Park, Suehyun; Joo, Heesun; Kim, Jun Soo
2018-01-31
Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.
Charge migration induced by attosecond pulses in bio-relevant molecules
International Nuclear Information System (INIS)
Calegari, Francesca; Castrovilli, Mattea C; Nisoli, Mauro; Trabattoni, Andrea; Palacios, Alicia; Ayuso, David; Martín, Fernando; Greenwood, Jason B; Decleva, Piero
2016-01-01
After sudden ionization of a large molecule, the positive charge can migrate throughout the system on a sub-femtosecond time scale, purely guided by electronic coherences. The possibility to actively explore the role of the electron dynamics in the photo-chemistry of bio-relevant molecules is of fundamental interest for understanding, and perhaps ultimately controlling, the processes leading to damage, mutation and, more generally, to the alteration of the biological functions of the macromolecule. Attosecond laser sources can provide the extreme time resolution required to follow this ultrafast charge flow. In this review we will present recent advances in attosecond molecular science: after a brief description of the results obtained for small molecules, recent experimental and theoretical findings on charge migration in bio-relevant molecules will be discussed. (topical review)
Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures
Directory of Open Access Journals (Sweden)
Bohinc, K.
2014-03-01
Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.
Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules
Buyukdagli, Sahin
2016-01-01
We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...
Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery
2007-07-01
Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can
International Nuclear Information System (INIS)
Okuno, Kazuhiko
2007-04-01
Systematic cross section measurements for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions in low energy collisions with atoms and molecules have been performed continuously by the identical apparatus installed with an octo-pole ion beam guide (OPIG) since 1980 till 2004. Recently, all of accumulated cross section data for a hundred collision systems has been entered into CMOL and CHART of the NIFS atomic and molecular numerical database together with some related cross section data. In this present paper, complicated ion-molecule reactions in hydrogen systems are revealed and the brief outlines of specific properties in low energy charge transfer collisions of multiply charged ions with atoms and molecules are introduced. (author)
International Nuclear Information System (INIS)
Kim, Eunae; Yeom, Min Sun
2014-01-01
Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge
Optical Spectroscopy Of Charged Quantum Dot Molecules
Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.
2007-04-01
Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.
DEFF Research Database (Denmark)
Meneau, Aurélie Y. B.; Olivier, Yoann; Backlund, Tomas
2016-01-01
In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld-effect tran......In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld......-effect transistor and CMS measurements as a function of temperature that in certain molecular semiconductors, such as solution-processible pentacene, charge carriers become trapped at low temperatures in environments in which the charges become highly localized on individual molecules, while in some other molecules...
Anisotropy in highly charged ion induced molecule fragmentation
International Nuclear Information System (INIS)
Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.
2006-01-01
Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)
Modulation and Control of Charge Transport Through Single-Molecule Junctions.
Wang, Kun; Xu, Bingqian
2017-02-01
The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge
Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.
2016-01-01
Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and
International Nuclear Information System (INIS)
Aleksanyan, V.T.; Samvelyan, S.Kh.
1984-01-01
General principles of plotting the parametric theory of IR spectrum intensities of polyatomic molecules are outlined. The development of the effective charges model in this theory is considered and the mathematical formalism of the first approximation of the method of effective atom charges is described in detail. The results of calculations of charges distribution in the Mo(CO) 6 , W(CO) 6 , Cp 2 V, Cp 2 Ru and others (Cp-cyclopentadiene), performed in the frame work of the outlined scheme are presented. It is shown that in the investigated carbonyles the effective charge on oxygen and metal atoms is negative, on carbon atom - positive. In dicyclopentavienyl complexes the effective charge on the metal atom is positive and is not over 0.6e; charge values on hydrogen and carbon atoms do not exceed, 0.10-0.15e. The notions of ''electrovalence'' of coordination bond and charge distribution in the case of metallocenes are not correlated
Mezey, Paul G.
2017-11-01
Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.
Directory of Open Access Journals (Sweden)
Oleg Meshcheryakov
2010-01-01
Full Text Available In humid air, the substantial charge-dipole attraction and electrostatic acceleration of surrounding water vapour molecules towards charged combustible nanoparticles cause intense electrostatic hydration and preferential oxidation of these nanoparticles by electrostatically accelerated polar water vapour molecules rather than nonaccelerated nonpolar oxygen gas molecules. Intense electrostatic hydration of charged combustible nanoparticles converts the nanoparticle's oxide-based shells into the hydroxide-based electrolyte shells, transforming these nanoparticles into reductant/air core-shell nanobatteries, periodically short-circuited by intraparticle field and thermionic emission. Partially synchronized electron emission breakdowns within trillions of nanoparticles-nanobatteries turn a cloud of charged nanoparticles-nanobatteries into a powerful radiofrequency aerosol generator. Electrostatic oxidative hydration and charge-catalyzed oxidation of charged combustible nanoparticles also contribute to a self-oscillating thermocycling process of evolution and periodic autoignition of inflammable gases near to the nanoparticle's surface. The described effects might be of interest for the improvement of certain nanotechnological heterophase processes and to better understand ball lightning phenomenon.
International Nuclear Information System (INIS)
Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.; Kuklja, Maija M.
2007-01-01
The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO 2 bond fission and C-NO 2 to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed
International Nuclear Information System (INIS)
Hedegard, Per; Bjornholm, Thomas
2005-01-01
The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond
Electron stereodynamics in coulomb explosion of molecules by slow highly charged ions
International Nuclear Information System (INIS)
Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko
2008-01-01
The three-center Coulombic over-the-barrier model is developed for Coulomb explosion of a homonuclear diatomic molecule in collisions with a slow (∼10 eV/amu) highly charged ion. A conventional two-step picture of multiple electron transfer followed by Coulomb explosion is far from appropriate because the molecule sets out to dissociate before the incident ion approaches the closest distance. We treat the formation of a quasi-molecule and its decay into the three moving atomic ions. Charge-asymmetric population between fragment ions observed in a triple-coincidence measurement is suggested to reflect the bond elongation during a collision. Collisions of Kr 8+ + N 2 are analyzed. (author)
Large tunable image-charge effects in single-molecule junctions.
Perrin, M.L.; Verzijl, C.J.; Martin, C.A.; Shaikh, A.J.; Eelkema, R.; Esch, J.H. van; Ruitenbeek, J.M. van; Thijssen, J.M.; Zant, H.S. van der; Dulic, D.
2013-01-01
Metal/organic interfaces critically determine the characteristics of molecular electronic devices, because they influence the arrangement of the orbital levels that participate in charge transport. Studies on self-assembled monolayers show molecule-dependent energy-level shifts as well as
Gowda, Srivardhan Shivappa
Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was
The effect of the charge density on the dipole moment of diatomic molecules
International Nuclear Information System (INIS)
Rosato, A.; Germano, J.S.E.
1986-01-01
The results of the calculation, using the Variational Cellular Method (VCM), of the electric dipole moment of several diatomic molecules are improved. In previous calculations, the electronic charge density was treated like a spherically symmetric function in the inscribed sphere within each cell and as being the same constant value for all intercellular regions. Since the results obtained with such an approximation have not been satisfactory, an improved approximation for the charge density in the intercellular regions is needed. It is considered that the charge density is still constant outside the inscribed sphere but with different values in each intercellular region. A new expression for the dipole moment is obtained, and applied to the diatomic molecules HF, CO, BF and CS. In addition, the corresponding dipole moment curves, potential energy curves and spectroscopic constants are calculated taking into consideration our approximation and the traditional approximation for the charge density. The results of the two models are compared with each other and with experimental results for all the molecules considered. (Author) [pt
Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.
Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou
2017-08-02
The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.
International Nuclear Information System (INIS)
Usenko, A.S.
1995-01-01
The equilibrium space-inhomogeneous distributions of free and pair bound charged particles are calculated in the dipole approximation for the plasma-molecular cylinder and sphere. It is shown that the space and orientational distributions of charged particles and molecules in these systems are similar to those in the cases of plasma-molecular system restricted by one or two parallel planes. The influence of the parameters of outer medium and a plasma-molecular system on the space and orientational distributions of charged particles and molecules is studied in detail
About the correlation between atomic charge fluctuations in a molecule
International Nuclear Information System (INIS)
Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.
1987-01-01
In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt
Crystal growth of new charge-transfer salts based on π-conjugated donor molecules
Energy Technology Data Exchange (ETDEWEB)
Morherr, Antonia, E-mail: morherr@stud.uni-frankfurt.de [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Witt, Sebastian [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Chernenkaya, Alisa [Graduate School Materials Science in Mainz, 55128 Mainz (Germany); Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bäcker, Jan-Peter [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Schönhense, Gerd [Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bolte, Michael [Institut für anorganische Chemie, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Krellner, Cornelius [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany)
2016-09-01
New charge transfer crystals of π-conjugated, aromatic molecules (phenanthrene and picene) as donors were obtained by physical vapor transport. The melting behavior, optimization of crystal growth and the crystal structure are reported for charge transfer salts with (fluorinated) tetracyanoquinodimethane (TCNQ-F{sub x}, x=0, 2, 4), which was used as acceptor material. The crystal structures were determined by single-crystal X-ray diffraction. Growth conditions for different vapor pressures in closed ampules were applied and the effect of these starting conditions for crystal size and quality is reported. The process of charge transfer was investigated by geometrical analysis of the crystal structure and by infrared spectroscopy on single crystals. With these three different acceptor strengths and the two sets of donor materials, it is possible to investigate the distribution of the charge transfer systematically. This helps to understand the charge transfer process in this class of materials with π-conjugated donor molecules.
Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule
Directory of Open Access Journals (Sweden)
Satoshi Ohmura
2016-01-01
Full Text Available Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC-triethylene glycol (TEG–C60 molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D+ and A- in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.
Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule
Energy Technology Data Exchange (ETDEWEB)
Ohmura, Satoshi, E-mail: s.ohmura.m4@cc.it-hiroshima.ac.jp [Research Center for Condensed Matter Physics, Department of Civil Engineering and Urban Design, Hiroshima Institute of Technology, Hiroshima 731-5193 (Japan); Tsuruta, Kenji [Department of Electrical and Electronic Engineering, Okayama University, Okayama 700-8530 (Japan); Shimojo, Fuyuki [Department of Physics, Kumamoto University, Kumamoto 860-8555 Japan (Japan); Nakano, Aiichiro [Collaboratory for Advanced Computing and Simulations, Department of Computer Science, Department of Physics & Astronomy, Department of Chemical Engineering & Materials Science, Department of Biological Sciences, University of Southern California, CA90089-024 (United States)
2016-01-15
Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC)-triethylene glycol (TEG)–C{sub 60} molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D{sup +} and A{sup -}) in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.
Komsa, Darya N; Staroverov, Viktor N
2016-11-08
Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.
International Nuclear Information System (INIS)
Janev, R.K.; Kato, T.; Wang, J.G.
2001-05-01
The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C x H y charge exchange reactions from thermal energies up to several hundreds keV for all C x H y molecules with x=1, 2, 3 and 1 ≤ y ≤ 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)
International Nuclear Information System (INIS)
Freire-Nordi, Cristina S.; Nascimento, Otaciro R.; Vieira, Armando A.H.; Nakaie, Clovis R.
2006-01-01
The existence of a mucilaginous envelope, sheath or capsule is usual in many desmids, but few data concerning its function are available. Previous studies of the transport function and permeation of molecules through the algae capsules were done using the algae Spondylosium panduriforme and Nephrocytium lunatum, the Electron Paramagnetic Resonance (EPR) technique, and different spin labels. The results suggested that the capsule functions as a selective diffusion medium. In the present work charged and uncharged molecules (spin labels group A) and Staurastrum iversenii var. americanum (Desmids),whose alga presents a great mucilaginous capsule, were used. Charged nitroxide molecules similar to amino acids (spin labels group B) were also used allowing a better understanding of the electrostatic effect in the permeation process across the capsule. The role of the cell capsule in the solute diffusion was evaluated by determining the capsulated and decapsulated cell permeation times. The permeation times for all spin labels tested in the cells lacking capsules were always shorter than those containing this physical barrier. The decay times of spin labels group A observed for S. iversenii were compared to other studied algae. The results regarding the diffusion of charged spin labels group B suggested that the interaction of cell capsule occurs more strongly with negatively charged molecules than with positively charged ones. The results obtained in this work with spin labels group A confirm that the capsule is an essential structure for the cell, and that due to the polar interactions with the spin labels, it plays an important role in the selection of small molecules. Several parameters, mainly those of electrostatic nature, seem to control the permeation across the algal capsules of spin labels group B, showing that structures which are similar to amino acids could diffuse across the interior of the algal cell. (author)
International Nuclear Information System (INIS)
Jean, Y.C.; Yu, C.; Wang, Y.Y.; Yeh, Y.Y.
1984-01-01
Rate constants for positronium atoms reacting chemically with charge-transfer molecules such as p-benzoquinone, nitrobenzene, and coenzyme Q-10 in a model bilayer membrane, dipalmitoylphosphatidylcholine (DPPC), have been measured at temperatures between 23 and 65 0 C. A strong variation of the positronium chemical reactivities, k/sub Ps/ was observed in these systems: k/sub Ps/ increases with increasing temperature until the pretransition temperature of the membrane reaches a maximum value near the main transition temperature and decreases at temperatures higher than the main transition temperature. This variation is interpreted in terms of fluidity and permeability changes associated with the phase transitions of membranes and in terms of charge-transfer-complex formation between the solubilized molecules and the polar head of the membrane. These results demonstrate that positronium and its annihilation characteristics can be employed to investigate charge transport phenomena and microstructural changes of real biological membranes
Energy Technology Data Exchange (ETDEWEB)
Janev, R.K.; Kato, T. [National Inst. for Fusion Science, Toki, Gifu (Japan); Wang, J.G. [Department of Physics and Astronomy, University of Georgia, Athens (United States)
2001-05-01
The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C{sub x}H{sub y} charge exchange reactions from thermal energies up to several hundreds keV for all C{sub x}H{sub y} molecules with x=1, 2, 3 and 1 {<=} y {<=} 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)
Directory of Open Access Journals (Sweden)
Kouji Suemori
2017-04-01
Full Text Available We investigated the influence of the positively charged particles generated during sputtering on the performances of organic light-emitting diodes (OLEDs with Mg:Ag alloy electrodes fabricated by sputtering. The number of positively charged particles increased by several orders of magnitude when the target current was increased from 0.1 A to 2.5 A. When a high target current was used, many positively charged particles with energies higher than the bond energy of single C–C bonds, which are typically found in organic molecules, were generated. In this situation, we observed serious OLED performance degradation. On the other hand, when a low target current was used, OLED performance degradation was not observed when the number of positively charged particles colliding with the organic underlayer increased. We concluded that sputtering damage caused by positively charged particles can be avoided by using a low target current.
Role of molecular charge in nucleocytoplasmic transport.
Directory of Open Access Journals (Sweden)
Alexander Goryaynov
Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.
Surface-confined electroactive molecules for multistate charge storage information.
Mas-Torrent, M; Rovira, C; Veciana, J
2013-01-18
Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.
Exploring Charge Transport in Guest Molecule Infiltrated Cu3(BTC)2 Metal Organic Framework
Energy Technology Data Exchange (ETDEWEB)
Leonard, Francois Leonard [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stavila, Vitalie [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Allendorf, Mark D. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)
2014-09-01
The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu3(BTC)2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu3(BTC)2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holes are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.
Charge transport properties of a twisted DNA molecule: A renormalization approach
Energy Technology Data Exchange (ETDEWEB)
Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)
2016-10-20
In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.
International Nuclear Information System (INIS)
Atterbury, C.; Kennedy, R.A.; Critchley, A.D.J.; Mayhew, C.A.
2002-01-01
Many sequential and parallel chemical reactions involving charged species occur in a plasma. Data needed to model plasma's chemical and physical environment includes cross-section, rate coefficients, and product ion distribution of electron-molecule and ion-molecule processes. Such reactions are studied by our group away from the complexity of the plasma environment, with experimental techniques that allow us to concentrate on a single process, where usually only one or two species are involved. A molecule commonly used in plasma etching applications is SF 6 1,2 . We have performed a series of positive ion-molecule and electron attachment studies on SF 6 and related molecules, including SeF 6 , TeF 6 (i.e. XF 6 molecules), SF 5 CF 3 and SF 5 Cl (i.e. SF 5 X molecules) 3- (. The studies of ion reactions with and electron attachment to SF 6 and physically similar molecules are of value when seeking to understand the ion and electron chemistry occurring in SF 6 containing plasma. The result of these studies are presented in this poster. Ion-molecule reactions. Rate coefficients and ion product branching ratios have been determined with the Selected Ion Flow Tube (SIFT) at room temperature (300 K) for reactions of SF 5 X with the following twenty-two cations; Ne + , F + , Ar + , N 2 + , N + , CO + , CO 2 + , O + , N 2 O + , O 2 + , SF 4 + , CF 2 + , SF + , SF 2 + , NO 2 + , SF 5 + , NO + , CF + , CF 3 + , SF 3 + , and H 3 O + (listed in order of decreasing recombination energy). SF 2 + , NO 2 + , NO + , SF 3 + , and H 3 O + are found to be unreacted with both SF 5 CF 3 and SF 5 Cl. The majority of the other reactions proceed with rate coefficients that are close to the capture value. Those found to occur at rates significantly less than the capture mechanism value re the reactions of O 2 + , SF + , SF 5 + , and CF 3 + with SF 5 CF 3 , and SF 4 + and SF 5 + with SF 5 Cl. Several distinction processes are observed among the large number of reactions studied, including
Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy
International Nuclear Information System (INIS)
Lee, Min Hyung; Song, Hyunwook
2013-01-01
We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects
Long-range charge transport in single G-quadruplex DNA molecules
DEFF Research Database (Denmark)
Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir
2014-01-01
DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...
Storage of charge carriers on emitter molecules in organic light-emitting diodes
Weichsel, Caroline; Burtone, Lorenzo; Reineke, Sebastian; Hintschich, Susanne I.; Gather, Malte C.; Leo, Karl; Lüssem, Björn
2012-08-01
Organic light-emitting diodes (OLEDs) using the red phosphorescent emitter iridium(III)bis(2-methyldibenzo[f,h]quinoxaline) (acetylacetonate) [Ir(MDQ)2(acac)] are studied by time-resolved electroluminescence measurements. A transient overshoot after voltage turn-off is found, which is attributed to electron accumulation on Ir(MDQ)2(acac) molecules. The mechanism is verified via impedance spectroscopy and by application of positive and negative off-voltages. We calculate the density of accumulated electrons and find that it scales linearly with the doping concentration of the emitter. Using thin quenching layers, we locate the position of the emission zone during normal OLED operation and after voltage turn-off. In addition, the transient overshoot is also observed in three-color white-emitting OLEDs. By time- and spectrally resolved measurements using a streak camera, we directly attribute the overshoot to electron accumulation on Ir(MDQ)2(acac). We propose that similar processes are present in many state-of-the-art OLEDs and believe that the quantification of charge carrier storage will help to improve the efficiency of OLEDs.
Anisotropic charge transport in large single crystals of π-conjugated organic molecules.
Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent
2014-05-07
The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.
Kümmel, Stephan
Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.
Bhattacharya, Atanu; Bernstein, Elliot R
2011-10-06
The radical cationic reactivity of the peptide analogue molecule CH(3)CO-Gly-NH(2) is addressed both experimentally and theoretically. The radical cation intermediate of CH(3)CO-Gly-NH(2) is created by single-photon ionization of this molecule at 118.22 nm (~10.5 eV). The two most stable conformers (C(7) and C(5)) of this molecule exhibit different folds along the backbone: the C(7) conformer has a γ-turn structure, and the C(5) conformer has a β-strand structure. The experimental results show that the radical cation intermediate of CH(3)CO-Gly-NH(2) dissociates and generates a fragment-ion signal at 73 amu that is observed through TOFMS. Theoretical results show how the fragment-ion signal at 73 amu is generated by only one conformer of CH(3)CO-Gly-NH(2) (C(7)) and how local charge and specific hydrogen bonding in the molecule influence fragmentation of the radical cation intermediate of CH(3)CO-Gly-NH(2). The specific fold of the molecule controls fragmentation of this reactive radical cation intermediate. Whereas the radical cation of the C(7) conformer dissociates through a hydrogen-transfer mechanism followed by HNCO elimination, the radical cation of the C(5) conformer does not dissociate at all. CASSCF calculations show that positive charge in the radical cationic C(7) conformer is localized at the NH(2)CO moiety of the molecular ion. This site-specific localization of the positive charge enhances the acidity of the terminal NH(2) group, facilitating hydrogen transfer from the NH(2) to the COCH(3) end of the molecular ion. Positive charge in the C(5) conformer of the CH(3)CO-Gly-NH(2) radical cation is, however, localized at the COCH(3) end of the molecular ion, and this conformer does not have enough energy to surmount the energy barrier to dissociation on the ion potential energy surface. CASSCF results show that conformation-specific localization of charge in the CH(3)CO-Gly-NH(2) molecular ion occurs as a result of the different hydrogen
Directory of Open Access Journals (Sweden)
Raúl García
2015-06-01
Full Text Available We describe the synthesis and single-molecule electrical transport properties of a molecular wire containing a π-extended tetrathiafulvalene (exTTF group and its charge-transfer complex with F4TCNQ. We form single-molecule junctions using the in situ break junction technique using a homebuilt scanning tunneling microscope with a range of conductance between 10 G0 down to 10−7 G0. Within this range we do not observe a clear conductance signature of the neutral parent molecule, suggesting either that its conductance is too low or that it does not form a stable junction. Conversely, we do find a clear conductance signature in the experiments carried out on the charge-transfer complex. Due to the fact we expected this species to have a higher conductance than the neutral molecule, we believe this supports the idea that the conductance of the neutral molecule is very low, below our measurement sensitivity. This idea is further supported by theoretical calculations. To the best of our knowledge, these are the first reported single-molecule conductance measurements on a molecular charge-transfer species.
Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K
2014-12-01
The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.
Directory of Open Access Journals (Sweden)
Rebecca Boll
2016-07-01
Full Text Available Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse.
Goli, Mohammad; Shahbazian, Shant
2014-04-14
This report is a primarily survey on the chemical nature of some exotic species containing the positively charged muon and the muonic helium, i.e., the negatively charged muon plus helium nucleus, as exotic isotopes of hydrogen, using the newly developed multi-component quantum theory of atoms in molecules (MC-QTAIM) analysis, employing ab initio non-Born-Oppenhiemer wavefunctions. Accordingly, the "atoms in molecules" analysis performed on various asymmetric exotic isotopomers of the hydrogen molecule, recently detected experimentally [Science, 2011, 331, 448], demonstrates that both the exotic isotopes are capable of forming atoms in molecules and retaining the identity of hydrogen atoms. Various derived properties of atomic basins containing the muonic helium cast no doubt that apart from its short life time, it is a heavier isotope of hydrogen while the properties of basins containing the positively charged muon are more remote from those of the orthodox hydrogen basins, capable of appreciable donation of electrons as well as large charge polarization. However, with some tolerance, they may also be categorized as hydrogen basins though with a smaller electronegativity. All in all, the present study also clearly demonstrates that the MC-QTAIM analysis is an efficient approach to decipher the chemical nature of species containing exotic constituents, which are difficult to elucidate by experimental and/or alternative theoretical schemes.
Charge transport parameters of HBC at different temperatures
Energy Technology Data Exchange (ETDEWEB)
Kirkpatrick, J. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, V.; Kremer, K.; Andrienko, D. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Nelson, J. [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)
2008-05-15
We study the dependence on temperature of the charge transport parameters for hexabenzocoronene (HBC). Following from Marcus theory, two charge transport parameters will be calculated: the transfer integral and the difference in site energies. These parameters are strongly dependent on the orientation and position of molecules. Position and orientation of molecules are determined using molecular dynamics. Transfer integrals are calculated from a simplified INDO method. A technique to compute energetic disorder, that is the spread in site energies for the charge carriers, is developed. In the herringbone phase transfer integrals are higher, but so is energetic disorder. We consider three derivatives of HBC with different side chains, which lead to different phase behaviour and distributions of charge transport parameters. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Energy Technology Data Exchange (ETDEWEB)
Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)
2014-11-16
Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an
Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard
2018-05-01
Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.
International Nuclear Information System (INIS)
Li Yun; Pan Lijia; Pu Lin; Shi Yi; Liu Chuan; Tsukagoshi, Kazuhito
2012-01-01
Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels. (paper)
Li, Yun; Liu, Chuan; Pan, Lijia; Pu, Lin; Tsukagoshi, Kazuhito; Shi, Yi
2012-01-01
Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels.
Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M
2016-04-01
The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.
Structural properties of water around uncharged and charged carbon nanotubes
International Nuclear Information System (INIS)
Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour
2013-01-01
Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules
Energy Technology Data Exchange (ETDEWEB)
Secker, Daniel
2008-06-03
The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)
International Nuclear Information System (INIS)
Farrokhi, S.
1966-01-01
The variation of the double charge-changing collision cross-sections of H + , D + , Li + ions with organic molecules (CH 4 , C 2 H 6 , C 3 H 8 , C 4 H 10 ) in the energy range 10-50 keV has been studied. Several maximums for σ 1-1 = f(E) have been shown. Their existence should be explained by the different possibilities of dissociating the target-molecules. The position of the maximums, for the H + → H - and D + → D - reactions is in good agreement with that defined by the Massey adiabatic relation. (author) [fr
SFG and SPR Study of Sodium Dodecyl Sulfate Film Assembly on Positively Charged Surfaces
Song, Sanghun; Weidner, Tobias; Wagner, Matthew; Castner, David
2012-02-01
This study uses sum frequency generation (SFG) vibrational spectroscopy and surface plasmon resonance (SPR) sensing to investigate the structure of sodium dodecyl sulfate (SDS) films formed on positively charged and hydrophilic surfaces. The SPR signals show a good surface coverage suggesting that full monolayer coverage is reached at 1 mM. SFG spectra of SDS adsorbed exhibits well resolved CH3 peaks and OH peaks. At both 0.2 mM and 1 mM SDS concentration the intensity of both the CH3 and OH peaks decreased close to background levels. We found that the loss of SFG signal at 0.2 mM occurs at this concentration independent of surface charge density. It is more likely that the loss of signal is related to structural inhomogeneity induced by a striped phase - stand-up phase transition. This is supported by a distinct change of the relative SFG phase between CH3/OH near 0.2 mM. The second intensity minimum might be related to charge compensation effects. We observed a substrate dependence for the high concentration transition. We also observed distinct SFG signal phase changes for water molecules associated with SDS layers at different SDS solution concentrations indicating that the orientation of bound water changed with SDS surface structure.
Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung
2005-03-17
Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.
Charging and heat collection by a positively charged dust grain in a plasma.
Delzanno, Gian Luca; Tang, Xian-Zhu
2014-07-18
Dust particulates immersed in a quasineutral plasma can emit electrons in several important applications. Once electron emission becomes strong enough, the dust enters the positively charged regime where the conventional orbital-motion-limited (OML) theory can break down due to potential-well effects on trapped electrons. A minimal modification of the trapped-passing boundary approximation in the so-called OML(+) approach is shown to accurately predict the dust charge and heat collection flux for a wide range of dust size and temperature.
Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda
2006-08-24
The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.
Solvation thermodynamics and heat capacity of polar and charged solutes in water
Sedlmeier, Felix; Netz, Roland R.
2013-03-01
The solvation thermodynamics and in particular the solvation heat capacity of polar and charged solutes in water is studied using atomistic molecular dynamics simulations. As ionic solutes we consider a F- and a Na+ ion, as an example for a polar molecule with vanishing net charge we take a SPC/E water molecule. The partial charges of all three solutes are varied in a wide range by a scaling factor. Using a recently introduced method for the accurate determination of the solvation free energy of polar solutes, we determine the free energy, entropy, enthalpy, and heat capacity of the three different solutes as a function of temperature and partial solute charge. We find that the sum of the solvation heat capacities of the Na+ and F- ions is negative, in agreement with experimental observations, but our results uncover a pronounced difference in the heat capacity between positively and negatively charged groups. While the solvation heat capacity ΔCp stays positive and even increases slightly upon charging the Na+ ion, it decreases upon charging the F- ion and becomes negative beyond an ion charge of q = -0.3e. On the other hand, the heat capacity of the overall charge-neutral polar solute derived from a SPC/E water molecule is positive for all charge scaling factors considered by us. This means that the heat capacity of a wide class of polar solutes with vanishing net charge is positive. The common ascription of negative heat capacities to polar chemical groups might arise from the neglect of non-additive interaction effects between polar and apolar groups. The reason behind this non-additivity is suggested to be related to the second solvation shell that significantly affects the solvation thermodynamics and due to its large spatial extent induces quite long-ranged interactions between solvated molecular parts and groups.
Position Reconstruction and Charge Distribution in LHCb VELO Silicon Sensors
Versloot, TW; Akiba, K; Artuso, M; Van Beuzekom, M; Borel, J; Bowcock, TJV; Buytaert, J; Collins, P; Dumps, R; Dwyer, L; Eckstein, D; Eklund, L; Ferro-Luzzi, M; Frei, R; Gersabek M; Haefeli, G; Hennessy, K; Huse, T; Jans, E; John, M; Ketel, TJ; Keune, A; Lastoviicka, T; Mountain, R; Neufeld, N; Parkes, C; Stone, S; Szumlak, T; Tobin, M; Van Lysebetten, A; Viret, S; De Vries, H; Wang, J
2007-01-01
In 2006, a partially equipped LHCb VELO detector half was characterised in a test beam experiment (Alignment Challenge and Detector Commissioning, ACDC3). The position reconstruction and resolution for 2-strip R-sensor clusters was studied as a function of strip pitch and track inclination on the sensor surface. The Charge Density Distribution (CDD) is derived from the weighted charge distribution. It becomes asymmetric for tracks non-perpendicular to the strip surface. It is shown that the asymmetric broadening of the CDD around the track intercept position results in a linear eta-function at higher angles (>6 degrees). The sensor spatial resolution is determined both using a linear weighted mean of strip charges, as well as a third-order polynomial approximation via a eta-correction. The experimental results are in agreement with previous simulations. Future studies are underway to determine the angle and pitch dependent parameters which will be implemented in the LHCb VELO cluster position software tools.
Positive, Neutral, and Negative Mass-Charges in General Relativity
Directory of Open Access Journals (Sweden)
Borissova L.
2006-07-01
Full Text Available As shown, any four-dimensional proper vector has two observable projections onto time line, attributed to our world and the mirror world (for a mass-bearing particle, the projections posses are attributed to positive and negative mass-charges. As predicted, there should be a class of neutrally mass-charged particles that inhabit neither our world nor the mirror world. Inside the space-time area (membrane the space rotates at the light speed, and all particles move at as well the light speed. So, the predicted particles of the neutrally mass-charged class should seem as light-like vortices.
International Nuclear Information System (INIS)
Wells, E.; Ben-Itzhak, I.; Carnes, K.D.; Krishnamurthi, V.
1996-01-01
The ratio of double- to single-ionization (DI/SI) as well as the ratio of ionization-excitation to single-ionization (IE/SI) in hydrogen molecules was studied by examining the effect of the projectile charge on these processes. The DI/SI and IE/SI ratios were measured using the coincidence time of flight technique at a fixed velocity (1 MeV/amu) over a range of projectile charge states (q = 1-9,14,20). Preliminary results indicate that for a highly charged F 9+ projectile the DI/SI and IE/SI ratios are 6.8% and 24.7%, respectively, a large increase from the ratios of 0.13% and 1.95%, respectively, for H + projectiles. For low charge states, the DI/SI is negligible relative to the IE/SI ratio, while for more highly charged projectiles the DI/SI ratio becomes comparable to the IE/SI ratio. This indicates that double-ionization increases much more rapidly with projectile charge than ionization-excitation
X-ray Pump–Probe Investigation of Charge and Dissociation Dynamics in Methyl Iodine Molecule
Directory of Open Access Journals (Sweden)
Li Fang
2017-05-01
Full Text Available Molecular dynamics is of fundamental interest in natural science research. The capability of investigating molecular dynamics is one of the various motivations for ultrafast optics. We present our investigation of photoionization and nuclear dynamics in methyl iodine (CH3I molecule with an X-ray pump X-ray probe scheme. The pump–probe experiment was realized with a two-mirror X-ray split and delay apparatus. Time-of-flight mass spectra at various pump–probe delay times were recorded to obtain the time profile for the creation of high charge states via sequential ionization and for molecular dissociation. We observed high charge states of atomic iodine up to 29+, and visualized the evolution of creating these high atomic ion charge states, including their population suppression and enhancement as the arrival time of the second X-ray pulse was varied. We also show the evolution of the kinetics of the high charge states upon the timing of their creation during the ionization-dissociation coupled dynamics. We demonstrate the implementation of X-ray pump–probe methodology for investigating X-ray induced molecular dynamics with femtosecond temporal resolution. The results indicate the footprints of ionization that lead to high charge states, probing the long-range potential curves of the high charge states.
Energy Technology Data Exchange (ETDEWEB)
Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.
2016-07-15
We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.
Excitation of atoms and molecules in collisions with highly charged ions
International Nuclear Information System (INIS)
Watson, R.L.
1991-01-01
Much of the work this year has been directed toward studies of charge exchange and ionization in single collisions of heavy ions with gaseous atoms and molecules. A study of the double ionization of He by high energy N 7+ ions, which began last year, was extended up in energy to 40 MeV/amu. These measurements verified the deviations from the predictions of theory observed in our previous work and indicated that the energy required to reach the limiting value of the ratio of double-to-single ionization cross sections may be as high as 70 MeV/amu
Radiation from Accelerating Electric Charges: The Third Derivative of Position
Butterworth, Edward
2010-03-01
While some textbooks appear to suggest that acceleration of an electric charge is both a necessary and sufficient cause for the generation of electromagnetic radiation, the question has in fact had an intricate and involved history. In particular, the acceleration of a charge in hyperbolic motion, the behavior of a charge supported against a gravitational force (and its implications for the Equivalence Principle), and a charge accelerated by a workless constraint have been the subject of repeated investigation. The present paper examines specifically the manner in which the third derivative of position enters into the equations of motion, and the implications this has for the emission of radiation. Plass opens his review article with the statement that ``A fundamental property of all charged particles is that electromagnetic energy is radiated whenever they are accelerated'' (Plass 1961; emphasis mine). His treatment of the equations of motion, however, emphasizes the importance of the occurrence of the third derivative of position therein, present in linear motion only when the rate of acceleration is increasing or decreasing. There appears to be general agreement that the presence of a nonzero third derivative indicates that this charge is radiating; but does its absence preclude radiation? This question leads back to the issues of charges accelerated by a uniform gravitational field. We will examine the equations of motion as presented in Fulton & Rohrlich (1960), Plass (1961), Barut (1964), Teitelboim (1970) and Mo & Papas (1971) in the light of more recent literature in an attempt to clarify this question.
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Electron distributions of the first-row homonuclear diatomic molecules, A2
International Nuclear Information System (INIS)
Ramirez, B.I.; Bielefeld Univ.
1982-08-01
Electron momentum density contour maps of the first-row homonuclear diatomic molecules, A 2 , are obtained from near Hartree-Fock wave functions. Both the total momentum density and momentum density difference (molecule - isolated atoms) maps present trends that may be related to the binding in the molecules. These results are compared with the corresponding charge density maps in position space (Bader, Henneker and Cade 1967). (author)
Maiti, Prabal K.; Bagchi, Biman
2009-12-01
In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.
Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A
2014-10-01
Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the
Williams, Peggy E; Marshall, David L; Poad, Berwyck L J; Narreddula, Venkateswara R; Kirk, Benjamin B; Trevitt, Adam J; Blanksby, Stephen J
2018-06-04
In the gas phase, arylperoxyl forming reactions play a significant role in low-temperature combustion and atmospheric processing of volatile organic compounds. We have previously demonstrated the application of charge-tagged phenyl radicals to explore the outcomes of these reactions using ion trap mass spectrometry. Here, we present a side-by-side comparison of rates and product distributions from the reaction of positively and negatively charge tagged phenyl radicals with dioxygen. The negatively charged distonic radical ions are found to react with significantly greater efficiency than their positively charged analogues. The product distributions of the anion reactions favor products of phenylperoxyl radical decomposition (e.g., phenoxyl radicals and cyclopentadienone), while the comparable fixed-charge cations yield the stabilized phenylperoxyl radical. Electronic structure calculations rationalize these differences as arising from the influence of the charged moiety on the energetics of rate-determining transition states and reaction intermediates within the phenylperoxyl reaction manifold and predict that this influence could extend to intra-molecular charge-radical separations of up to 14.5 Å. Experimental observations of reactions of the novel 4-(1-carboxylatoadamantyl)phenyl radical anion confirm that the influence of the charge on both rate and product distribution can be modulated by increasing the rigidly imposed separation between charge and radical sites. These findings provide a generalizable framework for predicting the influence of charged groups on polarizable radicals in gas phase distonic radical ions. Graphical Abstract.
Theory of Spin States of Quantum Dot Molecules
Ponomarev, I. V.; Reinecke, T. L.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Gammon, D.; Korenev, V. L.
2007-04-01
The photoluminescence spectrum of an asymmetric pair of coupled InAs quantum dots in an applied electric field shows a rich pattern of level anticrossings, crossings and fine structure that can be understood as a superposition of charge and spin configurations. We present a theoretical model that provides a description of the energy positions and intensities of the optical transitions in exciton, biexciton and charged exciton states of coupled quantum dots molecules.
2017-05-22
connecting the three quarks. Composite particles composed of partons are known as “hadrons” and must have a neutral color charge. There are six... neutral charge of neutrons. The up quark has positive charge equivalent to two-thirds the charge of an electron, and the down quark has negative...known as “heavy ions.” An ion is an atom or molecule with net electric charge, bare nuclei have a large positive charge due to the absence of
International Nuclear Information System (INIS)
Chiba, J.; Iwasaki, H.; Kageyama, T.; Kuribayashi, S.; Nakamura, K.; Sumiyoshi, T.; Takeda, T.
1983-01-01
A readout technqiue of multiwire proportional chambers by measurement of charges induced on cathode strips, orthogonal to anode wires, requires an algorithm to relate the measured charge distribution to the avalanche position. With given chamber parameters and under the influence of noise, resolution limits depend on the chosen algorithm. We have studied the position resolution obtained by the centroid method and by the charge-ratio method, both using three consecutive cathode strips. While the centroid method uses a single number, the center of gravity of the measured charges, the charge-ratio method uses the ratios of the charges Qsub(i-1)/Qsub(i) and Qsub(i+1)/Qsub(i) where Qsub(i) is the largest. To obtain a given resolution, the charge-ratio method generally allows wider cathode strips and therefore a smaller number of readout channels than the centroid method. (orig.)
Two-dimensional position sensitive silicon photodiode as a charged particle detector
International Nuclear Information System (INIS)
Kovacevic, K.; Zadro, M.
1999-01-01
A two-dimensional position sensitive silicon photodiode has been tested for measurement of position and energy of charged particles. Position nonlinearity and resolution, as well as energy resolution and ballistic deficit were measured for 5.486 MeV α-particles. The results obtained for different pulse shaping time constants are presented
Where to place the positive muon in the Periodic Table?
Goli, Mohammad; Shahbazian, Shant
2015-03-14
In a recent study it was suggested that the positively charged muon is capable of forming its own "atoms in molecules" (AIM) in the muonic hydrogen-like molecules, composed of two electrons, a muon and one of the hydrogen's isotopes, thus deserves to be placed in the Periodic Table [Phys. Chem. Chem. Phys., 2014, 16, 6602]. In the present report, the capacity of the positively charged muon in forming its own AIM is considered in a large set of molecules replacing muons with all protons in the hydrides of the second and third rows of the Periodic Table. Accordingly, in a comparative study the wavefunctions of both sets of hydrides and their muonic congeners are first derived beyond the Born-Oppenheimer (BO) paradigm, assuming protons and muons as quantum waves instead of clamped particles. Then, the non-BO wavefunctions are used to derive the AIM structures of both hydrides and muonic congeners within the context of the multi-component quantum theory of atoms in molecules. The results of the analysis demonstrate that muons are generally capable of forming their own atomic basins and the properties of these basins are not fundamentally different from those AIM containing protons. Particularly, the bonding modes in the muonic species seem to be qualitatively similar to their congener hydrides and no new bonding model is required to describe the bonding of muons to a diverse set of neighboring atoms. All in all, the positively charged muon is similar to a proton from the structural and bonding viewpoint and deserves to be placed in the same box of hydrogen in the Periodic Table. This conclusion is in line with a large body of studies on the chemical kinetics of the muonic molecules portraying the positively charged muon as a lighter isotope of hydrogen.
International Nuclear Information System (INIS)
Wells, E.; Carnes, K.D.; Tawara, H.; Ali, R.; Sidky, Emil Y.; Illescas, Clara; Ben-Itzhak, I.
2005-01-01
A coincidence time-of-flight technique coupled with projectile charge state analysis was used to study electron capture in collisions between slow highly charged ions and hydrogen molecules. We found single electron capture with no target excitation to be the dominant process for both C 6+ projectiles at a velocity of 0.8 atomic units and Ar 11+ projectiles at v 0.63 a.u. Double electron capture and transfer excitation, however, were found to be comparable and occur about 30% of the time relative to single capture. Most projectiles (96%) auto-ionize quickly following double capture into doubly excited states. The data are compared to classical and quantum mechanical model calculations
Bond charges and electronic charge transfer in ternary semiconductors
International Nuclear Information System (INIS)
Pietsch, U.
1986-01-01
By means of a simple molecule-theoretic model of 'linear superposition of two-electron molecules' the bond charges between nearest neighbours and the effective charges of ions are calculated for ternary zinc-blende structure alloys as well as chalcopyrite semiconductors. Taking into account both, the charge transfer among the ions caused by the differences of electronegativities of atoms used and between the bonds created by the internal stress of the lattice a nearly unvaried averaged bond charge amount of the alloy is found, but rather dramatically changed local bond charge parameters in comparison with the respective values of binary compounds used. This fact should influence the noncentral force interaction in such semiconductors. (author)
Influence of capture to excited states of multiply charged ion beams colliding with small molecules
International Nuclear Information System (INIS)
Montenegro, P; Monti, J M; Fojón, O A; Hanssen, J; Rivarola, R D
2015-01-01
Electron capture by multiply charged ions impacting on small molecules is theoretically investigated. Particular attention is paid to the case of biological targets. The interest is focused on the importance of the transition to excited final states which can play a dominant role on the total capture cross sections. Projectiles at intermediate and high collision energies are considered. Comparison with existing experimental data is shown. (paper)
Method and apparatus for positioning a beam of charged particles
International Nuclear Information System (INIS)
Michail, M.S.; Woodard, O.C.; Yourke, H.S.
1975-01-01
A beam of charged particles is stepped from one predetermined position to another to form a desired pattern on a semiconductor wafer. There is a dynamic correction for the deviation of the actual position of the beam from its predetermined position, so that the beam is applied to the deviated position rather than the predetermined position. Through the location of four registration marks, the writing field is precisely defined. Writing fields may be interconnected by the sharing of registration marks, enabling the construction of chips which are larger than a single writing field. (auth)
Energy Technology Data Exchange (ETDEWEB)
Choi, Seon Young; Jang, Soo Hwa [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of); Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su [Soongsil University, Department of Chemistry (Korea, Republic of); Lee, Kangtaek [Yonsei University, Department of Chemical and Biomolecular Engineering (Korea, Republic of); Yang, Sung Ik [Kyung Hee University, College of Environment and Applied Chemistry (Korea, Republic of); Joo, Sang-Woo, E-mail: sjoo@ssu.ac.kr [Soongsil University, Department of Chemistry (Korea, Republic of); Ryu, Pan Dong; Lee, So Yeong, E-mail: leeso@snu.ac.kr [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of)
2012-12-15
Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.
International Nuclear Information System (INIS)
Choi, Seon Young; Jang, Soo Hwa; Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su; Lee, Kangtaek; Yang, Sung Ik; Joo, Sang-Woo; Ryu, Pan Dong; Lee, So Yeong
2012-01-01
Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.
Constrained-DFT method for accurate energy-level alignment of metal/molecule interfaces
Souza, A. M.
2013-10-07
We present a computational scheme for extracting the energy-level alignment of a metal/molecule interface, based on constrained density functional theory and local exchange and correlation functionals. The method, applied here to benzene on Li(100), allows us to evaluate charge-transfer energies, as well as the spatial distribution of the image charge induced on the metal surface. We systematically study the energies for charge transfer from the molecule to the substrate as function of the molecule-substrate distance, and investigate the effects arising from image-charge confinement and local charge neutrality violation. For benzene on Li(100) we find that the image-charge plane is located at about 1.8 Å above the Li surface, and that our calculated charge-transfer energies compare perfectly with those obtained with a classical electrostatic model having the image plane located at the same position. The methodology outlined here can be applied to study any metal/organic interface in the weak coupling limit at the computational cost of a total energy calculation. Most importantly, as the scheme is based on total energies and not on correcting the Kohn-Sham quasiparticle spectrum, accurate results can be obtained with local/semilocal exchange and correlation functionals. This enables a systematic approach to convergence.
Constrained-DFT method for accurate energy-level alignment of metal/molecule interfaces
Souza, A. M.; Rungger, I.; Pemmaraju, C. D.; Schwingenschlö gl, Udo; Sanvito, S.
2013-01-01
We present a computational scheme for extracting the energy-level alignment of a metal/molecule interface, based on constrained density functional theory and local exchange and correlation functionals. The method, applied here to benzene on Li(100), allows us to evaluate charge-transfer energies, as well as the spatial distribution of the image charge induced on the metal surface. We systematically study the energies for charge transfer from the molecule to the substrate as function of the molecule-substrate distance, and investigate the effects arising from image-charge confinement and local charge neutrality violation. For benzene on Li(100) we find that the image-charge plane is located at about 1.8 Å above the Li surface, and that our calculated charge-transfer energies compare perfectly with those obtained with a classical electrostatic model having the image plane located at the same position. The methodology outlined here can be applied to study any metal/organic interface in the weak coupling limit at the computational cost of a total energy calculation. Most importantly, as the scheme is based on total energies and not on correcting the Kohn-Sham quasiparticle spectrum, accurate results can be obtained with local/semilocal exchange and correlation functionals. This enables a systematic approach to convergence.
Ma, Jie; Wang, Lin-Wang
2015-03-01
Perovskite-based solar cells have achieved high solar-energy conversion efficiencies and attracted wide attentions nowadays. Despite the rapid progress in solar-cell devices, many fundamental issues of the hybrid perovskites have not been fully understood. Experimentally, it is well known that in CH3NH3PbI3, the organic molecules CH3NH3 are randomly orientated at the room temperature, but the impact of the random molecular orientation has not been investigated. Using linear-scaling ab-initiomethods, we have calculated the electronic structures of the tetragonal phase of CH3NH3PbI3 with randomly orientated organic molecules in large supercells up to ~20,000 atoms. Due to the dipole moment of the organic molecule, the random orientation creates a novel system with long-range potential fluctuations unlike alloys or other conventional disordered systems. We find that the charge densities of the conduction-band minimum and the valence-band maximum are localized separately in nanoscales due to the potential fluctuations. The charge localization causes electron-hole separation and reduces carrier recombination rates, which may contribute to the long carrier lifetime observed in experiments. We have also proposed a model to explain the charge localization.
International Nuclear Information System (INIS)
Ren Shang-Qing; Yang Hong; Wang Wen-Wu; Tang Bo; Tang Zhao-Yun; Wang Xiao-Lei; Xu Hao; Luo Wei-Chun; Zhao Chao; Yan Jiang; Chen Da-Peng; Ye Tian-Chun
2015-01-01
A new method is proposed to extract the energy distribution of negative charges, which results from electron trapping by traps in the gate stack of nMOSFET during positive bias temperature instability (PBTI) stress based on the recovery measurement. In our case, the extracted energy distribution of negative charges shows an obvious dependence on energy, and the energy level of the largest energy density of negative charges is 0.01 eV above the conduction band of silicon. The charge energy distribution below that energy level shows strong dependence on the stress voltage. (paper)
International Nuclear Information System (INIS)
Palmero, F; Archilla, J F R; Hennig, D; Romero, F R
2004-01-01
Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder
The interactions of high-energy, highly charged Xe ions with buckyballs
International Nuclear Information System (INIS)
Ali, R.; Berry, H.G.; Cheng, S.
1994-01-01
Ionization and fragmentation have been measured for C 60 molecules bombarded by highly charged (up to 35+) xenon ions with energies ranging up to 625 MeV. The observed mass distribution of positively charged fragments is explained in terms of a theoretical model indicating that the total interaction cross section contains roughly equal contributions from (a) excitation of the giant plasmon resonance, and (b) large-energy-transfer processes that lead to multiple fragmentation of the molecule. Preliminary results of measurements on VUV photons emitted in these interactions are also presented
Positive zeta potential of a negatively charged semi-permeable plasma membrane
Sinha, Shayandev; Jing, Haoyuan; Das, Siddhartha
2017-08-01
The negative charge of the plasma membrane (PM) severely affects the nature of moieties that may enter or leave the cells and controls a large number of ion-interaction-mediated intracellular and extracellular events. In this letter, we report our discovery of a most fascinating scenario, where one interface (e.g., membrane-cytosol interface) of the negatively charged PM shows a positive surface (or ζ) potential, while the other interface (e.g., membrane-electrolyte interface) still shows a negative ζ potential. Therefore, we encounter a completely unexpected situation where an interface (e.g., membrane-cytosol interface) that has a negative surface charge density demonstrates a positive ζ potential. We establish that the attainment of such a property by the membrane can be ascribed to an interplay of the nature of the membrane semi-permeability and the electrostatics of the electric double layer established on either side of the charged membrane. We anticipate that such a membrane property can lead to such capabilities of the cell (in terms of accepting or releasing certain kinds of moieties as well regulating cellular signaling) that was hitherto inconceivable.
Pirim, C.; Gann, R. D.; McLain, J. L.; Orlando, T. M.
2015-09-01
Electron-induced polymerization processes and charging events that can occur within Titan's atmosphere or on its surface were simulated using electron irradiation and dissociative electron attachment (DEA) studies of nitrogen-containing organic condensates. The DEA studies probe the desorption of H- from hydrogen cyanide (HCN), acetonitrile (CH3CN), and aminoacetonitrile (NH2CH2CN) ices, as well as from synthesized tholin materials condensed or deposited onto a graphite substrate maintained at low temperature (90-130 K). The peak cross sections for H- desorption during low-energy (3-15 eV) electron irradiation were measured and range from 3 × 10-21 to 2 × 10-18 cm2. Chemical and structural transformations of HCN ice upon 2 keV electron irradiation were investigated using X-ray photoelectron and Fourier-transform infrared spectroscopy techniques. The electron-beam processed materials displayed optical properties very similar to tholins produced by conventional discharge methods. Electron and negative ion trapping lead to 1011 charges cm-2 on a flat surface which, assuming a radius of 0.05 μm for Titan aerosols, is ∼628 charges/radius (in μm). The facile charge trapping indicates that electron interactions with nitriles and complex tholin-like molecules could affect the conductivity of Titan's atmosphere due to the formation of large negative ion complexes. These negatively charged complexes can also precipitate onto Titan's surface and possibly contribute to surface reactions and the formation of dunes.
Mixed-mode reversed phase/positively charged repulsion chromatography for intact protein separation.
Ding, Ling; Guo, Zhimou; Hu, Zhuo; Liang, Xinmiao
2017-05-10
A mixed-mode reversed phase/positively charged repulsion stationary phase C8PN composed of octyl and amino group has been developed for separation of intact protein. Before the separation of proteins, a set of probe compounds were employed to evaluate the chromatographic properties of C8PN, demonstrating typical reversed phase/positively charged repulsion interaction on this stationary phase as estimated. Then the new C8PN stationary phase was used to separate a standard protein mixture on the reversed phase mode. Compared with a commercial C4 stationary phase, it showed different selectivity for some proteins. In order to better understand the properties of C8PN, the effect of acetonitrile content was investigated based on retention equation. Higher values of the equation parameters on C8PN demonstrated that the protein retentions were more sensitive to the change of acetonitrile content. Besides, the influences of buffer salt additives on the protein retentions were also studied. The retention factors of the proteins got larger with the increase of buffer salt concentration, which confirmed the positively charged repulsion interaction on the column. Finally, the C8PN was further applied to separate oxidized- and reduced- forms of Recombinant Human Growth Hormone. Our study indicated the advantages and application potential of mixed-mode reversed phase/positively charged repulsion stationary phase for intact protein separation. Copyright © 2017 Elsevier B.V. All rights reserved.
Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık
2016-05-01
A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.
Single molecule transistor based nanopore for the detection of nicotine
Energy Technology Data Exchange (ETDEWEB)
Ray, S. J., E-mail: ray.sjr@gmail.com [Institute of Materials Science, Technical University of Darmstadt, Alarich-Weiss-Str. 2, 64287 Darmstadt (Germany)
2014-12-28
A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.
Single molecule transistor based nanopore for the detection of nicotine
Ray, S. J.
2014-12-01
A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.
Effects of charging and electric field on graphene functionalized with titanium
International Nuclear Information System (INIS)
Gürel, H Hakan; Ciraci, S
2013-01-01
Titanium atoms are adsorbed to graphene with a significant binding energy and render diverse functionalities to it. Carrying out first-principles calculations, we investigated the effects of charging and static electric field on the physical and chemical properties of graphene covered by Ti adatoms. When uniformly Ti covered graphene is charged positively, its antiferromagnetic ground state changes to ferromagnetic metal and attains a permanent magnetic moment. Static electric field applied perpendicularly causes charge transfer between Ti and graphene, and can induce metal–insulator transition. While each Ti adatom adsorbed to graphene atom can hold four hydrogen molecules with a weak binding, these molecules can be released by charging or applying electric field perpendicularly. Hence, it is demonstrated that charging and applied static electric field induce quasi-continuous and side specific modifications in the charge distribution and potential energy of adatoms absorbed to single-layer nanostructures, resulting in fundamentally crucial effects on their physical and chemical properties. (paper)
International Nuclear Information System (INIS)
Talik, N.A.; Yeoh, K.H.; Ng, C.Y.B.; Tan, C.Y.; Yap, B.K.
2016-01-01
We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN 6 has been used for tandem OLED. • The improvement attributes to the lower V bi and larger ΔV L in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.
International Nuclear Information System (INIS)
Fordham, C.
1989-01-01
The position of a charged particle beam can be measured with a Beam Position Monitor (BPM) by converting the voltages induced on its array of electrodes into a position offset from the array's center. Most of the BPMs in the Arcs and Final Focus of the SLC use four stripline electrodes arranged symmetrically around the beam; normalized voltage differences are calculated as the difference divided by the sum of voltages on opposite electrode pairs. The resulting number is multiplied by a conversion factor, denoted in this paper as S b , to give the offset (in millimeters) of the charge from the center of the BPM. Prior to installation in the beam line, the BPMs were calibrated with a charge pulse on a rod. Owing to geometric effects which will be discussed later, a different conversion factor had to be used for calibration. It will be denoted here by S r . This paper gives the results of calculations and measurements of S r and S b for Arc and Final Focus BPMs. This paper also describes the relevant physical properties of the several types of BPMs and calculations of the expected scale factors, the measurement methods used, and gives the results of measurements, which are compared with the theoretical expectations. 2 refs., 18 figs., 7 tabs
Zhao, Ling; Xia, Huifen
2018-01-01
The project of polymer flooding has achieved great success in Daqing oilfield, and the main oil reservoir recovery can be improved by more than 15%. But, for some strong oil reservoir heterogeneity carrying out polymer flooding, polymer solution will be inefficient and invalid loop problem in the high permeability layer, then cause the larger polymer volume, and a significant reduction in the polymer flooding efficiency. Aiming at this problem, it is studied the method that improves heterogeneous oil reservoir polymer flooding effect by positively-charged gel profile control. The research results show that the polymer physical and chemical reaction of positively-charged gel with the residual polymer in high permeability layer can generate three-dimensional network of polymer, plugging high permeable layer, and increase injection pressure gradient, then improve the effect of polymer flooding development. Under the condition of the same dosage, positively-charged gel profile control can improve the polymer flooding recovery factor by 2.3∼3.8 percentage points. Under the condition of the same polymer flooding recovery factor increase value, after positively-charged gel profile control, it can reduce the polymer volume by 50 %. Applying mechanism of positively-charged gel profile control technology is feasible, cost savings, simple construction, and no environmental pollution, therefore has good application prospect.
Bassignana, D; Fernandez, M; Jaramillo, R; Lozano, M; Munoz, F.J; Pellegrini, G; Quirion, D; Vila, I; Vitorero, F
2013-01-01
Position sensitivity in semiconductor detectors of ionizing radiation is usually achieved by the segmentation of the sensing diode junction in many small sensing elements read out separately as in the case of conventional microstrips and pixel detectors. Alternatively, position sensitivity can be obtained by splitting the ionization signal collected by one single electrode amongst more than one readout channel with the ratio of the collected charges depending on the position where the signal was primary generated. Following this later approach, we implemented the charge division method in a conventional microstrip detector to obtain position sensitivity along the strip. We manufactured a proofof-concept demonstrator where the conventional aluminum electrodes were replaced by slightly resistive electrodes made of strongly doped poly-crystalline silicon and being readout at both strip ends. Here, we partially summarize the laser characterization of this first proof-of-concept demonstrator with special emphasis ...
Spectroscopy of Charged Quantum Dot Molecules
Stinaff, E. A.; Scheibner, M.; Bracker, A. S.; Ponomarev, I. V.; Ware, M. E.; Doty, M. F.; Reinecke, T. L.; Gammon, D.; Korenev, V. L.
2006-03-01
Spins of single charges in quantum dots are attractive for many quantum information and spintronic proposals. Scalable quantum information applications require the ability to entangle and operate on multiple spins in coupled quantum dots (CQDs). To further the understanding of these systems, we present detailed spectroscopic studies of InAs CQDs with control of the discrete electron or hole charging of the system. The optical spectrum reveals a pattern of energy anticrossings and crossings in the photoluminescence as a function of applied electric field. These features can be understood as a superposition of charge and spin configurations of the two dots and represent clear signatures of quantum mechanical coupling. The molecular resonance leading to these anticrossings is achieved at different electric fields for the optically excited (trion) states and the ground (hole) states allowing for the possibility of using the excited states for optically induced coupling of the qubits.
PEPTIDE SOLUBILITY, STRUCTURE AND CHARGE POSITION EFFECT ON ADSORPTION BY ALUMINIUM HYDROXIDE
Directory of Open Access Journals (Sweden)
Mary Trujillo
2008-04-01
Full Text Available Solubility, structure and position of charges in a peptide antigen sequence can be mentioned as being amongst the basic features of adsorption. In order to study their effect on adsorption, seven analogue series were synthesized from a MSP-1 peptide sequence by systematically replacing each one of the positions in the peptide sequence by aspartic acid, glutamic acid, serine, alanine, asparagine, glutamine or lysine. Such modifications in analogue peptide sequences showed a non-regular tendency regarding solubility and adsorption data. Aspartic acid and Glutamic acid analogue series showed great improvements in adsorption, especially in peptides where Lysine in position 6 and Arginine in position 13 were replaced. Solubility of position 5 analogue was greater than the position 6 analogue in Aspartic acid series; however, the position 6 analogue showed best adsorption results whilst the Aspartic acid in position 5 analogue showed no adsorption in the same conditions. Nuclear Magnetic Resonance structural analysis revealed differences in the -helical structureextension between these analogues. The Aspartic acid in position 6, located in the polar side of the helix, may allow this analogueto fit better onto the adsorption regions suggesting that the local electrostatic charge is responsible for this behavior.
Cross-sections for inelastic collisions of fast charged particles with atoms and molecules
International Nuclear Information System (INIS)
Inokuti, M.
1987-01-01
Despite the long history of research, the current experimental data of the cross-sections, required for solving problems of radiological physics and dosimetry, are far from being complete or even satisfactory for tentative applications. Calculations are, in general, difficult and only in exceptional situations lead to reliable results. Thus, one practical approach to the cross-section determination is to test experimental data with general criteria. This is possible because cross-sections for various processes are related among themselves and with many other properties of atoms and molecules. For example, the Bethe theory indicates a close connection between photoabsorption and energy absorption by glancing collisions and puts many other useful constraints on the cross-section data. Development and use of these data constraints, first advanced by Platzman, can now be demonstrated in many examples. More recent studies concern the determination of the analytic expression most suitable for fitting the data on the oscillator strength distribution or the energy distribution of secondary electrons from ionizing collisions of charged particles. There are three areas to which major efforts should be directed: (1) Methods of absolute cross-section measurements, both for electron and ionic collisions, must be thoroughly reviewed so that sources of systematic errors may be identified and corrected. (2) Efforts should be devoted to the understanding of the data systematics, viz. the trends of cross-sections for a series of molecules. This is especially important because the variety of molecules relevant to radiological physics and radiation biology is so enormous that even the data presentation for each molecule will be impractical. (3) Electron and ionic collisions with molecules in condensed phases will be an important topic of study for years to come. Initial reports on efforts in this direction are encouraging. 49 refs
Aligned deposition and electrical measurements on single DNA molecules
International Nuclear Information System (INIS)
Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid
2015-01-01
A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)
Charging of dust grains in a plasma with negative ions
Kim, Su-Hyun; Merlino, Robert L.
2006-05-01
The effect of negative ions on the charging of dust particles in a plasma is investigated experimentally. A plasma containing a very low percentage of electrons is formed in a single-ended SF6 is admitted into the vacuum system. The relatively cold (Te≈0.2eV ) readily attach to SF6 molecules to form SF6- negative ions. Calculations of the dust charge indicate that for electrons, negative ions, and positive ions of comparable temperatures, the charge (or surface potential) of the dust can be positive if the positive ion mass is smaller than the negative ion mass and if ɛ, the ratio of the electron to positive ion density, is sufficiently small. The K+ positive ions (mass 39amu) and SF6- negative ions (mass 146amu), and also utilizes a rotating cylinder to dispense dust into the plasma column. Analysis of the current-voltage characteristics of a Langmuir probe in the dusty plasma shows evidence for the reduction in the (magnitude) of the negative dust charge and the transition to positively charged dust as the relative concentration of the residual electrons is reduced. Some remarks are offered concerning experiments that could become possible in a dusty plasma with positive grains.
Development of a Sweetness Sensor for Aspartame, a Positively Charged High-Potency Sweetener
Directory of Open Access Journals (Sweden)
Masato Yasuura
2014-04-01
Full Text Available Taste evaluation technology has been developed by several methods, such as sensory tests, electronic tongues and a taste sensor based on lipid/polymer membranes. In particular, the taste sensor can individually quantify five basic tastes without multivariate analysis. However, it has proven difficult to develop a sweetness sensor, because sweeteners are classified into three types according to the electric charges in an aqueous solution; that is, no charge, negative charge and positive charge. Using membrane potential measurements, the taste-sensing system needs three types of sensor membrane for each electric charge type of sweetener. Since the commercially available sweetness sensor was only intended for uncharged sweeteners, a sweetness sensor for positively charged high-potency sweeteners such as aspartame was developed in this study. Using a lipid and plasticizers, we fabricated various lipid/polymer membranes for the sweetness sensor to identify the suitable components of the sensor membranes. As a result, one of the developed sensors showed responses of more than 20 mV to 10 mM aspartame and less than 5 mV to any other taste. The responses of the sensor depended on the concentration of aspartame. These results suggested that the developed sweetness sensor had high sensitivity to and high selectivity for aspartame.
Development of a sweetness sensor for aspartame, a positively charged high-potency sweetener.
Yasuura, Masato; Tahara, Yusuke; Ikezaki, Hidekazu; Toko, Kiyoshi
2014-04-23
Taste evaluation technology has been developed by several methods, such as sensory tests, electronic tongues and a taste sensor based on lipid/polymer membranes. In particular, the taste sensor can individually quantify five basic tastes without multivariate analysis. However, it has proven difficult to develop a sweetness sensor, because sweeteners are classified into three types according to the electric charges in an aqueous solution; that is, no charge, negative charge and positive charge. Using membrane potential measurements, the taste-sensing system needs three types of sensor membrane for each electric charge type of sweetener. Since the commercially available sweetness sensor was only intended for uncharged sweeteners, a sweetness sensor for positively charged high-potency sweeteners such as aspartame was developed in this study. Using a lipid and plasticizers, we fabricated various lipid/polymer membranes for the sweetness sensor to identify the suitable components of the sensor membranes. As a result, one of the developed sensors showed responses of more than 20 mV to 10 mM aspartame and less than 5 mV to any other taste. The responses of the sensor depended on the concentration of aspartame. These results suggested that the developed sweetness sensor had high sensitivity to and high selectivity for aspartame.
Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J
2015-09-16
Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.
Energy Technology Data Exchange (ETDEWEB)
Talik, N.A., E-mail: azrina_talik@hotmail.com [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yeoh, K.H. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Centre for Photonics and Advanced Materials Research (CPR), Lee Kong Chian Faculty of Engineering and Science, University Tunku Abdul Rahman, 43000 Kajang, Selangor (Malaysia); Ng, C.Y.B. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Tan, C.Y. [Centre of Advanced Manufacturing & Material Processing (AMMP), Department of Mechanical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yap, B.K., E-mail: kbyap@uniten.edu.my [Centre of Microelectronic and Nano Engineering (CeMNE), College of Engineering, Universiti Tenaga Nasional, 43000 Kajang, Selangor (Malaysia)
2016-01-15
We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN{sub 6} has been used for tandem OLED. • The improvement attributes to the lower V{sub bi} and larger ΔV{sub L} in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.
Optically directed molecular transport and 3D isoelectric positioning of amphoteric biomolecules
International Nuclear Information System (INIS)
Hafeman, Dean G.; Harkins, James B.; Witkowski, Charles E. II; Lewis, Nathan S.; Brown, Gilbert M.; Warmack, Robert J. Bruce; Thundat, Thomas George
2006-01-01
We demonstrate the formation of charged molecular packets and their transport within optically created electrical force-field traps in a pH-buffered electrolyte. We call this process photoelectrophoretic localization and transport (PELT). The electrolyte is in contact with a photoconductive semiconductor electrode and a counterelectrode that are connected through an external circuit. A light beam directed to coordinates on the photoconductive electrode surface produces a photocurrent within the circuit and electrolyte. Within the electrolyte, the photocurrent creates localized force-field traps centered at the illuminated coordinates. Charged molecules, including polypeptides and proteins, electrophoretically accumulate into the traps and subsequently can be transported in the electrolyte by moving the traps over the photoconductive electrode in response to movement of the light beam. The molecules in a single trap can be divided into aliquots, and the aliquots can be directed along multiple routes simultaneously by using multiple light beams. This photoelectrophoretic transport of charged molecules by PELT resembles the electrostatic transport of electrons within force-field wells of solid-state charge-coupled devices. The molecules, however, travel in a liquid electrolyte rather than a solid. Furthermore, we have used PELT to position amphoteric biomolecules in three dimensions. A 3D pH gradient was created in an electrolyte medium by controlling the illumination position on a photoconductive anode where protons were generated electrolytically. Photoelectrophoretic transport of amphoteric molecules through the pH gradient resulted in accumulation of the molecules at their apparent 3D isoelectric coordinates in the medium.
Directory of Open Access Journals (Sweden)
Ioan Bâldea
2016-03-01
Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.
Nuclear fusion rate of the muonic T3 molecule
International Nuclear Information System (INIS)
Faghihi, F.; Eskandari, M. R.
2004-01-01
The ground state binding energy, size and effective nuclear charge of the muonic T 3 molecule are calculated using Born-Oppenheimer adiabatic approximation. The system possesses two minimum positions, one at typically muonic and the second at the atomic distances. A symmetric planar vibrational model between two minima is assumed and the approximated potential are calculated. Moreover, nuclear fusion rate calculations of the short-life molecule is carried out due to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions
Charge migration and charge transfer in molecular systems
Directory of Open Access Journals (Sweden)
Hans Jakob Wörner
2017-11-01
Full Text Available The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review.
A two-dimensional position sensitive gas chamber with scanned charge transfer readout
Energy Technology Data Exchange (ETDEWEB)
Gomez, F. E-mail: faustgr@usc.es; Iglesias, A.; Lobato, R.; Mosquera, J.; Pardo, J.; Pena, J.; Pazos, A.; Pombar, M.; Rodriguez, A
2003-10-21
We have constructed and tested a two-dimensional position sensitive parallel-plate gas ionization chamber with scanned charge transfer readout. The scan readout method described here is based on the development of a new position-dependent charge transfer technique. It has been implemented by using gate strips perpendicularly oriented to the collector strips. This solution reduces considerably the number of electronic readout channels needed to cover large detector areas. The use of a 25 {mu}m thick kapton etched circuit allows high charge transfer efficiency with a low gating voltage, consequently needing a very simple commutating circuit. The present prototype covers 8x8 cm{sup 2} with a pixel size of 1.27x1.27 mm{sup 2}. Depending on the intended use and beam characteristics a smaller effective pixel is feasible and larger active areas are possible. This detector can be used for X-ray or other continuous beam intensity profile monitoring.
A two-dimensional position sensitive gas chamber with scanned charge transfer readout
International Nuclear Information System (INIS)
Gomez, F.; Iglesias, A.; Lobato, R.; Mosquera, J.; Pardo, J.; Pena, J.; Pazos, A.; Pombar, M.; Rodriguez, A.
2003-01-01
We have constructed and tested a two-dimensional position sensitive parallel-plate gas ionization chamber with scanned charge transfer readout. The scan readout method described here is based on the development of a new position-dependent charge transfer technique. It has been implemented by using gate strips perpendicularly oriented to the collector strips. This solution reduces considerably the number of electronic readout channels needed to cover large detector areas. The use of a 25 μm thick kapton etched circuit allows high charge transfer efficiency with a low gating voltage, consequently needing a very simple commutating circuit. The present prototype covers 8x8 cm 2 with a pixel size of 1.27x1.27 mm 2 . Depending on the intended use and beam characteristics a smaller effective pixel is feasible and larger active areas are possible. This detector can be used for X-ray or other continuous beam intensity profile monitoring
Quantum interference effects at room temperature in OPV-based single-molecule junctions
DEFF Research Database (Denmark)
Arroyo, Carlos R.; Frisenda, Riccardo; Moth-Poulsen, Kasper
2013-01-01
Interference effects on charge transport through an individual molecule can lead to a notable modulation and suppression on its conductance. In this letter, we report the observation of quantum interference effects occurring at room temperature in single-molecule junctions based on oligo(3......)-phenylenevinylene (OPV3) derivatives, in which the central benzene ring is coupled to either para- or meta-positions. Using the break-junction technique, we find that the conductance for a single meta-OPV3 molecule wired between gold electrodes is one order of magnitude smaller than that of a para-OPV3 molecule...
Small interfering RNA delivery through positively charged polymer nanoparticles
International Nuclear Information System (INIS)
Dragoni, Luca; Cesana, Alberto; Moscatelli, Davide; Ferrari, Raffaele; Morbidelli, Massimo; Lupi, Monica; Falcetta, Francesca; Ubezio, Paolo; D’Incalci, Maurizio
2016-01-01
Small interfering RNA (siRNA) is receiving increasing attention with regard to the treatment of many genetic diseases, both acquired and hereditary, such as cancer and diabetes. Being a high molecular weight (MW) polyanion, siRNA is not able to cross a cell membrane, and in addition it is unstable in physiological conditions. Accordingly, a biocompatible nanocarrier able to deliver siRNA into cells is needed. In this work, we synthesized biocompatible positively charged nanoparticles (NPs) following a two-step process that involves ring opening polymerization (ROP) and emulsion free radical polymerization (EFRP). Firstly, we proved the possibility of fine tuning the NPs’ characteristics (e.g. size and surface charge) by changing the synthetic process parameters. Then the capability in loading and delivering undamaged siRNA into a cancer cell cytoplasm has been shown. This latter process occurs through the biodegradation of the polymer constituting the NPs, whose kinetics can be tuned by adjusting the polymer’s MW. Finally, the ability of NPs to carry siRNA inside the cells in order to inhibit their target gene has been demonstrated using green flourescent protein positive cells. (paper)
Alqahtani, Obaid; Babics, Maxime; Gorenflot, Julien; Savikhin, Victoria; Ferron, Thomas; Balawi, Ahmed H.; Paulke, Andreas; Kan, Zhipeng; Pope, Michael; Clulow, Andrew J.; Wolf, Jannic Sebastian; Burn, Paul L.; Gentle, Ian R.; Neher, Dieter; Toney, Michael F.; Laquai, Fré dé ric; Beaujuge, Pierre; Collins, Brian A.
2018-01-01
The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.
Alqahtani, Obaid
2018-03-25
The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.
On the production of positive molecular ions in cometary comas
International Nuclear Information System (INIS)
Tarafdar, S.P.; Wickramasinghe, N.C.
1977-01-01
Positively charged molecular ions, such as H 2 O + , which have been observed in cometary comas, may be efficiently produced by the evaporation of positively charged clathrate grains of radii in the range approximately 10 -6 -10 -3 cm. Such grains may be expelled from nuclei of comets, along with gaseous molecules. Grain charging occurs via interaction with solar ultraviolet photons and/or solar wind protons. Observational data on the total quantities as well as the distributions of H 2 O and H 2 O + in cometary comas are shown to be in accord with detailed model calculations. (Auth.)
Lee, Victor; James, Nicole M.; Waitukaitis, Scott R.; Jaeger, Heinrich M.
2018-03-01
Electrostatic charging of insulating fine particles can be responsible for numerous phenomena ranging from lightning in volcanic plumes to dust explosions. However, even basic aspects of how fine particles become charged are still unclear. Studying particle charging is challenging because it usually involves the complexities associated with many-particle collisions. To address these issues, we introduce a method based on acoustic levitation, which makes it possible to initiate sequences of repeated collisions of a single submillimeter particle with a flat plate, and to precisely measure the particle charge in situ after each collision. We show that collisional charge transfer between insulators is dependent on the hydrophobicity of the contacting surfaces. We use glass, which we modify by attaching nonpolar molecules to the particle, the plate, or both. We find that hydrophilic surfaces develop significant positive charges after contacting hydrophobic surfaces. Moreover, we demonstrate that charging between a hydrophilic and a hydrophobic surface is suppressed in an acidic environment and enhanced in a basic one. Application of an electric field during each collision is found to modify the charge transfer, again depending on surface hydrophobicity. We discuss these results within the context of contact charging due to ion transfer, and we show that they lend strong support to O H- ions as the charge carriers.
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Charging of dust grains in a plasma with negative ions
International Nuclear Information System (INIS)
Kim, Su-Hyun; Merlino, Robert L.
2006-01-01
The effect of negative ions on the charging of dust particles in a plasma is investigated experimentally. A plasma containing a very low percentage of electrons is formed in a single-ended Q machine when SF 6 is admitted into the vacuum system. The relatively cold Q machine electrons (T e ≅0.2 eV) readily attach to SF 6 molecules to form SF 6 - negative ions. Calculations of the dust charge indicate that for electrons, negative ions, and positive ions of comparable temperatures, the charge (or surface potential) of the dust can be positive if the positive ion mass is smaller than the negative ion mass and if ε, the ratio of the electron to positive ion density, is sufficiently small. The Q machine plasma is operated with K + positive ions (mass 39 amu) and SF 6 - negative ions (mass 146 amu), and also utilizes a rotating cylinder to dispense dust into the plasma column. Analysis of the current-voltage characteristics of a Langmuir probe in the dusty plasma shows evidence for the reduction in the (magnitude) of the negative dust charge and the transition to positively charged dust as the relative concentration of the residual electrons is reduced. Some remarks are offered concerning experiments that could become possible in a dusty plasma with positive grains
First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules
Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken
Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.
Double photoionisation spectra of molecules
Eland, John
2017-01-01
This book contains spectra of the doubly charged positive ions (dications) of some 75 molecules, including the major constituents of terrestrial and planetary atmospheres and prototypes of major chemical groups. It is intended to be a new resource for research in all areas of molecular spectroscopy involving high energy environments, both terrestrial and extra-terrestrial. All the spectra have been produced by photoionisation using laboratory lamps or synchrotron radiation and have been measured using the magnetic bottle time-of-flight technique by coincidence detection of correlated electron pairs. Full references to published work on the same species are given, though for several molecules these are the first published spectra. Double ionisation energies are listed and discussed in relation to the molecular electronic structure of the molecules. A full introduction to the field of molecular double ionisation is included and the mechanisms by which double photoionisation can occur are examined in detail. A p...
International Nuclear Information System (INIS)
Zhang Lingyan; Yuan Ruo; Chai Yaqing; Li Xuelian
2007-01-01
Positively charged gold nanoparticle (positively charged nano-Au), which was prepared, characterized by ξ-potential and transmission electron microscopy (TEM) was used in combination with L-cysteine to fabricate a modified electrode for electrocatalytic reaction of biomolecules. Compared with electrodes modified by negatively charged gold nanoparticle/L-cysteine, or L-cysteine alone, the electrode modified by the positively charged gold nanoparticle/L-cysteine exhibited excellent electrochemical behavior toward the oxidation of biomolecules such as ascorbic acid, dopamine and hydrogen peroxide. Moreover, the proposed mechanism for electrocatalytic response of positively charged gold nanoparticle was discussed. The immunosensor showed a specific to ascorbic acid in the range 5.1 x 10 -7 -6.7 x 10 -4 M and a low detection limit of 1.5 x 10 -7 M. The experimental results demonstrate that positively charged gold nanoparticle have more efficient electrocatalytic reaction than negatively charged gold nanoparticle, which opens up new approach for fabricating sensor
Simulations of charge transport in organic compounds
Energy Technology Data Exchange (ETDEWEB)
Vehoff, Thorsten
2010-05-05
We study the charge transport properties of organic liquid crystals, i.e. hexabenzocoronene and carbazole macrocycle, and single crystals, i.e. rubrene, indolocarbazole and benzothiophene derivatives (BTBT, BBBT). The aim is to find structure-property relationships linking the chemical structure as well as the morphology with the bulk charge carrier mobility of the compounds. To this end, molecular dynamics (MD) simulations are performed yielding realistic equilibrated morphologies. Partial charges and molecular orbitals are calculated based on single molecules in vacuum using quantum chemical methods. The molecular orbitals are then mapped onto the molecular positions and orientations, which allows calculation of the transfer integrals between nearest neighbors using the molecular orbital overlap method. Thus we obtain realistic transfer integral distributions and their autocorrelations. In case of organic crystals the differences between two descriptions of charge transport, namely semi-classical dynamics (SCD) in the small polaron limit and kinetic Monte Carlo (KMC) based on Marcus rates, are studied. The liquid crystals are investigated solely in the hopping limit. To simulate the charge dynamics using KMC, the centers of mass of the molecules are mapped onto lattice sites and the transfer integrals are used to compute the hopping rates. In the small polaron limit, where the electronic wave function is spread over a limited number of neighboring molecules, the Schroedinger equation is solved numerically using a semi-classical approach. The carbazole macrocycles form columnar structures arranged on a hexagonal lattice with side chains facing inwards, so columns can closely approach each other allowing inter-columnar and thus three-dimensional transport. We are able to show that, on the time-scales of charge transport, static disorder due to slow side chain motions is the main factor determining the mobility. The high mobility of rubrene is explained by two main
International Nuclear Information System (INIS)
Kuen, I.; Howorka, F.
1983-01-01
Absolute cross sections for the excitation of optically emitting states in collisions of He + , Ne + , Ar + , Kr + , B + , He ++ , Ne ++ and Ar ++ with oxygen molecules are measured, the energy range of the ion being1 - 1800 eV Lab for the singly charged and 1 - 3600 eV for the doubly charged ions. Seven important processes can be distinguished: charge exchange excitation of O 2 + band, O I, O II, X I and X II lines (X + , X ++ being the primary ion), direct excitation of X II and double charge exchange excitations. The energy dependences of the excitation cross sections are remarkably different for different processes but similar for one process with different ions. The sum total of all cross sections together for excitations which lead to light emission is on the order of a few square angstroms at 1000 eV c.m. energy. The results are of interest for surface investigations, plasma diagnostics and laser work. (Author)
Detecting and identifying small molecules in a nanopore flux capacitor
International Nuclear Information System (INIS)
Bearden, Samuel; Zhang, Guigen; McClure, Ethan
2016-01-01
A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions. (paper)
Electrochemically-gated single-molecule electrical devices
International Nuclear Information System (INIS)
Guo, Shaoyin; Artés, Juan Manuel; Díez-Pérez, Ismael
2013-01-01
In the last decade, single-molecule electrical contacts have emerged as a new experimental platform that allows exploring charge transport phenomena in individual molecular blocks. This novel tool has evolved into an essential element within the Molecular Electronics field to understand charge transport processes in hybrid (bio)molecule/electrode interfaces at the nanoscale, and prospect the implementation of active molecular components into functional nanoscale optoelectronic devices. Within this area, three-terminal single-molecule devices have been sought, provided that they are highly desired to achieve full functionality in logic electronic circuits. Despite the latest experimental developments offer consistent methods to bridge a molecule between two electrodes (source and drain in a transistor notation), placing a third electrode (gate) close to the single-molecule electrical contact is still technically challenging. In this vein, electrochemically-gated single-molecule devices have emerged as an experimentally affordable alternative to overcome these technical limitations. In this review, the operating principle of an electrochemically-gated single-molecule device is presented together with the latest experimental methodologies to built them and characterize their charge transport characteristics. Then, an up-to-date comprehensive overview of the most prominent examples will be given, emphasizing on the relationship between the molecular structure and the final device electrical behaviour
Passing Current through Touching Molecules
DEFF Research Database (Denmark)
Schull, G.; Frederiksen, Thomas; Brandbyge, Mads
2009-01-01
The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...
Metal-organic and supramolecular architectures based on mechanically interlocked molecules
Fernando, Isurika Rosini
The focus of this work is on mechanically interlocked molecules (MIMs), which have unusual physicochemical and mechanical properties with potential applications in nano-scale/molecular devices and high strength materials. Rotaxanes, for example, consist of an axle-like molecule threaded through a wheel-like molecule, with bulky groups at the two ends of the axle preventing the wheel from dissociating. The position of the wheel along the axle can be switched in a controllable and reversible manner by applying external stimuli, a feature that might lead to the next generation of computers. Molecularly woven materials (MWMs), another example of molecules with mechanically interlocked features, are predicted to be unprecedentedly strong while being lightweight and flexible. With the ultimate goal of achieving control over the functioning of molecular devices in the solid state, a variety of pseudorotaxane building blocks were prepared and characterized, including a novel, rare blue-colored motif. The temperature-dependent assembly/disassembly of pseudorotaxanes was exploited for the construction of single-wavelength colorimetric temperature sensors over a 100 °C window. Pseudorotaxanes based on aromatic crown ether wheels and disubstituted 4,4'-bipyridinium axles were converted into rotaxanes upon binding to metal complexes (zinc, cadmium, mercury, copper, cobalt), and the formation of ordered crystalline arrays was studied in the solid state. The columnar organization of pseudorotaxanes by Hg2X6 2-- complexes (X = Cl, Br, I), leading to unprecedented dichroic (blue/red) rotaxane crystals, was demonstrated for the first time. From the crystal structures studied it became apparent that negatively charged metal complexes are needed for successful assembly with the positively charged pseudorotaxane units. To be able to use the more common, positively charged metal ions for rotaxane framework construction, neutral and negatively charged pseudorotaxanes were synthesized
Peng, Ran; Tang, Xiaowu Shirley; Li, Dongqing
2018-04-01
This paper presents a new method of sensing single molecules and cations by a carbon nanotube (CNT)-based differential resistive pulse sensing (RPS) technique on a nanofluidic chip. A mathematical model for multichannel RPS systems is developed to evaluate the CNT-based RPS signals. Individual cations, rhodamine B dye molecules, and ssDNAs are detected successfully with high resolution and high signal-to-noise ratio. Differentiating ssDNAs with 15 and 30 nucleotides are achieved. The experimental results also show that translocation of negatively charged ssDNAs through a CNT decreases the electrical resistance of the CNT channel, while translocation of positively charged cations and rhodamine B molecules increases the electrical resistance of the CNT. The CNT-based nanofluidic device developed in this work provides a new avenue for single-molecule/ion detection and offers a potential strategy for DNA sequencing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cheng, Xiuting; Li, Na; Zhu, Mengfu; Zhang, Lili; Deng, Yu; Deng, Cheng
2016-06-01
To develop a depth filter based on the electrostatic adsorption principle, positively charged microporous ceramic membrane was prepared from a diatomaceous earth ceramic membrane. The internal surface of the highly porous ceramic membrane was coated with uniformly distributed electropositive nano-Y2O3 coating. The dye removal performance was evaluated through pressurized filtration tests using Titan Yellow aqueous solution. It showed that positively charged microporous ceramic membrane exhibited a flow rate of 421L/(m(2)·hr) under the trans-membrane pressure of 0.03bar. Moreover it could effectively remove Titan Yellow with feed concentration of 10mg/L between pH3 to 8. The removal rate increased with the enhancement of the surface charge properties with a maximum rejection of 99.6%. This study provides a new and feasible method of removing organic dyes in wastewater. It is convinced that there will be a broad market for the application of charged ceramic membrane in the field of dye removal or recovery from industry wastewater. Copyright © 2016. Published by Elsevier B.V.
Evans, M. L.; Hangarter, R. P.
1993-01-01
Positively charged nylon blotting membranes were used as an anion binding medium to trap [14C]indoleactic acid (IAA) as it exited cells at the basal ends of Coleus blumei L. stem and Zea mays L. coleoptile segments. Autoradiography was used to visualize where the [14C] that moved out of the cut ends was localized on the nylon membrane. Diffusion of [14C]IAA from the initial point of contact with the nylon membrane was minimal. Comparison of the autoradiograms with anatomical tissue prints of the cut ends of the segments was used to determine what tissues participate in IAA movement. The results of these initial studies were consistent with other reports suggesting that [14C]IAA movement was primarily associated with vascular tissues in both C. blumei stems and corn coleoptiles, but the resolution was not sufficient to identify which vascular tissues were involved in IAA transport. With further refinements, this technique could also be used for studying the movement of other small charged molecules through plant tissues.
International Nuclear Information System (INIS)
Helm, H.
1984-01-01
An inverted, first-order perturbation approach is used to derive potential energy curves for diatomic molecules from experimental line positions of molecular bands. The concept adopted here is based on the inverted perturbation analysis (IPA) proposed by Kozman and Hinze, but uses radial eigenfunctions of the trial potential energy curves as basis sets for the perturbation correction. Using molecular linepositions rather than molecular energy levels we circumvent the necessity of defining molecular constants for the molecule prior to the derivation of the potential energy curves. (Author)
Lattice diffusion of a single molecule in solution
Ruggeri, Francesca; Krishnan, Madhavi
2017-12-01
The ability to trap a single molecule in an electrostatic potential well in solution has opened up new possibilities for the use of molecular electrical charge to study macromolecular conformation and dynamics at the level of the single entity. Here we study the diffusion of a single macromolecule in a two-dimensional lattice of electrostatic traps in solution. We report the ability to measure both the size and effective electrical charge of a macromolecule by observing single-molecule transport trajectories, typically a few seconds in length, using fluorescence microscopy. While, as shown previously, the time spent by the molecule in a trap is a strong function of its effective charge, we demonstrate here that the average travel time between traps in the landscape yields its hydrodynamic radius. Tailoring the pitch of the lattice thus yields two different experimentally measurable time scales that together uniquely determine both the size and charge of the molecule. Since no information is required on the location of the molecule between consecutive departure and arrival events at lattice sites, the technique is ideally suited to measurements on weakly emitting entities such as single molecules.
Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.
Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan
2018-05-07
Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.
Position readout by charge division in large two-dimensional detectors
International Nuclear Information System (INIS)
Alberi, J.L.
1976-10-01
The improvement in readout spatial resolution for charge division systems with subdivided readout electrodes has been analyzed. This readout forms the position and sum signals by a linear, unambiguous analogue summation technique. It is shown that the readout resolution is a function of only electrode capacitance and shaping parameters. The line width improves as 1/N/sup 1 / 2 /, where N is the number of electrode subdivisions
Theory of Charged Quantum Dot Molecules
Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.
2006-03-01
Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.
AARHUS: Exotic charge states in ASTRID
International Nuclear Information System (INIS)
Moller, Soren Pape
1995-01-01
Ions are atoms from which one or more orbital electrons have been detached. This removal can be done, for example, by impact of other electrons. Today beams of bare ions - nuclei without any electrons - are available, for example at the GSI heavy ion Laboratory, Darmstadt, even for the heaviest elements. Molecules too can be ionized by removal of one electron and these molecules can be accelerated to form high energy beams. Molecules are, however, generally not expected to be stable when more than one electron is missing, since there is too little negative charge to bind the positive nuclei. It was therefore a surprise when a stable doubly-charged molecular ion was found at experiments at the ASTRID storage ring, Aarhus, Denmark. The aim of the experiment was to measure lifetimes of expected metastable states of doubly-charged carbon monoxide, CO ++ . The CO ++ ions were produced in an ion source and the accelerated beam injected into the storage ring. The circulating intensity was then monitored by detecting neutral species produced in restgas collisions at the end of a straight section. For CO ++ , a fraction of the beam survived for tens of seconds, with a lifetime around 4 seconds. This lifetime was dominated by restgas collisions. The base pressure was around 2 x 10 -11 mbar. In order to avoid contamination from molecules with the same mass/charge ratio, e.g. singly-charged nitrogen-14, the carbon monoxide used was based on the naturally rare isotope carbon-13 rather than the abundant carbon-12. Many atoms can also bind an additional electron and form negative ions. Several negative ions are metastable, and lifetime measurements performed at ASTRID and elsewhere produce accurate results important for comparisons with theory. Double-charged negative ions could in principle exist, and indications of metastable states of H - and O - were seen some years ago as resonances in the electron bombardment of negative hydrogen ions. This process was recently studied at
AARHUS: Exotic charge states in ASTRID
Energy Technology Data Exchange (ETDEWEB)
Moller, Soren Pape
1995-04-15
Ions are atoms from which one or more orbital electrons have been detached. This removal can be done, for example, by impact of other electrons. Today beams of bare ions - nuclei without any electrons - are available, for example at the GSI heavy ion Laboratory, Darmstadt, even for the heaviest elements. Molecules too can be ionized by removal of one electron and these molecules can be accelerated to form high energy beams. Molecules are, however, generally not expected to be stable when more than one electron is missing, since there is too little negative charge to bind the positive nuclei. It was therefore a surprise when a stable doubly-charged molecular ion was found at experiments at the ASTRID storage ring, Aarhus, Denmark. The aim of the experiment was to measure lifetimes of expected metastable states of doubly-charged carbon monoxide, CO{sup ++}. The CO{sup ++} ions were produced in an ion source and the accelerated beam injected into the storage ring. The circulating intensity was then monitored by detecting neutral species produced in restgas collisions at the end of a straight section. For CO{sup ++}, a fraction of the beam survived for tens of seconds, with a lifetime around 4 seconds. This lifetime was dominated by restgas collisions. The base pressure was around 2 x 10{sup -11} mbar. In order to avoid contamination from molecules with the same mass/charge ratio, e.g. singly-charged nitrogen-14, the carbon monoxide used was based on the naturally rare isotope carbon-13 rather than the abundant carbon-12. Many atoms can also bind an additional electron and form negative ions. Several negative ions are metastable, and lifetime measurements performed at ASTRID and elsewhere produce accurate results important for comparisons with theory. Double-charged negative ions could in principle exist, and indications of metastable states of H{sup -} and O{sup -} were seen some years ago as resonances in the electron bombardment of negative hydrogen ions. This
Nossa, Javier; Islam, Fhokrul; Canali, Carlo; Pederson, Mark
2012-02-01
For device applications of single molecule magnets (SMMs) in high-density information storage and quantum-state control it is essential that the magnetic properties of the molecules remain stable under the influence of metallic contacts or surface environment. Recent tunneling experiments [1, 2] on N@C60 and Fe4 SMM have shown that these molecules preserve their magnetic characteristics when they are used as the central island of single-electron transistors. Although quantum spin models have been used extensively to study theoretically tunneling spectroscopy of SMMs, it has been shown recently that the orbital degrees of freedom, which is absent in spin models, can significantly affect the tunneling conductance [3]. In this work we present first-principles calculations of the neutral and charged states of N@C60 and Fe4 SMMs, and discuss a strategy to include their properties into a theory of quantum transport. We also present results of the magnetic anisotropy for the different charge states of Fe4 and discuss their relevance for experiments [2] in the sequential tunneling and cotunnelling regimes. [4pt] [1]. N. Roch et al., Phys. Rev. B 83, 081407 (2011). [0pt] [2]. A.S. Zyazin et al., Nano Lett. 10, 3307 (2010). [0pt] [3]. L. Michalak et al., Phys. Rev. Lett. 104, 017202 (2010).
Yang, Jingjuan; Han, Xiaoxiao; Yuan, Peipei; Bian, Baoan; Wang, Yixiang
2018-01-01
We investigate the electronic transport properties of dihydroazulene (DHA) and vinylheptafulvene (VHF) molecule sandwiched between two carbon nanotubes using density functional theory and non-equilibrium Green's function. The device displays significantly switching behavior between DHA and VHF isomerizations. It is found the different substitution position of F in the molecule influences the switching ratio of device, which is analyzed by transmission spectra and molecular projected self-consistent Hamiltonian. The observed negative differential resistance effect is explained by transmission spectra and transmission eigenstates of transmission peak in the bias window. The observed reverse of current in VHF form in which two H atoms on the right side of the benzene ring of the molecule are replaced by F is explained by transmission spectra and molecule-electrode coupling with the varied bias. The results suggest that the reasonable substitution position of molecule may improve the switching ratio, displaying a potential application in future molecular circuit.
Abbasi, Amirali; Sardroodi, Jaber Jahanbin
2018-06-01
Based on the density functional theory (DFT) calculations, we explored the sensing capabilities and electronic structures of TiO2/Stanene heterostructures as novel and highly efficient materials for detection of toxic NO2 and O3 molecules in the environment. Studied gas molecules were positioned at different sites and orientations towards the nanocomposite, and the adsorption process was examined based on the most stable structures. We found that both of these molecules are chemically adsorbed on the TiO2/Stanene heterostructures. The calculations of the adsorption energy indicate that the fivefold coordinated titanium sites of the TiO2/Stanene are the most stable sites for the adsorption of NO2 and O3 molecules. The side oxygen atoms of the gas molecules were found to be chemically bonded to these titanium atoms. The adsorption of gas molecules is an exothermic process, and the adsorption on the pristine nanocomposite is more favorable in energy than that on the nitrogen-doped nanocomposite. The effects of van der Waals interactions were taken into account, which indicate the adsorption energies were increased for the most sable configurations. The gas sensing response and charge transfers were analyzed in detail. The pristine nanocomposites have better sensing response than the doped ones. The spin density distribution plots indicate that the magnetization was mainly located over the adsorbed gas molecules. Mulliken charge analysis reveals that both NO2 and O3 molecules behave as charge acceptors, as evidenced by the accumulation of electronic charges on the adsorbed molecules predicted by charge density difference calculations. Our DFT results provide a theoretical basis for an innovative gas sensor system designed from a sensitive TiO2/Stanene heterostructures for efficient detection of harmful air pollutants such as NO2 and O3.
Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.
The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.
Electron beam patterning for writing of positively charged gold colloidal nanoparticles
Zafri, Hadar; Azougi, Jonathan; Girshevitz, Olga; Zalevsky, Zeev; Zitoun, David
2018-02-01
Synthesis at the nanoscale has progressed at a very fast pace during the last decades. The main challenge today lies in precise localization to achieve efficient nanofabrication of devices. In the present work, we report on a novel method for the patterning of gold metallic nanoparticles into nanostructures on a silicon-on-insulator (SOI) wafer. The fabrication makes use of relatively accessible equipment, a scanning electron microscope (SEM), and wet chemical synthesis. The electron beam implants electrons into the insulating material, which further anchors the positively charged Au nanoparticles by electrostatic attraction. The novel fabrication method was applied to several substrates useful in microelectronics to add plasmonic particles. The resolution and surface density of the deposition were tuned, respectively, by the electron energy (acceleration voltage) and the dose of electronic irradiation. We easily achieved the smallest written feature of 68 ± 18 nm on SOI, and the technique can be extended to any positively charged nanoparticles, while the resolution is in principle limited by the particle size distribution and the scattering of the electrons in the substrate. [Figure not available: see fulltext.
Intact Four-atom Organic Tetracation Stabilized by Charge Localization in the Gas Phase.
Yatsuhashi, Tomoyuki; Toyota, Kazuo; Mitsubayashi, Naoya; Kozaki, Masatoshi; Okada, Keiji; Nakashima, Nobuaki
2016-10-05
Several features distinguish intact multiply charged molecular cations (MMCs) from other species such as monocations and polycations: high potential energy, high electron affinity, a high density of electronic states with various spin multiplicities, and charge-dependent reactions. However, repulsive Coulombic interactions make MMCs quite unstable, and hence small organic MMCs are currently not readily available. Herein, we report that the isolated four-atom molecule diiodoacetylene survives after the removal of four electrons via tunneling. We show that the tetracation remains metastable towards dissociation because of the localization (91-95 %) of the positive charges on the terminal iodine atoms, ensuring minimum Coulomb repulsion between adjacent atoms as well as maximum charge-induced attractive dipole interactions between iodine and carbon. Our approach making use of iodines as the positively charged sites enables small organic MMCs to remain intact. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Panov, M.N.; Afrosimov, V.V.; Basalaev, A.A.; Guschina, N.A.; Nikulin, V.K.
2006-01-01
The interactions of protons and alpha-particles with hydrocarbons are investigated. A quantum-mechanical computation of the electronic structure of all hydrocarbons from methane to butane and its fragment ions was performed in the Hartree-Fock RHF/UHF approximation using a GAMESS program (General Atomic Molecular Electron Structure System). The correlation energy was taken into account within the framework of MP2 perturbation theory. The structural parameters of the hydrocarbon molecules and their charged and neutral fragments were calculated in two cases: in the geometry of the parent molecule or of the relaxation states. The difference of the full energy of the same fragments in and out of brackets gives us the vibration excitation energies of the fragments at the moment of creation. Additional Mulliken effective charges (in electron charge units) of atoms in the fragments have been calculated. The calculations show that removing one electron from the ethane molecule without electronic excitation produced a single charged molecular ion in vibration state with binding energy of hydrogen atoms, some decimal eV. As results we obtain C 2 H 6 + and C 2 H 5 + . Additional fragmentation of hydrocarbon needs electronic excitation of produced single charged ions. Cross sections for electron capture and excitation processes in collisions between the hydrogen-like He + , B 4+ and O 7+ ions have been evaluated. The purpose of the theory within this project during the period under review was to get for the first time new data on Single-Electron Capture (SEC) and Excitation Processes (EP) in collisions of He + (1s) ions with hydrogen-like impurity ions B 4+ (1s) and O 7+ (1s) in the energy range for He + ions from 0.2 MeV to 3.0 MeV. The calculations were carried out by using the method of close-coupling equations with basis sets of eleven and ten quasimolecular two-electron states for reactions (1, 2) and (3, 4), respectively (entrance channel, seven charge transfer channels
Simulation of the interaction of positively charged beams and electron clouds
International Nuclear Information System (INIS)
Markovik, Aleksandar
2013-01-01
The incoherent (head-tail) effect on the bunch due to the interaction with electron clouds (e-clouds) leads to a blow up of the transverse beam size in storage rings operating with positively charged beams. Even more the e-cloud effects are considered to be the main limiting factor for high current, high-brightness or high-luminosity operation of future machines. Therefore the simulation of e-cloud phenomena is a highly active field of research. The main focus in this work was set to a development of a tool for simulation of the interaction of relativistic bunches with non-relativistic parasitic charged particles. The result is the Particle-In-Cell Program MOEVE PIC Tracking which can track a 3D bunch under the influence of its own and external electromagnetic fields but first and foremost it simulates the interaction of relativistic positively charged bunches and initially static electrons. In MOEVE PIC Tracking the conducting beam pipe can be modeled with an arbitrary elliptical cross-section to achieve more accurate space charge field computations for both the bunch and the e-cloud. The simulation of the interaction between positron bunches and electron clouds in this work gave a detailed insight of the behavior of both particle species during and after the interaction. Further and ultimate goal of this work was a fast estimation of the beam stability under the influence of e-clouds in the storage ring. The standard approach to simulate the stability of a single bunch is to track the bunch particles through the linear optics of the machine by multiplying the 6D vector of each particle with the transformation matrices describing the lattice. Thereby the action of the e-cloud on the bunch is approximated by a pre-computed wake kick which is applied on one or more points in the lattice. Following the idea of K.Ohmi the wake kick was pre-computed as a two variable function of the bunch part exiting the e-cloud and the subsequent parts of a bunch which receive a
Attah, Isaac K; Platt, Sean P; Meot-Ner Mautner, Michael; El-Shall, M Samy; Peverati, Roberto; Head-Gordon, Martin
2015-04-02
The binding energy of the naphthalene(+•)(benzene) heterodimer cation has been determined to be 7.9 ± 1 kcal/mol for C10H8(+•)(C6H6) and 8.1 ± 1 kcal/mol for C10H8(+•)(C6D6) by equilibrium thermochemical measurements using the mass-selected drift cell technique. A second benzene molecule binds to the C10H8(+•)(C6D6) dimer with essentially the same energy (8.4 ± 1 kcal/mol), suggesting that the two benzene molecules are stacked on opposite sides of the naphthalene cation in the (C6D6)C10H8(+•)(C6D6) heterotrimer. The lowest-energy isomers of the C10H8(+•)(C6D6) and (C6D6)C10H8(+•)(C6D6) dimer and trimer calculated using the M11/cc-pVTZ method have parallel stacked structures with enthalpies of binding (-ΔH°) of 8.4 and 9.0 kcal/mol, respectively, in excellent agreement with the experimental values. The stacked face-to-face class of isomers is calculated to have substantial charge-transfer stabilization of about 45% of the total interaction energy despite the large difference between the ionization energies of benzene and naphthalene. Similarly, significant delocalization of the positive charge is found among all three fragments of the (C6D6)C10H8(+•)(C6D6) heterotrimer, thus leaving only 46% of the total charge on the central naphthalene moiety. This unexpectedly high charge-transfer component results in activating two benzene molecules in the naphthalene(+•)(benzene)2 heterotrimer cation to associate with a third benzene molecule at 219 K to form a benzene trimer cation and a neutral naphthalene molecule. The global minimum of the C10H8(+•)(C6H6)2 heterotrimer is found to be the one where the naphthalene cation is sandwiched between two benzene molecules. It is remarkable, and rather unusual, that the binding energy of the second benzene molecule is essentially the same as that of the first. This is attributed to the enhanced charge-transfer interaction in the stacked trimer radical cation.
Energy Technology Data Exchange (ETDEWEB)
Farrokhi, S [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires
1966-07-01
The variation of the double charge-changing collision cross-sections of H{sup +}, D{sup +}, Li{sup +} ions with organic molecules (CH{sub 4}, C{sub 2}H{sub 6}, C{sub 3}H{sub 8}, C{sub 4}H{sub 10}) in the energy range 10-50 keV has been studied. Several maximums for {sigma}{sub 1-1} = f(E) have been shown. Their existence should be explained by the different possibilities of dissociating the target-molecules. The position of the maximums, for the H{sup +} {yields} H{sup -} and D{sup +} {yields} D{sup -} reactions is in good agreement with that defined by the Massey adiabatic relation. (author) [French] Nous avons etudie la variation de la section efficace de double echange de charges des ions H{sup +}, D{sup +}, Li{sup +} lors de la collision avec les molecules organiques de CH{sub 4}, C{sub 2}H{sub 6}, C{sub 3}H{sub 8}, C{sub 4}H{sub 10} dans la gamme d'energie comprise entre 10 et 50 keV. Les resultats obtenus ont montre plusieurs maximums de {sigma}{sub 1-1} f(E). L'existence de ces maximums pourrait etre expliquee par les differentes possibilites de dissociation des molecules cibles. La position des points maximaux concernant les reactions H{sup +} {yields} H{sup -} et D{sup +} {yields} D{sup -} est en bon accord avec celle definie par la relation adiabatique de MASSEY. (auteur)
Single-Molecule Electronics: Chemical and Analytical Perspectives.
Nichols, Richard J; Higgins, Simon J
2015-01-01
It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.
Enriching the hydrogen storage capacity of carbon nanotube doped with polylithiated molecules
Panigrahi, P.; Naqvi, S. R.; Hankel, M.; Ahuja, R.; Hussain, T.
2018-06-01
In a quest to find optimum materials for efficient storage of clean energy, we have performed first principles calculations to study the structural and energy storage properties of one-dimensional carbon nanotubes (CNTs) functionalized with polylithiated molecules (PLMs). Van der Waals corrected calculations disclosed that various PLMs like CLi, CLi2, CLi3, OLi, OLi2, OLi3, bind strongly to CNTs even at high doping concentrations ensuring a uniform distribution of dopants without forming clusters. Bader charge analysis reveals that each Li in all the PLMs attains a partial positive charge and transform into Li+ cations. This situation allows multiple H2 molecules adsorbed with each Li+ through the polarization of incident H2 molecules via electrostatic and van der Waals type of interaction. With a maximum doping concentration, that is 3CLi2/3CLi3 and 3OLi2/3OLi3 a maximum of 36 H2 molecules could be adsorbed that corresponds to a reasonably high H2 storage capacity with the adsorption energies in the range of -0.33 to -0.15 eV/H2. This suits the ambient condition applications.
International Nuclear Information System (INIS)
Kusakabe, Toshio; Kitamuro, Satoshi; Nakai, Yohta; Tawara, Hiroyuki; Sasao, Mamiko
2012-01-01
Charge-transfer cross sections of the ground state He + ions in collisions with He atoms and simple molecules (H 2 , D 2 , N 2 , CO and CO 2 ) have been measured in the energy range of 0.20 to 4.0 keV with the initial growth rate method. Since previously published experimental data are scattered in the low energy region, the present observations would provide reasonably reliable cross section data below 4 keV. The charge transfer accompanied by dissociation of product molecular ion can be dominant at low energies for molecular targets. In He + + D 2 collisions, any isotope effect was not observed over the present energy range, compared to H 2 molecule. (author)
International Nuclear Information System (INIS)
Ye, ChuanXiang; Zhao, Yi; Liang, WanZhen
2015-01-01
The time-dependent correlation function approach for the calculations of absorption and resonance Raman spectra (RRS) of organic molecules absorbed on semiconductor surfaces [Y. Zhao and W. Z. Liang, J. Chem. Phys. 135, 044108 (2011)] is extended to include the contribution of the intermolecular charge transfer (CT) excitation from the absorbers to the semiconducting nanoparticles. The results demonstrate that the bidirectionally interfacial CT significantly modifies the spectral line shapes. Although the intermolecular CT excitation makes the absorption spectra red shift slightly, it essentially changes the relative intensities of mode-specific RRS and causes the oscillation behavior of surface enhanced Raman spectra with respect to interfacial electronic couplings. Furthermore, the constructive and destructive interferences of RRS from the localized molecular excitation and CT excitation are observed with respect to the electronic coupling and the bottom position of conductor band. The interferences are determined by both excitation pathways and bidirectionally interfacial CT
Structure-charge mobility relation for hexabenzocoronene derivatives
Energy Technology Data Exchange (ETDEWEB)
Kirkpatrick, James [Max Planck Institute for Polymer Research, Ackermannweg 10, Mainz 55128 (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, Valentina; Kremer, Kurt [Max Planck Institute for Polymer Research, Ackermannweg 10, Mainz 55128 (Germany); Nelson, Jenny [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Andrienko, Denis
2008-05-15
Charge mobilities of several derivatives of discotic liquid crystals have been determined by combining three methods into one scheme: (i) quantum chemical methods for the calculation of molecular electronic structures and reorganization energies (ii) molecular dynamics for simulation of the relative positions and orientations of molecules in a columnar mesophase, and (iii) kinetic Monte Carlo simulations and Master Equation approach to simulate charge transport. Applying this scheme to differently substituted hexabenzocoronene derivatives we reproduce the trends and magnitudes of mobilities as measured by pulse-radiolysis time-resolved microwave conductivity (PR-TRMC) and connect mobility directly to the microscopic morphology of the columns. Our study also shows that it is possible to understand and reproduce experimental charge transport parameters, and, in some cases, accurately predict them. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
Charge-transport simulations in organic semiconductors
Energy Technology Data Exchange (ETDEWEB)
May, Falk
2012-07-06
In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that
Multi-Excitonic Quantum Dot Molecules
Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.
2006-03-01
With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.
Enhancing SERS by Means of Supramolecular Charge Transfer
Wong, Eric; Flood, Amar; Morales, Alfredo
2009-01-01
In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.
International Nuclear Information System (INIS)
Chen Yungfu; Bae, Myung-Ho; Chialvo, Cesar; Dirks, Travis; Bezryadin, Alexey; Mason, Nadya
2011-01-01
We report measurements of magnetoresistance in bilayer graphene as a function of gate voltage (carrier density) and temperature. We examine multiple contributions to the magnetoresistance, including those of weak localization (WL), universal conductance fluctuations (UCF), and inhomogeneous charge transport. A clear WL signal is evident at all measured gate voltages (in the hole doped regime) and temperature ranges (from 0.25 to 4.3 K), and the phase coherence length extracted from the WL data does not saturate at low temperatures. The WL data is fit to demonstrate that the electron-electron Nyquist scattering is the major source of phase decoherence. A decrease in UCF amplitude with increase in gate voltage and temperature is shown to be consistent with a corresponding decrease in the phase coherence length. In addition, a weak positive magnetoresistance at higher magnetic fields is observed, and attributed to inhomogeneous charge transport. -- Research highlights: → Weak localization theory describes low-field magnetoresistance in bilayer graphene. → Electron-electron Nyquist scattering limits phase coherence in bilayer graphene. → Positive magnetoresistance reveals charge inhomogeneity in bilayer graphene.
Reduction of digital errors of digital charge division type position-sensitive detectors
International Nuclear Information System (INIS)
Uritani, A.; Yoshimura, K.; Takenaka, Y.; Mori, C.
1994-01-01
It is well known that ''digital errors'', i.e. differential non-linearity, appear in a position profile of radiation interactions when the profile is obtained with a digital charge-division-type position-sensitive detector. Two methods are presented to reduce the digital errors. They are the methods using logarithmic amplifiers and a weighting function. The validities of these two methods have been evaluated mainly by computer simulation. These methods can considerably reduce the digital errors. The best results are obtained when both methods are applied. ((orig.))
Single Molecule Nanoelectrochemistry in Electrical Junctions.
Nichols, Richard J; Higgins, Simon J
2016-11-15
It is now possible to reliably measure single molecule conductance in a wide variety of environments including organic liquids, ultrahigh vacuum, water, ionic liquids, and electrolytes. The most commonly used methods deploy scanning probe microscopes, mechanically formed break junctions, or lithographically formed nanogap contacts. Molecules are generally captured between a pair of facing electrodes, and the junction current response is measured as a function of bias voltage. Gating electrodes can also be added so that the electrostatic potential at the molecular bridge can be independently controlled by this third noncontacting electrode. This can also be achieved in an electrolytic environment using a four-electrode bipotentiostatic configuration, which allows independent electrode potential control of the two contacting electrodes. This is commonly realized using an electrochemical STM and enables single molecule electrical characterization as a function of electrode potential and redox state of the molecular bridge. This has emerged as a powerful tool in modern interfacial electrochemistry and nanoelectrochemistry for studying charge transport across single molecules as a function of electrode potential and the electrolytic environments. Such measurements are possible in electrolytes ranging from aqueous buffers to nonaqueous ionic liquids. In this Account, we illustrate a number of examples of single molecule electrical measurements under electrode potential control use a scanning tunneling microscope (STM) and demonstrate how these can help in the understanding of charge transport in single molecule junctions. Examples showing charge transport following phase coherent tunneling to incoherent charge hopping across redox active molecular bridges are shown. In the case of bipyridinium (or viologen) molecular wires, it is shown how electrochemical reduction leads to an increase of the single molecule conductance, which is controlled by the liquid electrochemical
Electron emission following collisions between multi-charged ions and D2 molecules
International Nuclear Information System (INIS)
Laurent, G.
2004-05-01
Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S 15+ , 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D + fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)
Meng, Xian; Liu, Zhimeng; Deng, Cheng; Zhu, Mengfu; Wang, Deyin; Li, Kui; Deng, Yu; Jiang, Mingming
2016-12-15
A novel microporous nano-MgO/diatomite ceramic membrane with high positive surface charge was prepared, including synthesis of precursor colloid, dip-coating and thermal decomposition. Combined SEM, EDS, XRD and XPS studies show the nano-MgO is irregularly distributed on the membrane surface or pore walls and forms a positively charged nano coating. And the nano-MgO coating is firmly attached to the diatomite membrane via SiO chemical bond. Thus the nano-MgO/diatomite membrane behaves strong electropositivity with the isoelectric point of 10.8. Preliminary filtration tests indicate that the as-prepared nano-MgO/diatomite membrane could remove approximately 99.7% of tetracycline in water through electrostatic adsorption effect. The desirable electrostatic property enables the nano-MgO/diatomite membrane to be a candidate for removal of organic pollutants from water. And it is convinced that there will be a great application prospect of charged ceramic membrane in water treatment field. Copyright © 2016 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Abbaszadegan, A.; Ghahramani, Y.; Nabavizadeh, M.; Gholami, A.; Hemmateenejad, I.; Dorostkar, S.; Sharghi, H.
2014-01-01
The bactericidal efficiency of various positively and negatively charged silver nanoparticles has been extensively evaluated in literature, but there is no report on efficacy of neutrally charged silver nanoparticles. The goal of this study is to evaluate the role of electrical charge at the surface of silver nanoparticles on antibacterial activity against a panel of microorganisms. Three different silver nanoparticles were synthesized by different methods, providing three different electrical surface charges (positive, neutral, and negative). The antibacterial activity of these nanoparticles was tested against gram-positive (i.e., Staphylococcus aureus, Streptococcus mutans, and Streptococcus pyogenes) and gram-negative (i.e., Escherichia coli and Proteus vulgaris) bacteria. Well diffusion and micro-dilution tests were used to evaluate the bactericidal activity of the nanoparticles. According to the obtained results, the positively-charged silver nanoparticles showed the highest bactericidal activity against all microorganisms tested. The negatively charged silver nanoparticles had the least and the neutral nanoparticles had intermediate antibacterial activity. The most resistant bacteria were Proteus vulgaris. We found that the surface charge of the silver nanoparticles was a significant factor affecting bactericidal activity on these surfaces. Although the positively charged nanoparticles showed the highest level of effectiveness against the organisms tested, the neutrally charged particles were also potent against most bacterial species.
Charge dividing mechanism in position-sensitive detectors
International Nuclear Information System (INIS)
Radeka, V.; Rehak, P.
1978-01-01
A complete charge-division mechanism, including both the diffusion and the electromagnetic wave propagation on resistive electrodes, is presented. The charge injected into such a transmission line divides between the two ends according to the ratio of resistances and independently of the value of the line resistance, of the propagation mechanism and of the distribution of inductance and capacitance along the line. The shortest charge division time is achieved for Rl = 2π (L/C)/sup 1/2), where R, L, C are resistance, inductance and capacitance per unit length and l is the length of the line
Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk
2017-07-01
Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.
Precise determination of the Bragg peak position of proton beams in liquid water
International Nuclear Information System (INIS)
Marouane, Abdelhak; Ouaskit, Said; Inchaouh, Jamal
2011-01-01
The influence of water molecules on the surrounding biological molecules during irradiation with protons is currently a major subject in radiation science. Proton collisions with the water molecules are estimated around the Bragg peak region, taking into account ionization, excitation, charge-changing processes, and energetic secondary electron behavior. The Bragg peak profile and position was determined by adopting a new approach involving discretization, incrementation, and dividing the target into layers, the thickness of each layer being selected randomly from a distribution weighted by the values of the total interaction cross section, from excitation up to ionization of the target and the incident projectile charge exchange. The calculation was carried out by a Monte-Carlo simulation in the energy range 20 ≤ E ≤ 10 8 eV, including the relativistic corrections.
Study of electric field distorted by space charges under positive lightning impulse voltage
Wang, Zezhong; Geng, Yinan
2018-03-01
Actually, many insulation problems are related to electric fields. And measuring electric fields is an important research topic of high-voltage engineering. In particular, the electric field distortion caused by space charge is the basis of streamer theory, and thus quantitatively measuring the Poisson electric field caused by space charge is significant to researching the mechanism of air gap discharge. In this paper, we used our photoelectric integrated sensor to measure the electric field distribution in a 1-m rod-plane gap under positive lightning impulse voltage. To verify the reliability of this quantitative measurement, we compared the measured results with calculated results from a numerical simulation. The electric-field time domain waveforms on the axis of the 1-m rod-plane out of the space charge zone were measured with various electrodes. The Poisson electric fields generated by space charge were separated from the Laplace electric field generated by applied voltages, and the amplitudes and variations were measured for various applied voltages and at various locations. This work also supplies the feasible basis for directly measuring strong electric field under high voltage.
Effect of substrate bias on deposition behaviour of charged silicon nanoparticles in ICP-CVD process
International Nuclear Information System (INIS)
Yoo, Seung-Wan; Kim, Jung-Hyung; Seong, Dae-Jin; You, Shin-Jae; Seo, Byong-Hoon; Hwang, Nong-Moon
2017-01-01
The effect of a substrate bias on the deposition behaviour of crystalline silicon films during inductively coupled plasma chemical vapour deposition (ICP-CVD) was analysed by consideration of non-classical crystallization, in which the building block is a nanoparticle rather than an individual atom or molecule. The coexistence of positively and negatively charged nanoparticles in the plasma and their role in Si film deposition are confirmed by applying bias voltages to the substrate, which is sufficiently small as not to affect the plasma potential. The sizes of positively and negatively charged nanoparticles captured on a carbon membrane and imaged using TEM are, respectively, 2.7–5.5 nm and 6–13 nm. The film deposited by positively charged nanoparticles has a typical columnar structure. In contrast, the film deposited by negatively charged nanoparticles has a structure like a powdery compact with the deposition rate about three times higher than that for positively charged nanoparticles. All the films exhibit crystallinity even though the substrate is at room temperature, which is attributed to the deposition of crystalline nanoparticles formed in the plasma. The film deposited by negatively charged nanoparticles has the highest crystalline fraction of 0.84. (paper)
Paterson, Alexandra F.
2017-12-27
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
Paterson, Alexandra F.; Lin, Yen-Hung; Mottram, Alexander D.; Fei, Zhuping; Niazi, Muhammad Rizwan; Kirmani, Ahmad R.; Amassian, Aram; Solomeshch, Olga; Tessler, Nir; Heeney, Martin; Anthopoulos, Thomas D.
2017-01-01
Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.
International Nuclear Information System (INIS)
Goncharov, A.A.; Dobrovol'skii, A.M.; Dunets, S.P.; Evsyukov, A.N.; Protsenko, I.M.
2009-01-01
We describe a new approach for creation an effective, low-cost, low-maintenance axially symmetric plasma optical tools for focusing and manipulating high-current beams of negatively charged particles, electrons and negative ions. This approach is based on fundamental plasma optical concept of magnetic insulation of electrons and non-magnetized positive ions providing creation of controlled uncompensated cloud of the space charge. The axially symmetric electrostatic plasma optical lens is well-known and well developed tool where this concept is used successfully. This provides control and focusing high-current positive ion beams in wide range of parameters. Here for the first time we present optimistic experimental results describing the application of an idea of magnetic insulation of electrons for generation of the stable cloud of positive space charge by focusing onto axis the converging stream of heavy ions produced by circular accelerator with closed electron drift. The estimations of a maximal concentration of uncompensated cloud of positive ions are also made
Positive column of a glow discharge in neon with charged dust grains (a review)
Energy Technology Data Exchange (ETDEWEB)
Polyakov, D. N., E-mail: cryolab@ihed.ras.ru; Shumova, V. V.; Vasilyak, L. M. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)
2017-03-15
The effect of charged micron-size dust grains (microparticles) on the electric parameters of the positive column of a low-pressure dc glow discharge in neon has been studied experimentally and numerically. Numerical analysis is carried out in the diffusion-drift approximation with allowance for the interaction of dust grains with metastable neon atoms. In a discharge with a dust grain cloud, the longitudinal electric field increases. As the number density of dust grains in an axisymmetric cylindrical dust cloud rises, the growth of the electric field saturates. It is shown that the contribution of metastable atoms to ionization is higher in a discharge with dust grains, in spite of the quenching of metastable atoms on dust grains. The processes of charging of dust grains and the dust cloud are considered. As the number density of dust grains rises, their charge decreases, while the space charge of the dust cloud increases. The results obtained can be used in plasma technologies involving microparticles.
Positive column of a glow discharge in neon with charged dust grains (a review)
International Nuclear Information System (INIS)
Polyakov, D. N.; Shumova, V. V.; Vasilyak, L. M.
2017-01-01
The effect of charged micron-size dust grains (microparticles) on the electric parameters of the positive column of a low-pressure dc glow discharge in neon has been studied experimentally and numerically. Numerical analysis is carried out in the diffusion-drift approximation with allowance for the interaction of dust grains with metastable neon atoms. In a discharge with a dust grain cloud, the longitudinal electric field increases. As the number density of dust grains in an axisymmetric cylindrical dust cloud rises, the growth of the electric field saturates. It is shown that the contribution of metastable atoms to ionization is higher in a discharge with dust grains, in spite of the quenching of metastable atoms on dust grains. The processes of charging of dust grains and the dust cloud are considered. As the number density of dust grains rises, their charge decreases, while the space charge of the dust cloud increases. The results obtained can be used in plasma technologies involving microparticles.
Excitation of atoms and molecules in collisions with highly charged ions
International Nuclear Information System (INIS)
Watson, R.L.
1993-01-01
A study of the double ionization of He by high-energy N 7+ ions was extended up in energy to 40 MeV/amu. Coincidence time-of-flight studies of multicharged N 2 , O 2 , and CO molecular ions produced in collisions with 97-MeV Ar 14+ ions were completed. Analysis of the total kinetic energy distributions and comparison with the available data for CO 2+ and CO 3+ from synchrotron radiation experiments led to the conclusion that ionization by Ar-ion impact populates states having considerably higher excitation energies than those accessed by photoionization. The dissociation fractions for CO 1+ and CO 2+ molecular ions, and the branching ratios for the most prominent charge division channels of CO 2+ through CO 7+ were determined from time-of-flight singles and coincidence data. An experiment designed to investigate the orientation dependence of dissociative multielectron ionization of molecules by heavy ion impact was completed. Measurements of the cross sections for K-shell ionization of intermediate-Z elements by 30-MeV/amu H, N, Ne, and Ar ions were completed. The cross sections were determined for solid targets of Z = 13, 22, 26, 29, 32, 40, 42, 46, and 50 by recording the spectra of K x rays with a Si(Li) spectrometer
Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA
Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan
2018-05-01
Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.
Charge transfer through single molecule contacts: How reliable are rate descriptions?
Directory of Open Access Journals (Sweden)
Denis Kast
2011-08-01
Full Text Available Background: The trend for the fabrication of electrical circuits with nanoscale dimensions has led to impressive progress in the field of molecular electronics in the last decade. However, a theoretical description of molecular contacts as the building blocks of future devices is challenging, as it has to combine the properties of Fermi liquids in the leads with charge and phonon degrees of freedom on the molecule. Outside of ab initio schemes for specific set-ups, generic models reveal the characteristics of transport processes. Particularly appealing are descriptions based on transfer rates successfully used in other contexts such as mesoscopic physics and intramolecular electron transfer. However, a detailed analysis of this scheme in comparison with numerically exact solutions is still elusive.Results: We show that a formulation in terms of transfer rates provides a quantitatively accurate description even in domains of parameter space where strictly it is expected to fail, e.g., at lower temperatures. Typically, intramolecular phonons are distributed according to a voltage driven steady state that can only roughly be captured by a thermal distribution with an effective elevated temperature (heating. An extension of a master equation for the charge–phonon complex, to effectively include the impact of off-diagonal elements of the reduced density matrix, provides very accurate solutions even for stronger electron–phonon coupling.Conclusion: Rate descriptions and master equations offer a versatile model to describe and understand charge transfer processes through molecular junctions. Such methods are computationally orders of magnitude less expensive than elaborate numerical simulations that, however, provide exact solutions as benchmarks. Adjustable parameters obtained, e.g., from ab initio calculations allow for the treatment of various realizations. Even though not as rigorously formulated as, e.g., nonequilibrium Green’s function
Krettenauer, Tobias; Johnston, Megan
2011-09-01
The study analyses adolescents' positively charged versus negatively charged moral emotion expectancies. Two hundred and five students (M= 14.83 years, SD= 2.21) participated in an interview depicting various situations in which a moral norm was either regarded or transgressed. Emotion expectancies were assessed for specific emotions (pride, guilt) as well as for overall strength and valence. In addition, self-importance of moral values was measured by a questionnaire. Results revealed that positively charged emotion expectancies were more pronounced in contexts of prosocial action than in the context of moral transgressions, whereas the opposite was true for negatively charged emotions. At the same time, expectations of guilt and pride were substantially related to the self-importance of moral values. ©2010 The British Psychological Society.
Position-sensitive X-ray detectors
International Nuclear Information System (INIS)
Hendrix, J.
1982-01-01
An overview is given of the different types of position-sensitive X-ray detectors used in kinetic studies of biological molecule state changes using X-ray diffraction with synchrotron radiation as a probe. The detector requirements and principles of operation of proportional counters are outlined. Multiwire proportional chamber systems and their readout techniques are described. Other detectors discussed include a drift chamber type detector, microchannel plates, charge-couple devices and, for high count rates, an integrating TV-detector. (U.K.)
Positively charged phosphorus as a hydrogen bond acceptor
DEFF Research Database (Denmark)
Hansen, Anne Schou; Du, Lin; Kjærgaard, Henrik Grum
2014-01-01
Phosphorus (P) is an element that is essential to the life of all organisms, and the atmospheric detection of phosphine suggests the existence of a volatile biogeochemical P cycle. Here, we investigate the ability of P to participate in the formation of OH···P hydrogen bonds. Three bimolecular......-stretching frequency red shifts and quantum chemical calculations, we find that P is an acceptor atom similar in strength to O and S and that all three P, O, and S atoms are weaker acceptors than N. The quantum chemical calculations show that both H and P in the OH···P hydrogen bond have partial positive charges......, as expected from their electronegativities. However, the electrostatic potentials show a negative potential area on the electron density surface around P that facilitates formation of hydrogen bonds....
Multiple ionization dynamics of molecules in intense laser fields
International Nuclear Information System (INIS)
Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko
2005-01-01
A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)
A charge exchange chamber with built-in focusing
International Nuclear Information System (INIS)
Devienne, F.M.
1975-01-01
This invention concerns a charge exchange chamber with built-in focusing enabling a beam of low divergence neutrals to be obtained from a beam of ions of a given energy. The ion beam enters the charge exchange chamber filled with a neutral gas under pressure, the effect of which is an exchange of charges between the ions and the neutral molecules or atoms of the gas. The positive ions are substantially sent along the axis of the enclosure, characterised in that it includes electric facilities for concentrating the ions of the beam near this axis. These electric facilities are composed of a series of grids perpendicular to the direction of the ion jet, grids that are transparent and of negative potential and the potential of each of these grids increases in absolute value along the path of the ion jet in the enclosure [fr
Directory of Open Access Journals (Sweden)
Susmita Sarkar
2018-03-01
Full Text Available In this paper onset of turbulence has been detected from the study of non linear dust acoustic wave propagation in a complex plasma considering electrons nonthermal and equilibrium dust charge positive. Dust grains are charged by secondary electron emission process. Our analysis shows that increase in electron nonthermality makes the grain charging process faster by reducing the magnitude of the nonadiabaticity induced pseudo viscosity. Consequently nature of dust charge variation changes from nonadiabatic to adiabatic one. For further increase of electron nonthermality, this pseudo viscosity becomes negative and hence generates a turbulent grain charging behaviour. This turbulent grain charging phenomenon is exclusively the outcome of this nonlinear study which was not found in linear analysis.
Nuclear Fusion Rate Study of a Muonic Molecule via Nuclear Threshold Resonances
Faghihi, F.; Eskandari, M. R.
This work follows our previous calculations of the ground state binding energy, size, and the effective nuclear charge of the muonic T3 molecule, using the Born-Oppenheimer adiabatic approximation. In our past articles, we showed that the system possesses two minimum positions, the first one at the muonic distance and the second at the atomic distance. Also, the symmetric planner vibrational model assumed between the two minima and the approximated potential were calculated. Following from the previous studies, we now calculate the fusion rate of the T3 muonic molecule according to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions.
Charge exchange in slow collisions of multiply charged ions with atoms
International Nuclear Information System (INIS)
Presnyakov, L.P.; Uskov, D.B.; Janev, R.K.
1982-01-01
Single-electron charge exchange between ions having a charge Z>6 and atoms is considered at relative velocities v< Z/sup 1/2/. An analytic method is developed for the solution of a multilevel problem that is a generalization of the decay model and of the approximation of nonadiabatic coupling between two states. Expressions are obtained for the reaction-product distributions in the principal and angular quantum numbers. The calculated total cross sections agree well with the experimental data on charge exchange of hydrogen atoms and molecules with nuclei. The theory describes the oscillations of the total cross section against the background of a monotonic growth as the charge is increased
Charge orders in organic charge-transfer salts
International Nuclear Information System (INIS)
Kaneko, Ryui; Valentí, Roser; Tocchio, Luca F; Becca, Federico
2017-01-01
Motivated by recent experimental suggestions of charge-order-driven ferroelectricity in organic charge-transfer salts, such as κ -(BEDT-TTF) 2 Cu[N(CN) 2 ]Cl, we investigate magnetic and charge-ordered phases that emerge in an extended two-orbital Hubbard model on the anisotropic triangular lattice at 3/4 filling. This model takes into account the presence of two organic BEDT-TTF molecules, which form a dimer on each site of the lattice, and includes short-range intramolecular and intermolecular interactions and hoppings. By using variational wave functions and quantum Monte Carlo techniques, we find two polar states with charge disproportionation inside the dimer, hinting to ferroelectricity. These charge-ordered insulating phases are stabilized in the strongly correlated limit and their actual charge pattern is determined by the relative strength of intradimer to interdimer couplings. Our results suggest that ferroelectricity is not driven by magnetism, since these polar phases can be stabilized also without antiferromagnetic order and provide a possible microscopic explanation of the experimental observations. In addition, a conventional dimer-Mott state (with uniform density and antiferromagnetic order) and a nonpolar charge-ordered state (with charge-rich and charge-poor dimers forming a checkerboard pattern) can be stabilized in the strong-coupling regime. Finally, when electron–electron interactions are weak, metallic states appear, with either uniform charge distribution or a peculiar 12-site periodicity that generates honeycomb-like charge order. (paper)
Energy Technology Data Exchange (ETDEWEB)
Kirchev, A.; Perrin, M.; Lemaire, E.; Karoui, F.; Mattera, F. [Commissariat de l' Energie Atomique, Institut National de l' Energie Solaire, INES-RDI, Parc Technologique de Savoie Technolac, 50 Avenue du Lac Leman, 73377 Le Bourget du Lac Cedex (France)
2008-02-15
The mechanism of the positive plate charge in pulse regime was studied in model lead-acid cells with one positive and two negative plates (8 Ah each) and Ag/Ag{sub 2}SO{sub 4} reference electrodes. The results showed that the evolution of the electrode potential is much slower on the positive plate than on the negative plate. Regardless of this fact, the calculated capacitive current of charge and self-discharge of the electrochemical double layer (EDL) during the 'ON' and 'OFF' half-periods of the pulse current square waves is comparable with the charge current amplitude. The result is due to the high values of the EDL on the surface of the lead dioxide active material. The influence of different factors like state of charge, state of health, pulse frequency, current amplitude and open circuit stay before the polarization was discussed. The previously determined optimal frequency of 1 Hz was associated with a maximum in the average double layer current on frequency dependence. The average double layer current is also maximal at SOC between 75 and 100%. The exchange of the constant current polarization with pulse polarization does not change substantially the mechanism and the overvoltage of the oxygen evolution reaction on the positive plate. The mechanism of the self-discharge of the EDL was also estimated analyzing long-time PPP transients (up to 2 h). It was found that when the PPP is lower than 1.2 V the preferred mechanism of EDL self-discharge is by coupling with the lead sulphate oxidation reaction. At higher values of PPP the EDL self-discharge happens via oxygen evolution. The high faradic efficiency of the pulse charge is due to the chemical oxidation of the Pb(II) ions by the O atoms and OH radicals formed at the oxygen evolution both during the 'ON' and 'OFF' periods. (author)
Directory of Open Access Journals (Sweden)
Ilenia De Luca
2016-09-01
Full Text Available Understanding the mechanisms by which mesenchymal stromal cells (MSCs interact with the physical properties (e.g. topography, charge, ζ-potential, and contact angle of polymeric surfaces is essential to design new biomaterials capable of regulating stem cell behavior. The present study investigated the ability of two polymers (pHM1 and pHM3 with different positive surface charge densities to modulate the differentiation of MSCs into osteoblast-like phenotype via cell-cell ephrinB2/EphB4 signaling. Although pHM1 promoted the phosphorylation of EphB4, leading to cell differentiation, pHM3, characterized by a high positive surface charge density, had no significant effect on EphB4 activation or MSCs differentiation. When the MSCs were cultured on pHM1 in the presence of a forward signaling blocking peptide, the osteoblast differentiation was compromised. Our results demonstrated that the ephrinB2/EphB4 interaction was required for MSCs differentiation into an osteoblast-like phenotype and that the presence of a high positive surface charge density altered this interaction.
Exploring charge transport properties and functionality of molecule-nanoparticle ensembles
Devid, Edwin Johan
2015-01-01
For more than 65 years, scientists have been fascinated by the idea to miniaturize electrical circuits toward the smallest length scales. One particular way is inspired by nature itself, specifically to assemble electrical components and switches from atoms and molecules. The molecules typically
The effects of electric fields on charged molecules and particles in individual microenvironments
Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.
Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.
Ataherian, Fatemeh; Wu, Nae-Lih
2011-01-01
The long-term charge/discharge cycling stability of MnO 2 electrode under positive polarization in aqueous KCl electrolyte has been studied over different potential windows spanning from the open circuit potential to varied higher-end potential
Mobilities of positive ions in gas ionization chambers
International Nuclear Information System (INIS)
Kusumegi, Asao
1990-01-01
Observed ion mobilities of organic molecules in Ar are compared with a complete polarization model to examine the performance of the model, and its applicability is discussed. In spite of its simplicity, the polarization model (small sphere limit) is found to agree satisfactorily with observed mobilities in the case of alkali ions in Ar. However, the model fails to account for the mobility of Ar + in Ar due to a resonant charge transfer interaction between the ion and the parent gas. On the other hand, the values of k, a parameter which depends on the kinetic and the potential energy of the relevant ion, derived from observed ion mobilities of organic molecules in Ar and in the parent gas are found to be close to each other. Except for few cases, it appears that the complete polarization model gives a reasonable approximation for the positive ion mobilities of organic molecules in Ar, though the importance of the ion mass identification is significant in considering the applicability of the model to the positive ion mobility of those organic molecules in Ar used in a gas ionization chamber. (N.K.)
Towards high charge carrier mobilities by rational design of organic semiconductors
Energy Technology Data Exchange (ETDEWEB)
Andrienko, Denis; Ruehle, Victor; Baumeier, Bjoern; Vehoff, Thorsten; Lukyanov, Alexander; Kremer, Kurt [Max Planck Institute for Polymer Research, Mainz (Germany); Marcon, Valentina [Technische Universitaet Darmstadt (Germany); Kirkpatrick, James; Nelson, Jenny [Imperial College London (United Kingdom); Lennartz, Christian [BASF AG, Ludwigshafen (Germany)
2010-07-01
The role of material morphology on charge carrier mobility in partially disordered organic semiconductors is discussed for several classes of materials: derivatives of hexabenzocoronenens, perylenediimides, triangularly-shaped polyaromatic hydrocarbons, and Alq{sub 3}. Simulations are performed using a package developed by Imperial College, London and Max Planck Institute for Polymer Research, Mainz (votca.org). This package combines several techniques into one scheme: quantum chemical methods for the calculation of molecular electronic structures and reorganization energies; molecular dynamics and systematic coarse-graining approaches for simulation of self-assembly and relative positions and orientations of molecules on large scales; kinetic Monte Carlo and master equation for studies of charge transport.
Hydration of excess electrons trapped in charge pockets on molecular surfaces
Jalbout, Abraham F.; Del Castillo, R.; Adamowicz, Ludwik
2007-01-01
In this work we strive to design a novel electron trap located on a molecular surface. The process of electron trapping involves hydration of the trapped electron. Previous calculations on surface electron trapping revealed that clusters of OH groups can form stable hydrogen-bonded networks on one side of a hydrocarbon surface (i.e. cyclohexane sheets), while the hydrogen atoms on the opposite side of the surface form pockets of positive charge that can attract extra negative charge. The excess electron density on such surfaces can be further stabilized by interactions with water molecules. Our calculations show that these anionic systems are stable with respect to vertical electron detachment (VDE).
Ghai, Ishan; Pira, Alessandro; Scorciapino, Mariano Andrea; Bodrenko, Igor; Benier, Lorraine; Ceccarelli, Matteo; Winterhalter, Mathias; Wagner, Richard
2017-03-16
A major challenge in the discovery of the new antibiotics against Gram-negative bacteria is to achieve sufficiently fast permeation in order to avoid high doses causing toxic side effects. So far, suitable assays for quantifying the uptake of charged antibiotics into bacteria are lacking. We apply an electrophysiological zero-current assay using concentration gradients of β-lactamase inhibitors combined with single-channel conductance to quantify their flux rates through OmpF. Molecular dynamic simulations provide in addition details on the interactions between the nanopore wall and the charged solutes. In particular, the interaction barrier for three β-lactamase inhibitors is surprisingly as low as 3-5 kcal/mol and only slightly above the diffusion barrier of ions such as chloride. Within our macroscopic constant field model, we determine that at a zero-membrane potential a concentration gradient of 10 μM of avibactam, sulbactam, or tazobactam can create flux rates of roughly 620 molecules/s per OmpF trimer.
Ahmed, Ghada H.; Parida, Manas R.; Tosato, Alberto; AbdulHalim, Lina G.; Usman, Anwar; Alsulami, Qana; Banavoth, Murali; Alarousu, Erkki; Bakr, Osman; Mohammed, Omar F.
2015-01-01
investigate the electrostatic interactions between the positively charged fullerene derivative C60-(N,N dimethylpyrrolidinium iodide) (CF) employed as an efficient molecular acceptor and two different donor molecules: Ag29 nanoclusters (NCs) and CdTe quantum
Symmetry-breaking intramolecular charge transfer in the excited state of meso-linked BODIPY dyads
Whited, Matthew T.; Patel, Niral M.; Roberts, Sean T.; Allen, Kathryn; Djurovich, Peter I.; Bradforth, Stephen E.; Thompson, Mark E.
2012-01-01
We report the synthesis and characterization of symmetric BODIPY dyads where the chromophores are attached at the meso position, using either a phenylene bridge or direct linkage. Both molecules undergo symmetry-breaking intramolecular charge transfer in the excited state, and the directly linked dyad serves as a visible-light-absorbing analogue of 9,9′-bianthryl.
Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.
Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi
2018-02-27
In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.
DEFF Research Database (Denmark)
Kiriy, N.; Bocharova, V.; Kiriy, A.
2004-01-01
This paper describes synthesis and characterization of two thiophene-based azomethines designed to optimize solubility, self-assembly, and charge carrier mobility. We found that incorporation of azomethine and amide moieties in the alpha,omega-position, and hexyl chains in the beta-position of th...... with the mobilities of the best organic semiconductors. All these significant differences in properties of related compounds can be attributed to the hydrogen bonding between QT-amide molecules responsible for the observed self-assembly....
Surface charge sensing by altering the phase transition in VO2
Kumar, S.; Esfandyarpour, R.; Davis, R.; Nishi, Y.
2014-08-01
Detection of surface charges has various applications in medicine, electronics, biotechnology, etc. The source of surface charge induction may range from simple charge-polarized molecules like water to complicated proteins. It was recently discovered that surface charge accumulation can alter the temperature at which VO2 undergoes a Mott transition. Here, we deposited polar molecules onto the surface of two-terminal thin-film VO2 lateral devices and monitored the joule-heating-driven Mott transition, or conductance switching. We observed that the power required to induce the conductance switching reduced upon treatment with polar molecules and, using in-situ blackbody-emission direct measurement of local temperature, we show that this reduction in power was accompanied by reduction in the Mott transition temperature. Further evidence suggested that this effect has specificity to the nature of the species used to induce surface charges. Using x-ray absorption spectroscopy, we also show that there is no detectable change in oxidation state of vanadium or structural phase in the bulk of the 40 nm VO2 thin-film even as the phase transition temperature is reduced by up to 20 K by the polar molecules. The ability to alter the phase transition parameters by depositing polar molecules suggests a potential application in sensing surface charges of different origins and this set of results also highlights interesting aspects of the phase transition in VO2.
Enhanced polarizability of aromatic molecules placed in the vicinity of silver clusters
International Nuclear Information System (INIS)
Mayer, A; Schatz, G C
2009-01-01
We use a charge-dipole interaction model to study the polarizability of aromatic molecules that are placed between two silver clusters. In particular we examine the enhancement in polarizability induced by the clusters at plasmon-like resonant frequencies of the cluster-molecule-cluster system. The model used for these simulations relies on representation of the atoms by both a net electric charge and a dipole. By relating the time variation of the atomic charges to the currents that flow through the bonds of the structures considered, a least-action principle can be formulated that enables the atomic charges and dipoles to be determined. We consider benzene, naphthalene and anthracene for this study, comparing the polarizability of these aromatic molecules when placed in the middle between two Ag 120 clusters, with their polarizability as isolated molecules. We find that the polarizability of these molecules is enhanced by the clusters, and this increases the electromagnetic coupling between the two clusters. This results in significant red-shifting (by up to 0.8 eV) of the lowest energy optical transition in the cluster-molecule-cluster system compared to plasmon-like excitation in the cluster-cluster system. The resulting resonant polarizability enhancement leads to an electromagnetic enhancement in surface-enhanced Raman scattering of over 10 6 .
Electronic coupling effects and charge transfer between organic molecules and metal surfaces
Energy Technology Data Exchange (ETDEWEB)
Forker, Roman
2010-07-01
We employ a variant of optical absorption spectroscopy, namely in situ differential reflectance spectroscopy (DRS), for an analysis of the structure-properties relations of thin epitaxial organic films. Clear correlations between the spectra and the differently intense coupling to the respective substrates are found. While rather broad and almost structureless spectra are obtained for a quaterrylene (QT) monolayer on Au(111), the spectral shape resembles that of isolated molecules when QT is grown on graphite. We even achieve an efficient electronic decoupling from the subjacent Au(111) by inserting an atomically thin organic spacer layer consisting of hexa-peri-hexabenzocoronene (HBC) with a noticeably dissimilar electronic behavior. These observations are further consolidated by a systematic variation of the metal substrate (Au, Ag, and Al), ranging from inert to rather reactive. For this purpose, 3,4,9,10-perylenetetracarboxylic dianhydride (PTCDA) is chosen to ensure comparability of the molecular film structures on the different metals, and also because its electronic alignment on various metal surfaces has previously been studied with great intensity. We present evidence for ionized PTCDA at several interfaces and propose the charge transfer to be related to the electronic level alignment governed by interface dipole formation on the respective metals. (orig.)
Brauer, Jan C.; Marchioro, Arianna; Paraecattil, Arun A.; Oskouei, Ahmad A.; Moser, Jacques-E.
2015-01-01
Electron injection from a photoexcited molecular sensitizer into a wide-bandgap semiconductor is the primary step toward charge separation in dye-sensitized solar cells (DSSCs). According to the current understanding of DSSCs functioning mechanism, charges are separated directly during this primary electron transfer process, yielding hot conduction band electrons in the semiconductor and positive holes localized on oxidized dye molecules at the surface. Comparing results of ultrafast transien...
Measuring momentum for charged particle tomography
Morris, Christopher; Fraser, Andrew Mcleod; Schultz, Larry Joe; Borozdin, Konstantin N.; Klimenko, Alexei Vasilievich; Sossong, Michael James; Blanpied, Gary
2010-11-23
Methods, apparatus and systems for detecting charged particles and obtaining tomography of a volume by measuring charged particles including measuring the momentum of a charged particle passing through a charged particle detector. Sets of position sensitive detectors measure scattering of the charged particle. The position sensitive detectors having sufficient mass to cause the charged particle passing through the position sensitive detectors to scatter in the position sensitive detectors. A controller can be adapted and arranged to receive scattering measurements of the charged particle from the charged particle detector, determine at least one trajectory of the charged particle from the measured scattering; and determine at least one momentum measurement of the charged particle from the at least one trajectory. The charged particle can be a cosmic ray-produced charged particle, such as a cosmic ray-produced muon. The position sensitive detectors can be drift cells, such as gas-filled drift tubes.
International Nuclear Information System (INIS)
Havener, Charles C.
2001-01-01
At ORNL Multicharged Ion Research Facility (MIRF), charge exchange (CX) cross sections have been measured for multicharged ions (MCI) on neutral atoms and molecules. The ORNL ion-atom merged-beam apparatus was used to measure single electron capture by MCI from H at eV/amu energies. A gas cell was used to measure single and double electron capture by MCI from a variety of molecular targets at keV collision energies. The merged-beams experiment has been successful in providing benchmark total electron capture measurements for several collision systems with a variety of multicharged ions on H or D
Theory and simulation of charge transport in disordered organic semiconductors
Bobbert, P.A.; Kondov, I.; Sutman, G.
2013-01-01
Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges
Electron capture in ion-molecule collisions at intermediate energy
International Nuclear Information System (INIS)
Kumura, M.
1986-01-01
Recent progress of theoretical charge transfer study in ion-molecule collisions at the intermediate energy is reviewed. Concept of close and distant collisions obtained from extensive ion-atom collision studies is identified so that it can be utilized to model two distinct collision processes. For a close collision, explicit representation of the whole collision complex is necessary to describe collision dynamics correctly, while a model potential approach for molecule is appropriate for a distant collision. It is shown that these two distinct models are indeed capable of reproducing experimental charge transfer cross sections. Some remarks for further theoretical study of ion-molecule collisions are also given. 21 refs., 8 figs
International Nuclear Information System (INIS)
Song Fei; Mao Hongying; Guan Dandan; Dou Weidong; Zhang Hanjie; Li Haiyang; He Pimo; Bao Shining; Hofmann, Philip
2009-01-01
The interface electronic properties of fluorene-1-carboxylic acid (FC-1) adsorbed on Cu(110) have been studied by ultraviolet photoemission spectroscopy (UPS) and first-principles calculations. Both the molecular orbitals and the Cu valence band are significantly modified upon adsorption. FC-1 is chemically bonded to Cu(110) through charge donation and back donation involving the lowest unoccupied molecular orbital (LUMO) and the highest occupied molecular orbital (HOMO) of the molecule. An observed reduction of the work function can be attributed to the adsorption induced charge redistribution, and the positive interface dipole.
International Nuclear Information System (INIS)
Hagen, R.D.
1975-01-01
A device for detecting the emission of charged particles from a specimen is described. The specimen is placed within an accumulator means which statically accumulates any charged particles emitted from the specimen. The accumulator means is pivotally positioned between a first capacitor plate having a positive electrical charge and a second capacitor plate having a negative electrical charge. The accumulator means is attracted to one capacitor plate and repelled from the other capacitor plate by an amount proportional to the amount and intensity of charged particles emitted by the specimen. (auth)
Adsorption behavior of Co anchored on graphene sheets toward NO, SO2, NH3, CO and HCN molecules
International Nuclear Information System (INIS)
Tang, Yanan; Chen, Weiguang; Li, Chenggang; Pan, Lijun; Dai, Xianqi; Ma, Dongwei
2015-01-01
Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH 3 molecule, the adsorbed NO, SO 2 , CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO 2 . The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device
DEFF Research Database (Denmark)
Kaasbjerg, Kristen; Flensberg, K.
2011-01-01
and molecular symmetries remain unclear. Using a theoretical framework developed for semiconductor-nanostructure-based single-electron transistors (SETs), we demonstrate that the image charge interaction breaks the molecular symmetries in a benzene-based single-molecule transistor operating in the Coulomb...... blockade regime. This results in the appearance of a so-called blocking state, which gives rise to negative-differential resistance (NDR). We show that the appearance of NDR and its magnitude in the symmetry-broken benzene SET depends in a complicated way on the interplay between the many-body matrix...
Abdalla, S; Obaid, A; Al-Marzouki, F M
2017-12-01
Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA molecule (σ DNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a
DEFF Research Database (Denmark)
Quarsten, H; Paulsen, G; Johansen, B H
1998-01-01
Susceptibility and resistance to type 1 diabetes are associated with MHC class II alleles that carry non-Asp and Asp at residue 57 of their beta chain respectively. The effect of Asp or non-Aspbeta57 may relate to a differential ability of distinct class II molecules to bind specific immuno......-pathogenic peptides. Recent studies in man and mouse have revealed that some type 1 diabetes-predisposing non-Aspbeta57 class II molecules (i.e. DQ8, DR4Dw15 and I-Ag7) preferentially bind peptides with a negatively charged anchor residue at P9. It has been suggested that this is a common feature of type 1 diabetes......-predisposing class II molecules. The molecular explanation for such a phenomenon could be that class II beta chains with Aspbeta57 form a salt bridge between Aspbeta57 and a conserved Arg of the a chain, whereas in non-Aspbeta57 molecules the Arg is unopposed and free to interact with negatively charged P9 peptide...
Interpreting anomalies observed in oxide semiconductor TFTs under negative and positive bias stress
Directory of Open Access Journals (Sweden)
Jong Woo Jin
2016-08-01
Full Text Available Oxide semiconductor thin-film transistors can show anomalous behavior under bias stress. Two types of anomalies are discussed in this paper. The first is the shift in threshold voltage (VTH in a direction opposite to the applied bias stress, and highly dependent on gate dielectric material. We attribute this to charge trapping/detrapping and charge migration within the gate dielectric. We emphasize the fundamental difference between trapping/detrapping events occurring at the semiconductor/dielectric interface and those occurring at gate/dielectric interface, and show that charge migration is essential to explain the first anomaly. We model charge migration in terms of the non-instantaneous polarization density. The second type of anomaly is negative VTH shift under high positive bias stress, with logarithmic evolution in time. This can be argued as electron-donating reactions involving H2O molecules or derived species, with a reaction rate exponentially accelerated by positive gate bias and exponentially decreased by the number of reactions already occurred.
Interpreting anomalies observed in oxide semiconductor TFTs under negative and positive bias stress
Energy Technology Data Exchange (ETDEWEB)
Jin, Jong Woo [LPICM, CNRS, Ecole Polytechnique, Université Paris Saclay, 91128, Palaiseau (France); Nathan, Arokia, E-mail: an299@cam.ac.uk [Engineering Department, University of Cambridge, Cambridge, CB3 0FA (United Kingdom); Barquinha, Pedro; Pereira, Luís; Fortunato, Elvira; Martins, Rodrigo [i3N/CENIMAT, Department of Materials Science, Faculty of Science and Technology, Universidade NOVA de Lisboa and CEMOP/UNINOVA, Campus de Caparica, 2829-516 Caparica (Portugal); Cobb, Brian [Holst Centre/TNO, Eindhoven, 5656 AE (Netherlands)
2016-08-15
Oxide semiconductor thin-film transistors can show anomalous behavior under bias stress. Two types of anomalies are discussed in this paper. The first is the shift in threshold voltage (V{sub TH}) in a direction opposite to the applied bias stress, and highly dependent on gate dielectric material. We attribute this to charge trapping/detrapping and charge migration within the gate dielectric. We emphasize the fundamental difference between trapping/detrapping events occurring at the semiconductor/dielectric interface and those occurring at gate/dielectric interface, and show that charge migration is essential to explain the first anomaly. We model charge migration in terms of the non-instantaneous polarization density. The second type of anomaly is negative V{sub TH} shift under high positive bias stress, with logarithmic evolution in time. This can be argued as electron-donating reactions involving H{sub 2}O molecules or derived species, with a reaction rate exponentially accelerated by positive gate bias and exponentially decreased by the number of reactions already occurred.
International Nuclear Information System (INIS)
Payami, M.
2004-01-01
In this work, we have shown the important role of the finite-size correction to the work function in predicting the correct position of the centroid of excess charge in positively charged simple metal clusters with different r s values (2≤ r s ≥ 7). For this purpose, firstly we have calculated the self-consistent Kohn-Sham energies of neutral and singly-ionized clusters with sizes 2≤ N ≥100 in the framework of local spin-density approximation and stabilized jellium model as well as simple jellium model with rigid jellium. Secondly, we have fitted our results to the asymptotic ionization formulas both with and without the size correction to the work function. The results of fittings show that the formula containing the size correction predict a correct position of the centroid inside the jellium while the other predicts a false position, outside the jellium sphere
International Nuclear Information System (INIS)
Damskin, B.B.; Baturina, O.A.; Vasil'ev, S.Yu.; Emets, V.V.; Kazarinov, V.E.
1999-01-01
Curves of differential capacitance in the interfaces Hg/H 2 O, Ga/H 2 O, (In-Ga)/H 2 O and (Tl-Ga)H 2 O in 0.05 M Na 2 SO 4 solutions with different additions of n-butanol have been obtained by the bridge method at a frequency of 420 Hz and temperature of 32 deg C. The method of regression analysis of the curves permitted ascertaining the adsorption parameters of n-butanol for the range of charges q, where there is no chemisorption of H 2 O dipoles. The data obtained suggested that the difference in the adsorption behaviour of organic molecules on the metals studied in the range of higher negative charges is largely determined by different electron electrochemical work functions, the definition being given by S. Trasatti [ru
Attosecond electron dynamics in molecules and liquids
WöRner, Hans Jakob
The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss some of our recent experiments that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. Using high-harmonic spectroscopy, we resolve the migration of an electron hole across the molecule with a resolution of 100 as and simultaneously demonstrate extensive control over charge migration. In the second class of experiments, we use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from molecules in the gas phase and from a liquid-water microjet, resolving electron transport through liquid water on the attosecond time scale.
ARCHITECTURE OF A CHARGE-TRANSFER STATE REGULATING LIGHT HARVESTING IN A PLANT ANTENNA PROTEIN
Energy Technology Data Exchange (ETDEWEB)
Fleming, Graham; Ahn, Tae Kyu; Avenson, Thomas J.; Ballottari, Matteo; Cheng, Yuan-Chung; Niyogi, Krishna K.; Bassi, Roberto; Fleming, Graham R.
2008-04-02
Energy-dependent quenching of excess absorbed light energy (qE) is a vital mechanism for regulating photosynthetic light harvesting in higher plants. All of the physiological characteristics of qE have been positively correlated with charge-transfer between coupled chlorophyll and zeaxanthin molecules in the light-harvesting antenna of photosystem II (PSII). In this work, we present evidence for charge-transfer quenching in all three of the individual minor antenna complexes of PSII (CP29, CP26, and CP24), and we conclude that charge-transfer quenching in CP29 involves a de-localized state of an excitonically coupled chlorophyll dimer. We propose that reversible conformational changes in CP29 can `tune? the electronic coupling between the chlorophylls in this dimer, thereby modulating the energy of the chlorophylls-zeaxanthin charge-transfer state and switching on and off the charge-transfer quenching during qE.
Tunable optical absorption in silicene molecules
Mokkath, Junais Habeeb; Schwingenschlö gl, Udo
2016-01-01
Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.
Tunable optical absorption in silicene molecules
Mokkath, Junais Habeeb
2016-07-13
Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.
Leventis, Nicholas; Yang, Jinua; Fabrizio,Even F.; Rawashdeh, Abdel-Monem M.; Oh, Woon Su; Sotiriou-Leventis, Chariklia
2004-01-01
Dendrimers are self-repeating globular branched star molecules, whose fractal structure continues to fascinate, challenge, and inspire. Functional dendrimers may incorporate redox centers, and potential applications include antennae molecules for light harvesting, sensors, mediators, and artificial biomolecules. We report the synthesis and redox properties of four star systems incorporating the 4-benzoyl-N-alkylpyridinium cation; the redox potential varies along the branches but remains constant at fixed radii. Bulk electrolysis shows that at a semi-infinite time scale all redox centers are electrochemically accessible. However, voltammetric analysis (cyclic voltammetry and differential pulse voltammetry) shows that on1y two of the three redox-active centers in the perimeter are electrochemically accessible during potential sweeps as slow as 20 mV/s and as fast as 10 V/s. On the contrary, both redox centers along branches are accessible electrochemically within the same time frame. These results are explained in terms of slow through-space charge transfer and the globular 3-D folding of the molecules and are discussed in terms of their implications on the design of efficient redox functional dendrimers.
Radioluminescence of aromatic molecule solutions in atactic and isotactic polystyrene
International Nuclear Information System (INIS)
Lisovskaya, I.A.; Alfimov, M.V.; Milinchuk, V.K.; Skvortsov, V.G.
1975-01-01
The generation of excited states of naphthalene-d 8 and carbazole molecules in polystyrene (PS) under X-ray illumination was investigated using luminescence method. A comparison of the concentration dependences of radioluminescence of the aromatic additives to solid PS and to toluene as well as the pattern of concentration versus photoluminescence of naphthalene-d 8 in PS demonstrates that unlike toluene there is no singlet-triplet conversion in PS owing to the formation of excimers. It is shown that the excited ststes of the aromatic additives in PS are populated under radiolysis via an energy transfer from singlet to triplet molecules of the matrix. Under the radiolysis the excited states of PS molecules may generate upon charge recombination. A comparison of radio luminescence spectra of the corresponding aromatic additives in two isomeric PS structures (atacting and isotactic) shows different processes with charge participation. The difference detected in the radioluminescence spectra of aromatic additives in the atactic and isotactic PS explained by the greater number of defects in atactic PS competing with the polymer molecule ion for charge capture
Electrostatic interactions between immunoglobulin (IgG) molecules and a charged sorbent
Bremer, M.G.E.G.; Duval, J.; Norde, Willem; Lyklema, J.
2004-01-01
The influence of electrostatic interactions on the adsorption of IgG is examined both theoretically and experimentally. The long-range interaction between IgG and the charged sorbent surface is treated in terms of the DLVO theory taking into account the possibility of charge- and potential
International Nuclear Information System (INIS)
Karczmarczyk, Aleksandra; Celebanska, Anna; Nogala, Wojciech; Sashuk, Volodymyr; Chernyaeva, Olga; Opallo, Marcin
2014-01-01
Graphical abstract: - Highlights: • Gold nanoparticulate film electrodes were prepared by layer-by-layer method from oppositely charged nanoparticles. • Positively charged nanoparticles play dominant role in glucose oxidation in alkaline solution. • Gold and gold-carbon nanoparticulate film electrodes exhibit similar glucose oxidation current and onset potential. - Abstract: Electrocatalytic oxidation of glucose was studied at nanoparticulate gold and gold-carbon film electrodes. These electrodes were prepared by a layer-by-layer method without application of any linker molecules. Gold nanoparticles were stabilized by undecane thiols functionalized by trimethyl ammonium or carboxylate groups, whereas the carbon nanoparticles were covered by phenylsulfonate functionalities. The gold nanoparticulate electrodes were characterized by UV-vis and XPS spectroscopy, atomic force microscopy and voltammetry, before and after heat-treatment. Heat-treatment facilitates the aggregation of the nanoparticles and affects the structure of the film. The comparison of the results obtained with film electrodes prepared from gold nanoparticles with the same charge and with gold-carbon nanoparticulate electrodes, proved that positively charged nanoparticles are responsible for the high electrocatalytic activity, whereas negatively charged ones act rather as a linker of the film
International Nuclear Information System (INIS)
Peltola, T.; Eremin, V.; Verbitskaya, E.; Härkönen, J.
2017-01-01
Segmented silicon detectors (micropixel and microstrip) are the main type of detectors used in the inner trackers of Large Hadron Collider (LHC) experiments at CERN. Due to the high luminosity and eventual high fluence of energetic particles, detectors with fast response to fit the short shaping time of 20–25 ns and sufficient radiation hardness are required. Charge collection measurements carried out at the Ioffe Institute have shown a reversal of the pulse polarity in the detector response to short-range charge injection. Since the measured negative signal is about 30–60% of the peak positive signal, the effect strongly reduces the CCE even in non-irradiated detectors. For further investigation of the phenomenon the measurements have been reproduced by TCAD simulations. As for the measurements, the simulation study was applied for the p-on-n strip detectors similar in geometry to those developed for the ATLAS experiment and for the Ioffe Institute designed p-on-n strip detectors with each strip having a window in the metallization covering the p + implant, allowing the generation of electron-hole pairs under the strip implant. Red laser scans across the strips and the interstrip gap with varying laser diameters and Si-SiO 2 interface charge densities ( Q f ) were carried out. The results verify the experimentally observed negative response along the scan in the interstrip gap. When the laser spot is positioned on the strip p + implant the negative response vanishes and the collected charge at the active strip increases respectively. The simulation results offer a further insight and understanding of the influence of the oxide charge density in the signal formation. The main result of the study is that a threshold value of Q f , that enables negligible losses of collected charges, is defined. The observed effects and details of the detector response for different charge injection positions are discussed in the context of Ramo's theorem.
Peltola, T.; Eremin, V.; Verbitskaya, E.; Härkönen, J.
2017-09-01
Segmented silicon detectors (micropixel and microstrip) are the main type of detectors used in the inner trackers of Large Hadron Collider (LHC) experiments at CERN. Due to the high luminosity and eventual high fluence of energetic particles, detectors with fast response to fit the short shaping time of 20-25 ns and sufficient radiation hardness are required. Charge collection measurements carried out at the Ioffe Institute have shown a reversal of the pulse polarity in the detector response to short-range charge injection. Since the measured negative signal is about 30-60% of the peak positive signal, the effect strongly reduces the CCE even in non-irradiated detectors. For further investigation of the phenomenon the measurements have been reproduced by TCAD simulations. As for the measurements, the simulation study was applied for the p-on-n strip detectors similar in geometry to those developed for the ATLAS experiment and for the Ioffe Institute designed p-on-n strip detectors with each strip having a window in the metallization covering the p+ implant, allowing the generation of electron-hole pairs under the strip implant. Red laser scans across the strips and the interstrip gap with varying laser diameters and Si-SiO2 interface charge densities (Qf) were carried out. The results verify the experimentally observed negative response along the scan in the interstrip gap. When the laser spot is positioned on the strip p+ implant the negative response vanishes and the collected charge at the active strip increases respectively. The simulation results offer a further insight and understanding of the influence of the oxide charge density in the signal formation. The main result of the study is that a threshold value of Qf, that enables negligible losses of collected charges, is defined. The observed effects and details of the detector response for different charge injection positions are discussed in the context of Ramo's theorem.
Directory of Open Access Journals (Sweden)
M. Payami
2003-12-01
Full Text Available In this work, we have shown the important role of the finite-size correction to the work function in predicting the correct position of the centroid of excess charge in positively charged simple metal clusters with different values . For this purpose, firstly we have calculated the self-consistent Kohn-Sham energies of neutral and singly-ionized clusters with sizes in the framework of local spin-density approximation and stabilized jellium model (SJM as well as simple jellium model (JM with rigid jellium. Secondly, we have fitted our results to the asymptotic ionization formulas both with and without the size correction to the work function. The results of fittings show that the formula containing the size correction predict a correct position of the centroid inside the jellium while the other predicts a false position, outside the jellium sphere.
Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep
2010-01-01
We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than
Challenging chemical concepts through charge density of molecules and crystals
International Nuclear Information System (INIS)
Gatti, Carlo
2013-01-01
Narrating my scientific career, I show in this paper how, starting as a computational and theoretical chemist, I got naturally involved with x-ray crystallographers because of the common interest in charge density and in the study of chemical bonds based on such an observable. The tools I devised and the conceptual developments I made to facilitate a profitable encounter between x-ray charge density and computational chemistry researchers are illustrated, with a special focus on the proposal and applications of the Source Function concept. (comment)
Chung, In-Young; Jang, Hyeri; Lee, Jieun; Moon, Hyunggeun; Seo, Sung Min; Kim, Dae Hwan
2012-02-17
We introduce a simulation method for the biosensor environment which treats the semiconductor and the electrolyte region together, using the well-established semiconductor 3D TCAD simulator tool. Using this simulation method, we conduct electrostatic simulations of SiNW biosensors with a more realistic target charge model where the target is described as a charged cube, randomly located across the nanowire surface, and analyze the Coulomb effect on the SiNW FET according to the position and distribution of the target charges. The simulation results show the considerable variation in the SiNW current according to the bound target positions, and also the dependence of conductance modulation on the polarity of target charges. This simulation method and the results can be utilized for analysis of the properties and behavior of the biosensor device, such as the sensing limit or the sensing resolution.
International Nuclear Information System (INIS)
Chung, In-Young; Moon, Hyunggeun; Jang, Hyeri; Lee, Jieun; Kim, Dae Hwan; Seo, Sung Min
2012-01-01
We introduce a simulation method for the biosensor environment which treats the semiconductor and the electrolyte region together, using the well-established semiconductor 3D TCAD simulator tool. Using this simulation method, we conduct electrostatic simulations of SiNW biosensors with a more realistic target charge model where the target is described as a charged cube, randomly located across the nanowire surface, and analyze the Coulomb effect on the SiNW FET according to the position and distribution of the target charges. The simulation results show the considerable variation in the SiNW current according to the bound target positions, and also the dependence of conductance modulation on the polarity of target charges. This simulation method and the results can be utilized for analysis of the properties and behavior of the biosensor device, such as the sensing limit or the sensing resolution. (paper)
International Nuclear Information System (INIS)
Bag, Saientan; Maingi, Vishal; Maiti, Prabal K.; Yelk, Joe; Glaser, Matthew A.; Clark, Noel A.; Walba, David M.
2015-01-01
Using atomistic molecular dynamics simulation, we study the discotic columnar liquid crystalline (LC) phases formed by a new organic compound having hexa-peri-Hexabenzocoronene (HBC) core with six pendant oligothiophene units recently synthesized by Nan Hu et al. [Adv. Mater. 26, 2066 (2014)]. This HBC core based LC phase was shown to have electric field responsive behavior and has important applications in organic electronics. Our simulation results confirm the hexagonal arrangement of columnar LC phase with a lattice spacing consistent with that obtained from small angle X-ray diffraction data. We have also calculated various positional and orientational correlation functions to characterize the ordering of the molecules in the columnar arrangement. The molecules in a column are arranged with an average twist of 25° having an average inter-molecular separation of ∼5 Å. Interestingly, we find an overall tilt angle of 43° between the columnar axis and HBC core. We also simulate the charge transport through this columnar phase and report the numerical value of charge carrier mobility for this liquid crystal phase. The charge carrier mobility is strongly influenced by the twist angle and average spacing of the molecules in the column
Energy Technology Data Exchange (ETDEWEB)
Tang, Yanan, E-mail: yntang2010@hotmail.com [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Chen, Weiguang; Li, Chenggang; Pan, Lijun [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Dai, Xianqi, E-mail: xqdai@henannu.edu.cn [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Ma, Dongwei [College of Physics and Electrical Engineering, Anyang Normal University, Anyang, Henan 455000 (China)
2015-07-01
Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH{sub 3} molecule, the adsorbed NO, SO{sub 2}, CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO{sub 2}. The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device.
International Nuclear Information System (INIS)
Abbas, I.
2008-05-01
We have developed a relatively simple model to calculate total cross-sections of various ionizing processes involving ion-atom or ion-molecule collisions. This model is based on the Zarour and Saalmann model and has benefited from 2 other models: the classical over-barrier (COB) model and the classical trajectory Monte-Carlo (CTMC) model. The COB model is used to describe the initial conditions of the target's electrons and their process us of creation while the CTMC model is used to build the statistical aspects necessary to calculate the cross sections of the ionizing processes. 3 major improvements have been brought to the Zarour and Saalmann model. First, the particle-particle interactions have been described by a Coulombian potential which is more realistic. Secondly, the initial conditions in the target are better represented by taking into account in an aleatory manner the position and speed distributions of the electrons. Thirdly, the use of energy criteria instead of purely geometrical ones to describe the final situation of the electrons has led to a better determination of the possible ionizing events. We have validated our model by applying it first, in collisional systems involving multi-charged projectiles like H + , He 2+ , Li 3+ , C 6+ , O 8+ and Ne 10+ and simple targets like H, He and H 2 , for which a lot of experimental data is available. Then, we have studied collisions involving the water molecule for which experimental and experimental data exist. Satisfactorily results for H 2 O target has led us to study other biological targets like adenine or cytosine. We have shown that our results are valid for impact energies over 100 keV/uma and most satisfactorily results concern simple ionizing processes like simple capture and simple ionization. For more complex processes such as transfer-ionization, double capture or double ionization, our results are valid for helium and hydrogen targets. In the case of water, the cross-sections of double
Efficient charge generation by relaxed charge-transfer states at organic interfaces
Vandewal, Koen
2013-11-17
Interfaces between organic electron-donating (D) and electron-accepting (A) materials have the ability to generate charge carriers on illumination. Efficient organic solar cells require a high yield for this process, combined with a minimum of energy losses. Here, we investigate the role of the lowest energy emissive interfacial charge-transfer state (CT1) in the charge generation process. We measure the quantum yield and the electric field dependence of charge generation on excitation of the charge-transfer (CT) state manifold via weakly allowed, low-energy optical transitions. For a wide range of photovoltaic devices based on polymer:fullerene, small-molecule:C60 and polymer:polymer blends, our study reveals that the internal quantum efficiency (IQE) is essentially independent of whether or not D, A or CT states with an energy higher than that of CT1 are excited. The best materials systems show an IQE higher than 90% without the need for excess electronic or vibrational energy. © 2014 Macmillan Publishers Limited.
Efficient charge generation by relaxed charge-transfer states at organic interfaces
Vandewal, Koen; Albrecht, Steve N.; Hoke, Eric T.; Graham, Kenneth; Widmer, Johannes; Douglas, Jessica D.; Schubert, Marcel; Mateker, William R.; Bloking, Jason T.; Burkhard, George F.; Sellinger, Alan; Frechet, Jean; Amassian, Aram; Riede, Moritz Kilian; McGehee, Michael D.; Neher, Dieter; Salleo, Alberto
2013-01-01
Interfaces between organic electron-donating (D) and electron-accepting (A) materials have the ability to generate charge carriers on illumination. Efficient organic solar cells require a high yield for this process, combined with a minimum of energy losses. Here, we investigate the role of the lowest energy emissive interfacial charge-transfer state (CT1) in the charge generation process. We measure the quantum yield and the electric field dependence of charge generation on excitation of the charge-transfer (CT) state manifold via weakly allowed, low-energy optical transitions. For a wide range of photovoltaic devices based on polymer:fullerene, small-molecule:C60 and polymer:polymer blends, our study reveals that the internal quantum efficiency (IQE) is essentially independent of whether or not D, A or CT states with an energy higher than that of CT1 are excited. The best materials systems show an IQE higher than 90% without the need for excess electronic or vibrational energy. © 2014 Macmillan Publishers Limited.
Interactions between nitrogen molecules and barium atoms on Ru (0001) surface
International Nuclear Information System (INIS)
Zhao Xinxin; Mi Yiming; Xu Hongxia; Wang Lili; Ren Li; Tao Xiangming; Tan Mingqiu
2011-01-01
We had performed first principles calculations on interactions between nitrogen molecules and barium atoms on Ru (0001) surface using density function theory methods. It was shown that effects of barium atoms weakened the bond strength of nitrogen molecules. The bond length of nitrogen molecule increases from 0.113 nm on Ru (001)-N 2 to 0.120 nm on Ru (001)-N 2 /Ba surface. While stretch vibrational frequency of nitrogen molecule decreased from 2222 cm -1 and charge transfer toward nitrogen molecule increased from 0.3 e to 1.1 e. Charge was mainly translated from 6 s orbitals of barium atoms to 4 d orbitals of substrate, which enhanced the hybridization between 4 d and 2 π orbitals and increased the dipole moment of 5 σ and d π orbitals of nitrogen molecule. The molecular dipole moment of nitrogen molecule was increased by -0.136 e Anstrom. It was suggested that barium had some characters to be an electronic promoter on the process of activating nitrogen molecules on Ru (0001) surface. (authors)
Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S
2017-09-01
VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.
Structural characterization of some substituted azolidine molecules
International Nuclear Information System (INIS)
Andreocci, M.V.; Bossa, M.; Furlani, C.; Mattogno, G.; Zanoni, R.; Consiglio Nazionale delle Ricerche, Rome; Devillanova, F.A.; Verani, G.
1981-01-01
The electronic structure of a series of organic molecules of general formula RN - (CH 2 ) 2 - X - C = Y, which are also of interest in inorganic chemistry because of their properties as ligands towards metals, have been investigated by X-ray photoelectron spectroscopy. The results suggest a general picture of atomic charge distribution within the investigated molecules, and allow an assessment of the effect of the different substituent groups X, Y, R (X = NR', O, S, CH 2 ; Y = O, S, Se; R, R' = H, alkyl) on the electronic structure of the ligands. Satisfactory correlation is found between experimental binding energies and computed CNDO/2 atomic charges, after correction for intramolecular Madelung potentials. (orig.)
Thermally induced charge current through long molecules
Zimbovskaya, Natalya A.; Nitzan, Abraham
2018-01-01
In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.
Understanding charge transport in molecular electronics.
Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R
2003-12-01
For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.
Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.
Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing
2017-04-01
The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.
Technetium-aspirin molecule complexes
International Nuclear Information System (INIS)
El-Shahawy, A.S.; Mahfouz, R.M.; Aly, A.A.M.; El-Zohry, M.
1993-01-01
Technetium-aspirin and technetium-aspirin-like molecule complexes were prepared. The structure of N-acetylanthranilic acid (NAA) has been decided through CNDO calculations. The ionization potential and electron affinity of the NAA molecule as well as the charge densities were calculated. The electronic absorption spectra of Tc(V)-Asp and Tc(V)-ATS complexes have two characteristic absorption bands at 450 and 600 nm, but the Tc(V)-NAA spectrum has one characteristic band at 450 nm. As a comparative study, Mo-ATS complex was prepared and its electronic absorption spectrum is comparable with the Tc-ATS complex spectrum. (author)
Charge Transport Processes in Molecular Junctions
Smith, Christopher Eugene
Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.
Beichel, Witali; Trapp, Nils; Hauf, Christoph; Kohler, Oliver; Eickerling, Georg; Scherer, Wolfgang; Krossing, Ingo
2014-03-17
The charge scaling effect in ionic liquids was explored on the basis of experimental and theoretical chargedensity analyses of [C1MIM][C1SO4] employing the quantum theory of atoms in molecules (QTAIM) approach. Integrated QTAIM charges of the experimental (calculated) charge density of the cation and anion resulted in non-integer values of ±0.90 (±0.87) e. Efficient charge transfer along the bond paths of the hydrogen bonds between the imidazolium ring and the anion was considered as the origin of these reduced charges. In addition, a detailed QTAIM analysis of the bonding situation in the [C1SO4]- anion revealed the presence of negative πO→σ*S-O hyperconjugation.
Interplay between efficiency and device architecture for small molecule organic solar cells.
Williams, Graeme; Sutty, Sibi; Aziz, Hany
2014-06-21
Small molecule organic solar cells (OSCs) have experienced a resurgence of interest over their polymer solar cell counterparts, owing to their improved batch-to-batch (thus, cell-to-cell) reliability. In this systematic study on OSC device architecture, we investigate five different small molecule OSC structures, including the simple planar heterojunction (PHJ) and bulk heterojunction (BHJ), as well as several planar-mixed structures. The different OSC structures are studied over a wide range of donor:acceptor mixing concentrations to gain a comprehensive understanding of their charge transport behavior. Transient photocurrent decay measurements provide crucial information regarding the interplay between charge sweep-out and charge recombination, and ultimately hint toward space charge effects in planar-mixed structures. Results show that the BHJ/acceptor architecture, comprising a BHJ layer with high C60 acceptor content, generates OSCs with the highest performance by balancing charge generation with charge collection. The performance of other device architectures is largely limited by hole transport, with associated hole accumulation and space charge effects.
Supermolecular structure and charge carriers mobilities of perylene diimides
Energy Technology Data Exchange (ETDEWEB)
Marcon, Valentina; Pisula, Wojtek; Andrienko, Denis [Max-Planck-Institut fuer Polymerforschung, Mainz (Germany); Kirkpatrick, James [Max-Planck-Institut fuer Polymerforschung, Mainz (Germany); Department of Physics, Imperial College London, London (United Kingdom)
2008-07-01
Perylene diimides form columnar phases, where the molecules stack on top of each other and the columns arrange in a regular lattice. The self-organization into well-ordered columns results in the one-dimensional charge transport along the stack of the aromatic cores of the molecules. Most of the discotic molecules which organize in columns are p-type semiconductors, while the class of rylene diimide molecules, to which perylene belongs, forms n-type organic semiconductors. Using atomistic molecular dynamics (MD) simulations we study the columnar phases of perylene diimides and establish correlations between the molecular structure, packing, and dynamical properties of these materials. By using a scheme which combines electronic structure calculations, MD and kinetic Monte Carlo simulations, a correlation is then established between the molecular structure and charge mobility of perylenes columnar mesophases.
Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.
2018-05-01
An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.
Mahale, Rajashree Y.; Dharmapurikar, Satej S.; Chini, Mrinmoy Kumar; Venugopalan, Vijay
2017-06-01
Diketopyrrolopyrrole based donor-acceptor-donor conjugated small molecules using ethylene dioxythiophene as a donor was synthesized. Electron deficient diketopyrrolopyrrole unit was substituted with thermocleavable (tert-butyl acetate) side chains. The thermal treatment of the molecules at 160 °C eliminated the tert-butyl ester group results in the formation of corresponding acid. Optical and theoretical studies revealed that the molecules adopted a change in molecular arrangement after thermolysis. The conjugated small molecules possessed p-channel charge transport characteristics in organic field effect transistors. The charge carrier mobility was increased after thermolysis of tert-butyl ester group to 5.07 × 10-5 cm2/V s.
The Minimum Binding Energy and Size of Doubly Muonic D3 Molecule
Eskandari, M. R.; Faghihi, F.; Mahdavi, M.
The minimum energy and size of doubly muonic D3 molecule, which two of the electrons are replaced by the much heavier muons, are calculated by the well-known variational method. The calculations show that the system possesses two minimum positions, one at typically muonic distance and the second at the atomic distance. It is shown that at the muonic distance, the effective charge, zeff is 2.9. We assumed a symmetric planar vibrational model between two minima and an oscillation potential energy is approximated in this region.
Energy Technology Data Exchange (ETDEWEB)
Yoshida, Kenji; Corper, Adam L.; Herro, Rana; Jabri, Bana; Wilson, Ian A.; Teyton, Luc (Scripps); (UC)
2011-11-16
Genetic susceptibility to autoimmunity is frequently associated with specific MHC alleles. Diabetogenic MHC class II molecules, such as human HLA-DQ8 and mouse I-A{sub g7}, typically have a small, uncharged amino acid residue at position 57 of their {beta} chain ({beta}57); this results in the absence of a salt bridge between {beta}57 and Arg{alpha}76, which is adjacent to the P9 pocket of the peptide-binding groove. However, the influence of Arg{alpha}76 on the selection of the TCR repertoire remains unknown, particularly when the MHC molecule binds a peptide with a neutral amino acid residue at position P9. Here, we have shown that diabetogenic MHC class II molecules bound to a peptide with a neutral P9 residue primarily selected and expanded cells expressing TCRs bearing a negatively charged residue in the first segment of their complementarity determining region 3{beta}. The crystal structure of one such TCR in complex with I-A{sub g7} bound to a peptide containing a neutral P9 residue revealed that a network of favorable long-range (greater than 4 {angstrom}) electrostatic interactions existed among Arg{alpha}76, the neutral P9 residue, and TCR, which supported the substantially increased TCR/peptide-MHC affinity. This network could be modulated or switched to a lower affinity interaction by the introduction of a negative charge at position P9 of the peptide. Our results support the existence of a switch at residue {beta}57 of the I-Ag7 and HLA-DQ8 class II molecules and potentially link normal thymic TCR selection with abnormal peripheral behavior.
Two-Dimensional Charge Transport in Disordered Organic Semiconductors
Brondijk, J. J.; Roelofs, W. S. C.; Mathijssen, S. G. J.; Shehu, A.; Cramer, T.; Biscarini, F.; Blom, P. W. M.; de Leeuw, D. M.
2012-01-01
We analyze the effect of carrier confinement on the charge-transport properties of organic field-effect transistors. Confinement is achieved experimentally by the use of semiconductors of which the active layer is only one molecule thick. The two-dimensional confinement of charge carriers provides
International Nuclear Information System (INIS)
Gerber, M.S.; Muller, D.W.
1976-01-01
The analysis of an orthogonal strip, two-dimensional position sensitive high purity germanium gamma ray detector is discussed. Position sensitivity is obtained by connecting each electrode strip on the detector to a resistor network. Charge, entering the network, divides in relation to the resistance between its entry point and the virtual earth points of the charge sensitive preamplifiers located at the end of each resistor network. The difference of the voltage pulses at the output of each preamplifier is proportional to the position at which the charge entered the resistor network and the sum of the pulse is proportional to the energy of the detected gamma ray. The analysis and spatial noise resolution is presented for this type of position sensitive detector. The results of the analysis show that the position resolution is proportional to the square root of the filter amplifier's output pulse time constant and that for energy measurement the resolution is maximized at the filter amplifier's noise corner time constant. The design of the electronic noise filtering system for the prototype gamma ray camera was based on the mathematical energy and spatial resolution equations. For the spatial channel a Gaussian trapezoidal filtering system was developed. Gaussian filtering was used for the energy channel. The detector noise model was verified by taking rms noise measurements of the filtered energy and spatial pulses from resistive readout charge dividing detectors. These measurements were within 10% of theory. (Auth.)
Single-molecule dynamics in nanofabricated traps
Cohen, Adam
2009-03-01
The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.
International Nuclear Information System (INIS)
Jones, C.S.
1989-01-01
Very little knowledge has been acquired in the past on the mechanistic pathway by which molecules respond in the N 2 mode of the thermionic ionization detector. An attempt is made here to elucidate the response mechanism of the detector. The basic response mechanisms are known for the electron capture detector, and an attempt is made to identify the certain mechanism by which selected molecules respond. The resonance electron capture rate constant has been believed to be temperature independent, and investigations of the temperature dependence of electron capture responses are presented. Mechanisms for the N 2 mode of the thermionic ionization detector have been proposed by examining the detector response to positive electron affinity molecules and by measurement of the ions produced by the detector. Electron capture mechanisms for selected molecules have been proposed by examining their temperature dependent responses in the electron capture detector and negative ion mass spectra of the samples. In studies of the resonance electron capture rate constant, the relative responses of selected positive electron affinity molecules and their temperature dependent responses were investigated. Positive electron affinity did not guarantee large responses in the N 2 mode thermionic ionization detector. High mass ions were measured following ionization of samples in the detector. Responses in the electron capture detector varied with temperature and electron affinity
Accuracy of free energies of hydration using CM1 and CM3 atomic charges.
Udier-Blagović, Marina; Morales De Tirado, Patricia; Pearlman, Shoshannah A; Jorgensen, William L
2004-08-01
Absolute free energies of hydration (DeltaGhyd) have been computed for 25 diverse organic molecules using partial atomic charges derived from AM1 and PM3 wave functions via the CM1 and CM3 procedures of Cramer, Truhlar, and coworkers. Comparisons are made with results using charges fit to the electrostatic potential surface (EPS) from ab initio 6-31G* wave functions and from the OPLS-AA force field. OPLS Lennard-Jones parameters for the organic molecules were used together with the TIP4P water model in Monte Carlo simulations with free energy perturbation theory. Absolute free energies of hydration were computed for OPLS united-atom and all-atom methane by annihilating the solutes in water and in the gas phase, and absolute DeltaGhyd values for all other molecules were computed via transformation to one of these references. Optimal charge scaling factors were determined by minimizing the unsigned average error between experimental and calculated hydration free energies. The PM3-based charge models do not lead to lower average errors than obtained with the EPS charges for the subset of 13 molecules in the original study. However, improvement is obtained by scaling the CM1A partial charges by 1.14 and the CM3A charges by 1.15, which leads to average errors of 1.0 and 1.1 kcal/mol for the full set of 25 molecules. The scaled CM1A charges also yield the best results for the hydration of amides including the E/Z free-energy difference for N-methylacetamide in water. Copyright 2004 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Ramona C. Polexe
2013-07-01
Full Text Available In this study, we describe the elaboration of multifunctional positively charged polyelectrolyte complex (PEC nanoparticles, designed to be stable at physiological salt concentration and pH, for effective targeted delivery. These nanoparticles were obtained by charge neutralization between chitosan (CS as polycation and hyaluronic acid (HA as polyanion. We showed that the course of the complexation process and the physico-chemical properties of the resulting colloids were impacted by (i internal parameters such as the Degree of Acetylation (DA, i.e., the molar ration of acetyl glucosamine residues and molar mass of CS, the HA molar mass and (ii external parameters like the charge mixing ratio and the polymer concentrations. As a result, nonstoichiometric colloidal PECs were obtained in water or PBS (pH 7.4 and remained stable over one month. The polymer interactions were characterized by thermal analysis (DSC and TGA and the morphology was studied by scanning electron microscopy. A model antibody, anti-ovalbumine (OVA immunoglobulin A (IgA was sorbed on the particle surface in water and PBS quantitatively in 4 h. The CS-HA/IgA nanoparticles average size was between 425–665 nm with a positive zeta potential. These results pointed out that CS-HA can be effective carriers for use in targeted drug delivery.
Solvation of excess electrons trapped in charge pockets on molecular surfaces
Jalbout, Abraham F.
This work considers the ability of hydrogen fluoride (HF) to solvate excess electrons located on cyclic hydrocarbon surfaces. The principle applied involves the formation of systems in which excess electrons can be stabilized not only on concentrated molecular surface charge pockets but also by HF. Recent studies have shown that OH groups can form stable hydrogen-bonded networks on one side of a hydrocarbon surface (i.e. cyclohexane sheets), at the same time, the hydrogen atoms on the opposite side of this surface form a pocket of positive charge can attract the excess electron. This density can be further stabilized by the addition of an HF molecule that can form an 'anion with an internally solvated electron' (AISE) state. These systems are shown to be stable with respect to vertical electron detachment (VDE).
Formation and fragmentation of quadruply charged molecular ions by intense femtosecond laser pulses.
Yatsuhashi, Tomoyuki; Nakashima, Nobuaki
2010-07-22
We investigated the formation and fragmentation of multiply charged molecular ions of several aromatic molecules by intense nonresonant femtosecond laser pulses of 1.4 mum with a 130 fs pulse duration (up to 2 x 10(14) W cm(-2)). Quadruply charged states were produced for 2,3-benzofluorene and triphenylene molecular ion in large abundance, whereas naphthalene and 1,1'-binaphthyl resulted only in up to triply charged molecular ions. The laser wavelength was nonresonant with regard to the electronic transitions of the neutral molecules, and the degree of fragmentation was strongly correlated with the absorption of the singly charged cation radical. Little fragmentation was observed for naphthalene (off-resonant with cation), whereas heavy fragmentation was observed in the case of 1,1'-binaphthyl (resonant with cation). The degree of H(2) (2H) and 2H(2) (4H) elimination from molecular ions increased as the charge states increased in all the molecules examined. A striking difference was found between triply and quadruply charged 2,3-benzofluorene: significant suppression of molecular ions with loss of odd number of hydrogen was observed in the quadruply charged ions. The Coulomb explosion of protons in the quadruply charged state and succeeding fragmentation resulted in the formation of triply charged molecular ions with an odd number of hydrogens. The hydrogen elimination mechanism in the highly charged state is discussed.
The charge spectrum of positive ions in a hydrogen aurora
Lynch, J.; Pulliam, D.; Leach, R.; Scherb, F.
1976-01-01
An auroral ion charge spectrometer was flown into a hydrogen aurora on a Javelin sounding rocket launched from Churchill, Manitoba. The instrument contained an electrostatic analyzer which selected particles with incident energy per unit charge up to 20 keV/charge and an 80-kV power supply which accelerated these ions onto an array of solid state detectors. Ions tentatively identified as H(+), He(+2), and O(+) were detected from 225 to 820 km in altitude. The experiment did not discriminate between H(+) and He(+), or between O(+), N(+), and C(+). Upper limits of highly charged heavy ion abundances have been set at 20% of the He(+2) and 0.15% of the H(+). It is concluded that both terrestrial and solar wind sources play significant roles in auroral ion precipitation.
Fermi level alignment in molecular nanojunctions and its relation to charge transfer
DEFF Research Database (Denmark)
Stadler, Robert; Jacobsen, Karsten Wedel
2006-01-01
The alignment of the Fermi level of a metal electrode within the gap of the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO) of a molecule is a key quantity in molecular electronics, which can vary the electron transparency of a single-molecule junction...... by orders of magnitude. We present a quantitative analysis of the relation between this level alignment (which can be estimated from charging free molecules) and charge transfer for bipyridine and biphenyl dithiolate (BPDT) molecules attached to gold leads based on density functional theory calculations...... end of the gap in the transmission function for bipyridine and at its lower end for BPDT....
Inner-shell excitation and ionic fragmentation of molecules
International Nuclear Information System (INIS)
Hitchcock, A.P.; Tyliszczak, T.; Cavell, R.G.
1997-01-01
Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF 6 and CO 2 . Their work is illustrated using results from the carborane and PF 3 studies
Inner-shell excitation and ionic fragmentation of molecules
Energy Technology Data Exchange (ETDEWEB)
Hitchcock, A.P.; Tyliszczak, T. [McMaster Univ., Hamilton, Ontario (Canada); Cavell, R.G. [Univ. of Alberta, Edmonton (Canada)] [and others
1997-04-01
Inner-shell excitation and associated decay spectroscopies are site specific probes of electronic and geometrical structure and photoionization dynamics. X-ray absorption probes the geometric and electronic structure, while time-of-flight mass spectrometry with multi-coincidence detection provides information on the photofragmentation dynamics of the initially produced inner-shell state. Auger decay of inner-shell excited and ionised states is an efficient source of multiply charged ions. The charge separation and fragmentation of these species, studied by photoelectron-photoion-photoion coincidence (also called charge separation mass spectrometry) gives insights into bonding and electronic structure. In molecules, the dependence of the fragmentation process on the X-ray energy can reveal cases of site and/or state selective fragmentation. At the ALS the authors have examined the soft X-ray spectroscopy and ionic fragmentation of a number of molecules, including carboranes, silylenes, phosphorus halides, SF{sub 6} and CO{sub 2}. Their work is illustrated using results from the carborane and PF{sub 3} studies.
Adsorption of different amphiphilic molecules onto polystyrene latices.
Jódar-Reyes, A B; Ortega-Vinuesa, J L; Martín-Rodríguez, A
2005-02-15
In order to know the influence of the surface characteristics and the chain properties on the adsorption of amphiphilic molecules onto polystyrene latex, a set of experiments to study the adsorption of ionic surfactants, nonionic surfactants and an amphiphilic synthetic peptide on different latex dispersions was performed. The adsorbed amount versus the equilibrium surfactant concentration was determined. The main adsorption mechanism was the hydrophobic attraction between the nonpolar tail of the molecule and the hydrophobic regions of the latex surface. This attraction overcame the electrostatic repulsion between chains and latex surface with identical charge sign. However, the electrostatic interactions chain-surface and chain-chain also played a role. General patterns for the adsorption of ionic chains on charged latex surfaces could be established. Regarding the shape, the isotherms presented different plateaus corresponding to electrostatic effects and conformational changes. The surfactant size also affects the adsorption results: the higher the hydrophilic moiety in the surfactant molecule the lower the adsorbed amount.
Directory of Open Access Journals (Sweden)
Anastasia Zubareva
2013-07-01
Full Text Available Chitosan (Chi is a natural biodegradable cationic polymer with remarkable potency as a vehicle for drug or vaccine delivery. Chi possesses multiple groups, which can be used both for Chi derivatization and for particle formation. The aim of this work was to produce stable nanosized range Chi gels (nanogels, NGs with different charge and to study the driving forces of complex formation between Chi NGs and proteins or peptides. Positively charged NGs of 150 nm in diameter were prepared from hexanoyl chitosan (HC by the ionotropic gelation method while negatively charged NGs of 190 nm were obtained from succinoyl Chi (SC by a Ca2+ coacervation approach. NGs were loaded with a panel of proteins or peptides with different weights and charges. We show that NGs preferentially formed complexes with oppositely charged molecules, especially peptides, as was demonstrated by gel-electrophoresis, confocal microscopy and HPLC. Complex formation was accompanied by a change in zeta-potential and decrease in size. We concluded that complex formation between Chi NGs and peptide/proteins is mediated mostly by electrostatic interactions.
Krishnan, M.
2017-05-01
We present a model for calculating the net and effective electrical charge of globular macromolecules and linear polyelectrolytes such as proteins and DNA, given the concentration of monovalent salt and pH in solution. The calculation is based on a numerical solution of the non-linear Poisson-Boltzmann equation using a finite element discretized continuum approach. The model simultaneously addresses the phenomena of charge regulation and renormalization, both of which underpin the electrostatics of biomolecules in solution. We show that while charge regulation addresses the true electrical charge of a molecule arising from the acid-base equilibria of its ionizable groups, charge renormalization finds relevance in the context of a molecule's interaction with another charged entity. Writing this electrostatic interaction free energy in terms of a local electrical potential, we obtain an "interaction charge" for the molecule which we demonstrate agrees closely with the "effective charge" discussed in charge renormalization and counterion-condensation theories. The predictions of this model agree well with direct high-precision measurements of effective electrical charge of polyelectrolytes such as nucleic acids and disordered proteins in solution, without tunable parameters. Including the effective interior dielectric constant for compactly folded molecules as a tunable parameter, the model captures measurements of effective charge as well as published trends of pKa shifts in globular proteins. Our results suggest a straightforward general framework to model electrostatics in biomolecules in solution. In offering a platform that directly links theory and experiment, these calculations could foster a systematic understanding of the interrelationship between molecular 3D structure and conformation, electrical charge and electrostatic interactions in solution. The model could find particular relevance in situations where molecular crystal structures are not available or
The role of charge in the surfactant-assisted stabilization of the natural product curcumin.
Wang, Zifan; Leung, Mandy H M; Kee, Tak W; English, Douglas S
2010-04-20
Colloidal solutions of surfactants that form micelles or vesicles are useful for solubilizing and stabilizing hydrophobic molecules that are otherwise sparingly soluble in aqueous solutions. In this paper we investigate the use of micelles and vesicles prepared from ionic surfactants for solubilizing and stabilizing curcumin, a medicinal natural product that undergoes alkaline hydrolysis in water. We identify spectroscopic signatures to evaluate curcumin partitioning and deprotonation in surfactant mixtures containing micelles or vesicles. These spectroscopic signatures allow us to monitor the interaction of curcumin with charged surfactants over a wide range of pH values. Titration data are presented to show the pH dependence of curcumin interactions with negatively and positively charged micelles and vesicles. In solutions of cationic micelles or positively charged vesicles, strong interaction between the Cur(-1) phenoxide ion and the positively charged surfactants results in a change in the acidity of the phenolic hydrogen and a lowering of the apparent lowest pK(a) value for curcumin. In the microenvironments formed by anionic micelles or negatively charged bilayers, our data indicates that curcumin partitions as the Cur(0) species, which is stabilized by interactions with the respective surfactant aggregates, and this leads to an increase in the apparent pK(a) values. Our results may explain some of the discrepancies within the literature with respect to reported pK(a) values and the acidity of the enolic versus phenolic protons. Hydrolysis rates, quantum yields, and molar absorption coefficients are reported for curcumin in a variety of solutions.
Atomic charges of sulfur in ionic liquids: experiments and calculations.
Fogarty, Richard M; Rowe, Rebecca; Matthews, Richard P; Clough, Matthew T; Ashworth, Claire R; Brandt, Agnieszka; Corbett, Paul J; Palgrave, Robert G; Smith, Emily F; Bourne, Richard A; Chamberlain, Thomas W; Thompson, Paul B J; Hunt, Patricia A; Lovelock, Kevin R J
2017-12-14
Experimental near edge X-ray absorption fine structure (NEXAFS) spectra, X-ray photoelectron (XP) spectra and Auger electron spectra are reported for sulfur in ionic liquids (ILs) with a range of chemical structures. These values provide experimental measures of the atomic charge in each IL and enable the evaluation of the suitability of NEXAFS spectroscopy and XPS for probing the relative atomic charge of sulfur. In addition, we use Auger electron spectroscopy to show that when XPS binding energies differ by less than 0.5 eV, conclusions on atomic charge should be treated with caution. Our experimental data provides a benchmark for calculations of the atomic charge of sulfur obtained using different methods. Atomic charges were computed for lone ions and ion pairs, both in the gas phase (GP) and in a solvation model (SMD), with a wide range of ion pair conformers considered. Three methods were used to compute the atomic charges: charges from the electrostatic potential using a grid based method (ChelpG), natural bond orbital (NBO) population analysis and Bader's atoms in molecules (AIM) approach. By comparing the experimental and calculated measures of the atomic charge of sulfur, we provide an order for the sulfur atoms, ranging from the most negative to the most positive atomic charge. Furthermore, we show that both ChelpG and NBO are reasonable methods for calculating the atomic charge of sulfur in ILs, based on the agreement with both the XPS and NEXAFS spectroscopy results. However, the atomic charges of sulfur derived from ChelpG are found to display significant, non-physical conformational dependence. Only small differences in individual atomic charge of sulfur were observed between lone ion (GP) and ion pair IL(SMD) model systems, indicating that ion-ion interactions do not strongly influence individual atomic charges.
Influence of Structure and Charge State on the Mechanism of CO Oxidation on Gold Clusters
Johnson, Grant; Burgel, Christian; Reilly, Nelly; Mitric, Roland; Kimble, Michele; Tyo, Eric; Castleman, A. W.; Bonacic-Koutecky, Vlasta
2008-05-01
Gas-phase reactivity experiments and high level theoretical calculations have been employed to study the interaction of both positively and negatively charged gold oxide clusters with carbon monoxide (CO). We demonstrate that for negatively charged clusters CO is oxidized to CO2 by an Eley-Ridel-like (ER-) mechanism involving the attack of CO on oxygen rather than gold. In contrast, for positively charged clusters, the oxidation reaction may also occur by a Langmuir-Hinshelwood-like (LH-) mechanism involving the initial binding of CO to a gold atom followed by subsequent migration to an oxygen site. The LH mechanism is made possible through the large energy gain associated with the adsorption of two CO molecules onto cationic gold clusters. Structure-reactivity relationships are also established which demonstrate that terminally bound oxygen atoms are the most active sites for CO oxidation. Bridge bonded oxygen atoms and molecularly bound O2 units are shown to be inert. We also establish an inverse relationship between the binding energy of CO to gold clusters and the energy of the clusters lowest unoccupied molecular orbital (LUMO).
Oil Contact Angles in a Water-Decane-Silicon Dioxide System: Effects of Surface Charge.
Xu, Shijing; Wang, Jingyao; Wu, Jiazhong; Liu, Qingjie; Sun, Chengzhen; Bai, Bofeng
2018-04-19
Oil wettability in the water-oil-rock systems is very sensitive to the evolution of surface charges on the rock surfaces induced by the adsorption of ions and other chemical agents in water flooding. Through a set of large-scale molecular dynamics simulations, we reveal the effects of surface charge on the oil contact angles in an ideal water-decane-silicon dioxide system. The results show that the contact angles of oil nano-droplets have a great dependence on the surface charges. As the surface charge density exceeds a critical value of 0.992 e/nm 2 , the contact angle reaches up to 78.8° and the water-wet state is very apparent. The variation of contact angles can be confirmed from the number density distributions of oil molecules. With increasing the surface charge density, the adsorption of oil molecules weakens and the contact areas between nano-droplets and silicon dioxide surface are reduced. In addition, the number density distributions, RDF distributions, and molecular orientations indicate that the oil molecules are adsorbed on the silicon dioxide surface layer-by-layer with an orientation parallel to the surface. However, the layered structure of oil molecules near the silicon dioxide surface becomes more and more obscure at higher surface charge densities.
The total position-spread tensor: Spin partition
International Nuclear Information System (INIS)
El Khatib, Muammar; Evangelisti, Stefano; Leininger, Thierry; Brea, Oriana; Fertitta, Edoardo; Bendazzoli, Gian Luigi
2015-01-01
The Total Position Spread (TPS) tensor, defined as the second moment cumulant of the position operator, is a key quantity to describe the mobility of electrons in a molecule or an extended system. In the present investigation, the partition of the TPS tensor according to spin variables is derived and discussed. It is shown that, while the spin-summed TPS gives information on charge mobility, the spin-partitioned TPS tensor becomes a powerful tool that provides information about spin fluctuations. The case of the hydrogen molecule is treated, both analytically, by using a 1s Slater-type orbital, and numerically, at Full Configuration Interaction (FCI) level with a V6Z basis set. It is found that, for very large inter-nuclear distances, the partitioned tensor growths quadratically with the distance in some of the low-lying electronic states. This fact is related to the presence of entanglement in the wave function. Non-dimerized open chains described by a model Hubbard Hamiltonian and linear hydrogen chains H n (n ≥ 2), composed of equally spaced atoms, are also studied at FCI level. The hydrogen systems show the presence of marked maxima for the spin-summed TPS (corresponding to a high charge mobility) when the inter-nuclear distance is about 2 bohrs. This fact can be associated to the presence of a Mott transition occurring in this region. The spin-partitioned TPS tensor, on the other hand, has a quadratical growth at long distances, a fact that corresponds to the high spin mobility in a magnetic system
The infra-red spectrum of the molecular dication (doubly positively charged molecule) D35Cl2+
International Nuclear Information System (INIS)
Abusen, R.A.
1999-07-01
The ion-beam/laser-beam spectrometer used in this work was designed, built and commissioned for the experimental investigation of doubly charged molecular species [Shiell 1995]. Using this spectrometer the photodissociation spectrum of the X 3 Σ - state of the molecular dication D 35 Cl 2+ was measured in the infrared. It has not yet been possible to assign and fit the observed transitions in the usual way, but comparisons of our spectra with ab-initio generated spectra show good agreement and form the basis for our preliminary assignments. Our preliminary analysis shows a good agreement between the measured spectra and an ab-initio theoretical spectra of the ν = 2-1 band, including the rotational constants and tunneling lifetimes, calculated from the potential energy of Bennett and McNab [1995]. The theoretical spectrum was brought into agreement with the measured spectra by moving its band origin by -21.1 cm -1 . The theoretical rotational constants that give good agreement with the spectrum are (in cm -1 ) B'' = 3.898, D'' = 3.561, H'' = 1.04 x 10 -9 , B' = 3.648, D' = 3.163 x 10 -4 , H' = -9.269 x 10 -8 . The shifted origin of the ν = 2-1 band is 994.3 cm -1 . A Fortran computer program was written to simulate 3Σ-3Σ vibration-rotation spectra. The theoretical spectrum obtained with this computer program has been compared with our measured spectrum. Our experimentally measured line widths and wavenumbers have been compared with the ab-initio theoretical spectrum and a good agreement obtained. This is good evidence that we are observing the ν=2-1 band of D 35 CI 2+ in the ground electronic state (X 3 Σ - state). Good agreement between measured and predicted hyperfine patterns was found using a Fermi contact constant (for the chlorine nucleus) of 190 MHz. (author)
Single-Molecule Photocurrent at a Metal-Molecule-Semiconductor Junction.
Vezzoli, Andrea; Brooke, Richard J; Higgins, Simon J; Schwarzacher, Walther; Nichols, Richard J
2017-11-08
We demonstrate here a new concept for a metal-molecule-semiconductor nanodevice employing Au and GaAs contacts that acts as a photodiode. Current-voltage traces for such junctions are recorded using a STM, and the "blinking" or "I(t)" method is used to record electrical behavior at the single-molecule level in the dark and under illumination, with both low and highly doped GaAs samples and with two different types of molecular bridge: nonconjugated pentanedithiol and the more conjugated 1,4-phenylene(dimethanethiol). Junctions with highly doped GaAs show poor rectification in the dark and a low photocurrent, while junctions with low doped GaAs show particularly high rectification ratios in the dark (>10 3 for a 1.5 V bias potential) and a high photocurrent in reverse bias. In low doped GaAs, the greater thickness of the depletion layer not only reduces the reverse bias leakage current, but also increases the volume that contributes to the photocurrent, an effect amplified by the point contact geometry of the junction. Furthermore, since photogenerated holes tunnel to the metal electrode assisted by the HOMO of the molecular bridge, the choice of the latter has a strong influence on both the steady state and transient metal-molecule-semiconductor photodiode response. The control of junction current via photogenerated charge carriers adds new functionality to single-molecule nanodevices.
Alsam, Amani Abdu
2017-03-14
Controlling the ultrafast dynamical process of photoinduced charge transfer at donor acceptor interfaces remains a major challenge for physical chemistry and solar cell communities. The process is complicated by the involvement of other complex dynamical processes, including hydrogen bond formation, energy transfer, and solvation dynamics occurring on similar time scales. In this study, we explore the remarkable impact of hydrogen-bond formation on the interfacial charge transfer between a negatively charged electron donating anionic porphyrin and a positively charged electron accepting pi-conjugated polymer, as a model system in solvents with different polarities and capabilities for hydiogen bonding using femtosecond transient absorption spectroscopy. Unlike the conventional understanding of the key role of hydrogen bonding in promoting the charge-transfer process, our steadystate and time-resolved results reveal that the intervening hydrogen-bonding environment and, consequently, the probable longer spacing between the donor and acceptor molecules significantly hinders the charge-transfer process between them. These results show that site-specific hydrogen bonding and geometric considerations between donor and acceptor can be exploited to control both the charge-transfer dynamics and its efficiency not only at donor acceptor interfaces but also in complex biological systems.
Charge transport through molecular switches
International Nuclear Information System (INIS)
Jan van der Molen, Sense; Liljeroth, Peter
2010-01-01
We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)
Charge transport through molecular switches
Energy Technology Data Exchange (ETDEWEB)
Jan van der Molen, Sense [Kamerlingh Onnes Laboratorium, Leiden University, Niels Bohrweg 2, 2333 CA Leiden (Netherlands); Liljeroth, Peter, E-mail: molen@physics.leidenuniv.n [Condensed Matter and Interfaces, Debye Institute for Nanomaterials Science, University of Utrecht, PO Box 80000, 3508 TA Utrecht (Netherlands)
2010-04-07
We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)
Spectrally resolved single-molecule electrometry
Ruggeri, F.; Krishnan, M.
2018-03-01
Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.
Polarization and charge transfer in the hydration of chloride ions
International Nuclear Information System (INIS)
Zhao Zhen; Rogers, David M.; Beck, Thomas L.
2010-01-01
A theoretical study of the structural and electronic properties of the chloride ion and water molecules in the first hydration shell is presented. The calculations are performed on an ensemble of configurations obtained from molecular dynamics simulations of a single chloride ion in bulk water. The simulations utilize the polarizable AMOEBA force field for trajectory generation and MP2-level calculations are performed to examine the electronic structure properties of the ions and surrounding waters in the external field of more distant waters. The ChelpG method is employed to explore the effective charges and dipoles on the chloride ions and first-shell waters. The quantum theory of atoms in molecules (QTAIM) is further utilized to examine charge transfer from the anion to surrounding water molecules. The clusters extracted from the AMOEBA simulations exhibit high probabilities of anisotropic solvation for chloride ions in bulk water. From the QTAIM analysis, 0.2 elementary charges are transferred from the ion to the first-shell water molecules. The default AMOEBA model overestimates the average dipole moment magnitude of the ion compared to the quantum mechanical value. The average magnitude of the dipole moment of the water molecules in the first shell treated at the MP2-level, with the more distant waters handled with an AMOEBA effective charge model, is 2.67 D. This value is close to the AMOEBA result for first-shell waters (2.72 D) and is slightly reduced from the bulk AMOEBA value (2.78 D). The magnitude of the dipole moment of the water molecules in the first solvation shell is most strongly affected by the local water-water interactions and hydrogen bonds with the second solvation shell, rather than by interactions with the ion.
Modesto-Costa, Lucas; Borges, Itamar
2018-08-05
The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.
Charge dividing mechanism on resistive electrode in position-sensitive detectors
International Nuclear Information System (INIS)
Radeka, V.; Rehak, P.
1978-10-01
A complete charge-division mechanism, including both the diffusion and the electromagnetic wave propagation on resistive electrodes, is presented. The charge injected into such a transmission line divides between the two ends according to the ratio of resistancies and independently of the value of the line resistance, of the propagation mechanism and of the distribution of inductance and capacitance along the line. The shortest charge division time is achieved for Rl = 2π (L/C) 1 / 2 , where R, L, C are resistance, inductance and capacitance per unit length and l is the length of the line
International Nuclear Information System (INIS)
Sharma, N.; Yu, D.; Zhu, Y.; Wu, Y.; Peterson, V. K.
2012-01-01
Lithium-ion batteries are undergoing rapid development to meet the energy demands of the transportation and renewable energy-generation sectors. The capacity of a lithium-ion battery is dependent on the amount of lithium that can be reversibly incorporated into the cathode. Neutron diffraction provides greater sensitivity towards lithium relative to other diffraction techniques. In conjunction with the penetration depth afforded by neutron diffraction, the information concerning lithium gained in a neutron diffraction study allows commercial lithium-ion batteries to be explored with respect to the lithium content in the whole cathode. Furthermore, neutron diffraction instruments featuring area detectors that allow relatively fast acquisitions enable perturbations of lithium location and occupancy in the cathode during charge/discharge cycling to be determined in real time. Here, we present the time, current, and temperature dependent lithium transfer occurring within a cathode functioning under conventional charge-discharge cycling. The lithium location and content, oxygen positional parameter, and lattice parameter of the Li 1+y Mn 2 0 4 cathode are measured and linked to the battery's charge/discharge characteristics (performance). We determine that the lithium-transfer mechanism involves two crystallographic sites, and that the mechanism differs between discharge and charge, explaining the relative ease of discharging (compared with charging) this material. Furthermore, we find that the rate of change of the lattice is faster on charging than discharging, and is dependent on the lithium insertion/ extraction processes (e.g. dependent on how the site occupancies evolve). Using in situ neutron diffraction data the atomic-scale understanding of cathode functionality is revealed, representing detailed information that can be used to direct improvements in battery performance at both the practical and fundamental level.
Electron-beam-charged dielectrics: Internal charge distribution
Beers, B. L.; Pine, V. W.
1981-01-01
Theoretical calculations of an electron transport model of the charging of dielectrics due to electron bombardment are compared to measurements of internal charge distributions. The emphasis is on the distribution of Teflon. The position of the charge centroid as a function of time is not monotonic. It first moves deeper into the material and then moves back near to the surface. In most time regimes of interest, the charge distribution is not unimodal, but instead has two peaks. The location of the centroid near saturation is a function of the incident current density. While the qualitative comparison of theory and experiment are reasonable, quantitative comparison shows discrepancies of as much as a factor of two.
Tsiaousis, D.; Munn, R. W.
2004-04-01
Calculations for the acetanilide crystal yield the effective polarizability (16.6 Å3), local electric field tensor, effective dipole moment (5.41 D), and dipole-dipole energy (-12.8 kJ/mol). Fourier-transform techniques are used to calculate the polarization energy P for a single charge in the perfect crystal (-1.16 eV); the charge-dipole energy WD is zero if the crystal carries no bulk dipole moment. Polarization energies for charge-transfer (CT) pairs combine with the Coulomb energy EC to give the screened Coulomb energy Escr; screening is nearly isotropic, with Escr≈EC/2.7. For CT pairs WD reduces to a term δWD arising from the interaction of the charge on each ion with the change in dipole moment on the other ion relative to the neutral molecule. The dipole moments calculated by density-functional theory methods with the B3LYP functional at the 6-311++G** level are 3.62 D for the neutral molecule, changing to 7.13 D and 4.38 D for the anion and cation, relative to the center of mass. Because of the large change in the anion, δWD reaches -0.9 eV and modifies the sequence of CT energies markedly from that of Escr, giving the lowest two CT pairs at -1.98 eV and -1.41 eV. The changes in P and WD near a vacancy are calculated; WD changes for the individual charges because the vacancy removes a dipole moment and modifies the crystal dielectric response, but δWD and EC do not change. A vacancy yields a positive change ΔP that scatters a charge or CT pair, but the change ΔWD can be negative and large enough to outweigh ΔP, yielding traps with depths that can exceed 150 meV for single charges and for CT pairs. Divacancies yield traps with depths nearly equal to the sum of those produced by the separate vacancies and so they can exceed 300 meV. These results are consistent with a mechanism of optical damage in which vacancies trap optically generated CT pairs that recombine and release energy; this can disrupt the lattice around the vacancy, thereby favoring
The Physics of Small Molecule Acceptors for Efficient and Stable Bulk Heterojunction Solar Cells
Gasparini, Nicola
2018-01-29
Organic bulk heterojunction solar cells based on small molecule acceptors have recently seen a rapid rise in the power conversion efficiency with values exceeding 13%. This impressive achievement has been obtained by simultaneous reduction of voltage and charge recombination losses within this class of materials as compared to fullerene-based solar cells. In this contribution, the authors review the current understanding of the relevant photophysical processes in highly efficient nonfullerene acceptor (NFA) small molecules. Charge generation, recombination, and charge transport is discussed in comparison to fullerene-based composites. Finally, the authors review the superior light and thermal stability of nonfullerene small molecule acceptor based solar cells, and highlight the importance of NFA-based composites that enable devices without early performance loss, thus resembling so-called burn-in free devices.
The Physics of Small Molecule Acceptors for Efficient and Stable Bulk Heterojunction Solar Cells
Gasparini, Nicola; Wadsworth, Andrew; Moser, Maximilian; Baran, Derya; McCulloch, Iain; Brabec, Christoph J.
2018-01-01
Organic bulk heterojunction solar cells based on small molecule acceptors have recently seen a rapid rise in the power conversion efficiency with values exceeding 13%. This impressive achievement has been obtained by simultaneous reduction of voltage and charge recombination losses within this class of materials as compared to fullerene-based solar cells. In this contribution, the authors review the current understanding of the relevant photophysical processes in highly efficient nonfullerene acceptor (NFA) small molecules. Charge generation, recombination, and charge transport is discussed in comparison to fullerene-based composites. Finally, the authors review the superior light and thermal stability of nonfullerene small molecule acceptor based solar cells, and highlight the importance of NFA-based composites that enable devices without early performance loss, thus resembling so-called burn-in free devices.
Study of ionization process of matrix molecules in matrix-assisted laser desorption ionization
Energy Technology Data Exchange (ETDEWEB)
Murakami, Kazumasa; Sato, Asami; Hashimoto, Kenro; Fujino, Tatsuya, E-mail: fujino@tmu.ac.jp
2013-06-20
Highlights: ► Proton transfer and adduction reaction of matrix in MALDI were studied. ► Hydroxyl group forming intramolecular hydrogen bond was related to the ionization. ► Intramolecular proton transfer in the electronic excited state was the initial step. ► Non-volatile analytes stabilized protonated matrix in the ground state. ► A possible mechanism, “analyte support mechanism”, has been proposed. - Abstract: Proton transfer and adduction reaction of matrix molecules in matrix-assisted laser desorption ionization were studied. By using 2,4,6-trihydroxyacetophenone (THAP), 2,5-dihydroxybenzoic acid (DHBA), and their related compounds in which the position of a hydroxyl group is different, it was clarified that a hydroxyl group forming an intramolecular hydrogen bond is related to the ionization of matrix molecules. Intramolecular proton transfer in the electronic excited state of the matrix and subsequent proton adduction from a surrounding solvent to the charge-separated matrix are the initial steps for the ionization of matrix molecules. Nanosecond pump–probe NIR–UV mass spectrometry confirmed that the existence of analyte molecules having large dipole moment in their structures is necessary for the stabilization of [matrix + H]{sup +} in the electronic ground state.
International Nuclear Information System (INIS)
Kumar Paul, Bijan; Samanta, Anuva; Kar, Samiran; Guchhait, Nikhil
2010-01-01
Intramolecular charge transfer (ICT) reaction has been investigated in 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester (DPDAME) using spectroscopic techniques. The molecule DPDAME shows local emission in non-polar solvent and dual emission in polar solvents. Solvatochromic effects on the Stokes shifted emission band clearly demonstrate the charge transfer character of the excited state. Quantum chemical calculations have been performed at Hartree-Fock (HF) and density functional theoretical (DFT) levels to correlate the experimental findings. Potential energy curves (PECs) for the ICT reaction have been evaluated along the donor twist angle at DFT and time dependent density functional theory (TDDFT) levels for the ground and excited states, respectively, using B3LYP hybrid functional and 6-31G** basis set. The solvent effects on the spectral properties have been explored theoretically at the same level with time dependent density functional theory-polarized continuum model (TDDFT-PCM) and the theoretical results are found to well substantiate the solvent polarity dependent Stokes shifted emission of DPDAME. Huge enhancement of dipole moment (Δμ=16.42 D) of the molecule following photoexcitation dictates the highly polar character of the excited state. Although elucidation of PECs does not exactly predict the operation of ICT according to twisted intramolecular charge transfer (TICT) model in DPDAME, lowering of vertical transition energy as a function of the donor twist coordinate scripts the occurrence of red shifted emission as observed experimentally.
Bâldea, Ioan
2017-10-26
Inspired by earlier attempts in organic electronics aiming at controlling charge injection from metals into organic materials by manipulating the Schottky energy barrier using self-assembled monolayers (SAMs), recent experimental and theoretical work in molecular electronics showed that metal-organic interfaces can be controlled via changes in the metal work function that are induced by SAMs. In this paper we indicate a different route to achieve interface-driven control over the charge transfer/transport at the molecular scale. It is based on the fact that, in floppy molecule based SAMs, the molecular conformation can be tuned by varying the coverage of the adsorbate. We demonstrate this effect with the aid of benchmark molecules that are often used to fabricate nanojunctions and consist of two rings that can easily rotate relative to each other. We show that, by varying the coverage of the SAM, the twisting angle φ of the considered molecular species can be modified by a factor of two. Given the fact that the low bias conductance G scales as cos 2 φ, this results in a change in G of over one order of magnitude for the considered molecular species. Tuning the twisting angle by controlling the SAM coverage may be significant, e.g., for current efforts to fabricate molecular switches. Conversely, the lack of control over the local SAM coverage may be problematic for the reproducibility and interpretation of the STM (scanning tunneling microscope) measurements on repeatedly forming single molecule break junctions.
International Nuclear Information System (INIS)
Wang Xumei; Xu Shuping; Xu Weiqing; Liang Chongyang; Li Hongrui; Sun Fei
2011-01-01
Multicolored fluorescent dye loaded PMMA nanospheres were synthesized by the electrostatic adsorption of dye molecules on the charged PMMA nanospheres, whose charges were adjusted by choosing different initiators. The charged PMMA nanospheres have a wider capacity and advantage for combining the charged dyes. The fluorescent dye-PMMA composite nanospheres possess the advantages of higher brightness, longer lifetime and stronger resistance to photobleaching relative to dye molecules. Dye leakage remained lower than 5% over one week. These fluorescent nanospheres have been used in biological labels in cell imaging. They can easily stain blood cancer cells without further surface modification.
Electron-vibron coupling effects on electron transport via a single-molecule magnet
McCaskey, Alexander; Yamamoto, Yoh; Warnock, Michael; Burzurí, Enrique; van der Zant, Herre S. J.; Park, Kyungwha
2015-03-01
We investigate how the electron-vibron coupling influences electron transport via an anisotropic magnetic molecule, such as a single-molecule magnet (SMM) Fe4, by using a model Hamiltonian with parameter values obtained from density-functional theory (DFT). The magnetic anisotropy parameters, vibrational energies, and electron-vibron coupling strengths of the Fe4 are computed using DFT. A giant spin model is applied to the Fe4 with only two charge states, specifically a neutral state with a total spin S =5 and a singly charged state with S =9 /2 , which is consistent with our DFT result and experiments on Fe4 single-molecule transistors. In sequential electron tunneling, we find that the magnetic anisotropy gives rise to new features in the conductance peaks arising from vibrational excitations. In particular, the peak height shows a strong, unusual dependence on the direction as well as magnitude of applied B field. The magnetic anisotropy also introduces vibrational satellite peaks whose position and height are modified with the direction and magnitude of applied B field. Furthermore, when multiple vibrational modes with considerable electron-vibron coupling have energies close to one another, a low-bias current is suppressed, independently of gate voltage and applied B field, although that is not the case for a single mode with a similar electron-vibron coupling. In the former case, the conductance peaks reveal a stronger B -field dependence than in the latter case. The new features appear because the magnetic anisotropy barrier is of the same order of magnitude as the energies of vibrational modes with significant electron-vibron coupling. Our findings clearly show the interesting interplay between magnetic anisotropy and electron-vibron coupling in electron transport via the Fe4. Similar behavior can be observed in transport via other anisotropic magnetic molecules.
Conduction mechanism in assemblies of metal nanoparticles linked by organic molecules
International Nuclear Information System (INIS)
Mueller, K.-H.; Herrmann, J.; Raguse, B.; Baxter, G.; Reda, T.
2002-01-01
Full text: We have investigated theoretically and experimentally electron transport through thin films of gold nanoparticles which are linked by alkanedithiol molecules of different chain lengths. We find that conduction between neighbouring nanoparticles takes place by electron tunnelling along weakly conducting organic linker molecules. Using a tight binding model for the alkanedithiol molecules to describe the tunnelling process we predict the conductivity to decrease exponentially with the length of the molecules. During tunnelling the electron has to overcome a charging energy due to the electron-hole interaction between tunnelling electrons and the corresponding holes left behind on the donor nanoparticle. Experimentally we find that large applied voltages cause nonlinear I-V characteristics and that the temperature dependence of the conductivity does not show Arrhenius behaviour but instead is of the form exp[-(E o /kT) 1/2 ]. Using percolation theory for a network of metal nanoparticles separated by barriers we show that strong disorder caused by variations in nanoparticle size and linker length as well as randomly trapped electric charges on the linker molecules can well explain our experimental data
Contributions of charge-density research to medicinal chemistry
Directory of Open Access Journals (Sweden)
Birger Dittrich
2014-11-01
Full Text Available This article reviews efforts in accurate experimental charge-density studies with relevance to medicinal chemistry. Initially, classical charge-density studies that measure electron density distribution via least-squares refinement of aspherical-atom population parameters are summarized. Next, interaction density is discussed as an idealized situation resembling drug–receptor interactions. Scattering-factor databases play an increasing role in charge-density research, and they can be applied both to small-molecule and macromolecular structures in refinement and analysis; software development facilitates their use. Therefore combining both of these complementary branches of X-ray crystallography is recommended, and examples are given where such a combination already proved useful. On the side of the experiment, new pixel detectors are allowing rapid measurements, thereby enabling both high-throughput small-molecule studies and macromolecular structure determination to higher resolutions. Currently, the most ambitious studies compute intermolecular interaction energies of drug–receptor complexes, and it is recommended that future studies benefit from recent method developments. Selected new developments in theoretical charge-density studies are discussed with emphasis on its symbiotic relation to crystallography.
Biradical and triradical organic magnetic molecules as spin filters and rectifiers
International Nuclear Information System (INIS)
Zhu, L.; Yao, K.L.; Liu, Z.L.
2012-01-01
Graphical abstract: (a) Negative differential resistance (NDR) characteristic and antiparallel spin-current (ASC) rectification; (b) spin-current (SC) rectification and charge-current (CC) rectification properties Display Omitted Highlights: ► Organic magnetic molecules at gold electrodes as spin/charge rectifier. ► Spin diode/rectification stems from length and asymmetry of molecular framework. ► Negative differential resistance, spin-filtering and switching evidenced. - Abstract: We have theoretically investigated the spin-polarized transport properties of molecular junctions consisting of biradical and triradical organic magnetic molecules sandwiched between two symmetric gold electrodes, respectively. It shows that these junctions function as a spin rectifier or a combination of spin and charge rectifiers with high spin rectification ratios exceeding 100, wherein the spin diode/rectification effect stems from the conjugated length and asymmetry of the molecular framework, which is the pre-requisite for electronic asymmetry of the adsorbed species. The negative differential resistance, spin-filtering and switching properties are also unveiled. In particular, it is revealed that the strong couplings between the electrodes and molecules are responsible for the negative differential resistance.
Sehaqui, H.
2015-01-01
© The Royal Society of Chemistry. Waste pulp residues are herein exploited for the synthesis of a sorbent for humic acid (HA), which is a major water pollutant. Cellulose pulp was etherified with a quaternary ammonium salt in water thereby introducing positive charges onto the surface of the pulp fibers, and subsequently mechanically disintegrated into high surface area cellulose nanofibers (CNF). CNF with three different charge contents were produced and their adsorption capacity towards HA was investigated with UV-spectrophotometry, quartz crystal microbalance with dissipation, and ζ-potential measurements. Substantial coverage of the CNF surface with HA in a wide pH range led to a reversal of the positive ζ-potentials of CNF suspensions. The HA adsorption capacity and the kinetics of HA uptake were found to be promoted by both acidic pH conditions and the surface charge content of CNF. It is suggested that HA adsorption onto CNF depends on electrostatic interactions between the two components, as well as on the conformation of HA. At pH ∼ 6, up to 310 mg g-1 of HA were adsorbed by the functionalized CNF, a substantially higher capacity than that of previously reported HA sorbents in the literature. It is further shown that CNF-HA complexes could be freeze-dried into "soil-mimicking" porous foams having good capacity to capture Cu(ii) ions and positive dyes from contaminated water. Thus, the most abundant natural polymer, i.e., cellulose could effectively bind the most abundant natural organic matter for environmental remediation purpose.
Electrostrictive deformations in small carbon clusters, hydrocarbon molecules, and carbon nanotubes
International Nuclear Information System (INIS)
Cabria, I.; Lopez, M. J.; Alonso, J. A.; Amovilli, C.; March, N. H.
2006-01-01
The electrostrictive response of small carbon clusters, hydrocarbon molecules, and carbon nanotubes is investigated using the density functional theory. For ringlike carbon clusters, one can get insight on the deformations induced by an electric field from a simple two-dimensional model in which the positive charge of the carbon ions is smeared out in a circular homogeneous line of charge and the electronic density is calculated for a constant applied electric field within a two-dimensional Thomas-Fermi method. According to the Hellmann-Feynman theorem, this model predicts, for fields of about 1 V/A ring , only a small elongation of the ring clusters in the direction of the electric field. Full three-dimensional density functional calculations with an external electric field show similar small deformations in the ring carbon clusters compared to the simple model. The saturated benzene and phenanthrene hydrocarbon molecules do not experience any deformation, even under the action of relatively intense (1 V/A ring ) electric fields. In contrast, finite carbon nanotubes experience larger elongations (∼2.9%) induced by relatively weak (0.1 V/A ring ) applied electric fields. Both C-C bond length elongation and the deformation of the honeycomb structure contribute equally to the nanotube elongation. The effect of the electric field in hydrogen terminated nanotubes is reduced with respect to the nanotubes with dangling bonds in the edges
Characterization of four different bipolar charging devices for nanoparticle charge conditioning
International Nuclear Information System (INIS)
Kallinger, Peter; Steiner, Gerhard; Szymanski, Wladyslaw W.
2012-01-01
Well-defined charge conditioning of nanoparticles is a prerequisite for a number of particle measuring techniques. We investigated two different soft X-ray devices (custom-built and TSI advanced aerosol neutralizer) an AC-corona discharge device (MSP electrical ionizer) and a radioactivity based Am-241 charger as a reference. Electrical mobility size distributions of positive and negative ions created in all devices were determined and their applicability for particle charging examined. The mobility spectra of the positive ions were found to be quite comparable for all chargers with a mean mobility of 1.50–1.60 cm 2 V −1 s −1 , whereas the spectra of the negative ions show differences in morphology leading to a broader range of mean mobilities (1.68–2.09 cm 2 V −1 s −1 ). However, results confirm that under the selected experimental conditions the charge equilibrium related to bipolar diffusion charging process was obtained in all charging devices.
Single charging events on colloidal particles in a nonpolar liquid with surfactant
Schreuer, Caspar; Vandewiele, Stijn; Brans, Toon; Strubbe, Filip; Neyts, Kristiaan; Beunis, Filip
2018-01-01
Electrical charging of colloidal particles in nonpolar liquids due to surfactant additives is investigated intensively, motivated by its importance in a variety of applications. Most methods rely on average electrophoretic mobility measurements of many particles, which provide only indirect information on the charging mechanism. In the present work, we present a method that allows us to obtain direct information on the charging mechanism, by measuring the charge fluctuations on individual particles with a precision higher than the elementary charge using optical trapping electrophoresis. We demonstrate the capabilities of the method by studying the influence of added surfactant OLOA 11000 on the charging of single colloidal PMMA particles in dodecane. The particle charge and the frequency of charging events are investigated both below and above the critical micelle concentration (CMC) and with or without applying a DC offset voltage. It is found that at least two separate charging mechanisms are present below the critical micelle concentration. One mechanism is a process where the particle is stripped from negatively charged ionic molecules. An increase in the charging frequency with increased surfactant concentration suggests a second mechanism that involves single surfactant molecules. Above the CMC, neutral inverse micelles can also be involved in the charging process.
Limits to differences in active and passive charges
Laemmerzahl, C.; Macias, A.; Mueller, H.
2007-01-01
We explore consequences of a hypothetical difference between active charges, which generate electric fields, and passive charges, which respond to them. A confrontation to experiments using atoms, molecules, or macroscopic matter yields limits on their fractional difference at levels down to 10^-21, which at the same time corresponds to an experimental confirmation of Newtons third law.
Point charges optimally placed to represent the multipole expansion of charge distributions.
Directory of Open Access Journals (Sweden)
Ramu Anandakrishnan
Full Text Available We propose an approach for approximating electrostatic charge distributions with a small number of point charges to optimally represent the original charge distribution. By construction, the proposed optimal point charge approximation (OPCA retains many of the useful properties of point multipole expansion, including the same far-field asymptotic behavior of the approximate potential. A general framework for numerically computing OPCA, for any given number of approximating charges, is described. We then derive a 2-charge practical point charge approximation, PPCA, which approximates the 2-charge OPCA via closed form analytical expressions, and test the PPCA on a set of charge distributions relevant to biomolecular modeling. We measure the accuracy of the new approximations as the RMS error in the electrostatic potential relative to that produced by the original charge distribution, at a distance 2x the extent of the charge distribution--the mid-field. The error for the 2-charge PPCA is found to be on average 23% smaller than that of optimally placed point dipole approximation, and comparable to that of the point quadrupole approximation. The standard deviation in RMS error for the 2-charge PPCA is 53% lower than that of the optimal point dipole approximation, and comparable to that of the point quadrupole approximation. We also calculate the 3-charge OPCA for representing the gas phase quantum mechanical charge distribution of a water molecule. The electrostatic potential calculated by the 3-charge OPCA for water, in the mid-field (2.8 Å from the oxygen atom, is on average 33.3% more accurate than the potential due to the point multipole expansion up to the octupole order. Compared to a 3 point charge approximation in which the charges are placed on the atom centers, the 3-charge OPCA is seven times more accurate, by RMS error. The maximum error at the oxygen-Na distance (2.23 Å is half that of the point multipole expansion up to the octupole
Study of correlations of positive and negative charged particles
International Nuclear Information System (INIS)
Takahashi, Y.; Chan, C.H.; Dong, B.L.; Duthie, J.G.; Gregory, J.C.; Hayashi, T.; Yokomi, H.; Christl, M.J.; Derrickson, J.H.; Eby, P.B.; Fountain, W.F.; Parnell, T.A.; Roberts, F.E.; Nagamiya, S.; Dake, S.; Tominaga, T.; Fuki, M.; Iyono, A.; Ogata, T.; Miyamura, O.
1991-01-01
Particle correlations of the central collision events of 32 S + Pb at 200 GeV/AMU have been studied by utilizing a Magnetic-Interferomagnetic-Emulsion-Chamber (MAGIC) detector. Particle angles, momentum, and charge-signs are measured for all produced charged tracks for each event. Two-particle correlation functions, C 2 = dN (vertical strokep 1 - p 2 vertical stroke = q)/dp 1 dp 2 , for (++), (--) and (+-) particles are examined. A source radius around 4 - 6 fm is observed for overall identical particle correlations, while unexpected short-range correlations of unlike-sign pairs are observed in the high rapidity region. An analysis of unlike-sign pairs in terms of resonance decays indicated that a large amount (40% relative to pions) of η or ω mesons (decaying into 3 π), or of scalar iso-scalar σ mesons (decaying into 2 π) would be required to explain some of the data. Multi-particle charge-sign clusters are recognized; however, their 'run-test' and 'conjugate-test' show small deviations from statistical fluctuations. (orig.)
International Nuclear Information System (INIS)
Xu, Jingyue; Li, Ying; Bie, Jiaxin; Guo, Jiajia; Luo, Yeli; Shen, Fei; Sun, Chunyan; Jiang, Wei
2015-01-01
A sensitive, specific and rapid colorimetric aptasensor for the determination of the plasticizer bisphenol A (BPA) was developed. It is based on the use of gold nanoparticles (AuNPs) that are positively charged due to the modification with cysteamine which is cationic at near-neutral pH values. If aptamers are added to such AuNPs, aggregation occurs due to electrostatic interactions between the negatively-charged aptamers and the positively-charged AuNPs. This results in a color change of the AuNPs from red to blue. If a sample containing BPA is added to the anti-BPA aptamers, the anti-BPA aptamers undergo folding via an induced-fit binding mechanism. This is accompanied by a conformational change, which prevents the aptamer-induced aggregation and color change of AuNPs. The effect was exploited to design a colorimetric assay for BPA. Under optimum conditions, the absorbance ratio of A 527 /A 680 is linearly proportional to the BPA concentration in the range from 35 to 140 ng∙mL −1 , with a detection limit of 0.11 ng∙mL −1 . The method has been successfully applied to the determination of BPA in spiked tap water and gave recoveries between 91 and 106 %. Data were in full accordance with results obtained from HPLC. This assay is selective, easily performed, and in our perception represents a promising alternative to existing methods for rapid quantification of BPA. (author)
International Nuclear Information System (INIS)
Matysik, Joerg; Boer, Ido de; Gast, Peter; Gorkom, Hans J. van; Groot, Huub J.M. de
2004-01-01
In a recent MAS NMR study, two types of histidine residues in the light-harvesting complex II (LH2) of Rhodopseudomonas acidophila were resolved: Type 1 (neutral) and Type 2 (positively charged) (Alia et al. J. Am. Chem. Soc.). The isotropic 13 C shifts of histidines coordinating to B850 BChl a are similar to fully positively charged histidine, while the 15 N shift anisotropy shows a predominantly neutral character. In addition the possibility that the ring currents are quenched by overlap in the superstructure of the complete ring of 18 B850 molecules in the LH2 complex could not be excluded. In the present work, by using two-dimensional heteronuclear ( 1 H- 13 C) dipolar correlation spectroscopy with phase-modulated Lee-Goldburg homonuclear 1 H decoupling applied during the t 1 period, a clear and unambiguous assignment of the protons of histidine interacting with the magnesium of a BChl a molecule is obtained and a significant ring current effect from B850 on the coordinating histidine is resolved. Using the ring current shift on 1 H, we refine the 13 C chemical shift assignment of the coordinating histidine and clearly distinguish the electronic structure of coordinating histidines from that of fully positively charged histidine. The DFT calculations corroborate that the coordinating histidines carry ∼0.2 electronic equivalent of positive charge in LH2. In addition, the data indicate that the ground state electronic structures of individual BChl a/His complexes is largely independent of supermolecular π interactions in the assembly of 18 B850 ring in LH2
Interactions of electrons with biologically important molecules
International Nuclear Information System (INIS)
Pisklova, K.; Papp, P.; Stano, M.
2012-01-01
For the study of interactions of low-energy electrons with the molecules in the gas phase, the authors used electron-molecule cross-beam apparatus. The experiment is carried out in high vacuum, where molecules of the tested compound are inducted through a capillary. For purposes of this experiment the sample was electrically heated to 180 Deg C., giving a bundle of GlyGly molecules into the gas phase. The resulting signals can be evaluated in two different modes: mass spectrum - at continuous electron energy (e.g. 100 eV) they obtained the signal of intensity of the ions according to their mass to charge ratio; ionization and resonance spectra - for selected ion mass when the authors received the signal of intensity of the ions, depending on the energy of interacting electron.
Adsorption of gas molecules on Ga-doped graphene and effect of applied electric field: A DFT study
Energy Technology Data Exchange (ETDEWEB)
Liang, Xiong-Yi [Department of Physics and Materials Science, City University of Hong Kong, Hong Kong SAR (China); Ding, Ning [Department of Physics and Materials Science, City University of Hong Kong, Hong Kong SAR (China); Key Laboratory for Applied Technology of Sophisticated Analytical Instruments, Shandong Academy of Sciences, Jinan 250014 (China); Ng, Siu-Pang [Department of Physics and Materials Science, City University of Hong Kong, Hong Kong SAR (China); Wu, Chi-Man Lawrence, E-mail: lawrence.wu@cityu.edu.hk [Department of Physics and Materials Science, City University of Hong Kong, Hong Kong SAR (China); Key Laboratory for Applied Technology of Sophisticated Analytical Instruments, Shandong Academy of Sciences, Jinan 250014 (China)
2017-07-31
Highlights: • H{sub 2}O, NH{sub 3}, CO, NO{sub 2} and NO are physically adsorbed on pristine graphene. • The adsorption energies of all gas molecules on graphene are increased after doping with Ga. • NO{sub 2} shows the strongest affinity to Ga-doped graphene. • The electronic properties and adsorption of NO{sub 2} on graphene and can be effectively tuned using an external electric field. - Abstract: Density functional theory calculations have been carried out to study the adsorption of varous gas molecules (H{sub 2}O, NH{sub 3}, CO, NO{sub 2} and NO) on pristine graphene and Ga-doped graphene in order to explore the feasibility of Ga-doped graphene based gas sensor. For each gas molecule, various adsorption positions and orientations were considered. The most stable configuration was determined and the adsorption energies with van der Waals interactions were calculated. Further, electronic properties such as electron density, density of states, charge transfer and band structure were investigated to understand the mechanism of adsorption. The results showed that the gas molecules studied were only weakly adsorbed on pristine graphene with small adsorption energies. On the other hand, the adsorption energies of all gas molecules on Ga-doped graphene increased by various amounts. Adsorption of gas molecules on Ga-doped graphene can open a relatively large band gap ranging from 0.267 to 0.397 eV. NO{sub 2} was found to be very sensitive to Ga-doped graphene with adsorption energy of −1.928 eV due to strong orbital hybridization and large charge transfer. Furthermore, our study suggests that the affinity and electronic properties of NO{sub 2} on Ga-doped graphene can be dramatically changed by an external electric field. A negative electric field enhances the adsorption of NO{sub 2} on Ga-doped graphene as reflected in the increase in adsorption energy. In contrast, the interaction will be weakened under a positive electric field. The results of the DFT
Adsorption of gas molecules on Ga-doped graphene and effect of applied electric field: A DFT study
International Nuclear Information System (INIS)
Liang, Xiong-Yi; Ding, Ning; Ng, Siu-Pang; Wu, Chi-Man Lawrence
2017-01-01
Highlights: • H_2O, NH_3, CO, NO_2 and NO are physically adsorbed on pristine graphene. • The adsorption energies of all gas molecules on graphene are increased after doping with Ga. • NO_2 shows the strongest affinity to Ga-doped graphene. • The electronic properties and adsorption of NO_2 on graphene and can be effectively tuned using an external electric field. - Abstract: Density functional theory calculations have been carried out to study the adsorption of varous gas molecules (H_2O, NH_3, CO, NO_2 and NO) on pristine graphene and Ga-doped graphene in order to explore the feasibility of Ga-doped graphene based gas sensor. For each gas molecule, various adsorption positions and orientations were considered. The most stable configuration was determined and the adsorption energies with van der Waals interactions were calculated. Further, electronic properties such as electron density, density of states, charge transfer and band structure were investigated to understand the mechanism of adsorption. The results showed that the gas molecules studied were only weakly adsorbed on pristine graphene with small adsorption energies. On the other hand, the adsorption energies of all gas molecules on Ga-doped graphene increased by various amounts. Adsorption of gas molecules on Ga-doped graphene can open a relatively large band gap ranging from 0.267 to 0.397 eV. NO_2 was found to be very sensitive to Ga-doped graphene with adsorption energy of −1.928 eV due to strong orbital hybridization and large charge transfer. Furthermore, our study suggests that the affinity and electronic properties of NO_2 on Ga-doped graphene can be dramatically changed by an external electric field. A negative electric field enhances the adsorption of NO_2 on Ga-doped graphene as reflected in the increase in adsorption energy. In contrast, the interaction will be weakened under a positive electric field. The results of the DFT calculation indicates the potential application of Ga
Detecting groups of coevolving positions in a molecule: a clustering approach
Directory of Open Access Journals (Sweden)
Galtier Nicolas
2007-11-01
Full Text Available Abstract Background Although the patterns of co-substitutions in RNA is now well characterized, detection of coevolving positions in proteins remains a difficult task. It has been recognized that the signal is typically weak, due to the fact that (i amino-acid are characterized by various biochemical properties, so that distinct amino acids changes are not functionally equivalent, and (ii a given mutation can be compensated by more than one mutation, at more than one position. Results We present a new method based on phylogenetic substitution mapping. The two above-mentioned problems are addressed by (i the introduction of a weighted mapping, which accounts for the biochemical effects (volume, polarity, charge of amino-acid changes, (ii the use of a clustering approach to detect groups of coevolving sites of virtually any size, and (iii the distinction between biochemical compensation and other coevolutionary mechanisms. We apply this methodology to a previously studied data set of bacterial ribosomal RNA, and to three protein data sets (myoglobin of vertebrates, S-locus Receptor Kinase and Methionine Amino-Peptidase. Conclusion We succeed in detecting groups of sites which significantly depart the null hypothesis of independence. Group sizes range from pairs to groups of size ≃ 10, depending on the substitution weights used. The structural and functional relevance of these groups of sites are assessed, and the various evolutionary processes potentially generating correlated substitution patterns are discussed.
Equilibrium configurations of tripolar charges
International Nuclear Information System (INIS)
Yershov, V.N.
2005-01-01
It is shown that an ensemble of particles with tripolar (color) charges will necessarily cohere in a hierarchy of structures, from simple clusters and strings to complex aggregates and cyclic molecule-like structures. The basic combinatoric rule remains essentially the same on different levels of the hierarchy, thus leading to a pattern of resemblance between different levels. The number of primitive charges in each structure is determined by the symmetry of the combined effective potential of this structure. The outlined scheme can serve as a framework for building a model of composite fundamental fermions. (author)
Sin, Jun-Sik
2017-12-01
In this paper, we study electrostatic properties between two similar or oppositely charged surfaces immersed in an electrolyte solution by using the mean-field approach accounting for solvent polarization and non-uniform size effects. Applying a free energy formalism accounting for unequal ion sizes and orientational ordering of water dipoles, we derive coupled and self-consistent equations to calculate electrostatic properties between charged surfaces. Electrostatic properties for similarly charged surfaces depend on the counterion size but not on the coion size. Moreover, electrostatic potential and osmotic pressure between similarly charged surfaces are found to be increased with increasing counterion size. On the other hand, the corresponding ones between oppositely charged surfaces are related to both sizes of positive and negative ions. For oppositely charged surfaces, the electrostatic potential, number density of solvent molecules, and relative permittivity of an electrolyte having unequal ion sizes are not symmetric about the centerline between the charged surfaces. For either case, the consideration of solvent polarization results in a decrease in the electrostatic potential and the osmotic pressure compared to the case without the effect.
Calculations on Electron Capture in Low Energy Ion-Molecule Collisions
Energy Technology Data Exchange (ETDEWEB)
Stancil, P.C. [Oak Ridge National Lab., TN (United States); Zygelman, B. [W.M. Keck Lab. for Computational Physics, Univ. of Nevada, Las Vegas, NV (United States); Kirby, K. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA (United States)
1997-12-31
Recent progress on the application of a quantal, molecular-orbital, close-coupling approach to the calculation of electron capture in collisions of multiply charged ions with molecules is discussed. Preliminary results for single electron capture by N{sup 2+} with H{sub 2} are presented. Electron capture by multiply charged ions colliding with H{sub 2} is an important process in laboratory and astrophysical plasmas. It provides a recombination mechanism for multiply charged ions in x-ray ionized astronomical environments which may have sparse electron and atomic hydrogen abundances. In the divertor region of a tokamak fusion device, charge exchange of impurity ions with H{sub 2} plays a role in the ionization balance and the production of radiative energy loss leading to cooling, X-ray and ultraviolet auroral emission from Jupiter is believed to be due to charge exchange of O and S ions with H{sub 2} in the Jovian atmosphere. Solar wind ions interacting with cometary molecules may have produced the x-rays observed from Comet Hyakutake. In order to model and understand the behavior of these environments, it is necessary to obtain total, electronic state-selective (ESS), and vibrational (or rotational) state-selective (VSS) capture cross sections for collision energies as low as 10 meV/amu to as high as 100 keV/amu in some instances. Fortunately, charge transfer with molecular targets has received considerable experimental attention. Numerous measurements have been made with flow tubes, ion traps, and ion beams. Flow tube and ion trap studies generally provide information on rate coefficients for temperatures between 800 K and 20,000 K. In this article, we report on the progress of our group in implementing a quantum-mechanical Molecular Orbital Close Coupling (MOCC) approach to the study of electron capture by multiply charged ions in collisions with molecules. We illustrate this with a preliminary investigation of Single Electron Capture (SEC) by N{sup 2+} with H
International Nuclear Information System (INIS)
Dey, T.K.; Bindal, R.C.; Prabhakar, S.; Tewari, P.K.
2010-01-01
A new, positively charged, thin film composite (TFC) type nanofiltration membrane has been developed and studied for its use in various aqueous stream separations. The membrane, containing fixed quaternary ammonium moieties, was developed by insitu interfacial polymerization of a functionalized amine (polyethyleneimine) and terephthaloyl chloride on a suitable base membrane. The nature of the charge on the membrane was established by ATR FT IR spectroscopy and was estimated by determination of its ion exchange capacity. The membrane was tested for its performance in single solute feed systems containing salts of various combinations of univalent and bivalent ions (NaCl, Na 2 SO 4 , CaCl 2 and MgSO 4 ) in test cell as well as in 2512 spiral modules. The membrane gave differential separation profile for these solutes with high rejection for CaCl 2 and low rejection for Na 2 SO 4 due to positive charge on the membrane and the type of charge constituting the salts. The membrane was also used for separation of simulated effluent solution containing uranyl nitrate in combination with ammonium nitrate which is a common effluent generated in nuclear industry. Here also the membrane gave differential separation profile for uranyl nitrate and ammonium nitrate in their mixture by concentrating the former salt and passing the later. This helped separation of these two solutes in the mixture into two different streams. (author)
Surface Charge Transfer Doping of Monolayer Phosphorene via Molecular Adsorption.
He, Yuanyuan; Xia, Feifei; Shao, Zhibin; Zhao, Jianwei; Jie, Jiansheng
2015-12-03
Monolayer phosphorene has attracted much attention owing to its extraordinary electronic, optical, and structural properties. Rationally tuning the electrical transport characteristics of monolayer phosphorene is essential to its applications in electronic and optoelectronic devices. Herein, we study the electronic transport behaviors of monolayer phosphorene with surface charge transfer doping of electrophilic molecules, including 2,3,5,6-tetrafluoro-7,7,8,8-tetracyanoquinodimethane (F4TCNQ), NO2, and MoO3, using density functional theory combined with the nonequilibrium Green's function formalism. F4TCNQ shows optimal performance in enhancing the p-type conductance of monolayer phosphorene. Static electronic properties indicate that the enhancement is originated from the charge transfer between adsorbed molecule and phosphorene layer. Dynamic transport behaviors demonstrate that additional channels for hole transport in host monolayer phosphorene were generated upon the adsorption of molecule. Our work unveils the great potential of surface charge transfer doping in tuning the electronic properties of monolayer phosphorene and is of significance to its application in high-performance devices.
Electrostatic Charging and Particle Interactions in Microscopic Insulating Grains
Lee, Victor
In this thesis, we experimentally investigate the electrostatic charging as well as the particle interactions in microscopic insulating grains. First, by tracking individual grains accelerated in an electric field, we quantitatively demonstrate that tribocharging of same-material grains depends on particle size. Large grains tend to charge positively, and small ones tend to charge negatively. Theories based on the transfer of trapped electrons can explain this tendency but have not been validated. Here we show that the number of trapped electrons, measured independently by a thermoluminescence technique, is orders of magnitude too small to be responsible for the amount of charge transferred. This result reveals that trapped electrons are not responsible for same-material tribocharging of dielectric particles. Second, same-material tribocharging in grains can result in important long-range electrostatic interactions. However, how these electrostatic interactions contribute to particle clustering remains elusive, primarily due to the lack of direct, detailed observations. Using a high-speed camera that falls with a stream charged grains, we observe for the first time how charged grains can undergo attractive as well as repulsive Kepler-like orbits. Charged particles can be captured in their mutual electrostatic potential and form clusters via multiple bounces. Dielectric polarization effects are directly observed, which lead to additional attractive forces and stabilize "molecule-like" arrangements of charged particles. Third, we have developed a new method to study the charge transfer of microscopic particles based on acoustic levitation techniques. This method allows us to narrow the complex problem of many-particle charging down to precise charge measurements of a single sub-millimeter particle colliding with a target plate. By simply attaching nonpolar groups onto glass surfaces, we show that the contact charging of a particle is highly dependent on
Latychevskaia, Tatiana; Wicki, Flavio; Longchamp, Jean-Nicolas; Escher, Conrad; Fink, Hans-Werner
2016-09-14
Visualizing individual charges confined to molecules and observing their dynamics with high spatial resolution is a challenge for advancing various fields in science, ranging from mesoscopic physics to electron transfer events in biological molecules. We show here that the high sensitivity of low-energy electrons to local electric fields can be employed to directly visualize individual charged adsorbates and to study their behavior in a quantitative way. This makes electron holography a unique probing tool for directly visualizing charge distributions with a sensitivity of a fraction of an elementary charge. Moreover, spatial resolution in the nanometer range and fast data acquisition inherent to lens-less low-energy electron holography allows for direct visual inspection of charge transfer processes.
Radiocarbon positive-ion mass spectrometry
Energy Technology Data Exchange (ETDEWEB)
Freeman, Stewart P.H.T.; Shanks, Richard P. [Scottish Universities Environmental Research Centre (SUERC), Scottish Enterprise Technology Park, East Kilbride G75 0QF (United Kingdom); Donzel, Xavier; Gaubert, Gabriel [Pantechnik S.A., 13 Rue de la Résistance, 14400 Bayeux (France)
2015-10-15
Proof-of-principle of a new mass spectrometric technique for radiocarbon measurement is demonstrated. Interfering nitrogen and hydrocarbon molecules are largely eliminated in a charge-exchange cell operating on non-metallic gas. The positive-to-negative ion conversion is the reverse of that conventionally used in accelerator mass spectrometry (AMS) and is compatible with plasma ion sources that may be significantly more efficient and capable of greater output than are AMS sputter ion sources. The Nanogan electron cyclotron resonance (ECR) ion source employed exhibited no sample memory and the >50 kyrs age range of AMS was reproduced. A bespoke prototype new instrument is now required to optimise the plasma and cell physics and to realise hypothetical performance gains over AMS.
Radiocarbon positive-ion mass spectrometry
International Nuclear Information System (INIS)
Freeman, Stewart P.H.T.; Shanks, Richard P.; Donzel, Xavier; Gaubert, Gabriel
2015-01-01
Proof-of-principle of a new mass spectrometric technique for radiocarbon measurement is demonstrated. Interfering nitrogen and hydrocarbon molecules are largely eliminated in a charge-exchange cell operating on non-metallic gas. The positive-to-negative ion conversion is the reverse of that conventionally used in accelerator mass spectrometry (AMS) and is compatible with plasma ion sources that may be significantly more efficient and capable of greater output than are AMS sputter ion sources. The Nanogan electron cyclotron resonance (ECR) ion source employed exhibited no sample memory and the >50 kyrs age range of AMS was reproduced. A bespoke prototype new instrument is now required to optimise the plasma and cell physics and to realise hypothetical performance gains over AMS.
Mobility of charge carriers in porous silicon layers
International Nuclear Information System (INIS)
Forsh, P. A.; Martyshov, M. N.; Latysheva, A. P.; Vorontsov, A. S.; Timoshenko, V. Yu.; Kashkarov, P. K.
2008-01-01
The (conduction) mobility of majority charge carriers in porous silicon layers of the n and p types is estimated by joint measurements of electrical conductivity and free charge carrier concentration, which is determined from IR absorption spectra. Adsorption of donor and acceptor molecules leading to a change in local electric fields in the structure is used to identify the processes controlling the mobility in porous silicon. It is found that adsorption of acceptor and donor molecules at porous silicon of the p and n types, respectively, leads to a strong increase in electrical conductivity, which is associated with an increase in the concentration of free carrier as well as in their mobility. The increase in the mobility of charge carriers as a result of adsorption indicates the key role of potential barriers at the boundaries of silicon nanocrystals and may be due to a decrease in the barrier height as a result of adsorption
Molecular spintronics using single-molecule magnets
Bogani, Lapo; Wernsdorfer, Wolfgang
2008-03-01
A revolution in electronics is in view, with the contemporary evolution of the two novel disciplines of spintronics and molecular electronics. A fundamental link between these two fields can be established using molecular magnetic materials and, in particular, single-molecule magnets. Here, we review the first progress in the resulting field, molecular spintronics, which will enable the manipulation of spin and charges in electronic devices containing one or more molecules. We discuss the advantages over more conventional materials, and the potential applications in information storage and processing. We also outline current challenges in the field, and propose convenient schemes to overcome them.
Effect of scanning in the supine and prone positions on dilation of air-charged colon in CTVC
International Nuclear Information System (INIS)
Ye Jing; Chen Junkun; Zhang Zongjun; Wang Junpeng; Gao Dazhi
2003-01-01
Objective: To evaluate the effect of scanning in the supine and prone positions on dilation of air-charged colon in CT virtual colonoscopy (CTVC). Methods: Thirty cases underwent CTVC scanning in both the supine and prone positions immediately before colonoscopy, and the dilation of each intestine was graded. The differences of colon dilation in different positions were compared. Results: In supine and prone position, there were 26 (17.3%) and 22 (14.7%) insufficient dilating colon segments, respectively, and only 5 (3.3%) insufficient dilating colon segments in double positions. 15(50.0%) and 13(43.3%) colons dilated insufficiently in supine and prone position, respectively, and decreased to 5 (16.7%) in double positions. The dilation of rectum, sigmoid colon, and transverse colon had significant difference in different positions. Conclusion: When performing CTVC, it is highly necessary to scan in both the supine and prone positions in order to ensure the sufficient dilation of colon. In supine position, the dilation of transverse colon is better, while the dilation of rectum and sigmoid colon in prone position is superior to that in supine position
Design study of beam position monitors for measuring second-order moments of charged particle beams
Yanagida, Kenichi; Suzuki, Shinsuke; Hanaki, Hirofumi
2012-01-01
This paper presents a theoretical investigation on the multipole moments of charged particle beams in two-dimensional polar coordinates. The theoretical description of multipole moments is based on a single-particle system that is expanded to a multiparticle system by superposition, i.e., summing over all single-particle results. This paper also presents an analysis and design method for a beam position monitor (BPM) that detects higher-order (multipole) moments of a charged particle beam. To calculate the electric fields, a numerical analysis based on the finite difference method was created and carried out. Validity of the numerical analysis was proven by comparing the numerical with the analytical results for a BPM with circular cross section. Six-electrode BPMs with circular and elliptical cross sections were designed for the SPring-8 linac. The results of the numerical calculations show that the second-order moment can be detected for beam sizes ≧420μm (circular) and ≧550μm (elliptical).
Oppositely charged colloids out of equilibrium
Vissers, T.
2010-11-01
Colloids are particles with a size in the range of a few nanometers up to several micrometers. Similar to atomic and molecular systems, they can form gases, liquids, solids, gels and glasses. Colloids can be used as model systems because, unlike molecules, they are sufficiently large to be studied directly with light microscopy and move sufficiently slow to study their dynamics. In this thesis, we study binary systems of polymethylmethacrylate (PMMA) colloidal particles suspended in low-polar solvent mixtures. Since the ions can still partially dissociate, a surface charge builds up which causes electrostatic interactions between the colloids. By carefully tuning the conditions inside the suspension, we make two kinds of particles oppositely charged. To study our samples, we use Confocal Laser Scanning Microscopy (CLSM). The positively and negatively charged particles can be distinguished by a different fluorescent dye. Colloids constantly experience a random motion resulting from random kicks of surrounding solvent molecules. When the attractions between the oppositely charged particles are weak, the particles can attach and detach many times and explore a lot of possible configurations and the system can reach thermodynamic equilibrium. For example, colloidal ‘ionic’ crystals consisting of thousands to millions of particles can form under the right conditions. When the attractions are strong, the system can become kinetically trapped inside a gel-like state. We observe that when the interactions change again, crystals can even emerge again from this gel-like phase. By using local order parameters, we quantitatively study the crystallization of colloidal particles and identify growth defects inside the crystals. We also study the effect of gravity on the growth of ionic crystals by using a rotating stage. We find that sedimentation can completely inhibit crystal growth and plays an important role in crystallization from the gel-like state. The surface
Profiles of equilibrium constants for self-association of aromatic molecules.
Beshnova, Daria A; Lantushenko, Anastasia O; Davies, David B; Evstigneev, Maxim P
2009-04-28
Analysis of the noncovalent, noncooperative self-association of identical aromatic molecules assumes that the equilibrium self-association constants are either independent of the number of molecules (the EK-model) or change progressively with increasing aggregation (the AK-model). The dependence of the self-association constant on the number of molecules in the aggregate (i.e., the profile of the equilibrium constant) was empirically derived in the AK-model but, in order to provide some physical understanding of the profile, it is proposed that the sources for attenuation of the equilibrium constant are the loss of translational and rotational degrees of freedom, the ordering of molecules in the aggregates and the electrostatic contribution (for charged units). Expressions are derived for the profiles of the equilibrium constants for both neutral and charged molecules. Although the EK-model has been widely used in the analysis of experimental data, it is shown in this work that the derived equilibrium constant, K(EK), depends on the concentration range used and hence, on the experimental method employed. The relationship has also been demonstrated between the equilibrium constant K(EK) and the real dimerization constant, K(D), which shows that the value of K(EK) is always lower than K(D).
DEFF Research Database (Denmark)
Bjørnholm, Thomas
2010-01-01
Bianthrone is a sterically hindered compound that exists in the form of two nonplanar isomers. Our experimental study of single-molecule junctions with bianthrone reveals persistent switching of electric conductance at low temperatures, which can be reasonably associated with molecular isomerizat...
Biradical and triradical organic magnetic molecules as spin filters and rectifiers
Energy Technology Data Exchange (ETDEWEB)
Zhu, L. [School of Physics, School of Optoelectronics Science and Engineering, Wuhan Pulsed Magnetic Field Center, Huazhong University of Science and Technology, Wuhan 430074 (China); Yao, K.L., E-mail: klyao@hust.edu.cn [School of Physics, School of Optoelectronics Science and Engineering, Wuhan Pulsed Magnetic Field Center, Huazhong University of Science and Technology, Wuhan 430074 (China); International Center of Materials Physics, Chinese Academy of Science, Shengyang 110015 (China); Liu, Z.L. [School of Physics, School of Optoelectronics Science and Engineering, Wuhan Pulsed Magnetic Field Center, Huazhong University of Science and Technology, Wuhan 430074 (China)
2012-03-13
Graphical abstract: (a) Negative differential resistance (NDR) characteristic and antiparallel spin-current (ASC) rectification; (b) spin-current (SC) rectification and charge-current (CC) rectification properties Display Omitted Highlights: Black-Right-Pointing-Pointer Organic magnetic molecules at gold electrodes as spin/charge rectifier. Black-Right-Pointing-Pointer Spin diode/rectification stems from length and asymmetry of molecular framework. Black-Right-Pointing-Pointer Negative differential resistance, spin-filtering and switching evidenced. - Abstract: We have theoretically investigated the spin-polarized transport properties of molecular junctions consisting of biradical and triradical organic magnetic molecules sandwiched between two symmetric gold electrodes, respectively. It shows that these junctions function as a spin rectifier or a combination of spin and charge rectifiers with high spin rectification ratios exceeding 100, wherein the spin diode/rectification effect stems from the conjugated length and asymmetry of the molecular framework, which is the pre-requisite for electronic asymmetry of the adsorbed species. The negative differential resistance, spin-filtering and switching properties are also unveiled. In particular, it is revealed that the strong couplings between the electrodes and molecules are responsible for the negative differential resistance.
Adsorption of CO molecules on doped graphene: A first-principles study
Directory of Open Access Journals (Sweden)
Weidong Wang
2016-02-01
Full Text Available As a typical kinds of toxic gases, CO plays an important role in environmental monitoring, control of chemical processes, space missions, agricultural and medical applications. Graphene is considered a potential candidate of gases sensor, so the adsorption of CO molecules on various graphene, including pristine graphene, Nitrogen-doped graphene (N-doped graphene and Aluminum-doped graphene (Al-doped graphene, are studied by using first-principles calculations. The optimal configurations, adsorption energies, charge transfer, and electronic properties including band structures, density of states and differential charge density are obtained. The adsorption energies of CO molecules on pristine graphene and N-doped graphene are −0.01 eV, and −0.03 eV, respectively. In comparison, the adsorption energy of CO on Al-doped graphene is much larger, −2.69 eV. Our results also show that there occurs a large amount of charge transfer between CO molecules and graphene sheet after the adsorption, which suggests Al-doped graphene is more sensitive to the adsorption of CO than pristine graphene and N-doped graphene. Therefore, the sensitivity of gases on graphene can be drastically improved by introducing the suitable dopants.
International Nuclear Information System (INIS)
Landers, A.L.; Alnaser, A.S.; Tanis, J.A.; Wells, E.; Osipov, T.; Carnes, K.D.; Ben-Itzhak, I.; Cocke, C.L.; McGuire, J.H.
2004-01-01
Cross sections differential in target orientation angle were measured for 19 MeV F 8+ +D 2 collisions. Multihit position-sensitive detectors were used to isolate the double-ionization channel and determine a posteriori the full momentum vectors of both ejected D + fragments. A strong dependence of the double ionization cross section on the angle between the incident ion direction and the target molecular axis is observed with a ≅3.5:1 enhancement for molecules aligned perpendicular to the projectile axis. This clear asymmetry is attributed to interference effects, analogous to Young's two-slit experiment, arising from coherent contributions to the ionization from both atomic centers. The data are compared to a simple scattering model based on two center interference
Yu, Shi; Li, Ming-Hsin; Choi, Seok Ki; Baker, James R; Larson, Ronald G
2013-09-03
The ability of poly(amido amine) (or PAMAM) dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5) dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.
Directory of Open Access Journals (Sweden)
Ronald G. Larson
2013-09-01
Full Text Available The ability of poly(amido amine (or PAMAM dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5 dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.
International Nuclear Information System (INIS)
Ho, Minhhuy; Schmider, H.; Edgecombe, K.E.
1994-01-01
Topological properties of the charge density p(→) of a series of diatomic molecules, as well as ethane, ethene, and acetylene are calculated at the Hartree-Fock level employing various basis sets, and by the AM1 method. The effect of the core orbitals on the bonding regions in these molecules is examined. The results help to evaluate the utility of AM1 wavefunctions for analyzing the topological properties of the charge density
Position dependence of charge collection in prototype sensors for the CMS pixel detector
Rohe, Tilman; Chiochia, Vincenzo; Cremaldi, Lucien M; Cucciarelli, Susanna; Dorokhov, Andrei; Konecki, Marcin; Prokofiev, Kirill; Regenfus, Christian; Sanders, David A; Son Seung Hee; Speer, Thomas; Swartz, Morris
2004-01-01
This paper reports on the sensor R&D activity for the CMS pixel detector. Devices featuring several design and technology options have been irradiated up to a proton fluence1 of 1 multiplied by 10**1**5 n //e//q/cm**2 at the CERN PS. Afterward, they were bump bonded to unirradiated readout chips and tested using high energy pions in the H2 beam line of the CERN SPS. The readout chip allows a nonzero suppressed full analogue readout and therefore a good characterization of the sensors in terms of noise and charge collection properties. The position dependence of signal is presented and the differences between the two sensor options are discussed. 20 Refs.
Adsorption of cations onto positively charged surface mesopores.
Neue, Uwe; Iraneta, Pamela; Gritti, Fabrice; Guiochon, Georges
2013-11-29
Uwe Neue developed a theoretical treatment to account for the adsorption of ions on mesopores of packing materials the walls of which are bonded to ionic ligands but left this work unfinished. We elaborated upon this treatment and refined it, based on the equivalence that he suggested between charged surface particles and a membrane that separates two ionic solutions but is impermeable to one specification. He had written that the electro-chemical potentials in both ionic solutions are equal (Donnan equilibrium). The equilibrium between the surface and the pore concentrations is accounted for by an homogeneous electrostatically modified Langmuir (EML) isotherm model. The theoretical results are presented for four different charge surface concentrations σ0=0, 0.001, 0.002, and 0.003C/m(2), using a phosphate buffer (W(S)pH=2.65) of ionic strength I=10mM. The average pore size, the specific surface area, and the specific pore volume of the stationary phase were Dp=140Å, Sp=182m(2)/g, and Vp=0.70cm(3)/g, respectively. The theoretical results provide the quantitative difference between the ionic strength, the pH, and the concentrations of all the ions in the pores and in the bulk eluent. The theory predicts (1) that the retention times of cations under linear conditions is lower and (2) that their band widths under overloaded conditions for a given retention factor shrinks when the surface charge density σ0 is increased. These theoretical results are in good agreement with experimental results published previously and explain them. Copyright © 2013 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Turner, R.E.
1984-01-01
A search was made for fractional charges of the form Z plus two-thirds e, where Z is an integer. It was assumed that the charges exist in natural form bound with other fractional charges in neutral molecules. It was further assumed that these neutral molecules are present in air. Two concentration schemes were employed. One sample was derived from the waste gases from a xenon distillation plant. This assumes that high mass, low vapor pressure components of air are concentrated along with the xenon. The second sample involved ionizing air, allowing a brief recombination period, and then collecting residual ions on the surface of titanium discs. Both samples were analyzed at the University of Rochester in a system using a tandem Van de Graff to accelerate particles through an essentially electrostatic beam handling system. The detector system employed both a Time of Flight and an energy-sensitive gas ionization detector. In the most sensitive mode of analysis, a gas absorber was inserted in the beam path to block the intense background. The presence of an absorber limited the search to highly penetrating particles. Effectively, this limited the search to particles with low Z and masses greater than roughly fifty GeV. The final sensitivities attained were on the order of 1 x 10 -20 for the ionized air sample and 1 x 10 -21 for the gas sample. A discussion of the caveats that could reduce the actual level of sensitivity is included
Single Molecule Conductance of Oligothiophene Derivatives
Dell, Emma J.
to sample similar conformers. This work demonstrates that the conductance of bithiophene displays a strong dependence on the conformational fluctuations accessible within a given junction configuration, and that the symmetry of such small molecules can significantly influence their conductance behavior. Next, the single-molecule conductance of a family of oligothiophenes comprising one to six thiophene units was measured. An anomalous behavior was found: the peak of the conductance histogram distribution did not follow a clear exponential decay with increasing number of thiophene units in the chain. The electronic properties of the materials were characterized by optical spectroscopy and electrochemistry to gain an understanding of the factors affecting the conductance of these molecules. Different conformers in the junction were postulated to be a contributing factor to the anomalous trend in the observed conductance as a function of molecule length. Then, the electronic properties of the thiophene-1,1-dioxide unit were investigated. These motifs have become synthetically accessible in the last decade, due to Rozen's unprecedentedly potent oxidizing reagent - HOF˙CH 3CN - which has been shown to be powerful yet selective enough to oxidize thiophenes in various environments. The resulting thiophene-1,1-dioxides show great promise for electronic devices. The oxidation chemistry of thiophenes was expanded and tuning of the frontier energy levels was demonstrated through combining electron poor and electron rich units. Finally, charge carriers in single-molecule junctions were shown to be tunable within a family of molecules containing these thiophene-1,1-dioxide (TDO) building blocks. Oligomers of TDO were designed in order to increase electron affinity, maintain delocalized frontier orbitals, while significantly decreasing the transport gap. Through thermopower measurements, the dominant charge carriers were shown to change from holes to electrons as the number of
McEntee, Monica; Stevanovic, Ana; Tang, Wenjie; Neurock, Matthew; Yates, John T
2015-02-11
Infrared (IR) studies of Au/TiO2 catalyst particles indicate that charge transfer from van der Waals-bound donor or acceptor molecules on TiO2 to or from Au occurs via transport of charge carriers in the semiconductor TiO2 support. The ΔνCO on Au is shown to be proportional to the polarizability of the TiO2 support fully covered with donor or acceptor molecules, producing a proportional frequency shift in νCO. Charge transfer through TiO2 is associated with the population of electron trap sites in the bandgap of TiO2 and can be independently followed by changes in photoluminescence intensity and by shifts in the broad IR absorbance region for electron trap sites, which is also proportional to the polarizability of donors by IR excitation. Density functional theory calculations show that electron transfer from the donor molecules to TiO2 and to supported Au particles produces a negative charge on the Au, whereas the transfer from the Au particles to the TiO2 support into acceptor molecules results in a positive charge on the Au. These changes along with the magnitudes of the shifts are consistent with the Stark effect. A number of experiments show that the ∼3 nm Au particles act as "molecular voltmeters" in influencing ΔνCO. Insulator particles, such as SiO2, do not display electron-transfer effects to Au particles on their surface. These studies are preliminary to doping studies of semiconductor-oxide particles by metal ions which modify Lewis acid/base oxide properties and possibly strongly modify the electron-transfer and catalytic activity of supported metal catalyst particles.
Islam, Nazmul; Ghosh, Dulal C
2012-01-01
Electrophilicity is an intrinsic property of atoms and molecules. It probably originates logistically with the involvement in the physical process of electrostatics of soaked charge in electronic shells and the screened nuclear charge of atoms. Motivated by the existing view of conceptual density functional theory that similar to electronegativity and hardness equalization, there should be a physical process of equalization of electrophilicity during the chemical process of formation of hetero nuclear molecules, we have developed a new theoretical scheme and formula for evaluating the electrophilicity of hetero nuclear molecules. A comparative study with available bench marking reveals that the hypothesis of electrophilicity and equalization, and the present method of evaluating equalized electrophilicity, are scientifically promising.
Directory of Open Access Journals (Sweden)
Dulal C. Ghosh
2012-02-01
Full Text Available Electrophilicity is an intrinsic property of atoms and molecules. It probably originates logistically with the involvement in the physical process of electrostatics of soaked charge in electronic shells and the screened nuclear charge of atoms. Motivated by the existing view of conceptual density functional theory that similar to electronegativity and hardness equalization, there should be a physical process of equalization of electrophilicity during the chemical process of formation of hetero nuclear molecules, we have developed a new theoretical scheme and formula for evaluating the electrophilicity of hetero nuclear molecules. A comparative study with available bench marking reveals that the hypothesis of electrophilicity and equalization, and the present method of evaluating equalized electrophilicity, are scientifically promising.
Salvat, Francesc; Jablonski, Aleksander; Powell, Cedric J.
2005-01-01
The FORTRAN 77 code system ELSEPA for the calculation of elastic scattering of electrons and positrons by atoms, positive ions and molecules is presented. These codes perform relativistic (Dirac) partial-wave calculations for scattering by a local central interaction potential V(r). For atoms and ions, the static-field approximation is adopted, with the potential set equal to the electrostatic interaction energy between the projectile and the target, plus an approximate local exchange interaction when the projectile is an electron. For projectiles with kinetic energies up to 10 keV, the potential may optionally include a semiempirical correlation-polarization potential to describe the effect of the target charge polarizability. Also, for projectiles with energies less than 1 MeV, an imaginary absorptive potential can be introduced to account for the depletion of the projectile wave function caused by open inelastic channels. Molecular cross sections are calculated by means of a single-scattering independent-atom approximation in which the electron density of a bound atom is approximated by that of the free neutral atom. Elastic scattering by individual atoms in solids is described by means of a muffin-tin model potential. Partial-wave calculations are feasible on modest personal computers for energies up to about 5 MeV. The ELSEPA code also implements approximate factorization methods that allow the fast calculation of elastic cross sections for much higher energies. The interaction model adopted in the calculations is defined by the user by combining the different options offered by the code. The nuclear charge distribution can be selected among four analytical models (point nucleus, uniformly charged sphere, Fermi's distribution and Helm's uniform-uniform distribution). The atomic electron density is handled in numerical form. The distribution package includes data files with electronic densities of neutral atoms of the elements hydrogen to lawrencium ( Z=1
Tunnel magnetoresistance of magnetic molecules with spin-vibron coupling
Directory of Open Access Journals (Sweden)
Ahmed Kenawy
2017-05-01
Full Text Available The effect of molecular vibrations on the tunnel magnetoresistance (TMR of a magnetic tunnel junction with a single spin-anisotropic molecule interconnecting its electrodes is investigated theoretically. We demonstrate that if these vibrations couple at the same time to the charge of tunneling electrons and to the spin of the molecule, the spin anisotropy of such a molecule becomes enhanced. This has, in turn, a profound impact on the TMR of such a device showing that molecular vibrations lead to a significant change of spin-polarized transport, differing for the parallel and antiparallel magnetic configuration of the junction.
Physical stage of photosynthesis charge separation
Yakovlev, A. G.; Shuvalov, V. A.
2016-06-01
An analytical review is given concerning the biophysical aspects of light-driven primary charge separation in photosynthesis reaction centers (RCs) which are special pigment-protein complexes residing in a cell membrane. The primary (physical) stage of charge separation occurs in the pico- and femtosecond ranges and consists of transferring an electron along the active A-branch of pigments. The review presents vast factual material on both the general issues of primary photosynthesis and some more specific topics, including (1) the role of the inactive B-branch of pigments, (2) the effect of the protein environment on the charge separation, and (3) the participation of monomeric bacteriochlorophyll BA in primary electron acceptance. It is shown that the electron transfer and stabilization are strongly influenced by crystallographic water and tyrosine M210 molecules from the nearest environment of BA. A linkage between collective nuclear motions and electron transfer upon charge separation is demonstrated. The nature of the high quantum efficiency of primary charge separation reactions is discussed.
Koole, Max; Thijssen, Jos M.; Valkenier, Hennie; Hummelen, Jan C.; van der Zant, Herre S. J.
It is understood that molecular conjugation plays an important role in charge transport through single-molecule junctions. Here, we investigate electron transport through an anthraquinone based single-molecule three-terminal device. With the use of an electric-field induced by a gate electrode, the
Freund, Friedemann T.; Freund, Minoru M.
2012-01-01
The prevailing view in the geophysics community is that the electrical conductivity structure of the Earth's continental crust over the 5-35 km depth range can best be understood by assuming the presence of intergranular fluids and/or of intragranular carbon films. Based on single crystal studies of melt-grown MgO, magma-derived sanidine and anorthosite feldspars and upper mantle olivine, we present evidence for the presence of electronic charge carriers, which derive from peroxy defects that are introduced during cooling, under non-equilibrium conditions, through a redox conversion of pairs of solute hydroxyl arising from dissolution of H2O.The peroxy defects become thermally activated in a 2-step process, leading to the release of defect electrons in the oxygen anion sublattice. Known as positive holes and symbolized by h(dot), these electronic charge carriers are highly mobile. Chemically equivalent to O(-) in a matrix of O(2-) they are highly oxidizing. Being metastable they can exist in the matrix of minerals, which crystallized in highly reduced environments. The h(dot) are highly mobile. They appear to control the electrical conductivity of crustal rocks in much of the 5-35 km depth range.
Malm, Magdalena; Kronqvist, Nina; Lindberg, Hanna; Gudmundsdotter, Lindvi; Bass, Tarek; Frejd, Fredrik Y; Höidén-Guthenberg, Ingmarie; Varasteh, Zohreh; Orlova, Anna; Tolmachev, Vladimir; Ståhl, Stefan; Löfblom, John
2013-01-01
The HER3 receptor is implicated in the progression of various cancers as well as in resistance to several currently used drugs, and is hence a potential target for development of new therapies. We have previously generated Affibody molecules that inhibit heregulin-induced signaling of the HER3 pathways. The aim of this study was to improve the affinity of the binders to hopefully increase receptor inhibition efficacy and enable a high receptor-mediated uptake in tumors. We explored a novel strategy for affinity maturation of Affibody molecules that is based on alanine scanning followed by design of library diversification to mimic the result from an error-prone PCR reaction, but with full control over mutated positions and thus less biases. Using bacterial surface display and flow-cytometric sorting of the maturation library, the affinity for HER3 was improved more than 30-fold down to 21 pM. The affinity is among the higher that has been reported for Affibody molecules and we believe that the maturation strategy should be generally applicable for improvement of affinity proteins. The new binders also demonstrated an improved thermal stability as well as complete refolding after denaturation. Moreover, inhibition of ligand-induced proliferation of HER3-positive breast cancer cells was improved more than two orders of magnitude compared to the previously best-performing clone. Radiolabeled Affibody molecules showed specific targeting of a number of HER3-positive cell lines in vitro as well as targeting of HER3 in in vivo mouse models and represent promising candidates for future development of targeted therapies and diagnostics.
Single-molecule conductance of redox molecules in electrochemical scanning tunneling microscopy
DEFF Research Database (Denmark)
Haiss, W.; Albrecht, Tim; van Zalinge, H.
2007-01-01
of a maximum in the I-tunneling versus electrode potential relationship can be fitted by a "soft" gating concept. This arises from large configurational fluctuations of the molecular bridge linked to the gold contacts by flexible chains. This view is incorporated in a formalism that is well-suited for data...... analysis and reproduces in all important respects the 6V6 data for physically sound values of the appropriate parameters. This study demonstrates that fluctuations of isolated configurationally "soft" molecules can dominate charge transport patterns and that theoretical frameworks for compact monolayers...
Charge patterns as templates for the assembly of layered biomolecular structures.
Naujoks, Nicola; Stemmer, Andreas
2006-08-01
Electric fields are used to guide the assembly of biomolecules in predefined geometric patterns on solid substrates. Local surface charges serve as templates to selectively position proteins on thin-film polymeric electret layers, thereby creating a basis for site-directed layered assembly of biomolecular structures. Charge patterns are created using the lithographic capabilities of an atomic force microscope, namely by applying voltage pulses between a conductive tip and the sample. Samples consist of a poly(methyl methacrylate) layer on a p-doped silicon support. Subsequently, the sample is developed in a water-in-oil emulsion, consisting of a dispersed aqueous phase containing biotin-modified immunoglobulinG molecules, and a continuous nonpolar, insulating oil phase. The electrostatic fields cause a net force of (di)electrophoretic nature on the droplet, thereby guiding the proteins to the predefined locations. Due to the functionalization of the immunoglobulinG molecules with biotin-groups, these patterns can now be used to initiate the localized layer-by-layer assembly of biomolecules based on the avidin-biotin mechanism. By binding 40 nm sized biotin-labelled beads to the predefined locations via a streptavidin linker, we verify the functionality of the previously deposited immunoglobulinG-biotin. All assembly steps following the initial deposition of the immunoglobulinG from emulsion can conveniently be conducted in aqueous solutions. Results show that pattern definition is maintained after immersion into aqueous solution.
International Nuclear Information System (INIS)
Kazanskii, A.K.
1984-01-01
The detachment of the electron from the H - ion during a collision with the nitrogen molecule at 1--6 keV occurs as a result of charge transfer to an unstable intermediate state of the molecular ion N - 2 and the subsequent decay of the ion. The formation process is described in the impulse approximation, and the motion of nuclei in the ion is treated quasiclassically. Expressions are obtained for the spectrum of emitted electrons and for the energy-loss spectrum of heavy particles. These expressions relate the spectra to the cross sections for the vibrational excitation of N 2 by electron impact. A convenient expression for the amplitude for the formation of the intermediate state is obtained in the ''boomerang'' model, and it is shown that one of the parameters, considered to be adjustable in traditional theory, can be calculated
Plasmonic tunnel junctions for single-molecule redox chemistry.
de Nijs, Bart; Benz, Felix; Barrow, Steven J; Sigle, Daniel O; Chikkaraddy, Rohit; Palma, Aniello; Carnegie, Cloudy; Kamp, Marlous; Sundararaman, Ravishankar; Narang, Prineha; Scherman, Oren A; Baumberg, Jeremy J
2017-10-20
Nanoparticles attached just above a flat metallic surface can trap optical fields in the nanoscale gap. This enables local spectroscopy of a few molecules within each coupled plasmonic hotspot, with near thousand-fold enhancement of the incident fields. As a result of non-radiative relaxation pathways, the plasmons in such sub-nanometre cavities generate hot charge carriers, which can catalyse chemical reactions or induce redox processes in molecules located within the plasmonic hotspots. Here, surface-enhanced Raman spectroscopy allows us to track these hot-electron-induced chemical reduction processes in a series of different aromatic molecules. We demonstrate that by increasing the tunnelling barrier height and the dephasing strength, a transition from coherent to hopping electron transport occurs, enabling observation of redox processes in real time at the single-molecule level.
Kölsch, S.; Fritz, F.; Fenner, M. A.; Kurch, S.; Wöhrl, N.; Mayne, A. J.; Dujardin, G.; Meyer, C.
2018-01-01
Hydrogen-terminated diamond is known for its unusually high surface conductivity that is ascribed to its negative electron affinity. In the presence of acceptor molecules, electrons are expected to transfer from the surface to the acceptor, resulting in p-type surface conductivity. Here, we present Kelvin probe force microscopy (KPFM) measurements on carbon nanotubes and C60 adsorbed onto a hydrogen-terminated diamond(001) surface. A clear reduction in the Kelvin signal is observed at the position of the carbon nanotubes and C60 molecules as compared with the bare, air-exposed surface. This result can be explained by the high positive electron affinity of carbon nanotubes and C60, resulting in electron transfer from the surface to the adsorbates. When an oxygen-terminated diamond(001) is used instead, no reduction in the Kelvin signal is obtained. While the presence of a charged adsorbate or a difference in work function could induce a change in the KPFM signal, a charge transfer effect of the hydrogen-terminated diamond surface, by the adsorption of the carbon nanotubes and the C60 fullerenes, is consistent with previous theoretical studies.
Domain-based small molecule binding site annotation
Directory of Open Access Journals (Sweden)
Dumontier Michel
2006-03-01
Full Text Available Abstract Background Accurate small molecule binding site information for a protein can facilitate studies in drug docking, drug discovery and function prediction, but small molecule binding site protein sequence annotation is sparse. The Small Molecule Interaction Database (SMID, a database of protein domain-small molecule interactions, was created using structural data from the Protein Data Bank (PDB. More importantly it provides a means to predict small molecule binding sites on proteins with a known or unknown structure and unlike prior approaches, removes large numbers of false positive hits arising from transitive alignment errors, non-biologically significant small molecules and crystallographic conditions that overpredict ion binding sites. Description Using a set of co-crystallized protein-small molecule structures as a starting point, SMID interactions were generated by identifying protein domains that bind to small molecules, using NCBI's Reverse Position Specific BLAST (RPS-BLAST algorithm. SMID records are available for viewing at http://smid.blueprint.org. The SMID-BLAST tool provides accurate transitive annotation of small-molecule binding sites for proteins not found in the PDB. Given a protein sequence, SMID-BLAST identifies domains using RPS-BLAST and then lists potential small molecule ligands based on SMID records, as well as their aligned binding sites. A heuristic ligand score is calculated based on E-value, ligand residue identity and domain entropy to assign a level of confidence to hits found. SMID-BLAST predictions were validated against a set of 793 experimental small molecule interactions from the PDB, of which 472 (60% of predicted interactions identically matched the experimental small molecule and of these, 344 had greater than 80% of the binding site residues correctly identified. Further, we estimate that 45% of predictions which were not observed in the PDB validation set may be true positives. Conclusion By
Experimental validation of calculated atomic charges in ionic liquids
Fogarty, Richard M.; Matthews, Richard P.; Ashworth, Claire R.; Brandt-Talbot, Agnieszka; Palgrave, Robert G.; Bourne, Richard A.; Vander Hoogerstraete, Tom; Hunt, Patricia A.; Lovelock, Kevin R. J.
2018-05-01
A combination of X-ray photoelectron spectroscopy and near edge X-ray absorption fine structure spectroscopy has been used to provide an experimental measure of nitrogen atomic charges in nine ionic liquids (ILs). These experimental results are used to validate charges calculated with three computational methods: charges from electrostatic potentials using a grid-based method (ChelpG), natural bond orbital population analysis, and the atoms in molecules approach. By combining these results with those from a previous study on sulfur, we find that ChelpG charges provide the best description of the charge distribution in ILs. However, we find that ChelpG charges can lead to significant conformational dependence and therefore advise that small differences in ChelpG charges (<0.3 e) should be interpreted with care. We use these validated charges to provide physical insight into nitrogen atomic charges for the ILs probed.
Directory of Open Access Journals (Sweden)
Diogo de Jesus Medeiros
2013-01-01
Full Text Available The suitable computation of accurate atomic charges for the GROMACS topology *.itp files of small molecules, generated in the PRODRG server, has been a tricky task nowadays because it does not calculate atomic charges using an ab initio method. Usually additional steps of structure optimization and charges calculation, followed by a tedious manual replacement of atomic charges in the *.itp file, are needed. In order to assist this task, we report here the ITP Adjuster 1.0, a utility program developed to perform the replacement of the PRODRG charges in the *.itp files of small molecules by ab initio charges.
Two-dimensional potential and charge distributions of positive surface streamer
International Nuclear Information System (INIS)
Tanaka, Daiki; Matsuoka, Shigeyasu; Kumada, Akiko; Hidaka, Kunihiko
2009-01-01
Information on the potential and the field profile along a surface discharge is required for quantitatively discussing and clarifying the propagation mechanism. The sensing technique with a Pockels crystal has been developed for directly measuring the potential and electric field distribution on a dielectric material. In this paper, the Pockels sensing system consists of a pulse laser and a CCD camera for measuring the instantaneous two-dimensional potential distribution on a 25.4 mm square area with a 50 μm sampling pitch. The temporal resolution is 3.2 ns which is determined by the pulse width of the laser emission. The transient change in the potential distribution of a positive surface streamer propagating in atmospheric air is measured with this system. The electric field and the charge distributions are also calculated from the measured potential profile. The propagating direction component of the electric field near the tip of the propagating streamer reaches 3 kV mm -1 . When the streamer stops, the potential distribution along a streamer forms an almost linear profile with the distance from the electrode, and its gradient is about 0.5 kV mm -1 .
International Nuclear Information System (INIS)
Aubouy, Miguel; Trizac, Emmanuel; Bocquet, Lyderic
2003-01-01
We propose an analytical approximation for the dependence of the effective charge on the bare charge for spherical and cylindrical macro-ions as a function of the size of the colloid and salt content, for the situation of a unique colloid immersed in a sea of electrolyte (where the definition of an effective charge is non-ambiguous). Our approach is based on the Poisson-Boltzmann (PB) mean-field theory. Mathematically speaking, our estimate is asymptotically exact in the limit κa >> 1, where a is the radius of the colloid and κ is the inverse screening length. In practice, a careful comparison with effective charge parameters, obtained by numerically solving the full nonlinear PB theory, proves that our estimate is good down to κa ∼ 1. This is precisely the limit appropriate to treat colloidal suspensions. A particular emphasis is put on the range of parameters suitable to describe both single and double strand DNA molecules under physiological conditions
International Nuclear Information System (INIS)
Morishita, Y.; Takata, N.
2013-01-01
The signal current from an ionisation chamber with a PMMA build-up cap decreases with irradiation time due to electric fields produced by positive charges induced on the cap. In the present study, it was confirmed that the signal current decreases faster for irradiation using narrower 60 Co gamma-ray beams. This is because the number of secondary electrons that are emitted from surrounding materials and penetrate the build-up cap is smaller in a narrower gamma-ray beam, so that fewer positive charges are neutralised. The ionisation chamber was first subjected to continuous gamma-ray irradiation for 24 h, following which it was irradiated with shorter periodic gamma-ray bursts while measuring the current signal. This allowed the coefficients of positive charge accumulation and dissipation to be determined. It was found that the dissipation coefficient has a large constant value during gamma-ray irradiation and decreases asymptotically to a small value after irradiation is stopped. From the coefficients, the minimum signal current was calculated, which is the value when accumulation and dissipation balance each other under continuous irradiation. The time required for the signal current to recover following irradiation was also calculated. (authors)
Masuda, Tetsuya; Kigo, Satomi; Mitsumoto, Mayuko; Ohta, Keisuke; Suzuki, Mamoru; Mikami, Bunzo; Kitabatake, Naofumi; Tani, Fumito
2018-01-01
Thaumatin, an intensely sweet-tasting protein, elicits sweet taste with a threshold of only 50 nM. Previous studies from our laboratory suggested that the complex model between the T1R2-T1R3 sweet receptor and thaumatin depends critically on the complementarity of electrostatic potentials. In order to further validate this model, we focused on three lysine residues (Lys78, Lys106, and Lys137), which were expected to be part of the interaction sites. Three thaumatin mutants (K78A, K106A, and K137A) were prepared and their threshold values of sweetness were examined. The results showed that the sweetness of K106A was reduced by about three times and those of K78A and K137A were reduced by about five times when compared to wild-type thaumatin. The three-dimensional structures of these mutants were also determined by X-ray crystallographic analyses at atomic resolutions. The overall structures of mutant proteins were similar to that of wild-type but the electrostatic potentials around the mutated sites became more negative. Since the three lysine residues are located in 20-40 Å apart each other on the surface of thaumatin molecule, these results suggest the positive charges on the surface of thaumatin play a crucial role in the interaction with the sweet receptor, and are consistent with a large surface is required for interaction with the sweet receptor, as proposed by the multipoint interaction model named wedge model.
Directory of Open Access Journals (Sweden)
Tetsuya Masuda
2018-02-01
Full Text Available Thaumatin, an intensely sweet-tasting protein, elicits sweet taste with a threshold of only 50 nM. Previous studies from our laboratory suggested that the complex model between the T1R2-T1R3 sweet receptor and thaumatin depends critically on the complementarity of electrostatic potentials. In order to further validate this model, we focused on three lysine residues (Lys78, Lys106, and Lys137, which were expected to be part of the interaction sites. Three thaumatin mutants (K78A, K106A, and K137A were prepared and their threshold values of sweetness were examined. The results showed that the sweetness of K106A was reduced by about three times and those of K78A and K137A were reduced by about five times when compared to wild-type thaumatin. The three-dimensional structures of these mutants were also determined by X-ray crystallographic analyses at atomic resolutions. The overall structures of mutant proteins were similar to that of wild-type but the electrostatic potentials around the mutated sites became more negative. Since the three lysine residues are located in 20–40 Å apart each other on the surface of thaumatin molecule, these results suggest the positive charges on the surface of thaumatin play a crucial role in the interaction with the sweet receptor, and are consistent with a large surface is required for interaction with the sweet receptor, as proposed by the multipoint interaction model named wedge model.
Liu, Weiwen
The continual downsizing of the basic functional units used in the electronics industry has motivated the study of the quantum computation and related topics. To overcome the limitations of classical physics and engineering, some unique quantum mechanical features, especially entanglement and superpositions have begun to be considered as important properties for future bits. Including these quantum mechanical features is attractive because the ability to utilize quantum mechanics can dramatically enhance computational power. Among the various ways of constructing the basic building blocks for quantum computation, we are particularly interested in using spins inside epitaxially grown InAs/GaAs quantum dot molecules as quantum bits (qubits). The ability to design and engineer nanostructures with tailored quantum properties is critical to engineering quantum computers and other novel electro-optical devices and is one of the key challenges for scaling up new ideas for device application. In this thesis, we will focus on how the structure and composition of quantum dot molecules can be used to control spin properties and charge interactions. Tunable spin and charge properties can enable new, more scalable, methods of initializing and manipulating quantum information. In this thesis, we demonstrate one method to enable electric-field tunability of Zeeman splitting for a single electron spin inside a quantum dot molecules by using heterostructure engineering techniques to modify the barrier that separates quantum dots. We describe how these structural changes to the quantum dot molecules also change charge interactions and propose ways to use this effect to enable accurate measurement of coulomb interactions and possibly charge occupancy inside these complicated quantum dot molecules.
Biological Nanopores: Confined Spaces for Electrochemical Single-Molecule Analysis.
Cao, Chan; Long, Yi-Tao
2018-02-20
Nanopore sensing is developing into a powerful single-molecule approach to investigate the features of biomolecules that are not accessible by studying ensemble systems. When a target molecule is transported through a nanopore, the ions occupying the pore are excluded, resulting in an electrical signal from the intermittent ionic blockade event. By statistical analysis of the amplitudes, duration, frequencies, and shapes of the blockade events, many properties of the target molecule can be obtained in real time at the single-molecule level, including its size, conformation, structure, charge, geometry, and interactions with other molecules. With the development of the use of α-hemolysin to characterize individual polynucleotides, nanopore technology has attracted a wide range of research interest in the fields of biology, physics, chemistry, and nanoscience. As a powerful single-molecule analytical method, nanopore technology has been applied for the detection of various biomolecules, including oligonucleotides, peptides, oligosaccharides, organic molecules, and disease-related proteins. In this Account, we highlight recent developments of biological nanopores in DNA-based sensing and in studying the conformational structures of DNA and RNA. Furthermore, we introduce the application of biological nanopores to investigate the conformations of peptides affected by charge, length, and dipole moment and to study disease-related proteins' structures and aggregation transitions influenced by an inhibitor, a promoter, or an applied voltage. To improve the sensing ability of biological nanopores and further extend their application to a wider range of molecular sensing, we focus on exploring novel biological nanopores, such as aerolysin and Stable Protein 1. Aerolysin exhibits an especially high sensitivity for the detection of single oligonucleotides both in current separation and duration. Finally, to facilitate the use of nanopore measurements and statistical analysis
Bond index: relation to second-order density matrix and charge fluctuations
International Nuclear Information System (INIS)
Giambiagi, M.S. de; Giambiagi, M.; Jorge, F.E.
1985-01-01
It is shown that, in the same way as the atomic charge is an invariant built from the first-order density matrix, the closed-shell generalized bond index is an invariant associated with the second-order reduced density matrix. The active charge of an atom (sum of bond indices) is shown to be the sum of all density correlation functions between it and the other atoms in the molecule; similarly, the self-charge is the fluctuation of its total charge. (Author) [pt
Enhanced biomimic bactericidal surfaces by coating with positively-charged ZIF nano-dagger arrays.
Yuan, Yuan; Zhang, Yugen
2017-10-01
Cicada wing surfaces are covered with dense patterns of nano-pillar structure that prevent bacterial growth by rupturing adhered microbial cells. To mimic the natural nano-pillar structure, we developed a general and simple method to grow metal organic framework (MOF) nano-dagger arrays on a wide range of surfaces. These nano-daggers possess high bactericidal activity, with log reduction >7 for Escherichia coli and Staphylococcus aureus. It was hypothesized that the positively-charged ZIF-L nano-dagger surfaces enhance bacterial cell adhesion, facilitating selective and efficient bacteria killing by the rigid and sharp nano-dagger tips. This research provides a safe and clean antimicrobial surface technology which does not require external chemicals and will not cause drug resistance. Copyright © 2017 Elsevier Inc. All rights reserved.
Design study of beam position monitors for measuring second-order moments of charged particle beams
Directory of Open Access Journals (Sweden)
Kenichi Yanagida
2012-01-01
Full Text Available This paper presents a theoretical investigation on the multipole moments of charged particle beams in two-dimensional polar coordinates. The theoretical description of multipole moments is based on a single-particle system that is expanded to a multiparticle system by superposition, i.e., summing over all single-particle results. This paper also presents an analysis and design method for a beam position monitor (BPM that detects higher-order (multipole moments of a charged particle beam. To calculate the electric fields, a numerical analysis based on the finite difference method was created and carried out. Validity of the numerical analysis was proven by comparing the numerical with the analytical results for a BPM with circular cross section. Six-electrode BPMs with circular and elliptical cross sections were designed for the SPring-8 linac. The results of the numerical calculations show that the second-order moment can be detected for beam sizes ≧420 μm (circular and ≧550 μm (elliptical.
Position statement on ethics, equipoise and research on charged particle radiation therapy.
Sheehan, Mark; Timlin, Claire; Peach, Ken; Binik, Ariella; Puthenparampil, Wilson; Lodge, Mark; Kehoe, Sean; Brada, Michael; Burnet, Neil; Clarke, Steve; Crellin, Adrian; Dunn, Michael; Fossati, Piero; Harris, Steve; Hocken, Michael; Hope, Tony; Ives, Jonathan; Kamada, Tadashi; London, Alex John; Miller, Robert; Parker, Michael; Pijls-Johannesma, Madelon; Savulescu, Julian; Short, Susan; Skene, Loane; Tsujii, Hirohiko; Tuan, Jeffrey; Weijer, Charles
2014-08-01
The use of charged-particle radiation therapy (CPRT) is an increasingly important development in the treatment of cancer. One of the most pressing controversies about the use of this technology is whether randomised controlled trials are required before this form of treatment can be considered to be the treatment of choice for a wide range of indications. Equipoise is the key ethical concept in determining which research studies are justified. However, there is a good deal of disagreement about how this concept is best understood and applied in the specific case of CPRT. This report is a position statement on these controversies that arises out of a workshop held at Wolfson College, Oxford in August 2011. The workshop brought together international leaders in the relevant fields (radiation oncology, medical physics, radiobiology, research ethics and methodology), including proponents on both sides of the debate, in order to make significant progress on the ethical issues associated with CPRT research. This position statement provides an ethical platform for future research and should enable further work to be done in developing international coordinated programmes of research. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
International Nuclear Information System (INIS)
Okuno, Kazuhiko
1978-12-01
This paper presents a compilation of the experimental works on charge changing cross sections for neutral atoms, negative- and positive-atomic ions of atomic numbers Z = 2 - 5 in collisions with atoms and simple molecules. A systematic survey of the literature has been made through October 1977. Some recent data are also included. The result is summarized in graphical forms with reference lists attached. (author)
International Nuclear Information System (INIS)
Okuno, Kazuhiko
1978-12-01
This paper presents a compilation of the experimental works on charge changing cross sections for neutral atoms, negative- and positive-atomic ions of atomic numbers Z = 9 - 11 in collisions with atoms and simple molecules. A systematic survey of the leterature has been made through October 1977. Some recent data are also included. The result is summarized in graphical forms with reference lists attached. (author)
International Nuclear Information System (INIS)
Okuno, Kazuhiko
1978-12-01
This paper presents a compilation of the experimental works on charge changing cross sections for neutral atoms, negative- and positive-atomic ions of atomic numbers Z = 6 - 8 in collisions with atoms and simple molecules. A systematic survey of the literature has been made through October 1977. Some recent data are also included. The result is summarized in graphical forms with reference lists attached. (author)
The most negative ion in the Thomas-Fermi-von Weizsaecker theory of atoms and molecules
International Nuclear Information System (INIS)
Benguria, R.; Lieb, E.H.; Princeton Univ., NJ
1985-01-01
Let Nsub(c) denote the maximum number of electrons that can be bound to an atom of nuclear charge z, in the Thomas-Fermi-von Weizaecker theory. It is proved that Nsub(c) cannot exceed z by more than one, and thus this theory is in agreement with experimental facts about real atoms. A similar result is proved for molecules, i.e. Nsub(c) cannot exceed the total nuclear charge by more than the number of atoms in the molecule. (author)
Sancho-García, J C
2012-05-07
A set of N-heteroquinones, deriving from oligoacenes, have been recently proposed as n-type organic semiconductors with high electron mobilities in thin-film transistors. Generally speaking, this class of compounds self-assembles in neighboring π-stacks linked by weak hydrogen bonds. We aim at theoretically characterizing here the sequential charge transport (hopping) process expected to take place across these arrays of molecules. To do so, we need to accurately address the preferred packing of these materials simultaneously to single-molecule properties related to charge-transfer events, carefully employing dispersion-corrected density functional theory methods to accurately extract the key molecular parameters governing this phenomenon at the nanoscale. This study confirms the great deal of interest around these compounds, since controlled functionalization of model molecules (i.e., pentacene) allows to efficiently tune the corresponding charge mobilities, and the capacity of modern quantum-chemical methods to predict it after rationalizing the underlying structure-property relationships.
Sadavarte, Rahul; Madadkar, Pedram; Filipe, Carlos Dm; Ghosh, Raja
2018-01-15
Monoclonal antibodies undergo various forms of chemical transformation which have been shown to cause loss in efficacy and alteration in pharmacokinetic properties of these molecules. Such modified antibody molecules are known as variants. They also display physical properties such as charge that are different from intact antibody molecules. However, the difference in charge is very subtle and separation based on it is quite challenging. Charge variants are usually separated using ion-exchange column chromatography or isoelectric focusing. In this paper, we report a rapid and scalable method for fractionating monoclonal antibody charge variants, based on the use of cation exchange laterally-fed membrane chromatography (LFMC). Starting with a sample of monoclonal antibody hIgG1-CD4, three well-resolved fractions were obtained using either pH or salt gradient. These fractions were identified as acidic, neutral and basic variants. Each of these fractions contained intact heavy and light chains and so antibody fragmentation had no role in variant generation. The separation was comparable to that using column chromatography but was an order of magnitude faster. Copyright © 2017 Elsevier B.V. All rights reserved.
Charging and geometric effects on conduction through Anthracene molecular junctions
Kaur, Rupan Preet; Sawhney, Ravinder Singh; Engles, Derick
We studied the geometric effects on the charge transfer through the anthracenedithiol (ADT) molecular junction using density functional theory combined with the non-equilibrium Green’s function approach. Two major geometric aspects, bond length and bond angle, were moderated to optimize the electrical conduction. From the results established in this paper, we found that the electrical conduction can be tuned from 0.2 G0 to 0.9 G0 by varying the Au-S bond length, whereas the moderation of bonding angle assayed a minor change from 0.37 G0 to 0.47 G0. We attributed this escalating zero bias conductance to the increasing charge on the terminal sulfur atom of the ADT molecule, which increased the energy of the HOMO orbital towards Fermi level and exhibited a semi-metallic behaviour. Therefore, geometry plays a critical role in deciding the charge transport through the metal/molecule interface.
Radical Chemistry and Charge Manipulation with an Atomic Force Microscope
Gross, Leo
The fuctionalization of tips by atomic manipulation dramatically increased the resolution of atomic force microscopy (AFM). The combination of high-resolution AFM with atomic manipulation now offers the unprecedented possibility to custom-design individual molecules by making and breaking bonds with the tip of the microscope and directly characterizing the products on the atomic scale. We recently applied this technique to generate and study reaction intermediates and to investigate chemical reactions trigged by atomic manipulation. We formed diradicals by dissociating halogen atoms and then reversibly triggered ring-opening and -closing reactions via atomic manipulation, allowing us to switch and control the molecule's reactivity, magnetic and optical properties. Additional information about charge states and charge distributions can be obtained by Kelvin probe force spectroscopy. On multilayer insulating films we investigated single-electron attachment, detachment and transfer between individual molecules. EU ERC AMSEL (682144), EU project PAMS (610446).
Geall, A J; Eaton, M A; Baker, T; Catterall, C; Blagbrough, I S
1999-10-15
We have quantified the effects of the regiochemical distribution of positive charges along the polyamine moiety in lipopolyamines for DNA molecular recognition. High affinity binding leads to charge neutralisation, DNA condensation and ultimately to lipofection. Binding affinities for calf thymus DNA were determined using an ethidium bromide displacement assay and condensation was detected by changes in turbidity using light scattering. The in vitro transfection competence of cholesterol polyamine carbamates was measured in CHO cells. In the design of DNA condensing and transfecting agents for non-viral gene therapy, the interrelationship of ammonium ions, not just their number, must be considered.
The R.E.D. tools: advances in RESP and ESP charge derivation and force field library building.
Dupradeau, François-Yves; Pigache, Adrien; Zaffran, Thomas; Savineau, Corentin; Lelong, Rodolphe; Grivel, Nicolas; Lelong, Dimitri; Rosanski, Wilfried; Cieplak, Piotr
2010-07-28
Deriving atomic charges and building a force field library for a new molecule are key steps when developing a force field required for conducting structural and energy-based analysis using molecular mechanics. Derivation of popular RESP charges for a set of residues is a complex and error prone procedure because it depends on numerous input parameters. To overcome these problems, the R.E.D. Tools (RESP and ESP charge Derive, ) have been developed to perform charge derivation in an automatic and straightforward way. The R.E.D. program handles chemical elements up to bromine in the periodic table. It interfaces different quantum mechanical programs employed for geometry optimization and computing molecular electrostatic potential(s), and performs charge fitting using the RESP program. By defining tight optimization criteria and by controlling the molecular orientation of each optimized geometry, charge values are reproduced at any computer platform with an accuracy of 0.0001 e. The charges can be fitted using multiple conformations, making them suitable for molecular dynamics simulations. R.E.D. allows also for defining charge constraints during multiple molecule charge fitting, which are used to derive charges for molecular fragments. Finally, R.E.D. incorporates charges into a force field library, readily usable in molecular dynamics computer packages. For complex cases, such as a set of homologous molecules belonging to a common family, an entire force field topology database is generated. Currently, the atomic charges and force field libraries have been developed for more than fifty model systems and stored in the RESP ESP charge DDataBase. Selected results related to non-polarizable charge models are presented and discussed.
Molecular electronics--resonant transport through single molecules.
Lörtscher, Emanuel; Riel, Heike
2010-01-01
The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.
International Nuclear Information System (INIS)
Oliveira, I. S. S. de; Miwa, R. H.
2015-01-01
We use ab initio simulations to investigate the adsorption and the self-assembly processes of tetracyanoquinodimethane (TCNQ), tetrafluoro-tetracyanoquinodimethane (F4-TCNQ), and tetrasodium 1,3,6,8-pyrenetetrasulfonic acid (TPA) on the graphene surface. We find that there are no chemical bonds at the molecule–graphene interface, even at the presence of grain boundaries on the graphene surface. The molecules bond to graphene through van der Waals interactions. In addition to the molecule–graphene interaction, we performed a detailed study of the role played by the (lateral) molecule–molecule interaction in the formation of the, experimentally verified, self-assembled layers of TCNQ and TPA on graphene. Regarding the electronic properties, we calculate the electronic charge transfer from the graphene sheet to the TCNQ and F4-TCNQ molecules, leading to a p-doping of graphene. Meanwhile, such charge transfer is reduced by an order of magnitude for TPA molecules on graphene. In this case, it is not expected a significant doping process upon the formation of self-assembled layer of TPA molecules on the graphene sheet
Theoretical aspects of electron transfer reactions of complex molecules
DEFF Research Database (Denmark)
Kuznetsov, A. M.; Ulstrup, Jens
2001-01-01
Features of electron transfer involving complex molecules are discussed. This notion presently refers to molecular reactants where charge transfer is accompanied by large molecular reorganization, and commonly used displaced harmonic oscillator models do not apply. It is shown that comprehensive...... theory of charge transfer in polar media offers convenient tools for the treatment of experimental data for such systems, with due account of large-amplitude strongly anharmonic intramolecular reorganization. Equations for the activation barrier and free energy relationships are provided, incorporating...
Abbasi, Amirali; Sardroodi, Jaber Jahanbin
2018-04-01
The adsorption of O3 molecule on the undoped and N-doped TiO2/WSe2 nanocomposites was studied using first principles density functional theory calculations. O3 interaction with TiO2/WSe2 nanocomposites is considered so as to investigate WSe2 effects on the adsorption process. WSe2 favors the adsorption of O3 on TiO2 particles. In other words, WSe2 is conducive to the interaction of O3 molecule with fivefold coordinated titanium sites of TiO2. The effects of vdW interactions were taken into account in order to obtain equilibrium geometries of O3 molecules at TiO2/WSe2 interfaces. For all adsorption configurations, the binding site was positioned on the fivefold coordinated titanium atoms. The results show that the interactions between O3 and TiO2 in TiO2/WSe2 nanocomposites are stronger than those between O3 and bare TiO2, suggesting that WSe2 helps to strengthen the interaction of ozone molecule with TiO2 particles. The results also indicate that the adsorption of the O3 molecule on the N-doped TiO2/WSe2 nanocomposite is more energetically favorable than the adsorption of O3 on the pristine one, representing that the N-doped nanocomposites are more sensitive than the undoped ones. Our DFT results clearly show that the N-doped TiO2/WSe2 nanocomposite would be a promising O3 gas sensor. The electronic structure of the adsorption system was also investigated, including analysis of the total and projected density of states, and charge density differences of the TiO2/WSe2 with adsorbed O3 molecules. The charge density difference calculations indicate that the charges were accumulated over the adsorbed O3 molecule. Besides, the N-doped nanocomposites have better sensing response than the pristine ones. This work was devoted to provide the theory basis for the design and development of novel and advanced O3 sensors based on modified TiO2/WSe2 nanocomposites.
Angular momentum of an electric charge and magnetically charged black hole
Energy Technology Data Exchange (ETDEWEB)
Garfinkle, D. (California Univ., Santa Barbara (USA). Dept. of Physics); Rey, S.J. (California Univ., Santa Barbara (USA). Dept. of Physics Florida Univ., Gainesville, FL (USA). Inst. for Fundamental Theory)
1991-03-21
We find the angular momentum L of a point particle with electric charge e held at a fixed position in the presence of a black hole with magnetic charge g. (For a point charge in the presence of an ordinary magnetic monopole, it is known that L=eg.) The angular momentum does depend on the separation distance between the particle and the black hole; however, L->eg for a large separation. Implications for the cosmic censorship hypothesis, the quantum hairs and other physical situations are discussed. (orig.).
Fragmentation and mean kinetic energy release of the nitrogen molecule
International Nuclear Information System (INIS)
Santos, A.C.F.; Melo, W.S.; Sant'Anna, M.M.; Sigaud, G.M.; Montenegro, E.C.
2007-01-01
Ionization and fragmentation of the N 2 molecule in coincidence with the final projectile charge state have been measured for the impact of 0.188-0.875 MeV/amu He + projectiles. The average kinetic energy release (KER) of the target ionic fragments is derived from the peak widths of their time-of-flight distributions. It is shown that the KER's for singly-charged products follow scaling laws irrespectively to the collision channel
Exciplex: An Intermolecular Charge-Transfer Approach for TADF.
Sarma, Monima; Wong, Ken-Tsung
2018-04-03
Organic materials that display thermally activated delayed fluorescence (TADF) are a striking class of functional materials that have witnessed a booming progress in recent years. In addition to pure TADF emitters achieved by the subtle manipulations of intramolecular charge transfer processes with sophisticated molecular structures, a new class of efficient TADF-based OLEDs with emitting layer formed by blending electron donor and acceptor molecules that involve intermolecular charge transfer have also been fabricated. In contrast to pure TADF materials, the exciplex-based systems can realize small ΔEST (0-0.05 eV) much more easily since the electron and hole are positioned on two different molecules, thereby giving small exchange energy. Consequently, exciplex-based OLEDs have the prospective to maximize the TADF contribution and achieve theoretical 100% internal quantum efficiency. Therefore, the challenging issue of achieving small ΔEST in organic systems could be solved. In this article, we summarize and discuss the latest and most significant developments regarding these rapidly evolving functional materials, wherein the majority of the reported exciplex forming systems are categorized into two sub-groups, viz. (a) exciplex as TADF emitters and (b) those as hosts for fluorescent, phosphorescent and TADF dopants according to their structural features and applications. The working mechanisms of the direct electroluminescence from the donor/acceptor interface and the exciplex-forming systems as co-host for the realization of high efficiency OLEDs are reviewed and discussed. This article delivers a summary of the current progresses and achievements of exciplex-based researches and points out the future challenges to trigger more research endeavors to this growing field.
Femtosecond response of polyatomic molecules to ultra-intense hard X-rays.
Rudenko, A; Inhester, L; Hanasaki, K; Li, X; Robatjazi, S J; Erk, B; Boll, R; Toyota, K; Hao, Y; Vendrell, O; Bomme, C; Savelyev, E; Rudek, B; Foucar, L; Southworth, S H; Lehmann, C S; Kraessig, B; Marchenko, T; Simon, M; Ueda, K; Ferguson, K R; Bucher, M; Gorkhover, T; Carron, S; Alonso-Mori, R; Koglin, J E; Correa, J; Williams, G J; Boutet, S; Young, L; Bostedt, C; Son, S-K; Santra, R; Rolles, D
2017-06-01
X-ray free-electron lasers enable the investigation of the structure and dynamics of diverse systems, including atoms, molecules, nanocrystals and single bioparticles, under extreme conditions. Many imaging applications that target biological systems and complex materials use hard X-ray pulses with extremely high peak intensities (exceeding 10 20 watts per square centimetre). However, fundamental investigations have focused mainly on the individual response of atoms and small molecules using soft X-rays with much lower intensities. Studies with intense X-ray pulses have shown that irradiated atoms reach a very high degree of ionization, owing to multiphoton absorption, which in a heteronuclear molecular system occurs predominantly locally on a heavy atom (provided that the absorption cross-section of the heavy atom is considerably larger than those of its neighbours) and is followed by efficient redistribution of the induced charge. In serial femtosecond crystallography of biological objects-an application of X-ray free-electron lasers that greatly enhances our ability to determine protein structure-the ionization of heavy atoms increases the local radiation damage that is seen in the diffraction patterns of these objects and has been suggested as a way of phasing the diffraction data. On the basis of experiments using either soft or less-intense hard X-rays, it is thought that the induced charge and associated radiation damage of atoms in polyatomic molecules can be inferred from the charge that is induced in an isolated atom under otherwise comparable irradiation conditions. Here we show that the femtosecond response of small polyatomic molecules that contain one heavy atom to ultra-intense (with intensities approaching 10 20 watts per square centimetre), hard (with photon energies of 8.3 kiloelectronvolts) X-ray pulses is qualitatively different: our experimental and modelling results establish that, under these conditions, the ionization of a molecule is
Energy Technology Data Exchange (ETDEWEB)
Pavanello, Michele [Department of Chemistry, Rutgers University, Newark, New Jersey 07102-1811 (United States); Van Voorhis, Troy [Department of Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139-4307 (United States); Visscher, Lucas [Amsterdam Center for Multiscale Modeling, VU University, De Boelelaan 1083, 1081 HV Amsterdam (Netherlands); Neugebauer, Johannes [Theoretische Organische Chemie, Organisch-Chemisches Institut der Westfaelischen Wilhelms-Universitaet Muenster, Corrensstrasse 40, 48149 Muenster (Germany)
2013-02-07
Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.
Roelofs, Andreas; Hong, Seungbum
2018-02-06
A method for rapid imaging of a material specimen includes positioning a tip to contact the material specimen, and applying a force to a surface of the material specimen via the tip. In addition, the method includes moving the tip across the surface of the material specimen while removing electrical charge therefrom, generating a signal produced by contact between the tip and the surface, and detecting, based on the data, the removed electrical charge induced through the tip during movement of the tip across the surface. The method further includes measuring the detected electrical charge.
Molecular distortion and charge transfer effects in ZnPc/Cu(111)
Amin, B.; Nazir, S.; Schwingenschlö gl, Udo
2013-01-01
The adsorption geometry and electronic properties of a zinc-phthalocyanine molecule on a Cu(111) substrate are studied by density functional theory. In agreement with experiment, we find remarkable distortions of the molecule, mainly as the central Zn atom tends towards the substrate to minimize the Zn-Cu distance. As a consequence, the Zn-N chemical bonding and energy levels of the molecule are significantly modified. However, charge transfer induces metallic states on the molecule and therefore is more important for the ZnPc/Cu(111) system than the structural distortions.
Molecular distortion and charge transfer effects in ZnPc/Cu(111)
Amin, B.
2013-04-23
The adsorption geometry and electronic properties of a zinc-phthalocyanine molecule on a Cu(111) substrate are studied by density functional theory. In agreement with experiment, we find remarkable distortions of the molecule, mainly as the central Zn atom tends towards the substrate to minimize the Zn-Cu distance. As a consequence, the Zn-N chemical bonding and energy levels of the molecule are significantly modified. However, charge transfer induces metallic states on the molecule and therefore is more important for the ZnPc/Cu(111) system than the structural distortions.
Doping Phosphorene with Holes and Electrons through Molecular Charge Transfer.
Vishnoi, Pratap; Rajesh, S; Manjunatha, S; Bandyopadhyay, Arkamita; Barua, Manaswee; Pati, Swapan K; Rao, C N R
2017-11-03
An important aspect of phosphorene, the novel two-dimensional semiconductor, is whether holes and electrons can both be doped in this material. Some reports found that only electrons can be preferentially doped into phosphorene. There are some theoretical calculations showing charge-transfer interaction with both tetrathiafulvalene (TTF) and tetracyanoethylene (TCNE). We have carried out an investigation of chemical doping of phosphorene by a variety of electron donor and acceptor molecules, employing both experiment and theory, Raman scattering being a crucial aspect of the study. We find that both electron acceptors and donors interact with phosphorene by charge-transfer, with the acceptors having more marked effects. All the three Raman bands of phosphorene soften and exhibit band broadening on interaction with both donor and acceptor molecules. First-principles calculations establish the occurrence of charge-transfer between phosphorene with donors as well as acceptors. The absence of electron-hole asymmetry is noteworthy. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Feng, Linlin; Dong, Huanli; Li, Qingyuan
2017-01-01
It is a common phenomenon for organic semiconductors to crystallize in two or more polymorphs, leading to various molecular packings and different charge transport properties. Therefore, it is a crucial issue of tuning molecular crystal polymorphs (i.e., adjusting the same molecule with different......)-based cruciform molecule, named as IF-TTF. The charge carrier mobility of the α-phase IF-TTF crystals was more than one order of magnitude higher than that of β-phase crystals, suggesting the importance of reasonably tuning molecular packing in solid state for the improvement of charge transport in organic...... semiconductors...
Angular momentum of an electric charge and magnetically charged black hole
International Nuclear Information System (INIS)
Garfinkle, D.; Rey, Soo-Jong
1990-01-01
We find the angular momentum L of a point particle with electric charge e held at a fixed position in the presence of a black hole with magnetic charge g. (For a point charge in the presence of an of ordinary magnetic monopole, it is known that L = eg). The angular momentum does depend on the separation distance between the particle and the black hole; however, L → eg for a large separation. Implications for the cosmic censorship hypothesis, the quantum hairs and other physical situations are discussed
Zinc oxide nanoparticles and monocytes: Impact of size, charge and solubility on activation status
Energy Technology Data Exchange (ETDEWEB)
Prach, Morag [Edinburgh Napier University, School of Life, Sport and Social Science, Edinburgh (United Kingdom); Stone, Vicki [Heriot-Watt University, School of Life Sciences, Edinburgh (United Kingdom); Proudfoot, Lorna, E-mail: l.proudfoot@napier.ac.uk [Edinburgh Napier University, School of Life, Sport and Social Science, Edinburgh (United Kingdom)
2013-01-01
Zinc oxide (ZnO) particle induced cytotoxicity was dependent on size, charge and solubility, factors which at sublethal concentrations may influence the activation of the human monocytic cell line THP1. ZnO nanoparticles (NP; average diameter 70 nm) were more toxic than the bulk form (< 44 μm mesh) and a positive charge enhanced cytotoxicity of the NP despite their relatively high dissolution. A positive charge of the particles has been shown in other studies to have an influence on cell viability. Centrifugal filtration using a cut off of 5 kDa and Zn element analysis by atomic absorption spectroscopy confirmed that exposure of the ZnO particles and NP to 10% foetal bovine serum resulted in a strong association of the Zn{sup 2+} ion with protein. This association with protein may influence interaction of the ZnO particles and NP with THP1 cells. After 24 h exposure to the ZnO particles and NP at sublethal concentrations there was little effect on immunological markers of inflammation such as HLA DR and CD14, although they may induce a modest increase in the adhesion molecule CD11b. The cytokine TNFα is normally associated with proinflammatory immune responses but was not induced by the ZnO particles and NP. There was also no effect on LPS stimulated TNFα production. These results suggest that ZnO particles and NP do not have a classical proinflammatory effect on THP1 cells. -- Highlights: ► ZnO is cytotoxic to THP-1 monocytes. ► ZnO nanoparticles are more toxic than the bulk form. ► Positive charge enhances ZnO nanoparticle cytotoxicity. ► Sublethal doses of ZnO particles do not induce classical proinflammatory markers.
Kasheverov, I.E.; Zhmak, M.N.; Vulfius, C.A.; Corbacheva, E.V.; Mordvintsev, D.Y.; Utkin, Y.N.; van Elk, R.; Smit, A.B.; Tsetlin, V.I.
2006-01-01
α-Conotoxins from Conus snails are indispensable tools for distinguishing various subtypes of nicotinic acetylcholine receptors (nAChRs), and synthesis of α-conotoxin analogs may yield novel antagonists of higher potency and selectivity. We incorporated additional positive charges into α-conotoxins
DEFF Research Database (Denmark)
Svane, Simon; Gorshkov, Vladimir; Kjeldsen, Frank
2015-01-01
charges per phosphate group. Three different phosphoinositide phosphates (mono-, di-, and triphosphorylated inositides), a phosphatidic acid, a phosphatidylcholine, a phosphatidylethanolamine, and a phosphatidylglycerol were investigated. The intensities obtained in positive ion-mode of phosphoinositide...... phosphates and phosphatidic acid bound to {LGa2}(5+) were between 2.5- and 116-fold higher than that of the unmodified lipids in the negative ion-mode. Native phosphoinositide ions yielded upon CID in the negative ion-mode predominantly product ions due to losses of H3PO4, PO3(-) and H2O. In comparison, CID...
Gamer, L.; Schulz, D.; Enss, C.; Fleischmann, A.; Gastaldo, L.; Kempf, S.; Krantz, C.; Novotný, O.; Schwalm, D.; Wolf, A.
2016-08-01
We present the design of MOCCA, a large-area particle detector that is developed for the position- and energy-resolving detection of neutral molecule fragments produced in electron-ion interactions at the Cryogenic Storage Ring at the Max Planck Institute for Nuclear Physics in Heidelberg. The detector is based on metallic magnetic calorimeters and consists of 4096 particle absorbers covering a total detection area of 44.8 mathrm {mm} × 44.8 mathrm {mm}. Groups of four absorbers are thermally coupled to a common paramagnetic temperature sensor where the strength of the thermal link is different for each absorber. This allows attributing a detector event within this group to the corresponding absorber by discriminating the signal rise times. A novel readout scheme further allows reading out all 1024 temperature sensors that are arranged in a 32 × 32 square array using only 16+16 current-sensing superconducting quantum interference devices. Numerical calculations taking into account a simplified detector model predict an energy resolution of Δ E_mathrm {FWHM} le 80 mathrm {eV} for all pixels of this detector.
Rapid charging of nickel-cadmium accumulators
Energy Technology Data Exchange (ETDEWEB)
Bruck, F
1972-01-01
Four types of charging of gas-tight Ni-Cd accumulators (a) normal; (b) accelerated; (c) rapid; and (d) ultra-rapid are described. For rapid charging, a built-in temperature sensor cuts off charging current at a prescribed point. In ultra-rapid charging, 50% charge can be attained in 3.5 min. and 25% charge within 50 sec. In the second phase of ultra-rapid charging, a surplus of oxygen is released at the positive electrode and a safety valve is provided for pressure reduction. Characteristic curves are given for various rates of charging and some data on discharge rates is also given.
Adams, Nigel G.; Fondren, L. Dalila; McLain, Jason L.; Jackson, Doug M.
2006-01-01
Several ring compounds have been detected in interstellar gas clouds, ISC, including the aromatic, benzene. Polycyclic aromatic hydrocarbons, PAHs, have been implicated as carriers of diffuse interstellar bands (DIBs) and unidentified infrared (UIR) bands. Heterocyclic aromatic rings of intermediate size containing nitrogen, possibly PreLife molecules, were included in early searches but were not detected and a recent search for Pyrimidine was unsuccessful. Our laboratory investigations of routes to such molecules could establish their existence in ISC and suggest conditions under which their concentrations would be maximized thus aiding the searches. The stability of such ring compounds (C5H5N, C4H4N2, C5H11N and C4H8O2) has been tested in the laboratory using charge transfer excitation in ion-molecule reactions. The fragmentation paths, including production of C4H4(+), C3H3N(+) and HCN, suggest reverse routes to the parent molecules, which are presently under laboratory investigation as production sources.
Lee, Kerry J.; Browning, Lauren M.; Nallathamby, Prakash D.; Xu, Xiao-Hong Nancy
2013-01-01
Nanomaterials possess unusually high surface area-to-volume ratios, and surface-determined physicochemical properties. It is essential to understand their surface-dependent toxicity in order to rationally design biocompatible nanomaterials for a wide variety of applications. In this study, we have functionalized the surfaces of silver nanoparticles (Ag NPs, 11.7 ± 2.7 nm in diameters) with three biocompatible peptides (CALNNK, CALNNS, CALNNE) to prepare positively (Ag-CALNNK NPs+ζ), negatively (Ag-CALNNS NPs−2ζ), and more negatively charged NPs (Ag-CALNNE NPs−4ζ), respectively. Each peptide differs in a single amino acid at its C-terminus, which minimizes the effects of peptide sequences and serves as a model molecule to create positive, neutral and negative charges on the surface of the NPs at pH 4–10. We have studied their charge-dependent transport into early-developing (cleavage-stage) zebrafish embryos and their effects on embryonic development using dark-field optical microscopy and spectroscopy (DFOMS). We found that all three Ag-peptide NPs passively diffused into the embryos via their chorionic pore canals, and stayed inside the embryos throughout their entire development (120 h), showing charge-independent diffusion modes and charge-dependent diffusion coefficients. Notably, the NPs create charge-dependent toxic effects on embryonic development, showing that the Ag-CALNNK NPs+ζ (positively charged) are the most biocompatible while the Ag-CALNNE NPs–4ζ (more negatively charged) are the most toxic. By comparing with our previous studies of the same sized citrated Ag and Au NPs, the Ag-peptide NPs are much more biocompatible than the citrated Ag NPs, and nearly as biocompatible as the Au NPs, showing the dependence of nanotoxicity upon the surface charges, surface functional groups and chemical compositions of the NPs. This study also demonstrates powerful applications of single NP plasmonic spectroscopy for quantitative analysis of single NPs
Observation of pendular butterfly Rydberg molecules
Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig
2016-01-01
Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143
Long-Ranged Oppositely Charged Interactions for Designing New Types of Colloidal Clusters
Directory of Open Access Journals (Sweden)
Ahmet Faik Demirörs
2015-04-01
Full Text Available Getting control over the valency of colloids is not trivial and has been a long-desired goal for the colloidal domain. Typically, tuning the preferred number of neighbors for colloidal particles requires directional bonding, as in the case of patchy particles, which is difficult to realize experimentally. Here, we demonstrate a general method for creating the colloidal analogs of molecules and other new regular colloidal clusters without using patchiness or complex bonding schemes (e.g., DNA coating by using a combination of long-ranged attractive and repulsive interactions between oppositely charged particles that also enable regular clusters of particles not all in close contact. We show that, due to the interplay between their attractions and repulsions, oppositely charged particles dispersed in an intermediate dielectric constant (4<ϵ<10 provide a viable approach for the formation of binary colloidal clusters. Tuning the size ratio and interactions of the particles enables control of the type and shape of the resulting regular colloidal clusters. Finally, we present an example of clusters made up of negatively charged large and positively charged small satellite particles, for which the electrostatic properties and interactions can be changed with an electric field. It appears that for sufficiently strong fields the satellite particles can move over the surface of the host particles and polarize the clusters. For even stronger fields, the satellite particles can be completely pulled off, reversing the net charge on the cluster. With computer simulations, we investigate how charged particles distribute on an oppositely charged sphere to minimize their energy and compare the results with the solutions to the well-known Thomson problem. We also use the simulations to explore the dependence of such clusters on Debye screening length κ^{−1} and the ratio of charges on the particles, showing good agreement with experimental observations.
Directory of Open Access Journals (Sweden)
Elisabeth Dalimier
2014-05-01
Full Text Available We review studies of two kinds of dips in spectral line profiles emitted by plasmas—dips that have been predicted theoretically and observed experimentally: Langmuir-wave-caused dips (L-dips and charge-exchange-caused dips (X-dips. There is a principal difference with respect to positions of L-dips and X-dips relative to the unperturbed wavelength of a spectral line: positions of L-dips scale with the electron density Ne roughly as Ne1/2, while positions of X-dips are almost independent of Ne (the dependence is much weaker than for L-dips. L-dips and X-dips phenomena are important, both fundamentally and practically. The fundamental importance is due to a rich physics behind each of these phenomena. L-dips are a multi-frequency resonance phenomenon caused by a single-frequency (monochromatic electric field. X-dips are due to charge exchange at anticrossings of terms of a diatomic quasi-molecule, whose nuclei have different charges. As for important practical applications, they are as follows: observations of L-dips constitute a very accurate method to measure the electron density in plasmas—a method that does not require knowledge of the electron temperature. L-dips also allow measuring the amplitude of the electric field of Langmuir waves—the only spectroscopic method available for this purpose. Observations of X-dips provide an opportunity to determine rate coefficient of charge exchange between multi-charged ions. This is an important reference data, virtually inaccessible by other experimental methods. The rate coefficients of charge exchange are important for magnetic fusion in Tokamaks, for population inversion in the soft x-ray and VUV ranges, for ion storage devices, as well as for astrophysics (e.g., for the solar plasma and for determining the physical state of planetary nebulae.
Oriented xenon hydride molecules in the gas phase
Czech Academy of Sciences Publication Activity Database
Buck, U.; Fárník, Michal
2006-01-01
Roč. 25, č. 4 (2006), s. 583-612 ISSN 0144-235X Grant - others:Deutsche Forschungsgemeinschaft(DE) SFB 357 Institutional research plan: CEZ:AV0Z40400503 Keywords : photofragment translational spectroscopy * charge transfer molecules * low temperature matrices * neutral rare-gas Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 6.036, year: 2006
Liquefaction of H2 molecules upon exterior surfaces of carbon nanotube bundles
International Nuclear Information System (INIS)
Han, Sang Soo; Kang, Jeung Ku; Lee, Hyuck Mo; Duin, Adri C.T. van; Goddard, William A. III
2005-01-01
We have used molecular dynamics simulations to investigate interaction of H 2 molecules on the exterior surfaces of carbon nanotubes (CNTs): single and bundle types. At 80 K and 10 MPa, it is found that charge transfer occurs from a low curvature region to a high curvature region of the deformed CNT bundle, which develops charge polarization only on the deformed structure. The long-range electrostatic interactions of polarized charges on the deformed CNT bundle with hydrogen molecules are observed to induce a high local-ordering of H 2 gas that results in hydrogen liquefaction. Our predicted heat of hydrogen liquefaction on the CNT bundle is 97.6 kcal kg -1 . On the other hand, hydrogen liquefaction is not observed in the CNT of a single type. This is because charge polarization is not developed on the single CNT as it is symmetrically deformed under the same pressure. Consequently, the hydrogen storage capacity on the CNT bundle is much higher due to liquefaction than that on the single CNT. Additionally, our results indicate that it would also be possible to liquefy H 2 gas on a more strongly polarized CNT bundle at temperatures higher than 80 K
A Study of Electrostatic Charge on Insulating Film by Electrostatic Force Microscopy
International Nuclear Information System (INIS)
Kikunaga, K; Toosaka, K; Kamohara, T; Sakai, K; Nonaka, K
2011-01-01
Electrostatic charge properties on polypropylene film have been characterized by atomic force microscopy and electrostatic force microscopy. The measurements have been carried out after the polypropylene film was electrified by contact and separation process in an atmosphere of controlled humidity. The negative and positive charge in concave surface has been observed. The correlation between concave surface and charge position suggests that the electrostatic charges could be caused by localized contact. On the other hand, positive charge on a flat surface has been observed. The absence of a relationship between surface profile and charge position suggests that the electrostatic charge should be caused by discharge during the separation process. The spatial migration of other positive charges through surface roughness has been observed. The results suggest that there could be some electron traps on the surface roughness and some potentials on the polypropylene film.
Charging and Screening in Nonpolar Solutions of Nonionizable Surfactants
Behrens, Sven
2010-03-01
Nonpolar liquids do not easily accommodate electric charges, but surfactant additives are often found to dramatically increase the solution conductivity and promote surface charging of suspended colloid particles. Such surfactant-mediated electrostatic effects have been associated with equilibrium charge fluctuations among reverse surfactant micelles and in some cases with the statistically rare ionization of individual surfactant molecules. Here we present experimental evidence that even surfactants without any ionizable group can mediate charging and charge screening in nonpolar oils, and that they can do so at surfactant concentrations well below the critical micelle concentration (cmc). Precision conductometry, light scattering, and Karl-Fischer titration of sorbitan oleate solutions in hexane, paired with electrophoretic mobility measurements on suspended polymer particles, reveal a distinctly electrostatic action of the surfactant. We interpret our observations in terms of a charge fluctuation model and argue that the observed charging processes are likely facilitated, but not limited, by the presence of ionizable impurities.
Electron-molecule interactions and their applications
Christophorou, L G
1984-01-01
Electron-Molecule Interactions and Their Applications, Volume 2 provides a balanced and comprehensive account of electron-molecule interactions in dilute and dense gases and liquid media. This book consists of six chapters. Chapter 1 deals with electron transfer reactions, while Chapter 2 discusses electron-molecular positive-ion recombination. The electron motion in high-pressure gases and electron-molecule interactions from single- to multiple-collision conditions is deliberated in Chapter 3. In Chapter 4, knowledge on electron-molecule interactions in gases is linked to that on similar proc
Physical adsorption and charge transfer of molecular Br2 on graphene.
Chen, Zheyuan; Darancet, Pierre; Wang, Lei; Crowther, Andrew C; Gao, Yuanda; Dean, Cory R; Taniguchi, Takashi; Watanabe, Kenji; Hone, James; Marianetti, Chris A; Brus, Louis E
2014-03-25
We present a detailed study of gaseous Br2 adsorption and charge transfer on graphene, combining in situ Raman spectroscopy and density functional theory (DFT). When graphene is encapsulated by hexagonal boron nitride (h-BN) layers on both sides, in a h-BN/graphene/h-BN sandwich structure, it is protected from doping by strongly oxidizing Br2. Graphene supported on only one side by h-BN shows strong hole doping by adsorbed Br2. Using Raman spectroscopy, we determine the graphene charge density as a function of pressure. DFT calculations reveal the variation in charge transfer per adsorbed molecule as a function of coverage. The molecular adsorption isotherm (coverage versus pressure) is obtained by combining Raman spectra with DFT calculations. The Fowler-Guggenheim isotherm fits better than the Langmuir isotherm. The fitting yields the adsorption equilibrium constant (∼0.31 Torr(-1)) and repulsive lateral interaction (∼20 meV) between adsorbed Br2 molecules. The Br2 molecule binding energy is ∼0.35 eV. We estimate that at monolayer coverage each Br2 molecule accepts 0.09 e- from single-layer graphene. If graphene is supported on SiO2 instead of h-BN, a threshold pressure is observed for diffusion of Br2 along the (somewhat rough) SiO2/graphene interface. At high pressure, graphene supported on SiO2 is doped by adsorbed Br2 on both sides.
Electrochemical Single-Molecule Transistors with Optimized Gate Coupling
DEFF Research Database (Denmark)
Osorio, Henrry M.; Catarelli, Samantha; Cea, Pilar
2015-01-01
Electrochemical gating at the single molecule level of viologen molecular bridges in ionic liquids is examined. Contrary to previous data recorded in aqueous electrolytes, a clear and sharp peak in the single molecule conductance versus electrochemical potential data is obtained in ionic liquids....... These data are rationalized in terms of a two-step electrochemical model for charge transport across the redox bridge. In this model the gate coupling in the ionic liquid is found to be fully effective with a modeled gate coupling parameter, ξ, of unity. This compares to a much lower gate coupling parameter...
Thunderstorm Charge Structures Producing Negative Gigantic Jets
Boggs, L.; Liu, N.; Riousset, J. A.; Shi, F.; Rassoul, H.
2016-12-01
Here we present observational and modeling results that provide insight into thunderstorm charge structures that produce gigantic jet discharges. The observational results include data from four different thunderstorms producing 9 negative gigantic jets from 2010 to 2014. We used radar, very high frequency (VHF) and low frequency (LF) lightning data to analyze the storm characteristics, charge structures, and lightning activity when the gigantic jets emerged from the parent thunderstorms. A detailed investigation of the evolution of one of the charge structures by analyzing the VHF data is also presented. The newly found charge structure obtained from the observations was analyzed with fractal modeling and compared with previous fractal modeling studies [Krehbiel et al., Nat. Geosci., 1, 233-237, 2008; Riousset et al., JGR, 115, A00E10, 2010] of gigantic jet discharges. Our work finds that for normal polarity thunderstorms, gigantic jet charge structures feature a narrow upper positive charge region over a wide middle negative charge region. There also likely exists a `ring' of negative screening charge located around the perimeter of the upper positive charge. This is different from previously thought charge structures of the storms producing gigantic jets, which had a very wide upper positive charge region over a wide middle negative charge region, with a very small negative screening layer covering the cloud top. The newly found charge structure results in leader discharge trees in the fractal simulations that closely match the parent flashes of gigantic jets inside and outside the thundercloud. The previously used charge structures, while vital to the understanding of gigantic jet initiation and the role of charge imbalances inside the cloud, do not produce leader discharge trees that agree with observed gigantic jet discharges.Finally, the newly discovered gigantic jet charge structures are formed near the end of a convective pulse [Meyer et al., JGR, 118
Improved Interaction Potentials for Charged Residues in Proteins
DEFF Research Database (Denmark)
Kepp, Kasper Planeta
2008-01-01
Electrostatic interactions dominate the structure and free energy of biomolecules. To obtain accurate free energies involving charged groups from molecular simulations, OPLS-AA parameters have been reoptimized using Monte Carlo free energy perturbation. New parameters fit a self-consistent, exper......Electrostatic interactions dominate the structure and free energy of biomolecules. To obtain accurate free energies involving charged groups from molecular simulations, OPLS-AA parameters have been reoptimized using Monte Carlo free energy perturbation. New parameters fit a self......, TIP4P or TIP3P; i.e., each water model requires specific water-charged molecule interaction potentials. New models (models 1 and 3) are thus described for both water models. Uncertainties in relative free energies of charged residues are ~2 kcal/mol with the new parameters, due to variations in system...
Peng, Yifeng; Tellier, Liane E; Temenoff, Johnna S
2016-08-16
Sustained release of anti-inflammatory agents remains challenging for small molecule drugs due to their low molecular weight and hydrophobicity. Therefore, the goal of this study was to control the release of a small molecule anti-inflammatory agent, crystal violet (CV), from hydrogels fabricated with heparin, a highly sulfated glycosaminoglycan capable of binding positively-charged molecules such as CV. In this system, both electrostatic interactions between heparin and CV and hydrogel degradation were tuned simultaneously by varying the level of heparin sulfation and varying the amount of dithiothreitol within hydrogels, respectively. It was found that heparin sulfation significantly affected CV release, whereby more sulfated heparin hydrogels (Hep and Hep(-N)) released CV with near zero-order release kinetics (R-squared values between 0.96-0.99). Furthermore, CV was released more quickly from fast-degrading hydrogels than slow-degrading hydrogels, providing a method to tune total CV release between 5-15 days while maintaining linear release kinetics. In particular, N-desulfated heparin hydrogels exhibited efficient CV loading (∼90% of originally included CV), near zero-order CV release kinetics, and maintenance of CV bioactivity after release, making this hydrogel formulation a promising CV delivery vehicle for a wide range of inflammatory diseases.
Theoretical treatment of charge transfer processes of relevance to astrophysics
Energy Technology Data Exchange (ETDEWEB)
Krstic, P.S.; Stancil, P.C.; Schultz, D.R.
1997-12-01
Charge transfer is an important process in many astrophysical and atmospheric environments. While numerous experimental and theoretical studies exist for H and He targets, data on other targets, particularly metals and molecules, are sparse. Using a variety of theoretical methods and computational techniques the authors are developing methods to estimate the cross sections for electron capture (charge transfer) in slow collisions of low charge state ions with heavy (Mg, Ca, Fe, Co, Ni and Zn) neutrals. In this ongoing work particular attention is paid to ascertaining the importance of double electron capture.
Theoretical treatment of charge transfer processes of relevance to astrophysics
International Nuclear Information System (INIS)
Krstic, P.S.; Stancil, P.C.; Schultz, D.R.
1997-12-01
Charge transfer is an important process in many astrophysical and atmospheric environments. While numerous experimental and theoretical studies exist for H and He targets, data on other targets, particularly metals and molecules, are sparse. Using a variety of theoretical methods and computational techniques the authors are developing methods to estimate the cross sections for electron capture (charge transfer) in slow collisions of low charge state ions with heavy (Mg, Ca, Fe, Co, Ni and Zn) neutrals. In this ongoing work particular attention is paid to ascertaining the importance of double electron capture
Garapati, Sriramya; Burns, Colin S
2014-03-01
Use of the 4-pyridylmethyl ester group for side-chain protection of glutamic acid residues in solid-phase peptide synthesis enables switching of the charge state of a peptide from negative to positive, thus making detection by positive ion mode ESI-MS possible. The pyridylmethyl ester moiety is readily removed from peptides in high yield by hydrogenation. Combining the 4-pyridylmethyl ester protecting group with benzyl ester protection reduces the number of the former needed to produce a net positive charge and allows for purification by RP HPLC. This protecting group is useful in the synthesis of highly acidic peptide sequences, which are often beset by problems with purification by standard RP HPLC and characterization by ESI-MS. Copyright © 2014 European Peptide Society and John Wiley & Sons, Ltd.
Controllability of the Coulomb charging energy in close-packed nanoparticle arrays.
Duan, Chao; Wang, Ying; Sun, Jinling; Guan, Changrong; Grunder, Sergio; Mayor, Marcel; Peng, Lianmao; Liao, Jianhui
2013-11-07
We studied the electronic transport properties of metal nanoparticle arrays, particularly focused on the Coulomb charging energy. By comparison, we confirmed that it is more reasonable to estimate the Coulomb charging energy using the activation energy from the temperature-dependent zero-voltage conductance. Based on this, we systematically and comprehensively investigated the parameters that could be used to tune the Coulomb charging energy in nanoparticle arrays. We found that four parameters, including the particle core size, the inter-particle distance, the nearest neighboring number, and the dielectric constant of ligand molecules, could significantly tune the Coulomb charging energy.
Charge-density matching in organic-inorganic uranyl compounds
International Nuclear Information System (INIS)
Krivovichev, S.V.; Krivovichev, S.V.; Tananaev, I.G.; Myasoedov, B.F.
2007-01-01
Single crystals of [C 10 H 26 N 2 ][(UO 2 )(SeO 4 ) 2 (H 2 O)](H 2 SeO 4 ) 0.85 (H 2 O) 2 (1), [C 10 H 26 N 2 ][(UO 2 )(SeO 4 ) 2 ] (H 2 SeO 4 ) 0.50 (H 2 O) (2), and [C 8 H 20 N] 2 [(UO 2 )(SeO 4 ) 2 (H 2 O)] (H 2 O) (3) were prepared by evaporation from aqueous solution of uranyl nitrate, selenic acid and the respective amines. The structures of the compounds have been solved by direct methods and structural models have been obtained. The structures of the compounds 1, 2, and 3 contain U and Se atoms in pentagonal bipyramidal and tetrahedral coordinations, respectively. The UO 7 and SeO 4 polyhedra polymerize by sharing common O atoms to form chains (compound 1) or sheets (compounds 2 and 3). In the structure of 1, the layers consisting of hydrogen-bonded [UO 2 (SeO 4 ) 2 (H 2 O)] 2- chains are separated by mixed organic-inorganic layers comprising from [NH 3 (CH 2 ) 10 NH 3 ] 2+ molecules, H 2 O molecules, and disordered electroneutral (H 2 SeO 4 ) groups. The structure of 2 has a similar architecture but a purely inorganic layer is represented by a fully connected [UO 2 (SeO 4 ) 2 ] 2- sheet. The structure of 3 does not contain disordered (H 2 SeO 4 ) groups but is based upon alternating [UO 2 (SeO 4 ) 2 (H 2 O)] 2- sheets and 1.5-nm-thick organic blocks consisting of positively charged protonated octylamine molecules, [NH 3 (CH 2 ) 7 CH 3 ] + . The structures may be considered as composed of anionic inorganic sheets (2D blocks) and cationic organic blocks self-organized according to competing hydrophilic-hydrophobic interactions. Analysis of the structures allows us to conclude that the charge-density matching principle is observed in uranyl compounds. In order to satisfy some basic peculiarities of uranyl (in general, actinyl) chemistry, it requires specific additional mechanisms: (a) in long-chain-amine-templated compounds, protonated amine molecules inter-digitate; (b) in long-chain-diamine-templated compounds, incorporation of acid-water interlayers into
Small molecule hydration energy and entropy from 3D-RISM
Johnson, J.; Case, D. A.; Yamazaki, T.; Gusarov, S.; Kovalenko, A.; Luchko, T.
2016-09-01
Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases.
Small molecule hydration energy and entropy from 3D-RISM
International Nuclear Information System (INIS)
Johnson, J; Case, D A; Yamazaki, T; Gusarov, S; Kovalenko, A; Luchko, T
2016-01-01
Implicit solvent models offer an attractive way to estimate the effects of a solvent environment on the properties of small or large solutes without the complications of explicit simulations. One common test of accuracy is to compute the free energy of transfer from gas to liquid for a variety of small molecules, since many of these values have been measured. Studies of the temperature dependence of these values (i.e. solvation enthalpies and entropies) can provide additional insights into the performance of implicit solvent models. Here, we show how to compute temperature derivatives of hydration free energies for the 3D-RISM integral equation approach. We have computed hydration free energies of 1123 small drug-like molecules (both neutral and charged). Temperature derivatives were also used to calculate hydration energies and entropies of 74 of these molecules (both neutral and charged) for which experimental data is available. While direct results have rather poor agreement with experiment, we have found that several previously proposed linear hydration free energy correction schemes give good agreement with experiment. These corrections also provide good agreement for hydration energies and entropies though simple extensions are required in some cases. (paper)
Conserved water molecules in bacterial serine hydroxymethyltransferases.
Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano
2015-10-01
Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Submicron position-sensitive detector
Energy Technology Data Exchange (ETDEWEB)
Pugatch, V M; Rosenfeld, A B; Litovchenko, P G; Barabash, L I; Nemets, O F; Pavlenko, Yu N; Vasiliev, Yu O [Ukrainian Academy of Sciences, Kiev (Ukraine). Inst. for Nuclear Research
1992-08-01
A method has been developed to measure precisely the coordinates of charged particles incident between adjacent strips of a strip detector. The position sensitivity of an inter-strip gap has been studied by means of a pulsed laser beam and irradiation by [alpha]-particles of a [sup 226]Ra-source. The capacitive division of charge generated by the incident particle depends on the position of its track. Its coordinates were determined by two-dimensional amplitude analysis of the charges collected by neighbouring strips. This method of coordinate determination applied to studies of spatial and energy distributions of electromagnetic as well as charged particle beams (including radioactive ion beams) of low intensity could provide the highest level of the precision limited by the track dimensions of charged particles, i.e. percents of a micrometer. (orig.).
Pazos, M Carolina; Castro, Miguel A; Orta, M Mar; Pavón, Esperanza; Valencia Rios, Jesús S; Alba, María D
2012-05-15
A family of organomicas was synthesized using synthetic swelling micas with high layer charge (Na(n)Si(8-n)Al(n)Mg(6)F(4)O(20)·XH(2)O, where n = 2, 3, and 4) exchanged with dodecylammonium and octadecylammonium cations. The molecular arrangement of the surfactant was elucidated on the basis on XRD patterns and DTA. The ordering conformation of the surfactant molecules into the interlayer space of micas was investigated by (13)C, (27)Al, and (29)Si MAS NMR. The arrangement of alkylammonium ions in these high-charge synthetic micas depends on the combined effects of the layer charge of the mica and the chain length of the cation. In the organomicas with dodecylammonium, a transition from a parallel layer to a bilayer-paraffin arrangement is observed when the layer charge of the mica increases. However, when octadecylammonium is the interlayer cation, the molecular arrangement of the surfactant was found to follow the bilayer-paraffin model for all values of layer charge. The amount of ordered conformation all-trans is directly proportional of layer charge.
International Nuclear Information System (INIS)
Cardia, R.; Malloci, G.; Bosin, A.; Serra, G.; Cappellini, G.
2016-01-01
We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.
Energy Technology Data Exchange (ETDEWEB)
Cardia, R. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy); Malloci, G., E-mail: giuliano.malloci@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Bosin, A.; Serra, G. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Cappellini, G., E-mail: giancarlo.cappellini@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy)
2016-10-20
We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.
Koole, Max; Thijssen, Jos M.; Valkenier, Hennie; Hummelen, Jan C.; Zant, Herre S. J. van der
2015-08-01
It is understood that molecular conjugation plays an important role in charge transport through single-molecule junctions. Here, we investigate electron transport through an anthraquinone based single-molecule three-terminal device. With the use of an electric-field induced by a gate electrode, the molecule is reduced resulting into a ten-fold increase in the off-resonant differential conductance. Theoretical calculations link the change in differential conductance to a reduction-induced change in conjugation, thereby lifting destructive interference of transport pathways.
Alcohol molecules adsorption on graphane nanosheets - A first-principles investigation
Nagarajan, V.; Chandiramouli, R.
2018-05-01
The geometric structure, electronic and adsorption properties of methanol, ethanol and 1-propanol molecules on hydrogenated graphene (graphane) were investigated using first-principles calculations. The stability of graphane base material is confirmed using formation energy and phonon band structures. The adsorption of alcohol molecules on bare graphane and hydrogen vacant graphane nanosheet is found to be prominent and the selectivity of alcohol molecules can be achieved using bare or hydrogen vacant graphane nanosheet. Moreover, the interaction of alcohol molecules on bare and hydrogen vacant graphane nanosheets is studied using the adsorption energy, energy band gap variation, Bader charge transfer and average energy band gap variation. The adsorption energy ranges from -0.149 to -0.383 eV upon alcohol adsorption. The energy gap varies from 4.71 to 2.62 eV for bare graphane and from 4.02 to 3.60 eV for hydrogen vacant graphane nanosheets upon adsorption of alcohol molecules. The adsorption properties of alcohol molecules provide useful information for the possible application of graphane nanosheet as a base material for the detection of alcohol molecules.
Zakim, D; Eibl, H
1992-07-05
Studies of the mechanism of lipid-induced regulation of the microsomal enzyme UDP-glucuronosyltransferase have been extended by examining the influence of charge within the polar region on the ability of lipids to activate delipidated pure enzyme. The effects of net negative charge, of charge separation in phosphocholine, and of the distribution of charge in the polar region of lipids were studied using the GT2p isoform isolated from pig liver. Prior experiments have shown that lipids with net negative charge inhibit the enzyme (Zakim, D., Cantor, M., and Eibl, H. (1988) J. Biol. Chem. 263, 5164-5169). The current experiments show that the extent of inhibition on a molar basis increases as the net negative charge increases from -1 to -2. The inhibitory effect of negatively charged lipids is on the functional state of the enzyme and is not due to electrostatic repulsion of negatively charged substrates of the enzyme. Although the inhibitory effect of net negative charge is removed when negative charge is balanced by a positive charge due to a quaternary nitrogen, neutrality of the polar region is not a sufficient condition for activation of the enzyme. In addition to a balance of charge between Pi and the quaternary nitrogen, the distance between the negative and positive charges and the orientation of the dipole created by them are critical for activation of GT2p. The negative and positive charges must be separated by the equivalent of three -CH2- groups for optimal activation by a lipid. Shortening this distance by one -CH2- unit leads to a lipid that is ineffective in activating the enzyme. Reversal of the orientation of the dipole in which the negative charge is on the polymethylene side of the lipid-water interface and the positive charge extends into water also produces a lipid that is not effective for activating GT2p. On the other hand, lipids with phosphoserine as the polar region, which has the "normal" P-N distance but carries a net negative charge, do
Xie, Yongjing; Min, Soyoung; Harte, Níal P; Kirk, Hannah; O'Brien, John E; Voorheis, H Paul; Svanborg, Catharina; Hun Mok, K
2013-01-01
Human α-lactalbumin made lethal to tumor cells (HAMLET) and its analogs are partially unfolded protein-oleic acid (OA) complexes that exhibit selective tumoricidal activity normally absent in the native protein itself. To understand the nature of the interaction between protein and OA moieties, charge-specific chemical modifications of lysine side chains involving citraconylation, acetylation, and guanidination were employed and the biophysical and biological properties were probed. Upon converting the original positively-charged lysine residues to negatively-charged citraconyl or neutral acetyl groups, the binding of OA to protein was eliminated, as were any cytotoxic activities towards osteosarcoma cells. Retention of the positive charges by converting lysine residues to homoarginine groups (guanidination); however, yielded unchanged binding of OA to protein and identical tumoricidal activity to that displayed by the wild-type α-lactalbumin-oleic acid complex. With the addition of OA, the wild-type and guanidinated α-lactalbumin proteins underwent substantial conformational changes, such as partial unfolding, loss of tertiary structure, but retention of secondary structure. In contrast, no significant conformational changes were observed in the citraconylated and acetylated α-lactalbumins, most likely because of the absence of OA binding. These results suggest that electrostatic interactions between the positively-charged basic groups on α-lactalbumin and the negatively-charged carboxylate groups on OA molecules play an essential role in the binding of OA to α-lactalbumin and that these interactions appear to be as important as hydrophobic interactions. Copyright © 2012 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Edward V. Sanin
2014-01-01
Full Text Available The paper deals with the spectral properties of dyes with interfragmental charge transfer, in particular, derivatives of 2-(3-coumaroylbenzopyrylium (CBP perchlorates. The positions of long-wavelength absorption and emission bands, quantum yields, and lifetimes of fluorescence were measured, mostly in aprotic solvents. Regression analysis of the relationship between the spectral characteristics of CBP and the main solvent parameters (polarity, polarisability, nucleophilicity, and electrophilicity was carried out. It was found that the characteristics of CBP depend mainly on two solvent parameters—polarity and/or nucleophilicity. An increase in these parameters results in a hypsochromic shift of absorption bands and a decrease of lifetimes and fluorescence intensity. The positions of the emission bands can demonstrate either hypsochromism or bathochromism, depending on the nature of the substituents. The solvatofluorochromic effects are not as strong as the solvatochromic ones. We believe that the spectral behaviour of CBP can be explained by cation depolarisation and by a decrease in the stability of nucleophilic complexes with solvent molecules that is associated with interfragmental charge transfer following excitation, relaxation, and radiative deactivation of the excited state.
Energy and spectrum of BeO molecule under the electric field from different directions
Jiang, M.; Guo, F. J.; Yan, A. Y.; Zhang, C. W.; Miao, F.
2010-01-01
Based on the density functional theory DFT/ B3LYP at 6-311g level, the ground states of BeO molecule are optimized. The effects of electric field on the bond length, the system energy, the charge distribution, the energy levels, the HOMO-LUMO gaps and the infrared spectrum of BeO molecule are
Energy Technology Data Exchange (ETDEWEB)
Madjet, Mohamed E., E-mail: mmadjet@qf.org.qa; El-Mellouhi, Fedwa; Carignano, Marcelo A.; Berdiyorov, Golibjon R. [Qatar Environment and Energy Research Institute, Hamad Bin Khalifa University, Qatar Foundation, P. O. Box 5825, Doha (Qatar)
2016-04-28
We calculated the partial charges in methylammonium (MA) lead-iodide perovskite CH{sub 3}NH{sub 3}PbI{sub 3} in its different crystalline phases using different first-principles electronic charge partitioning approaches, including the Bader, ChelpG, and density-derived electrostatic and chemical (DDEC) schemes. Among the three charge partitioning methods, the DDEC approach provides chemically intuitive and reliable atomic charges for this material, which consists of a mixture of transition metals, halide ions, and organic molecules. The DDEC charges are also found to be robust against the use of hybrid functionals and/or upon inclusion of spin–orbit coupling or dispersive interactions. We calculated explicitly the atomic charges with a special focus on the dipole moment of the MA molecules within the perovskite structure. The value of the dipole moment of the MA is reduced with respect to the isolated molecule due to charge redistribution involving the inorganic cage. DDEC charges and dipole moment of the organic part remain nearly unchanged upon its rotation within the octahedral cavities. Our findings will be of both fundamental and practical importance, as the accurate and consistent determination of the atomic charges is important in order to understand the average equilibrium distribution of the electrons and to help in the development of force fields for larger scale atomistic simulations to describe static, dynamic, and thermodynamic properties of the material.
DEFF Research Database (Denmark)
Huang, Cancan; Chen, Songjie; Ørnsø, Kristian Baruël
2015-01-01
Tuning charge transport at the single‐molecule level plays a crucial role in the construction of molecular electronic devices. Introduced herein is a promising and operationally simple approach to tune two distinct charge‐transport pathways through a cruciform molecule. Upon in situ cleavage of t...
Floating liquid bridge charge dynamics
Teschke, Omar; Soares, David Mendez; Gomes, Whyllerson Evaristo; Valente Filho, Juracyr Ferraz
2016-01-01
The interaction of liquid with electric fields is investigated in a configuration where up to 13 kV are applied between electrodes resulting in a 106 V/m electric field in the capillaries and where there is the formation of a free-standing fluid bridge in the interelectrode gap. The Mott-Gurney equation was fitted to the measured ionization current vs applied voltage curve which indicates that the ionization rate at the high-voltage anode electrode dimethylsulfoxide (DMSO) interface and space charging in the interelectrode gap determine the floating liquid bridge current for a given cathode-to-anode voltage. Space charge effects were measured in the cathode becker and also at the liquid bridge since the ionized charges at the anode migrate to the bridge outer surface and decrease the interfacial tension from 43 mJ/m2 to 29 mJ/m2. Two distinct structural regions then form the bridge, a charged plastic (bulk modulus ˜100 MPa) conducting outer layer with a surface conductivity of ˜10-9 Ω-1, which shapes and supports the floating fluid structure, and an inner liquid cylinder, where DMSO molecules flow.
A storage ring for neutral molecules
Crompvoets, F.M.H.
2005-01-01
Time-varying inhomogeneous electric fields can be used to manipulate the motion of neutral molecules in phase-space, i.e., position-momentum space, via their electric dipole moment. A theoretical background is given on the motion of the molecules in phase-space. As the forces exerted on the
Dynamic Colloidal Molecules Maneuvered by Light-Controlled Janus Micromotors.
Gao, Yirong; Mou, Fangzhi; Feng, Yizheng; Che, Shengping; Li, Wei; Xu, Leilei; Guan, Jianguo
2017-07-12
In this work, we propose and demonstrate a dynamic colloidal molecule that is capable of moving autonomously and performing swift, reversible, and in-place assembly dissociation in a high accuracy by manipulating a TiO 2 /Pt Janus micromotor with light irradiation. Due to the efficient motion of the TiO 2 /Pt Janus motor and the light-switchable electrostatic interactions between the micromotor and colloidal particles, the colloidal particles can be captured and assembled one by one on the fly, subsequently forming into swimming colloidal molecules by mimicking space-filling models of simple molecules with central atoms. The as-demonstrated dynamic colloidal molecules have a configuration accurately controlled and stabilized by regulating the time-dependent intensity of UV light, which controls the stop-and-go motion of the colloidal molecules. The dynamic colloidal molecules are dissociated when the light irradiation is turned off due to the disappearance of light-switchable electrostatic interaction between the motor and the colloidal particles. The strategy for the assembly of dynamic colloidal molecules is applicable to various charged colloidal particles. The simulated optical properties of a dynamic colloidal molecule imply that the results here may provide a novel approach for in-place building functional microdevices, such as microlens arrays, in a swift and reversible manner.
Bianchi, Federico; Praplan, Arnaud P; Sarnela, Nina; Dommen, Josef; Kürten, Andreas; Ortega, Ismael K; Schobesberger, Siegfried; Junninen, Heikki; Simon, Mario; Tröstl, Jasmin; Jokinen, Tuija; Sipilä, Mikko; Adamov, Alexey; Amorim, Antonio; Almeida, Joao; Breitenlechner, Martin; Duplissy, Jonathan; Ehrhart, Sebastian; Flagan, Richard C; Franchin, Alessandro; Hakala, Jani; Hansel, Armin; Heinritzi, Martin; Kangasluoma, Juha; Keskinen, Helmi; Kim, Jaeseok; Kirkby, Jasper; Laaksonen, Ari; Lawler, Michael J; Lehtipalo, Katrianne; Leiminger, Markus; Makhmutov, Vladimir; Mathot, Serge; Onnela, Antti; Petäjä, Tuukka; Riccobono, Francesco; Rissanen, Matti P; Rondo, Linda; Tomé, António; Virtanen, Annele; Viisanen, Yrjö; Williamson, Christina; Wimmer, Daniela; Winkler, Paul M; Ye, Penglin; Curtius, Joachim; Kulmala, Markku; Worsnop, Douglas R; Donahue, Neil M; Baltensperger, Urs
2014-12-02
We investigated the nucleation of sulfuric acid together with two bases (ammonia and dimethylamine), at the CLOUD chamber at CERN. The chemical composition of positive, negative, and neutral clusters was studied using three Atmospheric Pressure interface-Time Of Flight (APi-TOF) mass spectrometers: two were operated in positive and negative mode to detect the chamber ions, while the third was equipped with a nitrate ion chemical ionization source allowing detection of neutral clusters. Taking into account the possible fragmentation that can happen during the charging of the ions or within the first stage of the mass spectrometer, the cluster formation proceeded via essentially one-to-one acid-base addition for all of the clusters, independent of the type of the base. For the positive clusters, the charge is carried by one excess protonated base, while for the negative clusters it is carried by a deprotonated acid; the same is true for the neutral clusters after these have been ionized. During the experiments involving sulfuric acid and dimethylamine, it was possible to study the appearance time for all the clusters (positive, negative, and neutral). It appeared that, after the formation of the clusters containing three molecules of sulfuric acid, the clusters grow at a similar speed, independent of their charge. The growth rate is then probably limited by the arrival rate of sulfuric acid or cluster-cluster collision.
Investigation on Single-Molecule Junctions Based on Current–Voltage Characteristics
Directory of Open Access Journals (Sweden)
Yuji Isshiki
2018-02-01
Full Text Available The relationship between the current through an electronic device and the voltage across its terminals is a current–voltage characteristic (I–V that determine basic device performance. Currently, I–V measurement on a single-molecule scale can be performed using break junction technique, where a single molecule junction can be prepared by trapping a single molecule into a nanogap between metal electrodes. The single-molecule I–Vs provide not only the device performance, but also reflect information on energy dispersion of the electronic state and the electron-molecular vibration coupling in the junction. This mini review focuses on recent representative studies on I–Vs of the single molecule junctions that cover investigation on the single-molecule diode property, the molecular vibration, and the electronic structure as a form of transmission probability, and electronic density of states, including the spin state of the single-molecule junctions. In addition, thermoelectronic measurements based on I–Vs and identification of the charged carriers (i.e., electrons or holes are presented. The analysis in the single-molecule I–Vs provides fundamental and essential information for a better understanding of the single-molecule science, and puts the single molecule junction to more practical use in molecular devices.
Infrared intensities and charge mobility in hydrogen bonded complexes
Energy Technology Data Exchange (ETDEWEB)
Galimberti, Daria; Milani, Alberto; Castiglioni, Chiara [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta,” Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)
2013-08-21
The analytical model for the study of charge mobility in the molecules presented by Galimberti et al.[J. Chem. Phys. 138, 164115 (2013)] is applied to hydrogen bonded planar dimers. Atomic charges and charge fluxes are obtained from density functional theory computed atomic polar tensors and related first derivatives, thus providing an interpretation of the IR intensity enhancement of the X–H stretching band observed upon aggregation. Our results show that both principal and non-principal charge fluxes have an important role for the rationalization of the spectral behavior; moreover, they demonstrate that the modulation of the charge distribution during vibrational motions of the –XH⋯Y– fragment is not localized exclusively on the atoms directly involved in hydrogen bonding. With these premises we made some correlations between IR intensities, interaction energies, and charge fluxes. The model was tested on small dimers and subsequently to the bigger one cytosine-guanine. Thus, the model can be applied to complex systems.
Dosimeter charging and/or reading apparatus
International Nuclear Information System (INIS)
Fine, L.T.; Jackson, T.P.
1980-01-01
A device is disclosed for charging and/or reading a capacitor associated with an electrometer incorporated in a radiation dosimeter for the purpose of initializing or ''zeroing'', the dosimeter at the commencement of a radiation measurement cycle or reading it at any time thereafter. The dosimeter electrometer has a movable electrode the position of which is indicative of the charge remaining on the dosimeter capacitor and in turn the amount of radiation incident on the dosimeter since it was zeroed. The charging device also includes means for discharging, immediately upon conclusion of the dosimeter capacitor charging operation, stray capacitance inherent in the dosimeter by reason of its mechanical construction. The charge on the stray capacitance, if not discharged at the conclusion of the dosimeter capacitor charging operation, leaks off during the measurement cycle, introducing measurement errors. A light source and suitable switch means are provided for automatically illuminating the movable electrode of the dosimeter electrometer as an incident to charging the dosimeter capacitor to facilitate reading the initial, or ''zero'', position of the movable electrometer electrode after the dosimeter capacitor has been charged and the stray capacitance discharged. Also included is a manually actuatable switch means, which is operable independently of the aforementioned automatic switch means, to energize the lamp and facilitate reading of the dosimeter without charging
Solid-state nanopores for scanning single molecules and mimicking biology
Kowalczyk, S.W.
2011-01-01
Solid-state nanopores, nanometer-size holes in a thin synthetic membrane, are a versatile tool for the detection and manipulation of charged biomolecules. This thesis describes mostly experimental work on DNA translocation through solid-state nanopores, which we study at the single-molecule level.
Communication: On the isotope anomaly of nuclear quadrupole coupling in molecules
Filatov, Michael; Zou, Wenli; Cremer, Dieter
2012-10-01
The dependence of the nuclear quadrupole coupling constants (NQCC) on the interaction between electrons and a nucleus of finite size is theoretically analyzed. A deviation of the ratio of the NQCCs obtained from two different isotopomers of a molecule from the ratio of the corresponding bare nuclear electric quadrupole moments, known as quadrupole anomaly, is interpreted in terms of the logarithmic derivatives of the electric field gradient at the nuclear site with respect to the nuclear charge radius. Quantum chemical calculations based on a Dirac-exact relativistic methodology suggest that the effect of the changing size of the Au nucleus in different isotopomers can be observed for Au-containing molecules, for which the predicted quadrupole anomaly reaches values of the order of 0.1%. This is experimentally detectable and provides an insight into the charge distribution of non-spherical nuclei.
Borophene as a Promising Material for Charge-Modulated Switchable CO2 Capture.
Tan, Xin; Tahini, Hassan A; Smith, Sean C
2017-06-14
Ideal carbon dioxide (CO 2 ) capture materials for practical applications should bind CO 2 molecules neither too weakly to limit good loading kinetics nor too strongly to limit facile release. Although charge-modulated switchable CO 2 capture has been proposed to be a controllable, highly selective, and reversible CO 2 capture strategy, the development of a practical gas-adsorbent material remains a great challenge. In this study, by means of density functional theory (DFT) calculations, we have examined the possibility of conductive borophene nanosheets as promising sorbent materials for charge-modulated switchable CO 2 capture. Our results reveal that the binding strength of CO 2 molecules on negatively charged borophene can be significantly enhanced by injecting extra electrons into the adsorbent. At saturation CO 2 capture coverage, the negatively charged borophene achieves CO 2 capture capacities up to 6.73 × 10 14 cm -2 . In contrast to the other CO 2 capture methods, the CO 2 capture/release processes on negatively charged borophene are reversible with fast kinetics and can be easily controlled via switching on/off the charges carried by borophene nanosheets. Moreover, these negatively charged borophene nanosheets are highly selective for separating CO 2 from mixtures with CH 4 , H 2 , and/or N 2 . This theoretical exploration will provide helpful guidance for identifying experimentally feasible, controllable, highly selective, and high-capacity CO 2 capture materials with ideal thermodynamics and reversibility.
Developing Density of Laser-Cooled Neutral Atoms and Molecules in a Linear Magnetic Trap
Velasquez, Joe, III; Walstrom, Peter; di Rosa, Michael
2013-05-01
In this poster we show that neutral particle injection and accumulation using laser-induced spin flips may be used to form dense ensembles of ultracold magnetic particles, i.e., laser-cooled paramagnetic atoms and molecules. Particles are injected in a field-seeking state, are switched by optical pumping to a field-repelled state, and are stored in the minimum-B trap. The analogous process in high-energy charged-particle accumulator rings is charge-exchange injection using stripper foils. The trap is a linear array of sextupoles capped by solenoids. Particle-tracking calculations and design of our linear accumulator along with related experiments involving 7Li will be presented. We test these concepts first with atoms in preparation for later work with selected molecules. Finally, we present our preliminary results with CaH, our candidate molecule for laser cooling. This project is funded by the LDRD program of Los Alamos National Laboratory.
International Nuclear Information System (INIS)
Uchikawa, Sadao.
1978-01-01
Purpose: To enable continuous fuel discharging and charging steps in a bwr type reactor by effecting positioning only for once by providing a plurality of fuel assembly grippers and their drives co-axially on a rotatable surface. Constitution: A plurality of fuel assembly grippers and their drives are provided co-axially on a rotatable surface. For example, a gripper A, a drive B, a gripper C and a drive D are arranged co-axially in symmetric positions on a disk rotated on rails by wheels and rotational drives. A new fuel in a fuel pool is gripped by the gripper A and transported above the reactor core. Then, the disk is positioned so that the gripper C can grip the spent fuel in the core, and the fuel to be discharged is gripped and raised by the gripper C. Then the disk is rotated by 180 0 and the new fuel in the gripper A is charged into the position from which the old fuel has been discharged and, finally, the discharged fuel is sent to the fuel pool for storage. (Seki, T.)
Charge transport through molecular rods with reduced pi-conjugation.
Lörtscher, Emanuel; Elbing, Mark; Tschudy, Meinrad; von Hänisch, Carsten; Weber, Heiko B; Mayor, Marcel; Riel, Heike
2008-10-24
A series of oligophenylene rods of increasing lengths is synthesized to investigate the charge-transport mechanisms. Methyl groups are attached to the phenyl rings to weaken the electronic overlap of the pi-subsystems along the molecular backbones. Out-of-plane rotation of the phenyl rings is confirmed in the solid state by means of X-ray analysis and in solution by using UV/Vis spectroscopy. The influence of the reduced pi-conjugation on the resonant charge transport is studied at the single-molecule level by using the mechanically controllable break-junction technique. Experiments are performed under ultra-high-vacuum conditions at low temperature (50 K). A linear increase of the conductance gap with increasing number of phenyl rings (from 260 meV for one ring to 580 meV for four rings) is revealed. In addition, the absolute conductance of the first resonant peaks does not depend on the length of the molecular wire. Resonant transport through the first molecular orbital is found to be dominated by charge-carrier injection into the molecule, rather than by the intrinsic resistance of the molecular wire length.
Electronic and transport properties of Cobalt-based valence tautomeric molecules and polymers
Chen, Yifeng; Calzolari, Arrigo; Buongiorno Nardelli, Marco
2011-03-01
The advancement of molecular spintronics requires further understandings of the fundamental electronic structures and transport properties of prototypical spintronics molecules and polymers. Here we present a density functional based theoretical study of the electronic structures of Cobalt-based valence tautomeric molecules Co III (SQ)(Cat)L Co II (SQ)2 L and their polymers, where SQ refers to the semiquinone ligand, and Cat the catecholate ligand, while L is a redox innocent backbone ligand. The conversion from low-spin Co III ground state to high-spin Co II excited state is realized by imposing an on-site potential U on the Co atom and elongating the Co-N bond. Transport properties are subsequently calculated by extracting electronic Wannier functions from these systems and computing the charge transport in the ballistic regime using a Non-Equilibrium Green's Function (NEGF) approach. Our transport results show distinct charge transport properties between low-spin ground state and high-spin excited state, hence suggesting potential spintronics devices from these molecules and polymers such as spin valves.
Modification of the properties of porous silicon on adsorption of iodine molecules
International Nuclear Information System (INIS)
Vorontsov, A. S.; Osminkina, L. A.; Tkachenko, A. E.; Konstantinova, E. A.; Elenskii, V. G.; Timoshenko, V. Yu.; Kashkarov, P. K.
2007-01-01
Infrared spectroscopy and electron spin resonance measurements are used to study the properties of porous silicon layers on adsorption of the I 2 iodine molecules. The layers are formed on the p-an n-Si single-crystal wafers. It is established that, in the atmosphere of I 2 molecules, the charge-carrier concentration in the layers produced on the p-type wafers can be noticeably increased: the concentration of holes can attain values on the order of ∼10 18 -10 19 cm -3 . In porous silicon layers formed on the n-type wafers, the adsorption-induced inversion of the type of charge carriers and the partial substitution of silicon-hydrogen bonds by silicon-iodine bonds are observed. A decrease in the concentration of surface paramagnetic defects, P b centers, is observed in the samples with adsorbed iodine. The experimental data are interpreted in the context of the model in which it is assumed that both deep and shallow acceptor states are formed at the surface of silicon nanocrystals upon the adsorption of I 2 molecules
Amine reactivity with charged sulfuric acid clusters
Directory of Open Access Journals (Sweden)
B. R. Bzdek
2011-08-01
Full Text Available The distribution of charged species produced by electrospray of an ammonium sulfate solution in both positive and negative polarities is examined using Fourier transform ion cyclotron resonance mass spectrometry (FTICR-MS. Positively-charged ammonium bisulfate cluster composition differs significantly from negatively-charged cluster composition. For positively-charged clusters all sulfuric acid is neutralized to bisulfate, whereas for negatively-charged clusters the degree of sulfuric acid neutralization is cluster size-dependent. With increasing cluster size (and, therefore, a decreasing role of charge, both positively- and negatively-charged cluster compositions converge toward ammonium bisulfate. The reactivity of negatively-charged sulfuric acid-ammonia clusters with dimethylamine and ammonia is also investigated by FTICR-MS. Two series of negatively-charged clusters are investigated: [(HSO4(H2SO4x]− and [(NH4x(HSO4x+1(H2SO43]−. Dimethylamine substitution for ammonia in [(NH4 x(HSO4 x+1(H2SO43]− clusters is nearly collision-limited, and subsequent addition of dimethylamine to neutralize H2SO4 to bisulfate is within one order of magnitude of the substitution rate. Dimethylamine addition to [(HSO4 (H2SO4 x]− clusters is either not observed or very slow. The results of this study indicate that amine chemistry will be evident and important only in large ambient negative ions (>m/z 400, whereas amine chemistry may be evident in small ambient positive ions. Addition of ammonia to unneutralized clusters occurs at a rate that is ~2–3 orders of magnitude slower than incorporation of dimethylamine either by substitution or addition
Residual dust charges in discharge afterglow
International Nuclear Information System (INIS)
Coueedel, L.; Mikikian, M.; Boufendi, L.; Samarian, A. A.
2006-01-01
An on-ground measurement of dust-particle residual charges in the afterglow of a dusty plasma was performed in a rf discharge. An upward thermophoretic force was used to balance the gravitational force. It was found that positively charged, negatively charged, and neutral dust particles coexisted for more than 1 min after the discharge was switched off. The mean residual charge for 200-nm-radius particles was measured. The dust particle mean charge is about -5e at a pressure of 1.2 mbar and about -3e at a pressure of 0.4 mbar
Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo
2017-08-29
Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.
Complexation behavior of oppositely charged polyelectrolytes: Effect of charge distribution
International Nuclear Information System (INIS)
Zhao, Mingtian; Li, Baohui; Zhou, Jihan; Su, Cuicui; Niu, Lin; Liang, Dehai
2015-01-01
Complexation behavior of oppositely charged polyelectrolytes in a solution is investigated using a combination of computer simulations and experiments, focusing on the influence of polyelectrolyte charge distributions along the chains on the structure of the polyelectrolyte complexes. The simulations are performed using Monte Carlo with the replica-exchange algorithm for three model systems where each system is composed of a mixture of two types of oppositely charged model polyelectrolyte chains (EGEG) 5 /(KGKG) 5 , (EEGG) 5 /(KKGG) 5 , and (EEGG) 5 /(KGKG) 5 , in a solution including explicit solvent molecules. Among the three model systems, only the charge distributions along the chains are not identical. Thermodynamic quantities are calculated as a function of temperature (or ionic strength), and the microscopic structures of complexes are examined. It is found that the three systems have different transition temperatures, and form complexes with different sizes, structures, and densities at a given temperature. Complex microscopic structures with an alternating arrangement of one monolayer of E/K monomers and one monolayer of G monomers, with one bilayer of E and K monomers and one bilayer of G monomers, and with a mixture of monolayer and bilayer of E/K monomers in a box shape and a trilayer of G monomers inside the box are obtained for the three mixture systems, respectively. The experiments are carried out for three systems where each is composed of a mixture of two types of oppositely charged peptide chains. Each peptide chain is composed of Lysine (K) and glycine (G) or glutamate (E) and G, in solution, and the chain length and amino acid sequences, and hence the charge distribution, are precisely controlled, and all of them are identical with those for the corresponding model chain. The complexation behavior and complex structures are characterized through laser light scattering and atomic force microscopy measurements. The order of the apparent weight
Short chain molecular junctions: Charge transport versus dipole moment
International Nuclear Information System (INIS)
Ikram, I. Mohamed; Rabinal, M.K.
2015-01-01
Graphical abstract: - Highlights: • The role of dipole moment of organic molecules on molecular junctions has been studied. • Molecular junctions constituted using propargyl molecules of different dipole moments. • The electronic properties of the molecules were calculated using Gaussian software. • Junctions show varying rectification due to their varying dipole moment and orientation. - Abstract: The investigation of the influence of dipole moment of short chain organic molecules having three carbon atoms varying in end group on silicon surface was carried on. Here, we use three different molecules of propargyl series varying in dipole moment and its orientation to constitute molecular junctions. The charge transport mechanism in metal–molecules–semiconductor (MMS) junction obtained from current–voltage (I–V) characteristics shows the rectification behavior for two junctions whereas the other junction shows a weak rectification. The electronic properties of the molecules were calculated using Gaussian software package. The observed rectification behavior of these junctions is examined and found to be accounted to the orientation of dipole moment and electron cloud density distribution inside the molecules
Abgrall, N.; Anticic, T.; Antoniou, N.; Argyriades, J.; Baatar, B.; Blondel, A.; Blumer, J.; Bogusz, M.; Boldizsar, L.; Bravar, A.; Brooks, W.; Brzychczyk, J.; Bubak, A.; Bunyatov, S.A.; Busygina, O.; Cetner, T.; Choi, K.U.; Christakoglou, P.; Czopowicz, T.; Davis, N.; Diakonos, F.; Di Luise, S.; Dominik, W.; Dumarchez, J.; Engel, R.; Ereditato, A.; Esposito, L.S.; Feofilov, G.A.; Fodor, Z.; Ferrero, A.; Fulop, A.; Garrido, X.; Gazdzicki, M.; Golubeva, M.; Grebieszkow, K.; Grzeszczuk, A.; Guber, F.; Haesler, A.; Hakobyan, H.; Hasegawa, T.; Idczak, R.; Ivanov, Y.; Ivashkin, A.; Kadija, K.; Kapoyannis, A.; Katrynska, N.; Kielczewska, D.; Kikola, D.; Kim, J.H.; Kirejczyk, M.; Kisiel, J.; Kobayashi, T.; Kochebina, O.; Kolesnikov, V.I.; Kolev, D.; Kondratiev, V.P.; Korzenev, A.; Kowalski, S.; Krasnoperov, A.; Kuleshov, S.; Kurepin, A.; Lacey, R.; Lagoda, J.; Laszlo, A.; Lyubushkin, V.V.; Mackowiak-Pawlowska, M.; Majka, Z.; Malakhov, A.I.; Marchionni, A.; Marcinek, A.; Maris, I.; Marin, V.; Matulewicz, T.; Matveev, V.; Melkumov, G.L.; Meregaglia, A.; Messina, M.; Mrowczynski, St.; Murphy, S.; Nakadaira, T.; Nishikawa, K.; Palczewski, T.; Palla, G.; Panagiotou, A.D.; Paul, T.; Peryt, W.; Petukhov, O.; Planeta, R.; Pluta, J.; Popov, B.A.; Posiadala, M.; Pulawski, S.; Rauch, W.; Ravonel, M.; Renfordt, R.; Robert, A.; Rohrich, D.; Rondio, E.; Rossi, B.; Roth, M.; Rubbia, A.; Rybczynski, M.; Sadovsky, A.; Sakashita, K.; Sekiguchi, T.; Seyboth, P.; Shibata, M.; Skrzypczak, E.; Slodkowski, M.; Staszel, P.; Stefanek, G.; Stepaniak, J.; Strabel, C.; Strobele, H.; Susa, T.; Szaflik, P.; Szuba, M.; Tada, M.; Taranenko, A.; Tereshchenko, V.; Tsenov, R.; Turko, L.; Ulrich, R.; Unger, M.; Vassiliou, M.; Veberic, D.; Vechernin, V.V.; Vesztergombi, G.; Wilczek, A.; Wlodarczyk, Z.; Wojtaszek-Szwarc, A.; Yi, J.G.; Yoo, I.K.; Zambelli, L.; Zipper, W.
2012-01-01
Spectra of positively charged kaons in p+C interactions at 31 GeV/c were measured with the NA61/SHINE spectrometer at the CERN SPS. The analysis is based on the full set of data collected in 2007 with a graphite target with a thickness of 4% of a nuclear interaction length. Interaction cross sections and charged pion spectra were already measured using the same set of data. These new measurements in combination with the published ones are required to improve predictions of the neutrino flux for the T2K long baseline neutrino oscillation experiment in Japan. In particular, the knowledge of kaon production is crucial for precisely predicting the intrinsic electron neutrino component and the high energy tail of the T2K beam. The results are presented as a function of laboratory momentum in 2 intervals of the laboratory polar angle covering the range from 20 up to 240 mrad. The kaon spectra are compared with predictions of several hadron production models. Using the published...
Charged Triazole Cross-Linkers for Hyaluronan-Based Hybrid Hydrogels
Directory of Open Access Journals (Sweden)
Maike Martini
2016-09-01
Full Text Available Polyelectrolyte hydrogels play an important role in tissue engineering and can be produced from natural polymers, such as the glycosaminoglycan hyaluronan. In order to control charge density and mechanical properties of hyaluronan-based hydrogels, we developed cross-linkers with a neutral or positively charged triazole core with different lengths of spacer arms and two terminal maleimide groups. These cross-linkers react with thiolated hyaluronan in a fast, stoichiometric thio-Michael addition. Introducing a positive charge on the core of the cross-linker enabled us to compare hydrogels with the same interconnectivity, but a different charge density. Positively charged cross-linkers form stiffer hydrogels relatively independent of the size of the cross-linker, whereas neutral cross-linkers only form stable hydrogels at small spacer lengths. These novel cross-linkers provide a platform to tune the hydrogel network charge and thus the mechanical properties of the network. In addition, they might offer a wide range of applications especially in bioprinting for precise design of hydrogels.
A model with charges and polarizability for CS2 in an ionic liquid
Indian Academy of Sciences (India)
RUTH M LYNDEN-BELL
the static electrostatic distribution in the CS2 molecule with 7 charged sites and anisotropic polarizability on the carbon site and isotropic .... the charges modified to reproduce the molecular quad- ... face at 1.5 times the van der Waals radii from the nuclei ..... shows the probability distribution of induced dipoles on the C site ...
Surface single-molecule dynamics controlled by entropy at low temperatures
Gehrig, J. C.; Penedo, M.; Parschau, M.; Schwenk, J.; Marioni, M. A.; Hudson, E. W.; Hug, H. J.
2017-02-01
Configuration transitions of individual molecules and atoms on surfaces are traditionally described using an Arrhenius equation with energy barrier and pre-exponential factor (attempt rate) parameters. Characteristic parameters can vary even for identical systems, and pre-exponential factors sometimes differ by orders of magnitude. Using low-temperature scanning tunnelling microscopy (STM) to measure an individual dibutyl sulfide molecule on Au(111), we show that the differences arise when the relative position of tip apex and molecule changes by a fraction of the molecule size. Altering the tip position on that scale modifies the transition's barrier and attempt rate in a highly correlated fashion, which results in a single-molecular enthalpy-entropy compensation. Conversely, appropriately positioning the STM tip allows selecting the operating point on the compensation line and modifying the transition rates. The results highlight the need to consider entropy in transition rates of single molecules, even at low temperatures.
Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.
Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar
2014-05-01
Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zeng, Jia; Eckenrode, Heather M; Dai, Hai-Lung; Wilhelm, Michael J
2015-03-01
The adsorption and transport of hydrophobic molecules at the membrane surface of pre- and post-DMSO induced differentiated murine erythroleukemia (MEL) cells were examined by time- and wavelength-resolved second harmonic light scattering. Two medium (MEL cell, neutral BCP does not. It is suggested that an electrostatic interaction between the opposite charges of the cation and the MEL cell surface is the primary driving force for adsorption. Comparisons of adsorption density and free energy, measured at different pH and cell morphology, indicate that the interaction is predominantly through sialic acid carboxyl groups. MG cation adsorption densities have been determined as (0.6±0.3)×10(6) μm(-2) on the surface of undifferentiated MEL cells, and (1.8±0.5)×10(7) μm(-2) on differentiated MEL cells, while the deduced adsorption free energies are effectively identical (ca. -10.9±0.1 and -10.8±0.1 kcal mol(-1), respectively). The measured MG densities indicate that the total number of surface carboxyl groups is largely conserved following differentiation, and therefore the density of carboxylic groups is much larger on the differentiated cell surface than the undifferentiated one. Finally, in contrast to synthetic liposomes and bacterial membranes, surface adsorbed MG cations are unable to traverse the MEL cell membrane. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Medjanik, K.; Gloskovskii, A.; Kutnyakhov, D.; Felser, C.; Chercka, D.; Baumgarten, M.; Müllen, K.; Schönhense, G.
2012-01-01
Highlights: ► The effect of charge transfer in TMP/HMP–TCNQ complexes was studied using HAXPES. ► We examine changes in the core level spectra of TMP/HMP–TCNQ complexes. ► The charge is transferred to a fraction of 60% of the molecules in the complexes. - Abstract: The effect of charge transfer (CT) in complexes of the donors tetra- and hexamethoxyprene (TMP and HMP) with the classical acceptor tetracyanoquinodimethane (TCNQ) was studied using hard X-ray photoemission (HAXPES). Microcrystals of the complex were grown via vapour diffusion from donor–acceptor mixtures. The bulk sensitivity of HAXPES at a photon energy of 6 keV completely eliminates the problem of surface contamination for such delicate organic materials grown from solution. The donor molecules were produced using a novel synthesis route functionalizing polycyclic aromatic hydrocarbons at their periphery. For comparison, spectra were also taken from thin-film samples of the same compounds produced via co-deposition in UHV. Upon complex formation, the oxygen 1s core-level spectra (being a fingerprint of the methoxy-group of the donors) change from the single-line spectrum of pure HMP (TMP) to a spectrum with two distinct lines shifted by 1.4 (0.9) eV and 2.6 (2.3) eV with respect to the position of the oxygen 1s line of the pure donors. The nitrogen 1s spectra (being a fingerprint of the cyano-group in the acceptor) show two peaks as well with a corresponding shift of 0.9 eV and 2.0 eV in comparison with the leading line of pure TCNQ in opposite direction to the oxygen 1s spectra. These values are substantially larger than shifts in near edge X-ray absorption fine structure (NEXAFS) and ultraviolet photoelectron spectroscopy (UPS) spectra of the same complexes. The changes in the spectra are discussed in terms of the CT in the complexes. Residues of pure donor and acceptor materials in the microcrystal fractions of the complexes are evident from the presence of non-shifted lines. Peak
Energy Technology Data Exchange (ETDEWEB)
Yao, Yi; Berkowitz, Max L., E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu; Kanai, Yosuke, E-mail: maxb@unc.edu, E-mail: ykanai@unc.edu [Department of Chemistry, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599 (United States)
2015-12-28
The translational diffusivity of water in solutions of alkali halide salts depends on the identity of ions, exhibiting dramatically different behavior even in solutions of similar salts of NaCl and KCl. The water diffusion coefficient decreases as the salt concentration increases in NaCl. Yet, in KCl solution, it slightly increases and remains above bulk value as salt concentration increases. Previous classical molecular dynamics simulations have failed to describe this important behavior even when polarizable models were used. Here, we show that inclusion of dynamical charge transfer among water molecules produces results in a quantitative agreement with experiments. Our results indicate that the concentration-dependent diffusivity reflects the importance of many-body effects among the water molecules in aqueous ionic solutions. Comparison with quantum mechanical calculations shows that a heterogeneous and extended distribution of charges on water molecules around the ions due to ion-water and also water-water charge transfer plays a very important role in controlling water diffusivity. Explicit inclusion of the charge transfer allows us to model accurately the difference in the concentration-dependent water diffusivity between Na{sup +} and K{sup +} ions in simulations, and it is likely to impact modeling of a wide range of systems for medical and technological applications.
Institute of Scientific and Technical Information of China (English)
刘孝娟; 封继康; 任爱民
2003-01-01
The equilibrium geometries and UV-visible spectra of a series of donor-C60 molecules were obtained by means of the AM1 and INDO/CI method,on the basis of accurate geometric and electronic structures.The nonlinear second-order optical polarizabilities were calculated using the method INDO/SDCI combined with the Sum-Over-States(SOS) expression.The calculatedβ(λ=1.34μm) values are 28.81,48.56,57.33,66.99,70.85,85.84,and 142.14(×10-30 esu) for the molecules A,B,C,D,E,F and G,respectively.The frontier orbitals were plot for the representative molecules in order to exhibit the intramolecular charge transfer.The results indicate the introduction of thienylethylene can enhance the NLO response and the dimethylaniline-substituted dithienyl-ethylene-C60 (molecule G) possesses the largest NLO second-order optical polarizability.The large β values can be attributed to the charge transfer between the substituents and C60,as well as within the three-dimensional conjugated sphere of C60.
Energy Technology Data Exchange (ETDEWEB)
Shinde, N.; Morita, K. E-mail: k-morita@mail.nucl.nagoya-u.ac.jp; Dhole, S.D.; Ishikawa, D
2001-08-01
The energy spectra of positively charged and neutral species ejected from the Si(1 1 1) surfaces by keV Ar impact have been measured by means of a combined technique of the time-of-flight (TOF) analysis with the multi-photon resonance ionization spectroscopy (MPRIS). It is shown that positively charged species of Si{sup +}, Si{sup 2+} and SiO{sup +} are ejected from the as-cleaned 7x7 surface by 11 keV Ar impact. It is also shown that Ar sputter cleaning of the as-cleaned 7x7 surface for 14 min at the flux of 2x10{sup 13}/cm{sup 2}s removes completely the oxygen impurity and the yields of Si{sup 2+} is comparable to that of Si{sup +}. Moreover, the ionization probability of Si atoms sputtered is shown to be expressed as an exponential function of the inverse of their velocity. The production mechanism for the doubly charged Si ion is discussed based on the L-shell ionization of Si atoms due to quasi-molecule formation in the collisions of the surface atoms with energetic recoils and subsequent Auger decay of the L-shell vacancy to doubly ionized Si ions.
Evidence for charge-trapping inducing polymorphic structural-phase transition in pentacene.
Ando, Masahiko; Kehoe, Tom B; Yoneya, Makoto; Ishii, Hiroyuki; Kawasaki, Masahiro; Duffy, Claudia M; Minakata, Takashi; Phillips, Richard T; Sirringhaus, Henning
2015-01-07
Trapped-charge-induced transformation of pentacene polymorphs is observed by using in situ Raman spectroscopy and molecular dynamics simulations reveal that the charge should be localized in pentacene molecules at the interface with static intermolecular disorder along the long axis. Quantum chemical calculations of the intermolecular transfer integrals suggest the disorder to be large enough to induce Anderson-type localization. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Metal-Controlled Magnetoresistance at Room Temperature in Single-Molecule Devices.
Aragonès, Albert C; Aravena, Daniel; Valverde-Muñoz, Francisco J; Real, José Antonio; Sanz, Fausto; Díez-Pérez, Ismael; Ruiz, Eliseo
2017-04-26
The appropriate choice of the transition metal complex and metal surface electronic structure opens the possibility to control the spin of the charge carriers through the resulting hybrid molecule/metal spinterface in a single-molecule electrical contact at room temperature. The single-molecule conductance of a Au/molecule/Ni junction can be switched by flipping the magnetization direction of the ferromagnetic electrode. The requirements of the molecule include not just the presence of unpaired electrons: the electronic configuration of the metal center has to provide occupied or empty orbitals that strongly interact with the junction metal electrodes and that are close in energy to their Fermi levels for one of the electronic spins only. The key ingredient for the metal surface is to provide an efficient spin texture induced by the spin-orbit coupling in the topological surface states that results in an efficient spin-dependent interaction with the orbitals of the molecule. The strong magnetoresistance effect found in this kind of single-molecule wire opens a new approach for the design of room-temperature nanoscale devices based on spin-polarized currents controlled at molecular level.
Lee, Jaewon; Singh, Ranbir; Sin, Dong Hun; Kim, Heung Gyu; Song, Kyu Chan; Cho, Kilwon
2016-01-06
A new 3D nonfullerene small-molecule acceptor is reported. The 3D interlocking geometry of the small-molecule acceptor enables uniform molecular conformation and strong intermolecular connectivity, facilitating favorable nanoscale phase separation and electron charge transfer. By employing both a novel polymer donor and a nonfullerene small-molecule acceptor in the solution-processed organic solar cells, a high-power conversion efficiency of close to 6% is demonstrated. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Thomas P Burghardt
2011-02-01
Full Text Available Photoactivatable fluorescent probes developed specifically for single molecule detection extend advantages of single molecule imaging to high probe density regions of cells and tissues. They perform in the native biomolecule environment and have been used to detect both probe position and orientation.Fluorescence emission from a single photoactivated probe captured in an oil immersion, high numerical aperture objective, produces a spatial pattern on the detector that is a linear combination of 6 independent and distinct spatial basis patterns with weighting coefficients specifying emission dipole orientation. Basis patterns are tabulated for single photoactivated probes labeling myosin cross-bridges in a permeabilized muscle fiber undergoing total internal reflection illumination. Emitter proximity to the glass/aqueous interface at the coverslip implies the dipole near-field and dipole power normalization are significant affecters of the basis patterns. Other characteristics of the basis patterns are contributed by field polarization rotation with transmission through the microscope optics and refraction by the filter set. Pattern recognition utilized the generalized linear model, maximum likelihood fitting, for Poisson distributed uncertainties. This fitting method is more appropriate for treating low signal level photon counting data than χ(2 minimization.Results indicate that emission dipole orientation is measurable from the intensity image except for the ambiguity under dipole inversion. The advantage over an alternative method comparing two measured polarized emission intensities using an analyzing polarizer is that information in the intensity spatial distribution provides more constraints on fitted parameters and a single image provides all the information needed. Axial distance dependence in the emission pattern is also exploited to measure relative probe position near focus. Single molecule images from axial scanning fitted
International Nuclear Information System (INIS)
Weber, G; Braeuning, H; Hess, S; Maertin, R; Spillmann, U; Stoehlker, Th
2010-01-01
We report on a novel two-dimensional position sensitive Si(Li) detector dedicated to Compton polarimetry of x-ray radiation arising from highly-charged ions. The performance of the detector system was evaluated in ion-atom collision experiments at the ESR storage ringe at GSI, Darmstadt. Based on the data obtained, the polarimeter efficiency is estimated in this work.
On the Attosecond charge migration in Cl N, Cl O, Br N and Br O ...
Indian Academy of Sciences (India)
Abstract. The electron-electron relaxation and correlation-driven charge migration process, which features pure electronic aspect of ultrafast charge migration phenomenon, occurs on a very short timescale in ionized molecules and molecular clusters, prior to the onset of nuclear motion. In this article, we have presented ...
Hussain, Tanveer
2017-09-14
Binding of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules on two-dimensional silicene and germanene sheets have been investigated for the application of sensing of biomolecules using first principle density functional theory calculations. Binding energy range for nucleobases, amino acids and heterocyclic molecules with both the sheets have been found to be (0.43-1.16eV), (0.70-1.58eV) and (0.22-0.96eV) respectively, which along with the binding distances show that these molecules bind to both sheets by physisorption and chemisorption process. The exchange of electric charges between the monolayers and the incident molecules has been examined by means of Bader charge analysis. It has been observed that the introduction of DNA/RNA nucleobases, aromatic amino acids and heterocyclic molecules alters the electronic properties of both silicene and germanene nano sheets as studied by plotting the total (TDOS) and partial (PDOS) density of states. The DOS plots reveal the variation in the band gaps of both silicene and germanene caused by the introduction of studied molecules. Based on the obtained results we suggest that both silicene and germanene monolayers in their pristine form could be useful for sensing of biomolecules.
International Nuclear Information System (INIS)
Ramos, Marta M.D.; Correia, Helena M.G.
2006-01-01
The injection of charge carriers in conducting polymer layers gives rise to local electric fields which should have serious implications on the charge transport through the polymer layer. The charge distribution and the related electric field inside the ensemble of polymer molecules, with different molecular arrangements at nanoscale, determine whether or not intra-molecular charge transport takes place and the preferential direction for charge hopping between neighbouring molecules. Consequently, these factors play a significant role in the competition between current flow, charge trapping and recombination in polymer-based electronic devices. By suitable Monte Carlo calculations, we simulated the continuous injection of electrons and holes into polymer layers with different microstructures and followed their transport through those polymer networks. Results of these simulations provided a detailed picture of charge and electric field distribution in the polymer layer and allowed us to assess the consequences for current transport and recombination efficiency as well as the distribution of recombination events within the polymer film. In the steady state we found an accumulation of electrons and holes near the collecting electrodes giving rise to an internal electric field which is greater than the external applied field close to the electrodes and lower than the one in the central region of the polymer layer. We also found that a strong variation of electric field inside the polymer layer leads to an increase of recombination events in regions inside the polymer layer where the values of the internal electric field are lower
Dissociation of Methanol and Acetylene by slow Highly Charged Ion Collision
International Nuclear Information System (INIS)
De, Sankar; Rajput, Jyoti; Roy, A; Ahuja, R; Ghosh, P N; Safvan, C P
2007-01-01
We report here the results of dissociation of multiple charged methanol and acetylene molecules in collision with 1.2 MeV Ar 8+ projectiles. We observed a wide range of dissociation products from the TOF spectrum starting from undissociated molecular ions, fragments losing an hydrogen atom due to breakage of C-H and/or O-H bonds, to complete rupture of C-C and C-O skeletons for the respective molecules. From the coincidence map of the fragments, we could separate out the different dissociation channels between carbon and oxygen ionic fragments as well as complete two-body dissociation events. The most striking feature in the breakup of CH 3 OH is the formation of H 2 + and H 3 + due to intramolecular rearrangement of the C-H bonds within the methyl group. In dissociative ionization studies of C 2 H 2 , we observed a diatom-like behaviour of the C-C charged complex as evidenced from the measured slopes of the coincidence islands for carbon atomic charged fragments and theoretical values determined from the charge and momentum distribution of the correlated particles. The shape and orientation of the islands give further information about the momentum balance in the fragmentation process in two-body dissociation
Directory of Open Access Journals (Sweden)
Pamela Y Ting
Full Text Available Constitutively active BCR-ABL kinase fusions are causative mutations in the pathogenesis of hematopoietic neoplasias including chronic myelogenous leukemia (CML. Although these fusions have been successfully targeted with kinase inhibitors, drug-resistance and relapse continue to limit long-term survival, highlighting the need for continued innovative drug discovery. We developed a time-resolved Förster resonance energy transfer (TR-FRET -based assay to identify compounds that disrupt stimulation of the ABL kinase by blocking its ability to bind the positive regulator RIN1. This assay was used in a high throughput screen (HTS of two small molecule libraries totaling 444,743 compounds. 708 confirmed hits were counter-screened to eliminate off-target inhibitors and reanalyzed to prioritize compounds with IC50 values below 10 μM. The CML cell line K562 was then used to identify five compounds that decrease MAPK1/3 phosphorylation, which we determined to be an indicator of RIN1-dependent ABL signaling. One of these compounds is a thiadiazole, and the other four are structurally related acyl piperidine amides. Notably, these five compounds lower cellular BCR-ABL1 kinase activity by blocking a positive regulatory interaction rather than directly inhibiting ABL catalytic function.
International Nuclear Information System (INIS)
Kusakabe, T.; Buenker, R.J.; Kimura, M.
2002-01-01
Charge transfer processes resulting from collisions of H + ions with H 2 , D 2 , CO, CO 2 CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 molecules have been investigated in the energy range of 0.2 to 4.0 keV experimentally and theoretically. The initial growth rate method was employed in the experiment for studying the dynamics and cross sections. Theoretical analysis based on a molecular-orbital expansion method for H 2 , D 2 , CO, CH 4 and C 2 H 2 targets was also carried out. The present results for the H 2 , CO and CO 2 molecules by H + impact are found to be in excellent accord with most of previous measurements above 1 keV, but they show some differences below this energy where our result displays a stronger energy-dependence. For CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 targets, both experimental and theoretical results indicate that if one assumes vibrationally excited molecular ions (CH 4 + , C 2 H 2 + , C 2 H 6 + and C 3 H 8 + ) formed in the exit channel, then charge transfer processes sometimes become more favorable since these vibrationally excited fragments meet an accidental resonant condition. This is a clear indication of the role of vibrational excited states for charge transfer, and is an important realization for general understanding. (author)
Energy Technology Data Exchange (ETDEWEB)
Laurent, G
2004-05-15
Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S{sup 15+}, 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D{sup +} fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)
Sun, Jian-Ke; Ji, Min; Chen, Cheng; Wang, Wu-Gen; Wang, Peng; Chen, Rui-Ping; Zhang, Jie
2013-02-25
A bipyridinium ligand with a charge separated skeleton has been introduced into a metal-organic framework to yield a porous material with charge-polarized pore space, which exhibits selective adsorption for polar guest molecules and can be further used in gas chromatography for the separation of alcohol-water mixtures.
Zeng, Huadong; Cheng, Xinlu; Wang, Wei
2018-03-01
The adsorption behaviors and properties of hydrazine (N2H4) molecules on pristine and Li-decorated graphene sheets were investigated by means of first-principles based on density functional theory. We systematically analyzed the optimal geometry, average binding energy, charge transfer, charge density difference and density of states of N2H4 molecules adsorbed on pristine and Li-decorated graphene sheets. It is found that the interaction between single N2H4 molecule and pristine graphene is weak physisorption with the low binding energy of -0.026 eV, suggesting that the pristine graphene sheet is insensitive to the presence of N2H4 molecule. However, it is markedly enhanced after lithium decoration with the high binding energy of -1.004 eV, verifying that the Li-decorated graphene sheet is significantly sensitive to detect N2H4 molecule. Meanwhile, the effects of the concentrations of N2H4 molecules on two different substrates were studied detailedly. For pristine graphene substrate, the average binding energy augments apparently with increasing the number of N2H4 molecules, which is mainly attributed to the van der Waals interactions and hydrogen bonds among N2H4 clusters. Li-decorated graphene sheet has still a strong affinity to N2H4 molecules despite the corresponding average binding energy emerges a contrary tendency. Overall, Li-decorated graphene sheet could be considered as a potential gas sensor in field of hydrazine molecules.
Deschler, Felix; da Como, Enrico; Limmer, Thomas; Tautz, Raphael; Godde, Tillmann; Bayer, Manfred; von Hauff, Elizabeth; Yilmaz, Seyfullah; Allard, Sybille; Scherf, Ullrich; Feldmann, Jochen
2011-09-01
We investigate the effect of molecular doping on the recombination of electrons and holes localized at conjugated-polymer-fullerene interfaces. We demonstrate that a low concentration of p-type dopant molecules (<4% weight) reduces the interfacial recombination via charge transfer excitons and results in a favored formation of separated carriers. This is observed by the ultrafast quenching of photoluminescence from charge transfer excitons and the increase in photoinduced polaron density by ˜70%. The results are consistent with a reduced formation of emissive charge transfer excitons, induced by state filling of tail states.
Masum, Shah Md; Li, Shu Jie; Awad, Tarek S; Yamazaki, Masahito
2005-06-07
To elucidate the stability and phase transition of cubic phases of biomembranes with infinite periodic minimal surface is indispensable from biological and physicochemical aspects. In this report, we investigated the effect of positively charged peptide-3K (LLKKK) and poly(L-lysine) on the phase stability of monoolein (MO) membranes containing negatively charged dioleoylphosphatidic acid (DOPA) (i.e., DOPA/MO membranes) using small-angle X-ray scattering. At first, the effect of peptide-3K on 10% DOPA/90% MO membrane in excess water, which is in the Q229 phase, was investigated. At 3.4 mM peptide-3K, a Q229 to Q230 phase transition occurred, and at >3.4 mM peptide-3K, the membrane was in the Q230 phase. Poly(L-lysine) (M(w) 1K-4K) also induced the Q230 phase, but peptide-2K (LLKK) could not induce it in the same membrane. We also investigated the effect of peptide-3K on the multilamellar vesicle (MLV) of 25% DOPA/75% MO membrane, which is in L(alpha) phase. In the absence of peptide, the spacing of MLV was very large (11.3 nm), but at > or = 8 mM peptide-3K, it greatly decreased to a constant value (5.2 nm), irrespective of the peptide concentration, indicating that peptide-3K and the membranes form an electrostatically stabilized aggregation with low water content. Poly(L-lysine) also decreased greatly the spacing of the 25% DOPA/75% MO MLV, indicating the formation of a similar aggregation. To compare the effects of peptide-3K and poly(L-lysine) with that of osmotic stress on stability of the cubic phase, we investigated the effect of poly(ethylene glycol) with molecular weight 7500 (PEG-6K) on the phase stability of 10% DOPA/90% MO membrane. With an increase in PEG-6K concentration, i.e., with an increase in osmotic stress, the most stable phase changed as follows; Q229 (Schwartz's P surface) --> Q224 (D) --> Q230 (G). On the basis of these results, we discuss the mechanism of the effects of the positively charged short peptides (peptide-3K) and poly
Bond-equilibrium theory of liquid Se-Te alloys. II. Effect of singly attached ring molecules
Cutler, Melvin; Bez, Wolfgang G.
1981-06-01
A statistical-mechanical theory for bond equilibrium of chain polymers containing threefold (3F) and onefold (1F) bond defects is extended to include the effects of free ring molecules and ring molecules attached to chains by a single 3F atom. Positively charged singly attached rings are shown to play a key role in bond equilibrium in liquid Sex Te1-x by permitting the formation of ion pairs in which both constituents are effectively chain terminators, thus decreasing the average polymer size. The theory is applied to explain the behavior of the paramagnetic susceptibility, χp, and electronic transport as affected by the Fermi energy EF. It is found that the increase in χp with the concentration of Te is primarily the result of the smaller energy for breaking Te bonds. In addition, attached rings play an important role in determining the effect of temperature on χp. At x<~0.5, the concentrations of both free and attached rings becomes small at high T because of the high concentration of bond defects.
Formation of molecules in interstellar clouds from singly and multiply ionized atoms
International Nuclear Information System (INIS)
Langer, W.D.; and NASA, Institute for Space Studies, Goddard Space Flight Center, New York)
1978-01-01
Soft X-ray and cosmic rays produce multiply ionized atoms which may initiate molecule production in interstellar clouds. This molecule production can occur via ion-molecule reactions with H 2 , either directly from the multiply ionized atom (e.g.,C ++ + H 2 →CH + + H + ), or indirectly from the singly ionized atoms (e.g., N + + H 2 →NH + + H) that are formed from the recombination or charge transfer of the highly ionized atom (e.g., N ++ + e→N + + hv). We investigate the contribution of these reactions to the abundances of carbon-, nitrogen-, and oxygen-bearing molecules in isobaric models of diffuse clouds. In the presence of the average flux estimated for the diffuse soft X-ray background, multiply ionized atoms contribute only minimally (a few percent) to carbon-bearing molecules such as CH. In the neighborhood of diffuse structures or discrete sources, however, where the X-ray flux is enhanced, multiple ionization is considerably more important for molecule production
Site-dependent charge transfer at the Pt(111)-ZnPc interface and the effect of iodine
International Nuclear Information System (INIS)
Ahmadi, Sareh; Wojek, Bastian M.; Noël, Quentin; Göthelid, Mats; Agnarsson, Björn; Bidermane, Ieva; Sun, Chenghua
2014-01-01
The electronic structure of ZnPc, from sub-monolayers to thick films, on bare and iodated Pt(111) is studied by means of X-ray photoelectron spectroscopy, X-ray absorption spectroscopy, and scanning tunneling microscopy. Our results suggest that at low coverage ZnPc lies almost parallel to the Pt(111) substrate, in a non-planar configuration induced by Zn-Pt attraction, leading to an inhomogeneous charge distribution within the molecule and an inhomogeneous charge transfer to the molecule. ZnPc does not form a complete monolayer on the Pt surface, due to a surface-mediated intermolecular repulsion. At higher coverage ZnPc adopts a tilted geometry, due to a reduced molecule-substrate interaction. Our photoemission results illustrate that ZnPc is practically decoupled from Pt, already from the second layer. Pre-deposition of iodine on Pt hinders the Zn-Pt attraction, leading to a non-distorted first layer ZnPc in contact with Pt(111)-I(√3×√3) or Pt(111)-I(√7×√7), and a more homogeneous charge distribution and charge transfer at the interface. On increased ZnPc thickness iodine is dissolved in the organic film where it acts as an electron acceptor dopant
Electrostatic plasma lens for focusing negatively charged particle beams.
Goncharov, A A; Dobrovolskiy, A M; Dunets, S M; Litovko, I V; Gushenets, V I; Oks, E M
2012-02-01
We describe the current status of ongoing research and development of the electrostatic plasma lens for focusing and manipulating intense negatively charged particle beams, electrons, and negative ions. The physical principle of this kind of plasma lens is based on magnetic isolation electrons providing creation of a dynamical positive space charge cloud in shortly restricted volume propagating beam. Here, the new results of experimental investigations and computer simulations of wide-aperture, intense electron beam focusing by plasma lens with positive space charge cloud produced due to the cylindrical anode layer accelerator creating a positive ion stream towards an axis system is presented.
Charge Transfer Based Colorimetric Detection of Silver Ion
Energy Technology Data Exchange (ETDEWEB)
Han, Seung Choul; Kim, Kwang Seob; Choi, Soon Kyu; Oh, Jinho; Lee, Jae Wook [Dong-A Univ., Busan (Korea, Republic of)
2014-05-15
We have demonstrated the colorimetric chemosensor for detection of Ag{sup +} via formation of nanoparticles which is based on the intramolecular CT interaction between the electron-rich (2,6-dialkoxynaphthalene; Np) moiety and the electron-deficient (methyl viologen; MV{sup 2+}) moiety of a single sensor molecule. Under irradiation of light, Ag{sup +} was reduced to very small silver nanoparticle by CT interaction in the presence of OEGs as flexible recognition moiety of Ag{sup +} and stabilizer for Ag nanoparticles, thus Ag nanoparticles resulted to reddish brown in the color change of sensor solution, gradually. Therefore, the charge-transfer interaction between an electron-deficient and an electron-rich units existing at a sensor molecule can be regarded as a new and efficient method to construct various colorimetric chemosensors. Donor.acceptor interactions or charge transfer (CT) interactions are an important class of non-covalent interactions and have been widely exploited in self-assembling systems. Beyond molecular chemistry, supramolecular chemistry aims at constituting highly complex, functional chemical systems from components held together by intermolecular forces. Chemosensors are the molecules of abiotic origin that bind selectively and reversibly with the analyte with concomitant change in one or more properties of the system. The recognition and signaling of ionic and neutral species of varying complexity is one of the most intensively studied areas of contemporary supramolecular chemistry.
Position-dependent Effects of Polylysine on Sec Protein Transport*
Liang, Fu-Cheng; Bageshwar, Umesh K.; Musser, Siegfried M.
2012-01-01
The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or “pause sites,” were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport. PMID:22367204
Position-dependent effects of polylysine on Sec protein transport.
Liang, Fu-Cheng; Bageshwar, Umesh K; Musser, Siegfried M
2012-04-13
The bacterial Sec protein translocation system catalyzes the transport of unfolded precursor proteins across the cytoplasmic membrane. Using a recently developed real time fluorescence-based transport assay, the effects of the number and distribution of positive charges on the transport time and transport efficiency of proOmpA were examined. As expected, an increase in the number of lysine residues generally increased transport time and decreased transport efficiency. However, the observed effects were highly dependent on the polylysine position in the mature domain. In addition, a string of consecutive positive charges generally had a more significant effect on transport time and efficiency than separating the charges into two or more charged segments. Thirty positive charges distributed throughout the mature domain resulted in effects similar to 10 consecutive charges near the N terminus of the mature domain. These data support a model in which the local effects of positive charge on the translocation kinetics dominate over total thermodynamic constraints. The rapid translocation kinetics of some highly charged proOmpA mutants suggest that the charge is partially shielded from the electric field gradient during transport, possibly by the co-migration of counter ions. The transport times of precursors with multiple positively charged sequences, or "pause sites," were fairly well predicted by a local effect model. However, the kinetic profile predicted by this local effect model was not observed. Instead, the transport kinetics observed for precursors with multiple polylysine segments support a model in which translocation through the SecYEG pore is not the rate-limiting step of transport.
International Nuclear Information System (INIS)
Lee, E.P.
1977-01-01
In a recent report (UCID 17346, ''Relativistic Particle Beam in a Semi-Infinite Axially Symmetric conducting channel extending from a perfectly conducting plane,'' Dec. 13, 1976) Cooper and Neil demonstrate that the net charge transported by a beam pulse injected into a channel of finite conductivity equals the charge of the beam itself. The channel is taken to be infinite in the positive z direction, has finite radius and is terminated by a conducting ground plane at z =0. This result is not an obvious one, and it is restricted in its applicability by the special model assumed for the channel. It is the purpose to explain the result of Cooper and Neil in more qualitative terms and to make similar calculations using several other channel models. It must be emphasized that these calculations are not concerned with the fate of the transported charge after the pulse has stopped, but rather with how much charge leaves the ground plane assuming the pulse does not stop
Smith, Brandon; Clark, Michael; Grieco, Christopher; Larsen, Alec; Asbury, John; Gomez, Enrique
2015-03-01
Crystalline organic molecules often exhibit the ability to form multiple crystal structures depending on the processing conditions. Exploiting this polymorphism to optimize molecular orbital overlap between adjacent molecules within the unit lattice of conjugated polymers is an approach to enhance charge transport within the material. We have demonstrated the formation of tighter π- π stacking poly(3-hexylthiophene-2,5-diyl) polymorphs in films spin coated from ferrocene-containing solutions using grazing incident X-ray diffraction. As a result, we found that the addition of ferrocene to casting solutions yields thin-film transistors which exhibit significantly higher source-drain current and charge mobilities than neat polymer devices. Insights gleaned from ferrocene/poly(3-hexylthiophene) mixtures can serve as a template for selection and optimization of next generation small molecule/polymer systems possessing greater baseline charge mobilities. Ultimately, the development of such techniques to enhance the characteristics of organic transistors without imparting high costs or loss of advantageous properties will be a critical factor determining the future of organic components within the electronics market.
Correlating substituent parameter values to electron transport properties of molecules
International Nuclear Information System (INIS)
Vedova-Brook, Natalie; Matsunaga, Nikita; Sohlberg, Karl
2004-01-01
There are a vast number of organic compounds that could be considered for use in molecular electronics. Because of this, the need for efficient and economical screening tools has emerged. We demonstrate that the substituent parameter values (σ), commonly found in advanced organic chemistry textbooks, correlate strongly with features of the charge migration process, establishing them as useful indicators of electronic properties. Specifically, we report that ab initio derived electronic charge transfer values for 16 different substituted aromatic molecules for molecular junctions correlate to the σ values with a correlation coefficient squared (R 2 ) of 0.863
Directory of Open Access Journals (Sweden)
Kyeong-Ok Choi
2016-05-01
Full Text Available The objective of this study is to develop suitable formulations to improve the dissolution rate of poorly water soluble drugs. We selected lipid-based formulation as a drug carrier and modified the surface using positively charged chitosan derivative (HTCC to increase its water solubility and bioavailability. Chitosan and HTCC-coated lipid particles had higher zeta-potential values than uncoated one over the whole pH ranges and improved encapsulation efficiency. In vitro drug release showed that all NLC formulations showed higher in vitro release efficiency than drug particle at pH 7.4. Furthermore, NLC formulation prepared with chitosan or HTCC represented good sustained release property. The results indicate that chitosan and HTCC can be excellent formulating excipients of lipid-based delivery carrier for improving poorly water soluble drug delivery.
Choi, Kyeong-Ok; Choe, Jaehyeog; Suh, Seokjin; Ko, Sanghoon
2016-05-20
The objective of this study is to develop suitable formulations to improve the dissolution rate of poorly water soluble drugs. We selected lipid-based formulation as a drug carrier and modified the surface using positively charged chitosan derivative (HTCC) to increase its water solubility and bioavailability. Chitosan and HTCC-coated lipid particles had higher zeta-potential values than uncoated one over the whole pH ranges and improved encapsulation efficiency. In vitro drug release showed that all NLC formulations showed higher in vitro release efficiency than drug particle at pH 7.4. Furthermore, NLC formulation prepared with chitosan or HTCC represented good sustained release property. The results indicate that chitosan and HTCC can be excellent formulating excipients of lipid-based delivery carrier for improving poorly water soluble drug delivery.
Charge state distributions from highly charged ions channeled at a metal surface
International Nuclear Information System (INIS)
Folkerts, L.; Meyer, F.W.; Schippers, S.
1994-01-01
The vast majority of the experimental work in the field of multicharged ion-surface interactions, to date, has focused on x-ray and particularly on electron emission. These experiments include measurements of the total electron yield, the emission statistics of the electrons, and, most of all, the electron energy distributions. So far, little attention has been paid to the fate of the multicharged projectile ions after the scattering. To our knowledge, the only measurement of the charge state distribution of the scattered ions is the pioneering experiment of de Zwart et al., who measured the total yield of scattered 1+, 2+, and 3+ ions as a function of the primary charge state q (q = 1--11) for 20 key Ne, Ar, and Kr ions after reflection from a polycrystalline tungsten target. Their main finding is the sudden onset of scattered 3+ ions when inner-shell vacancies are present in the primary particles. This suggests that a certain fraction of the inner-shell vacancies survives the entire collision event, and decays via autoionization on the outgoing path. Since the projectiles scattered in the neutral charge state could not be detected in the experiment of de Zwart et al., they were not able to provide absolute charge state fractions. In our present experiment, we focus on the scattered projectiles, measuring both the final charge state and the total scattering angle with a single 2D position sensitive detector (PSD). This method gives us the number of positive, as well as neutral and negative, scattered ions, thus allowing us to extract absolute charge state fractions. Using a well-prepared single Au(110) crystal and a grazing incidence geometry, we were able to observe surface channeling along the [001] channels
Riccardi, E; Wang, J-C; Liapis, A I
2010-08-28
The transport of a charged adsorbate biomolecule in a porous polymeric adsorbent medium and its adsorption onto the covalently immobilized ligands have been modeled and investigated using molecular dynamics modeling and simulations as the third part of a novel fundamental methodology developed for studying ion-exchange chromatography based bioseparations. To overcome computational challenges, a novel simulation approach is devised where appropriate atomistic and coarse grain models are employed simultaneously and the transport of the adsorbate is characterized through a number of locations representative of the progress of the transport process. The adsorbate biomolecule for the system studied in this work changes shape, orientation, and lateral position in order to proceed toward the site where adsorption occurs and exhibits decreased mass transport coefficients as it approaches closer to the immobilized ligand. Furthermore, because the ligands are surrounded by counterions carrying the same type of charge as the adsorbate biomolecule, it takes the biomolecule repeated attempts to approach toward a ligand in order to displace the counterions in the proximity of the ligand and to finally become adsorbed. The formed adsorbate-ligand complex interacts with the counterions and polymeric molecules and is found to evolve slowly and continuously from one-site (monovalent) interaction to multisite (multivalent) interactions. Such a transition of the nature of adsorption reduces the overall adsorption capacity of the ligands in the adsorbent medium and results in a type of surface exclusion effect. Also, the adsorption of the biomolecule also presents certain volume exclusion effects by not only directly reducing the pore volume and the availability of the ligands in the adjacent regions, but also causing the polymeric molecules to change to more compact structures that could further shield certain ligands from being accessible to subsequent adsorbate molecules. These
Photoionization of atoms and molecules
International Nuclear Information System (INIS)
Samson, J.A.R.
1976-01-01
A literature review on the present state of knowledge in photoionization is presented. Various experimental techniques that have been developed to study photoionization, such as fluorescence and photoelectron spectroscopy, mass spectroscopy, are examined. Various atoms and molecules were chosen to illustrate these techniques, specifically helium and xenon atoms and hydrogen molecules. Specialized photoionization such as in positive and negative ions, excited states, and free radicals is also treated. Absorption cross sections and ionization potentials are also discussed
Effects of Charge-Transfer Excitons on the Photophysics of Organic Semiconductors
Hestand, Nicholas J.
The field of organic electronics has received considerable attention over the past several years due to the promise of novel electronic materials that are cheap, flexible and light weight. While some devices based on organic materials have already emerged on the market (e.g. organic light emitting diodes), a deeper understanding of the excited states within the condensed phase is necessary both to improve current commercial products and to develop new materials for applications that are currently in the commercial pipeline (e.g. organic photovoltaics, wearable displays, and field effect transistors). To this end, a model for pi-conjugated molecular aggregates and crystals is developed and analyzed. The model considers two types of electronic excitations, namely Frenkel and charge-transfer excitons, both of which play a prominent role in determining the nature of the excited states within tightly-packed organic systems. The former consist of an electron-hole pair bound to the same molecule while in the later the electron and hole are located on different molecules. The model also considers the important nuclear reorganization that occurs when the system switches between electronic states. This is achieved using a Holstein-style Hamiltonian that includes linear vibronic coupling of the electronic states to the nuclear motion associated with the high frequency vinyl-stretching and ring-breathing modes. Analysis of the model reveals spectroscopic signatures of charge-transfer mediated J- and H-aggregation in systems where the photophysical properties are determined primarily by charge-transfer interactions. Importantly, such signatures are found to be sensitive to the relative phase of the intermolecular electron and hole transfer integrals, and the relative energy of the Frenkel and charge-transfer states. When the charge-transfer integrals are in phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits J
Cooperative Charging Effects of Fibers From Electrospinning of Electrically Dissimilar Polymers
National Research Council Canada - National Science Library
Schreuder-Gibson, H. L; Gibson, P; Tsai, P; Gupta, P; Wilkes, G
2005-01-01
.... During electrospinning of the PS and PAN polymer solutions, the fibers became positively charged when positive voltage was applied to the solution-filled spinning nozzle and became negatively charged...
Electrons from fixed in space molecules and clusters
International Nuclear Information System (INIS)
Doerner, R.; Jahnke, T.; Czasch, A.; Jagutzki, O.; Schmidt-Boecking; Kreidi, K.; Knapp, A.; Schmidt, L.; Schoeffler, M.; Foucar, L.; Cocke, C.L.; Osipov, T.; Alnaser, A.
2004-01-01
Full text: We use modern multi particle momentum imaging techniques (COLTRIMS) to measure the vector momenta of all charged fragments, ions, photoelectrons and Auger electrons for small molecules excited by synchrotron radiation. These complete images of the fragmentation give an umprecedented detailed insight in the molecular photoionization and Auger process. Also latest results on molecular double ionisation and on cluster fragmentation unveiling interatomic coulomb decay will be presented
BEAM TRANSPORT AND STORAGE WITH COLD NEUTRAL ATOMS AND MOLECULES
Energy Technology Data Exchange (ETDEWEB)
Walstrom, Peter L. [Los Alamos National Laboratory
2012-05-15
A large class of cold neutral atoms and molecules is subject to magnetic field-gradient forces. In the presence of a field, hyperfine atomic states are split into several Zeeman levels. The slopes of these curves vs. field are the effective magnetic moments. By means of optical pumping in a field, Zeeman states of neutral lithium atoms and CaH molecules with effective magnetic moments of nearly {+-} one Bohr magneton can be selected. Particles in Zeeman states for which the energy increases with field are repelled by increasing fields; particles in states for which the energy decreases with field are attracted to increasing fields. For stable magnetic confinement, field-repelled states are required. Neutral-particle velocities in the present study are on the order of tens to hundreds of m/s and the magnetic fields needed for transport and injection are on the order of in the range of 0.01-1T. Many of the general concepts of charged-particle beam transport carry over into neutral particle spin-force optics, but with important differences. In general, the role of bending dipoles in charged particle optics is played by quadrupoles in neutral particle optics; the role of quadrupoles is played by sextupoles. The neutralparticle analog of charge-exchange injection into storage rings is the use of lasers to flip the state of particles from field-seeking to field-repelled. Preliminary tracking results for two neutral atom/molecule storage ring configurations are presented. It was found that orbit instabilities limit the confinment time in a racetrack-shaped ring with discrete magnetic elements with drift spaces between them; stable behavior was observed in a toroidal ring with a continuous sextupole field. An alternative concept using a linear sextupole or octupole channel with solenoids on the ends is presently being considered.
Indian Academy of Sciences (India)
structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.
Attraction of likely charged nano-sized grains in dust-electron plasmas
Energy Technology Data Exchange (ETDEWEB)
Vishnyakov, Vladimir I., E-mail: eksvar@ukr.net [Physical-Chemical Institute for Environmental and Human Protection, Odessa 65082 (Ukraine)
2016-01-15
Dust-electron plasma, which contains only the dust grains and electrons, emitted by them, is studied. Assumption of almost uniform spatial electrons distribution, which deviates from the uniformity only near the dust grains, leads to the grain charge division into two parts: first part is the individual for each grain “visible” charge and the second part is the common charge of the neutralized background. The visible grain charge can be both negative and positive, while the total grain charge is only positive. The attraction of likely charged grains is possible, because the grain interaction is determined by the visible charges. The equilibrium state between attraction and repulsion of grains is demonstrated.
Surface charge effects in protein adsorption on nanodiamonds.
Aramesh, M; Shimoni, O; Ostrikov, K; Prawer, S; Cervenka, J
2015-03-19
Understanding the interaction of proteins with charged diamond nanoparticles is of fundamental importance for diverse biomedical applications. Here we present a thorough study of protein binding, adsorption kinetics and structure on strongly positively (hydrogen-terminated) and negatively (oxygen-terminated) charged nanodiamond particles using a quartz crystal microbalance by dissipation and infrared spectroscopy. By using two model proteins (bovine serum albumin and lysozyme) of different properties (charge, molecular weight and rigidity), the main driving mechanism responsible for the protein binding to the charged nanoparticles was identified. Electrostatic interactions were found to dominate the protein adsorption dynamics, attachment and conformation. We developed a simple electrostatic model that can qualitatively explain the observed adsorption behaviour based on charge-induced pH modifications near the charged nanoparticle surfaces. Under neutral conditions, the local pH around the positively and negatively charged nanodiamonds becomes very high (11-12) and low (1-3) respectively, which has a profound impact on the protein charge, hydration and affinity to the nanodiamonds. Small proteins (lysozyme) were found to form multilayers with significant conformational changes to screen the surface charge, while larger proteins (albumin) formed monolayers with minor conformational changes. The findings of this study provide a step forward toward understanding and eventually predicting nanoparticle interactions with biofluids.
Ejecta from single-charge cratering explosions
Energy Technology Data Exchange (ETDEWEB)
Carlson, R H
1970-05-15
The objective was to obtain experimental data tracing the location of ejecta to its origin within the crater region. The experiment included ten high-explosive spherical charges weighing from 8 to 1000 pounds and detonated in a playa dry lake soil on the Tonopah Test Range. Each event included from 24 to 40 locations of distinctly different tracer material embedded in a plane in the expected crater region. Tracers consisted of glass, ceramic and bugle beads, chopped metal, and plastic wire. Results of this experiment yielded data on tracer dispersion as a function of charge weight, charge burial depth and tracer emplacement position. Tracer pattern parameters such as center-of-tracer mass, range to center-of-tracer mass, and angle to center-of-tracer mass were determined. There is a clear tendency for range (to center-of-tracer mass) and the size of the dispersion pattern to decrease as tracer emplacement depth increases. Increasing tracer emplacement depth and range tends to decrease the area over which tracers are dispersed on the ground surface. Tracers at the same scaled position relative to the charge were deposited closer to the crater (on a scaled basis) as charge weight was increased. (author)
Chemical wiring and soldering toward all-molecule electronic circuitry.
Okawa, Yuji; Mandal, Swapan K; Hu, Chunping; Tateyama, Yoshitaka; Goedecker, Stefan; Tsukamoto, Shigeru; Hasegawa, Tsuyoshi; Gimzewski, James K; Aono, Masakazu
2011-06-01
Key to single-molecule electronics is connecting functional molecules to each other using conductive nanowires. This involves two issues: how to create conductive nanowires at designated positions, and how to ensure chemical bonding between the nanowires and functional molecules. Here, we present a novel method that solves both issues. Relevant functional molecules are placed on a self-assembled monolayer of diacetylene compound. A probe tip of a scanning tunneling microscope is then positioned on the molecular row of the diacetylene compound to which the functional molecule is adsorbed, and a conductive polydiacetylene nanowire is fabricated by initiating chain polymerization by stimulation with the tip. Since the front edge of chain polymerization necessarily has a reactive chemical species, the created polymer nanowire forms chemical bonding with an encountered molecular element. We name this spontaneous reaction "chemical soldering". First-principles theoretical calculations are used to investigate the structures and electronic properties of the connection. We demonstrate that two conductive polymer nanowires are connected to a single phthalocyanine molecule. A resonant tunneling diode formed by this method is discussed. © 2011 American Chemical Society