu 610101 (China); Qu, Ronghai; Fang, Hai Yang [School of Electrical and Electronic Engineering, Huazhong University of Science and Technology, Wuhan 430074 (China); Xin, Ying [Center of Applied Superconductivity, School of Electrical Engineering and Automation, Tianjin University, Tianjin 300072 (China)

2015-03-15

Highlights: • A novel LVDC HTS power transmission network is presented. • An integrated power system is achieved by using HTS DC cable and SMES. • DC superconducting cable is verified to achieve self-acting fault current limitation. • SMES is verified to achieve fast-response buffering effect under a power fluctuation. • SMES is verified to achieve favorable load voltage protection effect under a fault. - Abstract: A low-voltage rated DC power transmission network integrated with superconducting cables (SCs) and superconducting magnetic energy storage (SMES) devices has been studied with analytic results presented. In addition to the properties of loss-less and high current transportation capacity, the effectively integrated system is formed with a self-acting fault current limitation feature of the SC and a buffering effect of the SMES to power fluctuations. The results obtained show that the integrated system can achieve high-quality power transmission under common power fluctuation conditions with an advanced self-protection feature under short circuit conditions, which is identified to suit especially the smart grid applications.

30 CFR 56.12071 - Movement or operation of equipment near high-voltage power lines.

Science.gov (United States)

2010-07-01

...-voltage power lines. 56.12071 Section 56.12071 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION... NONMETAL MINES Electricity § 56.12071 Movement or operation of equipment near high-voltage power lines. When equipment must be moved or operated near energized high-voltage powerlines (other than trolley...

To minimized power outage by the application of 'RTV' (room temperature vulcanizing) silicon on high voltage porcelain insulators in Pakistan

International Nuclear Information System (INIS)

Hafiz Tehzeeb ul Hassan

2003-01-01

In Pakistan power network comprises of 500KV, 220KV, 132KV, 66KV and 33KV transmission lines and 11KV power distribution systems. Number of insulators are used in connected units in the shape of strings with transmission line as per insulation requirements with proper design according to the various kinds of pollution stresses. The transmission lines are passing from or near polluted areas and very dusty plains of Punjab and Sindh provinces. Practices are being used in these transmission lines for removal of accumulated contamination of insulators by periodic cleaning twice a year or de-energized transmission lines. Even then discontinuation of supply takes place in the polluted areas in foggy weather. Special technique of using water repellent (Room Temperature Vulcanizing) silicone coating/paint has been introduced on high voltage disc Insulators to minimize the outage in power net work in Pakistan. Especially in high pollution areas near chemical factories and near brick kilns etc comparison study of coated and uncoated disc Insulators have been carried out by ESDD (Equal Salt Deposit Density) measurement in salt fog chamber. (author)

250 kV 6 mA compact Cockcroft-Walton high-voltage power supply

Energy Technology Data Exchange (ETDEWEB)

Ma, Zhan-Wen; Su, Xiao-Dong; Wei, Zhen; Huang, Zhi-Wu; Miao, Tian-You; Su, Tong-Ling [School of Nuclear Science and Technology, Lanzhou University, Lanzhou 730000 (China); Lu, Xiao-Long; Wang, Jun-Run; Yao, Ze-En, E-mail: zeyao@lzu.edu.cn [School of Nuclear Science and Technology, Lanzhou University, Lanzhou 730000 (China); Engineering Research Center for Neutron Application, Ministry of Education, Lanzhou University, Lanzhou 730000 (China)

2016-08-15

A compact power supply system for a compact neutron generator has been developed. A 4-stage symmetrical Cockcroft-Walton circuit is adopted to produce 250 kV direct current high-voltage. A 2-stage 280 kV isolation transformer system is used to drive the ion source power supply. For a compact structure, safety, and reliability during the operation, the Cockcroft-Walton circuit and the isolation transformer system are enclosed in an epoxy vessel containing the transformer oil whose size is about ∅350 mm × 766 mm. Test results indicate that the maximum output voltage of the power supply is 282 kV, and the stability of the output voltage is better than 0.63% when the high voltage power supply is operated at 250 kV, 6.9 mA with the input voltage varying ±10%.

Optimal Power Transmission of Offshore Wind Power Using a VSC-HVdc Interconnection

Directory of Open Access Journals (Sweden)

Miguel E. Montilla-DJesus

2017-07-01

Full Text Available High-voltage dc transmission based on voltage-source converter (VSC-HVdc is quickly increasing its power rating, and it can be the most appropriate link for the connection of offshore wind farms (OWFs to the grid in many locations. This paper presents a steady-state operation model to calculate the optimal power transmission of an OWF connected to the grid through a VSC-HVdc link. The wind turbines are based on doubly fed induction generators (DFIGs, and a detailed model of the internal OWF grid is considered in the model. The objective of the optimization problem is to maximize the active power output of the OWF, i.e., the reduction of losses, by considering the optimal reactive power allocation while taking into account the restrictions imposed by the available wind power, the reactive power capability of the DFIG, the DC link model, and the operating conditions. Realistic simulations are performed to evaluate the proposed model and to execute optimal operation analyses. The results show the effectiveness of the proposed method and demonstrate the advantages of using the reactive control performed by DFIG to achieve the optimal operation of the VSC-HVdc.

Control voltage and power fluctuations when connecting wind farms

Science.gov (United States)

Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana

2015-12-01

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

Control voltage and power fluctuations when connecting wind farms

International Nuclear Information System (INIS)

Berinde, Ioan; Bălan, Horia; Oros, Teodora Susana

2015-01-01

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve

Control voltage and power fluctuations when connecting wind farms

Energy Technology Data Exchange (ETDEWEB)

Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)

2015-12-23

Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

Reactive power management and voltage control in deregulated power markets

Science.gov (United States)

Spangler, Robert G.

The research that is the subject of this dissertation is about the management of reactive power and voltage support in the wholesale open access power markets in the United States (US). The purpose of this research is to place decisions about open access market structures, as they relate to reactive power and voltage control, on a logical and consistent economic basis, given the engineering needs of a commercial electric power system. An examination of the electricity markets operating in the US today reveals that current approaches to reactive power management and voltage support are extensions of those based on historical, regulated monopoly electric service. A case for change is built by first looking at the subject of reactive power from an engineering viewpoint and then from an economic perspective. Ultimately, a set of market rules for managing reactive power and voltage support is proposed. The proposal suggests that cost recovery for static and dynamic VARs is appropriately accomplished through the regulated transmission cost of service. Static VAR cost recovery should follow traditional rate recovery methodologies. In the case of dynamic VARs, this work provides a methodology based on the microeconomic theory of the firm for determining such cost. It further suggests that an operational strategy that reduces and limits the use of dynamic VARs, during normal operations, is appropriate. This latter point leads to an increase in the fixed cost of the transmission network but prevents price spikes and short supply situations from affecting, or being affected by, the reactive capability limitations associated with dynamic VARs supplied from synchronous generators. The rules are consistent with a market structure that includes competitive generation and their application will result in the communication of a clear understanding of the responsibilities, related to voltage control, of each type of market entity. In this sense, their application will contribute to

Transient analysis of the output short-circuit fault of high power and high voltage DC power supply

International Nuclear Information System (INIS)

Yang Zhigang; Zhang Jian; Huang Yiyun; Hao Xu; Sun Haozhang; Guo Fei

2014-01-01

The transient conditions of output short-circuit fault of high voltage DC power supply was introduced, and the energy of power supply injecting into klystron during the protection process of three-electrode gas switch were analyzed and calculated in detail when klystron load happening electrode arc faults. The results of calculation and simulation are consistent with the results of the experiment. When the output short-circuit fault of high voltage power supply occurs, switch can be shut off in the microsecond, and the short circuit current can be controlled in 200 A. It has verified the rapidity and reliability of the three-electrode gas switch protection, and it has engineering application value. (authors)

Application of Low Voltage High Resistance Grounding in Nuclear Power Plants

Directory of Open Access Journals (Sweden)

Choong-Koo Chang

2016-02-01

Full Text Available Most nuclear power plants now utilize solid grounded low voltage systems. For safety and reliability reasons, the low voltage (LV high resistance grounding (HRG system is also increasingly used in the pulp and paper, petroleum and chemical, and semiconductor industries. Fault detection is easiest and fastest with a solidly grounded system. However, a solidly grounded system has many limitations such as severe fault damage, poor reliability on essential circuits, and electrical noise caused by the high magnitude of ground fault currents. This paper will briefly address the strengths and weaknesses of LV grounding systems. An example of a low voltage HRG system in the LV system of a nuclear power plant will be presented. The HRG system is highly recommended for LV systems of nuclear power plants if sufficient considerations are provided to prevent nuisance tripping of ground fault relays and to avoid the deterioration of system reliability.

Communication Characteristics of Faulted Overhead High Voltage Power Lines at Low Radio Frequencies

Directory of Open Access Journals (Sweden)

Nermin Suljanović

2017-11-01

Full Text Available This paper derives a model of high-voltage overhead power line under fault conditions at low radio frequencies. The derived model is essential for design of communication systems to reliably transfer information over high voltage power lines. In addition, the model can also benefit advanced systems for power-line fault detection and classification exploiting the phenomenon of changed conditions on faulted power line, resulting in change of low radio frequency signal propagation. The methodology used in the paper is based on the multiconductor system analysis and propagation of electromagnetic waves over the power lines. The model for the high voltage power line under normal operation is validated using actual measurements obtained on 400 kV power line. The proposed model of faulted power lines extends the validated power-line model under normal operation. Simulation results are provided for typical power line faults and typical fault locations. Results clearly indicate sensitivity of power-line frequency response on different fault types.

Optimization of a high voltage power supply for a nitrogen laser

International Nuclear Information System (INIS)

Baly, L.; Garcia, M.A.; Martin, J.L.

1997-01-01

In the present paper the optimization of a high voltage switching power supply for a compact TEA nitrogen laser is described. Taking as criterion the recovering of the charging voltage in a 95% of the maximal voltage, the relationships between the recovering rate coefficient, the recovering time and the maximal repetition frequency were obtained. Using an experimental set-up the power supply optimal values of turns in the primary transformer coil N p= 35 and excitation pulse frequency f exc= 25.5 kHz was determined

The Power Behind the Controversy: Understanding Local Policy Elites' Perceptions on the Benefits and Risks Associated with High Voltage Power Line Installation in the State of Arkansas

Science.gov (United States)

Moyer, Rachael M.

Following a proposal for the installation of high voltage power lines in northwest Arkansas, a controversial policy debate emerged. Proponents of the transmission line argue that such an installation is inevitable and necessary to efficiently and reliably support the identified electric load in the region. Opponents claim that the lines will degrade the natural environment and hamper the tourism-based local economy in affected regions, notably in Ozark Mountain areas. This study seeks to understand how local policy elites perceive the benefits and risks associated with proposed transmission lines, which is a critical step in comprehending the formation and changes of related government policies. First, based upon the dual process theory of judgment, this study systematically investigates the triadic relationships between (a) more profound personal value predispositions, (b) affects and feelings, and (c) perceived benefits and risks related to the proposed installation of high voltage power lines among local policy elites in the state of Arkansas. Next, this study focuses more specifically on the role of value predispositions, specific emotional dimensions of affect heuristics, and perceptions pertaining to high voltage power line risks and benefits. Using original data collected from a statewide Internet survey of 420 local leaders and key policymakers about their opinions on the related issues, other factors claimed by previous literature, including trust, knowledge level, and demographic characteristics are considered. Analytical results suggest that grid-group cultural predispositions, as deeply held core values within local policy elites' individual belief systems, both directly and indirectly -- through affective feelings -- shape perceived utility associated with the installation of high voltage power lines. Recognizing that risk perceptions factor into policy decisions, some practical considerations for better designing policy addressing controversial issues

Method and system for a gas tube-based current source high voltage direct current transmission system

Science.gov (United States)

She, Xu; Chokhawala, Rahul Shantilal; Bray, James William; Sommerer, Timothy John; Zhou, Rui; Zhang, Di

2017-08-29

A high-voltage direct-current (HVDC) transmission system includes an alternating current (AC) electrical source and a power converter channel that includes an AC-DC converter electrically coupled to the electrical source and a DC-AC inverter electrically coupled to the AC-DC converter. The AC-DC converter and the DC-AC inverter each include a plurality of legs that includes at least one switching device. The power converter channel further includes a commutating circuit communicatively coupled to one or more switching devices. The commutating circuit is configured to "switch on" one of the switching devices during a first portion of a cycle of the H-bridge switching circuits and "switch off" the switching device during a second portion of the cycle of the first and second H-bridge switching circuits.

Controlled Compact High Voltage Power Lines

Directory of Open Access Journals (Sweden)

Postolati V.

2016-04-01

Full Text Available Nowadays modern overhead transmission lines (OHL constructions having several significant differences from conventional ones are being used in power grids more and more widely. Implementation of compact overhead lines equipped with FACTS devices, including phase angle regulator settings (compact controlled OHL, appears to be one of the most effective ways of power grid development. Compact controlled AC HV OHL represent a new generation of power transmission lines embodying recent advanced achievements in design solutions, including towers and insulation, together with interconnection schemes and control systems. Results of comprehensive research and development in relation to 110–500kV compact controlled power transmission lines together with theoretical basis, substantiation, and methodological approaches to their practical application are presented in the present paper.

Development of an intelligent high-voltage direct-current power supply for nuclear detectors

International Nuclear Information System (INIS)

Zhao Xiuliang

1997-01-01

The operation and performances of a new type direct-current high-voltage power supply are described. The power supply with intelligent feature is controlled by a single-chip microcomputer (8031), and various kinds of output voltage can be preset. The output-voltage is monitored and regulated by the single-chip microcomputer and displayed by LED. The output voltage is stable when the load current is within the allowable limits

High-voltage isolation transformer for sub-nanosecond rise time pulses constructed with annular parallel-strip transmission lines.

Science.gov (United States)

Homma, Akira

2011-07-01

A novel annular parallel-strip transmission line was devised to construct high-voltage high-speed pulse isolation transformers. The transmission lines can easily realize stable high-voltage operation and good impedance matching between primary and secondary circuits. The time constant for the step response of the transformer was calculated by introducing a simple low-frequency equivalent circuit model. Results show that the relation between the time constant and low-cut-off frequency of the transformer conforms to the theory of the general first-order linear time-invariant system. Results also show that the test transformer composed of the new transmission lines can transmit about 600 ps rise time pulses across the dc potential difference of more than 150 kV with insertion loss of -2.5 dB. The measured effective time constant of 12 ns agreed exactly with the theoretically predicted value. For practical applications involving the delivery of synchronized trigger signals to a dc high-voltage electron gun station, the transformer described in this paper exhibited advantages over methods using fiber optic cables for the signal transfer system. This transformer has no jitter or breakdown problems that invariably occur in active circuit components.

Modeling generalized interline power-flow controller (GIPFC using 48-pulse voltage source converters

Directory of Open Access Journals (Sweden)

Amir Ghorbani

2018-05-01

Full Text Available Generalized interline power-flow controller (GIPFC is one of the voltage-source controller (VSC-based flexible AC transmission system (FACTS controllers that can independently regulate the power-flow over each transmission line of a multiline system. This paper presents the modeling and performance analysis of GIPFC based on 48-pulsed voltage-source converters. This paper deals with a cascaded multilevel converter model, which is a 48-pulse (three levels voltage source converter. The voltage source converter described in this paper is a harmonic neutralized, 48-pulse GTO converter. The GIPFC controller is based on d-q orthogonal coordinates. The algorithm is verified using simulations in MATLAB/Simulink environment. Comparisons between unified power flow controller (UPFC and GIPFC are also included. Keywords: Generalized interline power-flow controller (GIPFC, Voltage source converter (VCS, 48-pulse GTO converter

Voltage Analysis Improvement of 150 kV Transmission Subsystem Using Static Synchronous Compensator (STATCOM)

Science.gov (United States)

Akbar, P. A.; Hakim, D. L.; Sucita, T.

2018-02-01

In this research, testing improvements to the distribution voltage electricity at 150 kV transmission subsystem Bandung Selatan and New Ujungberung using Flexible AC Transmission System (FACTS) technology. One of them is by doing the control of active and reactive power through the power electronics equipment Static Synchronous Compensator (STATCOM). The subsystem is tested because it has a voltage profile are relatively less well when based on the IEEE / ANSI C.84.1 (142.5 - 157.5 kV). This study was conducted by analyzing the Newton-Raphson power flow on the simulator DigSilent Power Factory 15 to determine the profile of the voltage (V) on the system. Bus which has the lowest voltage to be a reference in the installation of STATCOM. From this research is known that the voltage on the conditions of the existing bus 28, as many as 21-23 still below standard buses (142.5 kV), after the installation is done using STATCOM, voltage on the buses improved by increasing the number of tracks that follow the standard / is in the range 142.5 kV -157.5 kV as many as 23-27 buses or 78.6% - 96%, with the optimum mounting on a bus Rancaekek STATCOM II with a capacity of 300 MVA.

All solid state high voltage power supply for neutral beam sources

International Nuclear Information System (INIS)

Praeg, W.F.

1984-01-01

The conceptual design of a high frequency solid state, high power, high voltage, power system that reacts fast enough to be compatible with the requirements of a neutral beam source is presented. The system offers the potential of significant advantages over conventional power line frequency systems; such as high reliability, long life, relatively little maintenance requirements, compact size and modular design

Protection relay of phase-shifting device with thyristor switch for high voltage power transmission lines

Science.gov (United States)

Lachugin, V. F.; Panfilov, D. I.; Akhmetov, I. M.; Astashev, M. G.; Shevelev, A. V.

2014-12-01

Problems of functioning of differential current protection systems of phase shifting devices (PSD) with mechanically changed coefficient of transformation of shunt transformer are analyzed. Requirements for devices of protection of PSD with thyristor switch are formulated. Based on use of nonlinear models of series-wound and shunt transformers of PSD modes of operation of major protection during PSD, switching to zero load operation and to operation under load and during short circuit operation were studied for testing PSD with failures. Use of the principle of duplicating by devices of differential current protection (with realization of functions of breaking) of failures of separate pares of PSD with thyristor switch was substantiated. To ensure protection sensitivity to the shunt transformer winding short circuit, in particular, to a short circuit that is not implemented in the current differential protection for PSD with mechanical switch, the differential current protection reacting to the amount of primary ampere-turns of high-voltage and low-voltage winding of this transformer was designed. Studies have shown that the use of differential current cutoff instead of overcurrent protection for the shunt transformer wndings allows one to provide the sensitivity during thyristor failure with the formation of a short circuit. The results of simulation mode for the PSD with switch thyristor designed to be installed as switching point of Voskhod-Tatarskaya-Barabinsk 220 kV transmission line point out the efficiency of the developed solutions that ensure reliable functioning of the PSD.

The control system based on PXI technology for high voltage power supply

International Nuclear Information System (INIS)

Chen Dehong; Zhang Ming; Ma Shaoxiang; Xia Linglong; Zeng Zhen; Zhang Xueliang; Wang Chuliang; Yu Kexun

2014-01-01

A 100 kV/60 A high voltage power supply (HVPS) is being developed to carry some auxiliary heating research on J-TEXT and supply the auxiliary heating system. The power supply which consists of 144 switch modules is based on PSM technology. For the requirement of isolation, control and protection, a control system based on the PCI extensions for instrumentation (PXI) which meets up with the CODAC standards is designed with developed PSM technology for the high voltage power supply. The compact structure of hardware in the control system is presented too. And the control strategy which is based on shift phase pulse width modulation is discussed Some tests are performed on the control system to validate the control strategy, the experimental results show that the system has a good control performance and fast response, which meets the control requirement of 100 kV/60 A high voltage power supply. (authors)

Negative-feedback control system of the high voltage power supply for ECRH

International Nuclear Information System (INIS)

Ding Tonghai; Liu Baohua; Jiang Shufang

2001-01-01

A kind of high accuracy negative high voltage power supply (HVPS) was introduced. The serial feedback was regulated according to the character of the high power tetrode and a new kind of integrator with preset value, which solved the key technological problem of the HVPS that the ECRH system required a voltage of -80 kV, a pulse width of 10 - 100 ms and a precision of 99.7%. The result using a PSPICE code simulation has shown that the method is practical

Application of Newton's optimal power flow in voltage/reactive power control

Energy Technology Data Exchange (ETDEWEB)

Bjelogrlic, M.; Babic, B.S. (Electric Power Board of Serbia, Belgrade (YU)); Calovic, M.S. (Dept. of Electrical Engineering, University of Belgrade, Belgrade (YU)); Ristanovic, P. (Institute Nikola Tesla, Belgrade (YU))

1990-11-01

This paper considers an application of Newton's optimal power flow to the solution of the secondary voltage/reactive power control in transmission networks. An efficient computer program based on the latest achievements in the sparse matrix/vector techniques has been developed for this purpose. It is characterized by good robustness, accuracy and speed. A combined objective function appropriate for various system load levels with suitable constraints, for treatment of the power system security and economy is also proposed. For the real-time voltage/reactive power control, a suboptimal power flow procedure has been derived by using the reduced set of control variables. This procedure is based on the sensitivity theory applied to the determination of zones for the secondary voltage/reactive power control and corresponding reduced set of regulating sources, whose reactive outputs represent control variables in the optimal power flow program. As a result, the optimal power flow program output becomes a schedule to be used by operators in the process of the real-time voltage/reactive power control in both normal and emergency operating states.

Cryogenic Fiber Optic Sensors for Superconducting Magnets and Power Transmission Lines in High Energy Physics Applications

CERN Document Server

AUTHOR|(CDS)2081689; Bajko, Marta

In the framework of the Luminosity upgrade of the Large Hadron Collider (HL - LHC), a remarkable R&D effort is now ongoing at the European Organization for Nuclear Research (CERN) in order to develop a new generation of accelerator magnets and superconducting power transmission lines. The magnet technology will be based on Nb$_{3}$Sn enabling to operate in the 11 - 13 T range. In parallel, in order to preserve the power converters from the increasing radiation level, high power transmission lines are foreseen to feed the magnets from free - radiation zones. These will be based on high temperature superconductors cooled down with helium gas in the range 5 - 30 K. The new technologies will require advanced design and fabrication approaches as well as adapted instrumentation for monitoring both the R&D phase and operation. Resistive sensors have been used so far for voltage, temperature and strain monitoring but their integration still suffers from the number of electrical wires and the complex compensat...

Line Capacity Expansion and Transmission Switching in Power Systems With Large-Scale Wind Power

DEFF Research Database (Denmark)

Villumsen, Jonas Christoffer; Bronmo, Geir; Philpott, Andy B.

2013-01-01

In 2020 electricity production from wind power should constitute nearly 50% of electricity demand in Denmark. In this paper we look at optimal expansion of the transmission network in order to integrate 50% wind power in the system, while minimizing total fixed investment cost and expected cost...... of power generation. We allow for active switching of transmission elements to reduce congestion effects caused by Kirchhoff's voltage law. Results show that actively switching transmission lines may yield a better utilization of transmission networks with large-scale wind power and increase wind power...

Design of the all solid high-voltage power supply for a gyrotron body

Energy Technology Data Exchange (ETDEWEB)

Rao, Yihua [School of Mathematics and Physics, University of South China, Hengyang, 421001 (China); Chen, Wenguang, E-mail: 430000485393@usc.edu.cn [School of Electrical Engineering, University of South China, Hengyang, 421001 (China); Hu, Bo [School of Electrical Engineering, University of South China, Hengyang, 421001 (China); Rao, Jun; Huang, Mei; Kang, Zihua; Feng, Kun [Southwestern Institute of Physics, Chengdu, 610041 (China); Huang, Jiaqi [School of Electrical Engineering, University of South China, Hengyang, 421001 (China)

2017-04-15

Highlights: • Completed design of all solid-state high-voltage power supply for gyrotron body on HL-2M ECRH. • Consist of 58 PSM modules and one BUCK module, controlled by DSP system. • Fabricated full voltage 35 kV, 200 mA BPS and tested in dummy load. • The BPS can operate in three modes: single pulse mode, multi-pulse modulation mode and the six-level preset mode. - Abstract: Gyrotron plays an important role in the research of electron cyclotron resonance heating (ECRH) on Tokomak. The high-frequency switched power supply technology and pulse step modulation (PSM) technology are used in the development of the all solid high-voltage body power supply (BPS) for 1 MW/105 GHz Gyrotron on ECRH system. Firstly, the basic structure of the BPS and its control system are introduced. Secondly, the software control algorithm of voltage stabilization and modulate method are developed. Finally, the design is verified by the experiments. The experimental results of the single pulse mode, the multi-pulse modulation mode and the six-level preset mode, are shown. The output voltage of the power supply can reach 35 kV and the current at about 200 mA, which are adjustable in the full range. The maximum modulation frequency can reach 1 kHz and the front edge of the pulse can be adjust from 0 to 3 ms and the accuracy of the output voltage is less than 100 V. The results show that the control method is feasible and can be applied to other high power microwave sources.

The system of high-voltage power PMT for experiments at the JINR Nuclotron

International Nuclear Information System (INIS)

Piyadin, S.M.; Ladygin, V.P.; Pilyar, A.V.; Reznikov, S.G.; Janek, M.

2015-01-01

An 8-channel high-voltage power system based on the use of the module «Wenzel Elektronik N1130» is described. Specifications of control modules 8DAC-12 and 8ADC-14 designed for the high-voltage systems in CAMAC standard are presented. This system is designed to provide the power for the detectors used in physics experiments at the JINR Nuclotron.

Coordination of voltage and reactive power control in the extra high voltage substations based on the example of solutions applied in the national power system

Directory of Open Access Journals (Sweden)

Dariusz Kołodziej

2012-06-01

Full Text Available This paper presents examples of coordination between automatic voltage and reactive power control systems (ARST covering adjacent and strongly related extra high voltage substations. Included are conclusions resulting from the use of these solutions. The Institute of Power Engineering, Gdańsk Division has developed and deployed ARST systems in the national power system for a dozen or so years.

An approach for high voltage power supply system for HCAL of LHCb experiment

International Nuclear Information System (INIS)

Cimpean, A.; Dumitru, D.; Kluger, A.; Magureanu, C.; Tarta, D.; Coca, C.; Orlandea, M.; Popescu, S.

2003-01-01

The main aim of the calorimeter system of the LHCb (Large Hadron Collider Beauty) experiment dedicated to precision measurements of CP violation and rare phenomena is to provide identification of the electrons, hadrons and photons, for the level-0 trigger and offline analysis with measurements of position and energy. The system consists in a scintillator pad/preshower (SPD/PS) detector, an electromagnetic calorimeter (ECAL) and a hadron calorimeter (HCAL), all the sub-detectors having a similar technology with scintillating tiles as active material and being read out via wavelength-shifting fibers and with an identical readout electronics for ECAL and HCAL and similar electronics for the PS. During 1997-1999 a computer controlled High Voltage (HV) distribution scheme was developed by Horia Hulubei National Institute for Physics and Nuclear Engineering (IFIN-HH) group and used to supply the PMTs of half HCAL prototype during the beam tests (1998-2000). This scheme consisted of three parts: 1) a control box which includes low voltage power supply, the RS232 interface to a PC and three modules of high voltage power supply; 2) two types of multichannel HV distributors with an individual voltage setting; 3) a software package to control all settings and refresh them periodically. Based on the acquired experience, a new design for a High Voltage Power Supply (HVPS) which satisfies the LHCb requirements has been developed for PMTs of the hadron calorimeter. The demands of this system are simplicity and low cost. This HVPS with multiple outputs (HV for photocathode and D1 - D4 dynodes) is destined to supply, with the same high voltage, groups of PMTs sorted by similar characteristics as gain and sensitivity. Because of the high rates (∼ 40 MHz) supported by PMTs, booster voltage sources are necessary to supply current for the last 4 dynodes. The box has 5 HV power supplies for photocathodes and the last 4 dynodes, each HV power supply being followed by a 4 channel

High power RF transmission line component development

International Nuclear Information System (INIS)

Hong, B. G.; Hwang, C. K.; Bae, Y. D.; Yoon, J. S.; Wang, S. J.; Gu, S. H.; Yang, J. R.; Hahm, Y. S.; Oh, G. S.; Lee, J. R.; Lee, W. I.; Park, S. H.; Kang, M. S.; Oh, S. H.; Lee, W.I.

1999-12-01

We developed the liquid stub and phase shifter which are the key high RF power transmission line components. They show reliable operation characteristics and increased insulation capability, and reduced the size by using liquid (silicon oil, dielectric constant ε=2.72) instead of gas for insulating dielectric material. They do not have finger stock for the electric contact so the local temperature rise due to irregular contact and RF breakdown due to scratch in conductor are prevented. They can be utilized in broadcasting, radar facility which require high RF power transmission. Moreover, they are key components in RF heating system for fusion reactor. (author)

High power RF transmission line component development

Energy Technology Data Exchange (ETDEWEB)

Hong, B. G.; Hwang, C. K.; Bae, Y. D.; Yoon, J. S.; Wang, S. J.; Gu, S. H.; Yang, J. R.; Hahm, Y. S.; Oh, G. S.; Lee, J. R.; Lee, W. I.; Park, S. H.; Kang, M. S.; Oh, S. H.; Lee, W.I

1999-12-01

We developed the liquid stub and phase shifter which are the key high RF power transmission line components. They show reliable operation characteristics and increased insulation capability, and reduced the size by using liquid (silicon oil, dielectric constant {epsilon}=2.72) instead of gas for insulating dielectric material. They do not have finger stock for the electric contact so the local temperature rise due to irregular contact and RF breakdown due to scratch in conductor are prevented. They can be utilized in broadcasting, radar facility which require high RF power transmission. Moreover, they are key components in RF heating system for fusion reactor. (author)

Design of power oscillator for 500 keV/20 mA Cockroft-Walton high voltage supply

International Nuclear Information System (INIS)

Djasiman; Sudjatmoko; Suprapto

1999-01-01

A design of power oscillator for Cockroft-Walton high voltage supply was carried out. This high voltage supply would be used as the acceleration voltage supply of an electron beam machine designed to have 500 keV/20 mA capacity. The power oscillator design consisted of output specification, circuit diagram, power supply and oscillator main components determinations. The power oscillator output wave power, voltage and frequency designed according to voltage multiplier input requirements. The design results showed that the circuit was class-c tickler oscillator having an output specification of 12.1 kW, 15 kV and 40 kHz sinus wave. The main component was a ITK 15-2 triode tube. (author)

A new high-voltage level-shifting circuit for half-bridge power ICs

International Nuclear Information System (INIS)

Kong Moufu; Chen Xingbi

2013-01-01

In order to reduce the chip area and improve the reliability of HVICs, a new high-voltage level-shifting circuit with an integrated low-voltage power supply, two PMOS active resistors and a current mirror is proposed. The integrated low-voltage power supply not only provides energy for the level-shifting circuit and the logic circuit, but also provides voltage signals for the gates and sources of the PMOS active resistors to ensure that they are normally-on. The normally-on PMOS transistors do not, therefore, need to be fabricated in the depletion process. The current mirror ensures that the level-shifting circuit has a constant current, which can reduce the process error of the high-voltage devices of the circuit. Moreover, an improved RS trigger is also proposed to improve the reliability of the circuit. The proposed level-shifting circuit is analyzed and confirmed by simulation with MEDICI, and the simulation results show that the function is achieved well. (semiconductor integrated circuits)

Decision Optimization for Power Grid Operating Conditions with High- and Low-Voltage Parallel Loops

Directory of Open Access Journals (Sweden)

Dong Yang

2017-05-01

Full Text Available With the development of higher-voltage power grids, the high- and low-voltage parallel loops are emerging, which lead to energy losses and even threaten the security and stability of power systems. The multi-infeed high-voltage direct current (HVDC configurations widely appearing in AC/DC interconnected power systems make this situation even worse. Aimed at energy saving and system security, a decision optimization method for power grid operating conditions with high- and low-voltage parallel loops is proposed in this paper. Firstly, considering hub substation distribution and power grid structure, parallel loop opening schemes are generated with GN (Girvan-Newman algorithms. Then, candidate opening schemes are preliminarily selected from all these generated schemes based on a filtering index. Finally, with the influence on power system security, stability and operation economy in consideration, an evaluation model for candidate opening schemes is founded based on analytic hierarchy process (AHP. And a fuzzy evaluation algorithm is used to find the optimal scheme. Simulation results of a New England 39-bus system and an actual power system validate the effectiveness and superiority of this proposed method.

A digital controlled negative high voltage power source for LINAC of HLS

International Nuclear Information System (INIS)

Gao Hui; Chen Jun; Hong Jun; Wang Weibing

2005-01-01

This paper introduces the working principle of a 10-80 kV negative high voltage power source for the electronic gun of the 200 MeV LINAC of NSRL, especially how to realize the switch power, voltage/current sampling, feedback control and microcontroller module. The firmware design for the SOC microcontroller of ADuC8xx and the application software design for PC are also presented. (authors)

Wind Power Impact to Transient and Voltage Stability of the Power System in Eastern Denmark

DEFF Research Database (Denmark)

Rasmussen, Joana; Jørgensen, Preben; Palsson, Magni Thor

2005-01-01

Voltage stability, transient stability and reactive power compensation are extremely important issues for largescale integration of wind power in areas distant from the main transmission system in Eastern Denmark. This paper describes the application of a dynamic wind farm model in simulation...... studies for assessments of a large wind power penetration. The simulation results reveal problems with voltage stability due to the characteristic of wind turbine generation as well as the inability of the power system to meet the reactive power demand. Furthermore, the established model is applied...

Repetitive plasma opening switch for powerful high-voltage pulse generators

International Nuclear Information System (INIS)

Dolgachev, G.I.; Zakatov, L.P.; Nitishinskii, M.S.; Ushakov, A.G.

1998-01-01

Results are presented of experimental studies of plasma opening switches that serve to sharpen the pulses of inductive microsecond high-voltage pulse generators. It is demonstrated that repetitive plasma opening switches can be used to create super-powerful generators operating in a quasi-continuous regime. An erosion switching mechanism and the problem of magnetic insulation in repetitive switches are considered. Achieving super-high peak power in plasma switches makes it possible to develop new types of high-power generators of electron beams and X radiation. Possible implementations and the efficiency of these generators are discussed

Complete low power controller for high voltage power systems

International Nuclear Information System (INIS)

Sumner, R.; Blanar, G.

1997-01-01

The MHV100 is a custom CMOS integrated circuit, developed for the AMS experiment. It provides complete control for a single channel high voltage (HV) generator and integrates all the required digital communications, D to A and A to D converters, the analog feedback loop and output drivers. This chip has been designed for use in both distributed high voltage systems or for low cost single channel high voltage systems. The output voltage and current range is determined by the external components

The Design of Nanosecond Fast-switch Pulsed High Voltage Power Supply Based on Solid-state

International Nuclear Information System (INIS)

Chen Wenguang; Chen Wei; Rao Yihua

2009-01-01

The high voltage pulsed power supply is applied in the experiment of the nuclear science widely. It main consist of DC high-voltage power supply (HVPS) and pulse modulator. The high-frequency series-resonant inverter technology and IGBT series technology are used to design the HVPS and the modulator, respectively. The main circuit, control circuit, high voltage transformer and solid-state switch are illuminated in the paper. The apparatus can operate at a maximum output voltage of 6 kilovolt, which can be modulated single pulse and also be modulated by series pulse. A prototype is fabricated and tested, experimental results show that the pulsed power supply is well-designed and rising edge time to meet the nsclass; it can achieve the requirement of rapid modulation. (authors)

High Input Voltage Discharge Supply for High Power Hall Thrusters Using Silicon Carbide Devices

Science.gov (United States)

Pinero, Luis R.; Scheidegger, Robert J.; Aulsio, Michael V.; Birchenough, Arthur G.

2014-01-01

A power processing unit for a 15 kW Hall thruster is under development at NASA Glenn Research Center. The unit produces up to 400 VDC with two parallel 7.5 kW discharge modules that operate from a 300 VDC nominal input voltage. Silicon carbide MOSFETs and diodes were used in this design because they were the best choice to handle the high voltage stress while delivering high efficiency and low specific mass. Efficiencies in excess of 97 percent were demonstrated during integration testing with the NASA-300M 20 kW Hall thruster. Electromagnet, cathode keeper, and heater supplies were also developed and will be integrated with the discharge supply into a vacuum-rated brassboard power processing unit with full flight functionality. This design could be evolved into a flight unit for future missions that requires high power electric propulsion.

Optimization Design of an Inductive Energy Harvesting Device for Wireless Power Supply System Overhead High-Voltage Power Lines

Directory of Open Access Journals (Sweden)

Wei Wang

2016-03-01

Full Text Available Overhead high voltage power line (HVPL online monitoring equipment is playing an increasingly important role in smart grids, but the power supply is an obstacle to such systems’ stable and safe operation, so in this work a hybrid wireless power supply system, integrated with inductive energy harvesting and wireless power transmitting, is proposed. The energy harvesting device extracts energy from the HVPL and transfers that from the power line to monitoring equipment on transmission towers by transmitting and receiving coils, which are in a magnetically coupled resonant configuration. In this paper, the optimization design of online energy harvesting devices is analyzed emphatically by taking both HVPL insulation distance and wireless power supply efficiency into account. It is found that essential parameters contributing to more extracted energy include large core inner radius, core radial thickness, core height and small core gap within the threshold constraints. In addition, there is an optimal secondary coil turn that can maximize extracted energy when other parameters remain fixed. A simple and flexible control strategy is then introduced to limit power fluctuations caused by current variations. The optimization methods are finally verified experimentally.

A Secondary Voltage Control Method for an AC/DC Coupled Transmission System Based on Model Predictive Control

DEFF Research Database (Denmark)

Xu, Fengda; Guo, Qinglai; Sun, Hongbin

2015-01-01

For an AC/DC coupled transmission system, the change of transmission power on the DC lines will significantly influence the AC systems’ voltage. This paper describes a method to coordinated control the reactive power of power plants and shunt capacitors at DC converter stations nearby, in order t...

Local Dynamic Reactive Power for Correction of System Voltage Problems

Energy Technology Data Exchange (ETDEWEB)

Kueck, John D [ORNL; Rizy, D Tom [ORNL; Li, Fangxing [ORNL; Xu, Yan [ORNL; Li, Huijuan [University of Tennessee, Knoxville (UTK); Adhikari, Sarina [ORNL; Irminger, Philip [ORNL

2008-12-01

Distribution systems are experiencing outages due to a phenomenon known as local voltage collapse. Local voltage collapse is occurring in part because modern air conditioner compressor motors are much more susceptible to stalling during a voltage dip than older motors. These motors can stall in less than 3 cycles (.05s) when a fault, such as on the sub-transmission system, causes voltage to sag to 70 to 60%. The reasons for this susceptibility are discussed in the report. During the local voltage collapse, voltages are depressed for a period of perhaps one or two minutes. There is a concern that these local events are interacting together over larger areas and may present a challenge to system reliability. An effective method of preventing local voltage collapse is the use of voltage regulation from Distributed Energy Resources (DER) that can supply or absorb reactive power. DER, when properly controlled, can provide a rapid correction to voltage dips and prevent motor stall. This report discusses the phenomenon and causes of local voltage collapse as well as the control methodology we have developed to counter voltage sag. The problem is growing because of the use of low inertia, high efficiency air conditioner (A/C) compressor motors and because the use of electric A/C is growing in use and becoming a larger percentage of system load. A method for local dynamic voltage regulation is discussed which uses reactive power injection or absorption from local DER. This method is independent, rapid, and will not interfere with conventional utility system voltage control. The results of simulations of this method are provided. The method has also been tested at the ORNL s Distributed Energy Communications and Control (DECC) Laboratory using our research inverter and synchronous condenser. These systems at the DECC Lab are interconnected to an actual distribution system, the ORNL distribution system, which is fed from TVA s 161kV sub-transmission backbone. The test results

Proposal and Development of a High Voltage Variable Frequency Alternating Current Power System for Hybrid Electric Aircraft

Science.gov (United States)

Sadey, David J.; Taylor, Linda M.; Beach, Raymond F.

2017-01-01

The development of ultra-efficient commercial vehicles and the transition to low-carbon emission propulsion are seen as strategic thrust paths within NASA Aeronautics. A critical enabler to these paths comes in the form of hybrid electric propulsion systems. For megawatt-class systems, the best power system topology for these hybrid electric propulsion systems is debatable. Current proposals within NASA and the Aero community suggest using a combination of alternating current (AC) and direct current (DC) for power generation, transmission, and distribution. This paper proposes an alternative to the current thought model through the use of a primarily high voltage AC power system, supported by the Convergent Aeronautics Solutions (CAS) Project. This system relies heavily on the use of doubly-fed induction machines (DFIMs), which provide high power densities, minimal power conversion, and variable speed operation. The paper presents background on the activity along with the system architecture, development status, and preliminary results.

A New Approach to High Efficincy in Isolated Boost Converters for High-Power Low-Voltage Fuel Cell Apllications

DEFF Research Database (Denmark)

Nymand, Morten; Andersen, Michael A. E.

2008-01-01

A new low-leakage-inductance low-resistance design approach to low-voltage high-power isolated boost converters is presented. Very low levels of parasitic circuit inductances are achieved by optimizing transformer design and circuit lay-out. Primary side voltage clamp circuits can be eliminated...... by the use of power MOSFETs fully rated for repetitive avalanche. Voltage rating of primary switches can now be reduced, significantly reducing switch on-state losses. Finally, silicon carbide rectifying diodes allow fast diode turn-off, further reducing losses. Test results from a 1.5 kW full-bridge boost...... converter verify theoretical analysis and demonstrate very high efficiency. Worst case efficiency, at minimum input voltage maximum power, is 96.8 percent and maximum efficiency reaches 98 percent....

Automatic Voltage Control (AVC) of Danish Transmission System - Concept design

DEFF Research Database (Denmark)

Qin, Nan; Abildgaard, Hans; Lund, P.

2014-01-01

For more than 20 years it has been a consistent plan by all Danish governments to turn the Danish power production away from fossil fuels towards renewable energy. The result today is that 37% of the total Danish power consumption was covered by mainly wind energy in 2013 aiming at 50% by 2020......, objectives, constraints, algorithms for optimal power flow and some special functions in particular systems, which inspires the concept design of a Danish AVC system to address the future challenges of voltage control. In the concept, the Danish AVC design is based on a centralized control scheme. All...... the substation loses the telecommunications to the control center. RPCs will be integrated to the AVC system as normative regulators in the later stage. Distributed generation units can be organized as virtual power plants and participate in voltage control at transmission level. Energinet.dk as the Danish TSO...

Source of high-voltage power supply for ozone generators at glow discharge

International Nuclear Information System (INIS)

Bruev, A.A.; Golota, V.I.; Zavada, L.M.; Taran, G.V.

2000-01-01

High-voltage power supply source on quasi-resonance inverter base which works at direct current regime is described. This source forms 20 kV voltage with 0 - 10 mA current regulation. It protects the source from current break-downs and feeds ozone generators at glow discharge

Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

International Nuclear Information System (INIS)

Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

1993-01-01

Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently the authors used a MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r b < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. The authors' success with the MITL technology led them to investigate the application to higher energy accelerator designs. They have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30-50-ns FWHM output pulse

Application of Magnetically Insulated Transmission Lines for high current, high voltage electron beam accelerators

International Nuclear Information System (INIS)

Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Poukey, J.W.; Turman, B.N.

1991-01-01

Self Magnetically Insulated Transmission Lines (MITL) adders have been used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r ρ < 2 cm), 11 to 15 MeV, 50 to 100-kA beams with a small transverse velocity v perpendicular/c = β perpendicular ≤ 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30--50 ns FWHM output pulse. 10 refs

Application of magnetically insulated transmission lines for high current, high voltage electron beam accelerators

Science.gov (United States)

Shope, S. L.; Mazarakis, M. G.; Frost, C. A.; Poukey, J. W.; Turman, B. N.

Self Magnetically Insulated Transmission Lines (MITL) adders were used successfully in a number of Sandia accelerators such as HELIA, HERMES III, and SABRE. Most recently we used at MITL adder in the RADLAC/SMILE electron beam accelerator to produce high quality, small radius (r(sub rho) less than 2 cm), 11 - 15 MeV, 50 - 100-kA beams with a small transverse velocity v(perpendicular)/c = beta(perpendicular) less than or equal to 0.1. In RADLAC/SMILE, a coaxial MITL passed through the eight, 2 MV vacuum envelopes. The MITL summed the voltages of all eight feeds to a single foilless diode. The experimental results are in good agreement with code simulations. Our success with the MITL technology led us to investigate the application to higher energy accelerator designs. We have a conceptual design for a cavity-fed MITL that sums the voltages from 100 identical, inductively-isolated cavities. Each cavity is a toroidal structure that is driven simultaneously by four 8-ohm pulse-forming lines, providing a 1-MV voltage pulse to each of the 100 cavities. The point design accelerator is 100 MV, 500 kA, with a 30 - 50 ns FWHM output pulse.

A novel high voltage start up circuit for an integrated switched mode power supply

Energy Technology Data Exchange (ETDEWEB)

Hu Hao; Chen Xingbi, E-mail: huhao21@uestc.edu.c [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

2010-09-15

A novel high voltage start up circuit for providing an initial bias voltage to an integrated switched mode power supply (SMPS) is presented. An enhanced mode VDMOS transistor, the gate of which is biased by a floating p-island, is used to provide start up current and sustain high voltage. An NMOS transistor having a high source to ground breakdown voltage is included to extend the bias voltage range to the SMPS. Simulation results indicate that the high voltage start up circuit can start and restart as designed. The proposed structure is believed to be more energy saving and cost-effective compared with other solutions. (semiconductor devices)

Multi-Objective Differential Evolution for Voltage Security Constrained Optimal Power Flow in Deregulated Power Systems

Science.gov (United States)

Roselyn, J. Preetha; Devaraj, D.; Dash, Subhransu Sekhar

2013-11-01

Voltage stability is an important issue in the planning and operation of deregulated power systems. The voltage stability problems is a most challenging one for the system operators in deregulated power systems because of the intense use of transmission line capabilities and poor regulation in market environment. This article addresses the congestion management problem avoiding offline transmission capacity limits related to voltage stability by considering Voltage Security Constrained Optimal Power Flow (VSCOPF) problem in deregulated environment. This article presents the application of Multi Objective Differential Evolution (MODE) algorithm to solve the VSCOPF problem in new competitive power systems. The maximum of L-index of the load buses is taken as the indicator of voltage stability and is incorporated in the Optimal Power Flow (OPF) problem. The proposed method in hybrid power market which also gives solutions to voltage stability problems by considering the generation rescheduling cost and load shedding cost which relieves the congestion problem in deregulated environment. The buses for load shedding are selected based on the minimum eigen value of Jacobian with respect to the load shed. In the proposed approach, real power settings of generators in base case and contingency cases, generator bus voltage magnitudes, real and reactive power demands of selected load buses using sensitivity analysis are taken as the control variables and are represented as the combination of floating point numbers and integers. DE/randSF/1/bin strategy scheme of differential evolution with self-tuned parameter which employs binomial crossover and difference vector based mutation is used for the VSCOPF problem. A fuzzy based mechanism is employed to get the best compromise solution from the pareto front to aid the decision maker. The proposed VSCOPF planning model is implemented on IEEE 30-bus system, IEEE 57 bus practical system and IEEE 118 bus system. The pareto optimal

High power, medium voltage, series resonant converter for DC wind turbines

DEFF Research Database (Denmark)

Dincan, Catalin Gabriel; Kjær, Philip Carne; Chen, Yu-Hsing

2018-01-01

, and the resulting compact and efficient transformer, and soft-commutated inverter, present particular advantages in high-power, high-voltage applications, like DC offshore wind turbines. With transformer excitation frequency in hundreds of Hz range, line-frequency diodes can be employed in the high...

High-Power Microwave Transmission and Mode Conversion Program

Energy Technology Data Exchange (ETDEWEB)

Vernon, Ronald J. [Univ. of Wisconsin, Madison, WI (United States)

2015-08-14

This is a final technical report for a long term project to develop improved designs and design tools for the microwave hardware and components associated with the DOE Plasma Fusion Program. We have developed basic theory, software, fabrication techniques, and low-power measurement techniques for the design of microwave hardware associated gyrotrons, microwave mode converters and high-power microwave transmission lines. Specifically, in this report we discuss our work on designing quasi-optical mode converters for single and multiple frequencies, a new method for the analysis of perturbed-wall waveguide mode converters, perturbed-wall launcher design for TE0n mode gyrotrons, quasi-optical traveling-wave resonator design for high-power testing of microwave components, and possible improvements to the HSX microwave transmission line.

Design automation of switching mode high voltage power supply for nuclear instruments

International Nuclear Information System (INIS)

El-araby, S.M.S.

1999-01-01

This paper presents an automation procedure for the design of switching mode high voltage power supplies, using Pc programming facility. The procedure permits the selection of a ready made or designed ferrite transformer. This selection could be achieved according to the designer desire; as the program includes complete information about ready made ferrite transformer through complete database. The procedure is based on suggested template circuit. Micro-Cap IV simulation package is used to verify the desired high voltage power supply design. Simulation results agree quite well with suggested procedure's results. Design aspects and development needed to increase automation capabilities are also discussed

Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.

Science.gov (United States)

Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

2015-12-30

A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.

High-power high-voltage pulse generator for supplying electrostatic precipitators of dust

International Nuclear Information System (INIS)

Radu, A.; Martin, D.

1992-01-01

The study and development of an experimental high voltage generator specialized in the supply of electrostatic precipitators are presented. The main parameters of the pulse generator are: U = -30 kV, I = 8.8 A, τ = 120μs, f r = 150 Hz. The pulse generator was tested on a laboratory electrostatic precipitator with nominal capacitance C = 25 nF, biased at -40 kV by means of a separate high voltage rectifier. The experimental results will be used for the creation of a more powerful pulse generator, a prototype for the supply of a real industrial electrostatic precipitator: U = -50 kV, I = 313 A, τ = 100μs, f r = 300 Hz, C = 100 nF. (Author)

Structure Design and Analysis of High-Voltage Power Supply for ECRH

International Nuclear Information System (INIS)

Wang Lei; Huang Yiyun; Zhao Yanping; Zhang Jian; Yang Lei; Guo Wenjun

2014-01-01

In order to develop a high-voltage power supply (HVPS) with high quality parameters, not only its electrical circuit but also its structure should be studied in detail. In this paper, the structure design of the collector power supply for gyrotron is discussed first. Then the electrical field and potential simulations of its main devices are analyzed. Finally, relevant calculations and conclusions are given. (fusion engineering)

Design philosophy and use of high voltage power systems for multi-megawatt ion beam accelerators

International Nuclear Information System (INIS)

Barber, G.C.; Broverman, A.Y.; Hill, R.E.; Loring, C.M.; Ponte, N.S.

1977-01-01

The requirements for a neutral beam high voltage power system are derived from the characteristics of the ion source. High voltage system component characteristic requirements and choices are described

Development of anode high voltage power supply system for ECRH of HL-2A tokamak

International Nuclear Information System (INIS)

Chen Wenguang

2009-01-01

The anode high voltage power supply system consist of DC high-voltage power supply (HVPS) and pulse modulator. SCR is used to vary AC input voltage of the step-up transformer by controlling the trigger phase in the HVPS, and regulate the DC output voltage linearly at the potential of low-end via BJT, Dual closed-loop control technology is applied in the controller, and its maximum output is at 30kV and 130mA. Tetrode is the core component of the modulator. The circuit design is optimized by using the simulation software. Test and HL-2A discharge experimental results show that the power supply system is designed with some characteristics of output scale widely, low ripple and modulate quickly. (authors)

Medium and high voltage power cables market in Europe

International Nuclear Information System (INIS)

Kupiec, M.

1992-06-01

This note gives an overview of the European market for medium and high voltage power cables. In this text, emphasis is placed on suppliers and important European clients; there is also a brief review of the different techniques for cable laying and utilization in Europe. This not has mainly been drafted from informations supplied by EUROPACABLE

A new VME-based high voltage power supply for large photomultiplier systems

International Nuclear Information System (INIS)

Neumaier, S.; Hubbeling, T.; Kolb, B.W.; Purschke, M.L.; Ippolitov, M.; Blume, C.; Bohne, E.M.; Bucher, D.; Claussen, A.; Peitzmann, T.; Schepers, G.; Schlagheck, H.

1995-01-01

We describe a new high voltage power supply, developed for the leadglass calorimeter of the WA98 experiment at CERN. The high voltage is produced for each of the 10,080 photomultiplier tubes of the detector individually, by the same number of active bases with on-board Greinacher voltage multipliers. The full VME-based HV controller system, which addresses each base via bus cables once per second, is miniaturized and fits into a single VME crate. The main advantages of this approach are the low heat dissipation, the considerably reduced amount of cabling and cost, as well as the high stability and low noise of the system. (orig.)

High-voltage power supply of ND6 portable dose rate meter

International Nuclear Information System (INIS)

Wang Shaling

2001-01-01

Portable dose rate meter needs to be equipped with a set of high-voltage power supply which is supplied by batteries and has characteristic of high quality, low energy expense and small size. The author introduces application conditions and performance guide line

Draft Environmental Impact Statement: BPA/Puget Power Northwest Washington Transmission Project

International Nuclear Information System (INIS)

1993-11-01

Bonneville Power Administration (BPS) and Puget Sound Power ampersand Light (Puget Power) propose to upgrade the existing high-voltage transmission system in the Whatcom and Skagit County area between the towns of Custer and Sedro Woolley, including within the city of Bellingham starting in 1995. The upgrades of the interconnected 230,000 volt (230-kV) and 115-kV systems are needed to increase the reliability of the local transmission system and to increase the import capacity on a nearby US-Canada 500-kV intertie by about 850 megawatts (MW). The increase in north-south transfer capability would be shared by BPA and Puget Power (about 425 MW each). Other actions would include replacement of an existing BPA 230-kV single-circuit, wood-pole H-frame transmission line with a lattice-steel double-circuit line; an existing Puget Power 115-kV single wood-pole transmission line rebuild, two short 115-kV Puget Power lines added at BPA's Bellingham Substation; and improvements made at existing BPA and Puget Power substations

HVDC Transmission an Outlook and Significance for Pakistani Power Sector

Science.gov (United States)

Ahmad, Muhammad; Wang, Zhixin; Wang, Jinjian; Baloach, Mazhar H.; Longxin, Bao; Hua, Qing

2018-04-01

Recently a paradigm shift in the power sector is observed, i.e., countries across the globe have deviated their attention to distributed generation rather than conventional centralized bulk generation. Owing to the above narrative, distributed energy resources e.g., wind and PV have gained the adequate attention of governments and researchers courtesy to their eco-friendly nature. On the contrary, the increased infiltration of distributed generation to the power system has introduced many technical and economical glitches such as long-distance transmission, transmission lines efficiency, control capability and cost etc. To mitigate these complications, the utility of high voltage direct current (HVDC) transmission has emerged as a possible solution. In this context, this paper includes a brief discussion on the fundamentals HVDC and its significance in Pakistani power sector. Furthermore, the potential of distributed energy resources for Pakistan is also the subject matter of this paper, so that significance of HVDC transmission can effectively be deliberated.

The prediction and prevention of voltage collapse in the Finnish power system

Energy Technology Data Exchange (ETDEWEB)

Bastman, J; Lakervi, E [Tampere Univ. of Tech. (Finland); Hirvonen, R; Kuronen, P; Hagman, E [IVO Group (Finland)

1994-12-31

The Finnish power system is a part of the Nordic power system (NORDEL), which includes Finland, Sweden, Norway and the eastern part of Denmark. In NORDEL the transmission distances are long, which implies that the power transmission capacities are determined by stability criteria . The methods to prevent and predict the voltage collapse during severe disturbances are studied using advances simulation program. Results are presented. (author) 10 figs., 1 tab.

DIII-D ICRF high voltage power supply regulator upgrade

International Nuclear Information System (INIS)

Cary, W.P.; Burley, B.L.; Grosnickle, W.H.

1997-11-01

For reliable operation and component protection, of the 2 MW 30--120 MHz ICRF Amplifier System on DIII-D, it is desirable for the amplifier to respond to high VSWR conditions as rapidly as possible. This requires a rapid change in power which also means a rapid change in the high voltage power supply current demands. An analysis of the power supply's regulator dynamics was needed to verify its expected operation during such conditions. Based on this information it was found that a new regulator with a larger dynamic range and some anticipation capability would be required. This paper will discuss the system requirements, the as-delivered regulator performance, and the improved performance after installation of the new regulator system. It will also be shown how this improvement has made the amplifier perform at higher power levels more reliably

Design of High-Voltage Switch-Mode Power Amplifier Based on Digital-Controlled Hybrid Multilevel Converter

Directory of Open Access Journals (Sweden)

Yanbin Hou

2016-01-01

Full Text Available Compared with conventional Class-A, Class-B, and Class-AB amplifiers, Class-D amplifier, also known as switching amplifier, employs pulse width modulation (PWM technology and solid-state switching devices, capable of achieving much higher efficiency. However, PWM-based switching amplifier is usually designed for low-voltage application, offering a maximum output voltage of several hundred Volts. Therefore, a step-up transformer is indispensably adopted in PWM-based Class-D amplifier to produce high-voltage output. In this paper, a switching amplifier without step-up transformer is developed based on digital pulse step modulation (PSM and hybrid multilevel converter. Under the control of input signal, cascaded power converters with separate DC sources operate in PSM switch mode to directly generate high-voltage and high-power output. The relevant topological structure, operating principle, and design scheme are introduced. Finally, a prototype system is built, which can provide power up to 1400 Watts and peak voltage up to ±1700 Volts. And the performance, including efficiency, linearity, and distortion, is evaluated by experimental tests.

Study on the characters of high voltage charging power supply system for diagnostics neutral beam on HT-7 Tokamak

International Nuclear Information System (INIS)

Zhang Jian; Huang Yiyun; Liu Baohua; Guo Wenjun; Shen Xiaoling; Wei Wei

2011-01-01

A high voltage power supply system has been developed for the diagnostic neutral beam on the HT-7 experimental Tokamak, and the over-voltage phenomenon of storage capacitor was founded in the experiment. In order to analyse and resolve this problem, the structure and principle of high voltage power supply is described and the primary high voltage charging power supply system is introduced in detail. The phenomenon of over-voltage on the capacitors is also studied with circuit model, and the conclusion is obtained that the leakage inductance is the mA in reason which causes the over-voltage on the capacitors. (authors)

HVDC transmission from nuclear power plant

International Nuclear Information System (INIS)

Yoshida, Yukio; Takenaka, Kiyoshi; Ichikawa, Takemi; Ueda, Kiyotaka; Machida, Takehiko

1979-01-01

The HVDC transmission directly from nuclear power plants is one of the patterns of long distance and large capacity HVDC transmission systems. In this report, the double pole, two-circuit HVDC transmission from a BWR nuclear power plant is considered, and the dynamic response characteristics due to the faults in dc line and ac line of inverter side are analyzed, to clarify the dynamic characteristics of the BWR nuclear power plant and dc system due to system faults and the effects of dc power control to prevent reactor scram. (1) In the instantaneous earthing fault of one dc line, the reactor is not scrammed by start-up within 0.8 sec. (2) When the earthing fault continues, power transmission drops to 75% by suspending the faulty pole, and the reactor is scrammed. (3) In the instantaneous ground fault of 2 dc lines, the reactor is not scrammed if the faulty dc lines are started up within 0.4 sec. (4) In the existing control of dc lines, the reactor is scrammed when the ac voltage at an ac-dc connection point largely drops due to ac failure. (J.P.N.)

A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes

International Nuclear Information System (INIS)

Pei, Chengquan; Tian, Jinshou; Liu, Zhen; Qin, Hong; Wu, Shengli

2017-01-01

A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.

A novel ZVS high voltage power supply for micro-channel plate photomultiplier tubes

Energy Technology Data Exchange (ETDEWEB)

Pei, Chengquan [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Tian, Jinshou [Xi’an Institute of Optics and Precision Mechanics, Chinese Academy of Sciences, Xi' an 710119 (China); Liu, Zhen [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China); Qin, Hong [School of Computer Science and Technology, Xi' an University of Science and Technology, Xi' an 710054 (China); Wu, Shengli, E-mail: slwu@mail.xjtu.edu.cn [Key Laboratory for Physical Electronics and Devices of the Ministry of Education, Xi' an Jiaotong University, Xi’an 710049 (China)

2017-04-11

A novel resonant high voltage power supply (HVPS) with zero voltage switching (ZVS), to reduce the voltage stress on switching devices and improve conversion efficiency, is proposed. The proposed HVPS includes a drive circuit, a transformer, several voltage multiplying circuits, and a regulator circuit. The HVPS contains several secondary windings that can be precisely regulated. The proposed HVPS performed better than the traditional resistor voltage divider, which requires replacing matching resistors resulting in resistor dispersibility in the Micro-Channel Plate (MCP). The equivalent circuit of the proposed HVPS was established and the operational principle analyzed. The entire switching element can achieve ZVS, which was validated by a simulation and experiments. The properties of this HVPS were tested including minimum power loss (240 mW), maximum power loss (1 W) and conversion efficiency (85%). The results of this research are that the proposed HVPS was suitable for driving the micro-channel plate photomultiplier tube (MCP-PMT). It was therefore adopted to test the MCP-PMT, which will be used in Daya Bay reactor neutrino experiment II in China.

Proposed high voltage power supply for the ITER relevant lower hybrid current drive system

International Nuclear Information System (INIS)

Sharma, P.K.; Kazarian, F.; Garibaldi, P.; Gassman, T.; Artaud, J.F.; Bae, Y.S.; Belo, J.; Berger-By, G.; Bernard, J.M.; Cara, Ph.; Cardinali, A.; Castaldo, C.; Ceccuzzi, S.; Cesario, R.; Decker, J.; Delpech, L.; Ekedahl, A.; Garcia, J.; Goniche, M.; Guilhem, D.

2011-01-01

In the framework of the EFDA task HCD-08-03-01, the ITER lower hybrid current drive (LHCD) system design has been reviewed. The system aims to generate 24 MW of RF power at 5 GHz, of which 20 MW would be coupled to the plasmas. The present state of the art does not allow envisaging a unitary output of the klystrons exceeding 500 kW, so the project is based on 48 klystron units, leaving some margin when the transmission lines losses are taken into account. A high voltage power supply (HVPS), required to operate the klystrons, is proposed. A single HVPS would be used to feed and operate four klystrons in parallel configuration. Based on the above considerations, it is proposed to design and develop twelve HVPS, based on pulse step modulator (PSM) technology, each rated for 90 kV/90 A. This paper describes in details, the typical electrical requirements and the conceptual design of the proposed HVPS for the ITER LHCD system.

Power Transmission from Large Offshore Wind Farms

DEFF Research Database (Denmark)

Pedersen, Jørgen Kaas

1999-01-01

The major part of the coming wind farms in Denmark will be placed offshore. If the location is near a grid with a high short circuit level the power can be transmitted as AC.If the wind farm is far away from the grid and the grid perhaps has a low short circuit level, the best solution...... for transmitting the power can be by DC. At the moment it is possible to build self-commutating DC/AC-inverters up to about 150 kV. This paper will show a concept to a solution for a wind farm and a transmission system based on synchronous generators or a powerformer® with a rated voltage of 50 kV. The AC power...... will be rectified and boosted to a fixed DC voltage (e.g. 100 kV). The speed of the generator will be variable, depending of the wind but also controlled with the duty-cycle of the booster. In that way all wind turbines can be connected to the same DC bus and the cable to the inverter station connected to the AC...

Nonlinear control of voltage source converters in AC-DC power system.

Science.gov (United States)

Dash, P K; Nayak, N

2014-07-01

This paper presents the design of a robust nonlinear controller for a parallel AC-DC power system using a Lyapunov function-based sliding mode control (LYPSMC) strategy. The inputs for the proposed control scheme are the DC voltage and reactive power errors at the converter station and the active and reactive power errors at the inverter station of the voltage-source converter-based high voltage direct current transmission (VSC-HVDC) link. The stability and robust tracking of the system parameters are ensured by applying the Lyapunov direct method. Also the gains of the sliding mode control (SMC) are made adaptive using the stability conditions of the Lyapunov function. The proposed control strategy offers invariant stability to a class of systems having modeling uncertainties due to parameter changes and exogenous inputs. Comprehensive computer simulations are carried out to verify the proposed control scheme under several system disturbances like changes in short-circuit ratio, converter parametric changes, and faults on the converter and inverter buses for single generating system connected to the power grid in a single machine infinite-bus AC-DC network and also for a 3-machine two-area power system. Furthermore, a second order super twisting sliding mode control scheme has been presented in this paper that provides a higher degree of nonlinearity than the LYPSMC and damps faster the converter and inverter voltage and power oscillations. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Optimal Design of a Resonance-Based Voltage Boosting Rectifier for Wireless Power Transmission.

Science.gov (United States)

Lim, Jaemyung; Lee, Byunghun; Ghovanloo, Maysam

2018-02-01

This paper presents the design procedure for a new multi-cycle resonance-based voltage boosting rectifier (MCRR) capable of delivering a desired amount of power to the load (PDL) at a designated high voltage (HV) through a loosely-coupled inductive link. This is achieved by shorting the receiver (Rx) LC-tank for several cycles to harvest and accumulate the wireless energy in the RX inductor before boosting the voltage by breaking the loop and transferring the energy to the load in a quarter cycle. By optimizing the geometries of the transmitter (Tx) and Rx coils and the number of cycles, N , for energy harvesting, through an iterative design procedure, the MCRR can achieve the highest PDL under a given set of design constraints. Governing equations in the MCRR operation are derived to identify key specifications and the design guidelines. Using an exemplary set of specs, the optimized MCRR was able to generate 20.9 V DC across a 100 kΩ load from a 1.8 V p , 6.78 MHz sinusoid input in the ISM-band at a Tx/Rx coil separation of 1.3 cm, power transfer efficiency (PTE) of 2.2%, and N = 9 cycles. At the same coil distance and loading, coils optimized for a conventional half-wave rectifier (CHWR) were able to reach only 13.6 V DC from the same source.

Charging system of ECRH high-voltage power supply and its control system

International Nuclear Information System (INIS)

Hu Guofu; Ding Tonghai; Liu Baohua; Jiang Shufang

2003-01-01

High-voltage power supply (HVPS) of Electron Cyclotron Resonance Heating (ECRH) for HT-7 and HT-7U is presently being constructed. The high voltage (100 kV) energy of HVPS is stored in the capacitor banks, and they can power one or two gyrotrons. All the operation of the charging system will be done by the control system, where the field signals are interfaced to programmable logic controller (PLC). The use of PLC not only simplifies the control system, but also enhances the reliability. The software written by using configuration software installed in the master computer allows for remote and multiple operator control, and the status and data information is also remotely available

Construction of control and instrumentation devices of high voltage power supply of double chamber plasma nitrogen

International Nuclear Information System (INIS)

Saminto; Eko Priyono; Sugeng Riyanto

2013-01-01

A control and instrumentation devices of high voltage power supply of double chamber plasma nitrogen have been made. This device consists of the software and hardware component. Hardware component consists of SCR phase angle controller LPC-50HDA type, T100MD1616+ PLC, high voltage transformer and voltage rectifier system. Software component used a LADDER program and TBasic serves to control of the high voltage output. The components in these devices have been tested in the double chamber plasma nitrogen. Its performance meet with the design criteria that can supply of plasma nitrogen operation voltage in the range 290 Vdc to 851 Vdc with glow discharge current 0.4 A to 1.4 A. In general it can be said that the control and instrumentation devices of high voltage power supply is ready for use at the double chamber plasma nitrogen device. (author)

The development of long pulse high voltage power supply for MNI-1U neutral beam injector

International Nuclear Information System (INIS)

Detai Wang

1989-01-01

A high power long pulse high voltage power supply (HVPS) for MNI- 1 U neutral beam injector (NBI) is described. This HVPS is used as a switching regulator with a duty cycle of 1/100, the specifications of circuit are as follows, output pulse voltage 50kv, pulse current 30A, pulse width 50ms, rise-time and fall-time of the voltage are less than 25 μs, stability of the pulse flat is better than 0.5%, regulation response time of the pulse voltage less than 30 μs can be attained. It is also used as a stable DC HVPS, output voltage is 1 to 100kv, current is 1 to 5A. If regulation tube is shunted with high power resistor in parallel, the current can be extended to 10 A, stability of the output voltage or current is better than 0.1%. Now, the HVPS has been put into operation for MNI- 1 U NBI and PIG ion source made in French. 3 refs., 5 figs

Site Selection Strategy of Single-Frequency Tuned R-APF for Background Harmonic Voltage Damping in Power Systems

DEFF Research Database (Denmark)

Sun, Xiaofeng; Zeng, Jian; Chen, Zhe

2013-01-01

, and analyze the harmonic voltage propagation caused by the background harmonic voltage in power systems. Then, a new strategy is proposed for the site selection of resistive active power filter to damp the background harmonic voltage in power systems. Experiments have been performed to verify the theoretical......Series resonance between capacitance and line inductance may magnify background harmonic voltage and worsen the harmonic voltage distortion in power systems. To solve this problem, in this paper, the transmission line theory is used to set up the distributed parameter model of power system feeders...

Solar photovoltaic charging of high voltage nickel metal hydride batteries using DC power conversion

Science.gov (United States)

Kelly, Nelson A.; Gibson, Thomas L.

There are an increasing number of vehicle choices available that utilize batteries and electric motors to reduce tailpipe emissions and increase fuel economy. The eventual production of electricity and hydrogen in a renewable fashion, such as using solar energy, can achieve the long-term vision of having no tailpipe environmental impact, as well as eliminating the dependence of the transportation sector on dwindling supplies of petroleum for its energy. In this report we will demonstrate the solar-powered charging of the high-voltage nickel-metal hydride (NiMH) battery used in the GM 2-mode hybrid system. In previous studies we have used low-voltage solar modules to produce hydrogen via the electrolysis of water and to directly charge lithium-ion battery modules. Our strategy in the present work was to boost low-voltage PV voltage to over 300 V using DC-DC converters in order to charge the high-voltage NiMH battery, and to regulate the battery charging using software to program the electronic control unit supplied with the battery pack. A protocol for high-voltage battery charging was developed, and the solar to battery charging efficiency was measured under a variety of conditions. We believe this is the first time such high-voltage batteries have been charged using solar energy in order to prove the concept of efficient, solar-powered charging for battery-electric vehicles.

Characterization of a pulsed mode high voltage power supply for nuclear detectors

International Nuclear Information System (INIS)

Ghazali, A B; Ahmad, T S; Abdullah, N A

2013-01-01

This paper discusses the characterization of a pulsed mode high voltage power supply (HVPS) using LT1073 chip. The pulsed modulated signal generated from this chip is amplified using a step-up ferrite core transformer of 1:20 turn ratio and then further multiplied and converted into DC high voltage output using a diode-capacitor arrangement. The circuit is powered by a 9V alkaline battery but regulated at 5V supply. It was found that the output for this setup is 520V, 87 μA with 10% load regulation. This output is suitable to operate a pancake-type GM detector, typically model LND 7317 where the plateau is from 475V to 675V. It was also found that when a β-source with intensity of 120 cps is used, the power consumption of the circuit is 5 V, 10.1 mA only. When the battery was left 'on' for 40 hours continuously, the battery's voltage has dropped to 6.9V, meaning that the 5V supply as well as 520V output is still maintained. It is noted that the minimum output voltage of 475V has reached when the regulated supply has reduced to 4.6V and consequently the 9V battery dropped to 6.5V, and this had happened after approximately 3 days of continuous operation. The power efficiency for this circuitry was found to be 89.5%. This result has far better in performance since the commercial portable equipment of this type has normally specified that not less than 8 hours continuous operation only. On the circuit design for this power supply, it was found that the enveloped frequency is 133 Hz with approximately 50% duty cycle. The modulated frequency during 'on' state was found to be 256 KHz in which the majority of power consumption is required.

Manitoba Hydro long-term high-voltage transmission line magnetic field monitoring project

International Nuclear Information System (INIS)

Wong, P.S.; Ng, C.K.

2008-01-01

As part of the licensing process to construct a new 230 kV transmission line on an existing right-of-way in Manitoba, an electrical effects study was conducted in 1998. The study was part of the environmental assessment program crucial in obtaining government approval to construct the line. Some residents living adjacent to the new transmission circuit expressed concerns about alleged adverse health effects associated with long-term exposure to magnetic fields from high voltage transmission lines. In order to verify the accuracy of the predicted magnetic field levels submitted to the regulatory body in the the electrical effects study and to instill confidence in the residents of the affected communities, a three-year magnetic monitoring project was conducted between 2003 and 2005 along the right-of-way after the new 230kV transmission line was energized by Manitoba Hydro. This paper described the monitoring program, with reference to location; equipment; data analysis; and discussion of results. It was concluded that the long-term monitoring project demonstrated that the magnetic field prediction methodology was well understood and accurate, and provided valuable long-term magnetic field characteristics at the edge of the right-of-way. In addition, when there is opposition to a transmission line, public consultation and education were found to be the best options to arrive at a solution. 3 refs., 1 tab., 12 figs

High Voltage Distribution System (HVDS) as a better system compared to Low Voltage Distribution System (LVDS) applied at Medan city power network

Science.gov (United States)

Dinzi, R.; Hamonangan, TS; Fahmi, F.

2018-02-01

In the current distribution system, a large-capacity distribution transformer supplies loads to remote locations. The use of 220/380 V network is nowadays less common compared to 20 kV network. This results in losses due to the non-optimal distribution transformer, which neglected the load location, poor consumer profile, and large power losses along the carrier. This paper discusses how high voltage distribution systems (HVDS) can be a better system used in distribution networks than the currently used distribution system (Low Voltage Distribution System, LVDS). The proposed change of the system into the new configuration is done by replacing a large-capacity distribution transformer with some smaller-capacity distribution transformers and installed them in positions that closest to the load. The use of high voltage distribution systems will result in better voltage profiles and fewer power losses. From the non-technical side, the annual savings and payback periods on high voltage distribution systems will also be the advantage.

New trends in the development of high voltage technology

Energy Technology Data Exchange (ETDEWEB)

Aleksandrov, G N

1964-07-01

The question is raised as to what type of transmission should be developed to transfer power over long distances from the eastern to the western part of Russia, and what principles should be utilized to combine power transmission into single power system in the USSR. Aleksandrov indicates the need for higher voltage power transmission, and stresses that ac is more economical than dc. The author compares +-750 kV dc with 1000 kV ac. The economic comparison is conducted for the same level of insulation, and it is stated that it will result in the same amount of power transmitted. New insulation materials are mentioned, and wider use of fiberglass and other plastics is predicted.

Environmental impact of the aerial power transmission lines

International Nuclear Information System (INIS)

Cristescu, D.; Rusan, R.

1993-01-01

In the last 10-12 years the existence of the high voltage lines existence within populated areas has been more and more contested. The paper tries to complete a blank in the Romanian technical literature by introducing the concept of 'line corridor' which is different from the occupied geometric area and from 'the line disturbed corridor'. The concept is meant to specify the area where the high frequency and 50 Hz electromagnetic pollution exceeds some given limits. The impact of the power transmission lines on the human body, due to the effects of the electric and magnetic fields, is considered. Also, the aspects concerning the visual impact, the acoustic and radio noise and the area expensing by the high voltage lines, are considered. International standards and regulations regarding the limitations of this effects are presented. (author)

Technological Aspects: High Voltage

CERN Document Server

Faircloth, D.C.

2013-12-16

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

SYNTHESIS OF ACTIVE SCREENING SYSTEM OF MAGNETIC FIELD OF HIGH VOLTAGE POWER LINES OF DIFFERENT DESIGN TAKING INTO ACCOUNT SPATIAL AND TEMPORAL DISTRIBUTION OF MAGNETIC FIELD

Directory of Open Access Journals (Sweden)

B.I. Kuznetsov

2017-04-01

Full Text Available Purpose. Analyze the spatial and temporal distribution of the magnetic field of high voltage power lines with different design allowing and development of recommendations for the design of active screening systems by magnetic field of high voltage power lines. Methodology. Analysis of the spatial and temporal distribution of the magnetic field of high voltage power lines of different design allowing is made on the basis of Maxwell's equations solutions in the quasi-stationary approximation. Determination of the number, configuration, spatial arrangement and the compensation coil currents is formulated in the form of multiobjective optimization problem that is solved by multi-agent multiswarm stochastic optimization based on Pareto optimal solutions. Results of active screening system for the synthesis of various types of transmission lines with different numbers of windings controlled. The possibility of a significant reduction in the level of the flux density of the magnetic field source within a given region of space. Originality. For the first time an analysis of the spatial and temporal distribution of the magnetic field of power lines with different types and based on findings developed recommendations for the design of active screening system by magnetic field of high voltage power lines. Practical value. Practical recommendations on reasonable choice of the number and spatial arrangement of compensating windings of active screening system by magnetic field of high voltage power lines of different design allowing for the spatial and temporal distribution of the magnetic field. Results of active screening system synthesis of the magnetic field of industrial frequency generated by single-circuit 110 kV high voltage power lines with the supports have 330 - 1T «triangle» rotating magnetic field with full polarization in a residential five-storey building, located near the power lines. The system contains three compensating coil and reduces

Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

DEFF Research Database (Denmark)

Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

2016-01-01

: off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

Hard- and software of real time simulation tools of Electric Power System for adequate modeling power semiconductors in voltage source convertor based HVDC and FACTS

Directory of Open Access Journals (Sweden)

Ufa Ruslan A.

2014-01-01

Full Text Available The motivation of the presented research is based on the needs for development of new methods and tools for adequate simulation of Flexible Alternating Current Transmission System (FACTS devices and High Voltage Direct Current Transmission (HVDC system as part of real electric power systems (EPS. For that, a hybrid approach for advanced simulation of the FACTS and HVDC based on Voltage Source is proposed. The presented simulation results of the developed hybrid model of VSC confirm the achievement of the desired properties of the model and the effectiveness of the proposed solutions.

Development of a coordinated control system for BWR nuclear power plant and HVDC transmission system

International Nuclear Information System (INIS)

Ishikawa, M.; Hara, T.; Hirayama, K.; Sekiya, K.

1986-01-01

The combined use of dc and ac transmissions or so-called hybrid transmission was under study, employing both dc and ac systems to enable stable transmission of 10,000 MW of electric power generated by the BWR nuclear plant, scheduled to be built about 800 km away from the center of the load. It was thus necessary to develop a hybrid power transmission control system, the hybrid power transmission system consisting of a high voltage dc transmission system (HVDC) and an ultrahigh ac transmission system (UHVAC). It was also necessary to develop a control system for HVDC transmission which protects the BWR nuclear power plant from being influenced by any change in transmission mode that occurs as a result of faults on the UHVAC side when the entire power of the BWR plant is being sent by the HVDC transmission. This paper clarifies the requirements for the HVDC system control during hybrid transmission and also during dc transmission. The control method that satisfies these requirements was studied to develop a control algorithm

Investigating Enhancement Mode Gallium Nitride Power FETs in High Voltage, High Frequency Soft Switching Converters

DEFF Research Database (Denmark)

Nour, Yasser; Knott, Arnold; Jørgensen, Ivan Harald Holger

2016-01-01

An increased attention has been detected to develop smaller and lighter high voltage power converters in the range of 50V to 400V domain. The main applications for these converters are mainly focused for Power over Ethernet (PoE), LED lighting and AC adapters. This work will discuss a study...

Layout Capacitive Coupling and Structure Impacts on Integrated High Voltage Power MOSFETs

DEFF Research Database (Denmark)

Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

2016-01-01

The switching performances of the integrated high voltage power MOSFETs that have prevailing interconnection matrices are being heavily influenced by the parasitic capacitive coupling of on-chip metal wires. The mechanism of the side-byside coupling is generally known, however, the layer-to-layer......The switching performances of the integrated high voltage power MOSFETs that have prevailing interconnection matrices are being heavily influenced by the parasitic capacitive coupling of on-chip metal wires. The mechanism of the side-byside coupling is generally known, however, the layer...... extraction tool shows that the side-by-side coupling dominated structure can perform better than the layer-to-layer coupling dominated structure, in terms of on-resistance times input or output capacitance, by 9.2% and 4.9%, respectively....

High-voltage engineering and testing

CERN Document Server

Ryan, Hugh M

2013-01-01

This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

Single-point reactive power control method on voltage rise mitigation in residential networks with high PV penetration

DEFF Research Database (Denmark)

Hasheminamin, Maryam; Agelidis, Vassilios; Ahmadi, Abdollah

2018-01-01

Voltage rise (VR) due to reverse power flow is an important obstacle for high integration of Photovoltaic (PV) into residential networks. This paper introduces and elaborates a novel methodology of an index-based single-point-reactive power-control (SPRPC) methodology to mitigate voltage rise by ...... system with high r/x ratio. Efficacy, effectiveness and cost study of SPRPC is compared to droop control to evaluate its advantages.......Voltage rise (VR) due to reverse power flow is an important obstacle for high integration of Photovoltaic (PV) into residential networks. This paper introduces and elaborates a novel methodology of an index-based single-point-reactive power-control (SPRPC) methodology to mitigate voltage rise...... by absorbing adequate reactive power from one selected point. The proposed index utilizes short circuit analysis to select the best point to apply this Volt/Var control method. SPRPC is supported technically and financially by distribution network operator that makes it cost effective, simple and efficient...

Technological Aspects: High Voltage

International Nuclear Information System (INIS)

Faircloth, D C

2013-01-01

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

Termination for a superconducting power transmission line including a horizontal cryogenic bushing

Science.gov (United States)

Minati, Kurt F.; Morgan, Gerry H.; McNerney, Andrew J.; Schauer, Felix

1984-01-01

A termination for a superconducting power transmission line is disclosed which is comprised of a standard air entrance insulated vertical bushing with an elbow, a horizontal cryogenic bushing linking the pressurized cryogenic cable environment to the ambient temperature bushing and a stress cone which terminates the cable outer shield and transforms the large radial voltage gradient in the cable dielectric into a much lower radial voltage gradient in the high density helium coolant at the cold end of the cryogenic bushing.

High-voltage power supply - 2.500 V - 4mA

International Nuclear Information System (INIS)

Souza, H.H. de.

1977-01-01

A high-voltage power supply, in a NIM two-width module, was developed to be used in nuclear measurements systems. The design utilizes the principle of DC-DC conversion. A general description of the instrument and of its circuity is presented, as well as a report of the results obtained from the tests performed to establish its characteristics [pt

High-Efficiency Isolated Boost DCDC Converter for High-Power Low-Voltage Fuel-Cell Applications

DEFF Research Database (Denmark)

Nymand, Morten; Andersen, Michael A. E.

2010-01-01

high winding losses. The analysis of transformer leakage inductance reveals that extremely low leakage inductance can be achieved, allowing stored energy to be dissipated. Power MOSFETs fully rated for repetitive avalanches allow primary-side voltage clamp circuits to be eliminated. The oversizing...

Manufacturing Technology for High Voltage Power Supplies (HVPS). Volume III - Procedural Details

National Research Council Canada - National Science Library

1996-01-01

.... The thrust of this program was to improve the reliability of High Voltage Power Supplies (HVPS). This was accomplished conducting a comprehensive evaluation of the materials, components and processes used to produce HVPS...

High-voltage direct-current circuit breakers

International Nuclear Information System (INIS)

Yoshioka, Y.; Hirasawa, K.

1991-01-01

This paper reports that in 1954 the first high-voltage direct-current (HVDC) transmission system was put into operation between Gotland and the mainland of Sweden. Its system voltage and capacity were 100 kV and 20 MW, respectively. Since then many HVDC transmission systems have been planned, constructed, or commissioned in more than 30 places worldwide, and their total capacity is close to 40 GW. Most systems commissioned to date are two-terminal schemes, and HVDC breakers are not yet used in the high-potential main circuit of those systems, because the system is expected to perform well using only converter/inverter control even at a fault stage of the transmission line. However, even in a two-terminal scheme there are not a few merits in using an HVDC breaker when the system has two parallel transmission lines, that is, when it is a double-circuit system

Integrated Three-Voltage-Booster DC-DC Converter to Achieve High Voltage Gain with Leakage-Energy Recycling for PV or Fuel-Cell Power Systems

Directory of Open Access Journals (Sweden)

Chih-Lung Shen

2015-09-01

Full Text Available In this paper, an integrated three-voltage-booster DC-DC (direct current to direct current converter is proposed to achieve high voltage gain for renewable-energy generation systems. The proposed converter integrates three voltage-boosters into one power stage, which is composed of an active switch, a coupled-inductor, five diodes, and five capacitors. As compared with conventional high step-up converters, it has a lower component count. In addition, the features of leakage-energy recycling and switching loss reduction can be accomplished for conversion efficiency improvement. While the active switch is turned off, the converter can inherently clamp the voltage across power switch and suppress voltage spikes. Moreover, the reverse-recovery currents of all diodes can be alleviated by leakage inductance. A 200 W prototype operating at 100 kHz switching frequency with 36 V input and 400 V output is implemented to verify the theoretical analysis and to demonstrate the feasibility of the proposed high step-up DC-DC converter.

High-voltage, high-current, solid-state closing switch

Science.gov (United States)

Focia, Ronald Jeffrey

2017-08-22

A high-voltage, high-current, solid-state closing switch uses a field-effect transistor (e.g., a MOSFET) to trigger a high-voltage stack of thyristors. The switch can have a high hold-off voltage, high current carrying capacity, and high time-rate-of-change of current, di/dt. The fast closing switch can be used in pulsed power applications.

Modular VSC converter based HVDC power transmission from offshore wind power plant: Compared to the conventional HVAC system

DEFF Research Database (Denmark)

Sharma, Ranjan; Rasmussen, Tonny Wederberg; Jensen, Kim Høj

2010-01-01

power transmission options with HVDC systems are under consideration. In this paper, a comparison between a conventional HVAC transmission system and a HVDC system equipped with modular voltage source converters is provided. The comparison is based on the total energy transmission capability...

High voltage dc-dc converter with dynamic voltage regulation and decoupling during load-generated arcs

Science.gov (United States)

Shimer, Daniel W.; Lange, Arnold C.

1995-01-01

A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules.

High voltage dc--dc converter with dynamic voltage regulation and decoupling during load-generated arcs

Science.gov (United States)

Shimer, D.W.; Lange, A.C.

1995-05-23

A high-power power supply produces a controllable, constant high voltage output under varying and arcing loads. The power supply includes a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, an output rectifier for producing a dc voltage at the output of each module, and a current sensor for sensing output current. The power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle and circuitry is provided for sensing incipient arc currents at the output of the power supply to simultaneously decouple the power supply circuitry from the arcing load. The power supply includes a plurality of discrete switching type dc--dc converter modules. 5 Figs.

DC-link voltage oscillations reduction during unbalanced grid faults for high power wind turbines

DEFF Research Database (Denmark)

Delpino, Hernan Anres Miranda; Teodorescu, Remus; Rodriguez, Pedro

2011-01-01

During unbalanced grid voltage faults the Power injected to the grid experiences 100Hz oscillations as a result of interactions between positive and negative sequence components of three-phase voltages and currents. These oscillations can become as high as %50 percent of the rated power....... In this article an improved controller is proposed which present different behavior during normal operation and faults to keep track of non-sinusoidal current reference signals. The reference signals are calculated to obtain zero power oscillations. Reconfigurable resonant controllers are used for this purpose...

A new VME based high voltage power supply for large experiments

Energy Technology Data Exchange (ETDEWEB)

Ahn, S.C.; Angstadt, R.D.; Droege, T.F.; Johnson, M.E.; MacKinnon, B.A.; McNulty, S.E.; Shea, M.F.; Thompson, R.N.; Watson, M.M. (Fermi National Accelerator Lab., Batavia, IL (United States)); Franzini, P. (Columbia Univ., New York, NY (United States)); Jones, A.A. (Superconducting Super Collider Lab., Dallas, TX (United States)); Lopez, M.L. (La Plata Univ. Nacional (Argentina)); Wimpenny, S.J.; Yang, M.J

1991-11-01

A new VME based high voltage power supply has been developed for the D{O} experiment at Fermilab. There are three types of supplies delivering up to {plus minus}5.6 kV at 1.0 mA or +2.0 kV at 3.0 mA with a set accuracy of 1.5 V and extremely low voltage ripples. Complete computer control has allowed many special features to be developed for the supply, including user-defined control land monitor groups, variable ramp rates, and advanced histogram and graphic functions. 3 refs.

A new VME based high voltage power supply for large experiments

International Nuclear Information System (INIS)

Ahn, S.C.; Angstadt, R.D.; Droege, T.F.; Johnson, M.E.; MacKinnon, B.A.; McNulty, S.E.; Shea, M.F.; Thompson, R.N.; Watson, M.M.; Franzini, P.; Jones, A.A.; Lopez, M.L.; Wimpenny, S.J.; Yang, M.J.

1991-11-01

A new VME based high voltage power supply has been developed for the D OE experiment at Fermilab. There are three types of supplies delivering up to ±5.6 kV at 1.0 mA or +2.0 kV at 3.0 mA with a set accuracy of 1.5 V and extremely low voltage ripples. Complete computer control has allowed many special features to be developed for the supply, including user-defined control land monitor groups, variable ramp rates, and advanced histogram and graphic functions. 3 refs

PV Power-Generation System with a Phase-Shift PWM Technique for High Step-Up Voltage Applications

Directory of Open Access Journals (Sweden)

Cheng-Tao Tsai

2012-01-01

Full Text Available A PV power-generation system with a phase-shift pulse-width modulation (PWM technique for high step-up voltage applications is proposed. The proposed power-generation system consists of two stages. In the input stage, all power switches of the full-bridge converter with phase-shift technique can be operated with zero-current switching (ZCS at turn-on or turn-off transition. Hence, the switching losses of the power switches can be reduced. Then, in the DC output stage, a voltage-doubler circuit is used to boost a high dc-link bus voltage. To supply a utility power, a dc/ac inverter is connected to induce a sinusoidal source. In order to draw a maximum power from PV arrays source, a microcontroller is incorporated with the perturbation and observation method to implement maximum power point tracking (MPPT algorithm and power regulating scheme. In this study, a full load power of 300 W prototype has been built. Experimental results are presented to verify the performance and feasibility of the proposed PV power-generation system.

Design and power management of an offshore medium voltage DC microgrid realized through high voltage power electronics technologies and control

Science.gov (United States)

Grainger, Brandon Michael

The growth in the electric power industry's portfolio of Direct Current (DC) based generation and loads have captured the attention of many leading research institutions. Opportunities for using DC based systems have been explored in electric ship design and have been a proven, reliable solution for transmitting bulk power onshore and offshore. To integrate many of the renewable resources into our existing AC grid, a number of power conversions through power electronics are required to condition the equipment for direct connection. Within the power conversion stages, there is always a requirement to convert to or from DC. The AC microgrid is a conceptual solution proposed for integrating various types of renewable generation resources. The fundamental microgrid requirements include the capability of operating in islanding mode and/or grid connected modes. The technical challenges associated with microgrids include (1) operation modes and transitions that comply with IEEE1547 without extensive custom engineering and (2) control architecture and communication. The Medium Voltage DC (MVDC) architecture, explored by the University of Pittsburgh, can be visualized as a special type of DC microgrid. This dissertation is multi-faceted, focused on many design aspects of an offshore DC microgrid. The focal points of the discussion are focused on optimized high power, high frequency magnetic material performance in electric machines, transformers, and DC/DC power converters---all components found within offshore, power system architectures. A new controller design based upon model reference control is proposed and shown to stabilize the electric motor drives (modeled as constant power loads), which serve as the largest power consuming entities in the microgrid. The design and simulation of a state-of-the-art multilevel converter for High Voltage DC (HVDC) is discussed and a component sensitivity analysis on fault current peaks is explored. A power management routine is

A High Power Linear Solid State Pulser

International Nuclear Information System (INIS)

Boris Yen; Brent Davis; Rex Booth

1999-01-01

Particle Accelerators require high voltage and often high power. Typically the high voltage/power generation utilizes a topology with an extra energy store and a switching means to extract that stored energy. The switches may be active or passive devices. Active switches are hard or soft vacuum tubes, or semiconductors. When required voltages exceed tens of kilovolts, numerous semiconductors are stacked to withstand that potential. Such topologies can use large numbers of critical parts that, when in series, compromise the system reliability and performance. This paper describes a modular, linear, solid state amplifier which uses a parallel array of semiconductors, coupled with transmission line transformers. Such a design can provide output signals with voltages exceeding 10kV (into 50-ohms), and with rise and fall times (10-90 % amplitude) that are less than 1--ns. This compact solid state amplifier is modular, and has both hot-swap and soft fail capabilities

Power system voltage stability and agent based distribution automation in smart grid

Science.gov (United States)

Nguyen, Cuong Phuc

2011-12-01

Our interconnected electric power system is presently facing many challenges that it was not originally designed and engineered to handle. The increased inter-area power transfers, aging infrastructure, and old technologies, have caused many problems including voltage instability, widespread blackouts, slow control response, among others. These problems have created an urgent need to transform the present electric power system to a highly stable, reliable, efficient, and self-healing electric power system of the future, which has been termed "smart grid". This dissertation begins with an investigation of voltage stability in bulk transmission networks. A new continuation power flow tool for studying the impacts of generator merit order based dispatch on inter-area transfer capability and static voltage stability is presented. The load demands are represented by lumped load models on the transmission system. While this representation is acceptable in traditional power system analysis, it may not be valid in the future smart grid where the distribution system will be integrated with intelligent and quick control capabilities to mitigate voltage problems before they propagate into the entire system. Therefore, before analyzing the operation of the whole smart grid, it is important to understand the distribution system first. The second part of this dissertation presents a new platform for studying and testing emerging technologies in advanced Distribution Automation (DA) within smart grids. Due to the key benefits over the traditional centralized approach, namely flexible deployment, scalability, and avoidance of single-point-of-failure, a new distributed approach is employed to design and develop all elements of the platform. A multi-agent system (MAS), which has the three key characteristics of autonomy, local view, and decentralization, is selected to implement the advanced DA functions. The intelligent agents utilize a communication network for cooperation and

Transmission Technologies and Operational Characteristic Analysis of Hybrid UHV AC/DC Power Grids in China

Science.gov (United States)

Tian, Zhang; Yanfeng, Gong

2017-05-01

In order to solve the contradiction between demand and distribution range of primary energy resource, Ultra High Voltage (UHV) power grids should be developed rapidly to meet development of energy bases and accessing of large-scale renewable energy. This paper reviewed the latest research processes of AC/DC transmission technologies, summarized the characteristics of AC/DC power grids, concluded that China’s power grids certainly enter a new period of large -scale hybrid UHV AC/DC power grids and characteristics of “strong DC and weak AC” becomes increasingly pro minent; possible problems in operation of AC/DC power grids was discussed, and interaction or effect between AC/DC power grids was made an intensive study of; according to above problems in operation of power grids, preliminary scheme is summarized as fo llows: strengthening backbone structures, enhancing AC/DC transmission technologies, promoting protection measures of clean energ y accessing grids, and taking actions to solve stability problems of voltage and frequency etc. It’s valuable for making hybrid UHV AC/DC power grids adapt to operating mode of large power grids, thus guaranteeing security and stability of power system.

Stochastic reactive power market with volatility of wind power considering voltage security

International Nuclear Information System (INIS)

Kargarian, A.; Raoofat, M.

2011-01-01

While wind power generation is growing rapidly around the globe; its stochastic nature affects the system operation in many different aspects. In this paper, the impact of wind power volatility on the reactive power market is taken into account. The paper presents a novel stochastic method for optimal reactive power market clearing considering voltage security and volatile nature of the wind. The proposed optimization algorithm uses a multiobjective nonlinear programming technique to minimize market payment and simultaneously maximize voltage security margin. Considering a set of probable wind speeds, in the first stage, the proposed algorithm seeks to minimize expected system payment which is summation of reactive power payment and transmission loss cost. The object of the second stage is maximization of expected voltage security margin to increase the system loadability and security. Finally, in the last stage, a multiobjective function is presented to schedule the stochastic reactive power market using results of two previous stages. The proposed algorithm is applied to IEEE 14-bus test system. As a benchmark, Monte Carlo Simulation method is utilized to simulate the actual market of given period of time to evaluate results of the proposed algorithm, and satisfactory results are achieved. -- Highlights: →The paper proposes a new algorithm for stochastic reactive power market clearing. →The stochastic nature of the wind which impacts the system operation and market clearing process, is taken into account. →The paper suggests an expected voltage stability margin and optimizes it in conjunction with expected total market payment. →To clear the market with two mentioned objective functions, a three-stage multiobjective nonlinear programming is implemented. →Also, a simple method is suggested to determine a suitable priority coefficient between two individual objective functions.

A robust low quiescent current power receiver for inductive power transmission in bio implants

Science.gov (United States)

Helalian, Hamid; Pasandi, Ghasem; Jafarabadi Ashtiani, Shahin

2017-05-01

In this paper, a robust low quiescent current complementary metal-oxide semiconductor (CMOS) power receiver for wireless power transmission is presented. This power receiver consists of three main parts including rectifier, switch capacitor DC-DC converter and low-dropout regulator (LDO) without output capacitor. The switch capacitor DC-DC converter has variable conversion ratios and synchronous controller that lets the DC-DC converter to switch among five different conversion ratios to prevent output voltage drop and LDO regulator efficiency reduction. For all ranges of output current (0-10 mA), the voltage regulator is compensated and is stable. Voltage regulator stabilisation does not need the off-chip capacitor. In addition, a novel adaptive biasing frequency compensation method for low dropout voltage regulator is proposed in this paper. This method provides essential minimum current for compensation and reduces the quiescent current more effectively. The power receiver was designed in a 180-nm industrial CMOS technology, and the voltage range of the input is from 0.8 to 2 V, while the voltage range of the output is from 1.2 to 1.75 V, with a maximum load current of 10 mA, the unregulated efficiency of 79.2%, and the regulated efficiency of 64.4%.

Dual voltage power supply with 48 volt

Energy Technology Data Exchange (ETDEWEB)

Froeschl, Joachim; Proebstle, Hartmut; Sirch, Ottmar [BMW Group, Muenchen (Germany)

2012-11-01

Automotive electrics/electronics have just reached a period of tremendous change. High voltage systems for Hybrid, Plug-In Hybrid or Battery Electric Vehicles with high power electric motors, high energy accumulators and electric climate compressors will be introduced in order to achieve the challenging targets for CO{sub 2} emissions and energy efficiency and to anticipate the mobility of the future. Additionally, innovations and the continuous increase of functionality for comfort, safety, driver assistance and infotainment systems require more and more electrical power of the vehicle power supply at all. On the one hand side electrified vehicles will certainly achieve a significant market share, on the other hand side they will increase the pressure to conventional vehicles with combustion engines for fuel consumption and CO{sub 2} emissions. These vehicles will be enabled to keep their competitiveness by new functions and the optimization of their electric systems. A dual voltage power supply with 48 Volt and 12 Volt will be one of the key technologies to realize these requirements. The power capability of the existing 12 Volt power supply has reached its limits. Further potentials can only be admitted by the introduction of 48 Volt. For this reason the car manufacturers Audi, BMW, Daimler, Porsche and Volkswagen started very early on this item and developed a common specification of the new voltage range. Now, it is necessary to identify the probable systems at this voltage range and to start the developments. (orig.)

Performance of Doubly-Fed Wind Power Generators During Voltage Dips

DEFF Research Database (Denmark)

Aparicio, N.; Chen, Zhe; Beltran, H.

The growing of wind generation in Spain has forced its Transmission System Operator (TSO) to release new requirements that establish the amount of reactive power that a wind turbine has to supply to the grid during a voltage dip. Wind turbines equipped with doubly-fed induction generators (DFIG......) can regulate easily the reactive power generated in steady state. However, difficulties appear when reactive power has to be generated during voltage dips. Simulations have been carried out in order to check whether DFIG wind turbines can fulfill the reactive power requirements. Protection system...... commonly employed with DFIG in order to achieve ride-through capabilities including crowbar plays an important role to meet the requirements together with grid-side converter. Resistance associated with the crowbar and its connection duration are crucial at the beginning of the fault. Grid-side converter...

A high voltage DC switching power supply of corona discharge for ozone tube

International Nuclear Information System (INIS)

Ketkaew, Siseerot

2007-08-01

Full text: This paper presents a study of design and construction of a high voltage DC switching power supply for corona generating of ozone gas generating. This supply uses fly back converter at 3 k Vdc 30 khz and controls its operation using PWM techniques. I C TL494 is controlled of the switching. The testing of supply by putting high voltage to ozone gas tube at one-hour, the oxygen quantity 21 % of air, which ozone tube model enables ozone gas generating capacity of 95.2 mgO3/hr

Development of Live-working Robot for Power Transmission Lines

Science.gov (United States)

Yan, Yu; Liu, Xiaqing; Ren, Chengxian; Li, Jinliang; Li, Hui

2017-07-01

Dream-I, the first reconfigurable live-working robot for power transmission lines successfully developed in China, has the functions of autonomous walking on lines and accurately positioning. This paper firstly described operation task and object of the robot; then designed a general platform, an insulator replacement end and a drainage plate bolt fastening end of the robot, presented a control system of the robot, and performed simulation analysis on operation plan of the robot; and finally completed electrical field withstand voltage tests in a high voltage hall as well as online test and trial on actual lines. Experimental results show that by replacing ends of manipulators, the robot can fulfill operation tasks of live replacement of suspension insulators and live drainage plate bolt fastening.

A high-voltage equipment (high voltage supply, high voltage pulse generators, resonant charging inductance, synchro-instruments for gyrotron frequency measurements) for plasma applications

International Nuclear Information System (INIS)

Spassov, Velin

1996-01-01

This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)

Distance protection of multiple-circuit shared tower transmission lines with different voltages

DEFF Research Database (Denmark)

Silva, Filipe Miguel Faria da; Bak, Claus Leth

2017-01-01

combined faults, being advised to increase the resistive limit of the protection zone, if the network has lower short-circuit power. It is recommended to assure that the fault can only happen for cases where the faulted phase from the higher voltage level leads the faulted phase from the lower voltage......Multiple-circuit transmission lines combining different voltage levels in one tower present extra challenges when setting a protection philosophy, as faults between voltage levels are possible. In this study, the fault loop impedance of combined faults is compared with the fault loop impedance......-phase-to-ground faults. It is also demonstrated that the fault loop impedance of combined faults is more resistive, when compared with equivalent single-phase-to-ground faults. It is concluded that the settings used to protect a line against single-phase-to-ground faults are capable of protecting the line against...

Measurements of Voltage Harmonics in 400 kV Transmission Network

Directory of Open Access Journals (Sweden)

Ryszard Pawełek

2014-06-01

Full Text Available The paper deals with the analysis of voltage harmonics measurements performed in the 400 kV transmission network. The voltage was measured by means of three transducers: resistive voltage divider, inductive measuring transformer and capacitive voltage measuring transformer. Instrument errors were estimated for measuring transformers with reference to the harmonic values obtained from the voltage divider.

Centralized vs decentralized lunar power system study

Science.gov (United States)

Metcalf, Kenneth; Harty, Richard B.; Perronne, Gerald E.

1991-09-01

Three power-system options are considered with respect to utilization on a lunar base: the fully centralized option, the fully decentralized option, and a hybrid comprising features of the first two options. Power source, power conditioning, and power transmission are considered separately, and each architecture option is examined with ac and dc distribution, high and low voltage transmission, and buried and suspended cables. Assessments are made on the basis of mass, technological complexity, cost, reliability, and installation complexity, however, a preferred power-system architecture is not proposed. Preferred options include transmission based on ac, transmission voltages of 2000-7000 V with buried high-voltage lines and suspended low-voltage lines. Assessments of the total cost associated with the installations are required to determine the most suitable power system.

On-site voltage measurement with capacitive sensors on high voltage systems

NARCIS (Netherlands)

Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

2011-01-01

In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

High-Voltage Power Supply System for Laser Isotope Separation

Energy Technology Data Exchange (ETDEWEB)

Ketaily, E.C.; Buckner, R.P.; Uhrik, R.L.

1979-06-26

This report presents several concepts for Laser High-Voltage Power Supply (HVPS) Systems for a Laser Isotope Separation facility. Selection of equipments and their arrangement into operational systems is based on proven designs and on application concepts now being developed. This report has identified a number of alternative system arrangements and has provided preliminary cost estimates for each. The report includes a recommendation for follow-on studies that will further define the optimum Laser HVPS Systems. Brief descriptions are given of Modulator/Regulator circuit trade-offs, system control interfaces, and their impact on costs.

High-Voltage Power Supply System for Laser Isotope Separation

International Nuclear Information System (INIS)

Ketaily, E.C.; Buckner, R.P.; Uhrik, R.L.

1979-01-01

This report presents several concepts for Laser High-Voltage Power Supply (HVPS) Systems for a Laser Isotope Separation facility. Selection of equipments and their arrangement into operational systems is based on proven designs and on application concepts now being developed. This report has identified a number of alternative system arrangements and has provided preliminary cost estimates for each. The report includes a recommendation for follow-on studies that will further define the optimum Laser HVPS Systems. Brief descriptions are given of Modulator/Regulator circuit trade-offs, system control interfaces, and their impact on costs

High voltage power supplies for ITER RF heating and current drive systems

International Nuclear Information System (INIS)

Gassmann, T.; Arambhadiya, B.; Beaumont, B.; Baruah, U.K.; Bonicelli, T.; Darbos, C.; Purohit, D.; Decamps, H.; Albajar, F.; Gandini, F.; Henderson, M.; Kazarian, F.; Lamalle, P.U.; Omori, T.; Parmar, D.; Patel, A.; Rathi, D.; Singh, N.P.

2011-01-01

The RF heating and current drive (H and CD) systems to be installed for the ITER fusion machine are the electron cyclotron (EC), ion cyclotron (IC) and, although not in the first phase of the project, lower hybrid (LH). These systems require high voltage, high current power supplies (HVPS) in CW operation. These HVPS should deliver around 50 MW electrical power to each of the RF H and CD systems with stringent requirements in terms of accuracy, voltage ripple, response time, turn off time and fault energy. The PSM (Pulse Step Modulation) technology has demonstrated over the past 20 years its ability to fulfill these requirements in many industrial facilities and other fusion reactors and has therefore been chosen as reference design for the IC and EC HVPS systems. This paper describes the technical specifications, including interfaces, the resulting constraints on the design, the conceptual design proposed for ITER EC and IC HVPS systems and the current status.

Electric transmission technology

International Nuclear Information System (INIS)

Shah, K.R.

1990-01-01

Electric transmission technology has matured and can transmit bulk power more reliably and economically than the technology 10 years ago.In 1882, Marcel Depres transmitted 15 kW electric power at 2 kV, using a constant direct current; present transmission voltages have risen to ± 600 kV direct current (DC) and 765 kV alternating current (AC), and it is now possible to transmit bulk electric power at voltages as high as ± 1000 kV DC and 1500 kV AC. Affordable computer systems are now available to optimize transmission reliably. New materials have reduced the bulk of insulation for lines and equipment. New conducting materials and configurations have reduced losses in transmission. Advances in line structures and conductor motion, understanding of flashover characteristics of insulators and air-gaps and electrical performance of lines have resulted in more compact urban transmission lines. (author). 15 refs., 7 tabs., 11 figs

A High-Voltage Low-Power Switched-Capacitor DC-DC Converter Based on GaN and SiC Devices for LED Drivers

DEFF Research Database (Denmark)

Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

2018-01-01

Previous research on switched-capacitor DC-DC converters has focused on low-voltage and/or high-power ranges where the efficiencies are dominated by conduction loss. Switched-capacitor DC-DC converters at high-voltage (> 100 V) low-power (high efficiency and high power density...... are anticipated to emerge. This paper presents a switched-capacitor converter with an input voltage up to 380 V (compatible with rectified European mains) and a maximum output power of 10 W. GaN switches and SiC diodes are analytically compared and actively combined to properly address the challenges at high......-voltage low-current levels, where switching loss becomes significant. Further trade-off between conduction loss and switching loss is experimentally optimized with switching frequencies. Three variant designs of the proposed converter are implemented, and the trade-off between the efficiency and the power...

High Current, Low Voltage Power Converter [20kA, 6V] LHC Converter Prototype

CERN Document Server

Jørgensen, H E; Dupaquier, A; Fernqvist, G

1998-01-01

The superconducting LHC accelerator requires high currents (~12.5kA) and relatively low voltages (~10 V) for its magnets. The need to install the power converters underground is the driving force for reduced volume and high efficiency. Moreover, the LHC machine will require a very high level of performance from the power converters, particularly in terms of DC stability, dynamic response and also in matters of EMC. To meet these requirements soft-switching techniques will be used. This paper describes the development of a [20kA,6V] power converter intended as a stable high-current source for D CCT calibration and an evaluation prototype for the future LHC converters. The converter is made with a modular concept with five current sources [4kA,6V] in parallel. The 4kA sources are built as plu g-in modules: a diode rectifier on the AC mains with a damped L-C passive filter, a Zero Voltage Switching inverter working at 20 kHz and an output stage (high frequency transformers, Schottky rectifi ers and output filter...

Design issues of the High Voltage platform and feedthrough for the ITER NBI Ion Source

International Nuclear Information System (INIS)

Boldrin, M.; Palma, M. Dalla; Milani, F.

2009-01-01

In the ITER heating Neutral Beam Injector (NBI), a High Voltage air-insulated platform (named High Voltage Deck, HVD) will be installed to host the Ion Source and Extractor Power supply system and associated diagnostics referred to -1 MV DC potential. All power and control cables are routed from the HVD via a feedthrough (HV bushing) to the gas insulated transmission line which feeds the Injector. The paper focuses on insulation and mechanical issues for both HVD and HV bushing which are very special components, far from the present industrial standards as far as voltage (-1 MV DC) and dimensions are concerned. For this purpose, a preliminary design of the HVD has been carried out as concerns the mechanical structure and external shield. Then, the structure has been verified with a seismic analysis applying the seismic load excitation specified for the ITER construction site (Cadarache) and carrying out verifications according to relevant international standards. As regards the HV bushing design, proposals for the complex inner conductor structure and for interfaces to the HVD and transmission line are outlined; alternative installation layouts (aside or underneath the HVD) are compared from both mechanical and electrical points of view.

Experiences in simulating and testing coordinated voltage control provided by multiple wind power plants

Energy Technology Data Exchange (ETDEWEB)

Arlaban, T.; Alonso, O.; Ortiz, D. [Acciona Windpower S.A. (Spain); Peiro, J.; Rivas, R. [Red Electrica de Espana SAU (Spain); Quinonez-Varela, G.; Lorenzo, P. [Acciona Energia S.A. (Spain)

2011-07-01

This document presents some field tests performed in a transmission system node in order to check the adequacy of voltage control performance by multiple wind power plants, with an overall capacity of 395 MW. It briefly explains the Spanish TSO motivation towards new voltage control requirements and the necessity of performing such tests in order to set the most convenient voltage control parameters and to verify the stable operation. It presents how different the voltage control capability between modern wind turbines (DFIG) and older ones (SCIG) specifically retrofitted for voltage control is. (orig.)

The First Find of the Imperial Eagle’s Nest at the Pole of High-Voltage Power Transmission Line in the Republic of Altai, Russia

Directory of Open Access Journals (Sweden)

Elvira G. Nikolenko

2018-03-01

Full Text Available Inhabited nest of the Imperial Eagle was found on July 27, 2017 on the high-voltage power lines pole in the valley of the river Ursul near the fall of the river Karakol into it (Onguday district of the Altai Republic. Two adult nestlings ready to flyout and also a female bird were in the nest.

Transmission Level High Temperature Superconducting Fault Current Limiter

Energy Technology Data Exchange (ETDEWEB)

Stewart, Gary [SuperPower, Inc., Schenectady, NY (United States)

2016-10-05

The primary objective of this project was to demonstrate the feasibility and reliability of utilizing high-temperature superconducting (HTS) materials in a Transmission Level Superconducting Fault Current Limiter (SFCL) application. During the project, the type of high-temperature superconducting material used evolved from 1^st generation (1G) BSCCO-2212 melt cast bulk high-temperature superconductors to 2^nd generation (2G) YBCO-based high-temperature superconducting tape. The SFCL employed SuperPower's “Matrix” technology, that offers modular features to enable scale up to transmission voltage levels. The SFCL consists of individual modules that contain elements and parallel inductors that assist in carrying the current during the fault. A number of these modules are arranged in an m x n array to form the current-limiting matrix.

Experimental investigation of high temperature high voltage thermionic diode for the space power nuclear reactor

International Nuclear Information System (INIS)

Onufriyev, Valery V.

2001-01-01

It is well known that the rise of arc from the dense glow discharge is connected with the thermion and secondary processes on the cathode surface (Granovsky, 1971; Leob, 1953; Engel, 1935). First model of breakdown of the cathode layer is connected with the increase of the cathode temperature in consequence of the ion bombardment that leads to the grows its thermo-emissive current. Other model shows the main role of the secondary effects on the cathode surface-the increase of the secondary ion emission coefficient--γ i with the grows of glow discharge voltage. But the author of this investigation work of breakdown in Cs vapor (a transmission the glow discharge into self-maintaining arc discharge) discovered the next peculiarity: the value of breakdown voltage is constant when the values of vapor temperature (its pressure p cs ) and cathode temperature T k is constant too (U b =constant with T k =constant and p cs =constant) and it is not a statistical value (Onufryev, Grishin, 1996) (that was observed in gas glow discharges other authors (Granovsky, 1971; Leob, 1953; Engel, 1935)). The investigations of thermion high voltage high temperature diode (its breakdown characteristics in closed state and voltage-current characteristics in disclosed state) showed that the value of the breakdown voltage is depended on the vapor pressure in inter-electrode gap (IEG)-p cs and cathode temperature-T k and is independent on IEG length--Δ ieg . On this base it was settled that the main role in transition of glow discharge to self-maintaining arc discharge plays an ion cathode layer but more exactly--the region of excited atoms--''Aston glow.''

Experimental investigation of high temperature high voltage thermionic diode for the space power nuclear reactor

Science.gov (United States)

Onufriyev, Valery. V.

2001-02-01

It is well known that the rise of arc from the dense glow discharge is connected with the thermion and secondary processes on the cathode surface (Granovsky, 1971; Leob, 1953; Engel, 1935). First model of breakdown of the cathode layer is connected with the increase of the cathode temperature in consequence of the ion bombardment that leads to the grows its thermo-emissive current. Other model shows the main role of the secondary effects on the cathode surface-the increase of the secondary ion emission coefficient-γi with the grows of glow discharge voltage. But the author of this investigation work of breakdown in Cs vapor (a transmission the glow discharge into self-maintaining arc discharge) discovered the next peculiarity: the value of breakdown voltage is constant when the values of vapor temperature (its pressure pcs) and cathode temperature Tk is constant too (Ub=constant with Tk=constant and pcs=constant) and it is not a statistical value (Onufryev, Grishin, 1996) (that was observed in gas glow discharges other authors (Granovsky, 1971; Leob, 1953; Engel, 1935)). The investigations of thermion high voltage high temperature diode (its breakdown characteristics in closed state and voltage-current characteristics in disclosed state) showed that the value of the breakdown voltage is depended on the vapor pressure in inter-electrode gap (IEG)-pcs and cathode temperature-Tk and is independent on IEG length-Δieg. On this base it was settled that the main role in transition of glow discharge to self-maintaining arc discharge plays an ion cathode layer but more exactly-the region of excited atoms-``Aston glow.'' .

Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

Directory of Open Access Journals (Sweden)

Perić Dragoslav M.

2015-01-01

Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

Computer controlled high voltage system

Energy Technology Data Exchange (ETDEWEB)

Kunov, B; Georgiev, G; Dimitrov, L [and others

1996-12-31

A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

Practical Coupled Resonators in Domino Arrangements for Power Transmission and Distribution: Replacing Step-Down Power Transformers and Their Branches across the Power Grid

Directory of Open Access Journals (Sweden)

Athanasios G. Lazaropoulos

2013-01-01

Full Text Available This paper considers the potential of replacing step-down power transformers of the entire power grid as well as part of their transmission line branches with wireless power transfer (WPT technology components. Exploiting the state-of-the-art evolutions in the fields of WPT technology, coupled resonators in domino arrangements—domino coupled resonator (DCR configurations—are proposed as suitable technological substitute for step-down power transformers and are investigated in terms of performance metrics such as power transfer efficiency (PTE and transformation ratio (TR. The contribution of this paper is fivefold. First, an analytical theoretical analysis appropriate to the study of practical DCR configurations is demonstrated. In order to support the DCR configuration replacement venture, a detailed set of assumptions regarding efficient mid- and long-range high-power WPTs as well as related technical issues is first presented. The validity of the theoretical analysis is verified through experimental measurements. Second, applying the proposed theoretical analysis, a wealth of system parameters that mainly influences the PTE and TR of DCR configurations is identified. Their quantitative effect as well as corresponding DCR configuration adjustments are first presented. Third, an approximate method, denoted as approximate chain scattering matrix (CSM method, is first introduced. Based on the scattering matrix theory formalism, the approximate CSM method is suitable for mid- and long-range DCR configurations when the theoretical analysis becomes computationally slow. The numerical results of approximate CSM method are compared with the respective ones of theoretical analysis validating the extent and the accuracy of approximate CSM method. Fourth, the potential of power transformer replacement with practical DCR configurations is thoroughly investigated in terms of their TRs. A plethora of high-voltage/medium-voltage (HV/MV, MV/low-voltage

Outline of new extra high voltage research equipment at Kumatori research laboratories

Energy Technology Data Exchange (ETDEWEB)

Hohki, S; Ikeda, G

1965-01-01

Following up the construction in 1939 of an ehv research laboratory, another new research laboratory was established at Kumatori with a ground area of 142,000 square meters. As the first stage of this construction plan, the new research equipment was installed in November 1963 and began operation. The laboratory consists of comprehensive ehv research equipment and facilities relating to atomic energy. The former includes a 6000-kV impulse voltage generator, a 1650-kV alternating current testing transformer, a 300-m overhead transmission test line, a tower strength testing facility, and other various high-power test facilities. Studies on a 400- to 500-kV overhead power transmission system and other new transmission systems are currently being conducted. The details of the construction of the ehv research equipment together with the research policy for future ehv engineering are given.

High Power, Pulsed, RF Generation from Nonlinear Lumped Element Transmission Lines (NLETLs)

Science.gov (United States)

2011-02-05

in order to focus on the primary technology tinder consideration. Their practicality at very high powers and frequencies is questionable due to...also possessed suitably large CXL ratios. Measuring capacitive nonlinearity tinder high voltage proved to be more tricky than first imagi- ned

Ontario Hydro's environmental monitoring program for HV [high voltage] transmission line projects

International Nuclear Information System (INIS)

Braekevelt, P.N.

1991-01-01

Responsible monitoring and control of environmental impacts is key to obtaining future needed approvals for new high voltage (HV) transmission line projects. Ontario Hydro's environmental monitoring program was developed as a highly structured, self-imposed monitoring system to relieve government agencies of the responsibility of developing a similar external program. The goal was to be self-policing. The historical development, program structure, standards, priority ratings, documentation, communication and computerization of the program is described. The most effective way to minimize environmental impacts is to avoid sensitive features at the route selection stage, well before any construction takes place. The environmental monitoring program is based on the following blueprint: each crew member is responsible for environmental protection; environmental problems are to be resolved at the lowest level possible; potential concerns should be resolved before they become problems; known problems should be dealt with quickly to minimize impacts; team members should work cooperatively; and formal and regular communication is emphasized

30 CFR 75.811 - High-voltage underground equipment; grounding.

Science.gov (United States)

2010-07-01

...-voltage equipment supplying power to such equipment receiving power from resistance grounded systems shall... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-voltage underground equipment; grounding... COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Underground High-Voltage...

A novel power control strategy of Modular Multi-level Converter in HVDC-AC hybrid transmission systems for passive networks

DEFF Research Database (Denmark)

Hu, Zhenda; Wu, Rui; Yang, Xiaodong

2014-01-01

With the development of High Voltage DC Transmission (HVDC) technology, there will be more and more HVDC-AC hybrid transmission system in the world. A basic challenge in HVDC-AC hybrid transmission systems is to optimize the power sharing between DC and AC lines, which become more severe when sup...... control strategy of Modular Multi-level Converter in VSC-HVDC, which can optimize converter output power according to passive network loading variation. Proposal method is studied with a case study of a VSC-HVDC AC hybrid project by PSCAD/EMTDC simulations....

Automatic Voltage Control (AVC) System under Uncertainty from Wind Power

DEFF Research Database (Denmark)

Qin, Nan; Abildgaard, Hans; Flynn, Damian

2016-01-01

An automatic voltage control (AVC) system maintains the voltage profile of a power system in an acceptable range and minimizes the operational cost by coordinating the regulation of controllable components. Typically, all of the parameters in the optimization problem are assumed to be certain...... and constant in the decision making process. However, for high shares of wind power, uncertainty in the decision process due to wind power variability may result in an infeasible AVC solution. This paper proposes a voltage control approach which considers the voltage uncertainty from wind power productions....... The proposed method improves the performance and the robustness of a scenario based approach by estimating the potential voltage variations due to fluctuating wind power production, and introduces a voltage margin to protect the decision against uncertainty for each scenario. The effectiveness of the proposed...

Single-phased Fault Location on Transmission Lines Using Unsynchronized Voltages

Directory of Open Access Journals (Sweden)

ISTRATE, M.

2009-10-01

Full Text Available The increased accuracy into the fault's detection and location makes it easier for maintenance, this being the reason to develop new possibilities for a precise estimation of the fault location. In the field literature, many methods for fault location using voltages and currents measurements at one or both terminals of power grids' lines are presented. The double-end synchronized data algorithms are very precise, but the current transformers can limit the accuracy of these estimations. The paper presents an algorithm to estimate the location of the single-phased faults which uses only voltage measurements at both terminals of the transmission lines by eliminating the error due to current transformers and without introducing the restriction of perfect data synchronization. In such conditions, the algorithm can be used with the actual equipment of the most power grids, the installation of phasor measurement units with GPS system synchronized timer not being compulsory. Only the positive sequence of line parameters and sources are used, thus, eliminating the incertitude in zero sequence parameter estimation. The algorithm is tested using the results of EMTP-ATP simulations, after the validation of the ATP models on the basis of registered results in a real power grid.

Ground-fault protection of insulated high-voltage power networks in mines

Energy Technology Data Exchange (ETDEWEB)

Pudelko, H

1976-09-01

Safety of power networks is discussed in underground black coal mines in Poland. Safety in mines with a long service life was compared with safety in mines constructed since 1950. Power networks and systems protecting against electric ground-faults in the 2 mine groups are comparatively evaluated. Systems for protection against electric ground-faults in mine high-voltage networks with an insulated star point of the transformer are characterized. Fluctuations of resistance of electrical insulation under conditions of changing load are analyzed. The results of analyses are given in 14 diagrams. Recommendations for design of systems protecting against electric ground-faults in 6 kV mine power systems are made. 7 references.

The Effect of Current-Limiting Reactors on the Tripping of Short Circuits in High-Voltage Electrical Equipment

International Nuclear Information System (INIS)

Volkov, M. S.; Gusev, Yu. P.; Monakov, Yu. V.; Cho, Gvan Chun

2016-01-01

The insertion of current-limiting reactors into electrical equipment operating at a voltage of 110 and 220 kV produces a change in the parameters of the transient recovery voltages at the contacts of the circuit breakers for disconnecting short circuits, which could be the reason for the increase in the duration of the short circuit, damage to the electrical equipment and losses in the power system. The results of mathematical modeling of the transients, caused by tripping of the short circuit in a reactive electric power transmission line are presented, and data are given on the negative effect of a current-limiting resistor on the rate of increase and peak value of the transient recovery voltages. Methods of ensuring the standard requirements imposed on the parameters of the transient recovery voltages when using current-limiting reactors in the high-voltage electrical equipment of power plants and substations are proposed and analyzed

75 FR 63826 - Transmission Infrastructure Program-TransWest Express Transmission Project Capacity

Science.gov (United States)

2010-10-18

... Administration (Western), a Federal power marketing administration of the United States Department of Energy (DOE... operates an integrated 17,000 circuit mile, high-voltage transmission system across 15 western states... transmission lines and related facilities with at least one terminus in Western's marketing area, that deliver...

An RFID-Based Closed-Loop Wireless Power Transmission System for Biomedical Applications.

Science.gov (United States)

Kiani, Mehdi; Ghovanloo, Maysam

2010-04-01

This brief presents a standalone closed-loop wireless power transmission system that is built around a commercial off-the-shelf (COTS) radio-frequency identification (RFID) reader (TRF7960) operating at 13.56 MHz. It can be used for inductively powering implantable biomedical devices in a closed loop. Any changes in the distance and misalignment between transmitter and receiver coils in near-field wireless power transmission can cause a significant change in the received power, which can cause either a malfunction or excessive heat dissipation. RFID circuits are often used in an open loop. However, their back telemetry capability can be utilized to stabilize the received voltage on the implant. Our measurements showed that the delivered power to the transponder was maintained at 11.2 mW over a range of 0.5 to 2 cm, while the transmitter power consumption changed from 78 mW to 1.1 W. The closed-loop system can also oppose voltage variations as a result of sudden changes in the load current.

Voltage control of a power-frequency E-beam irradiator

International Nuclear Information System (INIS)

Zhou Zhizhong; Hu Shouming; Wang Jun; Guo Honglei; Su Haijun

2012-01-01

Voltage stability and precision are key specifications of an electron beam irradiator. A voltage control system was developed for smooth high voltage regulating on a power frequency electron accelerator. Pillar variac driven by servo motor was used as the regulating device, with a programmable logic controller as the control unit. An industrial PC was employed to realize human-machine interaction. Open-loop and closed-loop modes were employed to regulate the high voltage. Experimental results show that the speed, stability and precision for high voltage regulating were improved greatly, hence a much better performance of the electron accelerator. (authors)

An efficient high-voltage power supply for a photomultiplier tube

NARCIS (Netherlands)

Ainutdinov, VM; Vonsovskii, NN; Kompaniets, KG; Kozyr, AI; Mikhailov, YV

2003-01-01

An adjustable power supply for a photomultiplier tube operating in the pulsed spectrometric mode with a wide range of linearity is described. The power consumed by the source is 50 mW. The output voltage is varied from 800 to 2000 V. The maximum ripple amplitude is 2.5 mV.

Power transmission cable development for the Space Station Freedom electrical power system

Science.gov (United States)

Schmitz, Gregory V.; Biess, John J.

1989-01-01

Power transmission cable is presently being evaluated under a NASA Lewis Research Center advanced development contract for application in the Space Station Freedom (SSF) electrical power system (EPS). Evaluation testing has been performed by TRW and NASA Lewis Research Center. The results of this development contract are presented. The primary cable design goals are to provide (1) a low characteristic inductance to minimize line voltage drop at 20 kHz, (2) electromagnetic compatibility control of the 20-kHz ac power current, (3) a physical configuration that minimizes ac resistance and (4) release of trapped air for corona-free operation.

A study on stimulation of DC high voltage power of LCC series parallel resonant in projectile velocity measurement system

Science.gov (United States)

Lu, Dong-dong; Gu, Jin-liang; Luo, Hong-e.; Xia, Yan

2017-10-01

According to specific requirements of the X-ray machine system for measuring velocity of outfield projectile, a DC high voltage power supply system is designed for the high voltage or the smaller current. The system comprises: a series resonant circuit is selected as a full-bridge inverter circuit; a high-frequency zero-current soft switching of a high-voltage power supply is realized by PWM output by STM32; a nanocrystalline alloy transformer is chosen as a high-frequency booster transformer; and the related parameters of an LCC series-parallel resonant are determined according to the preset parameters of the transformer. The concrete method includes: a LCC series parallel resonant circuit and a voltage doubling circuit are stimulated by using MULTISM and MATLAB; selecting an optimal solution and an optimal parameter of all parts after stimulation analysis; and finally verifying the correctness of the parameter by stimulation of the whole system. Through stimulation analysis, the output voltage of the series-parallel resonant circuit gets to 10KV in 28s: then passing through the voltage doubling circuit, the output voltage gets to 120KV in one hour. According to the system, the wave range of the output voltage is so small as to provide the stable X-ray supply for the X-ray machine for measuring velocity of outfield projectile. It is fast in charging and high in efficiency.

A Study on Gas Insulation Characteristics for Design Optimization of High Voltage Power Apparatus

Energy Technology Data Exchange (ETDEWEB)

Kim, I S; Kim, M K; Seo, K S; Moon, I W; Choi, C K [Korea Electrotechnology Research Institute (Korea, Republic of)

1996-12-01

This study aim of obtaining the basic data for gas insulation in the high voltage apparatus and for investigating the breakdown characteristics in uniform field and non-uniform which the geometric construction in the practical power apparatus. In this study, the research results on the insulation technology published earlier are reviewed and the basic data for an optimum design of a high voltage apparatus are obtained thorough the experiment and computer simulation by using a uniform field. The main result are summarized as follows: (A) Investigation on the insulation technology in a large-capacity power apparatus. (B) Investigation on the breakdown characteristics in particle contaminated condition. (C) Investigation on the design in computer simulation. (D) Investigation on the simulation technology of breakdown characteristics. (E) Investigation on breakdown characteristics in the nonuniform field and experiment. (author). refs., figs., tabs.

Study on Communication Methods for Electric Power High-voltage Equipment Monitoring System

Directory of Open Access Journals (Sweden)

Jia Yu Chen

2018-02-01

Full Text Available Real-time monitoring of high-voltage equipment in substations is beneficial for early detection of faults. The use of wireless sensor networks to build monitoring system is an effective way, but the data collection is a difficult task. The author introduces a real-time monitoring system based on ZIGBEE and mobile communication technology. The system includes multiple monitoring points and terminal platforms. Each monitoring point consists of a number of sensor nodes to form a ZIGBEE network, detecting relevant parameters, coordinator node data collected one by one, known as linear transmission, and finally to the monitoring platform through the mobile communication network. This paper presents a fusion algorithm for monitoring cell data acquisition to reduce the amount of data uploaded to the base station. In addition, multi-hop routing algorithm based on opportunistic routing is proposed to balance network energy and improve network transmission rate and efficiency.

Ultra-long-pulse microwave negative high voltage power supply with fast protection

International Nuclear Information System (INIS)

Xu Weihua; Wu Junshuan; Zheng Guanghua; Huang Qiaolin; Yang Chunsheng; Zhou Yuanwei; Chen Yonghao

1998-01-01

Two 1.4 MW high voltage power supply (HVPS) modules with 3-5 s pulse duration have been developed for LHCD experiment in the HT-7 tokamak. The power source consists of a pulsed generator and the electric circuit. Duration of the ultra-long-pulse is controlled by switching-on dc relay immediately and switching-off ac contactor after a given time, and the fast protection is executed by a crowbar. Due to the soft starting of the power source, the problem of overvoltage induced by dc relay switching-on has been solved. Each power supply module outputs a rated power (-35 kV, 40 A) on the dummy load. With the klystrons connected as the load of the power supply modules, LHCD experiments have been conducted successfully in the HT-7 tokamak

Voltage scheduling for low power/energy

Science.gov (United States)

Manzak, Ali

2001-07-01

Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned

Conceptual design of pulsed high voltage and high precision power supply for a cyclotron auto-resonance maser (CARM) for plasma heating

International Nuclear Information System (INIS)

Zito, Pietro; Maffia, Giuseppe; Lampasi, Alessandro

2015-01-01

Highlights: • ENEA started a project to develop a cyclotron auto-resonance maser (CARM). • This facility requires an advanced pulsed high voltage power supply (HVPS). • The conceptual design answers to the performances requested for CARM HVPS. • The pulse transformer parameters were estimated according to IEEE standards. • PWM PID-based controller has been optimized to follow very fast rectangular pulses. - Abstract: Due to the high electron temperature during the plasma burning, both a higher power (>1 MW) and a higher frequency (up to 300 GHz) are required for plasma heating in future fusion experiments like DEMO. For this task, ENEA started a project to develop a cyclotron auto-resonance maser (CARM) able to produce an electron radiation in synchronism with the electromagnetic field and to transfer the electron beam kinetic energy to the plasma. This facility requires an advanced pulsed high voltage power supply (HVPS) with the following technical characteristics: variable output voltage up to 700 kV; variable pulse length in the range 5–50 μs; overshoot < 2%; rise time < 1 μs; voltage accuracy (including drop, ripple and stability) <0.1%. This paper describes the conceptual design and the technical solutions adopted to achieve the performance requested for the CARM HVPS.

Conceptual design of pulsed high voltage and high precision power supply for a cyclotron auto-resonance maser (CARM) for plasma heating

Energy Technology Data Exchange (ETDEWEB)

Zito, Pietro, E-mail: pietro.zito@enea.it; Maffia, Giuseppe; Lampasi, Alessandro

2015-10-15

Highlights: • ENEA started a project to develop a cyclotron auto-resonance maser (CARM). • This facility requires an advanced pulsed high voltage power supply (HVPS). • The conceptual design answers to the performances requested for CARM HVPS. • The pulse transformer parameters were estimated according to IEEE standards. • PWM PID-based controller has been optimized to follow very fast rectangular pulses. - Abstract: Due to the high electron temperature during the plasma burning, both a higher power (>1 MW) and a higher frequency (up to 300 GHz) are required for plasma heating in future fusion experiments like DEMO. For this task, ENEA started a project to develop a cyclotron auto-resonance maser (CARM) able to produce an electron radiation in synchronism with the electromagnetic field and to transfer the electron beam kinetic energy to the plasma. This facility requires an advanced pulsed high voltage power supply (HVPS) with the following technical characteristics: variable output voltage up to 700 kV; variable pulse length in the range 5–50 μs; overshoot < 2%; rise time < 1 μs; voltage accuracy (including drop, ripple and stability) <0.1%. This paper describes the conceptual design and the technical solutions adopted to achieve the performance requested for the CARM HVPS.

Novel Interleaved Converter with Extra-High Voltage Gain to Process Low-Voltage Renewable-Energy Generation

Directory of Open Access Journals (Sweden)

Chih-Lung Shen

2016-10-01

Full Text Available This paper presents a novel interleaved converter (NIC with extra-high voltage gain to process the power of low-voltage renewable-energy generators such as photovoltaic (PV panel, wind turbine, and fuel cells. The NIC can boost a low input voltage to a much higher voltage level to inject renewable energy to DC bus for grid applications. Since the NIC has two circuit branches in parallel at frond end to share input current, it is suitable for high power applications. In addition, the NIC is controlled in an interleaving pattern, which has the advantages that the NIC has lower input current ripple, and the frequency of the ripple is twice the switching frequency. Two coupled inductors and two switched capacitors are incorporated to achieve a much higher voltage gain than conventional high step-up converters. The proposed NIC has intrinsic features such as leakage energy totally recycling and low voltage stress on power semiconductor. Thorough theoretical analysis and key parameter design are presented in this paper. A prototype is built for practical measurements to validate the proposed NIC.

Novel high-voltage power lateral MOSFET with adaptive buried electrodes

International Nuclear Information System (INIS)

Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji

2012-01-01

A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Reactive Power Compensation of a 24 MW Wind Farm using a 12-Pulse Voltage Source Converter

DEFF Research Database (Denmark)

Pedersen, Knud Ole Helgesen; Pedersen, Jørgen Kaas

1998-01-01

Integration of large wind farms in distribution and transmission systems may have severe influence on the power quality at the connection point and may also influence the voltage controlling capability of the electrical system. The purpose of the described project has been to develop and investig......Integration of large wind farms in distribution and transmission systems may have severe influence on the power quality at the connection point and may also influence the voltage controlling capability of the electrical system. The purpose of the described project has been to develop...... and investigate the use of a STATCOM by modelling and field testing an 8 MVar unit in a 24 MW wind farm....

Interconnected High-Voltage Pulsed-Power Converters System Design for H− Ion Sources

CERN Document Server

Aguglia, D

2014-01-01

This paper presents the design and experimental validations of a system of three new high-voltage (HV) pulsedpower converters for the H− sources. The system requires three pulsed voltages (50, 40, and 25 kV to ground) at 2-Hz repetition rate, for 700 μs of usable flat-top. The solution presents ripplefree output voltages and minimal stored energy to protect the ion source from the consequences of arc events. Experimental results on the final full-scale prototype are presented. In case of short-circuit events, the maximal energy delivered to the source is in the Joule range. HV flat-top stability of 1% is experimentally achieved with a simple Proportional-Integral- Derivative regulation and preliminary tuned H− source (e.g., radio frequency control, gas injection, and so forth). The system is running since more than a year with no power converter failures and damage to the source.

Transient analysis for alternating over-current characteristics of HTSC power transmission cable

Science.gov (United States)

Lim, S. H.; Hwang, S. D.

2006-10-01

In this paper, the transient analysis for the alternating over-current distribution in case that the over-current was applied for a high-TC superconducting (HTSC) power transmission cable was performed. The transient analysis for the alternating over-current characteristics of HTSC power transmission cable with multi-layer is required to estimate the redistribution of the over-current between its conducting layers and to protect the cable system from the over-current in case that the quench in one or two layers of the HTSC power cable happens. For its transient analysis, the resistance generation of the conducting layers for the alternating over-current was reflected on its equivalent circuit, based on the resistance equation obtained by applying discrete Fourier transform (DFT) for the voltage and the current waveforms of the HTSC tape, which comprises each layer of the HTSC power transmission cable. It was confirmed through the numerical analysis on its equivalent circuit that after the current redistribution from the outermost layer into the inner layers first happened, the fast current redistribution between the inner layers developed as the amplitude of the alternating over-current increased.

Electrical engineering unit for the reactive power control of the load bus at the voltage instability

Science.gov (United States)

Kotenev, A. V.; Kotenev, V. I.; Kochetkov, V. V.; Elkin, D. A.

2018-01-01

For the purpose of reactive power control error reduction and decrease of the voltage sags in the electric power system caused by the asynchronous motors started the mathematical model of the load bus was developed. The model was built up of the sub-models of the following elements: a transformer, a transmission line, a synchronous and an asynchronous loads and a capacitor bank load, and represents the automatic reactive power control system taking into account electromagnetic processes of the asynchronous motors started and reactive power changing of the electric power system elements caused by the voltage fluctuation. The active power/time and reactive power/time characteristics based on the recommended procedure of the equivalent electric circuit parameters calculation were obtained. The derived automatic reactive power control system was shown to eliminate the voltage sags in the electric power system caused by the asynchronous motors started.

Optimisation of VSC-HVDC Transmission for Wind Power Plants

DEFF Research Database (Denmark)

Silva, Rodrigo Da

Connection of Wind Power Plants (WPP), typically oshore, using VSCHVDC transmission is an emerging solution with many benefits compared to the traditional AC solution, especially concerning the impact on control architecture of the wind farms and the grid. The VSC-HVDC solution is likely to meet...... more stringent grid codes than a conventional AC transmission connection. The purpose of this project is to analyse how HVDC solution, considering the voltage-source converter based technology, for grid connection of large wind power plants can be designed and optimised. By optimisation, the project...... the robust control technique is applied is compared with the classical proportional-integral (PI) performance, by means of time domain simulation in a point-to-point HVDC connection. The three main parameters in the discussion are the wind power delivered from the offshore wind power plant, the variation...

Optimum voltage of auxiliary systems for thermal and nuclear power plants

International Nuclear Information System (INIS)

Tokumitsu, Iwao; Segawa, Motomichi

1979-01-01

In the power plants in Japan, their unit power output has been greatly enhanced since the introduction of new powerful thermal power plants from 1950's to 1960's. In both thermal and nuclear power plants, 1,000 MW machines have been already in operation. The increase of unit power output results in the increase of in-plant load capacity. Of these the voltage adopted for in-plant low voltage systems is now mainly 440 V at load terminals, and the voltage for in-plant high voltage systems has been changing to 6 kV level via 3 kV and 4 kV levels. As plant capacity increases, the load of low voltage systems significantly increases, and it is required to raise the voltage of 400 V level. By the way, the low voltage in AC is specified to be not higher than 600 V. This makes the change within the above range comparatively easy. Considering these conditions, it is recommended to change the voltage for low voltage systems to 575 V at power source terminals and 550 V at load terminals. Some merits in constructing power systems and in economy by raising the voltage were examined. Though demerits are also found, they are only about 15% of total merits. The most advantageous point in raising the voltage is to be capable of increasing the supplying range to low voltage system loads. (Wakatsuki, Y.)

MOSFET-based high voltage short pulse generator for ultrasonic transducer excitation

Science.gov (United States)

Hidayat, Darmawan; Setianto, Syafei, Nendi Suhendi; Wibawa, Bambang Mukti

2018-02-01

This paper presents the generation of a high-voltage short pulse for the excitation of high frequency ultrasonic transducers. This is highly required in the purpose of various ultrasonic-based evaluations, particularly when high resolution measurement is necessary. A high voltage (+760 V) DC voltage source was pulsated by an ultrafast switching MOSFET which was driven by a pulse generator circuit consisting of an astable multivibrator, a one-shot multivibrator with Schmitt trigger input and a high current MOSFET driver. The generated pulses excited a 200-kHz and a 1-MHz ultrasonic transducers and tested in the transmission mode propagation to evaluate the performances of the generated pulse. The test results showed the generator were able to produce negative spike pulses up to -760 V voltage with the shortest time-width of 107.1 nanosecond. The transmission-received ultrasonic waves show frequency oscillation at 200 and 961 kHz and their amplitudes varied with the voltage of excitation pulse. These results conclude that the developed pulse generator is applicable to excite transducer for the generation of high frequency ultrasonic waves.

Enhanced Wireless Power Transmission Using Strong Paramagnetic Response.

Science.gov (United States)

Ahn, Dukju; Kiani, Mehdi; Ghovanloo, Maysam

2014-03-01

A method of quasi-static magnetic resonant coupling has been presented for improving the power transmission efficiency (PTE) in near-field wireless power transmission, which improves upon the state of the art. The traditional source resonator on the transmitter side is equipped with an additional resonator with a resonance frequency that is tuned substantially higher than the magnetic field excitation frequency. This additional resonator enhances the magnetic dipole moment and the effective permeability of the power transmitter, owing to a phenomenon known as the strong paramagnetic response. Both theoretical calculations and experimental results show increased PTE due to amplification of the effective permeability. In measurements, the PTE was improved from 57.8% to 64.2% at the nominal distance of 15 cm when the effective permeability was 2.6. The power delivered to load was also improved significantly, with the same 10 V excitation voltage, from 0.38 to 5.26 W.

High-voltage test and measuring techniques

CERN Document Server

Hauschild, Wolfgang

2014-01-01

It is the intent of this book to combine high-voltage (HV) engineering with HV testing technique and HV measuring technique. Based on long-term experience gained by the authors as lecturer and researcher as well as member in international organizations, such as IEC and CIGRE, the book will reflect the state of the art as well as the future trends in testing and diagnostics of HV equipment to ensure a reliable generation, transmission and distribution of electrical energy. The book is intended not only for experts but also for students in electrical engineering and high-voltage engineering.

High voltage high brightness electron accelerators with MITL voltage adder coupled to foilless diodes

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.

1993-01-01

During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm

Hybrid AC-High Voltage DC Grid Stability and Controls

Science.gov (United States)

Yu, Jicheng

The growth of energy demands in recent years has been increasing faster than the expansion of transmission facility construction. This tendency cooperating with the continuous investing on the renewable energy resources drives the research, development, and construction of HVDC projects to create a more reliable, affordable, and environmentally friendly power grid. Constructing the hybrid AC-HVDC grid is a significant move in the development of the HVDC techniques; the form of dc system is evolving from the point-to-point stand-alone dc links to the embedded HVDC system and the multi-terminal HVDC (MTDC) system. The MTDC is a solution for the renewable energy interconnections, and the MTDC grids can improve the power system reliability, flexibility in economic dispatches, and converter/cable utilizing efficiencies. The dissertation reviews the HVDC technologies, discusses the stability issues regarding the ac and HVDC connections, proposes a novel power oscillation control strategy to improve system stability, and develops a nonlinear voltage droop control strategy for the MTDC grid. To verify the effectiveness the proposed power oscillation control strategy, a long distance paralleled AC-HVDC transmission test system is employed. Based on the PSCAD/EMTDC platform simulation results, the proposed power oscillation control strategy can improve the system dynamic performance and attenuate the power oscillations effectively. To validate the nonlinear voltage droop control strategy, three droop controls schemes are designed according to the proposed nonlinear voltage droop control design procedures. These control schemes are tested in a hybrid AC-MTDC system. The hybrid AC-MTDC system, which is first proposed in this dissertation, consists of two ac grids, two wind farms and a five-terminal HVDC grid connecting them. Simulation studies are performed in the PSCAD/EMTDC platform. According to the simulation results, all the three design schemes have their unique salient

Economic Aspect of HVDC Transmission System for Indonesia Consideration in Nuclear Power Development

International Nuclear Information System (INIS)

Edwaren Liun

2009-01-01

As a country with hundreds million people, Indonesia needs to generate large scale power and distribute it to thorough country to improve gross domestic product of the population. In the power transmission domain, the High Voltage Direct Current (HVDC) transmission system should be considered for the next decades concerning any technical and economical problems with HVAC transmission. HVDC transmission system is the answer for the Indonesian condition. This system can connect the high energy potential regions to the high energy demand regions. HVDC is the most efficient to transport energy from one region to another one region. Dismantling and removing assets costs are included to the estimated for capital costs, while the environmental and property costs are the costs of securing designations and resource consents, and valuation and legal advice for the HVDC investment. Although converter terminals are expensive however, for long transmissions HVDC system can compensate the costs over breakeven distance through very efficient transmission system. Efficiency of HVDC is appearing from conductor wire, supporting tower, low energy loses and free space used by route of the transmission line. HVDC system is also free from some problem, concerning stability, inductive and capacitive load components, phase differences and frequency system. In the economic aspect the HVDC capital costs for the transmission options comprise estimates of the cost to design, purchase and construct new HVDC transmission components. While operating and maintenance costs of HVDC assets comprise the costs for replacement the old existing overhead transmission lines, underground and submarine cables, and HVDC converter station components. (author)

Mitigation of voltage dip and power system oscillations damping using dual STATCOM for grid connected DFIG

OpenAIRE

D.V.N. Ananth; G.V. Nagesh Kumar

2017-01-01

During grid fault, transmission lines reach its thermal limit and lose its capability to transfer. If this fault current enters generator terminals, it will lead to dip in stator voltage and consequently produces torque and real power oscillations. This further affects in the form of internal heat in rotor windings and finally damages the generator. A new control strategy is proposed to limit fault current using dual STATCOM, which will damp power oscillations and mitigate the voltage dip due...

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Nested high voltage generator/particle accelerator

International Nuclear Information System (INIS)

Adler, R.J.

1992-01-01

This patent describes a modular high voltage particle accelerator having an emission axis and an emission end, the accelerator. It comprises: a plurality of high voltage generators in nested adjacency to form a nested stack, each the generator comprising a cup-like housing having a base and a tubular sleeve extending from the base, a primary transformer winding encircling the nested stack; a secondary transformer winding between each adjacent pair of housings, magnetically linked to the primary transformer winding through the gaps; a power supply respective to each of the secondary windings converting alternating voltage from its respective secondary winding to d.c. voltage, the housings at the emission end forming a hollow throat for particle acceleration, a vacuum seal at the emission end of the throat which enables the throat to be evacuated; a particle source in the thrond power means to energize the primary transformer winding

HVDC transmission preferred to 750 kV ac

Energy Technology Data Exchange (ETDEWEB)

1965-06-25

It is unlikely that there will be a need in Britain for ac transmission voltages above 400 kV. But with the growing load density in the large conurbations with no possibility of local generation, high voltage dc transmission is likely to be most useful. It was concluded that by 1971 the 400 kV supergrid would be nation-wide and 6,200 circuit miles should be in service. With the expansion to accommodate the large new generating stations, the 400 kV supergrid would become an extremely high power distribution network rather than a transmission system. A higher voltage for transmission is outside the rational limit of speculation for a country the size of Britain.

Coordinated Voltage Control Scheme for VSC-HVDC Connected Wind Power Plants

DEFF Research Database (Denmark)

Guo, Yifei; Gao, Houlei; Wu, Qiuwei

2017-01-01

This paper proposes a coordinated voltage control scheme based on model predictive control (MPC) for voltage source converter‐based high voltage direct current (VSC‐HVDC) connected wind power plants (WPPs). In the proposed scheme, voltage regulation capabilities of VSC and WTGs are fully utilized...... and optimally coordinated. Two control modes, namely operation optimization mode and corrective mode, are designed to coordinate voltage control and economic operation of the system. In the first mode, the control objective includes the bus voltages, power losses and dynamic Var reserves of wind turbine...

Ultra-low power high temperature and radiation hard complementary metal-oxide-semiconductor (CMOS) silicon-on-insulator (SOI) voltage reference.

Science.gov (United States)

Boufouss, El Hafed; Francis, Laurent A; Kilchytska, Valeriya; Gérard, Pierre; Simon, Pascal; Flandre, Denis

2013-12-13

This paper presents an ultra-low power CMOS voltage reference circuit which is robust under biomedical extreme conditions, such as high temperature and high total ionized dose (TID) radiation. To achieve such performances, the voltage reference is designed in a suitable 130 nm Silicon-on-Insulator (SOI) industrial technology and is optimized to work in the subthreshold regime of the transistors. The design simulations have been performed over the temperature range of -40-200 °C and for different process corners. Robustness to radiation was simulated using custom model parameters including TID effects, such as mobilities and threshold voltages degradation. The proposed circuit has been tested up to high total radiation dose, i.e., 1 Mrad (Si) performed at three different temperatures (room temperature, 100 °C and 200 °C). The maximum drift of the reference voltage V(REF) depends on the considered temperature and on radiation dose; however, it remains lower than 10% of the mean value of 1.5 V. The typical power dissipation at 2.5 V supply voltage is about 20 μW at room temperature and only 75 μW at a high temperature of 200 °C. To understand the effects caused by the combination of high total ionizing dose and temperature on such voltage reference, the threshold voltages of the used SOI MOSFETs were extracted under different conditions. The evolution of V(REF) and power consumption with temperature and radiation dose can then be explained in terms of the different balance between fixed oxide charge and interface states build-up. The total occupied area including pad-ring is less than 0.09 mm2.

Voltage harmonics mitigation through hybrid active power filer

International Nuclear Information System (INIS)

Sahito, A.A.; Tunio, S.M.; Khizer, A.N.

2016-01-01

Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion) of 18.91 and 7.61 percentage in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter) is proposed to reduce these THD values below 5 percentage as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5 percentage. (author)

Voltage Harmonics Mitigation through Hybrid Active Power Filter

Directory of Open Access Journals (Sweden)

Anwer Ali Sahito

2016-01-01

Full Text Available Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion of 18.91 and 7.61% in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter is proposed to reduce these THD values below 5% as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5%.

The Evaluation Method of the Lightning Strike on Transmission Lines Aiming at Power Grid Reliability

Science.gov (United States)

Wen, Jianfeng; Wu, Jianwei; Huang, Liandong; Geng, Yinan; Yu, zhanqing

2018-01-01

Lightning protection of power system focuses on reducing the flashover rate, only distinguishing by the voltage level, without considering the functional differences between the transmission lines, and being lack of analysis the effect on the reliability of power grid. This will lead lightning protection design of general transmission lines is surplus but insufficient for key lines. In order to solve this problem, the analysis method of lightning striking on transmission lines for power grid reliability is given. Full wave process theory is used to analyze the lightning back striking; the leader propagation model is used to describe the process of shielding failure of transmission lines. The index of power grid reliability is introduced and the effect of transmission line fault on the reliability of power system is discussed in detail.

Voltage measurements at the vacuum post-hole convolute of the Z pulsed-power accelerator

Directory of Open Access Journals (Sweden)

E. M. Waisman

2014-12-01

Full Text Available Presented are voltage measurements taken near the load region on the Z pulsed-power accelerator using an inductive voltage monitor (IVM. Specifically, the IVM was connected to, and thus monitored the voltage at, the bottom level of the accelerator’s vacuum double post-hole convolute. Additional voltage and current measurements were taken at the accelerator’s vacuum-insulator stack (at a radius of 1.6 m by using standard D-dot and B-dot probes, respectively. During postprocessing, the measurements taken at the stack were translated to the location of the IVM measurements by using a lossless propagation model of the Z accelerator’s magnetically insulated transmission lines (MITLs and a lumped inductor model of the vacuum post-hole convolute. Across a wide variety of experiments conducted on the Z accelerator, the voltage histories obtained from the IVM and the lossless propagation technique agree well in overall shape and magnitude. However, large-amplitude, high-frequency oscillations are more pronounced in the IVM records. It is unclear whether these larger oscillations represent true voltage oscillations at the convolute or if they are due to noise pickup and/or transit-time effects and other resonant modes in the IVM. Results using a transit-time-correction technique and Fourier analysis support the latter. Regardless of which interpretation is correct, both true voltage oscillations and the excitement of resonant modes could be the result of transient electrical breakdowns in the post-hole convolute, though more information is required to determine definitively if such breakdowns occurred. Despite the larger oscillations in the IVM records, the general agreement found between the lossless propagation results and the results of the IVM shows that large voltages are transmitted efficiently through the MITLs on Z. These results are complementary to previous studies [R. D. McBride et al., Phys. Rev. ST Accel. Beams 13, 120401 (2010

Variable Ratio Hydrostatic Transmission Simulator for Optimal Wind Power Drivetrains

Directory of Open Access Journals (Sweden)

Jose M. Garcia-Bravo

2017-01-01

Full Text Available This work presents a hydromechanical transmission coupled to an electric AC motor and DC generator to simulate a wind power turbine drive train. The goal of this project was to demonstrate and simulate the ability of a hydrostatic variable ratio system to produce constant electric power at varying wind speeds. The experimental results show that the system can maintain a constant voltage when a 40% variation in input speed is produced. An accompanying computer simulation of the system was built and experimentally validated showing a discrete error no larger than 12%. Both the simulation and the experimental results show that the electrical power output can be regulated further if an energy storage device is used to absorb voltage spikes produced by abrupt changes in wind speed or wind direction.

Voltage control and protection in electrical power systems from system components to wide-area control

CERN Document Server

Corsi, Sandro

2015-01-01

Based on the author’s twenty years of experience, this book shows the practicality of modern, conceptually new, wide area voltage control in transmission and distribution smart grids, in detail. Evidence is given of the great advantages of this approach, as well as what can be gained by new control functionalities which modern technologies now available can provide. The distinction between solutions of wide area voltage regulation (V-WAR) and wide area voltage protection (V-WAP) are presented, demonstrating the proper synergy between them when they operate on the same power system as well as the simplicity and effectiveness of the protection solution in this case. The author provides an overview and detailed descriptions of voltage controls, distinguishing between generalities of underdeveloped, on-field operating applications and modern and available automatic control solutions, which are as yet not sufficiently known or perceived for what they are: practical, high-performance and reliable solutions. At th...

STUDY ON PERFORMANCE OF 21M 132kV TRANSMISSION TOWER WITH MEDIUM WIND INTENSITY

OpenAIRE

V. LAKSHMI; A. RAJAGOPALA RAO

2012-01-01

Electric Power is today playing an increasingly important role in the life of the community. In the electric power system the production and transmission of power are two predominant factors. For the purpose of transmission of electricity towers are the main medium with some wires at required distances and altitudes. The remotehydroelectric power plants have given rise to the need for extra high voltage. Prior to 1950, 150 kV electric transmission lines were considered and still higher voltag...

High Voltage Seismic Generator

Science.gov (United States)

Bogacz, Adrian; Pala, Damian; Knafel, Marcin

2015-04-01

This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

Evaluation of the contact switch materials in high voltage power supply for generate of underwater shockwave by electrical discharge

Directory of Open Access Journals (Sweden)

K Higa

2016-10-01

Full Text Available We have developed the high voltage power-supply unit by Cockcroft-Walton circuit for ingenerate high pressure due to underwater shockwave by electrical discharge. This high voltage power supply has the problem of the metal contact switch operation that contact switch stop by melting and bonding due to electrical spark. We have studied the evaluation of materials of contact switch for the reducing electrical energy loss and the problem of contact switch operation. In this research, measurement of discharge voltage and high pressure due to underwater shockwave was carried out using the contact switch made of different materials as brass plate, brass-carbon plate-brass and carbon block. The contact switch made of carbon is effective to reduce energy loss and problem of contactor switch operation.

Simulation of a Narrowband Power Line Communications System over Medium Voltage

Directory of Open Access Journals (Sweden)

Nikolaos Chiotellis

2016-03-01

Full Text Available Narrowband Power Line Communications (NB-PLCs are investigated as an alternative option for transferring low rate smart grid (SG data via Medium Voltage (MV power lines. In this framework, two variants of orthogonal frequency division multiplexing are examined, namely Filtered-OFDM (F-OFDM and Wavelet-OFDM (W-OFDM, in an attempt to determine which of them is capable of transmitting low rate SG data to greater distances over non-branched MV power lines. The reach of NB-PLC signals via MV power lines is estimated, taking into account the transfer function of the relevant PLC channels and noise mechanisms as well as the specific features of the two modulation options under consideration. Simulations show that NB-PLC transmission constitutes a technically feasible and economically affordable option for exchanging low rate data with remote SG nodes dispersed over the MV grid. Moreover, simulations show that F-OFDM allows low rate data transmission to considerably greater distances compared to W-OFDM.

A high-voltage pulse generator for corona plasma generation

NARCIS (Netherlands)

Yan, K.; Heesch, van E.J.M.; Pemen, A.J.M.; Huijbrechts, P.A.H.J.; Gompel, van F.M.; Leuken, van H.E.M.; Matyas, Z.

2002-01-01

This paper discusses a high-voltage pulse generator for producing corona plasma. The generator consists of three resonant charging circuits, a transmission line transformer, and a triggered spark-gap switch. Voltage pulses in the order of 30-100 kV with a rise time of 10-20 ns, a pulse duration of

Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

OpenAIRE

Bulyga Leonid L.; Tarasov Evgeniy V.; Ushakov Vasily Ya.; Kharlov Nikolay N.

2015-01-01

The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment...

Computer-aided analysis of power-electronic systems simulation of a high-voltage power converter

International Nuclear Information System (INIS)

Bordry, F.; Isch, H.W.; Proudlock, P.

1987-01-01

In the study of semiconductor devices, simulation methods play an important role in both the design of systems and the analysis of their operation. The authors describe a new and efficient computer-aided package program for general power-electronic systems. The main difficulty when taking into account non-linear elements, such as semiconductors, lies in determining the existence and the relations of the elementary sequences defined by the conduction or nonconduction of these components. The method does not require a priori knowledge of the state sequences of the semiconductor nor of the commutation instants, but only the circuit structure, its parameters and the commands to the controlled switches. The simulation program computes automatically both transient and steady-state waveforms for any circuit configuration. The simulation of a high-voltage power converter is presented, both for its steady-state and transient overload conditions. This 100 kV power converter (4 MW) will feed two klystrons in parallel

76 FR 79206 - Commercial Renewable Energy Transmission on the Outer Continental Shelf (OCS) Offshore Mid...

Science.gov (United States)

2011-12-21

...-circuit, high-voltage direct current (HVDC) transmission line that would collect power generated by wind...-voltage alternating current into HVDC using voltage sourced converters. Each offshore converter platform... transmission grid at up to seven locations where AWC terrestrial converter stations would convert the HVDC...

Voltage resonant inverter as a power source

OpenAIRE

Lupenko, Anatoliy; Stakhiv, Petro

2014-01-01

The operation mode of a voltage resonant inverter as a power source with variable load is analyzed. In order to reduce load power variations, an approach to development of the inverter’s load power response based on providing similar positive and negative power deviations from its nominal value has been proposed. The design procedure for resonant inverter with open loop structure as a power source has been elaborated. For a high pressure sodium lamp as a load, the power deviation of about 4% ...

A closed loop wireless power transmission system using a commercial RFID transceiver for biomedical applications.

Science.gov (United States)

Kiani, Mehdi; Ghovanloo, Maysam

2009-01-01

This paper presents a standalone closed loop wireless power transmission system that is built around a commercial off-the-shelf (COTS) radio frequency identification (RFID) transceiver (MLX90121) operating at 13.56 MHz. It can be used for inductively powering implantable biomedical devices in a closed loop fashion. Any changes in the distance and misalignment between transmitter and receiver coils in near-field wireless power transmission can cause a significant change in the received power, which can cause either malfunction or excessive heat dissipation. RFID transceivers are often used open loop. However, their back telemetry capability can be utilized to stabilize the received voltage on the implant. Our measurements showed that the delivered power to the transponder was maintained at 1.48 mW over a range of 6 to 12 cm, while the transmitter power consumption changed from 0.3 W to 1.21 W. The closed loop system can also oppose voltage variations as a result of sudden changes in load current.

Power transfer capability assessment of transmission interfaces with SVC and load shedding systems

Energy Technology Data Exchange (ETDEWEB)

Pavlovsky, V. [DMCC-Engineering, Kiev (Ukraine). Inst. of Electrodynamics; Dolzhenitsa, Y. [DMCC Engineering, Kiev (Ukraine); Ushapovskiy, K. [National Power Co. Ukrenergo, Kiev (Ukraine)

2009-07-01

As a result of deregulation in the power industry, energy trade and markets are pushing transmission system operators to operate their systems closer to the edge of the power transfer capability. Voltage instability and inadequate reactive power support of generators is a key factor in most major outages around the world. The ideal way to control power systems is to avoid emergencies by reliable planning and secure operation of power systems. Therefore, the accurate calculation of the power transfer capability of transmission interfaces is an important task on the planning and operation stages. This paper discussed the issue of transfer capability assessment and monitoring for interfaces with static var compensator (SVC) and load shedding schemes. It also proposed a special measure, a distance to voltage instability point, to monitor transfer capability on-line. The distance may be observed by measurement of SVC output. The paper considered the problem of optimal SVC size selection and a new approach was proposed based on P-V curves analysis. The paper discussed the problem formulation and proposed approach. A case was also presented in order to demonstrate the proposed approach on the IPS Ukraine-Crimea interface. It was concluded that the proposed approach allows the optimal rating of SVC for increasing transfers capability of transmission corridors. 12 refs., 9 figs.

Location of Faults in Power Transmission Lines Using the ARIMA Method

Directory of Open Access Journals (Sweden)

Danilo Pinto Moreira de Souza

2017-10-01

Full Text Available One of the major problems in transmission lines is the occurrence of failures that affect the quality of the electric power supplied, as the exact localization of the fault must be known for correction. In order to streamline the work of maintenance teams and standardize services, this paper proposes a method of locating faults in power transmission lines by analyzing the voltage oscillographic signals extracted at the line monitoring terminals. The developed method relates time series models obtained specifically for each failure pattern. The parameters of the autoregressive integrated moving average (ARIMA model are estimated in order to adjust the voltage curves and calculate the distance from the initial fault localization to the terminals. Simulations of the failures are performed through the ATPDraw ® (5.5 software and the analyses were completed using the RStudio ® (1.0.143 software. The results obtained with respect to the failures, which did not involve earth return, were satisfactory when compared with widely used techniques in the literature, particularly when the fault distance became larger in relation to the beginning of the transmission line.

Electric power transmission for a Hanford Nuclear Energy Center (HNEC)

International Nuclear Information System (INIS)

1975-09-01

The major issues examined in the comparison of the DIST and HNEC transmission concepts are: (1) type of transmission to be employed and an assessment of its technical feasibility, (2) availability of rights-of-way, (3) economics, (4) environmental impact, and (5) overall reliability of the transmission system. The type of transmission selected for bulk power transfer from an HNEC for the time period studied is overhead AC, 500 kV double or single circuit, a voltage currently used in the PNW system. This type of system can accommodate growth up to at least 23,000 MW of thermal capacity at an HNEC. Significant additional transmountain capacity needs would require 1100 kV transmission, which should be technologically proved by the end of the 1970s. (auth)

Modelling of long High Voltage AC Cables in the Transmission System

DEFF Research Database (Denmark)

Gudmundsdottir, Unnur Stella

: conductor-insulation (with or without SC layers)-conductor-insulation(-conductor-insulation), whereas a transmission line single core XLPE cable will normally have the configuration: conductor-SC layerinsulation-SC layer-conductor-SC layer-conductor-insulation. Furthermore the existing cable models use......, EMTDC/PSCAD is provided. A typical HV AC underground power cable is formed by 4 main layers, namely; Conductor-Insulation-Screen-Insulation. In addition to these main layers, the cable also has semiconductive screens, swelling tapes and metal foil. For high frequency modelling in EMT-based software......-SC layer-solid hollow conductor) is implemented in the model. These improvements result in a more correct series impedance and hence a more correct damping of the simulations. Even though the series impedance is more correct, it does still not include the proximity effect and high frequency oscillations...

Design and application of the high-voltage DC power-supply control system based on PLC

International Nuclear Information System (INIS)

Huang Yiyun; Zheng Guanghua; Wu Junshuan; Yang Chunsheng; Hu Huaichuan

2002-03-01

The design and application of A kind of high-voltage DC power-supply control system based on PLC is referred, in addition, KingView is used to monitor the system in real time and manage the man-machine conversation ideally

Audio-frequency noise emissions from high-voltage overhead power lines

International Nuclear Information System (INIS)

Semmler, M.; Straumann, U.; Roero, C.; Teich, T. H.

2005-01-01

This article discusses the noise-emissions caused by high-voltage overhead power lines that can occur under certain atmospheric conditions. These emissions, caused by electric discharges around the conductors, can achieve disturbing values, depending on the conditions prevailing at the time in question. The causes of the discharges are examined and the ionisation processes involved are looked at. The parameters influencing the discharges are discussed and measures that can be taken to reduce such audio-frequency emissions are looked at. The authors note that a reduction of peripheral field strengths can reduce emissions and that hydrophilic coatings can lead to faster reduction of such effects after rainfall

Online high voltage power supply ripple estimation and feedforward in LEDA

International Nuclear Information System (INIS)

Kwon, S.; Regan, A.; Wang, Y.M.; Rohlev, T.

1999-01-01

The Low Energy Demonstration Accelerator (LEDA) being constructed at Los Alamos National Laboratory will serve as the prototype for the low energy section of Acceleration Production of Tritium (APT) accelerator. This paper addresses the problem of LLRF control system for LEDA. They propose an estimator of the ripple and its time derivative and a control law which is based on PID control and adaptive feedforward of estimated ripple. The control law reduces the effect of the deterministic cathode ripple that is due to high voltage power supply and achieves tracking of desired set points

Using a Voltage Domain Programmable Technique for Low-Power Management Cell-Based Design

Directory of Open Access Journals (Sweden)

Ching-Hwa Cheng

2011-09-01

Full Text Available The Multi-voltage technique is an effective way to reduce power consumption. In the proposed cell-based voltage domain programmable (VDP technique, the high and low voltages applied to logic gates are programmable. The flexible voltage domain reassignment allows the chip performance and power consumption to be dynamically adjusted. In the proposed technique, the power switches possess the feature of flexible programming after chip manufacturing. This VDP method does not use an external voltage regulator to regulate the supply voltage level from outside of the chip but can be easily integrated within the design. This novel technique is proven by use of a video decoder test chip, which shows 55% and 61% power reductions compared to conventional single-Vdd and low-voltage designs, respectively. This power-aware performance adjusting mechanism shows great power reduction with a good power-performance management mechanism.

To Solution of Classical Problem Pertaining to Magnetic Interference of Overhead Power Transmission Line on Extended Conducting Communications

Directory of Open Access Journals (Sweden)

V. I. Glushko

2013-01-01

Full Text Available The paper considers a problem pertaining to magnetic interference of overhead power transmission lines and high-voltage bus bars of electrical installations on extended conducting communications and secondary circuits of relay protection and automation. A simplified task solution has been obtained on the basis of the Carson integral approximation.

Coordinated voltage control in offshore HVDC connected cluster of wind power plants

DEFF Research Database (Denmark)

Sakamuri, Jayachandra Naidu; Rather, Zakir Hussain; Rimez, Johan

This paper presents a coordinated voltage control scheme (CVCS) for a cluster of offshore wind power plants connected to a voltage-source converter-based high-voltage direct current system. The primary control point of the proposed voltage control scheme is the introduced Pilot bus, which is having...... by dispatching reactive power references to each wind turbine (WT) in the wind power plant cluster based on their available reactive power margin and network sensitivity-based participation factors, which are derived from the dV/dQ sensitivity of a WT bus w.r.t. the Pilot bus. This method leads...

High voltage electricity installations a planning perspective

CERN Document Server

Jay, Stephen Andrew

2006-01-01

The presence of high voltage power lines has provoked widespread concern for many years. High Voltage Electricity Installations presents an in-depth study of policy surrounding the planning of high voltage installations, discussing the manner in which they are percieved by the public, and the associated environmental issues. An analysis of these concerns, along with the geographical, environmental and political influences that shape their expression, is presented. Investigates local planning policy in an area of the energy sector that is of highly topical environmental and public concern Cover

Cable Insulation Breakdowns in the Modulator with a Switch Mode High Voltage Power Supply

CERN Document Server

Cours, A

2004-01-01

The Advanced Photon Source modulators are PFN-type pulsers with 40 kV switch mode charging power supplies (PSs). The PS and the PFN are connected to each other by 18 feet of high-voltage (HV) cable. Another HV cable connects two separate parts of the PFN. The cables are standard 75 kV x-ray cables. All four cable connectors were designed by the PS manufacturer. Both cables were operating at the same voltage level (about 35 kV). The PS’s output connector has never failed during five years of operation. One of the other three connectors failed approximately five times more often than the others. In order to resolve the failure problem, a transient analysis was performed for all connectors. It was found that transient voltage in the connector that failed most often was subjected to more high-frequency, high-amplitude AC components than the other three connectors. It was thought that these components caused partial discharge in the connector insulation and led to the insulation breakdown. Modification o...

A high power, tunable free electron maser for fusion

Energy Technology Data Exchange (ETDEWEB)

Urbanus, W.H.; Bratman, V.L.; Bongers, W.A.; Caplan, M.; Denisov, G.G.; Geer, C.A.J. van der; Manintveld, P.; Militsyn, B.; Oomens, A.A.M.; Poelman, A.J.; Plomp, J.; Pluygers, J.; Savilov, A.V.; Smeets, P.H.M.; Sterk, A.B.; Verhoeven, A.G.A

2001-01-01

The Fusion-FEM experiment, a high-power, electrostatic free-electron maser being built at the FOM-Institute for Plasma Physics 'Rijnhuizen', is operated at various frequencies. So far, experiments were done without a depressed collector, and the pulse length was limited to 12 {mu}s. Nevertheless, many aspects of generation of mm-wave power have been explored, such as the dependency on the electron beam energy and beam current, and cavity settings such as the feedback coefficient. An output power of 730 kW at 206 GHz is generated with a 7.2 A, 1.77 MeV electron beam, and 360 kW at 167 GHz is generated with a 7.4 A, 1.61 MeV electron beam. It is shown experimentally and by simulations that, depending on the electron beam energy, the FEM can operate in single-frequency regime. The next step of the FEM experiment is to reach a pulse length of 100 ms. The major part of the beam line, the high voltage systems, and the collector have been completed. The undulator and mm-wave cavity are now at high voltage (2 MV). The new mm-wave transmission line, which transports the mm-wave output power from the high-voltage terminal to ground and outside the pressure tank, has been tested at low power.

Cryogenic System for a High-Temperature Superconducting Power Transmission Cable

International Nuclear Information System (INIS)

Demko, J.A.; Gouge, M.J.; Hughey, R.L.; Lue, J.W.; Martin, R.; Sinha, U.; Stovall, J.P.

1999-01-01

High-temperature superconducting (HTS) cable systems for power transmission are under development that will use pressurized liquid nitrogen to provide cooling of the cable and termination hardware. Southwire Company and Oak Ridge National Laboratory have been operating a prototype HTS cable system that contains many of the typical components needed for a commercial power transmission application. It is being used to conduct research in the development of components and systems for eventual commercial deployment. The cryogenic system was built by Air Products and Chemicals, Allentown, Pennsylvania, and can circulate up to 0.35 kg/s of liquid nitrogen at temperatures as low as 67 K at pressures of 1 to 10 bars. Sufficient cooling is provided for testing a 5-m-long HTS transmission cable system that includes the terminations required for room temperature electrical connections. Testing of the 5-m HTS transmission cable has been conducted at the design ac conditions of 1250 A and 7.5 kV line to ground. This paper contains a description of the essential features of the HTS cable cryogenic system and performance results obtained during operation of the system. The salient features of the operation that are important in large commercial HTS cable applications will be discussed

Design of the corona current measurement sensor with wide bandwidth under dc ultra-high-voltage environment

International Nuclear Information System (INIS)

Liu, Yingyi; Yuan, Haiwen; Yang, Qinghua; Cui, Yong

2011-01-01

The research in the field of corona discharge, which is one of the key technologies, can help us to realize ultra-high-voltage (UHV) power transmission. This paper proposes a new sampling resistance sensor to measure the dc UHV corona current in a wide band. By designing the structural and distributed parameters of the sensor, the UHV dielectric breakdown performance and the wide-band measuring characteristics of the sensor are satisfied. A high-voltage discharge test shows that the designed sensor can work under a 1200 kV dc environment without the occurrence of corona discharge. A frequency characteristic test shows that the measuring bandwidth of the sensor can be improved from the current 4.5 to 20 MHz. The test results in an actual dc UHV transmission line demonstrate that the sensor can accurately measure the corona current under the dc UHV environment

Physicochemical assessment criteria for high-voltage pulse capacitors

Energy Technology Data Exchange (ETDEWEB)

Darian, L. A., E-mail: LDarian@rambler.ru; Lam, L. Kh. [National Research University, Moscow Power Engineering Institute (Russian Federation)

2016-12-15

In the paper, the applicability of decomposition products of internal insulation of high-voltage pulse capacitors is considered (aging is the reason for decomposition products of internal insulation). Decomposition products of internal insulation of high-voltage pulse capacitors can be used to evaluate their quality when in operation and in service. There have been three generations of markers of aging of insulation as in the case with power transformers. The area of applicability of markers of aging of insulation for power transformers has been studied and the area can be extended to high-voltage pulse capacitors. The research reveals that there is a correlation between the components and quantities of markers of aging of the first generation (gaseous decomposition products of insulation) dissolved in insulating liquid and the remaining life of high-voltage pulse capacitors. The application of markers of aging to evaluate the remaining service life of high-voltage pulse capacitor is a promising direction of research, because the design of high-voltage pulse capacitors keeps stability of markers of aging of insulation in high-voltage pulse capacitors. It is necessary to continue gathering statistical data concerning development of markers of aging of the first generation. One should also carry out research aimed at estimation of the remaining life of capacitors using markers of the second and the third generation.

Physicochemical assessment criteria for high-voltage pulse capacitors

International Nuclear Information System (INIS)

Darian, L. A.; Lam, L. Kh.

2016-01-01

In the paper, the applicability of decomposition products of internal insulation of high-voltage pulse capacitors is considered (aging is the reason for decomposition products of internal insulation). Decomposition products of internal insulation of high-voltage pulse capacitors can be used to evaluate their quality when in operation and in service. There have been three generations of markers of aging of insulation as in the case with power transformers. The area of applicability of markers of aging of insulation for power transformers has been studied and the area can be extended to high-voltage pulse capacitors. The research reveals that there is a correlation between the components and quantities of markers of aging of the first generation (gaseous decomposition products of insulation) dissolved in insulating liquid and the remaining life of high-voltage pulse capacitors. The application of markers of aging to evaluate the remaining service life of high-voltage pulse capacitor is a promising direction of research, because the design of high-voltage pulse capacitors keeps stability of markers of aging of insulation in high-voltage pulse capacitors. It is necessary to continue gathering statistical data concerning development of markers of aging of the first generation. One should also carry out research aimed at estimation of the remaining life of capacitors using markers of the second and the third generation.

Alternative Solder Bond Packaging Approach for High-Voltage (HV) Pulsed Power Devices

Science.gov (United States)

2016-09-01

triggered into the ON-state with a fiber - optic transmitter once the capacitor has been charged up to the desired voltage of choice with a power supply...substrate, which results in a much higher conductivity compared to highly doped p-type substrates in SiC (Fig. 1). The anode layer was etched using...reactive ion etch and then the mesa of the device was etched for total isolation. The gate contact implant was followed using nitrogen in a box

Prediction of the Voltage Quality in an Overhead Transmission Line with Distributed Parameters

Directory of Open Access Journals (Sweden)

Bulyga Leonid L.

2015-01-01

Full Text Available The present work is devoted to investigation of an electrical transmission line with allowance for distributed parameters. From the results of voltage measurements at terminals of an actual transmission line, effective values of the voltage are calculated for every line section. Special attention is given to higher harmonics and asymmetry. Spectral composition of the voltage is presented and changes in values of harmonic components are analyzed. The effect of higher harmonics on the equipment operation is analyzed.

Design of embedded control system for high-power tetrode modulator

International Nuclear Information System (INIS)

Tu Rui; Yao Lieying; Xuan Weimin

2010-01-01

The design of embedded control system for the high-power tetrode modulator and its test results are given. This control system is a closed-loop feedback system based on the DSP and embedded into the high-voltage modulator. A new modified method of VF fiber transmission is used in the embedded control system. The new method improves the speed of the transmission of feedback system. The results of the experiment demonstrate that the embedded feedback control system greatly increases the response speed of the whole system and improves the performance of the high-power tetrode on the HL-2A tokamak. This embedded feedback control system greatly simplifies the complexity of the original centralized control system. The operation of the control system is reliable. (authors)

Study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission from overhead High-Voltage Transmission Lines

International Nuclear Information System (INIS)

Parthasarathy, S.R.; Roha Tukimin; Wan Saffiey Wan Abdullah; Zulkifli Yusof; Mohd Azizi Mohd Jali

2016-01-01

The paper highlights the study on the Extremely Low Frequency (ELF) Electromagnetic Field (EMF) emission performed at an overhead 275-kV High-Voltage Transmission Lines. The study comprised of assessment at the transmission lines on 3 different cases and locations in Klang Valley, specifically on a vacant land near the transmission line, inside and around the house at the vicinity of the transmission line and the area directly under the transmission line. The instrument setup and measurement protocols during the assessment were adopted from standard measurement method and procedures stipulated under the Institute of Electrical and Electronics Engineers (IEEE) Standard. The results were compared with the standards recommended in the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. The results showed that the measured field strengths are within the safety limit with the highest measured exposure was 10.8 % and 1.8 % of the permissible exposure limit for the electric and magnetic field respectively. Both the field strengths were found to drop significantly against distance from the transmission lines where closer distances showed higher field strengths. Furthermore, the study revealed that buildings and other object such as trees and shrubs screen out the electric field, resulting in a lower value at indoor measurements and near the stated objects. In addition, higher value of electric and magnetic field strengths were recorded when assessment was being done directly under the transmission line compared to the lateral measurement. (author)

High voltage, high power operation of the plasma erosion opening switch

International Nuclear Information System (INIS)

Neri, J.M.; Boller, J.R.; Ottinger, P.F.; Weber, B.V.; Young, F.C.

1987-01-01

A Plasma Erosion Opening Switch (PEOS) is used as the opening switch for a vacuum inductive storage system driven by a 1.8-MV, 1.6-TW pulsed power generator. A 135-nH vacuum inductor is current charged to ∼750 kA in 50 ns through the closed PEOS which then opens in <10 ns into an inverse ion diode load. Electrical diagnostics and nuclear activations from ions accelerated in the diode yield a peak load voltage (4.25 MV) and peak load power (2.8 TW) that are 2.4 and 1.8 times greater than ideal matched load values for the same generator pulse

Preparation of Power Distribution System for High Penetration of Renewable Energy Part I. Dynamic Voltage Restorer for Voltage Regulation Pat II. Distribution Circuit Modeling and Validation

Science.gov (United States)

Khoshkbar Sadigh, Arash

Part I: Dynamic Voltage Restorer In the present power grids, voltage sags are recognized as a serious threat and a frequently occurring power-quality problem and have costly consequence such as sensitive loads tripping and production loss. Consequently, the demand for high power quality and voltage stability becomes a pressing issue. Dynamic voltage restorer (DVR), as a custom power device, is more effective and direct solutions for "restoring" the quality of voltage at its load-side terminals when the quality of voltage at its source-side terminals is disturbed. In the first part of this thesis, a DVR configuration with no need of bulky dc link capacitor or energy storage is proposed. This fact causes to reduce the size of the DVR and increase the reliability of the circuit. In addition, the proposed DVR topology is based on high-frequency isolation transformer resulting in the size reduction of transformer. The proposed DVR circuit, which is suitable for both low- and medium-voltage applications, is based on dc-ac converters connected in series to split the main dc link between the inputs of dc-ac converters. This feature makes it possible to use modular dc-ac converters and utilize low-voltage components in these converters whenever it is required to use DVR in medium-voltage application. The proposed configuration is tested under different conditions of load power factor and grid voltage harmonic. It has been shown that proposed DVR can compensate the voltage sag effectively and protect the sensitive loads. Following the proposition of the DVR topology, a fundamental voltage amplitude detection method which is applicable in both single/three-phase systems for DVR applications is proposed. The advantages of proposed method include application in distorted power grid with no need of any low-pass filter, precise and reliable detection, simple computation and implementation without using a phased locked loop and lookup table. The proposed method has been verified

Experimental Investigation of the Corona Discharge in Electrical Transmission due to AC/DC Electric Fields

Directory of Open Access Journals (Sweden)

Fuangpian Phanupong

2016-01-01

Full Text Available Nowadays, using of High Voltage Direct Current (HVDC transmission to maximize the transmission efficiency, bulk power transmission, connection of renewable power source from wind farm to the grid is of prime concern for the utility. However, due to the high electric field stress from Direct Current (DC line, the corona discharge can easily be occurred at the conductor surface leading to transmission loss. Therefore, the polarity effect of DC lines on corona inception and breakdown voltage should be investigated. In this work, the effect of DC polarity and Alternating Current (AC field stress on corona inception voltage and corona discharge is investigated on various test objects, such as High Voltage (HV needle, needle at ground plane, internal defect, surface discharge, underground cable without cable termination, cable termination with simulated defect and bare overhead conductor. The corona discharge is measured by partial discharge measurement device with high-frequency current transformer. Finally, the relationship between supply voltage and discharge intensity on each DC polarity and AC field stress can be successfully determined.

Control strategy and hardware implementation for DC–DC boost power circuit based on proportional–integral compensator for high voltage application

Directory of Open Access Journals (Sweden)

Sanjeevikumar Padmanaban

2015-06-01

Full Text Available For high-voltage (HV applications, the designers mostly prefer the classical DC–DC boost converter. However, it lacks due to the limitation of the output voltage by the gain transfer ratio, decreased efficiency and its requirement of two sensors for feedback signals, which creates complex control scheme with increased overall cost. Furthermore, the output voltage and efficiency are reduced due to the self-parasitic behavior of power circuit components. To overcome these drawbacks, this manuscript provides, the theoretical development and hardware implementation of DC–DC step-up (boost power converter circuit for obtaining extra output-voltage high-performance. The proposed circuit substantially improves the high output-voltage by voltage-lift technology with a closed loop proportional–integral controller. This complete numerical model of the converter circuit including closed loop P-I controller is developed in simulation (Matlab/Simulink software and the hardware prototype model is implemented with digital signal processor (DSP TMS320F2812. A detailed performance analysis was carried out under both line and load regulation conditions. Numerical simulation and its verification results provided in this paper, prove the good agreement of the circuit with theoretical background.

Low cost concepts to reduce the voltage ripple of the DC power supply

International Nuclear Information System (INIS)

Cheng, Y.; Liu, K.B.

1993-01-01

If the gain of current feedback is low, the short term stability of magnet power supply will be affected by a soft power line. Typically, the step-charge and the imbalance of the three phase power line cause the most serious voltage ripple. Usually, the voltage feedback with a coupling transformer is considered to reduce the voltage ripple. However, for the high current power supply, the space and cooling problem of the coupling transformer become inconvenient. In this paper, the authors suggest to use the toroidal core with the compensation winding, working like a DCCT, as the coupling transformer. Then, a high speed detector of the AC line level is developed. It restricts the voltage ripple passing to the coupling transformer. These methods have the advantage of small size, low power consumption and low cost

Mathematical modeling of agricultural fires beneath high voltage transmission lines

International Nuclear Information System (INIS)

El-Zohri, Emad H.; Shafey, Hamdy M.; Abdel-Salam, M.; Ahmed, A.

2011-01-01

This paper presents a mathematical model for agricultural fires based on a multi-phase formulation. The model includes dehydration and pyrolysis of agricultural fuel and pyrolysis products. The model considers a homogeneous distribution of the agricultural solid fuel particles, interacting with the gas flow via source terms. These terms include: drag forces, production of water vapour and pyrolysis products, radiative and convective heat exchange. A multi-phase radiative transfer equation for absorbing-emitting medium is considered to account for the radiative heat exchange between the gas and solid phases of the fire. The main outputs of the present model are most important to study the influence of agricultural fire occurring beneath high voltage transmission lines. The agricultural fire causes a flashover due to the ambient temperature rise and soot accumulation on the insulator of these transmission lines. Numerical results of the present model are obtained for flat grassland fires to study the effects of wind velocity, solid fuel moisture content and ignition length on some selected fire outputs. These outputs include the temperature, velocity, soot volume fraction fields of the gas phase, together with fire propagation rate and flame geometry. The numerical results are compared to the available experimental work in the literature. -- Research highlights: → The model is sensitive to the initial condition of the ignition length affecting the fire propagation rate and width. → The model predicts the effects of both the wind velocity and the fuel moisture content on fire propagation rate, in agreement with the available experimental work in the literature. → The model shows that both the wind velocity and the fuel moisture content are important factors affecting the fire plume thickness, location, and inclination. → The model is able to visualize the flame geometry through tracing radiative heat rates exceeding a threshold value for flame visibility (60 k

Study on profits and the financial position of the Dutch power transmission system operator Tennet 2005-2009

International Nuclear Information System (INIS)

2010-12-01

A study has been conducted into the profits of the grid operator of the Dutch national high-voltage power transmission system operator TenneT in the years 2005 to 2009. Also attention is paid to the financial position of TenneT. These results are taken into account with regard to method decisions for TenneT in the fifth regulatory period. [nl

Voltage adjusting characteristics in terahertz transmission through Fabry-Pérot-based metamaterials

Directory of Open Access Journals (Sweden)

Jun Luo

2015-10-01

Full Text Available Metallic electric split-ring resonators (SRRs with featured size in micrometer scale, which are connected by thin metal wires, are patterned to form a periodically distributed planar array. The arrayed metallic SRRs are fabricated on an n-doped gallium arsenide (n-GaAs layer grown directly over a semi-insulating gallium arsenide (SI-GaAs wafer. The patterned metal microstructures and n-GaAs layer construct a Schottky diode, which can support an external voltage applied to modify the device properties. The developed architectures present typical functional metamaterial characters, and thus is proposed to reveal voltage adjusting characteristics in the transmission of terahertz waves at normal incidence. We also demonstrate the terahertz transmission characteristics of the voltage controlled Fabry-Pérot-based metamaterial device, which is composed of arrayed metallic SRRs. To date, many metamaterials developed in earlier works have been used to regulate the transmission amplitude or phase at specific frequencies in terahertz wavelength range, which are mainly dominated by the inductance-capacitance (LC resonance mechanism. However, in our work, the external voltage controlled metamaterial device is developed, and the extraordinary transmission regulation characteristics based on both the Fabry-Pérot (FP resonance and relatively weak surface plasmon polariton (SPP resonance in 0.025-1.5 THz range, are presented. Our research therefore shows a potential application of the dual-mode-resonance-based metamaterial for improving terahertz transmission regulation.

130 kV 130 A High voltage switching mode power supply for neutral beam plasma heating: design issues

International Nuclear Information System (INIS)

Ganuza, D.; Del Rio, J.M.; Garcia, I.; Garcia, F.; Garcia de Madinabeitia, P.; Perez, A.; Zabaleta, J.R.

2003-01-01

The company JEMA has designed and manufactured two High Voltage Switching Mode Power Supplies (HVSMPS), rated at 130 kV dc and 130 A, each of which will feed the accelerator grids of two Positive Ion Neutral Injector (PINI) loads, to be installed at the Joint European Torus (EFDA-JET facility located at Culham, UK). The solution designed by JEMA includes two matching transformers which adapt the 36 kV of the JET AC power distribution network to the required 670 V at the secondary side. Additionally, such transformers provide a 30 deg.phase shift which is required by a 30000 A 12 pulse thyristor rectifier. The obtained and stabilised 650 V feed 120 IGBT invertors, which operate at 2778 Hz with modulated square waveform. Each invertor feeds a High Insulation High Frequency Transformer. The 120 transformers corresponding to one power supply are arranged in three oil filled tanks and provide the main insulation from the low voltage to the high voltage side. The square waveform obtained at the secondary of each transformer is rectified by means of a diode bridge. The connection in series of the 120 diode bridges provides the required 130 kV d.c. at the output. In order to protect the load, a redundant solid state crowbar has been designed. Such short circuiting device is composed of 26 Light Triggered Thyristors (LTTs), connected in series. Electrical simulations have been carried out in order to ensure that the system complies with the requirements of high accuracy and adequate protection of the load. The critical design of the High Voltage-High Frequency Transformers has also required electrostatic simulations of the electric field distribution

DC-bus voltage control of grid-connected voltage source converter by using space vector modulated direct power control under unbalanced network conditions

DEFF Research Database (Denmark)

Xiao, Lei; Huang, Shoudao; Lu, Kaiyuan

2013-01-01

Unbalanced grid voltage will cause large dc-bus voltage ripple and introduce high harmonic current components on the grid side. This will severely threaten the safety of the grid-connected voltage source converter (VSC) and consequently, affect the healthy operation condition of the load. In this......Unbalanced grid voltage will cause large dc-bus voltage ripple and introduce high harmonic current components on the grid side. This will severely threaten the safety of the grid-connected voltage source converter (VSC) and consequently, affect the healthy operation condition of the load....... In this study, a new proportional-integral-resonant (PI-RES) controller-based, space vector modulated direct power control topology is proposed to suppress the dc-bus voltage ripple and in the same time, controlling effectively the instantaneous power of the VSC. A special ac reactive power reference component...... is introduced in the controller, which is necessary in order to reduce the dc-bus voltage ripple and active power harmonics at the same time. The proposed control topology is implemented in the lab. Simulation and experimental results are provided to validate its performance and the analysis presented...

Low-latency video transmission over high-speed WPANs based on low-power video compression

DEFF Research Database (Denmark)

Belyaev, Evgeny; Turlikov, Andrey; Ukhanova, Ann

2010-01-01

This paper presents latency-constrained video transmission over high-speed wireless personal area networks (WPANs). Low-power video compression is proposed as an alternative to uncompressed video transmission. A video source rate control based on MINMAX quality criteria is introduced. Practical...

Design development and testing of high voltage power supply with crowbar protection for IOT based RF amplifier system in VECC

Science.gov (United States)

Thakur, S. K.; Kumar, Y.

2018-05-01

This paper described the detailed design, development and testing of high voltage power supply (‑30 kV, 3.2 A) and different power supplies for biasing electrodes of Inductive Output Tube (IOT) based high power Radio Frequency (RF) amplifier. This IOT based RF amplifier is further used for pursuing research and development activity in superconducting RF cavity project at Variable Energy Cyclotron Centre (VECC) Kolkata. The state-of-the-art technology of IOT-based high power RF amplifier is designed, developed, and tested at VECC which is the first of its kind in India. A high voltage power supply rated at negative polarity of 30 kV dc/3.2 A is required for biasing cathode of IOT with crowbar protection circuit. This power supply along with crowbar protection system is designed, developed and tested at VECC for testing the complete setup. The technical difficulties and challenges occured during the design of cathode power supply, its crowbar protection techniques along with other supported power supplies i.e. grid and ion pump power supplies are discussed in this paper.

Coordinated Control Strategies of VSC-HVDC-Based Wind Power Systems for Low Voltage Ride Through

Directory of Open Access Journals (Sweden)