WorldWideScience

Sample records for positively charged molecules

  1. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  2. The infra-red spectrum of the molecular dication (doubly positively charged molecule) D35Cl2+

    International Nuclear Information System (INIS)

    Abusen, R.A.

    1999-07-01

    The ion-beam/laser-beam spectrometer used in this work was designed, built and commissioned for the experimental investigation of doubly charged molecular species [Shiell 1995]. Using this spectrometer the photodissociation spectrum of the X 3 Σ - state of the molecular dication D 35 Cl 2+ was measured in the infrared. It has not yet been possible to assign and fit the observed transitions in the usual way, but comparisons of our spectra with ab-initio generated spectra show good agreement and form the basis for our preliminary assignments. Our preliminary analysis shows a good agreement between the measured spectra and an ab-initio theoretical spectra of the ν = 2-1 band, including the rotational constants and tunneling lifetimes, calculated from the potential energy of Bennett and McNab [1995]. The theoretical spectrum was brought into agreement with the measured spectra by moving its band origin by -21.1 cm -1 . The theoretical rotational constants that give good agreement with the spectrum are (in cm -1 ) B'' = 3.898, D'' = 3.561, H'' = 1.04 x 10 -9 , B' = 3.648, D' = 3.163 x 10 -4 , H' = -9.269 x 10 -8 . The shifted origin of the ν = 2-1 band is 994.3 cm -1 . A Fortran computer program was written to simulate 3Σ-3Σ vibration-rotation spectra. The theoretical spectrum obtained with this computer program has been compared with our measured spectrum. Our experimentally measured line widths and wavenumbers have been compared with the ab-initio theoretical spectrum and a good agreement obtained. This is good evidence that we are observing the ν=2-1 band of D 35 CI 2+ in the ground electronic state (X 3 Σ - state). Good agreement between measured and predicted hyperfine patterns was found using a Fermi contact constant (for the chlorine nucleus) of 190 MHz. (author)

  3. Optical Spectroscopy Of Charged Quantum Dot Molecules

    Science.gov (United States)

    Scheibner, M.; Bracker, A. S.; Stinaff, E. A.; Doty, M. F.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

    2007-04-01

    Coupling between two closely spaced quantum dots is observed by means of photoluminescence spectroscopy. Hole coupling is realized by rational crystal growth and heterostructure design. We identify molecular resonances of different excitonic charge states, including the important case of a doubly charged quantum dot molecule.

  4. Spectroscopy of Charged Quantum Dot Molecules

    Science.gov (United States)

    Stinaff, E. A.; Scheibner, M.; Bracker, A. S.; Ponomarev, I. V.; Ware, M. E.; Doty, M. F.; Reinecke, T. L.; Gammon, D.; Korenev, V. L.

    2006-03-01

    Spins of single charges in quantum dots are attractive for many quantum information and spintronic proposals. Scalable quantum information applications require the ability to entangle and operate on multiple spins in coupled quantum dots (CQDs). To further the understanding of these systems, we present detailed spectroscopic studies of InAs CQDs with control of the discrete electron or hole charging of the system. The optical spectrum reveals a pattern of energy anticrossings and crossings in the photoluminescence as a function of applied electric field. These features can be understood as a superposition of charge and spin configurations of the two dots and represent clear signatures of quantum mechanical coupling. The molecular resonance leading to these anticrossings is achieved at different electric fields for the optically excited (trion) states and the ground (hole) states allowing for the possibility of using the excited states for optically induced coupling of the qubits.

  5. Theory of Charged Quantum Dot Molecules

    Science.gov (United States)

    Ponomarev, I. V.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Ware, M. E.; Gammon, D.; Reinecke, T. L.; Korenev, V. L.

    2006-03-01

    Recent optical spectroscopy of excitonic molecules in coupled quantum dots (CQDs) tuned by electric field reveal a richer diversity in spectral line patterns than in their single quantum dot counterparts. We developed a theoretical model that allows us to classify energies and intensities of various PL transitions. In this approach the electric field induced resonance tunneling of the electron and hole states occurs at different biases due to the inherent asymmetry of CQDs. The truncated many-body basis configurations for each molecule are constructed from antisymmetrized products of single-particle states, where the electron occupies only one ground state level in single QD and the hole can occupy two lowest levels of CQD system. The Coulomb interaction between particles is treated with perturbation theory. As a result the observed PL spectral lines can be described with a small number of parameters. The theoretical predictions account well for recent experiments.

  6. Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures

    Directory of Open Access Journals (Sweden)

    Bohinc, K.

    2014-03-01

    Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.

  7. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  8. Thermally induced charge current through long molecules

    Science.gov (United States)

    Zimbovskaya, Natalya A.; Nitzan, Abraham

    2018-01-01

    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  9. About the correlation between atomic charge fluctuations in a molecule

    International Nuclear Information System (INIS)

    Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.

    1987-01-01

    In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt

  10. Charge migration induced by attosecond pulses in bio-relevant molecules

    International Nuclear Information System (INIS)

    Calegari, Francesca; Castrovilli, Mattea C; Nisoli, Mauro; Trabattoni, Andrea; Palacios, Alicia; Ayuso, David; Martín, Fernando; Greenwood, Jason B; Decleva, Piero

    2016-01-01

    After sudden ionization of a large molecule, the positive charge can migrate throughout the system on a sub-femtosecond time scale, purely guided by electronic coherences. The possibility to actively explore the role of the electron dynamics in the photo-chemistry of bio-relevant molecules is of fundamental interest for understanding, and perhaps ultimately controlling, the processes leading to damage, mutation and, more generally, to the alteration of the biological functions of the macromolecule. Attosecond laser sources can provide the extreme time resolution required to follow this ultrafast charge flow. In this review we will present recent advances in attosecond molecular science: after a brief description of the results obtained for small molecules, recent experimental and theoretical findings on charge migration in bio-relevant molecules will be discussed. (topical review)

  11. Anisotropy in highly charged ion induced molecule fragmentation

    International Nuclear Information System (INIS)

    Juhasz, Z.; Sulik, B.; Fremont, F.; Chesnel, J.Y.; Hajaji, A.

    2006-01-01

    Complete text of publication follows. Studying fragmentation processes of biologically relevant molecules due to highly charged ion impact is important to understand radiation damage in biological tissues. Energy spectra of the charged molecule fragments may reveal the different fragmentation patterns meanwhile the angular distributions of the fragments characterize the dependence of fragmentation probability on the initial orientation of the molecule. The research to explore the angular distribution of the molecule fragments has only recently been started[1]. In 2006 we performed measurements at ARIBE facility at GANIL, Caen (France), in order to investigate orientation effects in molecule fragmentation. Fragmentation of H 2 O, C 6 H 6 and CH 4 , which represent different level of symmetry, have been studied by 60 keV N 6+ ion impact. Energy spectra of the charged fragments at different observation angles have been taken. As our example spectra show the different protonic peaks can be attributed to different fragmentation processes. Significant anisotropy can be seen in the different processes. The strongest evidence for the anisotropy can be seen in the spectra of C 6 H 6 , where the spectra appear isotropic in almost the whole observed energy range except one peak, which has a strong angular dependence and is maximal around 90 deg. (author)

  12. Surface-confined electroactive molecules for multistate charge storage information.

    Science.gov (United States)

    Mas-Torrent, M; Rovira, C; Veciana, J

    2013-01-18

    Bi-stable molecular systems with potential for applications in binary memory devices are raising great interest for device miniaturization. Particular appealing are those systems that operate with electrical inputs since they are compatible with existing electronic technologies. The processing of higher memory densities in these devices could be accomplished by increasing the number of memory states in each cell, although this strategy has not been much explored yet. Here we highlight the recent advances devoted to the fabrication of charge-storage molecular surface-confined devices exhibiting multiple states. Mainly, this goal has been realized immobilizing a variety (or a combination) of electroactive molecules on a surface, although alternative approaches employing non-electroactive systems have also been described. Undoubtedly, the use of molecules with chemically tunable properties and nanoscale dimensions are raising great hopes for the devices of the future in which molecules can bring new perspectives such as multistability.

  13. Charge transport through image charged stabilized states in a single molecule single electron transistor device

    International Nuclear Information System (INIS)

    Hedegard, Per; Bjornholm, Thomas

    2005-01-01

    The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond

  14. Effective charge model in the theory of infrared intensities and its application for study of charge di.stribution in the molecules of organometallic compounds

    International Nuclear Information System (INIS)

    Aleksanyan, V.T.; Samvelyan, S.Kh.

    1984-01-01

    General principles of plotting the parametric theory of IR spectrum intensities of polyatomic molecules are outlined. The development of the effective charges model in this theory is considered and the mathematical formalism of the first approximation of the method of effective atom charges is described in detail. The results of calculations of charges distribution in the Mo(CO) 6 , W(CO) 6 , Cp 2 V, Cp 2 Ru and others (Cp-cyclopentadiene), performed in the frame work of the outlined scheme are presented. It is shown that in the investigated carbonyles the effective charge on oxygen and metal atoms is negative, on carbon atom - positive. In dicyclopentavienyl complexes the effective charge on the metal atom is positive and is not over 0.6e; charge values on hydrogen and carbon atoms do not exceed, 0.10-0.15e. The notions of ''electrovalence'' of coordination bond and charge distribution in the case of metallocenes are not correlated

  15. Systems Based Study of the Therapeutic Potential of Small Charged Molecules for the Inhibition of IL-1 Mediated Cartilage Degradation

    Science.gov (United States)

    Kar, Saptarshi; Smith, David W.; Gardiner, Bruce S.; Grodzinsky, Alan J.

    2016-01-01

    Inflammatory cytokines are key drivers of cartilage degradation in post-traumatic osteoarthritis. Cartilage degradation mediated by these inflammatory cytokines has been extensively investigated using in vitro experimental systems. Based on one such study, we have developed a computational model to quantitatively assess the impact of charged small molecules intended to inhibit IL-1 mediated cartilage degradation. We primarily focus on the simplest possible computational model of small molecular interaction with the IL-1 system—direct binding of the small molecule to the active site on the IL-1 molecule itself. We first use the model to explore the uptake and release kinetics of the small molecule inhibitor by cartilage tissue. Our results show that negatively charged small molecules are excluded from the negatively charged cartilage tissue and have uptake kinetics in the order of hours. In contrast, the positively charged small molecules are drawn into the cartilage with uptake and release timescales ranging from hours to days. Using our calibrated computational model, we subsequently explore the effect of small molecule charge and binding constant on the rate of cartilage degradation. The results from this analysis indicate that the small molecules are most effective in inhibiting cartilage degradation if they are either positively charged and/or bind strongly to IL-1α, or both. Furthermore, our results showed that the cartilage structural homeostasis can be restored by the small molecule if administered within six days following initial tissue exposure to IL-1α. We finally extended the scope of the computational model by simulating the competitive inhibition of cartilage degradation by the small molecule. Results from this model show that small molecules are more efficient in inhibiting cartilage degradation by binding directly to IL-1α rather than binding to IL-1α receptors. The results from this study can be used as a template for the design and

  16. Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

    International Nuclear Information System (INIS)

    Kim, Eunae; Yeom, Min Sun

    2014-01-01

    Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

  17. Temperature Dependence of Charge Localization in High-Mobility, Solution-Crystallized Small Molecule Semiconductors Studied by Charge Modulation Spectroscopy

    DEFF Research Database (Denmark)

    Meneau, Aurélie Y. B.; Olivier, Yoann; Backlund, Tomas

    2016-01-01

    In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld-effect tran......In solution-processable small molecule semiconductors, the extent of charge carrier wavefunction localization induced by dynamic disorder can be probed spectroscopically as a function of temperature using charge modulation spectroscopy (CMS). Here, it is shown based on combined fi eld......-effect transistor and CMS measurements as a function of temperature that in certain molecular semiconductors, such as solution-processible pentacene, charge carriers become trapped at low temperatures in environments in which the charges become highly localized on individual molecules, while in some other molecules...

  18. Interstellar Chemistry Gets More Complex With New Charged-Molecule Discovery

    Science.gov (United States)

    2007-07-01

    Astronomers using data from the National Science Foundation's Robert C. Byrd Green Bank Telescope (GBT) have found the largest negatively-charged molecule yet seen in space. The discovery of the third negatively-charged molecule, called an anion, in less than a year and the size of the latest anion will force a drastic revision of theoretical models of interstellar chemistry, the astronomers say. Molecule formation Formation Process of Large, Negatively-Charged Molecule in Interstellar Space CREDIT: Bill Saxton, NRAO/AUI/NSF Click on image for page of graphics and detailed information "This discovery continues to add to the diversity and complexity that is already seen in the chemistry of interstellar space," said Anthony J. Remijan of the National Radio Astronomy Observatory (NRAO). "It also adds to the number of paths available for making the complex organic molecules and other large molecular species that may be precursors to life in the giant clouds from which stars and planets are formed," he added. Two teams of scientists found negatively-charged octatetraynyl, a chain of eight carbon atoms and one hydrogen atom, in the envelope of gas around an old, evolved star and in a cold, dark cloud of molecular gas. In both cases, the molecule had an extra electron, giving it a negative charge. About 130 neutral and about a dozen positively-charged molecules have been discovered in space, but the first negatively-charged molecule was not discovered until late last year. The largest previously-discovered negative ion found in space has six carbon atoms and one hydrogen atom. "Until recently, many theoretical models of how chemical reactions evolve in interstellar space have largely neglected the presence of anions. This can no longer be the case, and this means that there are many more ways to build large organic molecules in cosmic environments than have been explored," said Jan M. Hollis of NASA's Goddard Space Flight Center (GSFC). Ultraviolet light from stars can

  19. Low energy cross section data for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions with atoms and molecules

    International Nuclear Information System (INIS)

    Okuno, Kazuhiko

    2007-04-01

    Systematic cross section measurements for ion-molecule reactions in hydrogen systems and for charge transfer of multiply charged ions in low energy collisions with atoms and molecules have been performed continuously by the identical apparatus installed with an octo-pole ion beam guide (OPIG) since 1980 till 2004. Recently, all of accumulated cross section data for a hundred collision systems has been entered into CMOL and CHART of the NIFS atomic and molecular numerical database together with some related cross section data. In this present paper, complicated ion-molecule reactions in hydrogen systems are revealed and the brief outlines of specific properties in low energy charge transfer collisions of multiply charged ions with atoms and molecules are introduced. (author)

  20. Topology of charge density of flucytosine and related molecules and characteristics of their bond charge distributions.

    Science.gov (United States)

    Murgich, Juan; Franco, Héctor J; San-Blas, Gioconda

    2006-08-24

    The molecular charge distribution of flucytosine (4-amino-5-fluoro-2-pyrimidone), uracil, 5-fluorouracil, and thymine was studied by means of density functional theory calculations (DFT). The resulting distributions were analyzed by means of the atoms in molecules (AIM) theory. Bonds were characterized through vectors formed with the charge density value, its Laplacian, and the bond ellipticity calculated at the bond critical point (BCP). Within each set of C=O, C-H, and N-H bonds, these vectors showed little dispersion. C-C bonds formed three different subsets, one with a significant degree of double bonding, a second corresponding to single bonds with a finite ellipticity produced by hyperconjugation, and a third one formed by a pure single bond. In N-C bonds, a decrease in bond length (an increase in double bond character) was not reflected as an increase in their ellipticity, as in all C-C bonds studied. It was also found that substitution influenced the N-C, C-O, and C-C bond ellipticity much more than density and its Laplacian at the BCP. The Laplacian of charge density pointed to the existence of both bonding and nonbonding maxima in the valence shell charge concentration of N, O, and F, while only bonding ones were found for the C atoms. The nonbonding maxima related to the sites for electrophilic attack and H bonding in O and N, while sites of nucleophilic attack were suggested by the holes in the valence shell of the C atoms of the carbonyl groups.

  1. Effect of charged and excited states on the decomposition of 1,1-diamino-2,2-dinitroethylene molecules

    International Nuclear Information System (INIS)

    Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.; Kuklja, Maija M.

    2007-01-01

    The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO 2 bond fission and C-NO 2 to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed

  2. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  3. Challenging chemical concepts through charge density of molecules and crystals

    International Nuclear Information System (INIS)

    Gatti, Carlo

    2013-01-01

    Narrating my scientific career, I show in this paper how, starting as a computational and theoretical chemist, I got naturally involved with x-ray crystallographers because of the common interest in charge density and in the study of chemical bonds based on such an observable. The tools I devised and the conceptual developments I made to facilitate a profitable encounter between x-ray charge density and computational chemistry researchers are illustrated, with a special focus on the proposal and applications of the Source Function concept. (comment)

  4. Radiation from Accelerating Electric Charges: The Third Derivative of Position

    Science.gov (United States)

    Butterworth, Edward

    2010-03-01

    While some textbooks appear to suggest that acceleration of an electric charge is both a necessary and sufficient cause for the generation of electromagnetic radiation, the question has in fact had an intricate and involved history. In particular, the acceleration of a charge in hyperbolic motion, the behavior of a charge supported against a gravitational force (and its implications for the Equivalence Principle), and a charge accelerated by a workless constraint have been the subject of repeated investigation. The present paper examines specifically the manner in which the third derivative of position enters into the equations of motion, and the implications this has for the emission of radiation. Plass opens his review article with the statement that ``A fundamental property of all charged particles is that electromagnetic energy is radiated whenever they are accelerated'' (Plass 1961; emphasis mine). His treatment of the equations of motion, however, emphasizes the importance of the occurrence of the third derivative of position therein, present in linear motion only when the rate of acceleration is increasing or decreasing. There appears to be general agreement that the presence of a nonzero third derivative indicates that this charge is radiating; but does its absence preclude radiation? This question leads back to the issues of charges accelerated by a uniform gravitational field. We will examine the equations of motion as presented in Fulton & Rohrlich (1960), Plass (1961), Barut (1964), Teitelboim (1970) and Mo & Papas (1971) in the light of more recent literature in an attempt to clarify this question.

  5. Positive, Neutral, and Negative Mass-Charges in General Relativity

    Directory of Open Access Journals (Sweden)

    Borissova L.

    2006-07-01

    Full Text Available As shown, any four-dimensional proper vector has two observable projections onto time line, attributed to our world and the mirror world (for a mass-bearing particle, the projections posses are attributed to positive and negative mass-charges. As predicted, there should be a class of neutrally mass-charged particles that inhabit neither our world nor the mirror world. Inside the space-time area (membrane the space rotates at the light speed, and all particles move at as well the light speed. So, the predicted particles of the neutrally mass-charged class should seem as light-like vortices.

  6. Position Reconstruction and Charge Distribution in LHCb VELO Silicon Sensors

    CERN Document Server

    Versloot, TW; Akiba, K; Artuso, M; Van Beuzekom, M; Borel, J; Bowcock, TJV; Buytaert, J; Collins, P; Dumps, R; Dwyer, L; Eckstein, D; Eklund, L; Ferro-Luzzi, M; Frei, R; Gersabek M; Haefeli, G; Hennessy, K; Huse, T; Jans, E; John, M; Ketel, TJ; Keune, A; Lastoviicka, T; Mountain, R; Neufeld, N; Parkes, C; Stone, S; Szumlak, T; Tobin, M; Van Lysebetten, A; Viret, S; De Vries, H; Wang, J

    2007-01-01

    In 2006, a partially equipped LHCb VELO detector half was characterised in a test beam experiment (Alignment Challenge and Detector Commissioning, ACDC3). The position reconstruction and resolution for 2-strip R-sensor clusters was studied as a function of strip pitch and track inclination on the sensor surface. The Charge Density Distribution (CDD) is derived from the weighted charge distribution. It becomes asymmetric for tracks non-perpendicular to the strip surface. It is shown that the asymmetric broadening of the CDD around the track intercept position results in a linear eta-function at higher angles (>6 degrees). The sensor spatial resolution is determined both using a linear weighted mean of strip charges, as well as a third-order polynomial approximation via a eta-correction. The experimental results are in agreement with previous simulations. Future studies are underway to determine the angle and pitch dependent parameters which will be implemented in the LHCb VELO cluster position software tools.

  7. Equilibrium distributions of free charged particles and molecules in systems with non-plane boundaries

    International Nuclear Information System (INIS)

    Usenko, A.S.

    1995-01-01

    The equilibrium space-inhomogeneous distributions of free and pair bound charged particles are calculated in the dipole approximation for the plasma-molecular cylinder and sphere. It is shown that the space and orientational distributions of charged particles and molecules in these systems are similar to those in the cases of plasma-molecular system restricted by one or two parallel planes. The influence of the parameters of outer medium and a plasma-molecular system on the space and orientational distributions of charged particles and molecules is studied in detail

  8. Method and apparatus for positioning a beam of charged particles

    International Nuclear Information System (INIS)

    Michail, M.S.; Woodard, O.C.; Yourke, H.S.

    1975-01-01

    A beam of charged particles is stepped from one predetermined position to another to form a desired pattern on a semiconductor wafer. There is a dynamic correction for the deviation of the actual position of the beam from its predetermined position, so that the beam is applied to the deviated position rather than the predetermined position. Through the location of four registration marks, the writing field is precisely defined. Writing fields may be interconnected by the sharing of registration marks, enabling the construction of chips which are larger than a single writing field. (auth)

  9. Modulation and Control of Charge Transport Through Single-Molecule Junctions.

    Science.gov (United States)

    Wang, Kun; Xu, Bingqian

    2017-02-01

    The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge

  10. Crystal growth of new charge-transfer salts based on π-conjugated donor molecules

    Energy Technology Data Exchange (ETDEWEB)

    Morherr, Antonia, E-mail: morherr@stud.uni-frankfurt.de [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Witt, Sebastian [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Chernenkaya, Alisa [Graduate School Materials Science in Mainz, 55128 Mainz (Germany); Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bäcker, Jan-Peter [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Schönhense, Gerd [Institut für Physik, Johannes Gutenberg-Universität, 55099 Mainz (Germany); Bolte, Michael [Institut für anorganische Chemie, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany); Krellner, Cornelius [Physikalisches Institut, Goethe-Universität Frankfurt am Main, 60438 Frankfurt am Main (Germany)

    2016-09-01

    New charge transfer crystals of π-conjugated, aromatic molecules (phenanthrene and picene) as donors were obtained by physical vapor transport. The melting behavior, optimization of crystal growth and the crystal structure are reported for charge transfer salts with (fluorinated) tetracyanoquinodimethane (TCNQ-F{sub x}, x=0, 2, 4), which was used as acceptor material. The crystal structures were determined by single-crystal X-ray diffraction. Growth conditions for different vapor pressures in closed ampules were applied and the effect of these starting conditions for crystal size and quality is reported. The process of charge transfer was investigated by geometrical analysis of the crystal structure and by infrared spectroscopy on single crystals. With these three different acceptor strengths and the two sets of donor materials, it is possible to investigate the distribution of the charge transfer systematically. This helps to understand the charge transfer process in this class of materials with π-conjugated donor molecules.

  11. Charge-Dipole Acceleration of Polar Gas Molecules towards Charged Nanoparticles: Involvement in Powerful Charge-Induced Catalysis of Heterophase Chemical Reactions and Ball Lightning Phenomenon

    Directory of Open Access Journals (Sweden)

    Oleg Meshcheryakov

    2010-01-01

    Full Text Available In humid air, the substantial charge-dipole attraction and electrostatic acceleration of surrounding water vapour molecules towards charged combustible nanoparticles cause intense electrostatic hydration and preferential oxidation of these nanoparticles by electrostatically accelerated polar water vapour molecules rather than nonaccelerated nonpolar oxygen gas molecules. Intense electrostatic hydration of charged combustible nanoparticles converts the nanoparticle's oxide-based shells into the hydroxide-based electrolyte shells, transforming these nanoparticles into reductant/air core-shell nanobatteries, periodically short-circuited by intraparticle field and thermionic emission. Partially synchronized electron emission breakdowns within trillions of nanoparticles-nanobatteries turn a cloud of charged nanoparticles-nanobatteries into a powerful radiofrequency aerosol generator. Electrostatic oxidative hydration and charge-catalyzed oxidation of charged combustible nanoparticles also contribute to a self-oscillating thermocycling process of evolution and periodic autoignition of inflammable gases near to the nanoparticle's surface. The described effects might be of interest for the improvement of certain nanotechnological heterophase processes and to better understand ball lightning phenomenon.

  12. Charge Transfer Effect on Raman and Surface Enhanced Raman Spectroscopy of Furfural Molecules.

    Science.gov (United States)

    Wan, Fu; Shi, Haiyang; Chen, Weigen; Gu, Zhaoliang; Du, Lingling; Wang, Pinyi; Wang, Jianxin; Huang, Yingzhou

    2017-08-02

    The detection of furfural in transformer oil through surface enhanced Raman spectroscopy (SERS) is one of the most promising online monitoring techniques in the process of transformer aging. In this work, the Raman of individual furfural molecules and SERS of furfural-M x (M = Ag, Au, Cu) complexes are investigated through density functional theory (DFT). In the Raman spectrum of individual furfural molecules, the vibration mode of each Raman peak is figured out, and the deviation from experimental data is analyzed by surface charge distribution. In the SERS of furfural-M x complexes, the influence of atom number and species on SERS chemical enhancement factors (EFs) are studied, and are further analyzed by charge transfer effect. Our studies strengthen the understanding of charge transfer effect in the SERS of furfural molecules, which is important in the online monitoring of the transformer aging process through SERS.

  13. Cross sections and rate coefficients for charge exchange reactions of protons with hydrocarbon molecules

    International Nuclear Information System (INIS)

    Janev, R.K.; Kato, T.; Wang, J.G.

    2001-05-01

    The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C x H y charge exchange reactions from thermal energies up to several hundreds keV for all C x H y molecules with x=1, 2, 3 and 1 ≤ y ≤ 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)

  14. Cross sections and rate coefficients for charge exchange reactions of protons with hydrocarbon molecules

    Energy Technology Data Exchange (ETDEWEB)

    Janev, R.K.; Kato, T. [National Inst. for Fusion Science, Toki, Gifu (Japan); Wang, J.G. [Department of Physics and Astronomy, University of Georgia, Athens (United States)

    2001-05-01

    The available experimental and theoretical cross section data on charge exchange processes in collisions of protons with hydrocarbon molecules have been collected and critically assessed. Using well established scaling relationships for the charge exchange cross sections at low and high collision energies, as well as the known rate coefficients for these reactions in the thermal energy region, a complete cross section database is constructed for proton-C{sub x}H{sub y} charge exchange reactions from thermal energies up to several hundreds keV for all C{sub x}H{sub y} molecules with x=1, 2, 3 and 1 {<=} y {<=} 2x + 2. Rate coefficients for these charge exchange reactions have also been calculated in the temperature range from 0.1 eV to 20 keV. (author)

  15. Storage of charge carriers on emitter molecules in organic light-emitting diodes

    Science.gov (United States)

    Weichsel, Caroline; Burtone, Lorenzo; Reineke, Sebastian; Hintschich, Susanne I.; Gather, Malte C.; Leo, Karl; Lüssem, Björn

    2012-08-01

    Organic light-emitting diodes (OLEDs) using the red phosphorescent emitter iridium(III)bis(2-methyldibenzo[f,h]quinoxaline) (acetylacetonate) [Ir(MDQ)2(acac)] are studied by time-resolved electroluminescence measurements. A transient overshoot after voltage turn-off is found, which is attributed to electron accumulation on Ir(MDQ)2(acac) molecules. The mechanism is verified via impedance spectroscopy and by application of positive and negative off-voltages. We calculate the density of accumulated electrons and find that it scales linearly with the doping concentration of the emitter. Using thin quenching layers, we locate the position of the emission zone during normal OLED operation and after voltage turn-off. In addition, the transient overshoot is also observed in three-color white-emitting OLEDs. By time- and spectrally resolved measurements using a streak camera, we directly attribute the overshoot to electron accumulation on Ir(MDQ)2(acac). We propose that similar processes are present in many state-of-the-art OLEDs and believe that the quantification of charge carrier storage will help to improve the efficiency of OLEDs.

  16. Charging and heat collection by a positively charged dust grain in a plasma.

    Science.gov (United States)

    Delzanno, Gian Luca; Tang, Xian-Zhu

    2014-07-18

    Dust particulates immersed in a quasineutral plasma can emit electrons in several important applications. Once electron emission becomes strong enough, the dust enters the positively charged regime where the conventional orbital-motion-limited (OML) theory can break down due to potential-well effects on trapped electrons. A minimal modification of the trapped-passing boundary approximation in the so-called OML(+) approach is shown to accurately predict the dust charge and heat collection flux for a wide range of dust size and temperature.

  17. Large tunable image-charge effects in single-molecule junctions.

    NARCIS (Netherlands)

    Perrin, M.L.; Verzijl, C.J.; Martin, C.A.; Shaikh, A.J.; Eelkema, R.; Esch, J.H. van; Ruitenbeek, J.M. van; Thijssen, J.M.; Zant, H.S. van der; Dulic, D.

    2013-01-01

    Metal/organic interfaces critically determine the characteristics of molecular electronic devices, because they influence the arrangement of the orbital levels that participate in charge transport. Studies on self-assembled monolayers show molecule-dependent energy-level shifts as well as

  18. Temperature dependence of positronium reactivities with charge transfer molecules in bilayer membranes

    International Nuclear Information System (INIS)

    Jean, Y.C.; Yu, C.; Wang, Y.Y.; Yeh, Y.Y.

    1984-01-01

    Rate constants for positronium atoms reacting chemically with charge-transfer molecules such as p-benzoquinone, nitrobenzene, and coenzyme Q-10 in a model bilayer membrane, dipalmitoylphosphatidylcholine (DPPC), have been measured at temperatures between 23 and 65 0 C. A strong variation of the positronium chemical reactivities, k/sub Ps/ was observed in these systems: k/sub Ps/ increases with increasing temperature until the pretransition temperature of the membrane reaches a maximum value near the main transition temperature and decreases at temperatures higher than the main transition temperature. This variation is interpreted in terms of fluidity and permeability changes associated with the phase transitions of membranes and in terms of charge-transfer-complex formation between the solubilized molecules and the polar head of the membrane. These results demonstrate that positronium and its annihilation characteristics can be employed to investigate charge transport phenomena and microstructural changes of real biological membranes

  19. Electron stereodynamics in coulomb explosion of molecules by slow highly charged ions

    International Nuclear Information System (INIS)

    Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko

    2008-01-01

    The three-center Coulombic over-the-barrier model is developed for Coulomb explosion of a homonuclear diatomic molecule in collisions with a slow (∼10 eV/amu) highly charged ion. A conventional two-step picture of multiple electron transfer followed by Coulomb explosion is far from appropriate because the molecule sets out to dissociate before the incident ion approaches the closest distance. We treat the formation of a quasi-molecule and its decay into the three moving atomic ions. Charge-asymmetric population between fragment ions observed in a triple-coincidence measurement is suggested to reflect the bond elongation during a collision. Collisions of Kr 8+ + N 2 are analyzed. (author)

  20. The effect of the charge density on the dipole moment of diatomic molecules

    International Nuclear Information System (INIS)

    Rosato, A.; Germano, J.S.E.

    1986-01-01

    The results of the calculation, using the Variational Cellular Method (VCM), of the electric dipole moment of several diatomic molecules are improved. In previous calculations, the electronic charge density was treated like a spherically symmetric function in the inscribed sphere within each cell and as being the same constant value for all intercellular regions. Since the results obtained with such an approximation have not been satisfactory, an improved approximation for the charge density in the intercellular regions is needed. It is considered that the charge density is still constant outside the inscribed sphere but with different values in each intercellular region. A new expression for the dipole moment is obtained, and applied to the diatomic molecules HF, CO, BF and CS. In addition, the corresponding dipole moment curves, potential energy curves and spectroscopic constants are calculated taking into consideration our approximation and the traditional approximation for the charge density. The results of the two models are compared with each other and with experimental results for all the molecules considered. (Author) [pt

  1. Small interfering RNA delivery through positively charged polymer nanoparticles

    International Nuclear Information System (INIS)

    Dragoni, Luca; Cesana, Alberto; Moscatelli, Davide; Ferrari, Raffaele; Morbidelli, Massimo; Lupi, Monica; Falcetta, Francesca; Ubezio, Paolo; D’Incalci, Maurizio

    2016-01-01

    Small interfering RNA (siRNA) is receiving increasing attention with regard to the treatment of many genetic diseases, both acquired and hereditary, such as cancer and diabetes. Being a high molecular weight (MW) polyanion, siRNA is not able to cross a cell membrane, and in addition it is unstable in physiological conditions. Accordingly, a biocompatible nanocarrier able to deliver siRNA into cells is needed. In this work, we synthesized biocompatible positively charged nanoparticles (NPs) following a two-step process that involves ring opening polymerization (ROP) and emulsion free radical polymerization (EFRP). Firstly, we proved the possibility of fine tuning the NPs’ characteristics (e.g. size and surface charge) by changing the synthetic process parameters. Then the capability in loading and delivering undamaged siRNA into a cancer cell cytoplasm has been shown. This latter process occurs through the biodegradation of the polymer constituting the NPs, whose kinetics can be tuned by adjusting the polymer’s MW. Finally, the ability of NPs to carry siRNA inside the cells in order to inhibit their target gene has been demonstrated using green flourescent protein positive cells. (paper)

  2. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  3. Charge transfer in dissociating iodomethane and fluoromethane molecules ionized by intense femtosecond X-ray pulses

    Directory of Open Access Journals (Sweden)

    Rebecca Boll

    2016-07-01

    Full Text Available Ultrafast electron transfer in dissociating iodomethane and fluoromethane molecules was studied at the Linac Coherent Light Source free-electron laser using an ultraviolet-pump, X-ray-probe scheme. The results for both molecules are discussed with respect to the nature of their UV excitation and different chemical properties. Signatures of long-distance intramolecular charge transfer are observed for both species, and a quantitative analysis of its distance dependence in iodomethane is carried out for charge states up to I21+. The reconstructed critical distances for electron transfer are in good agreement with a classical over-the-barrier model and with an earlier experiment employing a near-infrared pump pulse.

  4. Influence of capture to excited states of multiply charged ion beams colliding with small molecules

    International Nuclear Information System (INIS)

    Montenegro, P; Monti, J M; Fojón, O A; Hanssen, J; Rivarola, R D

    2015-01-01

    Electron capture by multiply charged ions impacting on small molecules is theoretically investigated. Particular attention is paid to the case of biological targets. The interest is focused on the importance of the transition to excited final states which can play a dominant role on the total capture cross sections. Projectiles at intermediate and high collision energies are considered. Comparison with existing experimental data is shown. (paper)

  5. Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule

    Directory of Open Access Journals (Sweden)

    Satoshi Ohmura

    2016-01-01

    Full Text Available Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC-triethylene glycol (TEG–C60 molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D+ and A- in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.

  6. Doping effect on photoabsorption and charge-separation dynamics in light-harvesting organic molecule

    Energy Technology Data Exchange (ETDEWEB)

    Ohmura, Satoshi, E-mail: s.ohmura.m4@cc.it-hiroshima.ac.jp [Research Center for Condensed Matter Physics, Department of Civil Engineering and Urban Design, Hiroshima Institute of Technology, Hiroshima 731-5193 (Japan); Tsuruta, Kenji [Department of Electrical and Electronic Engineering, Okayama University, Okayama 700-8530 (Japan); Shimojo, Fuyuki [Department of Physics, Kumamoto University, Kumamoto 860-8555 Japan (Japan); Nakano, Aiichiro [Collaboratory for Advanced Computing and Simulations, Department of Computer Science, Department of Physics & Astronomy, Department of Chemical Engineering & Materials Science, Department of Biological Sciences, University of Southern California, CA90089-024 (United States)

    2016-01-15

    Using ab-initio theoretical methods, we demonstrate possible enhancement of photo-conversion efficiency of an organic solar cell via intentional doping in molecular graphene-fullerene heterojunction [the hexabenzocoronene (HBC)-triethylene glycol (TEG)–C{sub 60} molecule]. Photoabsorption analysis indicates oxygen substitution into HBC leads to an extension of the spectra up to an infrared regime. A quantum-mechanical molecular dynamics simulation incorporating nonadiabatic electronic transitions reveals that a dissociated charge state (D{sup +} and A{sup -}) in the O-doped system is more stable than the pristine case due to the presence of an effective barrier by the TEG HOMO/LUMO level. We also find that oxygen doping in HBC enhances the intermolecular carrier mobility after charge separation. On the other hand, the pristine molecule undergoes rapid recombination between donor and acceptor charges at the interface. These analyses suggest that the graphene oxidation opens a new window in the application of organic super-molecules to solar cells.

  7. Charge dependence of one and two electron processes in collisions between hydrogen molecules and fast projectiles

    International Nuclear Information System (INIS)

    Wells, E.; Ben-Itzhak, I.; Carnes, K.D.; Krishnamurthi, V.

    1996-01-01

    The ratio of double- to single-ionization (DI/SI) as well as the ratio of ionization-excitation to single-ionization (IE/SI) in hydrogen molecules was studied by examining the effect of the projectile charge on these processes. The DI/SI and IE/SI ratios were measured using the coincidence time of flight technique at a fixed velocity (1 MeV/amu) over a range of projectile charge states (q = 1-9,14,20). Preliminary results indicate that for a highly charged F 9+ projectile the DI/SI and IE/SI ratios are 6.8% and 24.7%, respectively, a large increase from the ratios of 0.13% and 1.95%, respectively, for H + projectiles. For low charge states, the DI/SI is negligible relative to the IE/SI ratio, while for more highly charged projectiles the DI/SI ratio becomes comparable to the IE/SI ratio. This indicates that double-ionization increases much more rapidly with projectile charge than ionization-excitation

  8. X-ray Pump–Probe Investigation of Charge and Dissociation Dynamics in Methyl Iodine Molecule

    Directory of Open Access Journals (Sweden)

    Li Fang

    2017-05-01

    Full Text Available Molecular dynamics is of fundamental interest in natural science research. The capability of investigating molecular dynamics is one of the various motivations for ultrafast optics. We present our investigation of photoionization and nuclear dynamics in methyl iodine (CH3I molecule with an X-ray pump X-ray probe scheme. The pump–probe experiment was realized with a two-mirror X-ray split and delay apparatus. Time-of-flight mass spectra at various pump–probe delay times were recorded to obtain the time profile for the creation of high charge states via sequential ionization and for molecular dissociation. We observed high charge states of atomic iodine up to 29+, and visualized the evolution of creating these high atomic ion charge states, including their population suppression and enhancement as the arrival time of the second X-ray pulse was varied. We also show the evolution of the kinetics of the high charge states upon the timing of their creation during the ionization-dissociation coupled dynamics. We demonstrate the implementation of X-ray pump–probe methodology for investigating X-ray induced molecular dynamics with femtosecond temporal resolution. The results indicate the footprints of ionization that lead to high charge states, probing the long-range potential curves of the high charge states.

  9. The effect of polymer size and charge of molecules on permeation through synovial membrane and accumulation in hyaline articular cartilage.

    Science.gov (United States)

    Sterner, B; Harms, M; Wöll, S; Weigandt, M; Windbergs, M; Lehr, C M

    2016-04-01

    The treatment of joint related diseases often involves direct intra-articular injections. For rational development of novel delivery systems with extended residence time in the joint, detailed understanding of transport and retention phenomena within the joint is mandatory. This work presents a systematic study on the in vitro permeation, penetration and accumulation of model polymers with differing charges and molecular weights in bovine joint tissue. Permeation experiments with bovine synovial membrane were performed with PEG polymers (6-200 kDa) and methylene blue in customized diffusion chambers. For polyethylene glycol, 2-fold (PEG 6 kDa), 3-fold (PEG 10 kDa) and 13-fold (PEG 35 kDa) retention by the synovial membrane in reference to the small molecule methylene blue was demonstrated. No PEG 200 kDa was found in the acceptor in detectable amounts after 48 h. This showed the potential for a distinct extension of joint residence times by increasing molecular weights. In addition, experiments with bovine cartilage tissue were conducted. The ability for positively charged, high molecular weight chitosans and HEMA-Co-TMAP (HCT) polymers (up to 233 kDa) to distribute throughout the entire cartilage matrix was demonstrated. In contrast, a distribution into cartilage was not observed for neutral PEG polymers (6-200 kDa). Furthermore, the positive charge density of different compounds (chitosan, HEMA-Co-TMAP, methylene blue, MSC C1 (neutral NCE) and MSC D1 (positively charged NCE) was found to correlate with their accumulation in bovine cartilage tissue. In summary, the results offer pre-clinical in vitro data, indicating that the modification of molecular size and charge of a substance has the potential to decelerate its clearance through the synovial membrane and to promote accumulation inside the cartilage matrix. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Anisotropic charge transport in large single crystals of π-conjugated organic molecules.

    Science.gov (United States)

    Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent

    2014-05-07

    The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.

  11. Visualizing electron dynamics in organic materials: Charge transport through molecules and angular resolved photoemission

    Science.gov (United States)

    Kümmel, Stephan

    Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.

  12. Signatures of dynamics in charge transport through organic molecules; Dynamisches Verhalten beim Ladungstransport durch organische Molekuele

    Energy Technology Data Exchange (ETDEWEB)

    Secker, Daniel

    2008-06-03

    The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)

  13. Positively charged phosphorus as a hydrogen bond acceptor

    DEFF Research Database (Denmark)

    Hansen, Anne Schou; Du, Lin; Kjærgaard, Henrik Grum

    2014-01-01

    Phosphorus (P) is an element that is essential to the life of all organisms, and the atmospheric detection of phosphine suggests the existence of a volatile biogeochemical P cycle. Here, we investigate the ability of P to participate in the formation of OH···P hydrogen bonds. Three bimolecular......-stretching frequency red shifts and quantum chemical calculations, we find that P is an acceptor atom similar in strength to O and S and that all three P, O, and S atoms are weaker acceptors than N. The quantum chemical calculations show that both H and P in the OH···P hydrogen bond have partial positive charges......, as expected from their electronegativities. However, the electrostatic potentials show a negative potential area on the electron density surface around P that facilitates formation of hydrogen bonds....

  14. Exploring Charge Transport in Guest Molecule Infiltrated Cu3(BTC)2 Metal Organic Framework

    Energy Technology Data Exchange (ETDEWEB)

    Leonard, Francois Leonard [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stavila, Vitalie [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Allendorf, Mark D. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)

    2014-09-01

    The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu3(BTC)2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu3(BTC)2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holes are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.

  15. Reorganization energy upon charging a single molecule on an insulator measured by atomic force microscopy

    Science.gov (United States)

    Fatayer, Shadi; Schuler, Bruno; Steurer, Wolfram; Scivetti, Ivan; Repp, Jascha; Gross, Leo; Persson, Mats; Meyer, Gerhard

    2018-05-01

    Intermolecular single-electron transfer on electrically insulating films is a key process in molecular electronics1-4 and an important example of a redox reaction5,6. Electron-transfer rates in molecular systems depend on a few fundamental parameters, such as interadsorbate distance, temperature and, in particular, the Marcus reorganization energy7. This crucial parameter is the energy gain that results from the distortion of the equilibrium nuclear geometry in the molecule and its environment on charging8,9. The substrate, especially ionic films10, can have an important influence on the reorganization energy11,12. Reorganization energies are measured in electrochemistry13 as well as with optical14,15 and photoemission spectroscopies16,17, but not at the single-molecule limit and nor on insulating surfaces. Atomic force microscopy (AFM), with single-charge sensitivity18-22, atomic-scale spatial resolution20 and operable on insulating films, overcomes these challenges. Here, we investigate redox reactions of single naphthalocyanine (NPc) molecules on multilayered NaCl films. Employing the atomic force microscope as an ultralow current meter allows us to measure the differential conductance related to transitions between two charge states in both directions. Thereby, the reorganization energy of NPc on NaCl is determined as (0.8 ± 0.2) eV, and density functional theory (DFT) calculations provide the atomistic picture of the nuclear relaxations on charging. Our approach presents a route to perform tunnelling spectroscopy of single adsorbates on insulating substrates and provides insight into single-electron intermolecular transport.

  16. Electron-molecule chemistry and charging processes on organic ices and Titan's icy aerosol surrogates

    Science.gov (United States)

    Pirim, C.; Gann, R. D.; McLain, J. L.; Orlando, T. M.

    2015-09-01

    Electron-induced polymerization processes and charging events that can occur within Titan's atmosphere or on its surface were simulated using electron irradiation and dissociative electron attachment (DEA) studies of nitrogen-containing organic condensates. The DEA studies probe the desorption of H- from hydrogen cyanide (HCN), acetonitrile (CH3CN), and aminoacetonitrile (NH2CH2CN) ices, as well as from synthesized tholin materials condensed or deposited onto a graphite substrate maintained at low temperature (90-130 K). The peak cross sections for H- desorption during low-energy (3-15 eV) electron irradiation were measured and range from 3 × 10-21 to 2 × 10-18 cm2. Chemical and structural transformations of HCN ice upon 2 keV electron irradiation were investigated using X-ray photoelectron and Fourier-transform infrared spectroscopy techniques. The electron-beam processed materials displayed optical properties very similar to tholins produced by conventional discharge methods. Electron and negative ion trapping lead to 1011 charges cm-2 on a flat surface which, assuming a radius of 0.05 μm for Titan aerosols, is ∼628 charges/radius (in μm). The facile charge trapping indicates that electron interactions with nitriles and complex tholin-like molecules could affect the conductivity of Titan's atmosphere due to the formation of large negative ion complexes. These negatively charged complexes can also precipitate onto Titan's surface and possibly contribute to surface reactions and the formation of dunes.

  17. Single Molecule Spectroelectrochemistry of Interfacial Charge Transfer Dynamics In Hybrid Organic Solar Cell

    Energy Technology Data Exchange (ETDEWEB)

    Pan, Shanlin [Univ. of Alabama, Tuscaloosa, AL (United States)

    2014-11-16

    Our research under support of this DOE grant is focused on applied and fundamental aspects of model organic solar cell systems. Major accomplishments are: 1) we developed a spectroelectorchemistry technique of single molecule single nanoparticle method to study charge transfer between conjugated polymers and semiconductor at the single molecule level. The fluorescence of individual fluorescent polymers at semiconductor surfaces was shown to exhibit blinking behavior compared to molecules on glass substrates. Single molecule fluorescence excitation anisotropy measurements showed the conformation of the polymer molecules did not differ appreciably between glass and semiconductor substrates. The similarities in molecular conformation suggest that the observed differences in blinking activity are due to charge transfer between fluorescent polymer and semiconductor, which provides additional pathways between states of high and low fluorescence quantum efficiency. Similar spectroelectrochemistry work has been done for small organic dyes for understand their charge transfer dynamics on various substrates and electrochemical environments; 2) We developed a method of transferring semiconductor nanoparticles (NPs) and graphene oxide (GO) nanosheets into organic solvent for a potential electron acceptor in bulk heterojunction organic solar cells which employed polymer semiconductor as the electron donor. Electron transfer from the polymer semiconductor to semiconductor and GO in solutions and thin films was established through fluorescence spectroscopy and electroluminescence measurements. Solar cells containing these materials were constructed and evaluated using transient absorption spectroscopy and dynamic fluorescence techniques to understand the charge carrier generation and recombination events; 3) We invented a spectroelectorchemistry technique using light scattering and electroluminescence for rapid size determination and studying electrochemistry of single NPs in an

  18. Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy

    International Nuclear Information System (INIS)

    Lee, Min Hyung; Song, Hyunwook

    2013-01-01

    We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects

  19. One- and two-electron processes in collisions between hydrogen molecules and slow highly charged ions

    International Nuclear Information System (INIS)

    Wells, E.; Carnes, K.D.; Tawara, H.; Ali, R.; Sidky, Emil Y.; Illescas, Clara; Ben-Itzhak, I.

    2005-01-01

    A coincidence time-of-flight technique coupled with projectile charge state analysis was used to study electron capture in collisions between slow highly charged ions and hydrogen molecules. We found single electron capture with no target excitation to be the dominant process for both C 6+ projectiles at a velocity of 0.8 atomic units and Ar 11+ projectiles at v 0.63 a.u. Double electron capture and transfer excitation, however, were found to be comparable and occur about 30% of the time relative to single capture. Most projectiles (96%) auto-ionize quickly following double capture into doubly excited states. The data are compared to classical and quantum mechanical model calculations

  20. Charge transfer through amino groups-small molecules interface improving the performance of electroluminescent devices

    Science.gov (United States)

    Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Kus, Mahmut; Okur, Salih; Demic, Şerafettin; Demirak, Kadir; Kurt, Mustafa; Icli, Sıddık

    2016-05-01

    A carboxylic group functioned charge transporting was synthesized and self-assembled on an indium tin oxide (ITO) anode. A typical electroluminescent device [modified ITO/TPD (50 nm)/Alq3 (60 nm)/LiF (2 nm)/(120 nm)] was fabricated to investigate the effect of the amino groups-small molecules interface on the characteristics of the device. The increase in the surface work function of ITO is expected to facilitate the hole injection from the ITO anode to the Hole Transport Layer (HTL) in electroluminescence. The modified electroluminescent device could endure a higher current and showed a much higher luminance than the nonmodified one. For the produced electroluminescent devices, the I-V characteristics, optical characterization and quantum yields were performed. The external quantum efficiency of the modified electroluminescent device is improved as the result of the presence of the amino groups-small molecules interface.

  1. Excitation of atoms and molecules in collisions with highly charged ions

    International Nuclear Information System (INIS)

    Watson, R.L.

    1991-01-01

    Much of the work this year has been directed toward studies of charge exchange and ionization in single collisions of heavy ions with gaseous atoms and molecules. A study of the double ionization of He by high energy N 7+ ions, which began last year, was extended up in energy to 40 MeV/amu. These measurements verified the deviations from the predictions of theory observed in our previous work and indicated that the energy required to reach the limiting value of the ratio of double-to-single ionization cross sections may be as high as 70 MeV/amu

  2. Elimination of Spurious Fractional Charges in Dissociating Molecules by Correcting the Shape of Approximate Kohn-Sham Potentials.

    Science.gov (United States)

    Komsa, Darya N; Staroverov, Viktor N

    2016-11-08

    Standard density-functional approximations often incorrectly predict that heteronuclear diatomic molecules dissociate into fractionally charged atoms. We demonstrate that these spurious charges can be eliminated by adapting the shape-correction method for Kohn-Sham potentials that was originally introduced to improve Rydberg excitation energies [ Phys. Rev. Lett. 2012 , 108 , 253005 ]. Specifically, we show that if a suitably determined fraction of electron charge is added to or removed from a frontier Kohn-Sham orbital level, the approximate Kohn-Sham potential of a stretched molecule self-corrects by developing a semblance of step structure; if this potential is used to obtain the electron density of the neutral molecule, charge delocalization is blocked and spurious fractional charges disappear beyond a certain internuclear distance.

  3. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  4. SFG and SPR Study of Sodium Dodecyl Sulfate Film Assembly on Positively Charged Surfaces

    Science.gov (United States)

    Song, Sanghun; Weidner, Tobias; Wagner, Matthew; Castner, David

    2012-02-01

    This study uses sum frequency generation (SFG) vibrational spectroscopy and surface plasmon resonance (SPR) sensing to investigate the structure of sodium dodecyl sulfate (SDS) films formed on positively charged and hydrophilic surfaces. The SPR signals show a good surface coverage suggesting that full monolayer coverage is reached at 1 mM. SFG spectra of SDS adsorbed exhibits well resolved CH3 peaks and OH peaks. At both 0.2 mM and 1 mM SDS concentration the intensity of both the CH3 and OH peaks decreased close to background levels. We found that the loss of SFG signal at 0.2 mM occurs at this concentration independent of surface charge density. It is more likely that the loss of signal is related to structural inhomogeneity induced by a striped phase - stand-up phase transition. This is supported by a distinct change of the relative SFG phase between CH3/OH near 0.2 mM. The second intensity minimum might be related to charge compensation effects. We observed a substrate dependence for the high concentration transition. We also observed distinct SFG signal phase changes for water molecules associated with SDS layers at different SDS solution concentrations indicating that the orientation of bound water changed with SDS surface structure.

  5. Ion and electron swarm studies of relevance to plasma processing: positive ion-molecule and electron-molecule studies of SF6 and derivatives

    International Nuclear Information System (INIS)

    Atterbury, C.; Kennedy, R.A.; Critchley, A.D.J.; Mayhew, C.A.

    2002-01-01

    Many sequential and parallel chemical reactions involving charged species occur in a plasma. Data needed to model plasma's chemical and physical environment includes cross-section, rate coefficients, and product ion distribution of electron-molecule and ion-molecule processes. Such reactions are studied by our group away from the complexity of the plasma environment, with experimental techniques that allow us to concentrate on a single process, where usually only one or two species are involved. A molecule commonly used in plasma etching applications is SF 6 1,2 . We have performed a series of positive ion-molecule and electron attachment studies on SF 6 and related molecules, including SeF 6 , TeF 6 (i.e. XF 6 molecules), SF 5 CF 3 and SF 5 Cl (i.e. SF 5 X molecules) 3- (. The studies of ion reactions with and electron attachment to SF 6 and physically similar molecules are of value when seeking to understand the ion and electron chemistry occurring in SF 6 containing plasma. The result of these studies are presented in this poster. Ion-molecule reactions. Rate coefficients and ion product branching ratios have been determined with the Selected Ion Flow Tube (SIFT) at room temperature (300 K) for reactions of SF 5 X with the following twenty-two cations; Ne + , F + , Ar + , N 2 + , N + , CO + , CO 2 + , O + , N 2 O + , O 2 + , SF 4 + , CF 2 + , SF + , SF 2 + , NO 2 + , SF 5 + , NO + , CF + , CF 3 + , SF 3 + , and H 3 O + (listed in order of decreasing recombination energy). SF 2 + , NO 2 + , NO + , SF 3 + , and H 3 O + are found to be unreacted with both SF 5 CF 3 and SF 5 Cl. The majority of the other reactions proceed with rate coefficients that are close to the capture value. Those found to occur at rates significantly less than the capture mechanism value re the reactions of O 2 + , SF + , SF 5 + , and CF 3 + with SF 5 CF 3 , and SF 4 + and SF 5 + with SF 5 Cl. Several distinction processes are observed among the large number of reactions studied, including

  6. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    International Nuclear Information System (INIS)

    Li Yun; Pan Lijia; Pu Lin; Shi Yi; Liu Chuan; Tsukagoshi, Kazuhito

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels. (paper)

  7. Charge trapping at organic/self-assembly molecule interfaces studied by electrical switching behaviour in a crosspoint structure

    Science.gov (United States)

    Li, Yun; Liu, Chuan; Pan, Lijia; Pu, Lin; Tsukagoshi, Kazuhito; Shi, Yi

    2012-01-01

    Charge trapping at organic/self-assembly molecule (SAM) interfaces is studied by the electrical switching behaviour in a crosspoint structure, where interfacial charge trapping tunes the potential barrier of the SAM layer. The sample with rubrene exhibits the write-once read-many-times memory effect, which is due to the interfacial charges trapped at deep states. On the other hand, the sample with 2-amino-4,5-dicyanoimidazole presents recyclable conduction transition, which results from the trapped charges distributed at shallow states. Moreover, the percentage of the charges trapped at shallow states can be estimated from electrical transition levels.

  8. Cross-sections for inelastic collisions of fast charged particles with atoms and molecules

    International Nuclear Information System (INIS)

    Inokuti, M.

    1987-01-01

    Despite the long history of research, the current experimental data of the cross-sections, required for solving problems of radiological physics and dosimetry, are far from being complete or even satisfactory for tentative applications. Calculations are, in general, difficult and only in exceptional situations lead to reliable results. Thus, one practical approach to the cross-section determination is to test experimental data with general criteria. This is possible because cross-sections for various processes are related among themselves and with many other properties of atoms and molecules. For example, the Bethe theory indicates a close connection between photoabsorption and energy absorption by glancing collisions and puts many other useful constraints on the cross-section data. Development and use of these data constraints, first advanced by Platzman, can now be demonstrated in many examples. More recent studies concern the determination of the analytic expression most suitable for fitting the data on the oscillator strength distribution or the energy distribution of secondary electrons from ionizing collisions of charged particles. There are three areas to which major efforts should be directed: (1) Methods of absolute cross-section measurements, both for electron and ionic collisions, must be thoroughly reviewed so that sources of systematic errors may be identified and corrected. (2) Efforts should be devoted to the understanding of the data systematics, viz. the trends of cross-sections for a series of molecules. This is especially important because the variety of molecules relevant to radiological physics and radiation biology is so enormous that even the data presentation for each molecule will be impractical. (3) Electron and ionic collisions with molecules in condensed phases will be an important topic of study for years to come. Initial reports on efforts in this direction are encouraging. 49 refs

  9. Charge dividing mechanism in position-sensitive detectors

    International Nuclear Information System (INIS)

    Radeka, V.; Rehak, P.

    1978-01-01

    A complete charge-division mechanism, including both the diffusion and the electromagnetic wave propagation on resistive electrodes, is presented. The charge injected into such a transmission line divides between the two ends according to the ratio of resistances and independently of the value of the line resistance, of the propagation mechanism and of the distribution of inductance and capacitance along the line. The shortest charge division time is achieved for Rl = 2π (L/C)/sup 1/2), where R, L, C are resistance, inductance and capacitance per unit length and l is the length of the line

  10. Effect of positively charged particles on sputtering damage of organic electro-luminescent diodes with Mg:Ag alloy electrodes fabricated by facing target sputtering

    Directory of Open Access Journals (Sweden)

    Kouji Suemori

    2017-04-01

    Full Text Available We investigated the influence of the positively charged particles generated during sputtering on the performances of organic light-emitting diodes (OLEDs with Mg:Ag alloy electrodes fabricated by sputtering. The number of positively charged particles increased by several orders of magnitude when the target current was increased from 0.1 A to 2.5 A. When a high target current was used, many positively charged particles with energies higher than the bond energy of single C–C bonds, which are typically found in organic molecules, were generated. In this situation, we observed serious OLED performance degradation. On the other hand, when a low target current was used, OLED performance degradation was not observed when the number of positively charged particles colliding with the organic underlayer increased. We concluded that sputtering damage caused by positively charged particles can be avoided by using a low target current.

  11. The charge spectrum of positive ions in a hydrogen aurora

    Science.gov (United States)

    Lynch, J.; Pulliam, D.; Leach, R.; Scherb, F.

    1976-01-01

    An auroral ion charge spectrometer was flown into a hydrogen aurora on a Javelin sounding rocket launched from Churchill, Manitoba. The instrument contained an electrostatic analyzer which selected particles with incident energy per unit charge up to 20 keV/charge and an 80-kV power supply which accelerated these ions onto an array of solid state detectors. Ions tentatively identified as H(+), He(+2), and O(+) were detected from 225 to 820 km in altitude. The experiment did not discriminate between H(+) and He(+), or between O(+), N(+), and C(+). Upper limits of highly charged heavy ion abundances have been set at 20% of the He(+2) and 0.15% of the H(+). It is concluded that both terrestrial and solar wind sources play significant roles in auroral ion precipitation.

  12. Invariance of molecular charge transport upon changes of extended molecule size and several related issues

    Directory of Open Access Journals (Sweden)

    Ioan Bâldea

    2016-03-01

    Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.

  13. The Holographic Electron Density Theorem, de-quantization, re-quantization, and nuclear charge space extrapolations of the Universal Molecule Model

    Science.gov (United States)

    Mezey, Paul G.

    2017-11-01

    Two strongly related theorems on non-degenerate ground state electron densities serve as the basis of "Molecular Informatics". The Hohenberg-Kohn theorem is a statement on global molecular information, ensuring that the complete electron density contains the complete molecular information. However, the Holographic Electron Density Theorem states more: the local information present in each and every positive volume density fragment is already complete: the information in the fragment is equivalent to the complete molecular information. In other words, the complete molecular information provided by the Hohenberg-Kohn Theorem is already provided, in full, by any positive volume, otherwise arbitrarily small electron density fragment. In this contribution some of the consequences of the Holographic Electron Density Theorem are discussed within the framework of the "Nuclear Charge Space" and the Universal Molecule Model. In the Nuclear Charge Space" the nuclear charges are regarded as continuous variables, and in the more general Universal Molecule Model some other quantized parameteres are also allowed to become "de-quantized and then re-quantized, leading to interrelations among real molecules through abstract molecules. Here the specific role of the Holographic Electron Density Theorem is discussed within the above context.

  14. Effect of polysaccharide capsule of the microalgae Staurastrum iversenii var. americanum on diffusion of charged and uncharged molecules, using EPR technique

    International Nuclear Information System (INIS)

    Freire-Nordi, Cristina S.; Nascimento, Otaciro R.; Vieira, Armando A.H.; Nakaie, Clovis R.

    2006-01-01

    The existence of a mucilaginous envelope, sheath or capsule is usual in many desmids, but few data concerning its function are available. Previous studies of the transport function and permeation of molecules through the algae capsules were done using the algae Spondylosium panduriforme and Nephrocytium lunatum, the Electron Paramagnetic Resonance (EPR) technique, and different spin labels. The results suggested that the capsule functions as a selective diffusion medium. In the present work charged and uncharged molecules (spin labels group A) and Staurastrum iversenii var. americanum (Desmids),whose alga presents a great mucilaginous capsule, were used. Charged nitroxide molecules similar to amino acids (spin labels group B) were also used allowing a better understanding of the electrostatic effect in the permeation process across the capsule. The role of the cell capsule in the solute diffusion was evaluated by determining the capsulated and decapsulated cell permeation times. The permeation times for all spin labels tested in the cells lacking capsules were always shorter than those containing this physical barrier. The decay times of spin labels group A observed for S. iversenii were compared to other studied algae. The results regarding the diffusion of charged spin labels group B suggested that the interaction of cell capsule occurs more strongly with negatively charged molecules than with positively charged ones. The results obtained in this work with spin labels group A confirm that the capsule is an essential structure for the cell, and that due to the polar interactions with the spin labels, it plays an important role in the selection of small molecules. Several parameters, mainly those of electrostatic nature, seem to control the permeation across the algal capsules of spin labels group B, showing that structures which are similar to amino acids could diffuse across the interior of the algal cell. (author)

  15. First Principles Modeling and Interpretation of Ionization-Triggered Charge Migration in Molecules

    Science.gov (United States)

    Bruner, Adam; Hernandez, Sam; Mauger, Francois; Abanador, Paul; Gaarde, Mette; Schafer, Ken; Lopata, Ken

    Modeling attosecond coherent charge migration in molecules is important for understanding initial steps of photochemistry and light harvesting processes. Ionization triggered hole migration can be difficult to characterize and interpret as the dynamics can be convoluted with excited states. Here, we introduce a real-time time-dependent density functional theory (RT-TDDFT) approach for modeling such dynamics from first principles. To isolate the specific hole dynamics from excited states, Fourier transform analysis and orbital occupations are used to provide a spatial hole representation in the frequency domain. These techniques are applied to hole transfer across a thiophene dimer as well as core-hole triggered valence motion in nitrosobenzene. This work was supported by U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences, under Award No. DE-SC0012462.

  16. Study of correlations of positive and negative charged particles

    International Nuclear Information System (INIS)

    Takahashi, Y.; Chan, C.H.; Dong, B.L.; Duthie, J.G.; Gregory, J.C.; Hayashi, T.; Yokomi, H.; Christl, M.J.; Derrickson, J.H.; Eby, P.B.; Fountain, W.F.; Parnell, T.A.; Roberts, F.E.; Nagamiya, S.; Dake, S.; Tominaga, T.; Fuki, M.; Iyono, A.; Ogata, T.; Miyamura, O.

    1991-01-01

    Particle correlations of the central collision events of 32 S + Pb at 200 GeV/AMU have been studied by utilizing a Magnetic-Interferomagnetic-Emulsion-Chamber (MAGIC) detector. Particle angles, momentum, and charge-signs are measured for all produced charged tracks for each event. Two-particle correlation functions, C 2 = dN (vertical strokep 1 - p 2 vertical stroke = q)/dp 1 dp 2 , for (++), (--) and (+-) particles are examined. A source radius around 4 - 6 fm is observed for overall identical particle correlations, while unexpected short-range correlations of unlike-sign pairs are observed in the high rapidity region. An analysis of unlike-sign pairs in terms of resonance decays indicated that a large amount (40% relative to pions) of η or ω mesons (decaying into 3 π), or of scalar iso-scalar σ mesons (decaying into 2 π) would be required to explain some of the data. Multi-particle charge-sign clusters are recognized; however, their 'run-test' and 'conjugate-test' show small deviations from statistical fluctuations. (orig.)

  17. Study of position resolution for cathode readout MWPC with measurement of induced charge distribution

    International Nuclear Information System (INIS)

    Chiba, J.; Iwasaki, H.; Kageyama, T.; Kuribayashi, S.; Nakamura, K.; Sumiyoshi, T.; Takeda, T.

    1983-01-01

    A readout technqiue of multiwire proportional chambers by measurement of charges induced on cathode strips, orthogonal to anode wires, requires an algorithm to relate the measured charge distribution to the avalanche position. With given chamber parameters and under the influence of noise, resolution limits depend on the chosen algorithm. We have studied the position resolution obtained by the centroid method and by the charge-ratio method, both using three consecutive cathode strips. While the centroid method uses a single number, the center of gravity of the measured charges, the charge-ratio method uses the ratios of the charges Qsub(i-1)/Qsub(i) and Qsub(i+1)/Qsub(i) where Qsub(i) is the largest. To obtain a given resolution, the charge-ratio method generally allows wider cathode strips and therefore a smaller number of readout channels than the centroid method. (orig.)

  18. Adsorption of cations onto positively charged surface mesopores.

    Science.gov (United States)

    Neue, Uwe; Iraneta, Pamela; Gritti, Fabrice; Guiochon, Georges

    2013-11-29

    Uwe Neue developed a theoretical treatment to account for the adsorption of ions on mesopores of packing materials the walls of which are bonded to ionic ligands but left this work unfinished. We elaborated upon this treatment and refined it, based on the equivalence that he suggested between charged surface particles and a membrane that separates two ionic solutions but is impermeable to one specification. He had written that the electro-chemical potentials in both ionic solutions are equal (Donnan equilibrium). The equilibrium between the surface and the pore concentrations is accounted for by an homogeneous electrostatically modified Langmuir (EML) isotherm model. The theoretical results are presented for four different charge surface concentrations σ0=0, 0.001, 0.002, and 0.003C/m(2), using a phosphate buffer (W(S)pH=2.65) of ionic strength I=10mM. The average pore size, the specific surface area, and the specific pore volume of the stationary phase were Dp=140Å, Sp=182m(2)/g, and Vp=0.70cm(3)/g, respectively. The theoretical results provide the quantitative difference between the ionic strength, the pH, and the concentrations of all the ions in the pores and in the bulk eluent. The theory predicts (1) that the retention times of cations under linear conditions is lower and (2) that their band widths under overloaded conditions for a given retention factor shrinks when the surface charge density σ0 is increased. These theoretical results are in good agreement with experimental results published previously and explain them. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.

    2016-07-15

    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  20. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  1. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Seon Young; Jang, Soo Hwa [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of); Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su [Soongsil University, Department of Chemistry (Korea, Republic of); Lee, Kangtaek [Yonsei University, Department of Chemical and Biomolecular Engineering (Korea, Republic of); Yang, Sung Ik [Kyung Hee University, College of Environment and Applied Chemistry (Korea, Republic of); Joo, Sang-Woo, E-mail: sjoo@ssu.ac.kr [Soongsil University, Department of Chemistry (Korea, Republic of); Ryu, Pan Dong; Lee, So Yeong, E-mail: leeso@snu.ac.kr [Seoul National University, Laboratory of Veterinary Pharmacology, College of Veterinary Medicine and Institute for Veterinary Science (Korea, Republic of)

    2012-12-15

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  2. Cellular uptake and cytotoxicity of positively charged chitosan gold nanoparticles in human lung adenocarcinoma cells

    International Nuclear Information System (INIS)

    Choi, Seon Young; Jang, Soo Hwa; Park, Jin; Jeong, Saeromi; Park, Jin Ho; Ock, Kwang Su; Lee, Kangtaek; Yang, Sung Ik; Joo, Sang-Woo; Ryu, Pan Dong; Lee, So Yeong

    2012-01-01

    Cellular uptake, cytotoxicity, and mechanisms of cytotoxicity of the positively charged Au nanoparticles (NPs) were examined in A549 cells, which are one of the most characterized pulmonary cellular systems. Positively charged Au NPs were prepared by chemical reduction using chitosan. The dimension and surface charge of Au NPs were examined by transmission electron microscopy (TEM), dynamic light scattering, and zeta potential measurements. The uptake of Au NPs into A549 cells was also monitored using TEM and dark-field microscopy (DFM) and z-stack confocal microRaman spectroscopy. DFM live cell imaging was also performed to monitor the entry of chitosan Au NPs in real time. The cytotoxic assay, using both methylthiazol tetrazolium and lactate dehydrogenase assays revealed that positively charged Au NPs decreased cell viability. Flow cytometry, DNA fragmentation, real-time PCR, and western blot analysis suggest that positively charged chitosan Au NPs provoke cell damage through both apoptotic and necrotic pathways.

  3. Charge transfer through single molecule contacts: How reliable are rate descriptions?

    Directory of Open Access Journals (Sweden)

    Denis Kast

    2011-08-01

    Full Text Available Background: The trend for the fabrication of electrical circuits with nanoscale dimensions has led to impressive progress in the field of molecular electronics in the last decade. However, a theoretical description of molecular contacts as the building blocks of future devices is challenging, as it has to combine the properties of Fermi liquids in the leads with charge and phonon degrees of freedom on the molecule. Outside of ab initio schemes for specific set-ups, generic models reveal the characteristics of transport processes. Particularly appealing are descriptions based on transfer rates successfully used in other contexts such as mesoscopic physics and intramolecular electron transfer. However, a detailed analysis of this scheme in comparison with numerically exact solutions is still elusive.Results: We show that a formulation in terms of transfer rates provides a quantitatively accurate description even in domains of parameter space where strictly it is expected to fail, e.g., at lower temperatures. Typically, intramolecular phonons are distributed according to a voltage driven steady state that can only roughly be captured by a thermal distribution with an effective elevated temperature (heating. An extension of a master equation for the charge–phonon complex, to effectively include the impact of off-diagonal elements of the reduced density matrix, provides very accurate solutions even for stronger electron–phonon coupling.Conclusion: Rate descriptions and master equations offer a versatile model to describe and understand charge transfer processes through molecular junctions. Such methods are computationally orders of magnitude less expensive than elaborate numerical simulations that, however, provide exact solutions as benchmarks. Adjustable parameters obtained, e.g., from ab initio calculations allow for the treatment of various realizations. Even though not as rigorously formulated as, e.g., nonequilibrium Green’s function

  4. Synthesis, growth, structural modeling and physio-chemical properties of a charge transfer molecule: Guanidinium tosylate

    Science.gov (United States)

    Era, Paavai; Jauhar, RO. MU.; Vinitha, G.; Murugakoothan, P.

    2018-05-01

    An organic nonlinear optical material, guanidinium tosylate was synthesized adopting slow evaporation method and the crystals were harvested from aqueous methanolic medium with dimensions 13 × 9 × 3 mm3. Constitution of crystalline material was confirmed by single crystal X-ray diffraction study. The title compound crystallizes in the monoclinic crystal system with space group P21/c. The UV-vis-NIR spectral study of the grown crystal exhibits high transparency of 80% in the entire visible region with lower cut-off wavelength at 282 nm. Optimized molecular geometry of the grown crystal was obtained using density functional theory (DFT) and the frontier energy gaps calculated from the DFT aids to understand the charge transfer taking place in the molecule. The dielectric properties were studied as a function of temperature and frequency to find the charge distribution within the crystal. The titular compound is thermally stable up to 230 °C assessed by thermogravimetric and differential thermal analysis. Anisotropy in the mechanical behavior was observed while measuring for individual planes. The laser induced surface damage threshold of the grown crystal was measured to be 0.344 GW/cm2 for 1064 nm Nd:YAG laser radiation. Z-scan technique confirms the third-order nonlinear optical property with the ascertained nonlinear refractive index (n2), nonlinear absorption coefficient (β) and third order nonlinear susceptibility (χ(3)). Optical limiting study divulges that the transmitted output power step-up linearly with the increase of the input power at lower power realms and saturates from the threshold 24.95 mW/cm2 and amplitude 0.23 mW/cm2.

  5. Influence of charge on encapsulation and release behavior of small molecules in self-assembled layer-by-layer microcapsules.

    Science.gov (United States)

    Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K

    2014-12-01

    The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.

  6. Investigation of multi-state charge-storage properties of redox-active organic molecules in silicon-molecular hybrid devices for DRAM and Flash applications

    Science.gov (United States)

    Gowda, Srivardhan Shivappa

    Molecular electronics has recently spawned a considerable amount of interest with several molecules possessing charge-conduction and charge-storage properties proposed for use in electronic devices. Hybrid silicon-molecular technology has the promise of augmenting the current silicon technology and provide for a transitional path to future molecule-only technology. The focus of this dissertation work has been on developing a class of hybrid silicon-molecular electronic devices for DRAM and Flash memory applications utilizing redox-active molecules. This work exploits the ability of molecules to store charges with single-electron precision at room temperature. The hybrid devices are fabricated by forming self-assembled monolayers of redox-active molecules on Si and oxide (SiO2 and HfO2) surfaces via formation of covalent linkages. The molecules possess discrete quantum states from which electrons can tunnel to the Si substrate at discrete applied voltages (oxidation process, cell write), leaving behind a positively charged layer of molecules. The reduction (erase) process, which is the process of electrons tunneling back from Si to the molecules, neutralizes the positively charged molecular monolayer. Hybrid silicon-molecular capacitor test structures were electrically characterized with an electrolyte gate using cyclic voltammetry (CyV) and impedance spectroscopy (CV) techniques. The redox voltages, kinetics (write/erase speeds) and charge-retention characteristics were found to be strongly dependent on the Si doping type and densities, and ambient light. It was also determined that the redox energy states in the molecules communicate with the valence band of the Si substrate. This allows tuning of write and read states by modulating minority carriers in n- and p-Si substrates. Ultra-thin dielectric tunnel barriers (SiO2, HfO2) were placed between the molecules and the Si substrate to augment charge-retention for Flash memory applications. The redox response was

  7. Bianthrone in a Single-Molecule Junction: Conductance Switching with a Bistable Molecule Facilitated by Image Charge Effects

    DEFF Research Database (Denmark)

    Bjørnholm, Thomas

    2010-01-01

    Bianthrone is a sterically hindered compound that exists in the form of two nonplanar isomers. Our experimental study of single-molecule junctions with bianthrone reveals persistent switching of electric conductance at low temperatures, which can be reasonably associated with molecular isomerizat...

  8. Electronic coupling effects and charge transfer between organic molecules and metal surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Forker, Roman

    2010-07-01

    We employ a variant of optical absorption spectroscopy, namely in situ differential reflectance spectroscopy (DRS), for an analysis of the structure-properties relations of thin epitaxial organic films. Clear correlations between the spectra and the differently intense coupling to the respective substrates are found. While rather broad and almost structureless spectra are obtained for a quaterrylene (QT) monolayer on Au(111), the spectral shape resembles that of isolated molecules when QT is grown on graphite. We even achieve an efficient electronic decoupling from the subjacent Au(111) by inserting an atomically thin organic spacer layer consisting of hexa-peri-hexabenzocoronene (HBC) with a noticeably dissimilar electronic behavior. These observations are further consolidated by a systematic variation of the metal substrate (Au, Ag, and Al), ranging from inert to rather reactive. For this purpose, 3,4,9,10-perylenetetracarboxylic dianhydride (PTCDA) is chosen to ensure comparability of the molecular film structures on the different metals, and also because its electronic alignment on various metal surfaces has previously been studied with great intensity. We present evidence for ionized PTCDA at several interfaces and propose the charge transfer to be related to the electronic level alignment governed by interface dipole formation on the respective metals. (orig.)

  9. Excitation of atoms and molecules in collisions with highly charged ions

    International Nuclear Information System (INIS)

    Watson, R.L.

    1993-01-01

    A study of the double ionization of He by high-energy N 7+ ions was extended up in energy to 40 MeV/amu. Coincidence time-of-flight studies of multicharged N 2 , O 2 , and CO molecular ions produced in collisions with 97-MeV Ar 14+ ions were completed. Analysis of the total kinetic energy distributions and comparison with the available data for CO 2+ and CO 3+ from synchrotron radiation experiments led to the conclusion that ionization by Ar-ion impact populates states having considerably higher excitation energies than those accessed by photoionization. The dissociation fractions for CO 1+ and CO 2+ molecular ions, and the branching ratios for the most prominent charge division channels of CO 2+ through CO 7+ were determined from time-of-flight singles and coincidence data. An experiment designed to investigate the orientation dependence of dissociative multielectron ionization of molecules by heavy ion impact was completed. Measurements of the cross sections for K-shell ionization of intermediate-Z elements by 30-MeV/amu H, N, Ne, and Ar ions were completed. The cross sections were determined for solid targets of Z = 13, 22, 26, 29, 32, 40, 42, 46, and 50 by recording the spectra of K x rays with a Si(Li) spectrometer

  10. Functionalized organic semiconductor molecules to enhance charge carrier injection in electroluminescent cell

    Science.gov (United States)

    Yalcin, Eyyup; Kara, Duygu Akin; Karakaya, Caner; Yigit, Mesude Zeliha; Havare, Ali Kemal; Can, Mustafa; Tozlu, Cem; Demic, Serafettin; Kus, Mahmut; Aboulouard, Abdelkhalk

    2017-07-01

    Organic semiconductor (OSC) materials as a charge carrier interface play an important role to improve the device performance of organic electroluminescent cells. In this study, 4,4″-bis(diphenyl amino)-1,1':3‧,1″-terphenyl-5'-carboxylic acid (TPA) and 4,4″-di-9H-carbazol-9-yl-1,1':3‧,1″-terphenyl-5'-carboxylic acid (CAR) has been designed and synthesized to modify indium tin oxide (ITO) layer as interface. Bare ITO and PEDOT:PSS coated on ITO was used as reference anode electrodes for comparison. Furthermore, PEDOT:PSS coated over CAR/ITO and TPA/ITO to observe stability of OSC molecules and to completely cover the ITO surface. Electrical, optical and surface characterizations were performed for each device. Almost all modified devices showed around 36% decrease at the turn on voltage with respect to bare ITO. The current density of bare ITO, ITO/CAR and ITO/TPA were measured as 288, 1525 and 1869 A/m2, respectively. By increasing current density, luminance of modified devices showed much better performance with respect to unmodified devices.

  11. The effects of electric fields on charged molecules and particles in individual microenvironments

    Science.gov (United States)

    Jamieson, K. S.; ApSimon, H. M.; Jamieson, S. S.; Bell, J. N. B.; Yost, M. G.

    Measurements of small air ion concentrations, electrostatic potential and AC electric field strengths were taken in an office setting to investigate the link between electric fields and charged molecule and particle concentrations in individual microenvironments. The results obtained indicate that the electromagnetic environments individuals can be exposed to whilst indoors can often bear little resemblance to those experienced outdoors in nature, and that many individuals may spend large periods of their time in "Faraday cage"-like conditions exposed to inappropriate levels and types of electric fields that can reduce localised concentrations of biologically essential and microbiocidal small air ions. Such conditions may escalate their risk of infection from airborne contaminants, including microbes, whilst increasing localised surface contamination. The degree of "electro-pollution" that individuals are exposed to was shown to be influenced by the type of microenvironment they occupy, with it being possible for very different types of microenvironment to exist within the same room. It is suggested that adopting suitable electromagnetic hygiene/productivity guidelines that seek to replicate the beneficial effects created by natural environments may greatly mitigate such problems.

  12. Comparing Positively and Negatively Charged Distonic Radical Ions in Phenylperoxyl Forming Reactions.

    Science.gov (United States)

    Williams, Peggy E; Marshall, David L; Poad, Berwyck L J; Narreddula, Venkateswara R; Kirk, Benjamin B; Trevitt, Adam J; Blanksby, Stephen J

    2018-06-04

    In the gas phase, arylperoxyl forming reactions play a significant role in low-temperature combustion and atmospheric processing of volatile organic compounds. We have previously demonstrated the application of charge-tagged phenyl radicals to explore the outcomes of these reactions using ion trap mass spectrometry. Here, we present a side-by-side comparison of rates and product distributions from the reaction of positively and negatively charge tagged phenyl radicals with dioxygen. The negatively charged distonic radical ions are found to react with significantly greater efficiency than their positively charged analogues. The product distributions of the anion reactions favor products of phenylperoxyl radical decomposition (e.g., phenoxyl radicals and cyclopentadienone), while the comparable fixed-charge cations yield the stabilized phenylperoxyl radical. Electronic structure calculations rationalize these differences as arising from the influence of the charged moiety on the energetics of rate-determining transition states and reaction intermediates within the phenylperoxyl reaction manifold and predict that this influence could extend to intra-molecular charge-radical separations of up to 14.5 Å. Experimental observations of reactions of the novel 4-(1-carboxylatoadamantyl)phenyl radical anion confirm that the influence of the charge on both rate and product distribution can be modulated by increasing the rigidly imposed separation between charge and radical sites. These findings provide a generalizable framework for predicting the influence of charged groups on polarizable radicals in gas phase distonic radical ions. Graphical Abstract.

  13. Electron emission following collisions between multi-charged ions and D2 molecules

    International Nuclear Information System (INIS)

    Laurent, G.

    2004-05-01

    Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S 15+ , 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D + fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)

  14. Interference effects in double ionization of spatially aligned hydrogen molecules by fast highly charged ions

    International Nuclear Information System (INIS)

    Landers, A.L.; Alnaser, A.S.; Tanis, J.A.; Wells, E.; Osipov, T.; Carnes, K.D.; Ben-Itzhak, I.; Cocke, C.L.; McGuire, J.H.

    2004-01-01

    Cross sections differential in target orientation angle were measured for 19 MeV F 8+ +D 2 collisions. Multihit position-sensitive detectors were used to isolate the double-ionization channel and determine a posteriori the full momentum vectors of both ejected D + fragments. A strong dependence of the double ionization cross section on the angle between the incident ion direction and the target molecular axis is observed with a ≅3.5:1 enhancement for molecules aligned perpendicular to the projectile axis. This clear asymmetry is attributed to interference effects, analogous to Young's two-slit experiment, arising from coherent contributions to the ionization from both atomic centers. The data are compared to a simple scattering model based on two center interference

  15. Energy distribution extraction of negative charges responsible for positive bias temperature instability

    International Nuclear Information System (INIS)

    Ren Shang-Qing; Yang Hong; Wang Wen-Wu; Tang Bo; Tang Zhao-Yun; Wang Xiao-Lei; Xu Hao; Luo Wei-Chun; Zhao Chao; Yan Jiang; Chen Da-Peng; Ye Tian-Chun

    2015-01-01

    A new method is proposed to extract the energy distribution of negative charges, which results from electron trapping by traps in the gate stack of nMOSFET during positive bias temperature instability (PBTI) stress based on the recovery measurement. In our case, the extracted energy distribution of negative charges shows an obvious dependence on energy, and the energy level of the largest energy density of negative charges is 0.01 eV above the conduction band of silicon. The charge energy distribution below that energy level shows strong dependence on the stress voltage. (paper)

  16. Two-dimensional position sensitive silicon photodiode as a charged particle detector

    International Nuclear Information System (INIS)

    Kovacevic, K.; Zadro, M.

    1999-01-01

    A two-dimensional position sensitive silicon photodiode has been tested for measurement of position and energy of charged particles. Position nonlinearity and resolution, as well as energy resolution and ballistic deficit were measured for 5.486 MeV α-particles. The results obtained for different pulse shaping time constants are presented

  17. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  18. Collisions of singly and doubly charged ions with oxygen molecules in the energy range 1 - 1800 (3600) eV

    International Nuclear Information System (INIS)

    Kuen, I.; Howorka, F.

    1983-01-01

    Absolute cross sections for the excitation of optically emitting states in collisions of He + , Ne + , Ar + , Kr + , B + , He ++ , Ne ++ and Ar ++ with oxygen molecules are measured, the energy range of the ion being1 - 1800 eV Lab for the singly charged and 1 - 3600 eV for the doubly charged ions. Seven important processes can be distinguished: charge exchange excitation of O 2 + band, O I, O II, X I and X II lines (X + , X ++ being the primary ion), direct excitation of X II and double charge exchange excitations. The energy dependences of the excitation cross sections are remarkably different for different processes but similar for one process with different ions. The sum total of all cross sections together for excitations which lead to light emission is on the order of a few square angstroms at 1000 eV c.m. energy. The results are of interest for surface investigations, plasma diagnostics and laser work. (Author)

  19. Toward precise potential energy curves for diatomic molecules, derived from experimental line positions

    International Nuclear Information System (INIS)

    Helm, H.

    1984-01-01

    An inverted, first-order perturbation approach is used to derive potential energy curves for diatomic molecules from experimental line positions of molecular bands. The concept adopted here is based on the inverted perturbation analysis (IPA) proposed by Kozman and Hinze, but uses radial eigenfunctions of the trial potential energy curves as basis sets for the perturbation correction. Using molecular linepositions rather than molecular energy levels we circumvent the necessity of defining molecular constants for the molecule prior to the derivation of the potential energy curves. (Author)

  20. 2D position sensitive microstrip sensors with charge division along the strip Studies on the position measurement error

    CERN Document Server

    Bassignana, D; Fernandez, M; Jaramillo, R; Lozano, M; Munoz, F.J; Pellegrini, G; Quirion, D; Vila, I; Vitorero, F

    2013-01-01

    Position sensitivity in semiconductor detectors of ionizing radiation is usually achieved by the segmentation of the sensing diode junction in many small sensing elements read out separately as in the case of conventional microstrips and pixel detectors. Alternatively, position sensitivity can be obtained by splitting the ionization signal collected by one single electrode amongst more than one readout channel with the ratio of the collected charges depending on the position where the signal was primary generated. Following this later approach, we implemented the charge division method in a conventional microstrip detector to obtain position sensitivity along the strip. We manufactured a proofof-concept demonstrator where the conventional aluminum electrodes were replaced by slightly resistive electrodes made of strongly doped poly-crystalline silicon and being readout at both strip ends. Here, we partially summarize the laser characterization of this first proof-of-concept demonstrator with special emphasis ...

  1. Method of improving heterogeneous oil reservoir polymer flooding effect by positively-charged gel profile control

    Science.gov (United States)

    Zhao, Ling; Xia, Huifen

    2018-01-01

    The project of polymer flooding has achieved great success in Daqing oilfield, and the main oil reservoir recovery can be improved by more than 15%. But, for some strong oil reservoir heterogeneity carrying out polymer flooding, polymer solution will be inefficient and invalid loop problem in the high permeability layer, then cause the larger polymer volume, and a significant reduction in the polymer flooding efficiency. Aiming at this problem, it is studied the method that improves heterogeneous oil reservoir polymer flooding effect by positively-charged gel profile control. The research results show that the polymer physical and chemical reaction of positively-charged gel with the residual polymer in high permeability layer can generate three-dimensional network of polymer, plugging high permeable layer, and increase injection pressure gradient, then improve the effect of polymer flooding development. Under the condition of the same dosage, positively-charged gel profile control can improve the polymer flooding recovery factor by 2.3∼3.8 percentage points. Under the condition of the same polymer flooding recovery factor increase value, after positively-charged gel profile control, it can reduce the polymer volume by 50 %. Applying mechanism of positively-charged gel profile control technology is feasible, cost savings, simple construction, and no environmental pollution, therefore has good application prospect.

  2. Electrostatic interactions between immunoglobulin (IgG) molecules and a charged sorbent

    NARCIS (Netherlands)

    Bremer, M.G.E.G.; Duval, J.; Norde, Willem; Lyklema, J.

    2004-01-01

    The influence of electrostatic interactions on the adsorption of IgG is examined both theoretically and experimentally. The long-range interaction between IgG and the charged sorbent surface is treated in terms of the DLVO theory taking into account the possibility of charge- and potential

  3. Exploring charge transport properties and functionality of molecule-nanoparticle ensembles

    NARCIS (Netherlands)

    Devid, Edwin Johan

    2015-01-01

    For more than 65 years, scientists have been fascinated by the idea to miniaturize electrical circuits toward the smallest length scales. One particular way is inspired by nature itself, specifically to assemble electrical components and switches from atoms and molecules. The molecules typically

  4. Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.

    Science.gov (United States)

    Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi

    2018-02-27

    In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.

  5. Ionisation of atoms, molecules and biomolecules by impact of multiply charged ions of high energy: classical and quantal comparison

    International Nuclear Information System (INIS)

    Abbas, I.

    2008-05-01

    We have developed a relatively simple model to calculate total cross-sections of various ionizing processes involving ion-atom or ion-molecule collisions. This model is based on the Zarour and Saalmann model and has benefited from 2 other models: the classical over-barrier (COB) model and the classical trajectory Monte-Carlo (CTMC) model. The COB model is used to describe the initial conditions of the target's electrons and their process us of creation while the CTMC model is used to build the statistical aspects necessary to calculate the cross sections of the ionizing processes. 3 major improvements have been brought to the Zarour and Saalmann model. First, the particle-particle interactions have been described by a Coulombian potential which is more realistic. Secondly, the initial conditions in the target are better represented by taking into account in an aleatory manner the position and speed distributions of the electrons. Thirdly, the use of energy criteria instead of purely geometrical ones to describe the final situation of the electrons has led to a better determination of the possible ionizing events. We have validated our model by applying it first, in collisional systems involving multi-charged projectiles like H + , He 2+ , Li 3+ , C 6+ , O 8+ and Ne 10+ and simple targets like H, He and H 2 , for which a lot of experimental data is available. Then, we have studied collisions involving the water molecule for which experimental and experimental data exist. Satisfactorily results for H 2 O target has led us to study other biological targets like adenine or cytosine. We have shown that our results are valid for impact energies over 100 keV/uma and most satisfactorily results concern simple ionizing processes like simple capture and simple ionization. For more complex processes such as transfer-ionization, double capture or double ionization, our results are valid for helium and hydrogen targets. In the case of water, the cross-sections of double

  6. Mixed Domains Enhance Charge Generation and Extraction in Bulk-Heterojunction Solar Cells with Small-Molecule Donors

    KAUST Repository

    Alqahtani, Obaid

    2018-03-25

    The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.

  7. Mixed Domains Enhance Charge Generation and Extraction in Bulk-Heterojunction Solar Cells with Small-Molecule Donors

    KAUST Repository

    Alqahtani, Obaid; Babics, Maxime; Gorenflot, Julien; Savikhin, Victoria; Ferron, Thomas; Balawi, Ahmed H.; Paulke, Andreas; Kan, Zhipeng; Pope, Michael; Clulow, Andrew J.; Wolf, Jannic Sebastian; Burn, Paul L.; Gentle, Ian R.; Neher, Dieter; Toney, Michael F.; Laquai, Fré dé ric; Beaujuge, Pierre; Collins, Brian A.

    2018-01-01

    The interplay between nanomorphology and efficiency of polymer-fullerene bulk-heterojunction (BHJ) solar cells has been the subject of intense research, but the generality of these concepts for small-molecule (SM) BHJs remains unclear. Here, the relation between performance; charge generation, recombination, and extraction dynamics; and nanomorphology achievable with two SM donors benzo[1,2-b:4,5-b]dithiophene-pyrido[3,4-b]-pyrazine BDT(PPTh), namely SM1 and SM2, differing by their side-chains, are examined as a function of solution additive composition. The results show that the additive 1,8-diiodooctane acts as a plasticizer in the blends, increases domain size, and promotes ordering/crystallinity. Surprisingly, the system with high domain purity (SM1) exhibits both poor exciton harvesting and severe charge trapping, alleviated only slightly with increased crystallinity. In contrast, the system consisting of mixed domains and lower crystallinity (SM2) shows both excellent exciton harvesting and low charge recombination losses. Importantly, the onset of large, pure crystallites in the latter (SM2) system reduces efficiency, pointing to possible differences in the ideal morphologies for SM-based BHJ solar cells compared with polymer-fullerene devices. In polymer-based systems, tie chains between pure polymer crystals establish a continuous charge transport network, whereas SM-based active layers may in some cases require mixed domains that enable both aggregation and charge percolation to the electrodes.

  8. The relation of electrode voltages to charge position in SLC arc and final focus beam position monitors

    International Nuclear Information System (INIS)

    Fordham, C.

    1989-01-01

    The position of a charged particle beam can be measured with a Beam Position Monitor (BPM) by converting the voltages induced on its array of electrodes into a position offset from the array's center. Most of the BPMs in the Arcs and Final Focus of the SLC use four stripline electrodes arranged symmetrically around the beam; normalized voltage differences are calculated as the difference divided by the sum of voltages on opposite electrode pairs. The resulting number is multiplied by a conversion factor, denoted in this paper as S b , to give the offset (in millimeters) of the charge from the center of the BPM. Prior to installation in the beam line, the BPMs were calibrated with a charge pulse on a rod. Owing to geometric effects which will be discussed later, a different conversion factor had to be used for calibration. It will be denoted here by S r . This paper gives the results of calculations and measurements of S r and S b for Arc and Final Focus BPMs. This paper also describes the relevant physical properties of the several types of BPMs and calculations of the expected scale factors, the measurement methods used, and gives the results of measurements, which are compared with the theoretical expectations. 2 refs., 18 figs., 7 tabs

  9. Development of a Sweetness Sensor for Aspartame, a Positively Charged High-Potency Sweetener

    Directory of Open Access Journals (Sweden)

    Masato Yasuura

    2014-04-01

    Full Text Available Taste evaluation technology has been developed by several methods, such as sensory tests, electronic tongues and a taste sensor based on lipid/polymer membranes. In particular, the taste sensor can individually quantify five basic tastes without multivariate analysis. However, it has proven difficult to develop a sweetness sensor, because sweeteners are classified into three types according to the electric charges in an aqueous solution; that is, no charge, negative charge and positive charge. Using membrane potential measurements, the taste-sensing system needs three types of sensor membrane for each electric charge type of sweetener. Since the commercially available sweetness sensor was only intended for uncharged sweeteners, a sweetness sensor for positively charged high-potency sweeteners such as aspartame was developed in this study. Using a lipid and plasticizers, we fabricated various lipid/polymer membranes for the sweetness sensor to identify the suitable components of the sensor membranes. As a result, one of the developed sensors showed responses of more than 20 mV to 10 mM aspartame and less than 5 mV to any other taste. The responses of the sensor depended on the concentration of aspartame. These results suggested that the developed sweetness sensor had high sensitivity to and high selectivity for aspartame.

  10. Development of a sweetness sensor for aspartame, a positively charged high-potency sweetener.

    Science.gov (United States)

    Yasuura, Masato; Tahara, Yusuke; Ikezaki, Hidekazu; Toko, Kiyoshi

    2014-04-23

    Taste evaluation technology has been developed by several methods, such as sensory tests, electronic tongues and a taste sensor based on lipid/polymer membranes. In particular, the taste sensor can individually quantify five basic tastes without multivariate analysis. However, it has proven difficult to develop a sweetness sensor, because sweeteners are classified into three types according to the electric charges in an aqueous solution; that is, no charge, negative charge and positive charge. Using membrane potential measurements, the taste-sensing system needs three types of sensor membrane for each electric charge type of sweetener. Since the commercially available sweetness sensor was only intended for uncharged sweeteners, a sweetness sensor for positively charged high-potency sweeteners such as aspartame was developed in this study. Using a lipid and plasticizers, we fabricated various lipid/polymer membranes for the sweetness sensor to identify the suitable components of the sensor membranes. As a result, one of the developed sensors showed responses of more than 20 mV to 10 mM aspartame and less than 5 mV to any other taste. The responses of the sensor depended on the concentration of aspartame. These results suggested that the developed sweetness sensor had high sensitivity to and high selectivity for aspartame.

  11. Computational modeling of chemical reactions and interstitial growth and remodeling involving charged solutes and solid-bound molecules.

    Science.gov (United States)

    Ateshian, Gerard A; Nims, Robert J; Maas, Steve; Weiss, Jeffrey A

    2014-10-01

    Mechanobiological processes are rooted in mechanics and chemistry, and such processes may be modeled in a framework that couples their governing equations starting from fundamental principles. In many biological applications, the reactants and products of chemical reactions may be electrically charged, and these charge effects may produce driving forces and constraints that significantly influence outcomes. In this study, a novel formulation and computational implementation are presented for modeling chemical reactions in biological tissues that involve charged solutes and solid-bound molecules within a deformable porous hydrated solid matrix, coupling mechanics with chemistry while accounting for electric charges. The deposition or removal of solid-bound molecules contributes to the growth and remodeling of the solid matrix; in particular, volumetric growth may be driven by Donnan osmotic swelling, resulting from charged molecular species fixed to the solid matrix. This formulation incorporates the state of strain as a state variable in the production rate of chemical reactions, explicitly tying chemistry with mechanics for the purpose of modeling mechanobiology. To achieve these objectives, this treatment identifies the specific theoretical and computational challenges faced in modeling complex systems of interacting neutral and charged constituents while accommodating any number of simultaneous reactions where reactants and products may be modeled explicitly or implicitly. Several finite element verification problems are shown to agree with closed-form analytical solutions. An illustrative tissue engineering analysis demonstrates tissue growth and swelling resulting from the deposition of chondroitin sulfate, a charged solid-bound molecular species. This implementation is released in the open-source program FEBio ( www.febio.org ). The availability of this framework may be particularly beneficial to optimizing tissue engineering culture systems by examining the

  12. Diffusion of flexible, charged, nanoscopic molecules in solution: Size and pH dependence for PAMAM dendrimer

    Science.gov (United States)

    Maiti, Prabal K.; Bagchi, Biman

    2009-12-01

    In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.

  13. A two-dimensional position sensitive gas chamber with scanned charge transfer readout

    International Nuclear Information System (INIS)

    Gomez, F.; Iglesias, A.; Lobato, R.; Mosquera, J.; Pardo, J.; Pena, J.; Pazos, A.; Pombar, M.; Rodriguez, A.

    2003-01-01

    We have constructed and tested a two-dimensional position sensitive parallel-plate gas ionization chamber with scanned charge transfer readout. The scan readout method described here is based on the development of a new position-dependent charge transfer technique. It has been implemented by using gate strips perpendicularly oriented to the collector strips. This solution reduces considerably the number of electronic readout channels needed to cover large detector areas. The use of a 25 μm thick kapton etched circuit allows high charge transfer efficiency with a low gating voltage, consequently needing a very simple commutating circuit. The present prototype covers 8x8 cm 2 with a pixel size of 1.27x1.27 mm 2 . Depending on the intended use and beam characteristics a smaller effective pixel is feasible and larger active areas are possible. This detector can be used for X-ray or other continuous beam intensity profile monitoring

  14. Mixed-mode reversed phase/positively charged repulsion chromatography for intact protein separation.

    Science.gov (United States)

    Ding, Ling; Guo, Zhimou; Hu, Zhuo; Liang, Xinmiao

    2017-05-10

    A mixed-mode reversed phase/positively charged repulsion stationary phase C8PN composed of octyl and amino group has been developed for separation of intact protein. Before the separation of proteins, a set of probe compounds were employed to evaluate the chromatographic properties of C8PN, demonstrating typical reversed phase/positively charged repulsion interaction on this stationary phase as estimated. Then the new C8PN stationary phase was used to separate a standard protein mixture on the reversed phase mode. Compared with a commercial C4 stationary phase, it showed different selectivity for some proteins. In order to better understand the properties of C8PN, the effect of acetonitrile content was investigated based on retention equation. Higher values of the equation parameters on C8PN demonstrated that the protein retentions were more sensitive to the change of acetonitrile content. Besides, the influences of buffer salt additives on the protein retentions were also studied. The retention factors of the proteins got larger with the increase of buffer salt concentration, which confirmed the positively charged repulsion interaction on the column. Finally, the C8PN was further applied to separate oxidized- and reduced- forms of Recombinant Human Growth Hormone. Our study indicated the advantages and application potential of mixed-mode reversed phase/positively charged repulsion stationary phase for intact protein separation. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Recent measurements of low energy charge exchange cross sections for collisions of multicharged ions on neutral atoms and molecules

    International Nuclear Information System (INIS)

    Havener, Charles C.

    2001-01-01

    At ORNL Multicharged Ion Research Facility (MIRF), charge exchange (CX) cross sections have been measured for multicharged ions (MCI) on neutral atoms and molecules. The ORNL ion-atom merged-beam apparatus was used to measure single electron capture by MCI from H at eV/amu energies. A gas cell was used to measure single and double electron capture by MCI from a variety of molecular targets at keV collision energies. The merged-beams experiment has been successful in providing benchmark total electron capture measurements for several collision systems with a variety of multicharged ions on H or D

  16. Ultrafast Charge Generation Pathways in Photovoltaic Blends Based on Novel Star-Shaped Conjugated Molecules

    NARCIS (Netherlands)

    Kozlov, Oleg V.; Luponosov, Yuriy N.; Ponomarenko, Sergei A.; Kausch-Busies, Nina; Paraschuk, Dmitry Yu; Olivier, Yoann; Beljonne, David; Cornil, Jerome; Pshenichnikov, Maxim S.

    2015-01-01

    The quest for new materials is one of the main factors propelling recent advances in organic photovoltaics. Star-shaped small molecules (SSMs) have been proven promising candidates as perspective donor material due to the increase in numbers of excitation pathways caused by the degeneracy of the

  17. PEPTIDE SOLUBILITY, STRUCTURE AND CHARGE POSITION EFFECT ON ADSORPTION BY ALUMINIUM HYDROXIDE

    Directory of Open Access Journals (Sweden)

    Mary Trujillo

    2008-04-01

    Full Text Available Solubility, structure and position of charges in a peptide antigen sequence can be mentioned as being amongst the basic features of adsorption. In order to study their effect on adsorption, seven analogue series were synthesized from a MSP-1 peptide sequence by systematically replacing each one of the positions in the peptide sequence by aspartic acid, glutamic acid, serine, alanine, asparagine, glutamine or lysine. Such modifications in analogue peptide sequences showed a non-regular tendency regarding solubility and adsorption data. Aspartic acid and Glutamic acid analogue series showed great improvements in adsorption, especially in peptides where Lysine in position 6 and Arginine in position 13 were replaced. Solubility of position 5 analogue was greater than the position 6 analogue in Aspartic acid series; however, the position 6 analogue showed best adsorption results whilst the Aspartic acid in position 5 analogue showed no adsorption in the same conditions. Nuclear Magnetic Resonance structural analysis revealed differences in the -helical structureextension between these analogues. The Aspartic acid in position 6, located in the polar side of the helix, may allow this analogueto fit better onto the adsorption regions suggesting that the local electrostatic charge is responsible for this behavior.

  18. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    International Nuclear Information System (INIS)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

  19. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Energy Technology Data Exchange (ETDEWEB)

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

  20. Study on charge transfer reaction of several organic molecules with accelerated rare gas ions

    International Nuclear Information System (INIS)

    Takahasi, Makoto; Okuda, Sachiko; Arai, Eiichi; Ichinose, Akira; Takakubo, Masaaki.

    1984-01-01

    Observing the charge transfer mass spectra of ethylbenzene, cyclobutane and methanol in Ar and Xe ion impacts, we investigated the dependence of the secondary ion peak intensities (normalized to primary ion current and target pressure) on the translational energy of primary ions (0-3500 eV).In the case of ethylbenzene, several maxima of the secondary i on peak intensities were observed in Ar and Xe ion impacts. The correlation between the maxima and the primary ion energy was examined in terms of near adiabatic theory of Massey. Supplementary studies on the energy distribution of primary ion, charge transfer cross section between methanol and Xe ion, and final product analysis in rare gas ion irradiation on cyclobutane were described. (author)

  1. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    DEFF Research Database (Denmark)

    Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

  2. Charge exchange of excited mesic atoms of hydrogen isotopes in triple collisions with molecules

    International Nuclear Information System (INIS)

    Men'shikov, L.I.; Ponomarev, L.I.

    1985-01-01

    At high densities of deuterium-tritium mixture the probability for the occurrence of the isotope-exchange reaction (dμ)/sub n/+t → d+(tμ)/sub n/ from the excited states of n mesic atoms of deuterium is high in the triple collisions of mesic atoms with the molecules of hydrogen isotopes. This reaction should be taken into account in describing the kinetics of muon catalysis

  3. Positively charged microporous ceramic membrane for the removal of Titan Yellow through electrostatic adsorption.

    Science.gov (United States)

    Cheng, Xiuting; Li, Na; Zhu, Mengfu; Zhang, Lili; Deng, Yu; Deng, Cheng

    2016-06-01

    To develop a depth filter based on the electrostatic adsorption principle, positively charged microporous ceramic membrane was prepared from a diatomaceous earth ceramic membrane. The internal surface of the highly porous ceramic membrane was coated with uniformly distributed electropositive nano-Y2O3 coating. The dye removal performance was evaluated through pressurized filtration tests using Titan Yellow aqueous solution. It showed that positively charged microporous ceramic membrane exhibited a flow rate of 421L/(m(2)·hr) under the trans-membrane pressure of 0.03bar. Moreover it could effectively remove Titan Yellow with feed concentration of 10mg/L between pH3 to 8. The removal rate increased with the enhancement of the surface charge properties with a maximum rejection of 99.6%. This study provides a new and feasible method of removing organic dyes in wastewater. It is convinced that there will be a broad market for the application of charged ceramic membrane in the field of dye removal or recovery from industry wastewater. Copyright © 2016. Published by Elsevier B.V.

  4. Positive zeta potential of a negatively charged semi-permeable plasma membrane

    Science.gov (United States)

    Sinha, Shayandev; Jing, Haoyuan; Das, Siddhartha

    2017-08-01

    The negative charge of the plasma membrane (PM) severely affects the nature of moieties that may enter or leave the cells and controls a large number of ion-interaction-mediated intracellular and extracellular events. In this letter, we report our discovery of a most fascinating scenario, where one interface (e.g., membrane-cytosol interface) of the negatively charged PM shows a positive surface (or ζ) potential, while the other interface (e.g., membrane-electrolyte interface) still shows a negative ζ potential. Therefore, we encounter a completely unexpected situation where an interface (e.g., membrane-cytosol interface) that has a negative surface charge density demonstrates a positive ζ potential. We establish that the attainment of such a property by the membrane can be ascribed to an interplay of the nature of the membrane semi-permeability and the electrostatics of the electric double layer established on either side of the charged membrane. We anticipate that such a membrane property can lead to such capabilities of the cell (in terms of accepting or releasing certain kinds of moieties as well regulating cellular signaling) that was hitherto inconceivable.

  5. Resonance Raman spectra of organic molecules absorbed on inorganic semiconducting surfaces: Contribution from both localized intramolecular excitation and intermolecular charge transfer excitation

    International Nuclear Information System (INIS)

    Ye, ChuanXiang; Zhao, Yi; Liang, WanZhen

    2015-01-01

    The time-dependent correlation function approach for the calculations of absorption and resonance Raman spectra (RRS) of organic molecules absorbed on semiconductor surfaces [Y. Zhao and W. Z. Liang, J. Chem. Phys. 135, 044108 (2011)] is extended to include the contribution of the intermolecular charge transfer (CT) excitation from the absorbers to the semiconducting nanoparticles. The results demonstrate that the bidirectionally interfacial CT significantly modifies the spectral line shapes. Although the intermolecular CT excitation makes the absorption spectra red shift slightly, it essentially changes the relative intensities of mode-specific RRS and causes the oscillation behavior of surface enhanced Raman spectra with respect to interfacial electronic couplings. Furthermore, the constructive and destructive interferences of RRS from the localized molecular excitation and CT excitation are observed with respect to the electronic coupling and the bottom position of conductor band. The interferences are determined by both excitation pathways and bidirectionally interfacial CT

  6. Position readout by charge division in large two-dimensional detectors

    International Nuclear Information System (INIS)

    Alberi, J.L.

    1976-10-01

    The improvement in readout spatial resolution for charge division systems with subdivided readout electrodes has been analyzed. This readout forms the position and sum signals by a linear, unambiguous analogue summation technique. It is shown that the readout resolution is a function of only electrode capacitance and shaping parameters. The line width improves as 1/N/sup 1 / 2 /, where N is the number of electrode subdivisions

  7. Effect of different substitution position on the switching behavior in single-molecule device with carbon nanotube electrodes

    Science.gov (United States)

    Yang, Jingjuan; Han, Xiaoxiao; Yuan, Peipei; Bian, Baoan; Wang, Yixiang

    2018-01-01

    We investigate the electronic transport properties of dihydroazulene (DHA) and vinylheptafulvene (VHF) molecule sandwiched between two carbon nanotubes using density functional theory and non-equilibrium Green's function. The device displays significantly switching behavior between DHA and VHF isomerizations. It is found the different substitution position of F in the molecule influences the switching ratio of device, which is analyzed by transmission spectra and molecular projected self-consistent Hamiltonian. The observed negative differential resistance effect is explained by transmission spectra and transmission eigenstates of transmission peak in the bias window. The observed reverse of current in VHF form in which two H atoms on the right side of the benzene ring of the molecule are replaced by F is explained by transmission spectra and molecule-electrode coupling with the varied bias. The results suggest that the reasonable substitution position of molecule may improve the switching ratio, displaying a potential application in future molecular circuit.

  8. Study of the double charge-changing collision cross-sections of H+, D+, Li+ ions with organic molecules in the energy range 10-50 keV

    International Nuclear Information System (INIS)

    Farrokhi, S.

    1966-01-01

    The variation of the double charge-changing collision cross-sections of H + , D + , Li + ions with organic molecules (CH 4 , C 2 H 6 , C 3 H 8 , C 4 H 10 ) in the energy range 10-50 keV has been studied. Several maximums for σ 1-1 = f(E) have been shown. Their existence should be explained by the different possibilities of dissociating the target-molecules. The position of the maximums, for the H + → H - and D + → D - reactions is in good agreement with that defined by the Massey adiabatic relation. (author) [fr

  9. Cross-sections of charge and electronic states change of particles at ion-ion and ion-molecule collisions

    International Nuclear Information System (INIS)

    Panov, M.N.; Afrosimov, V.V.; Basalaev, A.A.; Guschina, N.A.; Nikulin, V.K.

    2006-01-01

    The interactions of protons and alpha-particles with hydrocarbons are investigated. A quantum-mechanical computation of the electronic structure of all hydrocarbons from methane to butane and its fragment ions was performed in the Hartree-Fock RHF/UHF approximation using a GAMESS program (General Atomic Molecular Electron Structure System). The correlation energy was taken into account within the framework of MP2 perturbation theory. The structural parameters of the hydrocarbon molecules and their charged and neutral fragments were calculated in two cases: in the geometry of the parent molecule or of the relaxation states. The difference of the full energy of the same fragments in and out of brackets gives us the vibration excitation energies of the fragments at the moment of creation. Additional Mulliken effective charges (in electron charge units) of atoms in the fragments have been calculated. The calculations show that removing one electron from the ethane molecule without electronic excitation produced a single charged molecular ion in vibration state with binding energy of hydrogen atoms, some decimal eV. As results we obtain C 2 H 6 + and C 2 H 5 + . Additional fragmentation of hydrocarbon needs electronic excitation of produced single charged ions. Cross sections for electron capture and excitation processes in collisions between the hydrogen-like He + , B 4+ and O 7+ ions have been evaluated. The purpose of the theory within this project during the period under review was to get for the first time new data on Single-Electron Capture (SEC) and Excitation Processes (EP) in collisions of He + (1s) ions with hydrogen-like impurity ions B 4+ (1s) and O 7+ (1s) in the energy range for He + ions from 0.2 MeV to 3.0 MeV. The calculations were carried out by using the method of close-coupling equations with basis sets of eleven and ten quasimolecular two-electron states for reactions (1, 2) and (3, 4), respectively (entrance channel, seven charge transfer channels

  10. Reduction of digital errors of digital charge division type position-sensitive detectors

    International Nuclear Information System (INIS)

    Uritani, A.; Yoshimura, K.; Takenaka, Y.; Mori, C.

    1994-01-01

    It is well known that ''digital errors'', i.e. differential non-linearity, appear in a position profile of radiation interactions when the profile is obtained with a digital charge-division-type position-sensitive detector. Two methods are presented to reduce the digital errors. They are the methods using logarithmic amplifiers and a weighting function. The validities of these two methods have been evaluated mainly by computer simulation. These methods can considerably reduce the digital errors. The best results are obtained when both methods are applied. ((orig.))

  11. Study of electric field distorted by space charges under positive lightning impulse voltage

    Science.gov (United States)

    Wang, Zezhong; Geng, Yinan

    2018-03-01

    Actually, many insulation problems are related to electric fields. And measuring electric fields is an important research topic of high-voltage engineering. In particular, the electric field distortion caused by space charge is the basis of streamer theory, and thus quantitatively measuring the Poisson electric field caused by space charge is significant to researching the mechanism of air gap discharge. In this paper, we used our photoelectric integrated sensor to measure the electric field distribution in a 1-m rod-plane gap under positive lightning impulse voltage. To verify the reliability of this quantitative measurement, we compared the measured results with calculated results from a numerical simulation. The electric-field time domain waveforms on the axis of the 1-m rod-plane out of the space charge zone were measured with various electrodes. The Poisson electric fields generated by space charge were separated from the Laplace electric field generated by applied voltages, and the amplitudes and variations were measured for various applied voltages and at various locations. This work also supplies the feasible basis for directly measuring strong electric field under high voltage.

  12. Positive column of a glow discharge in neon with charged dust grains (a review)

    Energy Technology Data Exchange (ETDEWEB)

    Polyakov, D. N., E-mail: cryolab@ihed.ras.ru; Shumova, V. V.; Vasilyak, L. M. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)

    2017-03-15

    The effect of charged micron-size dust grains (microparticles) on the electric parameters of the positive column of a low-pressure dc glow discharge in neon has been studied experimentally and numerically. Numerical analysis is carried out in the diffusion-drift approximation with allowance for the interaction of dust grains with metastable neon atoms. In a discharge with a dust grain cloud, the longitudinal electric field increases. As the number density of dust grains in an axisymmetric cylindrical dust cloud rises, the growth of the electric field saturates. It is shown that the contribution of metastable atoms to ionization is higher in a discharge with dust grains, in spite of the quenching of metastable atoms on dust grains. The processes of charging of dust grains and the dust cloud are considered. As the number density of dust grains rises, their charge decreases, while the space charge of the dust cloud increases. The results obtained can be used in plasma technologies involving microparticles.

  13. Positive column of a glow discharge in neon with charged dust grains (a review)

    International Nuclear Information System (INIS)

    Polyakov, D. N.; Shumova, V. V.; Vasilyak, L. M.

    2017-01-01

    The effect of charged micron-size dust grains (microparticles) on the electric parameters of the positive column of a low-pressure dc glow discharge in neon has been studied experimentally and numerically. Numerical analysis is carried out in the diffusion-drift approximation with allowance for the interaction of dust grains with metastable neon atoms. In a discharge with a dust grain cloud, the longitudinal electric field increases. As the number density of dust grains in an axisymmetric cylindrical dust cloud rises, the growth of the electric field saturates. It is shown that the contribution of metastable atoms to ionization is higher in a discharge with dust grains, in spite of the quenching of metastable atoms on dust grains. The processes of charging of dust grains and the dust cloud are considered. As the number density of dust grains rises, their charge decreases, while the space charge of the dust cloud increases. The results obtained can be used in plasma technologies involving microparticles.

  14. Detecting groups of coevolving positions in a molecule: a clustering approach

    Directory of Open Access Journals (Sweden)

    Galtier Nicolas

    2007-11-01

    Full Text Available Abstract Background Although the patterns of co-substitutions in RNA is now well characterized, detection of coevolving positions in proteins remains a difficult task. It has been recognized that the signal is typically weak, due to the fact that (i amino-acid are characterized by various biochemical properties, so that distinct amino acids changes are not functionally equivalent, and (ii a given mutation can be compensated by more than one mutation, at more than one position. Results We present a new method based on phylogenetic substitution mapping. The two above-mentioned problems are addressed by (i the introduction of a weighted mapping, which accounts for the biochemical effects (volume, polarity, charge of amino-acid changes, (ii the use of a clustering approach to detect groups of coevolving sites of virtually any size, and (iii the distinction between biochemical compensation and other coevolutionary mechanisms. We apply this methodology to a previously studied data set of bacterial ribosomal RNA, and to three protein data sets (myoglobin of vertebrates, S-locus Receptor Kinase and Methionine Amino-Peptidase. Conclusion We succeed in detecting groups of sites which significantly depart the null hypothesis of independence. Group sizes range from pairs to groups of size ≃ 10, depending on the substitution weights used. The structural and functional relevance of these groups of sites are assessed, and the various evolutionary processes potentially generating correlated substitution patterns are discussed.

  15. Formation and decay of the intermediate quasistationary ion N-2 during charge exchange between fast H- ions and nitrogen molecules

    International Nuclear Information System (INIS)

    Kazanskii, A.K.

    1984-01-01

    The detachment of the electron from the H - ion during a collision with the nitrogen molecule at 1--6 keV occurs as a result of charge transfer to an unstable intermediate state of the molecular ion N - 2 and the subsequent decay of the ion. The formation process is described in the impulse approximation, and the motion of nuclei in the ion is treated quasiclassically. Expressions are obtained for the spectrum of emitted electrons and for the energy-loss spectrum of heavy particles. These expressions relate the spectra to the cross sections for the vibrational excitation of N 2 by electron impact. A convenient expression for the amplitude for the formation of the intermediate state is obtained in the ''boomerang'' model, and it is shown that one of the parameters, considered to be adjustable in traditional theory, can be calculated

  16. Identification of small molecules that disrupt signaling between ABL and its positive regulator RIN1.

    Directory of Open Access Journals (Sweden)

    Pamela Y Ting

    Full Text Available Constitutively active BCR-ABL kinase fusions are causative mutations in the pathogenesis of hematopoietic neoplasias including chronic myelogenous leukemia (CML. Although these fusions have been successfully targeted with kinase inhibitors, drug-resistance and relapse continue to limit long-term survival, highlighting the need for continued innovative drug discovery. We developed a time-resolved Förster resonance energy transfer (TR-FRET -based assay to identify compounds that disrupt stimulation of the ABL kinase by blocking its ability to bind the positive regulator RIN1. This assay was used in a high throughput screen (HTS of two small molecule libraries totaling 444,743 compounds. 708 confirmed hits were counter-screened to eliminate off-target inhibitors and reanalyzed to prioritize compounds with IC50 values below 10 μM. The CML cell line K562 was then used to identify five compounds that decrease MAPK1/3 phosphorylation, which we determined to be an indicator of RIN1-dependent ABL signaling. One of these compounds is a thiadiazole, and the other four are structurally related acyl piperidine amides. Notably, these five compounds lower cellular BCR-ABL1 kinase activity by blocking a positive regulatory interaction rather than directly inhibiting ABL catalytic function.

  17. A two-dimensional position sensitive gas chamber with scanned charge transfer readout

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, F. E-mail: faustgr@usc.es; Iglesias, A.; Lobato, R.; Mosquera, J.; Pardo, J.; Pena, J.; Pazos, A.; Pombar, M.; Rodriguez, A

    2003-10-21

    We have constructed and tested a two-dimensional position sensitive parallel-plate gas ionization chamber with scanned charge transfer readout. The scan readout method described here is based on the development of a new position-dependent charge transfer technique. It has been implemented by using gate strips perpendicularly oriented to the collector strips. This solution reduces considerably the number of electronic readout channels needed to cover large detector areas. The use of a 25 {mu}m thick kapton etched circuit allows high charge transfer efficiency with a low gating voltage, consequently needing a very simple commutating circuit. The present prototype covers 8x8 cm{sup 2} with a pixel size of 1.27x1.27 mm{sup 2}. Depending on the intended use and beam characteristics a smaller effective pixel is feasible and larger active areas are possible. This detector can be used for X-ray or other continuous beam intensity profile monitoring.

  18. Microporous nano-MgO/diatomite ceramic membrane with high positive surface charge for tetracycline removal.

    Science.gov (United States)

    Meng, Xian; Liu, Zhimeng; Deng, Cheng; Zhu, Mengfu; Wang, Deyin; Li, Kui; Deng, Yu; Jiang, Mingming

    2016-12-15

    A novel microporous nano-MgO/diatomite ceramic membrane with high positive surface charge was prepared, including synthesis of precursor colloid, dip-coating and thermal decomposition. Combined SEM, EDS, XRD and XPS studies show the nano-MgO is irregularly distributed on the membrane surface or pore walls and forms a positively charged nano coating. And the nano-MgO coating is firmly attached to the diatomite membrane via SiO chemical bond. Thus the nano-MgO/diatomite membrane behaves strong electropositivity with the isoelectric point of 10.8. Preliminary filtration tests indicate that the as-prepared nano-MgO/diatomite membrane could remove approximately 99.7% of tetracycline in water through electrostatic adsorption effect. The desirable electrostatic property enables the nano-MgO/diatomite membrane to be a candidate for removal of organic pollutants from water. And it is convinced that there will be a great application prospect of charged ceramic membrane in water treatment field. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Negative and positive magnetoresistance in bilayer graphene: Effects of weak localization and charge inhomogeneity

    International Nuclear Information System (INIS)

    Chen Yungfu; Bae, Myung-Ho; Chialvo, Cesar; Dirks, Travis; Bezryadin, Alexey; Mason, Nadya

    2011-01-01

    We report measurements of magnetoresistance in bilayer graphene as a function of gate voltage (carrier density) and temperature. We examine multiple contributions to the magnetoresistance, including those of weak localization (WL), universal conductance fluctuations (UCF), and inhomogeneous charge transport. A clear WL signal is evident at all measured gate voltages (in the hole doped regime) and temperature ranges (from 0.25 to 4.3 K), and the phase coherence length extracted from the WL data does not saturate at low temperatures. The WL data is fit to demonstrate that the electron-electron Nyquist scattering is the major source of phase decoherence. A decrease in UCF amplitude with increase in gate voltage and temperature is shown to be consistent with a corresponding decrease in the phase coherence length. In addition, a weak positive magnetoresistance at higher magnetic fields is observed, and attributed to inhomogeneous charge transport. -- Research highlights: → Weak localization theory describes low-field magnetoresistance in bilayer graphene. → Electron-electron Nyquist scattering limits phase coherence in bilayer graphene. → Positive magnetoresistance reveals charge inhomogeneity in bilayer graphene.

  20. Manipulating the dipole layer of polar organic molecules on metal surfaces via different charge-transfer channels

    Science.gov (United States)

    Lin, Meng-Kai; Nakayama, Yasuo; Zhuang, Ying-Jie; Wang, Chin-Yung; Pi, Tun-Wen; Ishii, Hisao; Tang, S.-J.

    The key properties of organic films such as energy level alignment (ELA), work functions, and injection barriers are closely linked to this dipole layer. Using angle resolved photoemission spectroscopy (ARPES), we systemically investigate the coverage-dependent work functions and spectra line shapes of occupied molecular orbital states of a polar molecule, chloroaluminium phthalocyanine (ClAlPc), grown on Ag(111) to show that the orientations of the first ClAlPc layer can be manipulated via the molecule deposition rate and post annealing, causing ELA at organic-metal interface to differ for about 0.3 eV between Cl-up and Cl-down configuration. Moreover, by comparing the experimental results with the calculations based on both gas-phase model and realistic model of ClAlPc on Ag(111) , we evidence that the different orientations of ClAlPc dipole layers lead to different charge-transfer channels between ClAlPc and Ag, a key factor that controls the ELA at organic-metal interface.

  1. Simulation of the interaction of positively charged beams and electron clouds

    International Nuclear Information System (INIS)

    Markovik, Aleksandar

    2013-01-01

    The incoherent (head-tail) effect on the bunch due to the interaction with electron clouds (e-clouds) leads to a blow up of the transverse beam size in storage rings operating with positively charged beams. Even more the e-cloud effects are considered to be the main limiting factor for high current, high-brightness or high-luminosity operation of future machines. Therefore the simulation of e-cloud phenomena is a highly active field of research. The main focus in this work was set to a development of a tool for simulation of the interaction of relativistic bunches with non-relativistic parasitic charged particles. The result is the Particle-In-Cell Program MOEVE PIC Tracking which can track a 3D bunch under the influence of its own and external electromagnetic fields but first and foremost it simulates the interaction of relativistic positively charged bunches and initially static electrons. In MOEVE PIC Tracking the conducting beam pipe can be modeled with an arbitrary elliptical cross-section to achieve more accurate space charge field computations for both the bunch and the e-cloud. The simulation of the interaction between positron bunches and electron clouds in this work gave a detailed insight of the behavior of both particle species during and after the interaction. Further and ultimate goal of this work was a fast estimation of the beam stability under the influence of e-clouds in the storage ring. The standard approach to simulate the stability of a single bunch is to track the bunch particles through the linear optics of the machine by multiplying the 6D vector of each particle with the transformation matrices describing the lattice. Thereby the action of the e-cloud on the bunch is approximated by a pre-computed wake kick which is applied on one or more points in the lattice. Following the idea of K.Ohmi the wake kick was pre-computed as a two variable function of the bunch part exiting the e-cloud and the subsequent parts of a bunch which receive a

  2. ELSEPA—Dirac partial-wave calculation of elastic scattering of electrons and positrons by atoms, positive ions and molecules

    Science.gov (United States)

    Salvat, Francesc; Jablonski, Aleksander; Powell, Cedric J.

    2005-01-01

    The FORTRAN 77 code system ELSEPA for the calculation of elastic scattering of electrons and positrons by atoms, positive ions and molecules is presented. These codes perform relativistic (Dirac) partial-wave calculations for scattering by a local central interaction potential V(r). For atoms and ions, the static-field approximation is adopted, with the potential set equal to the electrostatic interaction energy between the projectile and the target, plus an approximate local exchange interaction when the projectile is an electron. For projectiles with kinetic energies up to 10 keV, the potential may optionally include a semiempirical correlation-polarization potential to describe the effect of the target charge polarizability. Also, for projectiles with energies less than 1 MeV, an imaginary absorptive potential can be introduced to account for the depletion of the projectile wave function caused by open inelastic channels. Molecular cross sections are calculated by means of a single-scattering independent-atom approximation in which the electron density of a bound atom is approximated by that of the free neutral atom. Elastic scattering by individual atoms in solids is described by means of a muffin-tin model potential. Partial-wave calculations are feasible on modest personal computers for energies up to about 5 MeV. The ELSEPA code also implements approximate factorization methods that allow the fast calculation of elastic cross sections for much higher energies. The interaction model adopted in the calculations is defined by the user by combining the different options offered by the code. The nuclear charge distribution can be selected among four analytical models (point nucleus, uniformly charged sphere, Fermi's distribution and Helm's uniform-uniform distribution). The atomic electron density is handled in numerical form. The distribution package includes data files with electronic densities of neutral atoms of the elements hydrogen to lawrencium ( Z=1

  3. Adsorption of a cationic dye molecule on polystyrene microspheres in colloids: effect of surface charge and composition probed by second harmonic generation.

    Science.gov (United States)

    Eckenrode, Heather M; Jen, Shih-Hui; Han, Jun; Yeh, An-Gong; Dai, Hai-Lung

    2005-03-17

    Nonlinear optical probe, second harmonic generation (SHG), of the adsorption of the dye molecule malachite green (MG), in cationic form at pH polystyrene microspheres in aqueous solution is used to study the effect of surface charge and composition on molecular adsorption. Three types of polystyrene microspheres with different surface composition are investigated: (1) a sulfate terminated, anionic surface, (2) a neutral surface without any functional group termination, and (3) an amine terminated, cationic surface. The cationic dye was found to adsorb at all three surfaces, regardless of surface charge. The adsorption free energies, DeltaG's, measured for the three surfaces are -12.67, -12.39, and -10.46 kcal/mol, respectively, with the trend as expected from the charge interactions. The adsorption density on the anionic surface, where attractive charge-charge interaction dominates, is determined by the surface negative charge density. The adsorption densities on the neutral and cationic surfaces are on the other hand higher, perhaps as a result of a balance between minimizing repulsive charge interaction and maximizing attractive molecule-substrate and intermolecular interactions. The relative strength of the SH intensity per molecule, in combination of a model calculation, reveals that the C(2) axis of the MG molecule is nearly perpendicular to the surface on the anionic surface and tilts away from the surface norm when the surface is neutral and further away when cationic. Changing the pH of the solution may alter the surface charge and subsequently affect the adsorption configuration and SH intensity.

  4. Single-molecule conductance of a chemically modified, π-extended tetrathiafulvalene and its charge-transfer complex with F4TCNQ

    Directory of Open Access Journals (Sweden)

    Raúl García

    2015-06-01

    Full Text Available We describe the synthesis and single-molecule electrical transport properties of a molecular wire containing a π-extended tetrathiafulvalene (exTTF group and its charge-transfer complex with F4TCNQ. We form single-molecule junctions using the in situ break junction technique using a homebuilt scanning tunneling microscope with a range of conductance between 10 G0 down to 10−7 G0. Within this range we do not observe a clear conductance signature of the neutral parent molecule, suggesting either that its conductance is too low or that it does not form a stable junction. Conversely, we do find a clear conductance signature in the experiments carried out on the charge-transfer complex. Due to the fact we expected this species to have a higher conductance than the neutral molecule, we believe this supports the idea that the conductance of the neutral molecule is very low, below our measurement sensitivity. This idea is further supported by theoretical calculations. To the best of our knowledge, these are the first reported single-molecule conductance measurements on a molecular charge-transfer species.

  5. Electron beam patterning for writing of positively charged gold colloidal nanoparticles

    Science.gov (United States)

    Zafri, Hadar; Azougi, Jonathan; Girshevitz, Olga; Zalevsky, Zeev; Zitoun, David

    2018-02-01

    Synthesis at the nanoscale has progressed at a very fast pace during the last decades. The main challenge today lies in precise localization to achieve efficient nanofabrication of devices. In the present work, we report on a novel method for the patterning of gold metallic nanoparticles into nanostructures on a silicon-on-insulator (SOI) wafer. The fabrication makes use of relatively accessible equipment, a scanning electron microscope (SEM), and wet chemical synthesis. The electron beam implants electrons into the insulating material, which further anchors the positively charged Au nanoparticles by electrostatic attraction. The novel fabrication method was applied to several substrates useful in microelectronics to add plasmonic particles. The resolution and surface density of the deposition were tuned, respectively, by the electron energy (acceleration voltage) and the dose of electronic irradiation. We easily achieved the smallest written feature of 68 ± 18 nm on SOI, and the technique can be extended to any positively charged nanoparticles, while the resolution is in principle limited by the particle size distribution and the scattering of the electrons in the substrate. [Figure not available: see fulltext.

  6. Influence of turn (or fold) and local charge in fragmentation of the peptide analogue molecule CH3CO-Gly-NH2 following single-photon VUV (118.22 nm) ionization.

    Science.gov (United States)

    Bhattacharya, Atanu; Bernstein, Elliot R

    2011-10-06

    The radical cationic reactivity of the peptide analogue molecule CH(3)CO-Gly-NH(2) is addressed both experimentally and theoretically. The radical cation intermediate of CH(3)CO-Gly-NH(2) is created by single-photon ionization of this molecule at 118.22 nm (~10.5 eV). The two most stable conformers (C(7) and C(5)) of this molecule exhibit different folds along the backbone: the C(7) conformer has a γ-turn structure, and the C(5) conformer has a β-strand structure. The experimental results show that the radical cation intermediate of CH(3)CO-Gly-NH(2) dissociates and generates a fragment-ion signal at 73 amu that is observed through TOFMS. Theoretical results show how the fragment-ion signal at 73 amu is generated by only one conformer of CH(3)CO-Gly-NH(2) (C(7)) and how local charge and specific hydrogen bonding in the molecule influence fragmentation of the radical cation intermediate of CH(3)CO-Gly-NH(2). The specific fold of the molecule controls fragmentation of this reactive radical cation intermediate. Whereas the radical cation of the C(7) conformer dissociates through a hydrogen-transfer mechanism followed by HNCO elimination, the radical cation of the C(5) conformer does not dissociate at all. CASSCF calculations show that positive charge in the radical cationic C(7) conformer is localized at the NH(2)CO moiety of the molecular ion. This site-specific localization of the positive charge enhances the acidity of the terminal NH(2) group, facilitating hydrogen transfer from the NH(2) to the COCH(3) end of the molecular ion. Positive charge in the C(5) conformer of the CH(3)CO-Gly-NH(2) radical cation is, however, localized at the COCH(3) end of the molecular ion, and this conformer does not have enough energy to surmount the energy barrier to dissociation on the ion potential energy surface. CASSCF results show that conformation-specific localization of charge in the CH(3)CO-Gly-NH(2) molecular ion occurs as a result of the different hydrogen

  7. Positive Charges on the Surface of Thaumatin Are Crucial for the Multi-Point Interaction with the Sweet Receptor.

    Science.gov (United States)

    Masuda, Tetsuya; Kigo, Satomi; Mitsumoto, Mayuko; Ohta, Keisuke; Suzuki, Mamoru; Mikami, Bunzo; Kitabatake, Naofumi; Tani, Fumito

    2018-01-01

    Thaumatin, an intensely sweet-tasting protein, elicits sweet taste with a threshold of only 50 nM. Previous studies from our laboratory suggested that the complex model between the T1R2-T1R3 sweet receptor and thaumatin depends critically on the complementarity of electrostatic potentials. In order to further validate this model, we focused on three lysine residues (Lys78, Lys106, and Lys137), which were expected to be part of the interaction sites. Three thaumatin mutants (K78A, K106A, and K137A) were prepared and their threshold values of sweetness were examined. The results showed that the sweetness of K106A was reduced by about three times and those of K78A and K137A were reduced by about five times when compared to wild-type thaumatin. The three-dimensional structures of these mutants were also determined by X-ray crystallographic analyses at atomic resolutions. The overall structures of mutant proteins were similar to that of wild-type but the electrostatic potentials around the mutated sites became more negative. Since the three lysine residues are located in 20-40 Å apart each other on the surface of thaumatin molecule, these results suggest the positive charges on the surface of thaumatin play a crucial role in the interaction with the sweet receptor, and are consistent with a large surface is required for interaction with the sweet receptor, as proposed by the multipoint interaction model named wedge model.

  8. Onset of turbulence induced by electron nonthermality in a complex plasma in presence of positively charged dust grains

    Directory of Open Access Journals (Sweden)

    Susmita Sarkar

    2018-03-01

    Full Text Available In this paper onset of turbulence has been detected from the study of non linear dust acoustic wave propagation in a complex plasma considering electrons nonthermal and equilibrium dust charge positive. Dust grains are charged by secondary electron emission process. Our analysis shows that increase in electron nonthermality makes the grain charging process faster by reducing the magnitude of the nonadiabaticity induced pseudo viscosity. Consequently nature of dust charge variation changes from nonadiabatic to adiabatic one. For further increase of electron nonthermality, this pseudo viscosity becomes negative and hence generates a turbulent grain charging behaviour. This turbulent grain charging phenomenon is exclusively the outcome of this nonlinear study which was not found in linear analysis.

  9. Adsorption and transport of charged vs. neutral hydrophobic molecules at the membrane of murine erythroleukemia (MEL) cells.

    Science.gov (United States)

    Zeng, Jia; Eckenrode, Heather M; Dai, Hai-Lung; Wilhelm, Michael J

    2015-03-01

    The adsorption and transport of hydrophobic molecules at the membrane surface of pre- and post-DMSO induced differentiated murine erythroleukemia (MEL) cells were examined by time- and wavelength-resolved second harmonic light scattering. Two medium (MEL cell, neutral BCP does not. It is suggested that an electrostatic interaction between the opposite charges of the cation and the MEL cell surface is the primary driving force for adsorption. Comparisons of adsorption density and free energy, measured at different pH and cell morphology, indicate that the interaction is predominantly through sialic acid carboxyl groups. MG cation adsorption densities have been determined as (0.6±0.3)×10(6) μm(-2) on the surface of undifferentiated MEL cells, and (1.8±0.5)×10(7) μm(-2) on differentiated MEL cells, while the deduced adsorption free energies are effectively identical (ca. -10.9±0.1 and -10.8±0.1 kcal mol(-1), respectively). The measured MG densities indicate that the total number of surface carboxyl groups is largely conserved following differentiation, and therefore the density of carboxylic groups is much larger on the differentiated cell surface than the undifferentiated one. Finally, in contrast to synthetic liposomes and bacterial membranes, surface adsorbed MG cations are unable to traverse the MEL cell membrane. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Electrical Conductivity of Rocks and Dominant Charge Carriers. Part 1; Thermally Activated Positive Holes

    Science.gov (United States)

    Freund, Friedemann T.; Freund, Minoru M.

    2012-01-01

    The prevailing view in the geophysics community is that the electrical conductivity structure of the Earth's continental crust over the 5-35 km depth range can best be understood by assuming the presence of intergranular fluids and/or of intragranular carbon films. Based on single crystal studies of melt-grown MgO, magma-derived sanidine and anorthosite feldspars and upper mantle olivine, we present evidence for the presence of electronic charge carriers, which derive from peroxy defects that are introduced during cooling, under non-equilibrium conditions, through a redox conversion of pairs of solute hydroxyl arising from dissolution of H2O.The peroxy defects become thermally activated in a 2-step process, leading to the release of defect electrons in the oxygen anion sublattice. Known as positive holes and symbolized by h(dot), these electronic charge carriers are highly mobile. Chemically equivalent to O(-) in a matrix of O(2-) they are highly oxidizing. Being metastable they can exist in the matrix of minerals, which crystallized in highly reduced environments. The h(dot) are highly mobile. They appear to control the electrical conductivity of crustal rocks in much of the 5-35 km depth range.

  11. Design study of beam position monitors for measuring second-order moments of charged particle beams

    Science.gov (United States)

    Yanagida, Kenichi; Suzuki, Shinsuke; Hanaki, Hirofumi

    2012-01-01

    This paper presents a theoretical investigation on the multipole moments of charged particle beams in two-dimensional polar coordinates. The theoretical description of multipole moments is based on a single-particle system that is expanded to a multiparticle system by superposition, i.e., summing over all single-particle results. This paper also presents an analysis and design method for a beam position monitor (BPM) that detects higher-order (multipole) moments of a charged particle beam. To calculate the electric fields, a numerical analysis based on the finite difference method was created and carried out. Validity of the numerical analysis was proven by comparing the numerical with the analytical results for a BPM with circular cross section. Six-electrode BPMs with circular and elliptical cross sections were designed for the SPring-8 linac. The results of the numerical calculations show that the second-order moment can be detected for beam sizes ≧420μm (circular) and ≧550μm (elliptical).

  12. Design study of beam position monitors for measuring second-order moments of charged particle beams

    Directory of Open Access Journals (Sweden)

    Kenichi Yanagida

    2012-01-01

    Full Text Available This paper presents a theoretical investigation on the multipole moments of charged particle beams in two-dimensional polar coordinates. The theoretical description of multipole moments is based on a single-particle system that is expanded to a multiparticle system by superposition, i.e., summing over all single-particle results. This paper also presents an analysis and design method for a beam position monitor (BPM that detects higher-order (multipole moments of a charged particle beam. To calculate the electric fields, a numerical analysis based on the finite difference method was created and carried out. Validity of the numerical analysis was proven by comparing the numerical with the analytical results for a BPM with circular cross section. Six-electrode BPMs with circular and elliptical cross sections were designed for the SPring-8 linac. The results of the numerical calculations show that the second-order moment can be detected for beam sizes ≧420  μm (circular and ≧550  μm (elliptical.

  13. Deciphering the "chemical" nature of the exotic isotopes of hydrogen by the MC-QTAIM analysis: the positively charged muon and the muonic helium as new members of the periodic table.

    Science.gov (United States)

    Goli, Mohammad; Shahbazian, Shant

    2014-04-14

    This report is a primarily survey on the chemical nature of some exotic species containing the positively charged muon and the muonic helium, i.e., the negatively charged muon plus helium nucleus, as exotic isotopes of hydrogen, using the newly developed multi-component quantum theory of atoms in molecules (MC-QTAIM) analysis, employing ab initio non-Born-Oppenhiemer wavefunctions. Accordingly, the "atoms in molecules" analysis performed on various asymmetric exotic isotopomers of the hydrogen molecule, recently detected experimentally [Science, 2011, 331, 448], demonstrates that both the exotic isotopes are capable of forming atoms in molecules and retaining the identity of hydrogen atoms. Various derived properties of atomic basins containing the muonic helium cast no doubt that apart from its short life time, it is a heavier isotope of hydrogen while the properties of basins containing the positively charged muon are more remote from those of the orthodox hydrogen basins, capable of appreciable donation of electrons as well as large charge polarization. However, with some tolerance, they may also be categorized as hydrogen basins though with a smaller electronegativity. All in all, the present study also clearly demonstrates that the MC-QTAIM analysis is an efficient approach to decipher the chemical nature of species containing exotic constituents, which are difficult to elucidate by experimental and/or alternative theoretical schemes.

  14. Enhanced biomimic bactericidal surfaces by coating with positively-charged ZIF nano-dagger arrays.

    Science.gov (United States)

    Yuan, Yuan; Zhang, Yugen

    2017-10-01

    Cicada wing surfaces are covered with dense patterns of nano-pillar structure that prevent bacterial growth by rupturing adhered microbial cells. To mimic the natural nano-pillar structure, we developed a general and simple method to grow metal organic framework (MOF) nano-dagger arrays on a wide range of surfaces. These nano-daggers possess high bactericidal activity, with log reduction >7 for Escherichia coli and Staphylococcus aureus. It was hypothesized that the positively-charged ZIF-L nano-dagger surfaces enhance bacterial cell adhesion, facilitating selective and efficient bacteria killing by the rigid and sharp nano-dagger tips. This research provides a safe and clean antimicrobial surface technology which does not require external chemicals and will not cause drug resistance. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Positively Charged Nanostructured Lipid Carriers and Their Effect on the Dissolution of Poorly Soluble Drugs

    Directory of Open Access Journals (Sweden)

    Kyeong-Ok Choi

    2016-05-01

    Full Text Available The objective of this study is to develop suitable formulations to improve the dissolution rate of poorly water soluble drugs. We selected lipid-based formulation as a drug carrier and modified the surface using positively charged chitosan derivative (HTCC to increase its water solubility and bioavailability. Chitosan and HTCC-coated lipid particles had higher zeta-potential values than uncoated one over the whole pH ranges and improved encapsulation efficiency. In vitro drug release showed that all NLC formulations showed higher in vitro release efficiency than drug particle at pH 7.4. Furthermore, NLC formulation prepared with chitosan or HTCC represented good sustained release property. The results indicate that chitosan and HTCC can be excellent formulating excipients of lipid-based delivery carrier for improving poorly water soluble drug delivery.

  16. Positively Charged Nanostructured Lipid Carriers and Their Effect on the Dissolution of Poorly Soluble Drugs.

    Science.gov (United States)

    Choi, Kyeong-Ok; Choe, Jaehyeog; Suh, Seokjin; Ko, Sanghoon

    2016-05-20

    The objective of this study is to develop suitable formulations to improve the dissolution rate of poorly water soluble drugs. We selected lipid-based formulation as a drug carrier and modified the surface using positively charged chitosan derivative (HTCC) to increase its water solubility and bioavailability. Chitosan and HTCC-coated lipid particles had higher zeta-potential values than uncoated one over the whole pH ranges and improved encapsulation efficiency. In vitro drug release showed that all NLC formulations showed higher in vitro release efficiency than drug particle at pH 7.4. Furthermore, NLC formulation prepared with chitosan or HTCC represented good sustained release property. The results indicate that chitosan and HTCC can be excellent formulating excipients of lipid-based delivery carrier for improving poorly water soluble drug delivery.

  17. Position dependence of charge collection in prototype sensors for the CMS pixel detector

    CERN Document Server

    Rohe, Tilman; Chiochia, Vincenzo; Cremaldi, Lucien M; Cucciarelli, Susanna; Dorokhov, Andrei; Konecki, Marcin; Prokofiev, Kirill; Regenfus, Christian; Sanders, David A; Son Seung Hee; Speer, Thomas; Swartz, Morris

    2004-01-01

    This paper reports on the sensor R&D activity for the CMS pixel detector. Devices featuring several design and technology options have been irradiated up to a proton fluence1 of 1 multiplied by 10**1**5 n //e//q/cm**2 at the CERN PS. Afterward, they were bump bonded to unirradiated readout chips and tested using high energy pions in the H2 beam line of the CERN SPS. The readout chip allows a nonzero suppressed full analogue readout and therefore a good characterization of the sensors in terms of noise and charge collection properties. The position dependence of signal is presented and the differences between the two sensor options are discussed. 20 Refs.

  18. Think positive : phase separation enables a positively charged additive to induce dramatic changes in calcium carbonate morphology

    NARCIS (Netherlands)

    Cantaert, B.; Kim, Y.; Ludwig, H.; Nudelman, F.; Sommerdijk, N.A.J.M.; Meldrum, F.C.

    2012-01-01

    Soluble macromolecules are essential to Nature's control over biomineral formation. Following early studies where macromolecules rich in aspartic and glutamic acid were extracted from nacre, research has focused on the use of negatively charged additives to control calcium carbonate precipitation.

  19. Studies of the pulse charge of lead-acid batteries for PV applications. Part I. Factors influencing the mechanism of the pulse charge of the positive plate

    Energy Technology Data Exchange (ETDEWEB)

    Kirchev, A.; Perrin, M.; Lemaire, E.; Karoui, F.; Mattera, F. [Commissariat de l' Energie Atomique, Institut National de l' Energie Solaire, INES-RDI, Parc Technologique de Savoie Technolac, 50 Avenue du Lac Leman, 73377 Le Bourget du Lac Cedex (France)

    2008-02-15

    The mechanism of the positive plate charge in pulse regime was studied in model lead-acid cells with one positive and two negative plates (8 Ah each) and Ag/Ag{sub 2}SO{sub 4} reference electrodes. The results showed that the evolution of the electrode potential is much slower on the positive plate than on the negative plate. Regardless of this fact, the calculated capacitive current of charge and self-discharge of the electrochemical double layer (EDL) during the 'ON' and 'OFF' half-periods of the pulse current square waves is comparable with the charge current amplitude. The result is due to the high values of the EDL on the surface of the lead dioxide active material. The influence of different factors like state of charge, state of health, pulse frequency, current amplitude and open circuit stay before the polarization was discussed. The previously determined optimal frequency of 1 Hz was associated with a maximum in the average double layer current on frequency dependence. The average double layer current is also maximal at SOC between 75 and 100%. The exchange of the constant current polarization with pulse polarization does not change substantially the mechanism and the overvoltage of the oxygen evolution reaction on the positive plate. The mechanism of the self-discharge of the EDL was also estimated analyzing long-time PPP transients (up to 2 h). It was found that when the PPP is lower than 1.2 V the preferred mechanism of EDL self-discharge is by coupling with the lead sulphate oxidation reaction. At higher values of PPP the EDL self-discharge happens via oxygen evolution. The high faradic efficiency of the pulse charge is due to the chemical oxidation of the Pb(II) ions by the O atoms and OH radicals formed at the oxygen evolution both during the 'ON' and 'OFF' periods. (author)

  20. A self-consistent phase-field approach to implicit solvation of charged molecules with Poisson–Boltzmann electrostatics

    Science.gov (United States)

    Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J. Andrew

    2015-01-01

    Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson–Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum–Chandler–Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods. PMID:26723595

  1. A self-consistent phase-field approach to implicit solvation of charged molecules with Poisson-Boltzmann electrostatics.

    Science.gov (United States)

    Sun, Hui; Wen, Jiayi; Zhao, Yanxiang; Li, Bo; McCammon, J Andrew

    2015-12-28

    Dielectric boundary based implicit-solvent models provide efficient descriptions of coarse-grained effects, particularly the electrostatic effect, of aqueous solvent. Recent years have seen the initial success of a new such model, variational implicit-solvent model (VISM) [Dzubiella, Swanson, and McCammon Phys. Rev. Lett. 96, 087802 (2006) and J. Chem. Phys. 124, 084905 (2006)], in capturing multiple dry and wet hydration states, describing the subtle electrostatic effect in hydrophobic interactions, and providing qualitatively good estimates of solvation free energies. Here, we develop a phase-field VISM to the solvation of charged molecules in aqueous solvent to include more flexibility. In this approach, a stable equilibrium molecular system is described by a phase field that takes one constant value in the solute region and a different constant value in the solvent region, and smoothly changes its value on a thin transition layer representing a smeared solute-solvent interface or dielectric boundary. Such a phase field minimizes an effective solvation free-energy functional that consists of the solute-solvent interfacial energy, solute-solvent van der Waals interaction energy, and electrostatic free energy described by the Poisson-Boltzmann theory. We apply our model and methods to the solvation of single ions, two parallel plates, and protein complexes BphC and p53/MDM2 to demonstrate the capability and efficiency of our approach at different levels. With a diffuse dielectric boundary, our new approach can describe the dielectric asymmetry in the solute-solvent interfacial region. Our theory is developed based on rigorous mathematical studies and is also connected to the Lum-Chandler-Weeks theory (1999). We discuss these connections and possible extensions of our theory and methods.

  2. Position statement on ethics, equipoise and research on charged particle radiation therapy.

    Science.gov (United States)

    Sheehan, Mark; Timlin, Claire; Peach, Ken; Binik, Ariella; Puthenparampil, Wilson; Lodge, Mark; Kehoe, Sean; Brada, Michael; Burnet, Neil; Clarke, Steve; Crellin, Adrian; Dunn, Michael; Fossati, Piero; Harris, Steve; Hocken, Michael; Hope, Tony; Ives, Jonathan; Kamada, Tadashi; London, Alex John; Miller, Robert; Parker, Michael; Pijls-Johannesma, Madelon; Savulescu, Julian; Short, Susan; Skene, Loane; Tsujii, Hirohiko; Tuan, Jeffrey; Weijer, Charles

    2014-08-01

    The use of charged-particle radiation therapy (CPRT) is an increasingly important development in the treatment of cancer. One of the most pressing controversies about the use of this technology is whether randomised controlled trials are required before this form of treatment can be considered to be the treatment of choice for a wide range of indications. Equipoise is the key ethical concept in determining which research studies are justified. However, there is a good deal of disagreement about how this concept is best understood and applied in the specific case of CPRT. This report is a position statement on these controversies that arises out of a workshop held at Wolfson College, Oxford in August 2011. The workshop brought together international leaders in the relevant fields (radiation oncology, medical physics, radiobiology, research ethics and methodology), including proponents on both sides of the debate, in order to make significant progress on the ethical issues associated with CPRT research. This position statement provides an ethical platform for future research and should enable further work to be done in developing international coordinated programmes of research. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  3. Positively versus negatively charged moral emotion expectancies in adolescence: the role of situational context and the developing moral self.

    Science.gov (United States)

    Krettenauer, Tobias; Johnston, Megan

    2011-09-01

    The study analyses adolescents' positively charged versus negatively charged moral emotion expectancies. Two hundred and five students (M= 14.83 years, SD= 2.21) participated in an interview depicting various situations in which a moral norm was either regarded or transgressed. Emotion expectancies were assessed for specific emotions (pride, guilt) as well as for overall strength and valence. In addition, self-importance of moral values was measured by a questionnaire. Results revealed that positively charged emotion expectancies were more pronounced in contexts of prosocial action than in the context of moral transgressions, whereas the opposite was true for negatively charged emotions. At the same time, expectations of guilt and pride were substantially related to the self-importance of moral values. ©2010 The British Psychological Society.

  4. Investigations of solution-processed charge generation unit with low concentration of small molecule doped in p-type/HAT-CN{sub 6} for tandem OLED

    Energy Technology Data Exchange (ETDEWEB)

    Talik, N.A., E-mail: azrina_talik@hotmail.com [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yeoh, K.H. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Centre for Photonics and Advanced Materials Research (CPR), Lee Kong Chian Faculty of Engineering and Science, University Tunku Abdul Rahman, 43000 Kajang, Selangor (Malaysia); Ng, C.Y.B. [Low Dimensional Material Research Centre (LDMRC), Physics Dept., Faculty of Science, University of Malaya, 50603 Kuala Lumpur (Malaysia); Tan, C.Y. [Centre of Advanced Manufacturing & Material Processing (AMMP), Department of Mechanical Engineering, Faculty of Engineering, University of Malaya, 50603 Kuala Lumpur (Malaysia); Yap, B.K., E-mail: kbyap@uniten.edu.my [Centre of Microelectronic and Nano Engineering (CeMNE), College of Engineering, Universiti Tenaga Nasional, 43000 Kajang, Selangor (Malaysia)

    2016-01-15

    We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN{sub 6} has been used for tandem OLED. • The improvement attributes to the lower V{sub bi} and larger ΔV{sub L} in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.

  5. Investigations of solution-processed charge generation unit with low concentration of small molecule doped in p-type/HAT-CN6 for tandem OLED

    International Nuclear Information System (INIS)

    Talik, N.A.; Yeoh, K.H.; Ng, C.Y.B.; Tan, C.Y.; Yap, B.K.

    2016-01-01

    We investigated the charge generation and injection mechanism in solution processed charge generation unit (CGU) used in our high performance tandem organic light emitting diode (OLED) via capacitance–voltage (C–V) and current density–voltage (J–V) measurements. By doping 2 wt% of small molecule 1,1-bis-(4-bis(4-tolyl)-aminophenyl) cyclohexene (TAPC) into Poly (N-vinylcarbazole) (PVK) as p-type layer of the CGU, we obtained more than two folds improvement in the tandem device efficiency compared to single device. The performance improvement of the TAPC doped CGU could be attributed to low built-in potential, large vacuum level shift as well as high charge density for efficient charge generation. - Highlights: • Charge-generation and injection mechanism in CGU for tandem OLED is investigated. • Small molecule, TAPC doped in p-type/HAT-CN 6 has been used for tandem OLED. • The improvement attributes to the lower V bi and larger ΔV L in doped layer. • Narrower W and high carrier density also contribute to efficiency improvement.

  6. Positive Charges on the Surface of Thaumatin Are Crucial for the Multi-Point Interaction with the Sweet Receptor

    Directory of Open Access Journals (Sweden)

    Tetsuya Masuda

    2018-02-01

    Full Text Available Thaumatin, an intensely sweet-tasting protein, elicits sweet taste with a threshold of only 50 nM. Previous studies from our laboratory suggested that the complex model between the T1R2-T1R3 sweet receptor and thaumatin depends critically on the complementarity of electrostatic potentials. In order to further validate this model, we focused on three lysine residues (Lys78, Lys106, and Lys137, which were expected to be part of the interaction sites. Three thaumatin mutants (K78A, K106A, and K137A were prepared and their threshold values of sweetness were examined. The results showed that the sweetness of K106A was reduced by about three times and those of K78A and K137A were reduced by about five times when compared to wild-type thaumatin. The three-dimensional structures of these mutants were also determined by X-ray crystallographic analyses at atomic resolutions. The overall structures of mutant proteins were similar to that of wild-type but the electrostatic potentials around the mutated sites became more negative. Since the three lysine residues are located in 20–40 Å apart each other on the surface of thaumatin molecule, these results suggest the positive charges on the surface of thaumatin play a crucial role in the interaction with the sweet receptor, and are consistent with a large surface is required for interaction with the sweet receptor, as proposed by the multipoint interaction model named wedge model.

  7. Pore Polarity and Charge Determine Differential Block of Kir1.1 and Kir7.1 Potassium Channels by Small-Molecule Inhibitor VU590.

    Science.gov (United States)

    Kharade, Sujay V; Sheehan, Jonathan H; Figueroa, Eric E; Meiler, Jens; Denton, Jerod S

    2017-09-01

    VU590 was the first publicly disclosed, submicromolar-affinity (IC 50 = 0.2 μ M), small-molecule inhibitor of the inward rectifier potassium (Kir) channel and diuretic target, Kir1.1. VU590 also inhibits Kir7.1 (IC 50 ∼ 8 μ M), and has been used to reveal new roles for Kir7.1 in regulation of myometrial contractility and melanocortin signaling. Here, we employed molecular modeling, mutagenesis, and patch clamp electrophysiology to elucidate the molecular mechanisms underlying VU590 inhibition of Kir1.1 and Kir7.1. Block of both channels is voltage- and K + -dependent, suggesting the VU590 binding site is located within the pore. Mutagenesis analysis in Kir1.1 revealed that asparagine 171 (N171) is the only pore-lining residue required for high-affinity block, and that substituting negatively charged residues (N171D, N171E) at this position dramatically weakens block. In contrast, substituting a negatively charged residue at the equivalent position in Kir7.1 enhances block by VU590, suggesting the VU590 binding mode is different. Interestingly, mutations of threonine 153 (T153) in Kir7.1 that reduce constrained polarity at this site (T153C, T153V, T153S) make wild-type and binding-site mutants (E149Q, A150S) more sensitive to block by VU590. The Kir7.1-T153C mutation enhances block by the structurally unrelated inhibitor VU714 but not by a higher-affinity analog ML418, suggesting that the polar side chain of T153 creates a barrier to low-affinity ligands that interact with E149 and A150. Reverse mutations in Kir1.1 suggest that this mechanism is conserved in other Kir channels. This study reveals a previously unappreciated role of membrane pore polarity in determination of Kir channel inhibitor pharmacology. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  8. Two-dimensional potential and charge distributions of positive surface streamer

    International Nuclear Information System (INIS)

    Tanaka, Daiki; Matsuoka, Shigeyasu; Kumada, Akiko; Hidaka, Kunihiko

    2009-01-01

    Information on the potential and the field profile along a surface discharge is required for quantitatively discussing and clarifying the propagation mechanism. The sensing technique with a Pockels crystal has been developed for directly measuring the potential and electric field distribution on a dielectric material. In this paper, the Pockels sensing system consists of a pulse laser and a CCD camera for measuring the instantaneous two-dimensional potential distribution on a 25.4 mm square area with a 50 μm sampling pitch. The temporal resolution is 3.2 ns which is determined by the pulse width of the laser emission. The transient change in the potential distribution of a positive surface streamer propagating in atmospheric air is measured with this system. The electric field and the charge distributions are also calculated from the measured potential profile. The propagating direction component of the electric field near the tip of the propagating streamer reaches 3 kV mm -1 . When the streamer stops, the potential distribution along a streamer forms an almost linear profile with the distance from the electrode, and its gradient is about 0.5 kV mm -1 .

  9. Positively charged gold nanoparticles capped with folate quaternary chitosan: Synthesis, cytotoxicity, and uptake by cancer cells.

    Science.gov (United States)

    Yen, Hui-Ju; Young, Yen-An; Tsai, Tsung-Neng; Cheng, Kuang-Ming; Chen, Xin-An; Chen, Ying-Chuan; Chen, Cheng-Cheung; Young, Jenn-Jong; Hong, Po-da

    2018-03-01

    In this study, we synthesized various quaternary chitosan derivatives and used them to stabilize gold nanoparticles (AuNPs). These chitosan derivatives comprised N-(2-hydroxy)propyl-3-trimethylammonium chitosan chloride (HTCC), folate-HTCC, galactosyl-HTCC, and their fluorescein isothiocyanate-conjugated derivatives. Various positively surface-charged AuNPs were prepared under alkaline conditions using glucose as a reducing agent in the presence of the HTCC derivatives (HTCCs). The effects of the concentration of NaOH, glucose, and HTCCs on the particles size, zeta potential, and stability were studied in detail. Cell cycle assays verify that none of the HTCCs or HTCCs-AuNPs was cytotoxic to human umbilical vein endothelial cells. Flow cytometry analysis showed that the folate HTCC-AuNPs were internalized in Caco-2, HepG2, and HeLa cancer cells to a significantly greater extent than AuNPs without folate. But, galactosyl HTCC-AuNPs only showed high cell uptake by HepG2 cells. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. The role of NH2-terminal positive charges in the activity of inward rectifier KATP channels.

    Science.gov (United States)

    Cukras, C A; Jeliazkova, I; Nichols, C G

    2002-09-01

    Approximately half of the NH(2) terminus of inward rectifier (Kir) channels can be deleted without significant change in channel function, but activity is lost when more than approximately 30 conserved residues before the first membrane spanning domain (M1) are removed. Systematic replacement of the positive charges in the NH(2) terminus of Kir6.2 with alanine reveals several residues that affect channel function when neutralized. Certain mutations (R4A, R5A, R16A, R27A, R39A, K47A, R50A, R54A, K67A) change open probability, whereas an overlapping set of mutants (R16A, R27A, K39A, K47A, R50A, R54A, K67A) change ATP sensitivity. Further analysis of the latter set differentiates mutations that alter ATP sensitivity as a consequence of altered open state stability (R16A, K39A, K67A) from those that may affect ATP binding directly (K47A, R50A, R54A). The data help to define the structural determinants of Kir channel function, and suggest possible structural motifs within the NH(2) terminus, as well as the relationship of the NH(2) terminus with the extended cytoplasmic COOH terminus of the channel.

  11. Osteoblasts with impaired spreading capacity benefit from the positive charges of plasma polymerised allylamine

    Directory of Open Access Journals (Sweden)

    F Kunz

    2015-03-01

    Full Text Available Bone diseases such as osteoporosis, osteoarthritis and rheumatoid arthritis, impinge on the performance of orthopaedic implants by impairing bone regeneration. For this reason, the development of effective surface modifications supporting the ingrowth of implants in morbid bone tissue is essential. Our study is designed to elucidate if cells with restricted cell-function limiting adhesion processes benefit from plasma polymer deposition on titanium. We used the actin filament disrupting agent cytochalasin D (CD as an experimental model for cells with impaired actin cytoskeleton. Indeed, the cell’s capacity to adhere and spread was drastically reduced due to shortened actin filaments and vinculin contacts that were smaller. The coating of titanium with a positively charged nanolayer of plasma polymerised allylamine (PPAAm abrogated these disadvantages in cell adhesion and the CD-treated osteoblasts were able to spread significantly. Interestingly, PPAAm increased spreading by causing enhanced vinculin number and contact length, but without significantly reorganising actin filaments. PPAAm with the monomer allylamine was deposited in a microwave-excited low-pressure plasma-processing reactor. Cell physiology was monitored by flow cytometry and confocal laser scanning microscopy, and the length and number of actin filaments was quantified by mathematical image processing. We showed that biomaterial surface modification with PPAAm could be beneficial even for osteoblasts with impaired cytoskeleton components. These insights into in vitro conditions may be used for the evaluation of future strategies to design implants for morbid bone tissue.

  12. Nanoscale charge localization induced by random orientations of organic molecules in hybrid perovskite CH3NH3PbI3

    Science.gov (United States)

    Ma, Jie; Wang, Lin-Wang

    2015-03-01

    Perovskite-based solar cells have achieved high solar-energy conversion efficiencies and attracted wide attentions nowadays. Despite the rapid progress in solar-cell devices, many fundamental issues of the hybrid perovskites have not been fully understood. Experimentally, it is well known that in CH3NH3PbI3, the organic molecules CH3NH3 are randomly orientated at the room temperature, but the impact of the random molecular orientation has not been investigated. Using linear-scaling ab-initiomethods, we have calculated the electronic structures of the tetragonal phase of CH3NH3PbI3 with randomly orientated organic molecules in large supercells up to ~20,000 atoms. Due to the dipole moment of the organic molecule, the random orientation creates a novel system with long-range potential fluctuations unlike alloys or other conventional disordered systems. We find that the charge densities of the conduction-band minimum and the valence-band maximum are localized separately in nanoscales due to the potential fluctuations. The charge localization causes electron-hole separation and reduces carrier recombination rates, which may contribute to the long carrier lifetime observed in experiments. We have also proposed a model to explain the charge localization.

  13. Simulation study of signal formation in position sensitive planar p-on-n silicon detectors after short range charge injection

    International Nuclear Information System (INIS)

    Peltola, T.; Eremin, V.; Verbitskaya, E.; Härkönen, J.

    2017-01-01

    Segmented silicon detectors (micropixel and microstrip) are the main type of detectors used in the inner trackers of Large Hadron Collider (LHC) experiments at CERN. Due to the high luminosity and eventual high fluence of energetic particles, detectors with fast response to fit the short shaping time of 20–25 ns and sufficient radiation hardness are required. Charge collection measurements carried out at the Ioffe Institute have shown a reversal of the pulse polarity in the detector response to short-range charge injection. Since the measured negative signal is about 30–60% of the peak positive signal, the effect strongly reduces the CCE even in non-irradiated detectors. For further investigation of the phenomenon the measurements have been reproduced by TCAD simulations. As for the measurements, the simulation study was applied for the p-on-n strip detectors similar in geometry to those developed for the ATLAS experiment and for the Ioffe Institute designed p-on-n strip detectors with each strip having a window in the metallization covering the p + implant, allowing the generation of electron-hole pairs under the strip implant. Red laser scans across the strips and the interstrip gap with varying laser diameters and Si-SiO 2 interface charge densities ( Q f ) were carried out. The results verify the experimentally observed negative response along the scan in the interstrip gap. When the laser spot is positioned on the strip p + implant the negative response vanishes and the collected charge at the active strip increases respectively. The simulation results offer a further insight and understanding of the influence of the oxide charge density in the signal formation. The main result of the study is that a threshold value of Q f , that enables negligible losses of collected charges, is defined. The observed effects and details of the detector response for different charge injection positions are discussed in the context of Ramo's theorem.

  14. Simulation study of signal formation in position sensitive planar p-on-n silicon detectors after short range charge injection

    Science.gov (United States)

    Peltola, T.; Eremin, V.; Verbitskaya, E.; Härkönen, J.

    2017-09-01

    Segmented silicon detectors (micropixel and microstrip) are the main type of detectors used in the inner trackers of Large Hadron Collider (LHC) experiments at CERN. Due to the high luminosity and eventual high fluence of energetic particles, detectors with fast response to fit the short shaping time of 20-25 ns and sufficient radiation hardness are required. Charge collection measurements carried out at the Ioffe Institute have shown a reversal of the pulse polarity in the detector response to short-range charge injection. Since the measured negative signal is about 30-60% of the peak positive signal, the effect strongly reduces the CCE even in non-irradiated detectors. For further investigation of the phenomenon the measurements have been reproduced by TCAD simulations. As for the measurements, the simulation study was applied for the p-on-n strip detectors similar in geometry to those developed for the ATLAS experiment and for the Ioffe Institute designed p-on-n strip detectors with each strip having a window in the metallization covering the p+ implant, allowing the generation of electron-hole pairs under the strip implant. Red laser scans across the strips and the interstrip gap with varying laser diameters and Si-SiO2 interface charge densities (Qf) were carried out. The results verify the experimentally observed negative response along the scan in the interstrip gap. When the laser spot is positioned on the strip p+ implant the negative response vanishes and the collected charge at the active strip increases respectively. The simulation results offer a further insight and understanding of the influence of the oxide charge density in the signal formation. The main result of the study is that a threshold value of Qf, that enables negligible losses of collected charges, is defined. The observed effects and details of the detector response for different charge injection positions are discussed in the context of Ramo's theorem.

  15. Separation analysis of macrolide antibiotics with good performance on a positively charged C18HCE column.

    Science.gov (United States)

    Wei, Jie; Shen, Aijin; Yan, Jingyu; Jin, Gaowa; Yang, Bingcheng; Guo, Zhimou; Zhang, Feifang; Liang, Xinmiao

    2016-03-01

    The separation of basic macrolide antibiotics suffers from peak tailing and poor efficiency on traditional silica-based reversed-phase liquid chromatography columns. In this work, a C18HCE column with positively charged surface was applied to the separation of macrolides. Compared with an Acquity BEH C18 column, the C18HCE column exhibited superior performance in the aspect of peak shape and separation efficiency. The screening of mobile phase additives including formic acid, acetic acid and ammonium formate indicated that formic acid was preferable for providing symmetrical peak shapes. Moreover, the influence of formic acid content was investigated. Analysis speed and mass spectrometry compatibility were also taken into account when optimizing the separation conditions for liquid chromatography coupled with tandem mass spectrometry. The developed method was successfully utilized for the determination of macrolide residues in a honey sample. Azithromycin was chosen as the internal standard for the quantitation of spiramycin and tilmicosin, while roxithromycin was used for erythromycin, tylosin, clarithromycin, josamycin and acetylisovaleryltylosin. Good correlation coefficients (r(2) > 0.9938) for all macrolides were obtained. The intra-day and inter-day recoveries were 73.7-134.7% and 80.7-119.7% with relative standard deviations of 2.5-8.0% and 3.9-16.1%, respectively. Outstanding sensitivity with limits of quantitation (S/N ≥ 10) of 0.02-1 μg/kg and limits of detection (S/N ≥ 3) of 0.01-0.5 μg/kg were achieved. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Quantum size correction to the work function and the centroid of excess charge in positively ionized simple metal clusters

    Directory of Open Access Journals (Sweden)

    M. Payami

    2003-12-01

    Full Text Available  In this work, we have shown the important role of the finite-size correction to the work function in predicting the correct position of the centroid of excess charge in positively charged simple metal clusters with different values . For this purpose, firstly we have calculated the self-consistent Kohn-Sham energies of neutral and singly-ionized clusters with sizes in the framework of local spin-density approximation and stabilized jellium model (SJM as well as simple jellium model (JM with rigid jellium. Secondly, we have fitted our results to the asymptotic ionization formulas both with and without the size correction to the work function. The results of fittings show that the formula containing the size correction predict a correct position of the centroid inside the jellium while the other predicts a false position, outside the jellium sphere.

  17. Quantum size correction to the work function and centroid of excess charge in positively ionized simple metal clusters

    International Nuclear Information System (INIS)

    Payami, M.

    2004-01-01

    In this work, we have shown the important role of the finite-size correction to the work function in predicting the correct position of the centroid of excess charge in positively charged simple metal clusters with different r s values (2≤ r s ≥ 7). For this purpose, firstly we have calculated the self-consistent Kohn-Sham energies of neutral and singly-ionized clusters with sizes 2≤ N ≥100 in the framework of local spin-density approximation and stabilized jellium model as well as simple jellium model with rigid jellium. Secondly, we have fitted our results to the asymptotic ionization formulas both with and without the size correction to the work function. The results of fittings show that the formula containing the size correction predict a correct position of the centroid inside the jellium while the other predicts a false position, outside the jellium sphere

  18. Charge dividing mechanism on resistive electrode in position-sensitive detectors

    International Nuclear Information System (INIS)

    Radeka, V.; Rehak, P.

    1978-10-01

    A complete charge-division mechanism, including both the diffusion and the electromagnetic wave propagation on resistive electrodes, is presented. The charge injected into such a transmission line divides between the two ends according to the ratio of resistancies and independently of the value of the line resistance, of the propagation mechanism and of the distribution of inductance and capacitance along the line. The shortest charge division time is achieved for Rl = 2π (L/C) 1 / 2 , where R, L, C are resistance, inductance and capacitance per unit length and l is the length of the line

  19. Long-Term Charge/Discharge Cycling Stability of MnO2 Aqueous Supercapacitor under Positive Polarization

    KAUST Repository

    Ataherian, Fatemeh; Wu, Nae-Lih

    2011-01-01

    The long-term charge/discharge cycling stability of MnO 2 electrode under positive polarization in aqueous KCl electrolyte has been studied over different potential windows spanning from the open circuit potential to varied higher-end potential

  20. Charge Spreading and Position Sensitivity in a Segmented Planar Germanium Detector (Preprint)

    National Research Council Canada - National Science Library

    Kroeger, R. A; Gehrels, N; Johnson, W. N; Kurfess, J. D; Phlips, B. P; Tueller, J

    1998-01-01

    The size of the charge cloud collected in a segmented germanium detector is limited by the size of the initial cloud, uniformity of the electric field, and the diffusion of electrons and holes through the detector...

  1. MOCCA: A 4k-Pixel Molecule Camera for the Position- and Energy-Resolving Detection of Neutral Molecule Fragments at CSR

    Science.gov (United States)

    Gamer, L.; Schulz, D.; Enss, C.; Fleischmann, A.; Gastaldo, L.; Kempf, S.; Krantz, C.; Novotný, O.; Schwalm, D.; Wolf, A.

    2016-08-01

    We present the design of MOCCA, a large-area particle detector that is developed for the position- and energy-resolving detection of neutral molecule fragments produced in electron-ion interactions at the Cryogenic Storage Ring at the Max Planck Institute for Nuclear Physics in Heidelberg. The detector is based on metallic magnetic calorimeters and consists of 4096 particle absorbers covering a total detection area of 44.8 mathrm {mm} × 44.8 mathrm {mm}. Groups of four absorbers are thermally coupled to a common paramagnetic temperature sensor where the strength of the thermal link is different for each absorber. This allows attributing a detector event within this group to the corresponding absorber by discriminating the signal rise times. A novel readout scheme further allows reading out all 1024 temperature sensors that are arranged in a 32 × 32 square array using only 16+16 current-sensing superconducting quantum interference devices. Numerical calculations taking into account a simplified detector model predict an energy resolution of Δ E_mathrm {FWHM} le 80 mathrm {eV} for all pixels of this detector.

  2. The regiochemical distribution of positive charges along cholesterol polyamine carbamates plays significant roles in modulating DNA binding affinity and lipofection.

    Science.gov (United States)

    Geall, A J; Eaton, M A; Baker, T; Catterall, C; Blagbrough, I S

    1999-10-15

    We have quantified the effects of the regiochemical distribution of positive charges along the polyamine moiety in lipopolyamines for DNA molecular recognition. High affinity binding leads to charge neutralisation, DNA condensation and ultimately to lipofection. Binding affinities for calf thymus DNA were determined using an ethidium bromide displacement assay and condensation was detected by changes in turbidity using light scattering. The in vitro transfection competence of cholesterol polyamine carbamates was measured in CHO cells. In the design of DNA condensing and transfecting agents for non-viral gene therapy, the interrelationship of ammonium ions, not just their number, must be considered.

  3. DFT calculations of the charged states of N@C60 and Fe4 single molecule magnets investigated in tunneling spectroscopy

    Science.gov (United States)

    Nossa, Javier; Islam, Fhokrul; Canali, Carlo; Pederson, Mark

    2012-02-01

    For device applications of single molecule magnets (SMMs) in high-density information storage and quantum-state control it is essential that the magnetic properties of the molecules remain stable under the influence of metallic contacts or surface environment. Recent tunneling experiments [1, 2] on N@C60 and Fe4 SMM have shown that these molecules preserve their magnetic characteristics when they are used as the central island of single-electron transistors. Although quantum spin models have been used extensively to study theoretically tunneling spectroscopy of SMMs, it has been shown recently that the orbital degrees of freedom, which is absent in spin models, can significantly affect the tunneling conductance [3]. In this work we present first-principles calculations of the neutral and charged states of N@C60 and Fe4 SMMs, and discuss a strategy to include their properties into a theory of quantum transport. We also present results of the magnetic anisotropy for the different charge states of Fe4 and discuss their relevance for experiments [2] in the sequential tunneling and cotunnelling regimes. [4pt] [1]. N. Roch et al., Phys. Rev. B 83, 081407 (2011). [0pt] [2]. A.S. Zyazin et al., Nano Lett. 10, 3307 (2010). [0pt] [3]. L. Michalak et al., Phys. Rev. Lett. 104, 017202 (2010).

  4. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Science.gov (United States)

    Spencer, J.; Gajdos, F.; Blumberger, J.

    2016-08-01

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  5. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Energy Technology Data Exchange (ETDEWEB)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

    2016-08-14

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  6. Adsorption behavior of n-butanol molecules on negatively charged surfaces of electrodes of mercury, gallium, and alloys In-Ga and Tl-Ga

    International Nuclear Information System (INIS)

    Damskin, B.B.; Baturina, O.A.; Vasil'ev, S.Yu.; Emets, V.V.; Kazarinov, V.E.

    1999-01-01

    Curves of differential capacitance in the interfaces Hg/H 2 O, Ga/H 2 O, (In-Ga)/H 2 O and (Tl-Ga)H 2 O in 0.05 M Na 2 SO 4 solutions with different additions of n-butanol have been obtained by the bridge method at a frequency of 420 Hz and temperature of 32 deg C. The method of regression analysis of the curves permitted ascertaining the adsorption parameters of n-butanol for the range of charges q, where there is no chemisorption of H 2 O dipoles. The data obtained suggested that the difference in the adsorption behaviour of organic molecules on the metals studied in the range of higher negative charges is largely determined by different electron electrochemical work functions, the definition being given by S. Trasatti [ru

  7. On a possibility of creation of positive space charge cloud in a system with magnetic insulation of electrons

    International Nuclear Information System (INIS)

    Goncharov, A.A.; Dobrovol'skii, A.M.; Dunets, S.P.; Evsyukov, A.N.; Protsenko, I.M.

    2009-01-01

    We describe a new approach for creation an effective, low-cost, low-maintenance axially symmetric plasma optical tools for focusing and manipulating high-current beams of negatively charged particles, electrons and negative ions. This approach is based on fundamental plasma optical concept of magnetic insulation of electrons and non-magnetized positive ions providing creation of controlled uncompensated cloud of the space charge. The axially symmetric electrostatic plasma optical lens is well-known and well developed tool where this concept is used successfully. This provides control and focusing high-current positive ion beams in wide range of parameters. Here for the first time we present optimistic experimental results describing the application of an idea of magnetic insulation of electrons for generation of the stable cloud of positive space charge by focusing onto axis the converging stream of heavy ions produced by circular accelerator with closed electron drift. The estimations of a maximal concentration of uncompensated cloud of positive ions are also made

  8. Effect of scanning in the supine and prone positions on dilation of air-charged colon in CTVC

    International Nuclear Information System (INIS)

    Ye Jing; Chen Junkun; Zhang Zongjun; Wang Junpeng; Gao Dazhi

    2003-01-01

    Objective: To evaluate the effect of scanning in the supine and prone positions on dilation of air-charged colon in CT virtual colonoscopy (CTVC). Methods: Thirty cases underwent CTVC scanning in both the supine and prone positions immediately before colonoscopy, and the dilation of each intestine was graded. The differences of colon dilation in different positions were compared. Results: In supine and prone position, there were 26 (17.3%) and 22 (14.7%) insufficient dilating colon segments, respectively, and only 5 (3.3%) insufficient dilating colon segments in double positions. 15(50.0%) and 13(43.3%) colons dilated insufficiently in supine and prone position, respectively, and decreased to 5 (16.7%) in double positions. The dilation of rectum, sigmoid colon, and transverse colon had significant difference in different positions. Conclusion: When performing CTVC, it is highly necessary to scan in both the supine and prone positions in order to ensure the sufficient dilation of colon. In supine position, the dilation of transverse colon is better, while the dilation of rectum and sigmoid colon in prone position is superior to that in supine position

  9. Image charge effects in single-molecule junctions: Breaking of symmetries and negative-differential resistance in a benzene single-electron transistor

    DEFF Research Database (Denmark)

    Kaasbjerg, Kristen; Flensberg, K.

    2011-01-01

    and molecular symmetries remain unclear. Using a theoretical framework developed for semiconductor-nanostructure-based single-electron transistors (SETs), we demonstrate that the image charge interaction breaks the molecular symmetries in a benzene-based single-molecule transistor operating in the Coulomb...... blockade regime. This results in the appearance of a so-called blocking state, which gives rise to negative-differential resistance (NDR). We show that the appearance of NDR and its magnitude in the symmetry-broken benzene SET depends in a complicated way on the interplay between the many-body matrix...

  10. Development and use of thin film composite based positively charged nanofiltration membranes in separation of aqueous streams and nuclear effluents

    International Nuclear Information System (INIS)

    Dey, T.K.; Bindal, R.C.; Prabhakar, S.; Tewari, P.K.

    2010-01-01

    A new, positively charged, thin film composite (TFC) type nanofiltration membrane has been developed and studied for its use in various aqueous stream separations. The membrane, containing fixed quaternary ammonium moieties, was developed by insitu interfacial polymerization of a functionalized amine (polyethyleneimine) and terephthaloyl chloride on a suitable base membrane. The nature of the charge on the membrane was established by ATR FT IR spectroscopy and was estimated by determination of its ion exchange capacity. The membrane was tested for its performance in single solute feed systems containing salts of various combinations of univalent and bivalent ions (NaCl, Na 2 SO 4 , CaCl 2 and MgSO 4 ) in test cell as well as in 2512 spiral modules. The membrane gave differential separation profile for these solutes with high rejection for CaCl 2 and low rejection for Na 2 SO 4 due to positive charge on the membrane and the type of charge constituting the salts. The membrane was also used for separation of simulated effluent solution containing uranyl nitrate in combination with ammonium nitrate which is a common effluent generated in nuclear industry. Here also the membrane gave differential separation profile for uranyl nitrate and ammonium nitrate in their mixture by concentrating the former salt and passing the later. This helped separation of these two solutes in the mixture into two different streams. (author)

  11. Novel use of positively charged nylon transfer membranes for trapping indoleacetic acid or other small anions during efflux from plant tissues

    Science.gov (United States)

    Evans, M. L.; Hangarter, R. P.

    1993-01-01

    Positively charged nylon blotting membranes were used as an anion binding medium to trap [14C]indoleactic acid (IAA) as it exited cells at the basal ends of Coleus blumei L. stem and Zea mays L. coleoptile segments. Autoradiography was used to visualize where the [14C] that moved out of the cut ends was localized on the nylon membrane. Diffusion of [14C]IAA from the initial point of contact with the nylon membrane was minimal. Comparison of the autoradiograms with anatomical tissue prints of the cut ends of the segments was used to determine what tissues participate in IAA movement. The results of these initial studies were consistent with other reports suggesting that [14C]IAA movement was primarily associated with vascular tissues in both C. blumei stems and corn coleoptiles, but the resolution was not sufficient to identify which vascular tissues were involved in IAA transport. With further refinements, this technique could also be used for studying the movement of other small charged molecules through plant tissues.

  12. Lithium position and occupancy fluctuations in a cathode during charge/discharge cycling of lithium-ion battery

    International Nuclear Information System (INIS)

    Sharma, N.; Yu, D.; Zhu, Y.; Wu, Y.; Peterson, V. K.

    2012-01-01

    Lithium-ion batteries are undergoing rapid development to meet the energy demands of the transportation and renewable energy-generation sectors. The capacity of a lithium-ion battery is dependent on the amount of lithium that can be reversibly incorporated into the cathode. Neutron diffraction provides greater sensitivity towards lithium relative to other diffraction techniques. In conjunction with the penetration depth afforded by neutron diffraction, the information concerning lithium gained in a neutron diffraction study allows commercial lithium-ion batteries to be explored with respect to the lithium content in the whole cathode. Furthermore, neutron diffraction instruments featuring area detectors that allow relatively fast acquisitions enable perturbations of lithium location and occupancy in the cathode during charge/discharge cycling to be determined in real time. Here, we present the time, current, and temperature dependent lithium transfer occurring within a cathode functioning under conventional charge-discharge cycling. The lithium location and content, oxygen positional parameter, and lattice parameter of the Li 1+y Mn 2 0 4 cathode are measured and linked to the battery's charge/discharge characteristics (performance). We determine that the lithium-transfer mechanism involves two crystallographic sites, and that the mechanism differs between discharge and charge, explaining the relative ease of discharging (compared with charging) this material. Furthermore, we find that the rate of change of the lattice is faster on charging than discharging, and is dependent on the lithium insertion/ extraction processes (e.g. dependent on how the site occupancies evolve). Using in situ neutron diffraction data the atomic-scale understanding of cathode functionality is revealed, representing detailed information that can be used to direct improvements in battery performance at both the practical and fundamental level.

  13. The Impact of Molecular p-Doping on Charge Transport in High-Mobility Small-Molecule/Polymer Blend Organic Transistors

    KAUST Repository

    Paterson, Alexandra F.

    2017-12-27

    Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.

  14. The Impact of Molecular p-Doping on Charge Transport in High-Mobility Small-Molecule/Polymer Blend Organic Transistors

    KAUST Repository

    Paterson, Alexandra F.; Lin, Yen-Hung; Mottram, Alexander D.; Fei, Zhuping; Niazi, Muhammad Rizwan; Kirmani, Ahmad R.; Amassian, Aram; Solomeshch, Olga; Tessler, Nir; Heeney, Martin; Anthopoulos, Thomas D.

    2017-01-01

    Molecular doping is a powerful tool with the potential to resolve many of the issues currently preventing organic thin-film transistor (OTFT) commercialization. However, the addition of dopant molecules into organic semiconductors often disrupts the host lattice, introducing defects and harming electrical transport. New dopant-based systems that overcome practical utilization issues, while still reaping the electrical performance benefits, would therefore be extremely valuable. Here, the impact of p-doping on the charge transport in blends consisting of the small-molecule 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT), the polymer indacenodithiophene-benzothiadiazole (C16IDT-BT), and the molecular dopant C60F48 is investigated. Electrical field-effect measurements indicate that p-doping not only enhances the average saturation mobility from 1.4 to 7.8 cm2 V−1 s−1 over 50 devices (maximum values from around 4 to 13 cm2 V−1 s−1), but also improves bias–stress stability, contact resistance, threshold voltage, and the overall device-to-device performance variation. Importantly, materials characterization using X-ray diffraction, X-ray photoemission spectroscopy, and ultraviolet photoemission spectroscopy, combined with charge transport modeling, reveal that effective doping is achieved without perturbing the microstructure of the polycrystalline semiconductor film. This work highlights the remarkable potential of ternary organic blends as a simple platform for OTFTs to achieve all the benefits of doping, with none of the drawbacks.

  15. Effect of position and momentum constraints on charge distribution in heavy-ion collisions

    International Nuclear Information System (INIS)

    Rajni; Kumar, Suneel

    2012-01-01

    The rich phenomenology of multifragmentation has been widely explored after two decades of its discovery. It has been experimentally shown that in one single heavy ion collision many intermediate mass fragments (IMFs) are produced, where IMFs are defined as fragments with 5 ≤ A ≤ A tot /6. In the earlier literature, the multifragmentation was studied by Jakobsson et al. who measured the charge particle distribution along with their kinetic energy spectra in 16 O/ 36 Ar induced reaction between 25 and 200 MeV/nucleon representing the various phenomena in heavy ion collisions

  16. Redox-Active Star Molecules Incorporating the 4-Benzoylpyridinium Cation - Implications for the Charge Transfer Along Branches vs. Across the Perimeter in Dendrimer

    Science.gov (United States)

    Leventis, Nicholas; Yang, Jinua; Fabrizio,Even F.; Rawashdeh, Abdel-Monem M.; Oh, Woon Su; Sotiriou-Leventis, Chariklia

    2004-01-01

    Dendrimers are self-repeating globular branched star molecules, whose fractal structure continues to fascinate, challenge, and inspire. Functional dendrimers may incorporate redox centers, and potential applications include antennae molecules for light harvesting, sensors, mediators, and artificial biomolecules. We report the synthesis and redox properties of four star systems incorporating the 4-benzoyl-N-alkylpyridinium cation; the redox potential varies along the branches but remains constant at fixed radii. Bulk electrolysis shows that at a semi-infinite time scale all redox centers are electrochemically accessible. However, voltammetric analysis (cyclic voltammetry and differential pulse voltammetry) shows that on1y two of the three redox-active centers in the perimeter are electrochemically accessible during potential sweeps as slow as 20 mV/s and as fast as 10 V/s. On the contrary, both redox centers along branches are accessible electrochemically within the same time frame. These results are explained in terms of slow through-space charge transfer and the globular 3-D folding of the molecules and are discussed in terms of their implications on the design of efficient redox functional dendrimers.

  17. Colorimetric method for determination of bisphenol A based on aptamer-mediated aggregation of positively charged gold nanoparticles

    International Nuclear Information System (INIS)

    Xu, Jingyue; Li, Ying; Bie, Jiaxin; Guo, Jiajia; Luo, Yeli; Shen, Fei; Sun, Chunyan; Jiang, Wei

    2015-01-01

    A sensitive, specific and rapid colorimetric aptasensor for the determination of the plasticizer bisphenol A (BPA) was developed. It is based on the use of gold nanoparticles (AuNPs) that are positively charged due to the modification with cysteamine which is cationic at near-neutral pH values. If aptamers are added to such AuNPs, aggregation occurs due to electrostatic interactions between the negatively-charged aptamers and the positively-charged AuNPs. This results in a color change of the AuNPs from red to blue. If a sample containing BPA is added to the anti-BPA aptamers, the anti-BPA aptamers undergo folding via an induced-fit binding mechanism. This is accompanied by a conformational change, which prevents the aptamer-induced aggregation and color change of AuNPs. The effect was exploited to design a colorimetric assay for BPA. Under optimum conditions, the absorbance ratio of A 527 /A 680 is linearly proportional to the BPA concentration in the range from 35 to 140 ng∙mL −1 , with a detection limit of 0.11 ng∙mL −1 . The method has been successfully applied to the determination of BPA in spiked tap water and gave recoveries between 91 and 106 %. Data were in full accordance with results obtained from HPLC. This assay is selective, easily performed, and in our perception represents a promising alternative to existing methods for rapid quantification of BPA. (author)

  18. Elaboration of Stable and Antibody Functionalized Positively Charged Colloids by Polyelectrolyte Complexation between Chitosan and Hyaluronic Acid

    Directory of Open Access Journals (Sweden)

    Ramona C. Polexe

    2013-07-01

    Full Text Available In this study, we describe the elaboration of multifunctional positively charged polyelectrolyte complex (PEC nanoparticles, designed to be stable at physiological salt concentration and pH, for effective targeted delivery. These nanoparticles were obtained by charge neutralization between chitosan (CS as polycation and hyaluronic acid (HA as polyanion. We showed that the course of the complexation process and the physico-chemical properties of the resulting colloids were impacted by (i internal parameters such as the Degree of Acetylation (DA, i.e., the molar ration of acetyl glucosamine residues and molar mass of CS, the HA molar mass and (ii external parameters like the charge mixing ratio and the polymer concentrations. As a result, nonstoichiometric colloidal PECs were obtained in water or PBS (pH 7.4 and remained stable over one month. The polymer interactions were characterized by thermal analysis (DSC and TGA and the morphology was studied by scanning electron microscopy. A model antibody, anti-ovalbumine (OVA immunoglobulin A (IgA was sorbed on the particle surface in water and PBS quantitatively in 4 h. The CS-HA/IgA nanoparticles average size was between 425–665 nm with a positive zeta potential. These results pointed out that CS-HA can be effective carriers for use in targeted drug delivery.

  19. Evidences from electron momentum spectroscopy for ultra-fast charge transfers and structural reorganizations in a floppy molecule: Ethanol

    International Nuclear Information System (INIS)

    Deleuze, Michael S; Hajgato, Balazs; Morini, Filippo

    2009-01-01

    Calculations of electron momentum distributions employing advanced Dyson orbital theories and statistical thermodynamics beyond the RRHO approximation fail to quantitatively reproduce the outermost momentum profile inferred from experiments on ethanol employing high resolution Electron Momentum Spectroscopy [1]. Study of the influence of nuclear dynamics in the initial ground state and final ionized state indicates that this discrepancy between theory and experiment reflects a charge transfer occurring during an ultra-fast dissociation of the ethanol radical cation into a methyl radical and H 2 C=O-H + .

  20. The Effect of Charge at the Surface of Silver Nanoparticles on Antimicrobial Activity against Gram-Positive and Gram-Negative Bacteria: A Preliminary Study

    International Nuclear Information System (INIS)

    Abbaszadegan, A.; Ghahramani, Y.; Nabavizadeh, M.; Gholami, A.; Hemmateenejad, I.; Dorostkar, S.; Sharghi, H.

    2014-01-01

    The bactericidal efficiency of various positively and negatively charged silver nanoparticles has been extensively evaluated in literature, but there is no report on efficacy of neutrally charged silver nanoparticles. The goal of this study is to evaluate the role of electrical charge at the surface of silver nanoparticles on antibacterial activity against a panel of microorganisms. Three different silver nanoparticles were synthesized by different methods, providing three different electrical surface charges (positive, neutral, and negative). The antibacterial activity of these nanoparticles was tested against gram-positive (i.e., Staphylococcus aureus, Streptococcus mutans, and Streptococcus pyogenes) and gram-negative (i.e., Escherichia coli and Proteus vulgaris) bacteria. Well diffusion and micro-dilution tests were used to evaluate the bactericidal activity of the nanoparticles. According to the obtained results, the positively-charged silver nanoparticles showed the highest bactericidal activity against all microorganisms tested. The negatively charged silver nanoparticles had the least and the neutral nanoparticles had intermediate antibacterial activity. The most resistant bacteria were Proteus vulgaris. We found that the surface charge of the silver nanoparticles was a significant factor affecting bactericidal activity on these surfaces. Although the positively charged nanoparticles showed the highest level of effectiveness against the organisms tested, the neutrally charged particles were also potent against most bacterial species.

  1. Discrete and continuum modeling of solvent effects in a twisted intramolecular charge transfer system: The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule.

    Science.gov (United States)

    Modesto-Costa, Lucas; Borges, Itamar

    2018-08-05

    The 4-N,N-dimethylaminobenzonitrile (DMABN) molecule is a prototypical system displaying twisted intramolecular (TICT) charge transfer effects. The ground and the first four electronic excited states (S 1 -S 4 ) in gas phase and upon solvation were studied. Charge transfer values as function of the torsion angle between the donor group (dimethylamine) and the acceptor moiety (benzonitrile) were explicitly computed. Potential energy curves were also obtained. The algebraic diagrammatic construction method at the second-order [ADC(2)] ab initio wave function was employed. Three solvents of increased polarities (benzene, DMSO and water) were investigated using discrete (average solvent electrostatic configuration - ASEC) and continuum (conductor-like screening model - COSMO) models. The results for the S 3 and S 4 excited states and the S 1 -S 4 charge transfer curves were not previously available in the literature. Electronic gas phase and solvent vertical spectra are in good agreement with previous theoretical and experimental results. In the twisted (90°) geometry the optical oscillator strengths have negligible values even for the S 2 bright state. Potential energy curves show two distinct pairs of curves intersecting at decreasing angles or not crossing in the more polar solvents. Charge transfer and electric dipole values allowed the rationalization of these results. The former effects are mostly independent of the solvent model and polarity. Although COSMO and ASEC solvent models mostly lead to similar results, there is an important difference: some crossings of the excitation energy curves appear only in the ASEC solvation model, which has important implications to the photochemistry of DMABN. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Radiographic study of bone deformans on charged condylar head position in TMJ arthrosis

    International Nuclear Information System (INIS)

    You, Dong Soo

    1983-01-01

    The author analyzed the morphologic changes of bone structure from 848 radiographics (424 joints) of 212 patients with temporomandibular joint arthrosis, which were obtained by the oblique-lateral transcranial projection and ortho pantomography. The interrelation of the bone changes and condylar head positions the results were as follows: 1. In the 212 patients with TMJ arthrosis, 210 patients (99.05%) show the condylar positional changes. Among them, 187 patients (89.05%) show the bone changes. 2. In TMJ arthrosis patients with bone changes, 108 patients (57.75%) show both the condylar positional changes and bone changes. 66 patients show the condylar positional changes bilaterally and bone changes unilaterally. On the other hand, 11 patients (5.88%) show the condylar positional changes unilaterally and bone change bilaterally. 3. The bone changes in the TMJ arthrosis patients with the condylar positional changes were as follows: There were the flattening of articular surface in 103 cases (26.55%) the erosion in 99 cases (25.52%), and the erosion in 88 cases (22.68%). There were not much differences among the three types of bone changes. And the deformity in 70 cases (18.04%), the sclerosis in 22 cases (5.67%), the marginal proliferation in 6 cases (1.55%) were seen. 4. The regions of bone changes in TMJ arthrosis patients with condylar positional changes were as follows: They occurred at the condyle head (51.04%), the articular eminence (39.20%) and the articular fossa (9.60%) in that order. The condylar positional changes and bone changes according to the regions were as follows: a) In the bone changes at the condylar head, the flattening (34.63%) was a most frequent finding and the deformity (27.63%) the erosion (34.63%) in the order. In the condylar positional changes, the downward positioning of condyle (41.44%) was a most frequent finding in the mouth closed state and the restricted movement within the articular fossa (35.46%) in the mouth open state. b) In

  3. Radiographic study of bone deformans on charged condylar head position in TMJ arthrosis

    Energy Technology Data Exchange (ETDEWEB)

    You, Dong Soo [Department of Oral Radiology, College of Dentistry, Seoul National University, Seoul (Korea, Republic of)

    1983-11-15

    The author analyzed the morphologic changes of bone structure from 848 radiographics (424 joints) of 212 patients with temporomandibular joint arthrosis, which were obtained by the oblique-lateral transcranial projection and ortho pantomography. The interrelation of the bone changes and condylar head positions the results were as follows: 1. In the 212 patients with TMJ arthrosis, 210 patients (99.05%) show the condylar positional changes. Among them, 187 patients (89.05%) show the bone changes. 2. In TMJ arthrosis patients with bone changes, 108 patients (57.75%) show both the condylar positional changes and bone changes. 66 patients show the condylar positional changes bilaterally and bone changes unilaterally. On the other hand, 11 patients (5.88%) show the condylar positional changes unilaterally and bone change bilaterally. 3. The bone changes in the TMJ arthrosis patients with the condylar positional changes were as follows: There were the flattening of articular surface in 103 cases (26.55%) the erosion in 99 cases (25.52%), and the erosion in 88 cases (22.68%). There were not much differences among the three types of bone changes. And the deformity in 70 cases (18.04%), the sclerosis in 22 cases (5.67%), the marginal proliferation in 6 cases (1.55%) were seen. 4. The regions of bone changes in TMJ arthrosis patients with condylar positional changes were as follows: They occurred at the condyle head (51.04%), the articular eminence (39.20%) and the articular fossa (9.60%) in that order. The condylar positional changes and bone changes according to the regions were as follows: a) In the bone changes at the condylar head, the flattening (34.63%) was a most frequent finding and the deformity (27.63%) the erosion (34.63%) in the order. In the condylar positional changes, the downward positioning of condyle (41.44%) was a most frequent finding in the mouth closed state and the restricted movement within the articular fossa (35.46%) in the mouth open state. b) In

  4. Applications of the quasi-elastic light scattering to the study of dynamic properties of charged macro-molecules

    International Nuclear Information System (INIS)

    Gouesin-Menez, Renee

    1979-01-01

    The object of this research thesis is to study the modifications of dynamic properties of a macromolecule under the influence of variations of its medium, by using a frequency analysis of the spectrum of light scattered by a solution of particles. Thus, an important part of this thesis addresses the study and development of the scattering method and of its analysis by 'photon pulses', and the development and adjustment of an electrophoretic device to study light scattering by molecules submitted to an electric field. Then, hydrodynamic characteristics of some macromolecules have been measured with or without electric field. The studied molecular systems have been: calibrated spheres of latex polystyrene, a globular protein (bovine serum albumin), a polysaccharide (under the form of a rigid short stick), a flexible linear polyelectrolyte (polymethacrylate), and two DNA samples

  5. Humic acid adsorption onto cationic cellulose nanofibers for bioinspired removal of copper( ii ) and a positively charged dye

    KAUST Repository

    Sehaqui, H.

    2015-01-01

    © The Royal Society of Chemistry. Waste pulp residues are herein exploited for the synthesis of a sorbent for humic acid (HA), which is a major water pollutant. Cellulose pulp was etherified with a quaternary ammonium salt in water thereby introducing positive charges onto the surface of the pulp fibers, and subsequently mechanically disintegrated into high surface area cellulose nanofibers (CNF). CNF with three different charge contents were produced and their adsorption capacity towards HA was investigated with UV-spectrophotometry, quartz crystal microbalance with dissipation, and ζ-potential measurements. Substantial coverage of the CNF surface with HA in a wide pH range led to a reversal of the positive ζ-potentials of CNF suspensions. The HA adsorption capacity and the kinetics of HA uptake were found to be promoted by both acidic pH conditions and the surface charge content of CNF. It is suggested that HA adsorption onto CNF depends on electrostatic interactions between the two components, as well as on the conformation of HA. At pH ∼ 6, up to 310 mg g-1 of HA were adsorbed by the functionalized CNF, a substantially higher capacity than that of previously reported HA sorbents in the literature. It is further shown that CNF-HA complexes could be freeze-dried into "soil-mimicking" porous foams having good capacity to capture Cu(ii) ions and positive dyes from contaminated water. Thus, the most abundant natural polymer, i.e., cellulose could effectively bind the most abundant natural organic matter for environmental remediation purpose.

  6. Memory for media: investigation of false memories for negatively and positively charged public events.

    Science.gov (United States)

    Porter, Stephen; Taylor, Kristian; Ten Brinke, Leanne

    2008-01-01

    Despite a large body of false memory research, little has addressed the potential influence of an event's emotional content on susceptibility to false recollections. The Paradoxical Negative Emotion (PNE) hypothesis predicts that negative emotion generally facilitates memory but also heightens susceptibility to false memories. Participants were asked whether they could recall 20 "widely publicised" public events (half fictitious) ranging in emotional valence, with or without visual cues. Participants recalled a greater number of true negative events (M=3.31/5) than true positive (M=2.61/5) events. Nearly everyone (95%) came to recall at least one false event (M=2.15 false events recalled). Further, more than twice as many participants recalled any false negative (90%) compared to false positive (41.7%) events. Negative events, in general, were associated with more detailed memories and false negative event memories were more detailed than false positive event memories. Higher dissociation scores were associated with false recollections of negative events, specifically.

  7. Charge Inversion of Phospholipids by Dimetal Complexes for Positive Ion-Mode Electrospray Ionization Mass Spectrometry Analysis

    DEFF Research Database (Denmark)

    Svane, Simon; Gorshkov, Vladimir; Kjeldsen, Frank

    2015-01-01

    charges per phosphate group. Three different phosphoinositide phosphates (mono-, di-, and triphosphorylated inositides), a phosphatidic acid, a phosphatidylcholine, a phosphatidylethanolamine, and a phosphatidylglycerol were investigated. The intensities obtained in positive ion-mode of phosphoinositide...... phosphates and phosphatidic acid bound to {LGa2}(5+) were between 2.5- and 116-fold higher than that of the unmodified lipids in the negative ion-mode. Native phosphoinositide ions yielded upon CID in the negative ion-mode predominantly product ions due to losses of H3PO4, PO3(-) and H2O. In comparison, CID...

  8. Role of uniform pore structure and high positive charges in the arsenate adsorption performance of Al13-modified montmorillonite

    International Nuclear Information System (INIS)

    Zhao, Shou; Feng, Chenghong; Huang, Xiangning; Li, Baohua; Niu, Junfeng; Shen, Zhenyao

    2012-01-01

    Highlights: ► Al 13 modification changes As(V) sorption mechanism of montmorillonites. ► Intercalated ion charges mainly affects As(V) adsorption kinetics. ► Uniform pore structure exhibit more excellent As(V) adsorption performance. - Abstract: Four modified montmorillonite adsorbents with varied Al 13 contents (i.e., Na-Mont, AC-Mont, PAC 20 -Mont, and Al 13 -Mont) were synthesized and characterized by N 2 adsorption/desorption, X-ray diffraction, and Fourier-transform infrared analyses. The arsenate adsorption performance of the four adsorbents were also investigated to determine the role of intercalated Al 13 , especially its high purity, high positive charge (+7), and special Keggin structure. With increased Al 13 content, the physicochemical properties (e.g., surface area, structural uniformity, basal spacing, and pore volume) and adsorption performance of the modified montmorillonites were significantly but disproportionately improved. The adsorption data well fitted the Freundlich and Redlich–Peterson isotherm model, whereas the kinetic data better correlated with the pseudo-second-order kinetic model. The arsenate sorption mechanism of the montmorillonites changed from physical to chemisorption after intercalation with Al 13 . Increasing charges of the intercalated ions enhanced the arsenate adsorption kinetics, but had minimal effect on the structural changes of the montmorillonites. The uniform pore structure formed by intercalation with high-purity Al 13 greatly enhanced the pore diffusion and adsorption rate of arsenate, resulting in the high adsorption performance of Al 13 -Mont.

  9. Effect of nuclear shielding in collision of positive charged helium ions with helium atoms

    Science.gov (United States)

    Ghavaminia, Hoda; Ghavaminia, Shirin

    2018-03-01

    Differential in angle and absolute cross sections in energy of the scattered particles are obtained for single charge exchange in ^3He^+-^4He collisions by means of the four body boundary-corrected first Born approximation (CB1-4B). The quantum-mechanical post and prior transition amplitudes are derived in terms of two-dimensional real integrals in the case of the prior form and five-dimensional quadratures for the post form. The effect of the dynamic electron correlation through the complete perturbation potential and the nuclear-screening influence of the passive electrons on the electron capture process is investigated. The results obtained in the CB1-4B method are compared with the available experimental data. For differential cross sections, the present results are in better agreement with experimental data than other theoretical data at extreme forward scattering angles. The integral cross sections are in excellent agreement with the experiment. Also, total cross sections for single electron capture, has been investigated using the classical trajectory Monte Carlo method. The present calculated results are found to be in an excellent agreement with the experimental data.

  10. High Efficiency, Low EMI and Positioning Tolerant Wireless Charging of EVs

    Energy Technology Data Exchange (ETDEWEB)

    Chabaan, Rakan [Hyundai American Technical Center Inc. (HATCI), Superior Twp, MI (United States)

    2017-12-01

    The objective of this project is to develop, implement, and demonstrate a wireless power transfer (WPT) system that is capable of the following metrics: Total system efficiencies of more than 85 percent with minimum 20 cm coil-to-coil gap; System output power at least 6.6 kW; but design system up to 19.2 kW for future higher power study; Maximum lateral positioning tolerance achievable while meeting regulatory emission guidelines.

  11. Study of Doubly Charged Delta Baryons in Collisions of Copper Nuclei at the Relativistic Heavy Ion Collider

    Science.gov (United States)

    2017-05-22

    connecting the three quarks. Composite particles composed of partons are known as “hadrons” and must have a neutral color charge. There are six... neutral charge of neutrons. The up quark has positive charge equivalent to two-thirds the charge of an electron, and the down quark has negative...known as “heavy ions.” An ion is an atom or molecule with net electric charge, bare nuclei have a large positive charge due to the absence of

  12. General Method to Determine the Flux of Charged Molecules through Nanopores Applied to β-Lactamase Inhibitors and OmpF.

    Science.gov (United States)

    Ghai, Ishan; Pira, Alessandro; Scorciapino, Mariano Andrea; Bodrenko, Igor; Benier, Lorraine; Ceccarelli, Matteo; Winterhalter, Mathias; Wagner, Richard

    2017-03-16

    A major challenge in the discovery of the new antibiotics against Gram-negative bacteria is to achieve sufficiently fast permeation in order to avoid high doses causing toxic side effects. So far, suitable assays for quantifying the uptake of charged antibiotics into bacteria are lacking. We apply an electrophysiological zero-current assay using concentration gradients of β-lactamase inhibitors combined with single-channel conductance to quantify their flux rates through OmpF. Molecular dynamic simulations provide in addition details on the interactions between the nanopore wall and the charged solutes. In particular, the interaction barrier for three β-lactamase inhibitors is surprisingly as low as 3-5 kcal/mol and only slightly above the diffusion barrier of ions such as chloride. Within our macroscopic constant field model, we determine that at a zero-membrane potential a concentration gradient of 10 μM of avibactam, sulbactam, or tazobactam can create flux rates of roughly 620 molecules/s per OmpF trimer.

  13. Conformation-related exciton localization and charge-pair formation in polythiophenes: ensemble and single-molecule study.

    Science.gov (United States)

    Sugimoto, Toshikazu; Habuchi, Satoshi; Ogino, Kenji; Vacha, Martin

    2009-09-10

    We study conformation-dependent photophysical properties of polythiophene (PT) by molecular dynamics simulations and by ensemble and single-molecule optical experiments. We use a graft copolymer consisting of a polythiophene backbone and long polystyrene branches and compare its properties with those obtained on the same polythiophene derivative without the side chains. Coarse-grain molecular dynamics simulations show that in a poor solvent, the PT without the side chains (PT-R) forms a globulelike conformation in which distances between any two conjugated segments on the chain are within the Forster radius for efficient energy transfer. In the PT with the polystyrene branches (PT-PS), the polymer main PT chain retains an extended coillike conformation, even in a poor solvent, and the calculated distances between conjugated segments favor energy transfer only between a few neighboring chromophores. The theoretical predictions are confirmed by measurements of fluorescence anisotropy and fluorescence blinking of the polymers' single chains. High anisotropy ratios and two-state blinking in PT-R are due to localization of the exciton on a single conjugated segment. These signatures of exciton localization are absent in single chains of PT-PS. Electric-field-induced quenching measured as a function of concentration of PT dispersed in an inert matrix showed that in well-isolated chains of PT-PS, the exciton dissociation is an intrachain process and that aggregation of the PT-R chains causes an increase in quenching due to the onset of interchain interactions. Measurements of the field-induced quenching on single chains indicate that in PT-R, the exciton dissociation is a slower process that takes place only after the exciton is localized on one conjugated segment.

  14. Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

    Science.gov (United States)

    Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

    2010-01-01

    We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than

  15. Investigation of the electrochemical and electrocatalytic behavior of positively charged gold nanoparticle and L-cysteine film on an Au electrode

    International Nuclear Information System (INIS)

    Zhang Lingyan; Yuan Ruo; Chai Yaqing; Li Xuelian

    2007-01-01

    Positively charged gold nanoparticle (positively charged nano-Au), which was prepared, characterized by ξ-potential and transmission electron microscopy (TEM) was used in combination with L-cysteine to fabricate a modified electrode for electrocatalytic reaction of biomolecules. Compared with electrodes modified by negatively charged gold nanoparticle/L-cysteine, or L-cysteine alone, the electrode modified by the positively charged gold nanoparticle/L-cysteine exhibited excellent electrochemical behavior toward the oxidation of biomolecules such as ascorbic acid, dopamine and hydrogen peroxide. Moreover, the proposed mechanism for electrocatalytic response of positively charged gold nanoparticle was discussed. The immunosensor showed a specific to ascorbic acid in the range 5.1 x 10 -7 -6.7 x 10 -4 M and a low detection limit of 1.5 x 10 -7 M. The experimental results demonstrate that positively charged gold nanoparticle have more efficient electrocatalytic reaction than negatively charged gold nanoparticle, which opens up new approach for fabricating sensor

  16. The Positively Charged Hyperbranched Polymers with Tunable Fluorescence and the Cell Imaging Application.

    Science.gov (United States)

    Ma, Hengchang; Qin, Yanfang; Yang, Zenming; Yang, Manyi; Ma, Yucheng; Yin, Pei; Yang, Yuan; Wang, Tao; Lei, Ziqiang; Yao, Xiaoqiang

    2018-04-25

    Fluorescence-tunable materials are becoming increasingly attractive for their potential application in optics, electronics, and biomedical technology. Herein, a multi-color molecular pixel system is realized using simple copolymerization method. Bleeding both of complementary colors from blue and yellow fluorescence segments, reproduced a serious multicolor fluorescence materials. Interestingly, the emission colors of the polymers can be fine-tuned in solid state, solution phase, and in hydrogel state. More importantly, the positive fluorescent polymers exhibited cell-membrane permeable ability, and were found to accumulate on the cell nucleus, exhibiting remarkable selectivity to give bright fluorescence. The DNA/RNA selectivity experiments in vitro and in vivo verified that [tris(4-(pyridin-4-yl)phenyl)amine]-[1,8-dibromooctane] (TPPA-DBO) has prominent selectivity to DNA over RNA inside cells.

  17. Supplementary Material for: Measurements of Positively Charged Ions in Premixed Methane-Oxygen Atmospheric Flames

    KAUST Repository

    Alquaity, Awad B. S.

    2017-01-01

    Cations and anions are formed as a result of chemi-ionization processes in combustion systems. Electric fields can be applied to reduce emissions and improve combustion efficiency by active control of the combustion process. Detailed flame ion chemistry models are needed to understand and predict the effect of external electric fields on combustion plasmas. In this work, a molecular beam mass spectrometer (MBMS) is utilized to measure ion concentration profiles in premixed methane–oxygen argon burner-stabilized atmospheric flames. Lean and stoichiometric flames are considered to assess the dependence of ion chemistry on flame stoichiometry. Relative ion concentration profiles are compared with numerical simulations using various temperature profiles, and good qualitative agreement was observed for the stoichiometric flame. However, for the lean flame, numerical simulations misrepresent the spatial distribution of selected ions greatly. Three modifications are suggested to enhance the ion mechanism and improve the agreement between experiments and simulations. The first two modifications comprise the addition of anion detachment reactions to increase anion recombination at low temperatures. The third modification involves restoring a detachment reaction to its original irreversible form. To our knowledge, this work presents the first detailed measurements of cations and flame temperature in canonical methane–oxygen-argon atmospheric flat flames. The positive ion profiles reported here may be useful to validate and improve ion chemistry models for methane-oxygen flames.

  18. Measurements of Positively Charged Ions in Premixed Methane-Oxygen Atmospheric Flames

    KAUST Repository

    Alquaity, Awad

    2016-08-22

    Cations and anions are formed as a result of chemi-ionization processes in combustion systems. Electric fields can be applied to reduce emissions and improve combustion efficiency by active control of the combustion process. Detailed flame ion chemistry models are needed to understand and predict the effect of external electric fields on combustion plasmas. In this work, a molecular beam mass spectrometer (MBMS) is utilized to measure ion concentration profiles in premixed methane–oxygen argon burner-stabilized atmospheric flames. Lean and stoichiometric flames are considered to assess the dependence of ion chemistry on flame stoichiometry. Relative ion concentration profiles are compared with numerical simulations using various temperature profiles, and good qualitative agreement was observed for the stoichiometric flame. However, for the lean flame, numerical simulations misrepresent the spatial distribution of selected ions greatly. Three modifications are suggested to enhance the ion mechanism and improve the agreement between experiments and simulations. The first two modifications comprise the addition of anion detachment reactions to increase anion recombination at low temperatures. The third modification involves restoring a detachment reaction to its original irreversible form. To our knowledge, this work presents the first detailed measurements of cations and flame temperature in canonical methane–oxygen-argon atmospheric flat flames. The positive ion profiles reported here may be useful to validate and improve ion chemistry models for methane-oxygen flames.

  19. Influence of joint direction and position of explosive charge on fragmentation

    International Nuclear Information System (INIS)

    Hafsaoui, Abdellah; Talhi, Korichi

    2009-01-01

    Although researchers have realized varying degrees of success in small-scale physical in situ testing, most will agree that the greatest uncertainty stems from the uncontrollable field variables. Given the diverse nature of field conditions encountered, there exists no reliable and proven method of predicting fragmentation. Due to the lack of adequate field controls, it is unlikely that a universal physical model will ever be developed for all blasting. This paper presents the results of a test conducted at the Hadjar Essoud quarry to investigate the problems associated with the discontinuities in the rock, which are among the factors causing the reduction of the resistance of the rocks to the explosive. Nevertheless, the distance between the joints, their dip and strike, and the position of the detonator play a significant role in the final fragmentation of the rock. In this work, we studied the role of the abovementioned factors on models of limestone rock of 150 X 375 X 450 mm. Accurate measurement of blast, fragmentation is important in mining and quarrying operations, in monitoring blasts, and optimizing their design. We shall use the Kuznetsov-Rammler method to measure fragmentation. It shows great potential as a practical aid to predict and control the quality of the fragmented material in the Hadjar Essoud quarry. (author)

  20. Smart SERS Hot Spots: Single Molecules Can Be Positioned in a Plasmonic Nanojunction Using Host-Guest Chemistry.

    Science.gov (United States)

    Kim, Nam Hoon; Hwang, Wooseup; Baek, Kangkyun; Rohman, Md Rumum; Kim, Jeehong; Kim, Hyun Woo; Mun, Jungho; Lee, So Young; Yun, Gyeongwon; Murray, James; Ha, Ji Won; Rho, Junsuk; Moskovits, Martin; Kim, Kimoon

    2018-04-04

    Single-molecule surface-enhanced Raman spectroscopy (SERS) offers new opportunities for exploring the complex chemical and biological processes that cannot be easily probed using ensemble techniques. However, the ability to place the single molecule of interest reliably within a hot spot, to enable its analysis at the single-molecule level, remains challenging. Here we describe a novel strategy for locating and securing a single target analyte in a SERS hot spot at a plasmonic nanojunction. The "smart" hot spot was generated by employing a thiol-functionalized cucurbit[6]uril (CB[6]) as a molecular spacer linking a silver nanoparticle to a metal substrate. This approach also permits one to study molecules chemically reluctant to enter the hot spot, by conjugating them to a moiety, such as spermine, that has a high affinity for CB[6]. The hot spot can accommodate at most a few, and often only a single, analyte molecule. Bianalyte experiments revealed that one can reproducibly treat the SERS substrate such that 96% of the hot spots contain a single analyte molecule. Furthermore, by utilizing a series of molecules each consisting of spermine bound to perylene bisimide, a bright SERS molecule, with polymethylene linkers of varying lengths, the SERS intensity as a function of distance from the center of the hot spot could be measured. The SERS enhancement was found to decrease as 1 over the square of the distance from the center of the hot spot, and the single-molecule SERS cross sections were found to increase with AgNP diameter.

  1. Responses and mechanisms of positive electron affinity molecules in the N2 mode of the thermionic ionization detector and the electron-capture detector

    International Nuclear Information System (INIS)

    Jones, C.S.

    1989-01-01

    Very little knowledge has been acquired in the past on the mechanistic pathway by which molecules respond in the N 2 mode of the thermionic ionization detector. An attempt is made here to elucidate the response mechanism of the detector. The basic response mechanisms are known for the electron capture detector, and an attempt is made to identify the certain mechanism by which selected molecules respond. The resonance electron capture rate constant has been believed to be temperature independent, and investigations of the temperature dependence of electron capture responses are presented. Mechanisms for the N 2 mode of the thermionic ionization detector have been proposed by examining the detector response to positive electron affinity molecules and by measurement of the ions produced by the detector. Electron capture mechanisms for selected molecules have been proposed by examining their temperature dependent responses in the electron capture detector and negative ion mass spectra of the samples. In studies of the resonance electron capture rate constant, the relative responses of selected positive electron affinity molecules and their temperature dependent responses were investigated. Positive electron affinity did not guarantee large responses in the N 2 mode thermionic ionization detector. High mass ions were measured following ionization of samples in the detector. Responses in the electron capture detector varied with temperature and electron affinity

  2. Measurement of Production Properties of Positively Charged Kaons in Proton-Carbon Interactions at 31 GeV/c

    CERN Document Server

    Abgrall, N.; Anticic, T.; Antoniou, N.; Argyriades, J.; Baatar, B.; Blondel, A.; Blumer, J.; Bogusz, M.; Boldizsar, L.; Bravar, A.; Brooks, W.; Brzychczyk, J.; Bubak, A.; Bunyatov, S.A.; Busygina, O.; Cetner, T.; Choi, K.U.; Christakoglou, P.; Czopowicz, T.; Davis, N.; Diakonos, F.; Di Luise, S.; Dominik, W.; Dumarchez, J.; Engel, R.; Ereditato, A.; Esposito, L.S.; Feofilov, G.A.; Fodor, Z.; Ferrero, A.; Fulop, A.; Garrido, X.; Gazdzicki, M.; Golubeva, M.; Grebieszkow, K.; Grzeszczuk, A.; Guber, F.; Haesler, A.; Hakobyan, H.; Hasegawa, T.; Idczak, R.; Ivanov, Y.; Ivashkin, A.; Kadija, K.; Kapoyannis, A.; Katrynska, N.; Kielczewska, D.; Kikola, D.; Kim, J.H.; Kirejczyk, M.; Kisiel, J.; Kobayashi, T.; Kochebina, O.; Kolesnikov, V.I.; Kolev, D.; Kondratiev, V.P.; Korzenev, A.; Kowalski, S.; Krasnoperov, A.; Kuleshov, S.; Kurepin, A.; Lacey, R.; Lagoda, J.; Laszlo, A.; Lyubushkin, V.V.; Mackowiak-Pawlowska, M.; Majka, Z.; Malakhov, A.I.; Marchionni, A.; Marcinek, A.; Maris, I.; Marin, V.; Matulewicz, T.; Matveev, V.; Melkumov, G.L.; Meregaglia, A.; Messina, M.; Mrowczynski, St.; Murphy, S.; Nakadaira, T.; Nishikawa, K.; Palczewski, T.; Palla, G.; Panagiotou, A.D.; Paul, T.; Peryt, W.; Petukhov, O.; Planeta, R.; Pluta, J.; Popov, B.A.; Posiadala, M.; Pulawski, S.; Rauch, W.; Ravonel, M.; Renfordt, R.; Robert, A.; Rohrich, D.; Rondio, E.; Rossi, B.; Roth, M.; Rubbia, A.; Rybczynski, M.; Sadovsky, A.; Sakashita, K.; Sekiguchi, T.; Seyboth, P.; Shibata, M.; Skrzypczak, E.; Slodkowski, M.; Staszel, P.; Stefanek, G.; Stepaniak, J.; Strabel, C.; Strobele, H.; Susa, T.; Szaflik, P.; Szuba, M.; Tada, M.; Taranenko, A.; Tereshchenko, V.; Tsenov, R.; Turko, L.; Ulrich, R.; Unger, M.; Vassiliou, M.; Veberic, D.; Vechernin, V.V.; Vesztergombi, G.; Wilczek, A.; Wlodarczyk, Z.; Wojtaszek-Szwarc, A.; Yi, J.G.; Yoo, I.K.; Zambelli, L.; Zipper, W.

    2012-01-01

    Spectra of positively charged kaons in p+C interactions at 31 GeV/c were measured with the NA61/SHINE spectrometer at the CERN SPS. The analysis is based on the full set of data collected in 2007 with a graphite target with a thickness of 4% of a nuclear interaction length. Interaction cross sections and charged pion spectra were already measured using the same set of data. These new measurements in combination with the published ones are required to improve predictions of the neutrino flux for the T2K long baseline neutrino oscillation experiment in Japan. In particular, the knowledge of kaon production is crucial for precisely predicting the intrinsic electron neutrino component and the high energy tail of the T2K beam. The results are presented as a function of laboratory momentum in 2 intervals of the laboratory polar angle covering the range from 20 up to 240 mrad. The kaon spectra are compared with predictions of several hadron production models. Using the published...

  3. Approximate energies and thermal properties of a position-dependent mass charged particle under external magnetic fields

    Institute of Scientific and Technical Information of China (English)

    M Eshghi; H Mehraban; S M Ikhdair

    2017-01-01

    We solve the Schr(o)dinger equation with a position-dependent mass (PDM) charged particle interacted via the superposition of the Morse-plus-Coulomb potentials and is under the influence of external magnetic and Aharonov-Bohm (AB) flux fields.The nonrelativistic bound state energies together with their wave functions are calculated for two spatially-dependent mass distribution functions.We also study the thermal quantifies of such a system.Further,the canonical formalism is used to compute various thermodynamic variables for second choosing mass by using the Gibbs formalism.We give plots for energy states as a function of various physical parameters.The behavior of the internal energy,specific heat,and entropy as functions of temperature and mass density parameter in the inverse-square mass case for different values of magnetic field are shown.

  4. Approximate energies and thermal properties of a position-dependent mass charged particle under external magnetic fields

    International Nuclear Information System (INIS)

    Eshghi, M; Mehraban, H; Ikhdair, S M

    2017-01-01

    We solve the Schrödinger equation with a position-dependent mass (PDM) charged particle interacted via the superposition of the Morse-plus-Coulomb potentials and is under the influence of external magnetic and Aharonov–Bohm (AB) flux fields. The nonrelativistic bound state energies together with their wave functions are calculated for two spatially-dependent mass distribution functions. We also study the thermal quantities of such a system. Further, the canonical formalism is used to compute various thermodynamic variables for second choosing mass by using the Gibbs formalism. We give plots for energy states as a function of various physical parameters. The behavior of the internal energy, specific heat, and entropy as functions of temperature and mass density parameter in the inverse-square mass case for different values of magnetic field are shown. (paper)

  5. Development of mini linac-based positron source and an efficient positronium convertor for positively charged antihydrogen production

    Science.gov (United States)

    Muranaka, T.; Debu, P.; Dupré, P.; Liszkay, L.; Mansoulie, B.; Pérez, P.; Rey, J. M.; Ruiz, N.; Sacquin, Y.; Crivelli, P.; Gendotti, U.; Rubbia, A.

    2010-04-01

    We have installed in Saclay a facility for an intense positron source in November 2008. It is based on a compact 5.5 MeV electron linac connected to a reaction chamber with a tungsten target inside to produce positrons via pair production. The expected production rate for fast positrons is 5·1011 per second. The study of moderation of fast positrons and the construction of a slow positron trap are underway. In parallel, we have investigated an efficient positron-positronium convertor using porous silica materials. These studies are parts of a project to produce positively charged antihydrogen ions aiming to demonstrate the feasibility of a free fall antigravity measurement of neutral antihydrogen.

  6. Development of mini linac-based positron source and an efficient positronium convertor for positively charged antihydrogen production

    International Nuclear Information System (INIS)

    Muranaka, T; Debu, P; Dupre, P; Liszkay, L; Mansoulie, B; Perez, P; Rey, J M; Ruiz, N; Sacquin, Y; Crivelli, P; Gendotti, U; Rubbia, A

    2010-01-01

    We have installed in Saclay a facility for an intense positron source in November 2008. It is based on a compact 5.5 MeV electron linac connected to a reaction chamber with a tungsten target inside to produce positrons via pair production. The expected production rate for fast positrons is 5·10 11 per second. The study of moderation of fast positrons and the construction of a slow positron trap are underway. In parallel, we have investigated an efficient positron-positronium convertor using porous silica materials. These studies are parts of a project to produce positively charged antihydrogen ions aiming to demonstrate the feasibility of a free fall antigravity measurement of neutral antihydrogen.

  7. Development of mini linac-based positron source and an efficient positronium convertor for positively charged antihydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Muranaka, T; Debu, P; Dupre, P; Liszkay, L; Mansoulie, B; Perez, P; Rey, J M; Ruiz, N; Sacquin, Y [Irfu, CEA-Saclay, F-91191 Gif-sur-Yvette Cedex (France); Crivelli, P; Gendotti, U; Rubbia, A, E-mail: tomoko.muranaka@cea.f [Institut fuer TelichenPhysik, ETHZ, CH-8093 Zuerich (Switzerland)

    2010-04-01

    We have installed in Saclay a facility for an intense positron source in November 2008. It is based on a compact 5.5 MeV electron linac connected to a reaction chamber with a tungsten target inside to produce positrons via pair production. The expected production rate for fast positrons is 5{center_dot}10{sup 11} per second. The study of moderation of fast positrons and the construction of a slow positron trap are underway. In parallel, we have investigated an efficient positron-positronium convertor using porous silica materials. These studies are parts of a project to produce positively charged antihydrogen ions aiming to demonstrate the feasibility of a free fall antigravity measurement of neutral antihydrogen.

  8. Long-Term Charge/Discharge Cycling Stability of MnO2 Aqueous Supercapacitor under Positive Polarization

    KAUST Repository

    Ataherian, Fatemeh

    2011-01-01

    The long-term charge/discharge cycling stability of MnO 2 electrode under positive polarization in aqueous KCl electrolyte has been studied over different potential windows spanning from the open circuit potential to varied higher-end potential limited by O 2 evolution. Cycling up to 1.2 V (vs Ag/AgCl (aq)) causes partial (35) capacitance fading to a plateau value within the initial cycles, accompanied by morphological reconstruction, reduction of surface Mn ions and oxygen evolution. The surface Mn-ion reduction has been attributed to a two-step oxidation-reduction mechanism involving OH oxidation in electrolyte, based on electrochemical analysis. When cycling potential extends to 1.4 V, extensive oxygen evolution takes place. The combination of surface passivation of current collector and extensive gas bubbling, which deteriorates electrical contact among the constituent particles within the electrode, results in further monotonic capacitance reduction. © 2011 The Electrochemical Society.

  9. Enhancement of charge transport properties of small molecule semiconductors by controlling fluorine substitution and effects on photovoltaic properties of organic solar cells and perovskite solar cells.

    Science.gov (United States)

    Yun, Jae Hoon; Park, Sungmin; Heo, Jin Hyuck; Lee, Hyo-Sang; Yoon, Seongwon; Kang, Jinback; Im, Sang Hyuk; Kim, Hyunjung; Lee, Wonmok; Kim, BongSoo; Ko, Min Jae; Chung, Dae Sung; Son, Hae Jung

    2016-11-01

    We prepared a series of small molecules based on 7,7'-(4,4-bis(2-ethylhexyl)-4 H -silolo[3,2- b :4,5- b ']dithiophene-2,6-diyl)bis(4-(5'-hexyl-[2,2'-bithiophene]-5-yl)benzo[ c ][1,2,5]thiadiazole) with different fluorine substitution patterns ( 0F-4F ). Depending on symmetricity and numbers of fluorine atoms incorporated in the benzo[ c ][1,2,5]thiadiazole unit, they show very different optical and morphological properties in a film. 2F and 4F , which featured symmetric and even-numbered fluorine substitution patterns, display improved molecular packing structures and higher crystalline properties in a film compared with 1F and 3F and thus, 2F achieved the highest OTFT mobility, which is followed by 4F . In the bulk heterojunction solar cell fabricated with PC 71 BM, 2F achieves the highest photovoltaic performance with an 8.14% efficiency and 0F shows the lowest efficiency of 1.28%. Moreover, the planar-type perovskite solar cell (PSC) prepared with 2F as a dopant-free hole transport material shows a high power conversion efficiency of 14.5% due to its high charge transporting properties, which were significantly improved compared with the corresponding PSC device obtained from 0F (8.5%). From the studies, it is demonstrated that low variation in the local dipole moment and the narrow distribution of 2F conformers make intermolecular interactions favorable, which may effectively drive crystal formations in the solid state and thus, higher charge transport properties compared with 1F and 3F .

  10. Formation of H- ions via vibrational excited molecules produced from recombinative wall desorption of H atoms in a low-pressure H/sub 2/ positive column

    NARCIS (Netherlands)

    Amorim, J.; Loureiro, J.; Schram, D.C.

    2001-01-01

    Recombinative wall desorption of hydrogen atoms in a low-pressure hydrogen positive column leading to formation of H/sub 2/ (X/sup 1/ Sigma /sub g//sup +/, v) molecules in optimum levels for H/sup -/ production by dissociative attachment is investigated. We employed a kinetic model that solves the

  11. Effect of positively charged short peptides on stability of cubic phases of monoolein/dioleoylphosphatidic acid mixtures.

    Science.gov (United States)

    Masum, Shah Md; Li, Shu Jie; Awad, Tarek S; Yamazaki, Masahito

    2005-06-07

    To elucidate the stability and phase transition of cubic phases of biomembranes with infinite periodic minimal surface is indispensable from biological and physicochemical aspects. In this report, we investigated the effect of positively charged peptide-3K (LLKKK) and poly(L-lysine) on the phase stability of monoolein (MO) membranes containing negatively charged dioleoylphosphatidic acid (DOPA) (i.e., DOPA/MO membranes) using small-angle X-ray scattering. At first, the effect of peptide-3K on 10% DOPA/90% MO membrane in excess water, which is in the Q229 phase, was investigated. At 3.4 mM peptide-3K, a Q229 to Q230 phase transition occurred, and at >3.4 mM peptide-3K, the membrane was in the Q230 phase. Poly(L-lysine) (M(w) 1K-4K) also induced the Q230 phase, but peptide-2K (LLKK) could not induce it in the same membrane. We also investigated the effect of peptide-3K on the multilamellar vesicle (MLV) of 25% DOPA/75% MO membrane, which is in L(alpha) phase. In the absence of peptide, the spacing of MLV was very large (11.3 nm), but at > or = 8 mM peptide-3K, it greatly decreased to a constant value (5.2 nm), irrespective of the peptide concentration, indicating that peptide-3K and the membranes form an electrostatically stabilized aggregation with low water content. Poly(L-lysine) also decreased greatly the spacing of the 25% DOPA/75% MO MLV, indicating the formation of a similar aggregation. To compare the effects of peptide-3K and poly(L-lysine) with that of osmotic stress on stability of the cubic phase, we investigated the effect of poly(ethylene glycol) with molecular weight 7500 (PEG-6K) on the phase stability of 10% DOPA/90% MO membrane. With an increase in PEG-6K concentration, i.e., with an increase in osmotic stress, the most stable phase changed as follows; Q229 (Schwartz's P surface) --> Q224 (D) --> Q230 (G). On the basis of these results, we discuss the mechanism of the effects of the positively charged short peptides (peptide-3K) and poly

  12. Electron emission following collisions between multi-charged ions and D{sub 2} molecules; Etude de l'emission electronique induite par impact d'ion multicharge sur la molecule D{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Laurent, G

    2004-05-15

    Dissociative ionisation mechanisms induced in collisions involving a highly charged ion (S{sup 15+}, 13.6 MeV/u) and a molecular deuterium target, have been studied through momentum vector correlations of both the D{sup +} fragments and the electrons produced. An experimental apparatus has been developed in order to detect in coincidence all the charged particles produced during the collision. The measurement of their momentum vectors, which allows one to determine both their kinetic energy and direction of emission with respect to the projectile one, combines Time of Flight, Position Sensitive Detection, and multi-coincidence techniques. The correlation of the fragment and electron kinetic energies enables not only to determine branching ratios between the dissociative ionisation pathways, but also to separate unambiguously kinetic energy distributions of fragments associated to each process. Finally, the angular distributions of ejected electrons, as a function of the orientation of the molecular axis with respect to the projectile direction, are deduced from the spatial correlation. Measurements are compared to theoretical angular distributions obtained using the CDW-EIS (Continuum Distorted Wave-Eikonal Initial State) method. (author)

  13. Theoretical study of stability and charge-transport properties of coronene molecule and some of its halogenated derivatives: A path to ambipolar organic-based materials?

    Energy Technology Data Exchange (ETDEWEB)

    Sancho-García, J. C., E-mail: jc.sancho@ua.es; Pérez-Jiménez, A. J., E-mail: aj.perez@ua.es [Departamento de Química Física, Universidad de Alicante, E-03080 Alicante (Spain)

    2014-10-07

    We have carefully investigated the structural and electronic properties of coronene and some of its fluorinated and chlorinated derivatives, including full periphery substitution, as well as the preferred orientation of the non-covalent dimer structures subsequently formed. We have paid particular attention to a set of methodological details, to first obtain single-molecule magnitudes as accurately as possible, including next the use of modern dispersion-corrected methods to tackle the corresponding non-covalently bound dimers. Generally speaking, this class of compounds is expected to self-assembly in neighboring π-stacks with dimer stabilization energies ranging from –20 to –30 kcal mol{sup −1} at close distances around 3.0–3.3 Å. Then, in a further step, we have also calculated hole and electron transfer rates of some suitable candidates for ambipolar materials, and corresponding charge mobility values, which are known to critically depend on the supramolecular organization of the samples. For coronene and per-fluorinated coronene, we have found high values for their hopping rates, although slightly smaller for the latter due to an increase (decrease) of the reorganization energies (electronic couplings)

  14. Simulation study on discrete charge effects of SiNW biosensors according to bound target position using a 3D TCAD simulator.

    Science.gov (United States)

    Chung, In-Young; Jang, Hyeri; Lee, Jieun; Moon, Hyunggeun; Seo, Sung Min; Kim, Dae Hwan

    2012-02-17

    We introduce a simulation method for the biosensor environment which treats the semiconductor and the electrolyte region together, using the well-established semiconductor 3D TCAD simulator tool. Using this simulation method, we conduct electrostatic simulations of SiNW biosensors with a more realistic target charge model where the target is described as a charged cube, randomly located across the nanowire surface, and analyze the Coulomb effect on the SiNW FET according to the position and distribution of the target charges. The simulation results show the considerable variation in the SiNW current according to the bound target positions, and also the dependence of conductance modulation on the polarity of target charges. This simulation method and the results can be utilized for analysis of the properties and behavior of the biosensor device, such as the sensing limit or the sensing resolution.

  15. Simulation study on discrete charge effects of SiNW biosensors according to bound target position using a 3D TCAD simulator

    International Nuclear Information System (INIS)

    Chung, In-Young; Moon, Hyunggeun; Jang, Hyeri; Lee, Jieun; Kim, Dae Hwan; Seo, Sung Min

    2012-01-01

    We introduce a simulation method for the biosensor environment which treats the semiconductor and the electrolyte region together, using the well-established semiconductor 3D TCAD simulator tool. Using this simulation method, we conduct electrostatic simulations of SiNW biosensors with a more realistic target charge model where the target is described as a charged cube, randomly located across the nanowire surface, and analyze the Coulomb effect on the SiNW FET according to the position and distribution of the target charges. The simulation results show the considerable variation in the SiNW current according to the bound target positions, and also the dependence of conductance modulation on the polarity of target charges. This simulation method and the results can be utilized for analysis of the properties and behavior of the biosensor device, such as the sensing limit or the sensing resolution. (paper)

  16. Study of the double charge-changing collision cross-sections of H{sup +}, D{sup +}, Li{sup +} ions with organic molecules in the energy range 10-50 keV; Etude des sections efficaces de double echange de charges ({sigma}{sub 1-1}) d'ions H{sup +}, D{sup +}, Li{sup +} traversant differents gaz organiques dans une gamme d'energie comprise entre 10 et 50 keV

    Energy Technology Data Exchange (ETDEWEB)

    Farrokhi, S [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1966-07-01

    The variation of the double charge-changing collision cross-sections of H{sup +}, D{sup +}, Li{sup +} ions with organic molecules (CH{sub 4}, C{sub 2}H{sub 6}, C{sub 3}H{sub 8}, C{sub 4}H{sub 10}) in the energy range 10-50 keV has been studied. Several maximums for {sigma}{sub 1-1} = f(E) have been shown. Their existence should be explained by the different possibilities of dissociating the target-molecules. The position of the maximums, for the H{sup +} {yields} H{sup -} and D{sup +} {yields} D{sup -} reactions is in good agreement with that defined by the Massey adiabatic relation. (author) [French] Nous avons etudie la variation de la section efficace de double echange de charges des ions H{sup +}, D{sup +}, Li{sup +} lors de la collision avec les molecules organiques de CH{sub 4}, C{sub 2}H{sub 6}, C{sub 3}H{sub 8}, C{sub 4}H{sub 10} dans la gamme d'energie comprise entre 10 et 50 keV. Les resultats obtenus ont montre plusieurs maximums de {sigma}{sub 1-1} f(E). L'existence de ces maximums pourrait etre expliquee par les differentes possibilites de dissociation des molecules cibles. La position des points maximaux concernant les reactions H{sup +} {yields} H{sup -} et D{sup +} {yields} D{sup -} est en bon accord avec celle definie par la relation adiabatique de MASSEY. (auteur)

  17. Positively charged residues at the five-fold symmetry axis of cell culture-adapted foot-and-mouth disease virus permit novel receptor interactions.

    Science.gov (United States)

    Berryman, Stephen; Clark, Stuart; Kakker, Naresh K; Silk, Rhiannon; Seago, Julian; Wadsworth, Jemma; Chamberlain, Kyle; Knowles, Nick J; Jackson, Terry

    2013-08-01

    Field isolates of foot-and-mouth disease virus (FMDV) have a restricted cell tropism which is limited by the need for certain RGD-dependent integrin receptors. In contrast, cell culture-adapted viruses use heparan sulfate (HS) or other unidentified molecules as receptors to initiate infection. Here, we report several novel findings resulting from cell culture adaptation of FMDV. In cell culture, a virus with the capsid of the A/Turkey/2/2006 field isolate gained the ability to infect CHO and HS-deficient CHO cells as a result of a single glutamine (Q)-to-lysine (K) substitution at VP1-110 (VP1-(Q)110(K)). Using site-directed mutagenesis, the introduction of lysine at this same site also resulted in an acquired ability to infect CHO cells by type O and Asia-1 FMDV. However, this ability appeared to require a second positively charged residue at VP1-109. CHO cells express two RGD-binding integrins (α5β1 and αvβ5) that, although not used by FMDV, have the potential to be used as receptors; however, viruses with the VP1-(Q)110(K) substitution did not use these integrins. In contrast, the VP1-(Q)110(K) substitution appeared to result in enhanced interactions with αvβ6, which allowed a virus with KGE in place of the normal RGD integrin-binding motif to use αvβ6 as a receptor. Thus, our results confirmed the existence of nonintegrin, non-HS receptors for FMDV on CHO cells and revealed a novel, non-RGD-dependent use of αvβ6 as a receptor. The introduction of lysine at VP1-110 may allow for cell culture adaptation of FMDV by design, which may prove useful for vaccine manufacture when cell culture adaptation proves intractable.

  18. Positively Charged Residues at the Five-Fold Symmetry Axis of Cell Culture-Adapted Foot-and-Mouth Disease Virus Permit Novel Receptor Interactions

    Science.gov (United States)

    Berryman, Stephen; Clark, Stuart; Kakker, Naresh K.; Silk, Rhiannon; Seago, Julian; Wadsworth, Jemma; Chamberlain, Kyle; Knowles, Nick J.

    2013-01-01

    Field isolates of foot-and-mouth disease virus (FMDV) have a restricted cell tropism which is limited by the need for certain RGD-dependent integrin receptors. In contrast, cell culture-adapted viruses use heparan sulfate (HS) or other unidentified molecules as receptors to initiate infection. Here, we report several novel findings resulting from cell culture adaptation of FMDV. In cell culture, a virus with the capsid of the A/Turkey/2/2006 field isolate gained the ability to infect CHO and HS-deficient CHO cells as a result of a single glutamine (Q)-to-lysine (K) substitution at VP1-110 (VP1-Q110K). Using site-directed mutagenesis, the introduction of lysine at this same site also resulted in an acquired ability to infect CHO cells by type O and Asia-1 FMDV. However, this ability appeared to require a second positively charged residue at VP1-109. CHO cells express two RGD-binding integrins (α5β1 and αvβ5) that, although not used by FMDV, have the potential to be used as receptors; however, viruses with the VP1-Q110K substitution did not use these integrins. In contrast, the VP1-Q110K substitution appeared to result in enhanced interactions with αvβ6, which allowed a virus with KGE in place of the normal RGD integrin-binding motif to use αvβ6 as a receptor. Thus, our results confirmed the existence of nonintegrin, non-HS receptors for FMDV on CHO cells and revealed a novel, non-RGD-dependent use of αvβ6 as a receptor. The introduction of lysine at VP1-110 may allow for cell culture adaptation of FMDV by design, which may prove useful for vaccine manufacture when cell culture adaptation proves intractable. PMID:23740982

  19. Bose-Einstein study of position-momentum correlations of charged pions in hadronic $Z^{0}$ decays

    CERN Document Server

    Abbiendi, G.; Akesson, P.F.; Alexander, G.; Anagnostou, G.; Anderson, K.J.; Asai, S.; Axen, D.; Bailey, I.; Barberio, E.; Barillari, T.; Barlow, R.J.; Batley, R.J.; Bechtle, P.; Behnke, T.; Bell, Kenneth Watson; Bell, P.J.; Bella, G.; Bellerive, A.; Benelli, G.; Bethke, S.; Biebel, O.; Boeriu, O.; Bock, P.; Boutemeur, M.; Braibant, S.; Brown, Robert M.; Burckhart, H.J.; Campana, S.; Capiluppi, P.; Carnegie, R.K.; Carter, A.A.; Carter, J.R.; Chang, C.Y.; Charlton, D.G.; Ciocca, C.; Csilling, A.; Cuffiani, M.; Dado, S.; Dallavalle, G.M.; De Roeck, A.; De Wolf, E.A.; Desch, K.; Dienes, B.; Dubbert, J.; Duchovni, E.; Duckeck, G.; Duerdoth, I.P.; Etzion, E.; Fabbri, F.; Ferrari, P.; Fiedler, F.; Fleck, I.; Ford, M.; Frey, A.; Gagnon, P.; Gary, John William; Geich-Gimbel, C.; Giacomelli, G.; Giacomelli, P.; Giunta, Marina; Goldberg, J.; Gross, E.; Grunhaus, J.; Gruwe, M.; Gupta, A.; Hajdu, C.; Hamann, M.; Hanson, G.G.; Harel, A.; Hauschild, M.; Hawkes, C.M.; Hawkings, R.; Herten, G.; Heuer, R.D.; Hill, J.C.; Horvath, D.; Igo-Kemenes, P.; Ishii, K.; Jeremie, H.; Jovanovic, P.; Junk, T.R.; Kanzaki, J.; Karlen, D.; Kawagoe, K.; Kawamoto, T.; Keeler, R.K.; Kellogg, R.G.; Kennedy, B.W.; Kluth, S.; Kobayashi, T.; Kobel, M.; Komamiya, S.; Kramer, T.; Krasznahorkay, A., Jr.; Krieger, P.; von Krogh, J.; Kuhl, T.; Kupper, M.; Lafferty, G.D.; Landsman, H.; Lanske, D.; Lellouch, D.; Lettso, J.; Levinson, L.; Lillich, J.; Lloyd, S.L.; Loebinger, F.K.; Lu, J.; Ludwig, A.; Ludwig, J.; Mader, W.; Marcellini, S.; Martin, A.J.; Mashimo, T.; Mattig, Peter; McKenna, J.; McPherson, R.A.; Meijers, F.; Menges, W.; Merritt, F.S.; Mes, H.; Meyer, N.; Michelini, A.; Mihara, S.; Mikenberg, G.; Miller, D.J.; Mohr, W.; Mori, T.; Mutter, A.; Nagai, K.; Nakamura, I.; Nanjo, H.; Neal, H.A.; O'Neale, S.W.; Oh, A.; Oreglia, M.J.; Orito, S.; Pahl, C.; Pasztor, G.; Pater, J.R.; Pilcher, J.E.; Pinfold, J.; Plane, D.E.; Pooth, O.; Przybycien, M.; Quadt, A.; Rabbertz, K.; Rembser, C.; Renkel, P.; Roney, J.M.; Rossi, A.M.; Rozen, Y.; Runge, K.; Sachs, K.; Saeki, T.; Sarkisyan, E.K.G.; Schaile, A.D.; Schaile, O.; Scharff-Hansen, P.; Schieck, J.; Schorner-Sadenius, T.; Schroder, M.; Schumacher, M.; Seuster, R.; Shears, T.G.; Shen, B.C.; Sherwood, P.; Skuja, A.; Smith, A.M.; Sobie, R.; Soldner-Rembold, S.; Spano, F.; Stahl, A.; Strom, David M.; Strohmer, R.; Tarem, S.; Tasevsky, M.; Teuscher, R.; Thomson, M.A.; Torrence, E.; Toya, D.; Trigger, I.; Trocsanyi, Z.; Tsur, E.; Turner-Watson, M.F.; Ueda, I.; Ujvari, B.; Vollmer, C.F.; Vannerem, P.; Vertesi, R.; Verzocchi, M.; Voss, H.; Vossebeld, J.; Ward, C.P.; Ward, D.R.; Watkins, P.M.; Watson, A.T.; Watson, N.K.; Wells, P.S.; Wengler, T.; Wermes, N.; Wilson, G.W.; Wilson, J.A.; Wolf, G.; Wyatt, T.R.; Yamashita, S.; Zer-Zion, D.; Zivkovic, Lidija

    2007-01-01

    A study of Bose-Einstein correlations in pairs of identically charged pions produced in e+e- annihilations at the Z0 peak has been performed for the first time assuming a non-static emitting source. The results are based on the high statistics data obtained with the OPAL detector at LEP. The correlation functions have been analyzed in intervals of the average pair transverse momentum and of the pair rapidity, in order to study possible correlations between the pion production points and their momenta (position-momentum correlations). The Yano-Koonin and the Bertsch-Pratt parameterizations have been fitted to the measured correlation functions to estimate the geometrical parameters of the source as well as the velocity of the source elements with respect to the overall centre-of-mass frame. The source rapidity is found to scale approximately with the pair rapidity, and both the longitudinal and transverse source dimensions are found to decrease for increasing average pair transverse momenta.

  20. The role of space charge in the performance of the bunching system for the ATLAS Positive Ion Injector

    International Nuclear Information System (INIS)

    Pardo, R.C.; Smith, R.

    1995-01-01

    The bunching system of the ATLAS Positive Ion Injector consists of a four-frequency harmonic buncher, a beam-tail removing chopper, and a 24.25 MHz spiral resonator sine-wave rebuncher. The system is designed to efficiently create beam pulses of approximately 0.25 nsec FWHM for injection into mid acceleration by the ATLAS superconducting linac. Studies of the effect of space charge on the performance of the system have been undertaken and compared to simulations as part of the design process for a new bunching system to be developed for a second ion source. Results of measurements and modeling studies indicate that the present system suffers significant bunching performance deterioration at beam currents as low as 5 eμA for 238 U 26+ at a velocity of β=0.0085. The low beam current tolerance of the present system is in reasonable agreement with computer simulation. Studies of two alternatives to the present bunching system are discussed and their limitations are explored

  1. The noise analysis and optimum filtering techniques for a two-dimensional position sensitive orthogonal strip gamma ray detector employing resistive charge division

    International Nuclear Information System (INIS)

    Gerber, M.S.; Muller, D.W.

    1976-01-01

    The analysis of an orthogonal strip, two-dimensional position sensitive high purity germanium gamma ray detector is discussed. Position sensitivity is obtained by connecting each electrode strip on the detector to a resistor network. Charge, entering the network, divides in relation to the resistance between its entry point and the virtual earth points of the charge sensitive preamplifiers located at the end of each resistor network. The difference of the voltage pulses at the output of each preamplifier is proportional to the position at which the charge entered the resistor network and the sum of the pulse is proportional to the energy of the detected gamma ray. The analysis and spatial noise resolution is presented for this type of position sensitive detector. The results of the analysis show that the position resolution is proportional to the square root of the filter amplifier's output pulse time constant and that for energy measurement the resolution is maximized at the filter amplifier's noise corner time constant. The design of the electronic noise filtering system for the prototype gamma ray camera was based on the mathematical energy and spatial resolution equations. For the spatial channel a Gaussian trapezoidal filtering system was developed. Gaussian filtering was used for the energy channel. The detector noise model was verified by taking rms noise measurements of the filtered energy and spatial pulses from resistive readout charge dividing detectors. These measurements were within 10% of theory. (Auth.)

  2. Inhibiting HER3-mediated tumor cell growth with affibody molecules engineered to low picomolar affinity by position-directed error-prone PCR-like diversification.

    Science.gov (United States)

    Malm, Magdalena; Kronqvist, Nina; Lindberg, Hanna; Gudmundsdotter, Lindvi; Bass, Tarek; Frejd, Fredrik Y; Höidén-Guthenberg, Ingmarie; Varasteh, Zohreh; Orlova, Anna; Tolmachev, Vladimir; Ståhl, Stefan; Löfblom, John

    2013-01-01

    The HER3 receptor is implicated in the progression of various cancers as well as in resistance to several currently used drugs, and is hence a potential target for development of new therapies. We have previously generated Affibody molecules that inhibit heregulin-induced signaling of the HER3 pathways. The aim of this study was to improve the affinity of the binders to hopefully increase receptor inhibition efficacy and enable a high receptor-mediated uptake in tumors. We explored a novel strategy for affinity maturation of Affibody molecules that is based on alanine scanning followed by design of library diversification to mimic the result from an error-prone PCR reaction, but with full control over mutated positions and thus less biases. Using bacterial surface display and flow-cytometric sorting of the maturation library, the affinity for HER3 was improved more than 30-fold down to 21 pM. The affinity is among the higher that has been reported for Affibody molecules and we believe that the maturation strategy should be generally applicable for improvement of affinity proteins. The new binders also demonstrated an improved thermal stability as well as complete refolding after denaturation. Moreover, inhibition of ligand-induced proliferation of HER3-positive breast cancer cells was improved more than two orders of magnitude compared to the previously best-performing clone. Radiolabeled Affibody molecules showed specific targeting of a number of HER3-positive cell lines in vitro as well as targeting of HER3 in in vivo mouse models and represent promising candidates for future development of targeted therapies and diagnostics.

  3. Role of molecular charge in nucleocytoplasmic transport.

    Directory of Open Access Journals (Sweden)

    Alexander Goryaynov

    Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.

  4. Cellobiose Dehydrogenase Aryl Diazonium Modified Single Walled Carbon Nanotubes: Enhanced Direct Electron Transfer through a Positively Charged Surface

    Science.gov (United States)

    2011-01-01

    One of the challenges in the field of biosensors and biofuel cells is to establish a highly efficient electron transfer rate between the active site of redox enzymes and electrodes to fully access the catalytic potential of the biocatalyst and achieve high current densities. We report on very efficient direct electron transfer (DET) between cellobiose dehydrogenase (CDH) from Phanerochaete sordida (PsCDH) and surface modified single walled carbon nanotubes (SWCNT). Sonicated SWCNTs were adsorbed on the top of glassy carbon electrodes and modified with aryl diazonium salts generated in situ from p-aminobenzoic acid and p-phenylenediamine, thus featuring at acidic pH (3.5 and 4.5) negative or positive surface charges. After adsorption of PsCDH, both electrode types showed excellent long-term stability and very efficient DET. The modified electrode presenting p-aminophenyl groups produced a DET current density of 500 μA cm−2 at 200 mV vs normal hydrogen reference electrode (NHE) in a 5 mM lactose solution buffered at pH 3.5. This is the highest reported DET value so far using a CDH modified electrode and comes close to electrodes using mediated electron transfer. Moreover, the onset of the electrocatalytic current for lactose oxidation started at 70 mV vs NHE, a potential which is 50 mV lower compared to when unmodified SWCNTs were used. This effect potentially reduces the interference by oxidizable matrix components in biosensors and increases the open circuit potential in biofuel cells. The stability of the electrode was greatly increased compared with unmodified but cross-linked SWCNTs electrodes and lost only 15% of the initial current after 50 h of constant potential scanning. PMID:21417322

  5. Charge-transfer cross sections of ground state He+ ions in collisions with He atoms and simple molecules in the energy range below 4.0 keV

    International Nuclear Information System (INIS)

    Kusakabe, Toshio; Kitamuro, Satoshi; Nakai, Yohta; Tawara, Hiroyuki; Sasao, Mamiko

    2012-01-01

    Charge-transfer cross sections of the ground state He + ions in collisions with He atoms and simple molecules (H 2 , D 2 , N 2 , CO and CO 2 ) have been measured in the energy range of 0.20 to 4.0 keV with the initial growth rate method. Since previously published experimental data are scattered in the low energy region, the present observations would provide reasonably reliable cross section data below 4 keV. The charge transfer accompanied by dissociation of product molecular ion can be dominant at low energies for molecular targets. In He + + D 2 collisions, any isotope effect was not observed over the present energy range, compared to H 2 molecule. (author)

  6. Performance of a position sensitive Si(Li) x-ray detector dedicated to Compton polarimetry of stored and trapped highly-charged ions

    International Nuclear Information System (INIS)

    Weber, G; Braeuning, H; Hess, S; Maertin, R; Spillmann, U; Stoehlker, Th

    2010-01-01

    We report on a novel two-dimensional position sensitive Si(Li) detector dedicated to Compton polarimetry of x-ray radiation arising from highly-charged ions. The performance of the detector system was evaluated in ion-atom collision experiments at the ESR storage ringe at GSI, Darmstadt. Based on the data obtained, the polarimeter efficiency is estimated in this work.

  7. Alpha-conotoxin analogs with additional positive charge show increased selectivity towards Torpedo californica and some neuronal subtypes of nicotinic acetylcholine receptors

    NARCIS (Netherlands)

    Kasheverov, I.E.; Zhmak, M.N.; Vulfius, C.A.; Corbacheva, E.V.; Mordvintsev, D.Y.; Utkin, Y.N.; van Elk, R.; Smit, A.B.; Tsetlin, V.I.

    2006-01-01

    α-Conotoxins from Conus snails are indispensable tools for distinguishing various subtypes of nicotinic acetylcholine receptors (nAChRs), and synthesis of α-conotoxin analogs may yield novel antagonists of higher potency and selectivity. We incorporated additional positive charges into α-conotoxins

  8. Basal electric and magnetic fields of celestial bodies come from positive-negative charge separation caused by gravitation of quasi-Casimir pressure in weak interaction

    Science.gov (United States)

    Chen, Shao-Guang

    According to f =d(mv)/dt=m(dv/dt)+ v(dm/dt), a same gravitational formula had been de-duced from the variance in physical mass of QFT and from the variance in mass of inductive energy-transfer of GR respectively: f QF T = f GR = -G (mM/r2 )((r/r)+(v/c)) when their interaction-constants are all taken the experimental values (H05-0029-08, E15-0039-08). f QF T is the quasi-Casimir pressure. f GR is equivalent to Einstein's equation, then more easy to solve it. The hypothesis of the equivalent principle is not used in f QF T , but required by f GR . The predictions of f QF T and f GR are identical except that f QF T has quantum effects but f GR has not and f GR has Lense-Thirring effect but f QF T has not. The quantum effects of gravitation had been verified by Nesvizhevsky et al with the ultracold neutrons falling in the earth's gravitational field in 2002. Yet Lense-Thirring effect had not been measured by GP-B. It shows that f QF T is essential but f GR is phenomenological. The macro-f QF T is the statistic average pressure collided by net virtual neutrinos ν 0 flux (after self-offset in opposite directions) and in direct proportion to the mass. But micro-f QF T is in direct proportion to the scattering section. The electric mass (in inverse proportion to de Broglie wavelength λ) far less than nucleonic mass and the electric scattering section (in direct proportion to λ2 ) far large than that of nucleon, then the net ν 0 flux pressure exerted to electron far large than that to nucleon and the electric displacement far large than that of nucleon, it causes the gravitational polarization of positive-negative charge center separation. Because the gravity far less than the electromagnetic binding force, in atoms the gravitational polarization only produces a little separation. But the net ν 0 flux can press a part freedom electrons in plasma of ionosphere into the earth's surface, the static electric force of redundant positive ions prevents electrons from further

  9. Double photoionisation spectra of molecules

    CERN Document Server

    Eland, John

    2017-01-01

    This book contains spectra of the doubly charged positive ions (dications) of some 75 molecules, including the major constituents of terrestrial and planetary atmospheres and prototypes of major chemical groups. It is intended to be a new resource for research in all areas of molecular spectroscopy involving high energy environments, both terrestrial and extra-terrestrial. All the spectra have been produced by photoionisation using laboratory lamps or synchrotron radiation and have been measured using the magnetic bottle time-of-flight technique by coincidence detection of correlated electron pairs. Full references to published work on the same species are given, though for several molecules these are the first published spectra. Double ionisation energies are listed and discussed in relation to the molecular electronic structure of the molecules. A full introduction to the field of molecular double ionisation is included and the mechanisms by which double photoionisation can occur are examined in detail. A p...

  10. Adjacent effect on positive charge transfer from radical cation of n-dodecane to scavenger studied by supbicosecond pulse radiolysis, statistical and Monte Carlo approach

    International Nuclear Information System (INIS)

    Saeki, A.; Tagawa, S.; Kozawa, T.; Yoshida, Y.

    2003-01-01

    Time-dependent behaviors of radical cation in n-dodecane in the presence of high-concentrated cation scavenger triethylamine were measured by subpicosecond pulse radiolysis system. The significant reduction of the initial yield in the optical density was observed. This reduction were not able to be explained by the first order rate constant. Therefore, we assumed that this phenomena occur due to the adjacent effect of the solute molecules. We approached this effect by the statistical model and configurational-bias Monte Carlo method. In both methods, we supposed a condition that the cation site in the radical cation is delocalized and will be scavenged rapidly within the time resolution if the solute molecules is adjacent to any sites of the solvent. In addition to the adjacent effect, the fact that a large part of the solvent molecules is excluded by the solute molecules especially at high concentration was taken into consideration. First, we formulated this effect by a statistical model. In addition to the above assumption, this model is based on the following assumption; the effects of molecule's shape, conformation and interaction among molecules were ignored and the aggregation of the solute molecules were treated randomly. As a result, the formula indicated good agreement with the experimental data. Second, as another approach, we adopted the configurational-bias Monte Carlo simulation to reproduce the liquid system. The OLPS model was used to describe the intermolecular and intramolecular potentials. The adjacent effect estimated by this method corresponded to the experimental data with a threshold of 0.5 nm. This value are close to a typical reaction radius. The average number of adjacent solvent molecules and the distribution of aggregated solute's number were also collected from the position data

  11. The P9 pocket of HLA-DQ2 (non-Aspbeta57) has no particular preference for negatively charged anchor residues found in other type 1 diabetes-predisposing non-Aspbeta57 MHC class II molecules

    DEFF Research Database (Denmark)

    Quarsten, H; Paulsen, G; Johansen, B H

    1998-01-01

    Susceptibility and resistance to type 1 diabetes are associated with MHC class II alleles that carry non-Asp and Asp at residue 57 of their beta chain respectively. The effect of Asp or non-Aspbeta57 may relate to a differential ability of distinct class II molecules to bind specific immuno......-pathogenic peptides. Recent studies in man and mouse have revealed that some type 1 diabetes-predisposing non-Aspbeta57 class II molecules (i.e. DQ8, DR4Dw15 and I-Ag7) preferentially bind peptides with a negatively charged anchor residue at P9. It has been suggested that this is a common feature of type 1 diabetes......-predisposing class II molecules. The molecular explanation for such a phenomenon could be that class II beta chains with Aspbeta57 form a salt bridge between Aspbeta57 and a conserved Arg of the a chain, whereas in non-Aspbeta57 molecules the Arg is unopposed and free to interact with negatively charged P9 peptide...

  12. Environmental charging of spacecraft-tests of thermal control materials for use on the global positioning system flight space vehicle. Part 2: Specimen 6 to 9

    Science.gov (United States)

    Stevens, N. J.; Berkopec, F. D.; Blech, R. A.

    1976-01-01

    The NASA/USAF program on the Environmental Charging of Spacecraft Surfaces consists, in part, of experimental efforts directed toward evaluating the response of materials to the environmental charged particle flux. Samples of thermal blankets of the type to be used on the Global Positioning System Flight Space Vehicles were tested to determine their response to electron flux. The primary result observed was that no discharges were obtained with the quartz-fiber-fabric-covered multilayer insulation specimen. The taped aluminized polyester grounding system used on all specimens did not appear to grossly deteriorate with time; however, the specimens require specific external pressure to maintain constant grounding system resistance.

  13. Positively charged polymers modulate the fate of human mesenchymal stromal cells via ephrinB2/EphB4 signaling

    Directory of Open Access Journals (Sweden)

    Ilenia De Luca

    2016-09-01

    Full Text Available Understanding the mechanisms by which mesenchymal stromal cells (MSCs interact with the physical properties (e.g. topography, charge, ζ-potential, and contact angle of polymeric surfaces is essential to design new biomaterials capable of regulating stem cell behavior. The present study investigated the ability of two polymers (pHM1 and pHM3 with different positive surface charge densities to modulate the differentiation of MSCs into osteoblast-like phenotype via cell-cell ephrinB2/EphB4 signaling. Although pHM1 promoted the phosphorylation of EphB4, leading to cell differentiation, pHM3, characterized by a high positive surface charge density, had no significant effect on EphB4 activation or MSCs differentiation. When the MSCs were cultured on pHM1 in the presence of a forward signaling blocking peptide, the osteoblast differentiation was compromised. Our results demonstrated that the ephrinB2/EphB4 interaction was required for MSCs differentiation into an osteoblast-like phenotype and that the presence of a high positive surface charge density altered this interaction.

  14. The 4-pyridylmethyl ester as a protecting group for glutamic and aspartic acids: 'flipping' peptide charge states for characterization by positive ion mode ESI-MS.

    Science.gov (United States)

    Garapati, Sriramya; Burns, Colin S

    2014-03-01

    Use of the 4-pyridylmethyl ester group for side-chain protection of glutamic acid residues in solid-phase peptide synthesis enables switching of the charge state of a peptide from negative to positive, thus making detection by positive ion mode ESI-MS possible. The pyridylmethyl ester moiety is readily removed from peptides in high yield by hydrogenation. Combining the 4-pyridylmethyl ester protecting group with benzyl ester protection reduces the number of the former needed to produce a net positive charge and allows for purification by RP HPLC. This protecting group is useful in the synthesis of highly acidic peptide sequences, which are often beset by problems with purification by standard RP HPLC and characterization by ESI-MS. Copyright © 2014 European Peptide Society and John Wiley & Sons, Ltd.

  15. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    Science.gov (United States)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

    2011-07-01

    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that

  16. Small molecule ErbB inhibitors decrease proliferative signaling and promote apoptosis in philadelphia chromosome-positive acute lymphoblastic leukemia.

    Directory of Open Access Journals (Sweden)

    Mary E Irwin

    Full Text Available The presence of the Philadelphia chromosome in patients with acute lymphoblastic leukemia (Ph(+ALL is a negative prognostic indicator. Tyrosine kinase inhibitors (TKI that target BCR/ABL, such as imatinib, have improved treatment of Ph(+ALL and are generally incorporated into induction regimens. This approach has improved clinical responses, but molecular remissions are seen in less than 50% of patients leaving few treatment options in the event of relapse. Thus, identification of additional targets for therapeutic intervention has potential to improve outcomes for Ph+ALL. The human epidermal growth factor receptor 2 (ErbB2 is expressed in ~30% of B-ALLs, and numerous small molecule inhibitors are available to prevent its activation. We analyzed a cohort of 129 ALL patient samples using reverse phase protein array (RPPA with ErbB2 and phospho-ErbB2 antibodies and found that activity of ErbB2 was elevated in 56% of Ph(+ALL as compared to just 4.8% of Ph(-ALL. In two human Ph+ALL cell lines, inhibition of ErbB kinase activity with canertinib resulted in a dose-dependent decrease in the phosphorylation of an ErbB kinase signaling target p70S6-kinase T389 (by 60% in Z119 and 39% in Z181 cells at 3 µM. Downstream, phosphorylation of S6-kinase was also diminished in both cell lines in a dose-dependent manner (by 91% in both cell lines at 3 µM. Canertinib treatment increased expression of the pro-apoptotic protein Bim by as much as 144% in Z119 cells and 49% in Z181 cells, and further produced caspase-3 activation and consequent apoptotic cell death. Both canertinib and the FDA-approved ErbB1/2-directed TKI lapatinib abrogated proliferation and increased sensitivity to BCR/ABL-directed TKIs at clinically relevant doses. Our results suggest that ErbB signaling is an additional molecular target in Ph(+ALL and encourage the development of clinical strategies combining ErbB and BCR/ABL kinase inhibitors for this subset of ALL patients.

  17. Doubly versus Singly Positively Charged Oxygen Ions Back-Scattering from a Silicon Surface under Dynamic O2+ Bombardment

    Czech Academy of Sciences Publication Activity Database

    Franzreb, K.; Williams, P.; Lörinčík, Jan; Šroubek, Zdeněk

    203-204, 1/4 (2003), s. 39-42 ISSN 0169-4332 Institutional research plan: CEZ:AV0Z2067918; CEZ:AV0Z4040901 Keywords : low-energy ion scattering * doubly charged ions * molecular orbital Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.284, year: 2003

  18. Single molecule fluorescence image patterns linked to dipole orientation and axial position: application to myosin cross-bridges in muscle fibers.

    Directory of Open Access Journals (Sweden)

    Thomas P Burghardt

    2011-02-01

    Full Text Available Photoactivatable fluorescent probes developed specifically for single molecule detection extend advantages of single molecule imaging to high probe density regions of cells and tissues. They perform in the native biomolecule environment and have been used to detect both probe position and orientation.Fluorescence emission from a single photoactivated probe captured in an oil immersion, high numerical aperture objective, produces a spatial pattern on the detector that is a linear combination of 6 independent and distinct spatial basis patterns with weighting coefficients specifying emission dipole orientation. Basis patterns are tabulated for single photoactivated probes labeling myosin cross-bridges in a permeabilized muscle fiber undergoing total internal reflection illumination. Emitter proximity to the glass/aqueous interface at the coverslip implies the dipole near-field and dipole power normalization are significant affecters of the basis patterns. Other characteristics of the basis patterns are contributed by field polarization rotation with transmission through the microscope optics and refraction by the filter set. Pattern recognition utilized the generalized linear model, maximum likelihood fitting, for Poisson distributed uncertainties. This fitting method is more appropriate for treating low signal level photon counting data than χ(2 minimization.Results indicate that emission dipole orientation is measurable from the intensity image except for the ambiguity under dipole inversion. The advantage over an alternative method comparing two measured polarized emission intensities using an analyzing polarizer is that information in the intensity spatial distribution provides more constraints on fitted parameters and a single image provides all the information needed. Axial distance dependence in the emission pattern is also exploited to measure relative probe position near focus. Single molecule images from axial scanning fitted

  19. The first report on Listeria monocytogenes producing siderophores and responds positively to N-acyl homoserine lactone (AHL) molecules by enhanced biofilm formation.

    Science.gov (United States)

    Naik, Milind Mohan; Bhangui, Purva; Bhat, Chinmay

    2017-12-01

    Listeria monocytogenes are Gram-positive well-known emerging food-borne pathogens causing listeriosis in humans. In the present study, we have isolated biofilm-forming Listeria sp. from utensils used by a local milk collection dairy society at Usgao Goa, which collects milk for Goa dairy. Through biochemical tests and 16S rRNA sequence analysis, the bacterium was confirmed to be L. monocytogenes and designated as strain BN3, having GenBank accession number MF095110. We report for the first time Gram-positive L. monocytogenes strain BN3 producing iron-chelating siderophores by chrome azurol S (CAS) agar test. Also, this is a first report which reveals that L. monocytogenes strain BN3 responds to N-hexanoyl-homoserine lactone molecule (C 6 -HSL) by gradual increase in their biofilm-forming potential with a gradual increase in AHL (C 6 -HSL) concentration (250, 500 nM-1 μM) as compared to control revealed by crystal violet assay (CV) in microtiter plate. These results were further confirmed by scanning electron microscopy (SEM). A significant decrease in biofilm formation was observed when L. monocytogenes strain BN3 was treated with 10 µg/ml (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid, but when 250 and 500 nM AHL molecules were added, biofilm formation in strain BN3 was found to be enhanced as compared to control even in the presence of antibacterial compound, (R)-2-(2-hydroxynaphthalen-1-yl)thiazolidine-4-carboxylic acid. These results revealed that AHL molecules nullify the effect of antimicrobial compound and promote biofilm formation in L. monocytogenes strain BN3.

  20. Evidence for excited state intramolecular charge transfer reaction in donor-acceptor molecule 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester: Experimental and quantum chemical approach

    International Nuclear Information System (INIS)

    Kumar Paul, Bijan; Samanta, Anuva; Kar, Samiran; Guchhait, Nikhil

    2010-01-01

    Intramolecular charge transfer (ICT) reaction has been investigated in 5-(4-dimethylamino-phenyl)-penta-2,4-dienoic acid methyl ester (DPDAME) using spectroscopic techniques. The molecule DPDAME shows local emission in non-polar solvent and dual emission in polar solvents. Solvatochromic effects on the Stokes shifted emission band clearly demonstrate the charge transfer character of the excited state. Quantum chemical calculations have been performed at Hartree-Fock (HF) and density functional theoretical (DFT) levels to correlate the experimental findings. Potential energy curves (PECs) for the ICT reaction have been evaluated along the donor twist angle at DFT and time dependent density functional theory (TDDFT) levels for the ground and excited states, respectively, using B3LYP hybrid functional and 6-31G** basis set. The solvent effects on the spectral properties have been explored theoretically at the same level with time dependent density functional theory-polarized continuum model (TDDFT-PCM) and the theoretical results are found to well substantiate the solvent polarity dependent Stokes shifted emission of DPDAME. Huge enhancement of dipole moment (Δμ=16.42 D) of the molecule following photoexcitation dictates the highly polar character of the excited state. Although elucidation of PECs does not exactly predict the operation of ICT according to twisted intramolecular charge transfer (TICT) model in DPDAME, lowering of vertical transition energy as a function of the donor twist coordinate scripts the occurrence of red shifted emission as observed experimentally.

  1. Charge transfer processes in collisions of H+ ions with H2, D2, CO, CO2 CH4, C2H2, C2H6 and C3H8 molecules below 10 keV

    International Nuclear Information System (INIS)

    Kusakabe, T.; Buenker, R.J.; Kimura, M.

    2002-01-01

    Charge transfer processes resulting from collisions of H + ions with H 2 , D 2 , CO, CO 2 CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 molecules have been investigated in the energy range of 0.2 to 4.0 keV experimentally and theoretically. The initial growth rate method was employed in the experiment for studying the dynamics and cross sections. Theoretical analysis based on a molecular-orbital expansion method for H 2 , D 2 , CO, CH 4 and C 2 H 2 targets was also carried out. The present results for the H 2 , CO and CO 2 molecules by H + impact are found to be in excellent accord with most of previous measurements above 1 keV, but they show some differences below this energy where our result displays a stronger energy-dependence. For CH 4 , C 2 H 2 , C 2 H 6 and C 3 H 8 targets, both experimental and theoretical results indicate that if one assumes vibrationally excited molecular ions (CH 4 + , C 2 H 2 + , C 2 H 6 + and C 3 H 8 + ) formed in the exit channel, then charge transfer processes sometimes become more favorable since these vibrationally excited fragments meet an accidental resonant condition. This is a clear indication of the role of vibrational excited states for charge transfer, and is an important realization for general understanding. (author)

  2. A surprising way to control the charge transport in molecular electronics: the subtle impact of the coverage of self-assembled monolayers of floppy molecules adsorbed on metallic electrodes.

    Science.gov (United States)

    Bâldea, Ioan

    2017-10-26

    Inspired by earlier attempts in organic electronics aiming at controlling charge injection from metals into organic materials by manipulating the Schottky energy barrier using self-assembled monolayers (SAMs), recent experimental and theoretical work in molecular electronics showed that metal-organic interfaces can be controlled via changes in the metal work function that are induced by SAMs. In this paper we indicate a different route to achieve interface-driven control over the charge transfer/transport at the molecular scale. It is based on the fact that, in floppy molecule based SAMs, the molecular conformation can be tuned by varying the coverage of the adsorbate. We demonstrate this effect with the aid of benchmark molecules that are often used to fabricate nanojunctions and consist of two rings that can easily rotate relative to each other. We show that, by varying the coverage of the SAM, the twisting angle φ of the considered molecular species can be modified by a factor of two. Given the fact that the low bias conductance G scales as cos 2  φ, this results in a change in G of over one order of magnitude for the considered molecular species. Tuning the twisting angle by controlling the SAM coverage may be significant, e.g., for current efforts to fabricate molecular switches. Conversely, the lack of control over the local SAM coverage may be problematic for the reproducibility and interpretation of the STM (scanning tunneling microscope) measurements on repeatedly forming single molecule break junctions.

  3. Accumulation and dissipation of positive charges induced on a PMMA build-up cap of an ionisation chamber by 60Co gamma-ray irradiation

    International Nuclear Information System (INIS)

    Morishita, Y.; Takata, N.

    2013-01-01

    The signal current from an ionisation chamber with a PMMA build-up cap decreases with irradiation time due to electric fields produced by positive charges induced on the cap. In the present study, it was confirmed that the signal current decreases faster for irradiation using narrower 60 Co gamma-ray beams. This is because the number of secondary electrons that are emitted from surrounding materials and penetrate the build-up cap is smaller in a narrower gamma-ray beam, so that fewer positive charges are neutralised. The ionisation chamber was first subjected to continuous gamma-ray irradiation for 24 h, following which it was irradiated with shorter periodic gamma-ray bursts while measuring the current signal. This allowed the coefficients of positive charge accumulation and dissipation to be determined. It was found that the dissipation coefficient has a large constant value during gamma-ray irradiation and decreases asymptotically to a small value after irradiation is stopped. From the coefficients, the minimum signal current was calculated, which is the value when accumulation and dissipation balance each other under continuous irradiation. The time required for the signal current to recover following irradiation was also calculated. (authors)

  4. Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

    Science.gov (United States)

    Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

    2017-08-29

    Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

  5. Atom and molecule projectile and fast aggregate excitation, ionization and dissociation in thin targets in the out-of-charge equilibrium field

    International Nuclear Information System (INIS)

    Clouvas, A.

    1985-12-01

    The aim of this experimental study is to confirm the possible existence of bound states for light atomic and molecular projectiles inside solid targets, in the MeV energy range. For this purpose we have used, various experimental methods such as charge state distribution measurements, energy loss measurements, beam foil spectroscopy and electron spectroscopy. It was confirmed that bound states of light atomic and molecular projectiles can exist in a solid medium. The various cross sections (charge exchange, excitation, ionisation, dissociation) relative to these bound states have been measured [fr

  6. Theory of Spin States of Quantum Dot Molecules

    Science.gov (United States)

    Ponomarev, I. V.; Reinecke, T. L.; Scheibner, M.; Stinaff, E. A.; Bracker, A. S.; Doty, M. F.; Gammon, D.; Korenev, V. L.

    2007-04-01

    The photoluminescence spectrum of an asymmetric pair of coupled InAs quantum dots in an applied electric field shows a rich pattern of level anticrossings, crossings and fine structure that can be understood as a superposition of charge and spin configurations. We present a theoretical model that provides a description of the energy positions and intensities of the optical transitions in exciton, biexciton and charged exciton states of coupled quantum dots molecules.

  7. Charge-resonance excitations in symmetric molecules - Comparison of linear response DFT with CC3 for the excited states of a model dimer

    DEFF Research Database (Denmark)

    Kuhlman, Thomas Scheby; Mikkelsen, Kurt V.; Møller, Klaus Braagaard

    2009-01-01

    to a reference CC3 calculation revealing a better description of the excited states by CAM-B3LYP than that of B3LYP. The Λ parameter introduced by Peach et al. [M.J.G. Peach, P. Benfield, T. Helgaker, D.J. Tozer, J. Chem. Phys. 128 (2008) 044118] does not always reveal the problematic charge-resonance states...

  8. Entanglements in Marginal Solutions: A Means of Tuning Pre-Aggregation of Conjugated Polymers with Positive Implications for Charge Transport

    KAUST Repository

    Hu, Hanlin

    2015-06-17

    The solution-processing of conjugated polymers, just like commodity polymers, is subject to solvent and molecular weight-dependent solubility, interactions and chain entanglements within the polymer, all of which can influence the crystallization and microstructure development in semi-crystalline polymers and consequently affect charge transport and optoelectronic properties. Disentanglement of polymer chains in marginal solvents was reported to work via ultrasonication, facilitating the formation of photophysically ordered polymer aggregates. In this contribution, we explore how a wide range of technologically relevant solvents and formulations commonly used in organic electronics influence chain entanglement and the aggregation behaviour of P3HT using a combination of rheological and spectrophotometric measurements. The specific viscosity of the solution offers an excellent indication of the degree of entanglements in the solution, which is found to be related to the solubility of P3HT in a given solvent. Moreover, deliberately disentangling the solution in the presence of solvophobic driving forces, leads consistently to formation of photophysically visible aggregates which is indicative of local and perhaps long range order in the solute. We show for a broad range of solvents and molecular weights that disentanglement ultimately leads to significant ordering of the polymer in the solid state and a commensurate increase in charge transport properties. In doing so we demonstrate a remarkable ability to tune the microstructure which has important implications for transport properties. We discuss its potential implications in the context of organic photovoltaics.

  9. Entanglements in Marginal Solutions: A Means of Tuning Pre-Aggregation of Conjugated Polymers with Positive Implications for Charge Transport

    KAUST Repository

    Hu, Hanlin; Zhao, Kui; Fernandes, Nikhil J.; Boufflet, Pierre; Bannock, James Henry; Yu, Liyang; de Mello, John C; Stingelin, Natalie; Heeney, Martin; Giannelis, Emmanuel P.; Amassian, Aram

    2015-01-01

    The solution-processing of conjugated polymers, just like commodity polymers, is subject to solvent and molecular weight-dependent solubility, interactions and chain entanglements within the polymer, all of which can influence the crystallization and microstructure development in semi-crystalline polymers and consequently affect charge transport and optoelectronic properties. Disentanglement of polymer chains in marginal solvents was reported to work via ultrasonication, facilitating the formation of photophysically ordered polymer aggregates. In this contribution, we explore how a wide range of technologically relevant solvents and formulations commonly used in organic electronics influence chain entanglement and the aggregation behaviour of P3HT using a combination of rheological and spectrophotometric measurements. The specific viscosity of the solution offers an excellent indication of the degree of entanglements in the solution, which is found to be related to the solubility of P3HT in a given solvent. Moreover, deliberately disentangling the solution in the presence of solvophobic driving forces, leads consistently to formation of photophysically visible aggregates which is indicative of local and perhaps long range order in the solute. We show for a broad range of solvents and molecular weights that disentanglement ultimately leads to significant ordering of the polymer in the solid state and a commensurate increase in charge transport properties. In doing so we demonstrate a remarkable ability to tune the microstructure which has important implications for transport properties. We discuss its potential implications in the context of organic photovoltaics.

  10. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  11. Synthesis of an A-D-A type of molecule used as electron acceptor for improving charge transfer in organic solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Chao-Zhi, E-mail: chzhzhang@sohu.com [Department of Chemistry, Nanjing University of Information Science & Technology, Nanjing 210044 (China); Gu, Shu-Duo; Shen, Dan; Yuan, Yang [Department of Chemistry, Nanjing University of Information Science & Technology, Nanjing 210044 (China); Zhang, Mingdao, E-mail: matchlessjimmy@163.com [Jiangsu Key Laboratory of Atmospheric Environment Monitoring and Pollution Control, Nanjing University of Information Science & Technology, Nanjing 210044 (China)

    2016-08-22

    Electron-accepting molecules play an important role in developing organic solar cells. A new type of A-D-A molecule, 3,6-di([7-(5-bromothiophen-2-yl)-1,5,2,4,6,8-dithiotetrazocin-3-yl]thiophen -2-yl)-9-(2-ethylhexyl)carbazole, was synthesized. The lowest unoccupied molecular orbital (LUMO) and highest occupied molecular orbital (HOMO) energy levels are −3.55 and −5.85 eV, respectively. Therefore, the A-D-A type of compound could be used as electron acceptor for fabricating organic solar cell with a high open circuit voltage. Gibbs free energy (−49.2 kJ/mol) reveals that the process of A-D-A acceptor accepting an electron from poly(3-hexylthiophene) at excited state is spontaneous. The value of entropy (118 J/mol) in the process of an electron transferring from P3HT to the A-D-A acceptor at organic interface suggests that electrons generated from separation of electron-hole pairs at donor/acceptor interface would be delocalized efficiently. Therefore, the A-D-A molecule would be a potential acceptor for efficient organic BHJ solar cells.

  12. Electron distributions of the first-row homonuclear diatomic molecules, A2

    International Nuclear Information System (INIS)

    Ramirez, B.I.; Bielefeld Univ.

    1982-08-01

    Electron momentum density contour maps of the first-row homonuclear diatomic molecules, A 2 , are obtained from near Hartree-Fock wave functions. Both the total momentum density and momentum density difference (molecule - isolated atoms) maps present trends that may be related to the binding in the molecules. These results are compared with the corresponding charge density maps in position space (Bader, Henneker and Cade 1967). (author)

  13. Bounds on the g/sub K//sub N//sub Σ/ 2 coupling constant from positivity and charge-exchange data

    International Nuclear Information System (INIS)

    Antolin, J.

    1987-01-01

    Positivity of the imaginary part of the forward K - n elastic amplitude on the unphysical cut allows the calculation of bounds on the g/sub K//sub N//sub Σ/ 2 coupling constant using the forward differential cross sections of the charge-exchange reaction K - p→K-bar 0 n, the scarce K - n real-part data, and a Stieltjes parametrization of the K - p real-part data. The bounds on the coupling constant are 2.11 2 - n amplitude: (0.35 +- 0.05) +- (0.16 +- 0.04)i GeV/c

  14. Doubly versus singly positively charged oxygen ions back-scattered from a silicon surface under dynamic O2+ bombardment

    International Nuclear Information System (INIS)

    Franzreb, Klaus; Williams, Peter; Loerincik, Jan; Sroubek, Zdenek

    2003-01-01

    Mass-resolved (and emission-charge-state-resolved) low-energy ion back-scattering during dynamic O 2 + bombardment of a silicon surface was applied in a Cameca IMS-3f secondary ion mass spectrometry (SIMS) instrument to determine the bombarding energy dependence of the ratio of back-scattered O 2+ versus O + . While the ratio of O 2+ versus O + drops significantly at reduced bombarding energies, O 2+ back-scattered from silicon was still detectable at an impact energy (in the lab frame) as low as about 1.6 keV per oxygen atom. Assuming neutralization prior to impact, O 2+ ion formation in an asymmetric 16 O→ 28 Si collision is expected to take place via 'collisional double ionization' (i.e. by promotion of two outer O 2p electrons) rather than by the production of an inner-shell (O 2s or O 1s) core hole followed by Auger-type de-excitation during or after ejection. A molecular orbital (MO) correlation diagram calculated for a binary 'head-on' O-Si collision supports this interpretation

  15. [Detection and clinical value of epithelial cellular adhesion molecule (EpCAM) mRNA positive circulating tumor cells in metastatic breast cancer].

    Science.gov (United States)

    Yan, Ying; Cheng, Jian-ping; Di, Li-jun; Song, Guo-hong; Ren, Jun

    2012-04-18

    To test for circulating tumor cells (CTCs) relying on epithelial cellular adhesion molecule (EpCAM) expression in metastatic breast cancer by quantitative real-time reverse transcription-PCR. In the study,47 metastatic breast cancer patients were evaluated by quantitative real-time PCR for detecting EpCAM mRNA. In addition, analyses were carried out for their correlation with patients' clinicopathologic features, response, and the time to progression (TTP). The sensitivity of EpCAM mRNA in the metastatic breast cancer patients was about 40%. However, the specificity of EpCAM mRNA for 20 healthy controls was 100%. TTP was calculated, and compared with that between EpCAM mRNA-positive and EpCAM mRNA-negative groups. For the retrospective study, the median TTP was 7.1 months and 11.1 months (P=0.013) for patients with EpCAM mRNA-positive and EpCAM mRNA-negative, respectively, after the first cycle chemotherapy. Moreover, a statistically significant correlation was demonstrated between EpCAM mRNA and TTP in patients who underwent the first or the second-line chemotherapy (P=0.018), but there was no significance in the patients pretreated with two or more previous chemotherapy lines (P=0.471). This study provides evidence of the presence of EpCAM mRNA in approximately 40% of patients with metastatic breast cancer. There is a strong correlation between EpCAM mRNA results after the first cycle therapy and TTP in metastatic breast cancer patients, and EpCAM mRNA positive after chemotherapy may predict shorter TTP.

  16. Hard X-ray polarimetry with position sensitve germanium detectors. Studies of the recombination transitions into highly charged ions

    Energy Technology Data Exchange (ETDEWEB)

    Tashenov, Stanislav

    2005-07-01

    In this work a first study of the photon polarization for the process of radiative recombination has been performed. This was done at the ESR storage ring at GSI for uranium ions colliding with N2 at various collision energies. For this measurement a high purity Ge Pixel Detector with a 4 x 4 segmentation matrix was applied. The investigation was performed at the Gas-jet target of the ESR. The detector was placed at 60 and 90 observation angles. The sensitivity of the Compton scattering effect to the linear polarization of the X-Ray radiation was employed for the polarization measurement. Detailed investigations of the scattering and geometrical effects inside the detector were performed in order to develop a method to interpret the experimental data and extract the degree of the linear polarization in the hard X-Ray regime with a high precision. A special emphasis was given to the geometry of the detector and it's influence on the measured pixel-to-pixel Compton scattering intensities. The developed method enabled to achieve a precision of the order of 10% with the Pixel Detector which is dominated by the statistical uncertainties. The obtained results show a good agreement with the theoretical values derived from the exact relativistic calculations. For the case of the linear polarization of the K-REC photons, the measured data con rm the theoretical prediction that strong depolarization effects occur for high projectile charges in the forward hemisphere. The latter is in disagreement with the nonrelativistic theory which predicts a 100 % polarization regardless of the emission angle. (orig.)

  17. Hard X-ray polarimetry with position sensitve germanium detectors. Studies of the recombination transitions into highly charged ions

    International Nuclear Information System (INIS)

    Tashenov, Stanislav

    2005-01-01

    In this work a first study of the photon polarization for the process of radiative recombination has been performed. This was done at the ESR storage ring at GSI for uranium ions colliding with N2 at various collision energies. For this measurement a high purity Ge Pixel Detector with a 4 x 4 segmentation matrix was applied. The investigation was performed at the Gas-jet target of the ESR. The detector was placed at 60 and 90 observation angles. The sensitivity of the Compton scattering effect to the linear polarization of the X-Ray radiation was employed for the polarization measurement. Detailed investigations of the scattering and geometrical effects inside the detector were performed in order to develop a method to interpret the experimental data and extract the degree of the linear polarization in the hard X-Ray regime with a high precision. A special emphasis was given to the geometry of the detector and it's influence on the measured pixel-to-pixel Compton scattering intensities. The developed method enabled to achieve a precision of the order of 10% with the Pixel Detector which is dominated by the statistical uncertainties. The obtained results show a good agreement with the theoretical values derived from the exact relativistic calculations. For the case of the linear polarization of the K-REC photons, the measured data con rm the theoretical prediction that strong depolarization effects occur for high projectile charges in the forward hemisphere. The latter is in disagreement with the nonrelativistic theory which predicts a 100 % polarization regardless of the emission angle. (orig.)

  18. The effect of desulfation of chondroitin sulfate on interactions with positively charged growth factors and upregulation of cartilaginous markers in encapsulated MSCs.

    Science.gov (United States)

    Lim, Jeremy J; Temenoff, Johnna S

    2013-07-01

    Sulfated glycosaminoglycans (GAGs) are known to interact electrostatically with positively charged growth factors to modulate signaling. Therefore, regulating the degree of sulfation of GAGs may be a promising approach to tailor biomaterial carriers for controlled growth factor delivery and release. For this study, chondroitin sulfate (CS) was first desulfated to form chondroitin, and resulting crosslinked CS and chondroitin hydrogels were examined in vitro for release of positively charged model protein (histone) and for their effect on cartilaginous differentiation of encapsulated human mesenchymal stem cells (MSCs). Desulfation significantly increased the release of histone from chondroitin hydrogels (30.6 ± 2.3 μg released over 8 days, compared to natively sulfated CS with 20.2 ± 0.8 μg), suggesting that sulfation alone plays a significant role in modulating protein interactions with GAG hydrogels. MSCs in chondroitin hydrogels significantly upregulated gene expression of collagen II and aggrecan by day 21 in chondrogenic medium (115 ± 100 and 23.1 ± 7.9 fold upregulation of collagen II and aggrecan, respectively), compared to CS hydrogels and PEG-based swelling controls, indicating that desulfation may actually enhance the response of MSCs to soluble chondrogenic cues, such as TGF-β1. Thus, desulfated chondroitin materials present a promising biomaterial tool to further investigate electrostatic GAG/growth factor interactions, especially for repair of cartilaginous tissues. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Increased charge transfer of Poly (ethylene oxide) based electrolyte by addition of small molecule and its application in dye-sensitized solar cells

    International Nuclear Information System (INIS)

    Muthuraaman, B.; Will, Geoffrey; Wang, Hongxia; Moonie, Paul; Bell, John

    2013-01-01

    A Poly (ethylene oxide) based polymer electrolyte impregnated with 2-Mercapto benzimidazole was comprehensively characterized by XRD, UV–visible spectroscopy, FTIR as well as electrochemical impedance spectroscopy. It was found that the crystallization of PEO was dramatically reduced and the ionic conductivity of the electrolyte was increased 4.5 fold by addition of 2-Mercapto benzimidazole. UV–visible and FTIR spectroscopes indicated the formation of charge transfer complex between 2-Mercapto benzimidazole and iodine of the electrolyte. Dye-sensitized solar cells with the polymer electrolytes were assembled. It was found that both the photocurrent density and photovoltage were enhanced with respect to the DSC without 2-Mercapto benzimidazole, leading to a 60% increase of the performance of the cell.

  20. Charge transport parameters of HBC at different temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Kirkpatrick, J. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, V.; Kremer, K.; Andrienko, D. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Nelson, J. [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)

    2008-05-15

    We study the dependence on temperature of the charge transport parameters for hexabenzocoronene (HBC). Following from Marcus theory, two charge transport parameters will be calculated: the transfer integral and the difference in site energies. These parameters are strongly dependent on the orientation and position of molecules. Position and orientation of molecules are determined using molecular dynamics. Transfer integrals are calculated from a simplified INDO method. A technique to compute energetic disorder, that is the spread in site energies for the charge carriers, is developed. In the herringbone phase transfer integrals are higher, but so is energetic disorder. We consider three derivatives of HBC with different side chains, which lead to different phase behaviour and distributions of charge transport parameters. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  1. Collisional charging of individual submillimeter particles: Using ultrasonic levitation to initiate and track charge transfer

    Science.gov (United States)

    Lee, Victor; James, Nicole M.; Waitukaitis, Scott R.; Jaeger, Heinrich M.

    2018-03-01

    Electrostatic charging of insulating fine particles can be responsible for numerous phenomena ranging from lightning in volcanic plumes to dust explosions. However, even basic aspects of how fine particles become charged are still unclear. Studying particle charging is challenging because it usually involves the complexities associated with many-particle collisions. To address these issues, we introduce a method based on acoustic levitation, which makes it possible to initiate sequences of repeated collisions of a single submillimeter particle with a flat plate, and to precisely measure the particle charge in situ after each collision. We show that collisional charge transfer between insulators is dependent on the hydrophobicity of the contacting surfaces. We use glass, which we modify by attaching nonpolar molecules to the particle, the plate, or both. We find that hydrophilic surfaces develop significant positive charges after contacting hydrophobic surfaces. Moreover, we demonstrate that charging between a hydrophilic and a hydrophobic surface is suppressed in an acidic environment and enhanced in a basic one. Application of an electric field during each collision is found to modify the charge transfer, again depending on surface hydrophobicity. We discuss these results within the context of contact charging due to ion transfer, and we show that they lend strong support to O H- ions as the charge carriers.

  2. Influence of fused aromatic ring on the stability of charge transfer complex between iodine and some five membered heterocyclic molecules through ultrasonic and spectral studies

    Science.gov (United States)

    Ulagendran, V.; Balu, P.; Kannappan, V.; Kumar, R.; Jayakumar, S.

    2017-08-01

    The charge transfer (CT) interaction between two fused heterocyclic compounds with basic pyrrole group as donors, viz., indole (IND) and carbazole (CAR), and iodine (acceptor) in DMSO medium is investigated by ultrasonic and UV-visible spectral methods at 303 K. The formation of CT complex in these systems is established from the trend in acoustical and excess thermo acoustical properties with molar concentration. The frequency acoustic spectra (FAS) is also carried out on these two systems for two fixed concentrations 0.002 M and 0.02 M, and in the frequency range 1 MHz-10 MHz to justify the frequency chosen for ultrasonic study. The absorption coefficient values in solution are computed and discussed. The formation constants of these complexes are determined using Kannappan equation in ultrasonic method. The formation of 1:1 complexes between iodine and IND, CAR was established by the theory of Benesi - Hildebrand in the UV-visible spectroscopic method. The stability constants of the CT complexes determined by spectroscopic and ultrasonic methods show a similar trend. These values also indicate that the presence of fused aromatic ring influences significantly when compared with K values of similar CT complexes of parent five membered heterocyclic compound (pyrrole) reported by us earlier.

  3. irGPU.proton.Net: Irregular strong charge interaction networks of protonatable groups in protein molecules--a GPU solver using the fast multipole method and statistical thermodynamics.

    Science.gov (United States)

    Kantardjiev, Alexander A

    2015-04-05

    A cluster of strongly interacting ionization groups in protein molecules with irregular ionization behavior is suggestive for specific structure-function relationship. However, their computational treatment is unconventional (e.g., lack of convergence in naive self-consistent iterative algorithm). The stringent evaluation requires evaluation of Boltzmann averaged statistical mechanics sums and electrostatic energy estimation for each microstate. irGPU: Irregular strong interactions in proteins--a GPU solver is novel solution to a versatile problem in protein biophysics--atypical protonation behavior of coupled groups. The computational severity of the problem is alleviated by parallelization (via GPU kernels) which is applied for the electrostatic interaction evaluation (including explicit electrostatics via the fast multipole method) as well as statistical mechanics sums (partition function) estimation. Special attention is given to the ease of the service and encapsulation of theoretical details without sacrificing rigor of computational procedures. irGPU is not just a solution-in-principle but a promising practical application with potential to entice community into deeper understanding of principles governing biomolecule mechanisms. © 2015 Wiley Periodicals, Inc.

  4. Interaction of cationic porphyrins with DNA: Importance of the number and position of the charges and minimum structural requirements for intercalation

    International Nuclear Information System (INIS)

    Sari, M.A.; Battioni, J.P.; Dupre, D.; Mansuy, D.; Le Pecq, J.B.

    1990-01-01

    Thirty-three porphyrins or metalloporphyrins corresponding to the general formula [meso-[N-methyl-4(or 3 or 2)-pyridiniumyl] n (aryl) 4-n porphyrin]M (M = H 2 , Cu II , or ClFe III ), with n = 2-4, have been synthesized and characterized by UV-visible and 1 H NMR spectroscopy and mass spectrometry. These porphyrins differ not only in the number (2-4) and position of their cationic charges but also in the steric requirements to reach even temporarily a completely planar geometry. Interaction of these porphyrins or metalloporphyrins with calf thymus DNA has been studied and their apparent affinity binding constants have been determined by use of a competition method with ethidium bromide which was applicable not only for all the free base porphyrins but also for their copper (II) or iron (III) complexes. Whatever their mode of binding may be, their apparent affinity binding constants were relatively high and a linear decrease of log K app with the number of porphyrin charges was observed. Studies of porphyrin-DNA interactions by UV and fluorescence spectroscopy, viscosimetry, and fluorescence energy transfer experiments showed that not only the tetracationic meso-tetrakis[N-methyl-4(or 3)-pyridiniumyl]porphyrins, which both involved four freely rotating meso-aryl groups, but also the corresponding tri- and dicationic porphyrins were able to intercalate into calf thymus DNA. These results show that only half of the porphyrin ring is necessary for intercalation to occur

  5. Kinetic energies of charged fragments resulting from multifragmentation and asymmetric fission of the C60 molecule in collisions with monocharged ions (2-130 keV)

    International Nuclear Information System (INIS)

    Rentenier, A; Bordenave-Montesquieu, D; Moretto-Capelle, P; Bordenave-Montesquieu, A

    2003-01-01

    Multifragmentation and asymmetric fission (AF) of the C 60 molecule induced by H + , H 2 + , H 3 + and He + ions at medium collision energies (2-130 keV) are considered. Momenta and kinetic energies of C n + fragment ions (n = 1- 12) are deduced from an analysis of time-of-flight spectra. In multifragmentation processes, momenta are found to be approximately constant when n > 2, a behaviour which explains that the most probable kinetic energy, as well as the width of the kinetic energy distributions, is found to be inversely proportional to the fragment size n; both momenta and kinetic energies are independent of the velocity and nature of the projectile, and hence of the energy deposit. A specific study of the AF shows that the kinetic energies of C 2 + , C 4 + and C 6 + fragments are also independent of the collision velocity and projectile species; a quantitative agreement is found with values deduced from kinetic energy release measurements by another group in electron impact experiments, and the observed decrease when the mass of the light fragment increases is also reproduced. A quantitative comparison of AF and multifragmentation for the n = 2, 4 and 6 fragment ions shows that kinetic energies in AF exceed that in multifragmentation, a result which explains the oscillations observed when momenta or kinetic energies of fragments are plotted against the n-value. The AF yield is also found to scale with the energy deposit in the collision velocity range extending below the velocity at the maximum of the electronic stopping power; except for protons, it remains negligible with respect to multifragmentation as soon as the total energy deposit exceeds about 100 eV

  6. Impact of the interaction with the positive charge in adsorption of benzene and other organic compounds from aqueous solutions on carbons

    Science.gov (United States)

    Terzyk, Artur P.; Ćwiertnia, Magdalena S.; Wiśniewski, Marek; Gauden, Piotr A.; Rychlicki, Gerhard; Szymański, Grzegorz S.

    2007-02-01

    We present the results of benzene adsorption at the acidic pH level determined on the series of chemically modified activated carbons and at three temperatures. The influence of carbon surface chemical composition on benzene adsorption is discussed. It is shown that the decrease in the pH level from 7 up to 1.5 increases benzene adsorption and the only exception is carbon modified with gaseous ammonia. Basing on the results of current work and those published previously (for phenol, paracetamol, acetanilide and aniline) and using the results of quantum chemistry calculations (DFT, Gaussian 98) we show, that the value of the energy of interaction with unit positive charge is crucial during the analysis of the influence of pH level on adsorption. Obtained results allow to predict the changes in adsorption of aromatics on carbons with the decrease in the pH level.

  7. Modulational instability of ultra-low-frequency shear dust Alfvén waves in a plasma medium of positive and negatively charged dust fluids

    International Nuclear Information System (INIS)

    Mamun, A. A.

    2014-01-01

    The propagation of finite amplitude ultra-low-frequency shear dust Alfvén (SDA) waves, and their modulational instability in a magnetized plasma medium of positive and negatively charged dust fluids have been theoretically investigated by using the reductive perturbation method. The derivative nonlinear Schrödinger equation is derived to examine the stability analysis of such SDA waves. It is found that the SDA waves propagating in such an opposite polarity dust plasma medium are modulationally unstable, and that the instability criterion and the growth rate of these unstable SDA waves in such a novel opposite polarity dust plasma medium are found to be significantly different from those in electron–ion or electron–positron plasma media. The implications of the present investigation in different space environments and laboratory devices are briefly discussed.

  8. The impact of electrostatic interactions on ultrafast charge transfer at Ag 29 nanoclusters–fullerene and CdTe quantum dots–fullerene interfaces

    KAUST Repository

    Ahmed, Ghada H.; Parida, Manas R.; Tosato, Alberto; AbdulHalim, Lina G.; Usman, Anwar; Alsulami, Qana; Banavoth, Murali; Alarousu, Erkki; Bakr, Osman; Mohammed, Omar F.

    2015-01-01

    investigate the electrostatic interactions between the positively charged fullerene derivative C60-(N,N dimethylpyrrolidinium iodide) (CF) employed as an efficient molecular acceptor and two different donor molecules: Ag29 nanoclusters (NCs) and CdTe quantum

  9. PHA665752, a small-molecule inhibitor of c-Met, inhibits hepatocyte growth factor-stimulated migration and proliferation of c-Met-positive neuroblastoma cells

    International Nuclear Information System (INIS)

    Crosswell, Hal E; Dasgupta, Anindya; Alvarado, Carlos S; Watt, Tanya; Christensen, James G; De, Pradip; Durden, Donald L; Findley, Harry W

    2009-01-01

    c-Met is a tyrosine kinase receptor for hepatocyte growth factor/scatter factor (HGF/SF), and both c-Met and its ligand are expressed in a variety of tissues. C-Met/HGF/SF signaling is essential for normal embryogenesis, organogenesis, and tissue regeneration. Abnormal c-Met/HGF/SF signaling has been demonstrated in different tumors and linked to aggressive and metastatic tumor phenotypes. In vitro and in vivo studies have demonstrated inhibition of c-Met/HGF/SF signaling by the small-molecule inhibitor PHA665752. This study investigated c-Met and HGF expression in two neuroblastoma (NBL) cell lines and tumor tissue from patients with NBL, as well as the effects of PHA665752 on growth and motility of NBL cell lines. The effect of the tumor suppressor protein PTEN on migration and proliferation of tumor cells treated with PHA665752 was also evaluated. Expression of c-Met and HGF in NBL cell lines SH-EP and SH-SY5Y and primary tumor tissue was assessed by immunohistochemistry and quantitative RT-PCR. The effect of PHA665752 on c-Met/HGF signaling involved in NBL cell proliferation and migration was evaluated in c-Met-positive cells and c-Met-transfected cells. The transwell chemotaxis assay and the MTT assay were used to measure migration and proliferation/cell-survival of tumor cells, respectively. The PPAR-γ agonist rosiglitazone was used to assess the effect of PTEN on PHA665752-induced inhibition of NBL cell proliferation/cell-survival and migration High c-Met expression was detected in SH-EP cells and primary tumors from patients with advanced-stage disease. C-Met/HGF signaling induced both migration and proliferation of SH-EP cells. Migration and proliferation/cell-survival were inhibited by PHA665752 in a dose-dependent manner. We also found that induced overexpression of PTEN following treatment with rosiglitazone significantly enhanced the inhibitory effect of PHA665752 on NBL-cell migration and proliferation. c-Met is highly expressed in most tumors from

  10. A zeta potential value determines the aggregate's size of penta-substituted [60]fullerene derivatives in aqueous suspension whereas positive charge is required for toxicity against bacterial cells.

    Science.gov (United States)

    Deryabin, Dmitry G; Efremova, Ludmila V; Vasilchenko, Alexey S; Saidakova, Evgeniya V; Sizova, Elena A; Troshin, Pavel A; Zhilenkov, Alexander V; Khakina, Ekaterina A; Khakina, Ekaterina E

    2015-08-08

    The cause-effect relationships between physicochemical properties of amphiphilic [60]fullerene derivatives and their toxicity against bacterial cells have not yet been clarified. In this study, we report how the differences in the chemical structure of organic addends in 10 originally synthesized penta-substituted [60]fullerene derivatives modulate their zeta potential and aggregate's size in salt-free and salt-added aqueous suspensions as well as how these physicochemical characteristics affect the bioenergetics of freshwater Escherichia coli and marine Photobacterium phosphoreum bacteria. Dynamic light scattering, laser Doppler micro-electrophoresis, agarose gel electrophoresis, atomic force microscopy, and bioluminescence inhibition assay were used to characterize the fullerene aggregation behavior in aqueous solution and their interaction with the bacterial cell surface, following zeta potential changes and toxic effects. Dynamic light scattering results indicated the formation of self-assembled [60]fullerene aggregates in aqueous suspensions. The measurement of the zeta potential of the particles revealed that they have different surface charges. The relationship between these physicochemical characteristics was presented as an exponential regression that correctly described the dependence of the aggregate's size of penta-substituted [60]fullerene derivatives in salt-free aqueous suspension from zeta potential value. The prevalence of DLVO-related effects was shown in salt-added aqueous suspension that decreased zeta potential values and affected the aggregation of [60]fullerene derivatives expressed differently for individual compounds. A bioluminescence inhibition assay demonstrated that the toxic effect of [60]fullerene derivatives against E. coli cells was strictly determined by their positive zeta potential charge value being weakened against P. phosphoreum cells in an aquatic system of high salinity. Atomic force microscopy data suggested that the

  11. Structural properties of water around uncharged and charged carbon nanotubes

    International Nuclear Information System (INIS)

    Dezfoli, Amir Reza Ansari; Mehrabian, Mozaffar Ali; Rafsanjani, Hassan Hashemipour

    2013-01-01

    Studying the structural properties of water molecules around the carbon nanotubes is very important in a wide variety of carbon nanotubes applications. We studied the number of hydrogen bonds, oxygen and hydrogen density distributions, and water orientation around carbon nanotubes. The water density distribution for all carbon nanotubes was observed to have the same feature. In water-carbon nanotubes interface, a high-density region of water molecules exists around carbon nanotubes. The results reveal that the water orientation around carbon nanotubes is roughly dependent on carbon nanotubes surface charge. The water molecules in close distances to carbon nanotubes were found to make an HOH plane nearly perpendicular to the water-carbon nanotubes interface for carbon nanotubes with negative surface charge. For uncharged carbon nanotubes and carbon nanotubes with positive surface charge, the HOH plane was in tangential orientation with water-carbon nanotubes interface. There was also a significant reduction in hydrogen bond of water region around carbon nanotubes as compared with hydrogen bond in bulk water. This reduction was very obvious for carbon nanotubes with positive surface charge. In addition, the calculation of dynamic properties of water molecules in water-CNT interface revealed that there is a direct relation between the number of Hbonds and self-diffusion coefficient of water molecules

  12. Molecule nanoweaver

    Science.gov (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  13. Label-Free Platform for MicroRNA Detection Based on the Fluorescence Quenching of Positively Charged Gold Nanoparticles to Silver Nanoclusters.

    Science.gov (United States)

    Miao, Xiangmin; Cheng, Zhiyuan; Ma, Haiyan; Li, Zongbing; Xue, Ning; Wang, Po

    2018-01-16

    A novel strategy was developed for microRNA-155 (miRNA-155) detection based on the fluorescence quenching of positively charged gold nanoparticles [(+)AuNPs] to Ag nanoclusters (AgNCs). In the designed system, DNA-stabilized Ag nanoclusters (DNA/AgNCs) were introduced as fluorescent probes, and DNA-RNA heteroduplexes were formed upon the addition of target miRNA-155. Meanwhile, the (+)AuNPs could be electrostatically adsorbed on the negatively charged single-stranded DNA (ssDNA) or DNA-RNA heteroduplexes to quench the fluorescence signal. In the presence of duplex-specific nuclease (DSN), DNA-RNA heteroduplexes became a substrate for the enzymatic hydrolysis of the DNA strand to yield a fluorescence signal due to the diffusion of AgNCs away from (+)AuNPs. Under the optimal conditions, (+)AuNPs displayed very high quenching efficiency to AgNCs, which paved the way for ultrasensitive detection with a low detection limit of 33.4 fM. In particular, the present strategy demonstrated excellent specificity and selectivity toward the detection of target miRNA against control miRNAs, including mutated miRNA-155, miRNA-21, miRNA-141, let-7a, and miRNA-182. Moreover, the practical application value of the system was confirmed by the evaluation of the expression levels of miRNA-155 in clinical serum samples with satisfactory results, suggesting that the proposed sensing platform is promising for applications in disease diagnosis as well as the fundamental research of biochemistry.

  14. The electron trap parameter extraction-based investigation of the relationship between charge trapping and activation energy in IGZO TFTs under positive bias temperature stress

    Science.gov (United States)

    Rhee, Jihyun; Choi, Sungju; Kang, Hara; Kim, Jae-Young; Ko, Daehyun; Ahn, Geumho; Jung, Haesun; Choi, Sung-Jin; Myong Kim, Dong; Kim, Dae Hwan

    2018-02-01

    Experimental extraction of the electron trap parameters which are associated with charge trapping into gate insulators under the positive bias temperature stress (PBTS) is proposed and demonstrated for the first time in amorphous indium-gallium-zinc-oxide thin-film transistors. This was done by combining the PBTS/recovery time-evolution of the experimentally decomposed threshold voltage shift (ΔVT) and the technology computer-aided design (TCAD)-based charge trapping simulation. The extracted parameters were the trap density (NOT) = 2.6 × 1018 cm-3, the trap energy level (ΔET) = 0.6 eV, and the capture cross section (σ0) = 3 × 10-19 cm2. Furthermore, based on the established TCAD framework, the relationship between the electron trap parameters and the activation energy (Ea) is comprehensively investigated. It is found that Ea increases with an increase in σ0, whereas Ea is independent of NOT. In addition, as ΔET increases, Ea decreases in the electron trapping-dominant regime (low ΔET) and increases again in the Poole-Frenkel (PF) emission/hopping-dominant regime (high ΔET). Moreover, our results suggest that the cross-over ΔET point originates from the complicated temperature-dependent competition between the capture rate and the emission rate. The PBTS bias dependence of the relationship between Ea and ΔET suggests that the electric field dependence of the PF emission-based electron hopping is stronger than that of the thermionic field emission-based electron trapping.

  15. Quantum interference effects at room temperature in OPV-based single-molecule junctions

    DEFF Research Database (Denmark)

    Arroyo, Carlos R.; Frisenda, Riccardo; Moth-Poulsen, Kasper

    2013-01-01

    Interference effects on charge transport through an individual molecule can lead to a notable modulation and suppression on its conductance. In this letter, we report the observation of quantum interference effects occurring at room temperature in single-molecule junctions based on oligo(3......)-phenylenevinylene (OPV3) derivatives, in which the central benzene ring is coupled to either para- or meta-positions. Using the break-junction technique, we find that the conductance for a single meta-OPV3 molecule wired between gold electrodes is one order of magnitude smaller than that of a para-OPV3 molecule...

  16. Effects of charging and electric field on graphene functionalized with titanium

    International Nuclear Information System (INIS)

    Gürel, H Hakan; Ciraci, S

    2013-01-01

    Titanium atoms are adsorbed to graphene with a significant binding energy and render diverse functionalities to it. Carrying out first-principles calculations, we investigated the effects of charging and static electric field on the physical and chemical properties of graphene covered by Ti adatoms. When uniformly Ti covered graphene is charged positively, its antiferromagnetic ground state changes to ferromagnetic metal and attains a permanent magnetic moment. Static electric field applied perpendicularly causes charge transfer between Ti and graphene, and can induce metal–insulator transition. While each Ti adatom adsorbed to graphene atom can hold four hydrogen molecules with a weak binding, these molecules can be released by charging or applying electric field perpendicularly. Hence, it is demonstrated that charging and applied static electric field induce quasi-continuous and side specific modifications in the charge distribution and potential energy of adatoms absorbed to single-layer nanostructures, resulting in fundamentally crucial effects on their physical and chemical properties. (paper)

  17. Charged particle detector

    International Nuclear Information System (INIS)

    Hagen, R.D.

    1975-01-01

    A device for detecting the emission of charged particles from a specimen is described. The specimen is placed within an accumulator means which statically accumulates any charged particles emitted from the specimen. The accumulator means is pivotally positioned between a first capacitor plate having a positive electrical charge and a second capacitor plate having a negative electrical charge. The accumulator means is attracted to one capacitor plate and repelled from the other capacitor plate by an amount proportional to the amount and intensity of charged particles emitted by the specimen. (auth)

  18. Additive and interaction effects at three amino acid positions in HLA-DQ and HLA-DR molecules drive type 1 diabetes risk

    NARCIS (Netherlands)

    Hu, Xinli; Deutsch, Aaron J; Lenz, Tobias L; Onengut-Gumuscu, Suna; Han, Buhm; Chen, Wei-Min; Howson, Joanna M M; Todd, John A; de Bakker, Paul I W; Rich, Stephen S; Raychaudhuri, Soumya

    Variation in the human leukocyte antigen (HLA) genes accounts for one-half of the genetic risk in type 1 diabetes (T1D). Amino acid changes in the HLA-DR and HLA-DQ molecules mediate most of the risk, but extensive linkage disequilibrium complicates the localization of independent effects. Using

  19. Simulations of charge transport in organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Vehoff, Thorsten

    2010-05-05

    We study the charge transport properties of organic liquid crystals, i.e. hexabenzocoronene and carbazole macrocycle, and single crystals, i.e. rubrene, indolocarbazole and benzothiophene derivatives (BTBT, BBBT). The aim is to find structure-property relationships linking the chemical structure as well as the morphology with the bulk charge carrier mobility of the compounds. To this end, molecular dynamics (MD) simulations are performed yielding realistic equilibrated morphologies. Partial charges and molecular orbitals are calculated based on single molecules in vacuum using quantum chemical methods. The molecular orbitals are then mapped onto the molecular positions and orientations, which allows calculation of the transfer integrals between nearest neighbors using the molecular orbital overlap method. Thus we obtain realistic transfer integral distributions and their autocorrelations. In case of organic crystals the differences between two descriptions of charge transport, namely semi-classical dynamics (SCD) in the small polaron limit and kinetic Monte Carlo (KMC) based on Marcus rates, are studied. The liquid crystals are investigated solely in the hopping limit. To simulate the charge dynamics using KMC, the centers of mass of the molecules are mapped onto lattice sites and the transfer integrals are used to compute the hopping rates. In the small polaron limit, where the electronic wave function is spread over a limited number of neighboring molecules, the Schroedinger equation is solved numerically using a semi-classical approach. The carbazole macrocycles form columnar structures arranged on a hexagonal lattice with side chains facing inwards, so columns can closely approach each other allowing inter-columnar and thus three-dimensional transport. We are able to show that, on the time-scales of charge transport, static disorder due to slow side chain motions is the main factor determining the mobility. The high mobility of rubrene is explained by two main

  20. Positively-charged semi-tunnel is a structural and surface characteristic of polyphosphate-binding proteins: an in-silico study.

    Directory of Open Access Journals (Sweden)

    Zheng Zachory Wei

    Full Text Available Phosphate is essential for all major life processes, especially energy metabolism and signal transduction. A linear phosphate polymer, polyphosphate (polyP, linked by high-energy phosphoanhydride bonds, can interact with various proteins, playing important roles as an energy source and regulatory factor. However, polyP-binding structures are largely unknown. Here we proposed a putative polyP binding site, a positively-charged semi-tunnel (PCST, identified by surface electrostatics analyses in polyP kinases (PPKs and many other polyP-related proteins. We found that the PCSTs in varied proteins were folded in different secondary structure compositions. Molecular docking calculations revealed a significant value for binding affinity to polyP in PCST-containing proteins. Utilizing the PCST identified in the β subunit of PPK3, we predicted the potential polyP-binding domain of PPK3. The discovery of this feature facilitates future searches for polyP-binding proteins and discovery of the mechanisms for polyP-binding activities. This should greatly enhance the understanding of the many physiological functions of protein-bound polyP and the involvement of polyP and polyP-binding proteins in various human diseases.

  1. Position for Site-Specific Attachment of a DOTA Chelator to Synthetic Affibody Molecules Has a Different Influence on the Targeting Properties of 68Ga-Compared to 111In-Labeled Conjugates

    Directory of Open Access Journals (Sweden)

    Hadis Honarvar

    2014-12-01

    Full Text Available Affibody molecules, small (7 kDa scaffold proteins, are a promising class of probes for radionuclide molecular imaging. Radiolabeling of Affibody molecules with the positron-emitting nuclide 68Ga would permit the use of positron emission tomography (PET, providing better resolution, sensitivity, and quantification accuracy than single-photon emission computed tomography (SPECT. The synthetic anti-HER2 ZHER2:S1 Affibody molecule was conjugated with DOTA at the N-terminus, in the middle of helix 3, or at the C-terminus. The biodistribution of 68Ga- and 111In-labeled Affibody molecules was directly compared in NMRI nu/nu mice bearing SKOV3 xenografts. The position of the chelator strongly influenced the biodistribution of the tracers, and the influence was more pronounced for 68Ga-labeled Affibody molecules than for the 111In-labeled counterparts. The best 68Ga-labeled variant was 68Ga-[DOTA-A1]-ZHER2:S1 which provided a tumor uptake of 13 ± 1 %ID/g and a tumor to blood ratio of 39 ± 12 at 2 hours after injection. 111In-[DOTA-A1]-ZHER2:S1 and 111In-[DOTA-K58]-ZHER2:S1 were equally good at this time point, providing a tumor uptake of 15 to 16 %ID/g and a tumor to blood ratio in the range of 60 to 80. In conclusion, the selection of the best position for a chelator in Affibody molecules can be used for optimization of their imaging properties. This may be important for the development of Affibody-based and other protein-based imaging probes.

  2. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  3. Nuclear fusion rate of the muonic T3 molecule

    International Nuclear Information System (INIS)

    Faghihi, F.; Eskandari, M. R.

    2004-01-01

    The ground state binding energy, size and effective nuclear charge of the muonic T 3 molecule are calculated using Born-Oppenheimer adiabatic approximation. The system possesses two minimum positions, one at typically muonic and the second at the atomic distances. A symmetric planar vibrational model between two minima is assumed and the approximated potential are calculated. Moreover, nuclear fusion rate calculations of the short-life molecule is carried out due to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions

  4. Solvation thermodynamics and heat capacity of polar and charged solutes in water

    Science.gov (United States)

    Sedlmeier, Felix; Netz, Roland R.

    2013-03-01

    The solvation thermodynamics and in particular the solvation heat capacity of polar and charged solutes in water is studied using atomistic molecular dynamics simulations. As ionic solutes we consider a F- and a Na+ ion, as an example for a polar molecule with vanishing net charge we take a SPC/E water molecule. The partial charges of all three solutes are varied in a wide range by a scaling factor. Using a recently introduced method for the accurate determination of the solvation free energy of polar solutes, we determine the free energy, entropy, enthalpy, and heat capacity of the three different solutes as a function of temperature and partial solute charge. We find that the sum of the solvation heat capacities of the Na+ and F- ions is negative, in agreement with experimental observations, but our results uncover a pronounced difference in the heat capacity between positively and negatively charged groups. While the solvation heat capacity ΔCp stays positive and even increases slightly upon charging the Na+ ion, it decreases upon charging the F- ion and becomes negative beyond an ion charge of q = -0.3e. On the other hand, the heat capacity of the overall charge-neutral polar solute derived from a SPC/E water molecule is positive for all charge scaling factors considered by us. This means that the heat capacity of a wide class of polar solutes with vanishing net charge is positive. The common ascription of negative heat capacities to polar chemical groups might arise from the neglect of non-additive interaction effects between polar and apolar groups. The reason behind this non-additivity is suggested to be related to the second solvation shell that significantly affects the solvation thermodynamics and due to its large spatial extent induces quite long-ranged interactions between solvated molecular parts and groups.

  5. On the production of positive molecular ions in cometary comas

    International Nuclear Information System (INIS)

    Tarafdar, S.P.; Wickramasinghe, N.C.

    1977-01-01

    Positively charged molecular ions, such as H 2 O + , which have been observed in cometary comas, may be efficiently produced by the evaporation of positively charged clathrate grains of radii in the range approximately 10 -6 -10 -3 cm. Such grains may be expelled from nuclei of comets, along with gaseous molecules. Grain charging occurs via interaction with solar ultraviolet photons and/or solar wind protons. Observational data on the total quantities as well as the distributions of H 2 O and H 2 O + in cometary comas are shown to be in accord with detailed model calculations. (Auth.)

  6. A 90-day study of sub-chronic oral toxicity of 20 nm positively charged zinc oxide nanoparticles in Sprague Dawley rats

    Directory of Open Access Journals (Sweden)

    Park HS

    2014-12-01

    Full Text Available Hark-Soo Park,1 Seon-Ju Kim,1 Taek-Jin Lee,1 Geon-Yong Kim,1 EunHo Meang,1 Jeong-Sup Hong,1 Su-Hyon Kim,1 Sang-Bum Koh,1 Seung-Guk Hong,1 Yle-Shik Sun,1 Jin Seok Kang,2 Yu-Ri Kim,3 Meyoung-Kon Kim,3 Jayoung Jeong,4 Jong-Kwon Lee,4 Woo-Chan Son,5 Jae-Hak Park61General Toxicology Team, Korea Testing and Research Institute, Seoul, 2Department of Biomedical Laboratory Science, Namseoul University, Cheonan, 3Department of Biochemistry and Molecular Biology, Korea University Medical School and College, Seoul, 4National Institute of Food and Drug Safety Evaluation, Seoul, 5Department of Pathology, University of Ulsan College of Medicine, Asan Medical Center, Seoul, 6Laboratory Animal Medicine, College of Veterinary Medicine, Seoul National University, Seoul, KoreaPurpose: The study reported here was conducted to determine the systemic oral toxicity and to find the no-observed-adverse-effect level of 20 nm positively charged zinc oxide (ZnOSM,20(+ nanoparticles in Sprague Dawley rats for 90 days.Methods: For the 90-day toxicity study, the high dose was set as 500 mg per kg of body weight (mg/kg and the middle and low dose were set to 250 mg/kg and 125 mg/kg, respectively. The rats were held for a 14-day recovery period after the last administration, to observe for the persistence or reduction of any toxic effects. A distributional study was also carried out for the systemic distribution of ZnOSM,20(+ NPs.Results: No rats died during the test period. There were no significant clinical changes due to the test article during the experimental period in functional assessment, body weight, food and water consumption, ophthalmological testing, urine analysis, necropsy findings, or organ weights, but salivation was observed immediately after administration in both sexes. The total red blood cell count was increased, and hematocrit, albumin, mean cell volume, mean cell hemoglobin, and mean cell hemoglobin concentration were decreased significantly compared with

  7. Sol-gel niobia sorbent with a positively charged octadecyl ligand providing enhanced enrichment of nucleotides and organophosphorus pesticides in capillary microextraction for online HPLC analysis.

    Science.gov (United States)

    Kesani, Sheshanka; Malik, Abdul

    2018-04-01

    A niobia-based sol-gel organic-inorganic hybrid sorbent carrying a positively charged C 18 ligand (Nb 2 O 5 -C 18 (+ve)) was synthesized to achieve enhanced enrichment capability in capillary microextraction of organophosphorus compounds (which include organophosphorus pesticides and nucleotides) before their online analysis by high-performance liquid chromatography. The sorbent was designed to simultaneously provide three different types of molecular level interactions: electrostatic, Lewis acid-base, and van der Waals interactions. To understand relative contributions of various molecular level analyte-sorbent interactions in the extraction process, two other sol-gel niobia sorbents were also created: (a) a purely inorganic sol-gel niobia sorbent (Nb 2 O 5 ) and (b) an organic-inorganic hybrid sol-gel niobia sorbent carrying an electrically neutral-bonded octadecyl ligand (Nb 2 O 5 -C 18 ). The extraction efficiency of the created sol-gel niobia sorbent (Nb 2 O 5 -C 18 (+ve)) was compared with that of analogously designed and synthesized titania-based sol-gel sorbent (TiO 2 -C 18 (+ve)), taking into consideration that titania-based sorbents present state-of-the-art extraction media for organophosphorus compounds. In capillary microextraction with high-performance liquid chromatography analysis, Nb 2 O 5 -C 18 (+ve) had shown 40-50% higher specific extraction values (a measure of extraction efficiency) over that of TiO 2 -C 18 (+ve). Compared to TiO 2 -C 18 (+ve), Nb 2 O 5 -C 18 (+ve) also provided superior analyte desorption efficiency (96 vs. 90%) during the online release of the extracted organophosphorus pesticides from the sorbent coating in the capillary microextraction capillary to the chromatographic column using reversed-phase high-performance liquid chromatography mobile phase. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. A comparative study of the nanoscale and macroscale tribological attributes of alumina and stainless steel surfaces immersed in aqueous suspensions of positively or negatively charged nanodiamonds

    Science.gov (United States)

    Curtis, Colin K; Marek, Antonin; Smirnov, Alex I

    2017-01-01

    This article reports a comparative study of the nanoscale and macroscale tribological attributes of alumina and stainless steel surfaces immersed in aqueous suspensions of positively (hydroxylated) or negatively (carboxylated) charged nanodiamonds (ND). Immersion in −ND suspensions resulted in a decrease in the macroscopic friction coefficients to values in the range 0.05–0.1 for both stainless steel and alumina, while +ND suspensions yielded an increase in friction for stainless steel contacts but little to no increase for alumina contacts. Quartz crystal microbalance (QCM), atomic force microscopy (AFM) and scanning electron microscopy (SEM) measurements were employed to assess nanoparticle uptake, surface polishing, and resistance to solid–liquid interfacial shear motion. The QCM studies revealed abrupt changes to the surfaces of both alumina and stainless steel upon injection of –ND into the surrounding water environment that are consistent with strong attachment of NDs and/or chemical changes to the surfaces. AFM images of the surfaces indicated slight increases in the surface roughness upon an exposure to both +ND and −ND suspensions. A suggested mechanism for these observations is that carboxylated −NDs from aqueous suspensions are forming robust lubricious deposits on stainless and alumina surfaces that enable gliding of the surfaces through the −ND suspensions with relatively low resistance to shear. In contrast, +ND suspensions are failing to improve tribological performance for either of the surfaces and may have abraded existing protective boundary layers in the case of stainless steel contacts. This study therefore reveals atomic scale details associated with systems that exhibit starkly different macroscale tribological properties, enabling future efforts to predict and design complex lubricant interfaces. PMID:29046852

  9. A comparative study of the nanoscale and macroscale tribological attributes of alumina and stainless steel surfaces immersed in aqueous suspensions of positively or negatively charged nanodiamonds

    Directory of Open Access Journals (Sweden)

    Colin K. Curtis

    2017-09-01

    Full Text Available This article reports a comparative study of the nanoscale and macroscale tribological attributes of alumina and stainless steel surfaces immersed in aqueous suspensions of positively (hydroxylated or negatively (carboxylated charged nanodiamonds (ND. Immersion in −ND suspensions resulted in a decrease in the macroscopic friction coefficients to values in the range 0.05–0.1 for both stainless steel and alumina, while +ND suspensions yielded an increase in friction for stainless steel contacts but little to no increase for alumina contacts. Quartz crystal microbalance (QCM, atomic force microscopy (AFM and scanning electron microscopy (SEM measurements were employed to assess nanoparticle uptake, surface polishing, and resistance to solid–liquid interfacial shear motion. The QCM studies revealed abrupt changes to the surfaces of both alumina and stainless steel upon injection of –ND into the surrounding water environment that are consistent with strong attachment of NDs and/or chemical changes to the surfaces. AFM images of the surfaces indicated slight increases in the surface roughness upon an exposure to both +ND and −ND suspensions. A suggested mechanism for these observations is that carboxylated −NDs from aqueous suspensions are forming robust lubricious deposits on stainless and alumina surfaces that enable gliding of the surfaces through the −ND suspensions with relatively low resistance to shear. In contrast, +ND suspensions are failing to improve tribological performance for either of the surfaces and may have abraded existing protective boundary layers in the case of stainless steel contacts. This study therefore reveals atomic scale details associated with systems that exhibit starkly different macroscale tribological properties, enabling future efforts to predict and design complex lubricant interfaces.

  10. Covariance of charged amino acids at positions 322 and 440 of HIV-1 Env contributes to coreceptor specificity of subtype B viruses, and can be used to improve the performance of V3 sequence-based coreceptor usage prediction algorithms.

    Directory of Open Access Journals (Sweden)

    Kieran Cashin

    Full Text Available The ability to determine coreceptor usage of patient-derived human immunodeficiency virus type 1 (HIV-1 strains is clinically important, particularly for the administration of the CCR5 antagonist maraviroc. The envelope glycoprotein (Env determinants of coreceptor specificity lie primarily within the gp120 V3 loop region, although other Env determinants have been shown to influence gp120-coreceptor interactions. Here, we determined whether conserved amino acid alterations outside the V3 loop that contribute to coreceptor usage exist, and whether these alterations improve the performance of V3 sequence-based coreceptor usage prediction algorithms. We demonstrate a significant covariant association between charged amino acids at position 322 in V3 and position 440 in the C4 Env region that contributes to the specificity of HIV-1 subtype B strains for CCR5 or CXCR4. Specifically, positively charged Lys/Arg at position 322 and negatively charged Asp/Glu at position 440 occurred more frequently in CXCR4-using viruses, whereas negatively charged Asp/Glu at position 322 and positively charged Arg at position 440 occurred more frequently in R5 strains. In the context of CD4-bound gp120, structural models suggest that covariation of amino acids at Env positions 322 and 440 has the potential to alter electrostatic interactions that are formed between gp120 and charged amino acids in the CCR5 N-terminus. We further demonstrate that inclusion of a "440 rule" can improve the sensitivity of several V3 sequence-based genotypic algorithms for predicting coreceptor usage of subtype B HIV-1 strains, without compromising specificity, and significantly improves the AUROC of the geno2pheno algorithm when set to its recommended false positive rate of 5.75%. Together, our results provide further mechanistic insights into the intra-molecular interactions within Env that contribute to coreceptor specificity of subtype B HIV-1 strains, and demonstrate that incorporation

  11. Effect of Surface Hydration on Antifouling Properties of Mixed Charged Polymers.

    Science.gov (United States)

    Leng, Chuan; Huang, Hao; Zhang, Kexin; Hung, Hsiang-Chieh; Xu, Yao; Li, Yaoxin; Jiang, Shaoyi; Chen, Zhan

    2018-05-07

    Interfacial water structure on a polymer surface in water (or surface hydration) is related to the antifouling activity of the polymer. Zwitterionic polymer materials exhibit excellent antifouling activity due to their strong surface hydration. It was proposed to replace zwitterionic polymers using mixed charged polymers because it is much easier to prepare mixed charged polymer samples with much lower costs. In this study, using sum frequency generation (SFG) vibrational spectroscopy, we investigated interfacial water structures on mixed charged polymer surfaces in water, and how such structures change while exposing to salt solutions and protein solutions. The 1:1 mixed charged polymer exhibits excellent antifouling property while other mixed charged polymers with different ratios of the positive/negative charges do not. It was found that on the 1:1 mixed charged polymer surface, SFG water signal is dominated by the contribution of the strongly hydrogen bonded water molecules, indicating strong hydration of the polymer surface. The responses of the 1:1 mixed charged polymer surface to salt solutions are similar to those of zwitterionic polymers. Interestingly, exposure to high concentrations of salt solutions leads to stronger hydration of the 1:1 mixed charged polymer surface after replacing the salt solution with water. Protein molecules do not substantially perturb the interfacial water structure on the 1:1 mixed charged polymer surface and do not adsorb to the surface, showing that this mixed charged polymer is an excellent antifouling material.

  12. Molecule Matters

    Indian Academy of Sciences (India)

    DMABN, has received tremendous attention for nearly five decades. ... lar Charge Transfer (TICT) mechanism. According to this. Figure 1. A pictorial illus- tration of dual .... However, unlike the ground state measurement, this experiment.

  13. Atkins' molecules

    CERN Document Server

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  14. Interstellar Molecules

    Science.gov (United States)

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  15. Charging of dust grains in a plasma with negative ions

    International Nuclear Information System (INIS)

    Kim, Su-Hyun; Merlino, Robert L.

    2006-01-01

    The effect of negative ions on the charging of dust particles in a plasma is investigated experimentally. A plasma containing a very low percentage of electrons is formed in a single-ended Q machine when SF 6 is admitted into the vacuum system. The relatively cold Q machine electrons (T e ≅0.2 eV) readily attach to SF 6 molecules to form SF 6 - negative ions. Calculations of the dust charge indicate that for electrons, negative ions, and positive ions of comparable temperatures, the charge (or surface potential) of the dust can be positive if the positive ion mass is smaller than the negative ion mass and if ε, the ratio of the electron to positive ion density, is sufficiently small. The Q machine plasma is operated with K + positive ions (mass 39 amu) and SF 6 - negative ions (mass 146 amu), and also utilizes a rotating cylinder to dispense dust into the plasma column. Analysis of the current-voltage characteristics of a Langmuir probe in the dusty plasma shows evidence for the reduction in the (magnitude) of the negative dust charge and the transition to positively charged dust as the relative concentration of the residual electrons is reduced. Some remarks are offered concerning experiments that could become possible in a dusty plasma with positive grains

  16. Charging of dust grains in a plasma with negative ions

    Science.gov (United States)

    Kim, Su-Hyun; Merlino, Robert L.

    2006-05-01

    The effect of negative ions on the charging of dust particles in a plasma is investigated experimentally. A plasma containing a very low percentage of electrons is formed in a single-ended SF6 is admitted into the vacuum system. The relatively cold (Te≈0.2eV ) readily attach to SF6 molecules to form SF6- negative ions. Calculations of the dust charge indicate that for electrons, negative ions, and positive ions of comparable temperatures, the charge (or surface potential) of the dust can be positive if the positive ion mass is smaller than the negative ion mass and if ɛ, the ratio of the electron to positive ion density, is sufficiently small. The K+ positive ions (mass 39amu) and SF6- negative ions (mass 146amu), and also utilizes a rotating cylinder to dispense dust into the plasma column. Analysis of the current-voltage characteristics of a Langmuir probe in the dusty plasma shows evidence for the reduction in the (magnitude) of the negative dust charge and the transition to positively charged dust as the relative concentration of the residual electrons is reduced. Some remarks are offered concerning experiments that could become possible in a dusty plasma with positive grains.

  17. Detection of Individual Molecules and Ions by Carbon Nanotube-Based Differential Resistive Pulse Sensor.

    Science.gov (United States)

    Peng, Ran; Tang, Xiaowu Shirley; Li, Dongqing

    2018-04-01

    This paper presents a new method of sensing single molecules and cations by a carbon nanotube (CNT)-based differential resistive pulse sensing (RPS) technique on a nanofluidic chip. A mathematical model for multichannel RPS systems is developed to evaluate the CNT-based RPS signals. Individual cations, rhodamine B dye molecules, and ssDNAs are detected successfully with high resolution and high signal-to-noise ratio. Differentiating ssDNAs with 15 and 30 nucleotides are achieved. The experimental results also show that translocation of negatively charged ssDNAs through a CNT decreases the electrical resistance of the CNT channel, while translocation of positively charged cations and rhodamine B molecules increases the electrical resistance of the CNT. The CNT-based nanofluidic device developed in this work provides a new avenue for single-molecule/ion detection and offers a potential strategy for DNA sequencing. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Constrained-DFT method for accurate energy-level alignment of metal/molecule interfaces

    KAUST Repository

    Souza, A. M.

    2013-10-07

    We present a computational scheme for extracting the energy-level alignment of a metal/molecule interface, based on constrained density functional theory and local exchange and correlation functionals. The method, applied here to benzene on Li(100), allows us to evaluate charge-transfer energies, as well as the spatial distribution of the image charge induced on the metal surface. We systematically study the energies for charge transfer from the molecule to the substrate as function of the molecule-substrate distance, and investigate the effects arising from image-charge confinement and local charge neutrality violation. For benzene on Li(100) we find that the image-charge plane is located at about 1.8 Å above the Li surface, and that our calculated charge-transfer energies compare perfectly with those obtained with a classical electrostatic model having the image plane located at the same position. The methodology outlined here can be applied to study any metal/organic interface in the weak coupling limit at the computational cost of a total energy calculation. Most importantly, as the scheme is based on total energies and not on correcting the Kohn-Sham quasiparticle spectrum, accurate results can be obtained with local/semilocal exchange and correlation functionals. This enables a systematic approach to convergence.

  19. Constrained-DFT method for accurate energy-level alignment of metal/molecule interfaces

    KAUST Repository

    Souza, A. M.; Rungger, I.; Pemmaraju, C. D.; Schwingenschlö gl, Udo; Sanvito, S.

    2013-01-01

    We present a computational scheme for extracting the energy-level alignment of a metal/molecule interface, based on constrained density functional theory and local exchange and correlation functionals. The method, applied here to benzene on Li(100), allows us to evaluate charge-transfer energies, as well as the spatial distribution of the image charge induced on the metal surface. We systematically study the energies for charge transfer from the molecule to the substrate as function of the molecule-substrate distance, and investigate the effects arising from image-charge confinement and local charge neutrality violation. For benzene on Li(100) we find that the image-charge plane is located at about 1.8 Å above the Li surface, and that our calculated charge-transfer energies compare perfectly with those obtained with a classical electrostatic model having the image plane located at the same position. The methodology outlined here can be applied to study any metal/organic interface in the weak coupling limit at the computational cost of a total energy calculation. Most importantly, as the scheme is based on total energies and not on correcting the Kohn-Sham quasiparticle spectrum, accurate results can be obtained with local/semilocal exchange and correlation functionals. This enables a systematic approach to convergence.

  20. An ab initio study of the field-induced position change of a C60 molecule adsorbed on a gold tip

    DEFF Research Database (Denmark)

    Stadler, Robert; Kubatkin, S.; Bjørnholm, Thomas

    2007-01-01

    lightning rod effect which might explain the switching between configurations found in experiments. We also analyse our results for the adsorption energetics in terms of an electrostatic expression for the total energy, where the dependence of the polarizability of the junction on the position of the C60...

  1. Atomic charges of sulfur in ionic liquids: experiments and calculations.

    Science.gov (United States)

    Fogarty, Richard M; Rowe, Rebecca; Matthews, Richard P; Clough, Matthew T; Ashworth, Claire R; Brandt, Agnieszka; Corbett, Paul J; Palgrave, Robert G; Smith, Emily F; Bourne, Richard A; Chamberlain, Thomas W; Thompson, Paul B J; Hunt, Patricia A; Lovelock, Kevin R J

    2017-12-14

    Experimental near edge X-ray absorption fine structure (NEXAFS) spectra, X-ray photoelectron (XP) spectra and Auger electron spectra are reported for sulfur in ionic liquids (ILs) with a range of chemical structures. These values provide experimental measures of the atomic charge in each IL and enable the evaluation of the suitability of NEXAFS spectroscopy and XPS for probing the relative atomic charge of sulfur. In addition, we use Auger electron spectroscopy to show that when XPS binding energies differ by less than 0.5 eV, conclusions on atomic charge should be treated with caution. Our experimental data provides a benchmark for calculations of the atomic charge of sulfur obtained using different methods. Atomic charges were computed for lone ions and ion pairs, both in the gas phase (GP) and in a solvation model (SMD), with a wide range of ion pair conformers considered. Three methods were used to compute the atomic charges: charges from the electrostatic potential using a grid based method (ChelpG), natural bond orbital (NBO) population analysis and Bader's atoms in molecules (AIM) approach. By comparing the experimental and calculated measures of the atomic charge of sulfur, we provide an order for the sulfur atoms, ranging from the most negative to the most positive atomic charge. Furthermore, we show that both ChelpG and NBO are reasonable methods for calculating the atomic charge of sulfur in ILs, based on the agreement with both the XPS and NEXAFS spectroscopy results. However, the atomic charges of sulfur derived from ChelpG are found to display significant, non-physical conformational dependence. Only small differences in individual atomic charge of sulfur were observed between lone ion (GP) and ion pair IL(SMD) model systems, indicating that ion-ion interactions do not strongly influence individual atomic charges.

  2. Measuring momentum for charged particle tomography

    Science.gov (United States)

    Morris, Christopher; Fraser, Andrew Mcleod; Schultz, Larry Joe; Borozdin, Konstantin N.; Klimenko, Alexei Vasilievich; Sossong, Michael James; Blanpied, Gary

    2010-11-23

    Methods, apparatus and systems for detecting charged particles and obtaining tomography of a volume by measuring charged particles including measuring the momentum of a charged particle passing through a charged particle detector. Sets of position sensitive detectors measure scattering of the charged particle. The position sensitive detectors having sufficient mass to cause the charged particle passing through the position sensitive detectors to scatter in the position sensitive detectors. A controller can be adapted and arranged to receive scattering measurements of the charged particle from the charged particle detector, determine at least one trajectory of the charged particle from the measured scattering; and determine at least one momentum measurement of the charged particle from the at least one trajectory. The charged particle can be a cosmic ray-produced charged particle, such as a cosmic ray-produced muon. The position sensitive detectors can be drift cells, such as gas-filled drift tubes.

  3. Adhesion molecules

    CERN Document Server

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  4. Positive photocatalysis of a Diels-Alder reaction by quenching of excited naphthalene-indole charge-transfer complex with cyclohexadiene.

    Science.gov (United States)

    Gonzalez-Béjar, María; Stiriba, Salah-Eddine; Miranda, Miguel A; Pérez-Prieto, Julia

    2007-02-01

    [reaction: see text] Naphthalene photo-catalyzes formation of cyclohexadiene-indole cycloadducts in a wavelength-dependent process. Steady-state irradiation and time-resolved fluorescence studies agree well with NP-InH ground-state charge transfer (CT) complexes as the key species responsible for the photo-catalyzed process.

  5. Adhesion, growth and osteogenic differentiation of human bone marrow mesenchymal stem cells on positively and negatively charged and uncharged ferroelectric crystal surfaces\

    Czech Academy of Sciences Publication Activity Database

    Vandrovcová, Marta; Bačáková, Lucie; Vaněk, Přemysl; Petzelt, Jan

    2016-01-01

    Roč. 19, č. 135 (2016), s. 2-7 ISSN 1429-7248 R&D Projects: GA ČR(CZ) GA15-01558S Institutional support: RVO:67985823 ; RVO:68378271 Keywords : electroactive ceramics * surface charge * cell number * bone matrix mineralization Subject RIV: EI - Biotechnology ; Bionics; BO - Biophysics (FZU-D)

  6. Charge imbalance

    International Nuclear Information System (INIS)

    Clarke, J.

    1981-01-01

    This article provides a long theoretical development of the main ideas of charge imbalance in superconductors. Concepts of charge imbalance and quasiparticle charge are introduced, especially in regards to the use of tunnel injection in producing and detecting charge imbalance. Various mechanisms of charge relaxation are discussed, including inelastic scattering processes, elastic scattering in the presence of energy-gap anisotropy, and various pair-breaking mechanisms. In each case, present theories are reviewed in comparison with experimental data

  7. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  8. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  9. Symmetry-breaking intramolecular charge transfer in the excited state of meso-linked BODIPY dyads

    KAUST Repository

    Whited, Matthew T.; Patel, Niral M.; Roberts, Sean T.; Allen, Kathryn; Djurovich, Peter I.; Bradforth, Stephen E.; Thompson, Mark E.

    2012-01-01

    We report the synthesis and characterization of symmetric BODIPY dyads where the chromophores are attached at the meso position, using either a phenylene bridge or direct linkage. Both molecules undergo symmetry-breaking intramolecular charge transfer in the excited state, and the directly linked dyad serves as a visible-light-absorbing analogue of 9,9′-bianthryl.

  10. Electrons in Molecules

    Indian Academy of Sciences (India)

    structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

  11. The interactions of high-energy, highly charged Xe ions with buckyballs

    International Nuclear Information System (INIS)

    Ali, R.; Berry, H.G.; Cheng, S.

    1994-01-01

    Ionization and fragmentation have been measured for C 60 molecules bombarded by highly charged (up to 35+) xenon ions with energies ranging up to 625 MeV. The observed mass distribution of positively charged fragments is explained in terms of a theoretical model indicating that the total interaction cross section contains roughly equal contributions from (a) excitation of the giant plasmon resonance, and (b) large-energy-transfer processes that lead to multiple fragmentation of the molecule. Preliminary results of measurements on VUV photons emitted in these interactions are also presented

  12. AARHUS: Exotic charge states in ASTRID

    International Nuclear Information System (INIS)

    Moller, Soren Pape

    1995-01-01

    Ions are atoms from which one or more orbital electrons have been detached. This removal can be done, for example, by impact of other electrons. Today beams of bare ions - nuclei without any electrons - are available, for example at the GSI heavy ion Laboratory, Darmstadt, even for the heaviest elements. Molecules too can be ionized by removal of one electron and these molecules can be accelerated to form high energy beams. Molecules are, however, generally not expected to be stable when more than one electron is missing, since there is too little negative charge to bind the positive nuclei. It was therefore a surprise when a stable doubly-charged molecular ion was found at experiments at the ASTRID storage ring, Aarhus, Denmark. The aim of the experiment was to measure lifetimes of expected metastable states of doubly-charged carbon monoxide, CO ++ . The CO ++ ions were produced in an ion source and the accelerated beam injected into the storage ring. The circulating intensity was then monitored by detecting neutral species produced in restgas collisions at the end of a straight section. For CO ++ , a fraction of the beam survived for tens of seconds, with a lifetime around 4 seconds. This lifetime was dominated by restgas collisions. The base pressure was around 2 x 10 -11 mbar. In order to avoid contamination from molecules with the same mass/charge ratio, e.g. singly-charged nitrogen-14, the carbon monoxide used was based on the naturally rare isotope carbon-13 rather than the abundant carbon-12. Many atoms can also bind an additional electron and form negative ions. Several negative ions are metastable, and lifetime measurements performed at ASTRID and elsewhere produce accurate results important for comparisons with theory. Double-charged negative ions could in principle exist, and indications of metastable states of H - and O - were seen some years ago as resonances in the electron bombardment of negative hydrogen ions. This process was recently studied at

  13. AARHUS: Exotic charge states in ASTRID

    Energy Technology Data Exchange (ETDEWEB)

    Moller, Soren Pape

    1995-04-15

    Ions are atoms from which one or more orbital electrons have been detached. This removal can be done, for example, by impact of other electrons. Today beams of bare ions - nuclei without any electrons - are available, for example at the GSI heavy ion Laboratory, Darmstadt, even for the heaviest elements. Molecules too can be ionized by removal of one electron and these molecules can be accelerated to form high energy beams. Molecules are, however, generally not expected to be stable when more than one electron is missing, since there is too little negative charge to bind the positive nuclei. It was therefore a surprise when a stable doubly-charged molecular ion was found at experiments at the ASTRID storage ring, Aarhus, Denmark. The aim of the experiment was to measure lifetimes of expected metastable states of doubly-charged carbon monoxide, CO{sup ++}. The CO{sup ++} ions were produced in an ion source and the accelerated beam injected into the storage ring. The circulating intensity was then monitored by detecting neutral species produced in restgas collisions at the end of a straight section. For CO{sup ++}, a fraction of the beam survived for tens of seconds, with a lifetime around 4 seconds. This lifetime was dominated by restgas collisions. The base pressure was around 2 x 10{sup -11} mbar. In order to avoid contamination from molecules with the same mass/charge ratio, e.g. singly-charged nitrogen-14, the carbon monoxide used was based on the naturally rare isotope carbon-13 rather than the abundant carbon-12. Many atoms can also bind an additional electron and form negative ions. Several negative ions are metastable, and lifetime measurements performed at ASTRID and elsewhere produce accurate results important for comparisons with theory. Double-charged negative ions could in principle exist, and indications of metastable states of H{sup -} and O{sup -} were seen some years ago as resonances in the electron bombardment of negative hydrogen ions. This

  14. Bond charges and electronic charge transfer in ternary semiconductors

    International Nuclear Information System (INIS)

    Pietsch, U.

    1986-01-01

    By means of a simple molecule-theoretic model of 'linear superposition of two-electron molecules' the bond charges between nearest neighbours and the effective charges of ions are calculated for ternary zinc-blende structure alloys as well as chalcopyrite semiconductors. Taking into account both, the charge transfer among the ions caused by the differences of electronegativities of atoms used and between the bonds created by the internal stress of the lattice a nearly unvaried averaged bond charge amount of the alloy is found, but rather dramatically changed local bond charge parameters in comparison with the respective values of binary compounds used. This fact should influence the noncentral force interaction in such semiconductors. (author)

  15. Theory and simulation of charge transport in disordered organic semiconductors

    NARCIS (Netherlands)

    Bobbert, P.A.; Kondov, I.; Sutman, G.

    2013-01-01

    Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges

  16. Carbonyltrichlorotris(dimethylphenylphosphine)technetium-ethanol (1/1), the first seven-coordinate complex of technetium; position of this molecule in the Csub(3v) family

    Energy Technology Data Exchange (ETDEWEB)

    Bandoli, G; Clemente, D A; Mazzi, U [Consiglio Nazionale delle Ricerche, Padua (Italy). Lab. di Chimica e Tecnologia dei Radioelementi

    1978-01-01

    The preparation and the crystal and molecular structure of the title complex are reported. The coordination polyhedron is that of a distorted capped octahedron Csub(3v) symmetry). The technetium atom is seven-coordnate and bonded to three phosphine ligands (capped face), three chlorine ligands (uncapped face), and to the carbonyl group, which occupies the unique capping position. Crystals are monoclinic, space group P2/sub 1//c, with cell dimensions a = 11.732(9), b = 11.807(9), c = 23.588(12) A, and ..beta..103.42(8)/sup 0/. The structure has been refined by least squares to a conventional R of 0.093 for 1 794 observed reflections. Metal-ligand bond lengths are: Tc-CO 1.86(2), Tc-C1 2.48(1). and Tc-p 2.44(1) A. Seven coordinate complexes are briefly reviewed: in particular, a description of Csub(3v) symmetry and its distortions has been developed in terms of repulsion theory and the angular-overlap model.

  17. Intact Four-atom Organic Tetracation Stabilized by Charge Localization in the Gas Phase.

    Science.gov (United States)

    Yatsuhashi, Tomoyuki; Toyota, Kazuo; Mitsubayashi, Naoya; Kozaki, Masatoshi; Okada, Keiji; Nakashima, Nobuaki

    2016-10-05

    Several features distinguish intact multiply charged molecular cations (MMCs) from other species such as monocations and polycations: high potential energy, high electron affinity, a high density of electronic states with various spin multiplicities, and charge-dependent reactions. However, repulsive Coulombic interactions make MMCs quite unstable, and hence small organic MMCs are currently not readily available. Herein, we report that the isolated four-atom molecule diiodoacetylene survives after the removal of four electrons via tunneling. We show that the tetracation remains metastable towards dissociation because of the localization (91-95 %) of the positive charges on the terminal iodine atoms, ensuring minimum Coulomb repulsion between adjacent atoms as well as maximum charge-induced attractive dipole interactions between iodine and carbon. Our approach making use of iodines as the positively charged sites enables small organic MMCs to remain intact. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Exploration of sensing of nitrogen dioxide and ozone molecules using novel TiO2/Stanene heterostructures employing DFT calculations

    Science.gov (United States)

    Abbasi, Amirali; Sardroodi, Jaber Jahanbin

    2018-06-01

    Based on the density functional theory (DFT) calculations, we explored the sensing capabilities and electronic structures of TiO2/Stanene heterostructures as novel and highly efficient materials for detection of toxic NO2 and O3 molecules in the environment. Studied gas molecules were positioned at different sites and orientations towards the nanocomposite, and the adsorption process was examined based on the most stable structures. We found that both of these molecules are chemically adsorbed on the TiO2/Stanene heterostructures. The calculations of the adsorption energy indicate that the fivefold coordinated titanium sites of the TiO2/Stanene are the most stable sites for the adsorption of NO2 and O3 molecules. The side oxygen atoms of the gas molecules were found to be chemically bonded to these titanium atoms. The adsorption of gas molecules is an exothermic process, and the adsorption on the pristine nanocomposite is more favorable in energy than that on the nitrogen-doped nanocomposite. The effects of van der Waals interactions were taken into account, which indicate the adsorption energies were increased for the most sable configurations. The gas sensing response and charge transfers were analyzed in detail. The pristine nanocomposites have better sensing response than the doped ones. The spin density distribution plots indicate that the magnetization was mainly located over the adsorbed gas molecules. Mulliken charge analysis reveals that both NO2 and O3 molecules behave as charge acceptors, as evidenced by the accumulation of electronic charges on the adsorbed molecules predicted by charge density difference calculations. Our DFT results provide a theoretical basis for an innovative gas sensor system designed from a sensitive TiO2/Stanene heterostructures for efficient detection of harmful air pollutants such as NO2 and O3.

  19. Single molecule transistor based nanopore for the detection of nicotine

    Energy Technology Data Exchange (ETDEWEB)

    Ray, S. J., E-mail: ray.sjr@gmail.com [Institute of Materials Science, Technical University of Darmstadt, Alarich-Weiss-Str. 2, 64287 Darmstadt (Germany)

    2014-12-28

    A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.

  20. Single molecule transistor based nanopore for the detection of nicotine

    Science.gov (United States)

    Ray, S. J.

    2014-12-01

    A nanopore based detection methodology was proposed and investigated for the detection of Nicotine. This technique uses a Single Molecular Transistor working as a nanopore operational in the Coulomb Blockade regime. When the Nicotine molecule is pulled through the nanopore area surrounded by the Source(S), Drain (D), and Gate electrodes, the charge stability diagram can detect the presence of the molecule and is unique for a specific molecular structure. Due to the weak coupling between the different electrodes which is set by the nanopore size, the molecular energy states stay almost unaffected by the electrostatic environment that can be realised from the charge stability diagram. Identification of different orientation and position of the Nicotine molecule within the nanopore area can be made from specific regions of overlap between different charge states on the stability diagram that could be used as an electronic fingerprint for detection. This method could be advantageous and useful to detect the presence of Nicotine in smoke which is usually performed using chemical chromatography techniques.

  1. Fractional charges

    International Nuclear Information System (INIS)

    Saminadayar, L.

    2001-01-01

    20 years ago fractional charges were imagined to explain values of conductivity in some materials. Recent experiments have proved the existence of charges whose value is the third of the electron charge. This article presents the experimental facts that have led theorists to predict the existence of fractional charges from the motion of quasi-particles in a linear chain of poly-acetylene to the quantum Hall effect. According to the latest theories, fractional charges are neither bosons nor fermions but anyons, they are submitted to an exclusive principle that is less stringent than that for fermions. (A.C.)

  2. First charge collection and position-precision data on the medium-resistivity silicon strip detectors before and after neutron irradiation up to 2x1014 n/cm2

    International Nuclear Information System (INIS)

    Li Zheng; Dezillie, B.; Eremin, V.; Li, C.J.; Verbitskaya, E.

    1999-01-01

    Test strip detectors of 125 μm, 500 μm, and 1 mm pitches with about 1 cm 2 areas have been made on medium-resistivity silicon wafers (1.3 and 2.7 kΩ cm). Detectors of 500 μm pitch have been tested for charge collection and position precision before and after neutron irradiation (up to 2x10 14 n/cm 2 ) using 820 and 1030 nm laser lights with different beam-spot sizes. It has been found that for a bias of 250 V a strip detector made of 1.3 kΩ cm (300 μm thick) can be fully depleted before and after an irradiation of 2x10 14 n/cm 2 . For a 500 μm pitch strip detector made of 2.7 kΩ cm tested with an 1030 nm laser light with 200 μm spot size, the position reconstruction error is about 14 μm before irradiation, and 17 μm after about 1.7x10 13 n/cm 2 irradiation. We demonstrated in this work that medium resistivity silicon strip detectors can work just as well as the traditional high-resistivity ones, but with higher radiation tolerance. We also tested charge sharing and position reconstruction using a 1030 nm wavelength (300 μm absorption length in Si at RT) laser, which provides a simulation of MIP particles in high-physics experiments in terms of charge collection and position reconstruction

  3. Detecting and identifying small molecules in a nanopore flux capacitor

    International Nuclear Information System (INIS)

    Bearden, Samuel; Zhang, Guigen; McClure, Ethan

    2016-01-01

    A new method of molecular detection in a metallic-semiconductor nanopore was developed and evaluated with experimental and computational methods. Measurements were made of the charging potential of the electrical double layer (EDL) capacitance as charge-carrying small molecules translocated the nanopore. Signals in the charging potential were found to be correlated to the physical properties of analyte molecules. From the measured signals, we were able to distinguish molecules with different valence charge or similar valence charge but different size. The relative magnitude of the signals from different analytes was consistent over a wide range of experimental conditions, suggesting that the detected signals are likely due to single molecules. Computational modeling of the nanopore system indicated that the double layer potential signal may be described in terms of disruption of the EDL structure due to the size and charge of the analyte molecule, in agreement with Huckel and Debye’s analysis of the electrical atmosphere of electrolyte solutions. (paper)

  4. Charge orders in organic charge-transfer salts

    International Nuclear Information System (INIS)

    Kaneko, Ryui; Valentí, Roser; Tocchio, Luca F; Becca, Federico

    2017-01-01

    Motivated by recent experimental suggestions of charge-order-driven ferroelectricity in organic charge-transfer salts, such as κ -(BEDT-TTF) 2 Cu[N(CN) 2 ]Cl, we investigate magnetic and charge-ordered phases that emerge in an extended two-orbital Hubbard model on the anisotropic triangular lattice at 3/4 filling. This model takes into account the presence of two organic BEDT-TTF molecules, which form a dimer on each site of the lattice, and includes short-range intramolecular and intermolecular interactions and hoppings. By using variational wave functions and quantum Monte Carlo techniques, we find two polar states with charge disproportionation inside the dimer, hinting to ferroelectricity. These charge-ordered insulating phases are stabilized in the strongly correlated limit and their actual charge pattern is determined by the relative strength of intradimer to interdimer couplings. Our results suggest that ferroelectricity is not driven by magnetism, since these polar phases can be stabilized also without antiferromagnetic order and provide a possible microscopic explanation of the experimental observations. In addition, a conventional dimer-Mott state (with uniform density and antiferromagnetic order) and a nonpolar charge-ordered state (with charge-rich and charge-poor dimers forming a checkerboard pattern) can be stabilized in the strong-coupling regime. Finally, when electron–electron interactions are weak, metallic states appear, with either uniform charge distribution or a peculiar 12-site periodicity that generates honeycomb-like charge order. (paper)

  5. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  6. Optically directed molecular transport and 3D isoelectric positioning of amphoteric biomolecules

    International Nuclear Information System (INIS)

    Hafeman, Dean G.; Harkins, James B.; Witkowski, Charles E. II; Lewis, Nathan S.; Brown, Gilbert M.; Warmack, Robert J. Bruce; Thundat, Thomas George

    2006-01-01

    We demonstrate the formation of charged molecular packets and their transport within optically created electrical force-field traps in a pH-buffered electrolyte. We call this process photoelectrophoretic localization and transport (PELT). The electrolyte is in contact with a photoconductive semiconductor electrode and a counterelectrode that are connected through an external circuit. A light beam directed to coordinates on the photoconductive electrode surface produces a photocurrent within the circuit and electrolyte. Within the electrolyte, the photocurrent creates localized force-field traps centered at the illuminated coordinates. Charged molecules, including polypeptides and proteins, electrophoretically accumulate into the traps and subsequently can be transported in the electrolyte by moving the traps over the photoconductive electrode in response to movement of the light beam. The molecules in a single trap can be divided into aliquots, and the aliquots can be directed along multiple routes simultaneously by using multiple light beams. This photoelectrophoretic transport of charged molecules by PELT resembles the electrostatic transport of electrons within force-field wells of solid-state charge-coupled devices. The molecules, however, travel in a liquid electrolyte rather than a solid. Furthermore, we have used PELT to position amphoteric biomolecules in three dimensions. A 3D pH gradient was created in an electrolyte medium by controlling the illumination position on a photoconductive anode where protons were generated electrolytically. Photoelectrophoretic transport of amphoteric molecules through the pH gradient resulted in accumulation of the molecules at their apparent 3D isoelectric coordinates in the medium.

  7. Internal Charging

    Science.gov (United States)

    Minow, Joseph I.

    2014-01-01

    (1) High energy (>100keV) electrons penetrate spacecraft walls and accumulate in dielectrics or isolated conductors; (2) Threat environment is energetic electrons with sufficient flux to charge circuit boards, cable insulation, and ungrounded metal faster than charge can dissipate; (3) Accumulating charge density generates electric fields in excess of material breakdown strenght resulting in electrostatic discharge; and (4) System impact is material damage, discharge currents inside of spacecraft Faraday cage on or near critical circuitry, and RF noise.

  8. Charge migration and charge transfer in molecular systems

    Directory of Open Access Journals (Sweden)

    Hans Jakob Wörner

    2017-11-01

    Full Text Available The transfer of charge at the molecular level plays a fundamental role in many areas of chemistry, physics, biology and materials science. Today, more than 60 years after the seminal work of R. A. Marcus, charge transfer is still a very active field of research. An important recent impetus comes from the ability to resolve ever faster temporal events, down to the attosecond time scale. Such a high temporal resolution now offers the possibility to unravel the most elementary quantum dynamics of both electrons and nuclei that participate in the complex process of charge transfer. This review covers recent research that addresses the following questions. Can we reconstruct the migration of charge across a molecule on the atomic length and electronic time scales? Can we use strong laser fields to control charge migration? Can we temporally resolve and understand intramolecular charge transfer in dissociative ionization of small molecules, in transition-metal complexes and in conjugated polymers? Can we tailor molecular systems towards specific charge-transfer processes? What are the time scales of the elementary steps of charge transfer in liquids and nanoparticles? Important new insights into each of these topics, obtained from state-of-the-art ultrafast spectroscopy and/or theoretical methods, are summarized in this review.

  9. Charge gradient microscopy

    Science.gov (United States)

    Roelofs, Andreas; Hong, Seungbum

    2018-02-06

    A method for rapid imaging of a material specimen includes positioning a tip to contact the material specimen, and applying a force to a surface of the material specimen via the tip. In addition, the method includes moving the tip across the surface of the material specimen while removing electrical charge therefrom, generating a signal produced by contact between the tip and the surface, and detecting, based on the data, the removed electrical charge induced through the tip during movement of the tip across the surface. The method further includes measuring the detected electrical charge.

  10. Technetium-aspirin molecule complexes

    International Nuclear Information System (INIS)

    El-Shahawy, A.S.; Mahfouz, R.M.; Aly, A.A.M.; El-Zohry, M.

    1993-01-01

    Technetium-aspirin and technetium-aspirin-like molecule complexes were prepared. The structure of N-acetylanthranilic acid (NAA) has been decided through CNDO calculations. The ionization potential and electron affinity of the NAA molecule as well as the charge densities were calculated. The electronic absorption spectra of Tc(V)-Asp and Tc(V)-ATS complexes have two characteristic absorption bands at 450 and 600 nm, but the Tc(V)-NAA spectrum has one characteristic band at 450 nm. As a comparative study, Mo-ATS complex was prepared and its electronic absorption spectrum is comparable with the Tc-ATS complex spectrum. (author)

  11. Organization and intramolecular charge-transfer enhancement in tripodal tris[(pyridine-4-yl)phenyl]amine push-pull molecules by intercalation into layered materials bearing acidic functionalities

    Czech Academy of Sciences Publication Activity Database

    Melánová, Klára; Cvejn, D.; Bureš, F.; Zima, Vítězslav; Svoboda, Jan; Beneš, L.; Mikysek, T.; Pytela, O.; Knotek, P.

    2014-01-01

    Roč. 43, č. 27 (2014), s. 10462-10470 ISSN 1477-9226 R&D Projects: GA ČR(CZ) GA13-01061S Institutional support: RVO:61389013 Keywords : tripodal push-pull molecules * intercalation * zirconium hydrogenphosphate Subject RIV: CA - Inorganic Chemistry Impact factor: 4.197, year: 2014

  12. Where to place the positive muon in the Periodic Table?

    Science.gov (United States)

    Goli, Mohammad; Shahbazian, Shant

    2015-03-14

    In a recent study it was suggested that the positively charged muon is capable of forming its own "atoms in molecules" (AIM) in the muonic hydrogen-like molecules, composed of two electrons, a muon and one of the hydrogen's isotopes, thus deserves to be placed in the Periodic Table [Phys. Chem. Chem. Phys., 2014, 16, 6602]. In the present report, the capacity of the positively charged muon in forming its own AIM is considered in a large set of molecules replacing muons with all protons in the hydrides of the second and third rows of the Periodic Table. Accordingly, in a comparative study the wavefunctions of both sets of hydrides and their muonic congeners are first derived beyond the Born-Oppenheimer (BO) paradigm, assuming protons and muons as quantum waves instead of clamped particles. Then, the non-BO wavefunctions are used to derive the AIM structures of both hydrides and muonic congeners within the context of the multi-component quantum theory of atoms in molecules. The results of the analysis demonstrate that muons are generally capable of forming their own atomic basins and the properties of these basins are not fundamentally different from those AIM containing protons. Particularly, the bonding modes in the muonic species seem to be qualitatively similar to their congener hydrides and no new bonding model is required to describe the bonding of muons to a diverse set of neighboring atoms. All in all, the positively charged muon is similar to a proton from the structural and bonding viewpoint and deserves to be placed in the same box of hydrogen in the Periodic Table. This conclusion is in line with a large body of studies on the chemical kinetics of the muonic molecules portraying the positively charged muon as a lighter isotope of hydrogen.

  13. Charge preamplifier

    International Nuclear Information System (INIS)

    Chaminade, R.; Passerieux, J.P.

    1961-01-01

    We describe a charge preamplifier having the following properties: - large open loop gain giving both stable gain and large input charge transfer; - stable input grid current with aging and without any adjustment; - fairly fast rise; - nearly optimum noise performance; - industrial material. (authors)

  14. Charge Meter

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 19; Issue 4. Charge Meter: Easy Way to Measure Charge and Capacitance: Some Interesting Electrostatic Experiments. M K Raghavendra V Venkataraman. Classroom Volume 19 Issue 4 April 2014 pp 376-390 ...

  15. ARCHITECTURE OF A CHARGE-TRANSFER STATE REGULATING LIGHT HARVESTING IN A PLANT ANTENNA PROTEIN

    Energy Technology Data Exchange (ETDEWEB)

    Fleming, Graham; Ahn, Tae Kyu; Avenson, Thomas J.; Ballottari, Matteo; Cheng, Yuan-Chung; Niyogi, Krishna K.; Bassi, Roberto; Fleming, Graham R.

    2008-04-02

    Energy-dependent quenching of excess absorbed light energy (qE) is a vital mechanism for regulating photosynthetic light harvesting in higher plants. All of the physiological characteristics of qE have been positively correlated with charge-transfer between coupled chlorophyll and zeaxanthin molecules in the light-harvesting antenna of photosystem II (PSII). In this work, we present evidence for charge-transfer quenching in all three of the individual minor antenna complexes of PSII (CP29, CP26, and CP24), and we conclude that charge-transfer quenching in CP29 involves a de-localized state of an excitonically coupled chlorophyll dimer. We propose that reversible conformational changes in CP29 can `tune? the electronic coupling between the chlorophylls in this dimer, thereby modulating the energy of the chlorophylls-zeaxanthin charge-transfer state and switching on and off the charge-transfer quenching during qE.

  16. Charging machine

    International Nuclear Information System (INIS)

    Medlin, J.B.

    1976-01-01

    A charging machine for loading fuel slugs into the process tubes of a nuclear reactor includes a tubular housing connected to the process tube, a charging trough connected to the other end of the tubular housing, a device for loading the charging trough with a group of fuel slugs, means for equalizing the coolant pressure in the charging trough with the pressure in the process tubes, means for pushing the group of fuel slugs into the process tube and a latch and a seal engaging the last object in the group of fuel slugs to prevent the fuel slugs from being ejected from the process tube when the pusher is removed and to prevent pressure liquid from entering the charging machine. 3 claims, 11 drawing figures

  17. Structure-charge mobility relation for hexabenzocoronene derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Kirkpatrick, James [Max Planck Institute for Polymer Research, Ackermannweg 10, Mainz 55128 (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, Valentina; Kremer, Kurt [Max Planck Institute for Polymer Research, Ackermannweg 10, Mainz 55128 (Germany); Nelson, Jenny [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Andrienko, Denis

    2008-05-15

    Charge mobilities of several derivatives of discotic liquid crystals have been determined by combining three methods into one scheme: (i) quantum chemical methods for the calculation of molecular electronic structures and reorganization energies (ii) molecular dynamics for simulation of the relative positions and orientations of molecules in a columnar mesophase, and (iii) kinetic Monte Carlo simulations and Master Equation approach to simulate charge transport. Applying this scheme to differently substituted hexabenzocoronene derivatives we reproduce the trends and magnitudes of mobilities as measured by pulse-radiolysis time-resolved microwave conductivity (PR-TRMC) and connect mobility directly to the microscopic morphology of the columns. Our study also shows that it is possible to understand and reproduce experimental charge transport parameters, and, in some cases, accurately predict them. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  18. A charge exchange chamber with built-in focusing

    International Nuclear Information System (INIS)

    Devienne, F.M.

    1975-01-01

    This invention concerns a charge exchange chamber with built-in focusing enabling a beam of low divergence neutrals to be obtained from a beam of ions of a given energy. The ion beam enters the charge exchange chamber filled with a neutral gas under pressure, the effect of which is an exchange of charges between the ions and the neutral molecules or atoms of the gas. The positive ions are substantially sent along the axis of the enclosure, characterised in that it includes electric facilities for concentrating the ions of the beam near this axis. These electric facilities are composed of a series of grids perpendicular to the direction of the ion jet, grids that are transparent and of negative potential and the potential of each of these grids increases in absolute value along the path of the ion jet in the enclosure [fr

  19. Electrostatic Charging and Particle Interactions in Microscopic Insulating Grains

    Science.gov (United States)

    Lee, Victor

    In this thesis, we experimentally investigate the electrostatic charging as well as the particle interactions in microscopic insulating grains. First, by tracking individual grains accelerated in an electric field, we quantitatively demonstrate that tribocharging of same-material grains depends on particle size. Large grains tend to charge positively, and small ones tend to charge negatively. Theories based on the transfer of trapped electrons can explain this tendency but have not been validated. Here we show that the number of trapped electrons, measured independently by a thermoluminescence technique, is orders of magnitude too small to be responsible for the amount of charge transferred. This result reveals that trapped electrons are not responsible for same-material tribocharging of dielectric particles. Second, same-material tribocharging in grains can result in important long-range electrostatic interactions. However, how these electrostatic interactions contribute to particle clustering remains elusive, primarily due to the lack of direct, detailed observations. Using a high-speed camera that falls with a stream charged grains, we observe for the first time how charged grains can undergo attractive as well as repulsive Kepler-like orbits. Charged particles can be captured in their mutual electrostatic potential and form clusters via multiple bounces. Dielectric polarization effects are directly observed, which lead to additional attractive forces and stabilize "molecule-like" arrangements of charged particles. Third, we have developed a new method to study the charge transfer of microscopic particles based on acoustic levitation techniques. This method allows us to narrow the complex problem of many-particle charging down to precise charge measurements of a single sub-millimeter particle colliding with a target plate. By simply attaching nonpolar groups onto glass surfaces, we show that the contact charging of a particle is highly dependent on

  20. Charge independence and charge symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Miller, G A [Washington Univ., Seattle, WA (United States). Dept. of Physics; van Oers, W T.H. [Manitoba Univ., Winnipeg, MB (Canada). Dept. of Physics; [TRIUMF, Vancouver, BC (Canada)

    1994-09-01

    Charge independence and charge symmetry are approximate symmetries of nature, violated by the perturbing effects of the mass difference between up and down quarks and by electromagnetic interactions. The observations of the symmetry breaking effects in nuclear and particle physics and the implications of those effects are reviewed. (author). 145 refs., 3 tabs., 11 figs.

  1. Charge independence and charge symmetry

    International Nuclear Information System (INIS)

    Miller, G.A.

    1994-09-01

    Charge independence and charge symmetry are approximate symmetries of nature, violated by the perturbing effects of the mass difference between up and down quarks and by electromagnetic interactions. The observations of the symmetry breaking effects in nuclear and particle physics and the implications of those effects are reviewed. (author). 145 refs., 3 tabs., 11 figs

  2. Nuclear Fusion Rate Study of a Muonic Molecule via Nuclear Threshold Resonances

    Science.gov (United States)

    Faghihi, F.; Eskandari, M. R.

    This work follows our previous calculations of the ground state binding energy, size, and the effective nuclear charge of the muonic T3 molecule, using the Born-Oppenheimer adiabatic approximation. In our past articles, we showed that the system possesses two minimum positions, the first one at the muonic distance and the second at the atomic distance. Also, the symmetric planner vibrational model assumed between the two minima and the approximated potential were calculated. Following from the previous studies, we now calculate the fusion rate of the T3 muonic molecule according to the overlap integral of the resonance nuclear compound nucleus and the molecular wave functions.

  3. Tunnelling of a molecule

    International Nuclear Information System (INIS)

    Jarvis, P.D.; Bulte, D.P.

    1998-01-01

    A quantum-mechanical description of tunnelling is presented for a one-dimensional system with internal oscillator degrees of freedom. The 'charged diatomic molecule' is frustrated on encountering a barrier potential by its centre of charge not being coincident with its centre of mass, resulting in transitions amongst internal states. In an adiabatic limit, the tunnelling of semiclassical coherent-like oscillator states is shown to exhibit the Hartman and Bueuttiker-Landauer times t H and t BL , with the time dependence of the coherent state parameter for the tunnelled state given by α(t) = α e -iω(t+Δt) , Δt = t H - it BL . A perturbation formalism is developed, whereby the exact transfer matrix can be expanded to any desired accuracy in a suitable limit. An 'intrinsic' time, based on the oscillator transition rate during tunnelling, transmission or reflection, is introduced. In simple situations the resulting intrinsic tunnelling time is shown to vanish to lowest order. In the general case a particular (nonzero) parametrisation is inferred, and its properties discussed in comparison with the literature on tunnelling times for both wavepackets and internal clocks. Copyright (1998) CSIRO Australia

  4. Search for fractional charge

    International Nuclear Information System (INIS)

    Turner, R.E.

    1984-01-01

    A search was made for fractional charges of the form Z plus two-thirds e, where Z is an integer. It was assumed that the charges exist in natural form bound with other fractional charges in neutral molecules. It was further assumed that these neutral molecules are present in air. Two concentration schemes were employed. One sample was derived from the waste gases from a xenon distillation plant. This assumes that high mass, low vapor pressure components of air are concentrated along with the xenon. The second sample involved ionizing air, allowing a brief recombination period, and then collecting residual ions on the surface of titanium discs. Both samples were analyzed at the University of Rochester in a system using a tandem Van de Graff to accelerate particles through an essentially electrostatic beam handling system. The detector system employed both a Time of Flight and an energy-sensitive gas ionization detector. In the most sensitive mode of analysis, a gas absorber was inserted in the beam path to block the intense background. The presence of an absorber limited the search to highly penetrating particles. Effectively, this limited the search to particles with low Z and masses greater than roughly fifty GeV. The final sensitivities attained were on the order of 1 x 10 -20 for the ionized air sample and 1 x 10 -21 for the gas sample. A discussion of the caveats that could reduce the actual level of sensitivity is included

  5. Superexcited states of molecules

    International Nuclear Information System (INIS)

    Nakamura, Hiroki; Takagi, Hidekazu.

    1990-01-01

    The report addresses the nature and major features of molecule's superexcited states, focusing on their involvement in dynamic processes. It also outlines the quantum defect theory which allows various processes involving these states to be treated in a unified way. The Rydberg state has close relation with an ionized state with a positive energy. The quantum defect theory interprets such relation. Specifically, the report first describes the quantum defect theory focusing on its basic principle. The multi-channel quantum defect theory is then outlined centering on how to describe a Rydberg-type superexcited state. Description of a dissociative double-electron excited state is also discussed. The quantum defect theory is based on the fact that the physics of the motion of a Rydberg electron vary with the region in the electron's coordinate space. Finally, various molecular processes that involve a superexcited state are addressed focusing on autoionization, photoionization, dissociative recombination and bonding ionization of diatomic molecules. (N.K.)

  6. Rapid charging of nickel-cadmium accumulators

    Energy Technology Data Exchange (ETDEWEB)

    Bruck, F

    1972-01-01

    Four types of charging of gas-tight Ni-Cd accumulators (a) normal; (b) accelerated; (c) rapid; and (d) ultra-rapid are described. For rapid charging, a built-in temperature sensor cuts off charging current at a prescribed point. In ultra-rapid charging, 50% charge can be attained in 3.5 min. and 25% charge within 50 sec. In the second phase of ultra-rapid charging, a surplus of oxygen is released at the positive electrode and a safety valve is provided for pressure reduction. Characteristic curves are given for various rates of charging and some data on discharge rates is also given.

  7. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid

    2015-01-01

    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  8. Synthesis of positively charged hybrid PHMB-stabilized silver nanoparticles: the search for a new type of active substances used in plant protection products

    Science.gov (United States)

    Krutyakov, Yurii A.; Kudrinsky, Alexey A.; Gusev, Alexander A.; Zakharova, Olga V.; Klimov, Alexey I.; Yapryntsev, Alexey D.; Zherebin, Pavel M.; Shapoval, Olga A.; Lisichkin, Georgii V.

    2017-07-01

    Modern agriculture calls for a decrease in pesticide application, particularly in order to decrease the negative impact on the environment. Therefore the development of new active substances and plant protection products (PPP) to minimize the chemical load on ecosystems is a very important problem. Substances based on silver nanoparticles are a promising solution of this problem because of the fact that in correct doses such products significantly increase yields and decrease crop diseases while displaying low toxicity to humans and animals. In this paper we for the first time propose application of polymeric guanidine compounds with varying chain lengths (from 10 to 130 elementary links) for the design and synthesis of modified silver nanoparticles to be used as the basis of a new generation of PPP. Colloidal solutions of nanocrystalline silver containing 0.5 g l-1 of silver and 0.01-0.4 g l-1 of polyhexamethylene biguanide hydrochloride (PHMB) were obtained by reduction of silver nitrate with sodium borohydride in the presence of PHMB. The field experiment has shown that silver-containing solutions have a positive effect on agronomic properties of potato, wheat and apple. Also the increase in activity of such antioxidant system enzymes as peroxidase and catalase in the tissues of plants treated with nanosilver has been registered.

  9. Photoionization of atoms and molecules

    International Nuclear Information System (INIS)

    Samson, J.A.R.

    1976-01-01

    A literature review on the present state of knowledge in photoionization is presented. Various experimental techniques that have been developed to study photoionization, such as fluorescence and photoelectron spectroscopy, mass spectroscopy, are examined. Various atoms and molecules were chosen to illustrate these techniques, specifically helium and xenon atoms and hydrogen molecules. Specialized photoionization such as in positive and negative ions, excited states, and free radicals is also treated. Absorption cross sections and ionization potentials are also discussed

  10. New porphyrins bearing positively charged peripheral groups linked by a sulfonamide group to meso-tetraphenylporphyrin: interactions with calf thymus DNA.

    Science.gov (United States)

    Manono, Janet; Marzilli, Patricia A; Marzilli, Luigi G

    2009-07-06

    New water-soluble cationic meso-tetraarylporphyrins (TArP, Ar = 4-C(6)H(4)) and some metal derivatives have been synthesized and characterized. One main goal was to assess if N-methylpyridinium (N-Mepy) groups must be directly attached to the porphyrin core for intercalative binding of porphyrins to DNA. The new porphyrins have the general formula, [T(R(2)R(1)NSO(2)Ar)P]X(4/8) (R(1) = CH(3) or H and R(2) = N-Mepy-n-CH(2) with n = 2, 3, or 4; or R(1) = R(2) = Et(3)NCH(2)CH(2)). Interactions of selected porphyrins and metalloporphyrins (Cu(II), Zn(II)) with calf thymus DNA were investigated by visible circular dichroism (CD), absorption, and fluorescence spectroscopies. The DNA-induced changes in the porphyrin Soret region (a positive induced CD feature and, at high DNA concentration, increases in the Soret band and fluorescence intensities) indicate that the new porphyrins interact with DNA in an outside, non-self-stacking binding mode. Several new metalloporphyrins did not increase DNA solution viscosity and thus do not intercalate, confirming the conclusion drawn from spectroscopic studies. Porphyrins known to intercalate typically bear two or more N-Mepy groups directly attached to the porphyrin ring, such as the prototypical meso-tetra(N-Mepy)porphyrin tetracation (TMpyP(4)). The distances between the nitrogens of the N-Mepy group are estimated to be approximately 11 A (cis) and 16 A (trans) for the relatively rigid TMpyP(4). For the new flexible porphyrin, [T(N-Mepy-4-CH(2)(CH(3))NSO(2)Ar)P]Cl(4), the distances between the nitrogens are estimated to be able to span the range from approximately 9 to approximately 25 A. Thus, the N-Mepy groups in the new porphyrins can adopt the same spacing as in known intercalators such as TMpyP(4). The absence of intercalation by the new porphyrins indicates that the propensity for the N-Mepy group to facilitate DNA intercalation of cationic porphyrins requires direct attachment of N-Mepy groups to the porphyrin core.

  11. Hereditary folate malabsorption: A positively charged amino acid at position 113 of the proton-coupled folate transporter (PCFT/SLC46A1) is required for folic acid binding

    International Nuclear Information System (INIS)

    Lasry, Inbal; Berman, Bluma; Glaser, Fabian; Jansen, Gerrit; Assaraf, Yehuda G.

    2009-01-01

    The proton-coupled folate transporter (PCFT/SLC46A1) mediates intestinal folate uptake at acidic pH. Some loss of folic acid (FA) transport mutations in PCFT from hereditary folate malabsorption (HFM) patients cluster in R113, thereby suggesting a functional role for this residue. Herein, unlike non-conservative substitutions, an R113H mutant displayed 80-fold increase in the FA transport Km while retaining parental Vmax, hence indicating a major fall in folate substrate affinity. Furthermore, consistent with the preservation of 9% of parental transport activity, R113H transfectants displayed a substantial decrease in the FA growth requirement relative to mock transfectants. Homology modeling based on the crystal structures of the Escherichia coli transporter homologues EmrD and glycerol-3-phosphate transporter revealed that the R113H rotamer properly protrudes into the cytoplasmic face of the minor cleft normally occupied by R113. These findings constitute the first demonstration that a basic amino acid at position 113 is required for folate substrate binding.

  12. Resonance charge exchange processes

    International Nuclear Information System (INIS)

    Duman, E.L.; Evseev, A.V.; Eletskij, A.V.; Radtsig, A.A.; Smirnov, B.M.

    1979-01-01

    The calculation results for the resonance charge exchange cross sections for positive and negative atomic and molecular ions are given. The calculations are performed on the basis of the asymptotic theory. The factors affecting the calculation accuracy are analysed. The calculation data for 28 systems are compared with the experiment

  13. Photonic Molecule Lasers Revisited

    Science.gov (United States)

    Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.

    2014-05-01

    Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

  14. Dynamics of Interfacial Charge Transfer States and Carriers Separation in Dye-Sensitized Solar Cells: A Time-Resolved Terahertz Spectroscopy Study

    OpenAIRE

    Brauer, Jan C.; Marchioro, Arianna; Paraecattil, Arun A.; Oskouei, Ahmad A.; Moser, Jacques-E.

    2015-01-01

    Electron injection from a photoexcited molecular sensitizer into a wide-bandgap semiconductor is the primary step toward charge separation in dye-sensitized solar cells (DSSCs). According to the current understanding of DSSCs functioning mechanism, charges are separated directly during this primary electron transfer process, yielding hot conduction band electrons in the semiconductor and positive holes localized on oxidized dye molecules at the surface. Comparing results of ultrafast transien...

  15. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Multi-Excitonic Quantum Dot Molecules

    Science.gov (United States)

    Scheibner, M.; Stinaff, E. A.; Doty, M. F.; Ware, M. E.; Bracker, A. S.; Gammon, D.; Ponomarev, I. V.; Reinecke, T. L.; Korenev, V. L.

    2006-03-01

    With the ability to create coupled pairs of quantum dots, the next step towards the realization of semiconductor based quantum information processing devices can be taken. However, so far little knowledge has been gained on these artificial molecules. Our photoluminescence experiments on single InAs/GaAs quantum dot molecules provide the systematics of coupled quantum dots by delineating the spectroscopic features of several key charge configurations in such quantum systems, including X, X^+,X^2+, XX, XX^+ (with X being the neutral exciton). We extract general rules which determine the formation of molecular states of coupled quantum dots. These include the fact that quantum dot molecules provide the possibility to realize various spin configurations and to switch the electron hole exchange interaction on and off by shifting charges inside the molecule. This knowledge will be valuable in developing implementations for quantum information processing.

  17. Understanding charge transport in molecular electronics.

    Science.gov (United States)

    Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R

    2003-12-01

    For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.

  18. Effect of substrate bias on deposition behaviour of charged silicon nanoparticles in ICP-CVD process

    International Nuclear Information System (INIS)

    Yoo, Seung-Wan; Kim, Jung-Hyung; Seong, Dae-Jin; You, Shin-Jae; Seo, Byong-Hoon; Hwang, Nong-Moon

    2017-01-01

    The effect of a substrate bias on the deposition behaviour of crystalline silicon films during inductively coupled plasma chemical vapour deposition (ICP-CVD) was analysed by consideration of non-classical crystallization, in which the building block is a nanoparticle rather than an individual atom or molecule. The coexistence of positively and negatively charged nanoparticles in the plasma and their role in Si film deposition are confirmed by applying bias voltages to the substrate, which is sufficiently small as not to affect the plasma potential. The sizes of positively and negatively charged nanoparticles captured on a carbon membrane and imaged using TEM are, respectively, 2.7–5.5 nm and 6–13 nm. The film deposited by positively charged nanoparticles has a typical columnar structure. In contrast, the film deposited by negatively charged nanoparticles has a structure like a powdery compact with the deposition rate about three times higher than that for positively charged nanoparticles. All the films exhibit crystallinity even though the substrate is at room temperature, which is attributed to the deposition of crystalline nanoparticles formed in the plasma. The film deposited by negatively charged nanoparticles has the highest crystalline fraction of 0.84. (paper)

  19. Oppositely charged colloids out of equilibrium

    Science.gov (United States)

    Vissers, T.

    2010-11-01

    Colloids are particles with a size in the range of a few nanometers up to several micrometers. Similar to atomic and molecular systems, they can form gases, liquids, solids, gels and glasses. Colloids can be used as model systems because, unlike molecules, they are sufficiently large to be studied directly with light microscopy and move sufficiently slow to study their dynamics. In this thesis, we study binary systems of polymethylmethacrylate (PMMA) colloidal particles suspended in low-polar solvent mixtures. Since the ions can still partially dissociate, a surface charge builds up which causes electrostatic interactions between the colloids. By carefully tuning the conditions inside the suspension, we make two kinds of particles oppositely charged. To study our samples, we use Confocal Laser Scanning Microscopy (CLSM). The positively and negatively charged particles can be distinguished by a different fluorescent dye. Colloids constantly experience a random motion resulting from random kicks of surrounding solvent molecules. When the attractions between the oppositely charged particles are weak, the particles can attach and detach many times and explore a lot of possible configurations and the system can reach thermodynamic equilibrium. For example, colloidal ‘ionic’ crystals consisting of thousands to millions of particles can form under the right conditions. When the attractions are strong, the system can become kinetically trapped inside a gel-like state. We observe that when the interactions change again, crystals can even emerge again from this gel-like phase. By using local order parameters, we quantitatively study the crystallization of colloidal particles and identify growth defects inside the crystals. We also study the effect of gravity on the growth of ionic crystals by using a rotating stage. We find that sedimentation can completely inhibit crystal growth and plays an important role in crystallization from the gel-like state. The surface

  20. Sources for charged particles

    International Nuclear Information System (INIS)

    Arianer, J.

    1997-01-01

    This document is a basic course on charged particle sources for post-graduate students and thematic schools on large facilities and accelerator physics. A simple but precise description of the creation and the emission of charged particles is presented. This course relies on every year upgraded reference documents. Following relevant topics are considered: electronic emission processes, technological and practical considerations on electron guns, positron sources, production of neutral atoms, ionization, plasma and discharge, different types of positive and negative ion sources, polarized particle sources, materials for the construction of ion sources, low energy beam production and transport. (N.T.)

  1. Position-sensitive X-ray detectors

    International Nuclear Information System (INIS)

    Hendrix, J.

    1982-01-01

    An overview is given of the different types of position-sensitive X-ray detectors used in kinetic studies of biological molecule state changes using X-ray diffraction with synchrotron radiation as a probe. The detector requirements and principles of operation of proportional counters are outlined. Multiwire proportional chamber systems and their readout techniques are described. Other detectors discussed include a drift chamber type detector, microchannel plates, charge-couple devices and, for high count rates, an integrating TV-detector. (U.K.)

  2. Associating Oligonucleotides with Positively Charged Liposomes

    Czech Academy of Sciences Publication Activity Database

    Jurkiewicz, P.; Okruszek, A.; Hof, Martin; Langner, M.

    2003-01-01

    Roč. 8, č. 1 (2003), s. 77-84 ISSN 1425-8153 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : oligonucleotides * fluorescence correlation spectroscopy * DOTAP Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 0.455, year: 2003

  3. Single-molecule dynamics in nanofabricated traps

    Science.gov (United States)

    Cohen, Adam

    2009-03-01

    The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

  4. First charge collection and position-precision data on the medium-resistivity silicon strip detectors before and after neutron irradiation up to 2x10 sup 1 sup 4 n/cm sup 2

    CERN Document Server

    Li Zheng; Eremin, V; Li, C J; Verbitskaya, E

    1999-01-01

    Test strip detectors of 125 mu m, 500 mu m, and 1 mm pitches with about 1 cm sup 2 areas have been made on medium-resistivity silicon wafers (1.3 and 2.7 k OMEGA cm). Detectors of 500 mu m pitch have been tested for charge collection and position precision before and after neutron irradiation (up to 2x10 sup 1 sup 4 n/cm sup 2) using 820 and 1030 nm laser lights with different beam-spot sizes. It has been found that for a bias of 250 V a strip detector made of 1.3 k OMEGA cm (300 mu m thick) can be fully depleted before and after an irradiation of 2x10 sup 1 sup 4 n/cm sup 2. For a 500 mu m pitch strip detector made of 2.7 k OMEGA cm tested with an 1030 nm laser light with 200 mu m spot size, the position reconstruction error is about 14 mu m before irradiation, and 17 mu m after about 1.7x10 sup 1 sup 3 n/cm sup 2 irradiation. We demonstrated in this work that medium resistivity silicon strip detectors can work just as well as the traditional high-resistivity ones, but with higher radiation tolerance. We als...

  5. Towards high charge carrier mobilities by rational design of organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Andrienko, Denis; Ruehle, Victor; Baumeier, Bjoern; Vehoff, Thorsten; Lukyanov, Alexander; Kremer, Kurt [Max Planck Institute for Polymer Research, Mainz (Germany); Marcon, Valentina [Technische Universitaet Darmstadt (Germany); Kirkpatrick, James; Nelson, Jenny [Imperial College London (United Kingdom); Lennartz, Christian [BASF AG, Ludwigshafen (Germany)

    2010-07-01

    The role of material morphology on charge carrier mobility in partially disordered organic semiconductors is discussed for several classes of materials: derivatives of hexabenzocoronenens, perylenediimides, triangularly-shaped polyaromatic hydrocarbons, and Alq{sub 3}. Simulations are performed using a package developed by Imperial College, London and Max Planck Institute for Polymer Research, Mainz (votca.org). This package combines several techniques into one scheme: quantum chemical methods for the calculation of molecular electronic structures and reorganization energies; molecular dynamics and systematic coarse-graining approaches for simulation of self-assembly and relative positions and orientations of molecules on large scales; kinetic Monte Carlo and master equation for studies of charge transport.

  6. Hydration of excess electrons trapped in charge pockets on molecular surfaces

    Science.gov (United States)

    Jalbout, Abraham F.; Del Castillo, R.; Adamowicz, Ludwik

    2007-01-01

    In this work we strive to design a novel electron trap located on a molecular surface. The process of electron trapping involves hydration of the trapped electron. Previous calculations on surface electron trapping revealed that clusters of OH groups can form stable hydrogen-bonded networks on one side of a hydrocarbon surface (i.e. cyclohexane sheets), while the hydrogen atoms on the opposite side of the surface form pockets of positive charge that can attract extra negative charge. The excess electron density on such surfaces can be further stabilized by interactions with water molecules. Our calculations show that these anionic systems are stable with respect to vertical electron detachment (VDE).

  7. Tunable optical absorption in silicene molecules

    KAUST Repository

    Mokkath, Junais Habeeb; Schwingenschlö gl, Udo

    2016-01-01

    Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.

  8. Tunable optical absorption in silicene molecules

    KAUST Repository

    Mokkath, Junais Habeeb

    2016-07-13

    Two-dimensional materials with a tunable band gap that covers a wide range of the solar spectrum hold great promise for sunlight harvesting. For this reason, we investigate the structural, electronic, and optical properties of silicene molecules using time dependent density functional theory. We address the influence of the molecular size, buckling, and charge state as well as that of a dielectric environment. Unlike planar graphene molecules, silicene molecules prefer to form low-buckled structures with strong visible to ultraviolet optical response. We also identify molecular plasmons.

  9. Kinetic energies of charged fragments resulting from multifragmentation and asymmetric fission of the C{sub 60} molecule in collisions with monocharged ions (2-130 keV)

    Energy Technology Data Exchange (ETDEWEB)

    Rentenier, A; Bordenave-Montesquieu, D; Moretto-Capelle, P; Bordenave-Montesquieu, A [Laboratoire CAR-IRSAMC, UMR 5589 CNRS - Universite Paul Sabatier, 118 Route de Narbonne, 31062 Toulouse Cedex (France)

    2003-04-28

    Multifragmentation and asymmetric fission (AF) of the C{sub 60} molecule induced by H{sup +}, H{sub 2}{sup +}, H{sub 3}{sup +} and He{sup +} ions at medium collision energies (2-130 keV) are considered. Momenta and kinetic energies of C{sub n}{sup +} fragment ions (n = 1- 12) are deduced from an analysis of time-of-flight spectra. In multifragmentation processes, momenta are found to be approximately constant when n > 2, a behaviour which explains that the most probable kinetic energy, as well as the width of the kinetic energy distributions, is found to be inversely proportional to the fragment size n; both momenta and kinetic energies are independent of the velocity and nature of the projectile, and hence of the energy deposit. A specific study of the AF shows that the kinetic energies of C{sub 2}{sup +}, C{sub 4}{sup +} and C{sub 6}{sup +} fragments are also independent of the collision velocity and projectile species; a quantitative agreement is found with values deduced from kinetic energy release measurements by another group in electron impact experiments, and the observed decrease when the mass of the light fragment increases is also reproduced. A quantitative comparison of AF and multifragmentation for the n = 2, 4 and 6 fragment ions shows that kinetic energies in AF exceed that in multifragmentation, a result which explains the oscillations observed when momenta or kinetic energies of fragments are plotted against the n-value. The AF yield is also found to scale with the energy deposit in the collision velocity range extending below the velocity at the maximum of the electronic stopping power; except for protons, it remains negligible with respect to multifragmentation as soon as the total energy deposit exceeds about 100 eV.

  10. Study on molecular modelling of the selectivity of catalysts for heavy petroleum fractions hydrocracking; Etude sur molecule modele des parametres regissant la selectivite des catalyseurs d'hydrocraquage des charges lourdes

    Energy Technology Data Exchange (ETDEWEB)

    Leite, L.

    2000-10-19

    Hydrocracking is a catalytic petroleum refining process that is commonly applied to upgrade the heavier fractions obtained from the distillation of crude oils. Nowadays the European demand for good quality middle distillates (kerosene and gas-oil) is high and one important goal for the refining is to transform selectively feedstocks into middle distillates. To understand how this transformation occurs, studies on model compounds have been investigated. Numerous studies have been devoted to paraffin hydrocracking. However theses molecules do not fully represent heavy petroleum fraction. Taking into account that the trend in the future will be to treat heavier feedstocks containing a large quantity of PNA (Polynuclear Aromatic hydrocarbons), the understanding of their transformation under hydrocracking conditions is a key point. In this study, we studied hydrocracking of phenanthrene over platinum on acid solids catalysts. Our main aim was to compare hydrocracking catalysts in term of catalytic activity and selectivity toward primary products thanks to our model reaction and to correlate these catalytic performances with acid solid properties and especially to rationalize the effects due to the acidity and the porosity of the acid solids. Catalytic experiments emphasised an effect of the porous structure on the selectivities. The acidity of the catalysts seemed to impose the catalytic activity but did not permit to explain the selectivities. This 'effect of the structure' has been clarified with the simulation of intermediate products adsorption and diffusion in the studied structures thanks to a molecular modelling study. Indeed, the selectivities obtained during phenanthrene hydrocracking have been linked up with the intermediate products adsorption energies in the structures. The results of this study permit to propose that the key-step for selectivities determination is the physical desorption of the primary products. (author)

  11. Equilibrium configurations of tripolar charges

    International Nuclear Information System (INIS)

    Yershov, V.N.

    2005-01-01

    It is shown that an ensemble of particles with tripolar (color) charges will necessarily cohere in a hierarchy of structures, from simple clusters and strings to complex aggregates and cyclic molecule-like structures. The basic combinatoric rule remains essentially the same on different levels of the hierarchy, thus leading to a pattern of resemblance between different levels. The number of primitive charges in each structure is determined by the symmetry of the combined effective potential of this structure. The outlined scheme can serve as a framework for building a model of composite fundamental fermions. (author)

  12. Study of the electronic structure at the interface between fluorene-1-carboxylic acid molecules and Cu(110)

    International Nuclear Information System (INIS)

    Song Fei; Mao Hongying; Guan Dandan; Dou Weidong; Zhang Hanjie; Li Haiyang; He Pimo; Bao Shining; Hofmann, Philip

    2009-01-01

    The interface electronic properties of fluorene-1-carboxylic acid (FC-1) adsorbed on Cu(110) have been studied by ultraviolet photoemission spectroscopy (UPS) and first-principles calculations. Both the molecular orbitals and the Cu valence band are significantly modified upon adsorption. FC-1 is chemically bonded to Cu(110) through charge donation and back donation involving the lowest unoccupied molecular orbital (LUMO) and the highest occupied molecular orbital (HOMO) of the molecule. An observed reduction of the work function can be attributed to the adsorption induced charge redistribution, and the positive interface dipole.

  13. Trapping molecules in two and three dimensions

    International Nuclear Information System (INIS)

    Pinkse, PW.H.; Junglen, T.; Rieger, T.; Rangwala, S.A.; Windpassinger, P.; Rempe, G.

    2005-01-01

    Full text: Cold molecules offer a new testing ground for quantum-physical effects in nature. For example, producing slow beams of large molecules could push experiments studying the boundary between quantum interference and classical particles up towards ever heavier particles. Moreover, cold molecules, in particular YbF, seem an attractive way to narrow down the constraints on the value of the electron dipole moment and finally, quantum information processing using chains of cold polar molecules or vibrational states in molecules have been proposed. All these proposals rely on advanced production and trapping techniques, most of which are still under development. Therefore, novel production and trapping techniques for cold molecules could offer new possibilities not found in previous methods. Electric traps hold promise for deep trap potentials for neutral molecules. Recently we have demonstrated two-dimensional trapping of polar molecules in a four-wire guide using electrostatic and electrodynamic trapping techniques. Filled from a thermal effusive source, such a guide will deliver a beam of slow molecules, which is an ideal source for interferometry experiments with large molecules, for instance. Here we report about the extension of this work to three-dimensional trapping. Polar molecules with a positive Stark shift can be trapped in the minimum of an electrostatic field. We have successfully tested a large volume electrostatic trap for ND3 molecules. A special feature of this trap is that it can be loaded continuously from an electrostatic guide, at a temperature of a few hundred mK. (author)

  14. Positively charged polysilsesquioxane/iodide lonic liquid as a quasi solid-state redox electrolyte for dye-sensitized photo electrochemical cells: infrared, 29 Si NMR, and electrical studies

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available A new sol-gel precursor based on 1-methyl-3-[3-(trimethoxy- λ 4 -silylpropyl]-1 H -imidazolium iodide (MTMSPI + I − was synthesized and investigated as a potential novel quasi solid-state ionic liquid redox electrolyte for dye-synthesized photoelectrochemical (DSPEC cells of the Graetzel type. MTMSPI + I − was hydrolyzed with acidified water and the reaction products of the sol-gel condensation reactions assessed with the help of 29 Si NMR and infrared spectroscopic techniques. Results of the time-dependent spectra analyses showed the formation of positively charged polyhedral cube-like silsesquioxane species that still contained a small amount of silanol end groups, which were removed after heating at 200 ° C . After cooling, the resulting material formed is a tough, yellowish, and transparent solid, which could be reheated again and used for assembling DSPEC cells. The addition of iodine increased the specific conductivity of the hydrolyzed and nonhydrolyzed MTMSPI + I − , which we attributed to the formation of triiodide ions contributed to the conductivity via the Grotthus mechanism. DSPEC cells based on a titania-dye system with MTMSPI + I − electrolyte containing iodine (0.1 M reached an overall efficiency between 3.3–3.7%.

  15. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    Science.gov (United States)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  16. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    Science.gov (United States)

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  17. Attosecond electron dynamics in molecules and liquids

    Science.gov (United States)

    WöRner, Hans Jakob

    The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss some of our recent experiments that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. Using high-harmonic spectroscopy, we resolve the migration of an electron hole across the molecule with a resolution of 100 as and simultaneously demonstrate extensive control over charge migration. In the second class of experiments, we use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from molecules in the gas phase and from a liquid-water microjet, resolving electron transport through liquid water on the attosecond time scale.

  18. Net charge fluctuations and local charge compensation

    International Nuclear Information System (INIS)

    Fu Jinghua

    2006-01-01

    We propose net charge fluctuation as a measure of local charge correlation length. It is demonstrated that, in terms of a schematic multiperipheral model, net charge fluctuation satisfies the same Quigg-Thomas relation as satisfied by charge transfer fluctuation. Net charge fluctuations measured in finite rapidity windows depend on both the local charge correlation length and the size of the observation window. When the observation window is larger than the local charge correlation length, the net charge fluctuation only depends on the local charge correlation length, while forward-backward charge fluctuations always have strong dependence on the observation window size. Net charge fluctuations and forward-backward charge fluctuations measured in the present heavy ion experiments show characteristic features similar to those from multiperipheral models. But the data cannot all be understood within this simple model

  19. Observation of pendular butterfly Rydberg molecules

    Science.gov (United States)

    Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig

    2016-01-01

    Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143

  20. Model improvements to simulate charging in SEM

    Science.gov (United States)

    Arat, K. T.; Klimpel, T.; Hagen, C. W.

    2018-03-01

    Charging of insulators is a complex phenomenon to simulate since the accuracy of the simulations is very sensitive to the interaction of electrons with matter and electric fields. In this study, we report model improvements for a previously developed Monte-Carlo simulator to more accurately simulate samples that charge. The improvements include both modelling of low energy electron scattering and charging of insulators. The new first-principle scattering models provide a more realistic charge distribution cloud in the material, and a better match between non-charging simulations and experimental results. Improvements on charging models mainly focus on redistribution of the charge carriers in the material with an induced conductivity (EBIC) and a breakdown model, leading to a smoother distribution of the charges. Combined with a more accurate tracing of low energy electrons in the electric field, we managed to reproduce the dynamically changing charging contrast due to an induced positive surface potential.

  1. A storage ring for neutral molecules

    NARCIS (Netherlands)

    Crompvoets, F.M.H.

    2005-01-01

    Time-varying inhomogeneous electric fields can be used to manipulate the motion of neutral molecules in phase-space, i.e., position-momentum space, via their electric dipole moment. A theoretical background is given on the motion of the molecules in phase-space. As the forces exerted on the

  2. Thunderstorm Charge Structures Producing Negative Gigantic Jets

    Science.gov (United States)

    Boggs, L.; Liu, N.; Riousset, J. A.; Shi, F.; Rassoul, H.

    2016-12-01

    Here we present observational and modeling results that provide insight into thunderstorm charge structures that produce gigantic jet discharges. The observational results include data from four different thunderstorms producing 9 negative gigantic jets from 2010 to 2014. We used radar, very high frequency (VHF) and low frequency (LF) lightning data to analyze the storm characteristics, charge structures, and lightning activity when the gigantic jets emerged from the parent thunderstorms. A detailed investigation of the evolution of one of the charge structures by analyzing the VHF data is also presented. The newly found charge structure obtained from the observations was analyzed with fractal modeling and compared with previous fractal modeling studies [Krehbiel et al., Nat. Geosci., 1, 233-237, 2008; Riousset et al., JGR, 115, A00E10, 2010] of gigantic jet discharges. Our work finds that for normal polarity thunderstorms, gigantic jet charge structures feature a narrow upper positive charge region over a wide middle negative charge region. There also likely exists a `ring' of negative screening charge located around the perimeter of the upper positive charge. This is different from previously thought charge structures of the storms producing gigantic jets, which had a very wide upper positive charge region over a wide middle negative charge region, with a very small negative screening layer covering the cloud top. The newly found charge structure results in leader discharge trees in the fractal simulations that closely match the parent flashes of gigantic jets inside and outside the thundercloud. The previously used charge structures, while vital to the understanding of gigantic jet initiation and the role of charge imbalances inside the cloud, do not produce leader discharge trees that agree with observed gigantic jet discharges.Finally, the newly discovered gigantic jet charge structures are formed near the end of a convective pulse [Meyer et al., JGR, 118

  3. Charge transport problem

    International Nuclear Information System (INIS)

    Lee, E.P.

    1977-01-01

    In a recent report (UCID 17346, ''Relativistic Particle Beam in a Semi-Infinite Axially Symmetric conducting channel extending from a perfectly conducting plane,'' Dec. 13, 1976) Cooper and Neil demonstrate that the net charge transported by a beam pulse injected into a channel of finite conductivity equals the charge of the beam itself. The channel is taken to be infinite in the positive z direction, has finite radius and is terminated by a conducting ground plane at z =0. This result is not an obvious one, and it is restricted in its applicability by the special model assumed for the channel. It is the purpose to explain the result of Cooper and Neil in more qualitative terms and to make similar calculations using several other channel models. It must be emphasized that these calculations are not concerned with the fate of the transported charge after the pulse has stopped, but rather with how much charge leaves the ground plane assuming the pulse does not stop

  4. Point charges optimally placed to represent the multipole expansion of charge distributions.

    Directory of Open Access Journals (Sweden)

    Ramu Anandakrishnan

    Full Text Available We propose an approach for approximating electrostatic charge distributions with a small number of point charges to optimally represent the original charge distribution. By construction, the proposed optimal point charge approximation (OPCA retains many of the useful properties of point multipole expansion, including the same far-field asymptotic behavior of the approximate potential. A general framework for numerically computing OPCA, for any given number of approximating charges, is described. We then derive a 2-charge practical point charge approximation, PPCA, which approximates the 2-charge OPCA via closed form analytical expressions, and test the PPCA on a set of charge distributions relevant to biomolecular modeling. We measure the accuracy of the new approximations as the RMS error in the electrostatic potential relative to that produced by the original charge distribution, at a distance 2x the extent of the charge distribution--the mid-field. The error for the 2-charge PPCA is found to be on average 23% smaller than that of optimally placed point dipole approximation, and comparable to that of the point quadrupole approximation. The standard deviation in RMS error for the 2-charge PPCA is 53% lower than that of the optimal point dipole approximation, and comparable to that of the point quadrupole approximation. We also calculate the 3-charge OPCA for representing the gas phase quantum mechanical charge distribution of a water molecule. The electrostatic potential calculated by the 3-charge OPCA for water, in the mid-field (2.8 Å from the oxygen atom, is on average 33.3% more accurate than the potential due to the point multipole expansion up to the octupole order. Compared to a 3 point charge approximation in which the charges are placed on the atom centers, the 3-charge OPCA is seven times more accurate, by RMS error. The maximum error at the oxygen-Na distance (2.23 Å is half that of the point multipole expansion up to the octupole

  5. Charge transport through molecular switches

    International Nuclear Information System (INIS)

    Jan van der Molen, Sense; Liljeroth, Peter

    2010-01-01

    We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

  6. Charge transport through molecular switches

    Energy Technology Data Exchange (ETDEWEB)

    Jan van der Molen, Sense [Kamerlingh Onnes Laboratorium, Leiden University, Niels Bohrweg 2, 2333 CA Leiden (Netherlands); Liljeroth, Peter, E-mail: molen@physics.leidenuniv.n [Condensed Matter and Interfaces, Debye Institute for Nanomaterials Science, University of Utrecht, PO Box 80000, 3508 TA Utrecht (Netherlands)

    2010-04-07

    We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

  7. Enriching the hydrogen storage capacity of carbon nanotube doped with polylithiated molecules

    Science.gov (United States)

    Panigrahi, P.; Naqvi, S. R.; Hankel, M.; Ahuja, R.; Hussain, T.

    2018-06-01

    In a quest to find optimum materials for efficient storage of clean energy, we have performed first principles calculations to study the structural and energy storage properties of one-dimensional carbon nanotubes (CNTs) functionalized with polylithiated molecules (PLMs). Van der Waals corrected calculations disclosed that various PLMs like CLi, CLi2, CLi3, OLi, OLi2, OLi3, bind strongly to CNTs even at high doping concentrations ensuring a uniform distribution of dopants without forming clusters. Bader charge analysis reveals that each Li in all the PLMs attains a partial positive charge and transform into Li+ cations. This situation allows multiple H2 molecules adsorbed with each Li+ through the polarization of incident H2 molecules via electrostatic and van der Waals type of interaction. With a maximum doping concentration, that is 3CLi2/3CLi3 and 3OLi2/3OLi3 a maximum of 36 H2 molecules could be adsorbed that corresponds to a reasonably high H2 storage capacity with the adsorption energies in the range of -0.33 to -0.15 eV/H2. This suits the ambient condition applications.

  8. Precise determination of the Bragg peak position of proton beams in liquid water

    International Nuclear Information System (INIS)

    Marouane, Abdelhak; Ouaskit, Said; Inchaouh, Jamal

    2011-01-01

    The influence of water molecules on the surrounding biological molecules during irradiation with protons is currently a major subject in radiation science. Proton collisions with the water molecules are estimated around the Bragg peak region, taking into account ionization, excitation, charge-changing processes, and energetic secondary electron behavior. The Bragg peak profile and position was determined by adopting a new approach involving discretization, incrementation, and dividing the target into layers, the thickness of each layer being selected randomly from a distribution weighted by the values of the total interaction cross section, from excitation up to ionization of the target and the incident projectile charge exchange. The calculation was carried out by a Monte-Carlo simulation in the energy range 20 ≤ E ≤ 10 8 eV, including the relativistic corrections.

  9. Single molecule tracking

    Science.gov (United States)

    Shera, E. Brooks

    1988-01-01

    A detection system is provided for identifying individual particles or molecules having characteristic emission in a flow train of the particles in a flow cell. A position sensitive sensor is located adjacent the flow cell in a position effective to detect the emissions from the particles within the flow cell and to assign spatial and temporal coordinates for the detected emissions. A computer is then enabled to predict spatial and temporal coordinates for the particle in the flow train as a function of a first detected emission. Comparison hardware or software then compares subsequent detected spatial and temporal coordinates with the predicted spatial and temporal coordinates to determine whether subsequently detected emissions originate from a particle in the train of particles. In one embodiment, the particles include fluorescent dyes which are excited to fluoresce a spectrum characteristic of the particular particle. Photones are emitted adjacent at least one microchannel plate sensor to enable spatial and temporal coordinates to be assigned. The effect of comparing detected coordinates with predicted coordinates is to define a moving sample volume which effectively precludes the effects of background emissions.

  10. Influence of the charge trap density distribution in a gate insulator on the positive-bias stress instability of amorphous indium-gallium-zinc oxide thin-film transistors

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Eungtaek; Kim, Choong-Ki; Lee, Myung Keun; Bang, Tewook; Choi, Yang-Kyu; Choi, Kyung Cheol, E-mail: shkp@kaist.ac.kr, E-mail: kyungcc@kaist.ac.kr [School of Electrical Engineering, KAIST, Daejeon 34141 (Korea, Republic of); Park, Sang-Hee Ko, E-mail: shkp@kaist.ac.kr, E-mail: kyungcc@kaist.ac.kr [Department of Material Science and Engineering, KAIST, Daejeon 34141 (Korea, Republic of)

    2016-05-02

    We investigated the positive-bias stress (PBS) instability of thin film transistors (TFTs) composed of different types of first-gate insulators, which serve as a protection layer of the active surface. Two different deposition methods, i.e., the thermal atomic layer deposition (THALD) and plasma-enhanced ALD (PEALD) of Al{sub 2}O{sub 3}, were applied for the deposition of the first GI. When THALD was used to deposit the GI, amorphous indium-gallium-zinc oxide (a-IGZO) TFTs showed superior stability characteristics under PBS. For example, the threshold voltage shift (ΔV{sub th}) was 0 V even after a PBS time (t{sub stress}) of 3000 s under a gate voltage (V{sub G}) condition of 5 V (with an electrical field of 1.25 MV/cm). On the other hand, when the first GI was deposited by PEALD, the ΔV{sub th} value of a-IGZO TFTs was 0.82 V after undergoing an identical amount of PBS. In order to interpret the disparate ΔV{sub th} values resulting from PBS quantitatively, the average oxide charge trap density (N{sub T}) in the GI and its spatial distribution were investigated through low-frequency noise characterizations. A higher N{sub T} resulted during in the PEALD type GI than in the THALD case. Specifically, the PEALD process on a-IGZO layer surface led to an increasing trend of N{sub T} near the GI/a-IGZO interface compared to bulk GI owing to oxygen plasma damage on the a-IGZO surface.

  11. Influence of the charge trap density distribution in a gate insulator on the positive-bias stress instability of amorphous indium-gallium-zinc oxide thin-film transistors

    International Nuclear Information System (INIS)

    Kim, Eungtaek; Kim, Choong-Ki; Lee, Myung Keun; Bang, Tewook; Choi, Yang-Kyu; Choi, Kyung Cheol; Park, Sang-Hee Ko

    2016-01-01

    We investigated the positive-bias stress (PBS) instability of thin film transistors (TFTs) composed of different types of first-gate insulators, which serve as a protection layer of the active surface. Two different deposition methods, i.e., the thermal atomic layer deposition (THALD) and plasma-enhanced ALD (PEALD) of Al_2O_3, were applied for the deposition of the first GI. When THALD was used to deposit the GI, amorphous indium-gallium-zinc oxide (a-IGZO) TFTs showed superior stability characteristics under PBS. For example, the threshold voltage shift (ΔV_t_h) was 0 V even after a PBS time (t_s_t_r_e_s_s) of 3000 s under a gate voltage (V_G) condition of 5 V (with an electrical field of 1.25 MV/cm). On the other hand, when the first GI was deposited by PEALD, the ΔV_t_h value of a-IGZO TFTs was 0.82 V after undergoing an identical amount of PBS. In order to interpret the disparate ΔV_t_h values resulting from PBS quantitatively, the average oxide charge trap density (N_T) in the GI and its spatial distribution were investigated through low-frequency noise characterizations. A higher N_T resulted during in the PEALD type GI than in the THALD case. Specifically, the PEALD process on a-IGZO layer surface led to an increasing trend of N_T near the GI/a-IGZO interface compared to bulk GI owing to oxygen plasma damage on the a-IGZO surface.

  12. Interactions of electrons with biologically important molecules

    International Nuclear Information System (INIS)

    Pisklova, K.; Papp, P.; Stano, M.

    2012-01-01

    For the study of interactions of low-energy electrons with the molecules in the gas phase, the authors used electron-molecule cross-beam apparatus. The experiment is carried out in high vacuum, where molecules of the tested compound are inducted through a capillary. For purposes of this experiment the sample was electrically heated to 180 Deg C., giving a bundle of GlyGly molecules into the gas phase. The resulting signals can be evaluated in two different modes: mass spectrum - at continuous electron energy (e.g. 100 eV) they obtained the signal of intensity of the ions according to their mass to charge ratio; ionization and resonance spectra - for selected ion mass when the authors received the signal of intensity of the ions, depending on the energy of interacting electron.

  13. Electron-molecule interactions and their applications

    CERN Document Server

    Christophorou, L G

    1984-01-01

    Electron-Molecule Interactions and Their Applications, Volume 2 provides a balanced and comprehensive account of electron-molecule interactions in dilute and dense gases and liquid media. This book consists of six chapters. Chapter 1 deals with electron transfer reactions, while Chapter 2 discusses electron-molecular positive-ion recombination. The electron motion in high-pressure gases and electron-molecule interactions from single- to multiple-collision conditions is deliberated in Chapter 3. In Chapter 4, knowledge on electron-molecule interactions in gases is linked to that on similar proc

  14. The role of charge in the surfactant-assisted stabilization of the natural product curcumin.

    Science.gov (United States)

    Wang, Zifan; Leung, Mandy H M; Kee, Tak W; English, Douglas S

    2010-04-20

    Colloidal solutions of surfactants that form micelles or vesicles are useful for solubilizing and stabilizing hydrophobic molecules that are otherwise sparingly soluble in aqueous solutions. In this paper we investigate the use of micelles and vesicles prepared from ionic surfactants for solubilizing and stabilizing curcumin, a medicinal natural product that undergoes alkaline hydrolysis in water. We identify spectroscopic signatures to evaluate curcumin partitioning and deprotonation in surfactant mixtures containing micelles or vesicles. These spectroscopic signatures allow us to monitor the interaction of curcumin with charged surfactants over a wide range of pH values. Titration data are presented to show the pH dependence of curcumin interactions with negatively and positively charged micelles and vesicles. In solutions of cationic micelles or positively charged vesicles, strong interaction between the Cur(-1) phenoxide ion and the positively charged surfactants results in a change in the acidity of the phenolic hydrogen and a lowering of the apparent lowest pK(a) value for curcumin. In the microenvironments formed by anionic micelles or negatively charged bilayers, our data indicates that curcumin partitions as the Cur(0) species, which is stabilized by interactions with the respective surfactant aggregates, and this leads to an increase in the apparent pK(a) values. Our results may explain some of the discrepancies within the literature with respect to reported pK(a) values and the acidity of the enolic versus phenolic protons. Hydrolysis rates, quantum yields, and molar absorption coefficients are reported for curcumin in a variety of solutions.

  15. Fuel charging machine

    International Nuclear Information System (INIS)

    Uchikawa, Sadao.

    1978-01-01

    Purpose: To enable continuous fuel discharging and charging steps in a bwr type reactor by effecting positioning only for once by providing a plurality of fuel assembly grippers and their drives co-axially on a rotatable surface. Constitution: A plurality of fuel assembly grippers and their drives are provided co-axially on a rotatable surface. For example, a gripper A, a drive B, a gripper C and a drive D are arranged co-axially in symmetric positions on a disk rotated on rails by wheels and rotational drives. A new fuel in a fuel pool is gripped by the gripper A and transported above the reactor core. Then, the disk is positioned so that the gripper C can grip the spent fuel in the core, and the fuel to be discharged is gripped and raised by the gripper C. Then the disk is rotated by 180 0 and the new fuel in the gripper A is charged into the position from which the old fuel has been discharged and, finally, the discharged fuel is sent to the fuel pool for storage. (Seki, T.)

  16. CHARGE Association

    Directory of Open Access Journals (Sweden)

    Semanti Chakraborty

    2012-01-01

    Full Text Available We present here a case of 17-year-old boy from Kolkata presenting with obesity, bilateral gynecomastia, mental retardation, and hypogonadotrophic hypogonadism. The patient weighed 70 kg and was of 153 cm height. Facial asymmetry (unilateral facial palsy, gynecomastia, decreased pubic and axillary hair, small penis, decreased right testicular volume, non-palpable left testis, and right-sided congenital inguinal hernia was present. The patient also had disc coloboma, convergent squint, microcornea, microphthalmia, pseudohypertelorism, low set ears, short neck, and choanalatresia. He had h/o VSD repaired with patch. Laboratory examination revealed haemoglobin 9.9 mg/dl, urea 24 mg/dl, creatinine 0.68 mg/dl. IGF1 77.80 ng/ml (decreased for age, GH <0.05 ng/ml, testosterone 0.25 ng/ml, FSH-0.95 ΅IU/ml, LH 0.60 ΅IU/ml. ACTH, 8:00 A.M cortisol, FT3, FT4, TSH, estradiol, DHEA-S, lipid profile, and LFT was within normal limits. Prolactin was elevated at 38.50 ng/ml. The patient′s karyotype was 46XY. Echocardiography revealed ventricularseptal defect closed with patch, grade 1 aortic regurgitation, and ejection fraction 67%. Ultrasound testis showed small right testis within scrotal sac and undescended left testis within left inguinal canal. CT scan paranasal sinuses revealed choanalatresia and deviation of nasal septum to the right. Sonomammography revealed bilateral proliferation of fibroglandular elements predominantly in subareoalar region of breasts. MRI of brain and pituitary region revealed markedly atrophic pituitary gland parenchyma with preserved infundibulum and hypothalamus and widened suprasellar cistern. The CHARGE association is an increasingly recognized non-random pattern of congenital anomalies comprising of coloboma, heart defect, choanal atresia, retarded growth and development, genital hypoplasia, ear abnormalities, and/or deafness. [1] These anomalies have a higher probability of occurring together. In this report, we have

  17. Conserved water molecules in bacterial serine hydroxymethyltransferases.

    Science.gov (United States)

    Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

    2015-10-01

    Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  18. Electron capture in ion-molecule collisions at intermediate energy

    International Nuclear Information System (INIS)

    Kumura, M.

    1986-01-01

    Recent progress of theoretical charge transfer study in ion-molecule collisions at the intermediate energy is reviewed. Concept of close and distant collisions obtained from extensive ion-atom collision studies is identified so that it can be utilized to model two distinct collision processes. For a close collision, explicit representation of the whole collision complex is necessary to describe collision dynamics correctly, while a model potential approach for molecule is appropriate for a distant collision. It is shown that these two distinct models are indeed capable of reproducing experimental charge transfer cross sections. Some remarks for further theoretical study of ion-molecule collisions are also given. 21 refs., 8 figs

  19. Adsorption behavior of Co anchored on graphene sheets toward NO, SO2, NH3, CO and HCN molecules

    International Nuclear Information System (INIS)

    Tang, Yanan; Chen, Weiguang; Li, Chenggang; Pan, Lijun; Dai, Xianqi; Ma, Dongwei

    2015-01-01

    Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH 3 molecule, the adsorbed NO, SO 2 , CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO 2 . The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device

  20. Designing thiophene-based azomethine oligomers with tailored properties: Self-assembly and charge carrier mobility

    DEFF Research Database (Denmark)

    Kiriy, N.; Bocharova, V.; Kiriy, A.

    2004-01-01

    This paper describes synthesis and characterization of two thiophene-based azomethines designed to optimize solubility, self-assembly, and charge carrier mobility. We found that incorporation of azomethine and amide moieties in the alpha,omega-position, and hexyl chains in the beta-position of th...... with the mobilities of the best organic semiconductors. All these significant differences in properties of related compounds can be attributed to the hydrogen bonding between QT-amide molecules responsible for the observed self-assembly....

  1. Enhancing SERS by Means of Supramolecular Charge Transfer

    Science.gov (United States)

    Wong, Eric; Flood, Amar; Morales, Alfredo

    2009-01-01

    In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.

  2. Formation of Ultracold Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)

    2016-01-28

    Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

  3. Charge-transport simulations in organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    May, Falk

    2012-07-06

    In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that

  4. Molecular spintronics using single-molecule magnets

    Science.gov (United States)

    Bogani, Lapo; Wernsdorfer, Wolfgang

    2008-03-01

    A revolution in electronics is in view, with the contemporary evolution of the two novel disciplines of spintronics and molecular electronics. A fundamental link between these two fields can be established using molecular magnetic materials and, in particular, single-molecule magnets. Here, we review the first progress in the resulting field, molecular spintronics, which will enable the manipulation of spin and charges in electronic devices containing one or more molecules. We discuss the advantages over more conventional materials, and the potential applications in information storage and processing. We also outline current challenges in the field, and propose convenient schemes to overcome them.

  5. The status of molecules

    International Nuclear Information System (INIS)

    Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN

    1994-06-01

    This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)

  6. Electron-beam-charged dielectrics: Internal charge distribution

    Science.gov (United States)

    Beers, B. L.; Pine, V. W.

    1981-01-01

    Theoretical calculations of an electron transport model of the charging of dielectrics due to electron bombardment are compared to measurements of internal charge distributions. The emphasis is on the distribution of Teflon. The position of the charge centroid as a function of time is not monotonic. It first moves deeper into the material and then moves back near to the surface. In most time regimes of interest, the charge distribution is not unimodal, but instead has two peaks. The location of the centroid near saturation is a function of the incident current density. While the qualitative comparison of theory and experiment are reasonable, quantitative comparison shows discrepancies of as much as a factor of two.

  7. The Minimum Binding Energy and Size of Doubly Muonic D3 Molecule

    Science.gov (United States)

    Eskandari, M. R.; Faghihi, F.; Mahdavi, M.

    The minimum energy and size of doubly muonic D3 molecule, which two of the electrons are replaced by the much heavier muons, are calculated by the well-known variational method. The calculations show that the system possesses two minimum positions, one at typically muonic distance and the second at the atomic distance. It is shown that at the muonic distance, the effective charge, zeff is 2.9. We assumed a symmetric planar vibrational model between two minima and an oscillation potential energy is approximated in this region.

  8. Residual dust charges in discharge afterglow

    International Nuclear Information System (INIS)

    Coueedel, L.; Mikikian, M.; Boufendi, L.; Samarian, A. A.

    2006-01-01

    An on-ground measurement of dust-particle residual charges in the afterglow of a dusty plasma was performed in a rf discharge. An upward thermophoretic force was used to balance the gravitational force. It was found that positively charged, negatively charged, and neutral dust particles coexisted for more than 1 min after the discharge was switched off. The mean residual charge for 200-nm-radius particles was measured. The dust particle mean charge is about -5e at a pressure of 1.2 mbar and about -3e at a pressure of 0.4 mbar

  9. Cold Rydberg molecules

    Science.gov (United States)

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  10. Structural characterization of some substituted azolidine molecules

    International Nuclear Information System (INIS)

    Andreocci, M.V.; Bossa, M.; Furlani, C.; Mattogno, G.; Zanoni, R.; Consiglio Nazionale delle Ricerche, Rome; Devillanova, F.A.; Verani, G.

    1981-01-01

    The electronic structure of a series of organic molecules of general formula RN - (CH 2 ) 2 - X - C = Y, which are also of interest in inorganic chemistry because of their properties as ligands towards metals, have been investigated by X-ray photoelectron spectroscopy. The results suggest a general picture of atomic charge distribution within the investigated molecules, and allow an assessment of the effect of the different substituent groups X, Y, R (X = NR', O, S, CH 2 ; Y = O, S, Se; R, R' = H, alkyl) on the electronic structure of the ligands. Satisfactory correlation is found between experimental binding energies and computed CNDO/2 atomic charges, after correction for intramolecular Madelung potentials. (orig.)

  11. Workplace Charging. Charging Up University Campuses

    Energy Technology Data Exchange (ETDEWEB)

    Giles, Carrie [ICF International, Fairfax, VA (United States); Ryder, Carrie [ICF International, Fairfax, VA (United States); Lommele, Stephen [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-03-01

    This case study features the experiences of university partners in the U.S. Department of Energy's (DOE) Workplace Charging Challenge with the installation and management of plug-in electric vehicle (PEV) charging stations.

  12. Optoelectronics of Molecules and Polymers

    CERN Document Server

    Moliton, André

    2006-01-01

    Optoelectronic devices are being developed at an extraordinary rate. Organic light emitting diodes, photovoltaic devices and electro-optical modulators are pivotal to the future of displays, photosensors and solar cells, and communication technologies. This book details the theories underlying the relevant mechanisms in organic materials and covers, at a basic level, how the organic components are made. The first part of this book introduces the fundamental theories used to detail ordered solids and localised energy levels. The methods used to determine energy levels in perfectly ordered molecular and macromolecular systems are discussed, making sure that the effects of quasi-particles are not missed. The function of excitons and their transfer between two molecules are studied, and the problems associated with interfaces and charge injection into resistive media are presented. The second part details technological aspects such as the fabrication of devices based on organic materials by dry etching. The princ...

  13. Single-Molecule Electronics: Chemical and Analytical Perspectives.

    Science.gov (United States)

    Nichols, Richard J; Higgins, Simon J

    2015-01-01

    It is now possible to measure the electrical properties of single molecules using a variety of techniques including scanning probe microcopies and mechanically controlled break junctions. Such measurements can be made across a wide range of environments including ambient conditions, organic liquids, ionic liquids, aqueous solutions, electrolytes, and ultra high vacuum. This has given new insights into charge transport across molecule electrical junctions, and these experimental methods have been complemented with increasingly sophisticated theory. This article reviews progress in single-molecule electronics from a chemical perspective and discusses topics such as the molecule-surface coupling in electrical junctions, chemical control, and supramolecular interactions in junctions and gating charge transport. The article concludes with an outlook regarding chemical analysis based on single-molecule conductance.

  14. Experimental validation of calculated atomic charges in ionic liquids

    Science.gov (United States)

    Fogarty, Richard M.; Matthews, Richard P.; Ashworth, Claire R.; Brandt-Talbot, Agnieszka; Palgrave, Robert G.; Bourne, Richard A.; Vander Hoogerstraete, Tom; Hunt, Patricia A.; Lovelock, Kevin R. J.

    2018-05-01

    A combination of X-ray photoelectron spectroscopy and near edge X-ray absorption fine structure spectroscopy has been used to provide an experimental measure of nitrogen atomic charges in nine ionic liquids (ILs). These experimental results are used to validate charges calculated with three computational methods: charges from electrostatic potentials using a grid-based method (ChelpG), natural bond orbital population analysis, and the atoms in molecules approach. By combining these results with those from a previous study on sulfur, we find that ChelpG charges provide the best description of the charge distribution in ILs. However, we find that ChelpG charges can lead to significant conformational dependence and therefore advise that small differences in ChelpG charges (<0.3 e) should be interpreted with care. We use these validated charges to provide physical insight into nitrogen atomic charges for the ILs probed.

  15. Single Molecule Nanoelectrochemistry in Electrical Junctions.

    Science.gov (United States)

    Nichols, Richard J; Higgins, Simon J

    2016-11-15

    It is now possible to reliably measure single molecule conductance in a wide variety of environments including organic liquids, ultrahigh vacuum, water, ionic liquids, and electrolytes. The most commonly used methods deploy scanning probe microscopes, mechanically formed break junctions, or lithographically formed nanogap contacts. Molecules are generally captured between a pair of facing electrodes, and the junction current response is measured as a function of bias voltage. Gating electrodes can also be added so that the electrostatic potential at the molecular bridge can be independently controlled by this third noncontacting electrode. This can also be achieved in an electrolytic environment using a four-electrode bipotentiostatic configuration, which allows independent electrode potential control of the two contacting electrodes. This is commonly realized using an electrochemical STM and enables single molecule electrical characterization as a function of electrode potential and redox state of the molecular bridge. This has emerged as a powerful tool in modern interfacial electrochemistry and nanoelectrochemistry for studying charge transport across single molecules as a function of electrode potential and the electrolytic environments. Such measurements are possible in electrolytes ranging from aqueous buffers to nonaqueous ionic liquids. In this Account, we illustrate a number of examples of single molecule electrical measurements under electrode potential control use a scanning tunneling microscope (STM) and demonstrate how these can help in the understanding of charge transport in single molecule junctions. Examples showing charge transport following phase coherent tunneling to incoherent charge hopping across redox active molecular bridges are shown. In the case of bipyridinium (or viologen) molecular wires, it is shown how electrochemical reduction leads to an increase of the single molecule conductance, which is controlled by the liquid electrochemical

  16. Electrostatic charge characteristics of jet nebulized aerosols.

    Science.gov (United States)

    Kwok, Philip Chi Lip; Trietsch, Sebastiaan J; Kumon, Michiko; Chan, Hak-Kim

    2010-06-01

    Liquid droplets can be spontaneously charged in the absence of applied electric fields by spraying. It has been shown by computational simulation that charges may influence particle deposition in the airways. The electrostatic properties of jet nebulized aerosols and their potential effects on lung deposition have hardly been studied. A modified electrical low pressure impactor (ELPI) was employed to characterize the aerosol charges generated from jet nebulized commercial products. The charge and size measurements were conducted at 50% RH and 22 degrees C with a modified ELPI. Ventolin, Bricanyl, and Atrovent were nebulized using PARI LC Plus jet nebulizers coupled to a DeVilbiss Pulmo-Aide compressor. The aerosols were sampled in 30-sec durations. The drug deposits on the impactor stages were assayed chemically using high-performance liquid chromatography (HPLC). The charges of nebulized deionized water, isotonic saline, and the three commercial products diluted with saline were also measured to analyze the contributions of the major nebule ingredients on charging. No mass assays were performed on these runs. All three commercial nebules generated net negative charges. The magnitude of the charges reduced over the period of nebulization. Ventolin and Bricanyl yielded similar charge profiles. Highly variable charges were produced from deionized water. On the other hand, nebulized saline reproducibly generated net positive charges. Diluted commercial nebules showed charge polarity inversion. The charge profiles of diluted salbutamol and terbutaline solutions resembled those of saline, while the charges from diluted ipratropium solutions fluctuated near neutrality. The charge profiles were shown to be influenced by the concentration and physicochemical properties of the drugs, as well as the history of nebulization. The drugs may have unique isoelectric concentrations in saline at which the nebulized droplets would carry near-zero charges. According to results from

  17. Electrocatalytic glucose oxidation at gold and gold-carbon nanoparticulate film prepared from oppositely charged nanoparticles

    International Nuclear Information System (INIS)

    Karczmarczyk, Aleksandra; Celebanska, Anna; Nogala, Wojciech; Sashuk, Volodymyr; Chernyaeva, Olga; Opallo, Marcin

    2014-01-01

    Graphical abstract: - Highlights: • Gold nanoparticulate film electrodes were prepared by layer-by-layer method from oppositely charged nanoparticles. • Positively charged nanoparticles play dominant role in glucose oxidation in alkaline solution. • Gold and gold-carbon nanoparticulate film electrodes exhibit similar glucose oxidation current and onset potential. - Abstract: Electrocatalytic oxidation of glucose was studied at nanoparticulate gold and gold-carbon film electrodes. These electrodes were prepared by a layer-by-layer method without application of any linker molecules. Gold nanoparticles were stabilized by undecane thiols functionalized by trimethyl ammonium or carboxylate groups, whereas the carbon nanoparticles were covered by phenylsulfonate functionalities. The gold nanoparticulate electrodes were characterized by UV-vis and XPS spectroscopy, atomic force microscopy and voltammetry, before and after heat-treatment. Heat-treatment facilitates the aggregation of the nanoparticles and affects the structure of the film. The comparison of the results obtained with film electrodes prepared from gold nanoparticles with the same charge and with gold-carbon nanoparticulate electrodes, proved that positively charged nanoparticles are responsible for the high electrocatalytic activity, whereas negatively charged ones act rather as a linker of the film

  18. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  19. Molecule of the Month

    Indian Academy of Sciences (India)

    Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...

  20. Molecule of the Month

    Indian Academy of Sciences (India)

    Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...

  1. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:

  2. Single molecule conductance

    NARCIS (Netherlands)

    Willems, R.

    2008-01-01

    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  3. Spectrally resolved single-molecule electrometry

    Science.gov (United States)

    Ruggeri, F.; Krishnan, M.

    2018-03-01

    Escape-time electrometry is a recently developed experimental technique that offers the ability to measure the effective electrical charge of a single biomolecule in solution with sub-elementary charge precision. The approach relies on measuring the average escape-time of a single charged macromolecule or molecular species transiently confined in an electrostatic fluidic trap. Comparing the experiments with the predictions of a mean-field model of molecular electrostatics, we have found that the measured effective charge even reports on molecular conformation, e.g., folded or disordered state, and non-uniform charge distribution in disordered proteins or polyelectrolytes. Here we demonstrate the ability to use the spectral dimension to distinguish minute differences in electrical charge between individual molecules or molecular species in a single simultaneous measurement, under identical experimental conditions. Using one spectral channel for referenced measurement, this kind of photophysical distinguishability essentially eliminates the need for accurate knowledge of key experimental parameters, otherwise obtained through intensive characterization of the experimental setup. As examples, we demonstrate the ability to detect small differences (˜5%) in the length of double-stranded DNA fragments as well as single amino acid exchange in an intrinsically disordered protein, prothymosin α.

  4. Molecules in stars

    International Nuclear Information System (INIS)

    Tsuji, T.

    1986-01-01

    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  5. Metal-organic and supramolecular architectures based on mechanically interlocked molecules

    Science.gov (United States)

    Fernando, Isurika Rosini

    The focus of this work is on mechanically interlocked molecules (MIMs), which have unusual physicochemical and mechanical properties with potential applications in nano-scale/molecular devices and high strength materials. Rotaxanes, for example, consist of an axle-like molecule threaded through a wheel-like molecule, with bulky groups at the two ends of the axle preventing the wheel from dissociating. The position of the wheel along the axle can be switched in a controllable and reversible manner by applying external stimuli, a feature that might lead to the next generation of computers. Molecularly woven materials (MWMs), another example of molecules with mechanically interlocked features, are predicted to be unprecedentedly strong while being lightweight and flexible. With the ultimate goal of achieving control over the functioning of molecular devices in the solid state, a variety of pseudorotaxane building blocks were prepared and characterized, including a novel, rare blue-colored motif. The temperature-dependent assembly/disassembly of pseudorotaxanes was exploited for the construction of single-wavelength colorimetric temperature sensors over a 100 °C window. Pseudorotaxanes based on aromatic crown ether wheels and disubstituted 4,4'-bipyridinium axles were converted into rotaxanes upon binding to metal complexes (zinc, cadmium, mercury, copper, cobalt), and the formation of ordered crystalline arrays was studied in the solid state. The columnar organization of pseudorotaxanes by Hg2X6 2-- complexes (X = Cl, Br, I), leading to unprecedented dichroic (blue/red) rotaxane crystals, was demonstrated for the first time. From the crystal structures studied it became apparent that negatively charged metal complexes are needed for successful assembly with the positively charged pseudorotaxane units. To be able to use the more common, positively charged metal ions for rotaxane framework construction, neutral and negatively charged pseudorotaxanes were synthesized

  6. Lattice diffusion of a single molecule in solution

    Science.gov (United States)

    Ruggeri, Francesca; Krishnan, Madhavi

    2017-12-01

    The ability to trap a single molecule in an electrostatic potential well in solution has opened up new possibilities for the use of molecular electrical charge to study macromolecular conformation and dynamics at the level of the single entity. Here we study the diffusion of a single macromolecule in a two-dimensional lattice of electrostatic traps in solution. We report the ability to measure both the size and effective electrical charge of a macromolecule by observing single-molecule transport trajectories, typically a few seconds in length, using fluorescence microscopy. While, as shown previously, the time spent by the molecule in a trap is a strong function of its effective charge, we demonstrate here that the average travel time between traps in the landscape yields its hydrodynamic radius. Tailoring the pitch of the lattice thus yields two different experimentally measurable time scales that together uniquely determine both the size and charge of the molecule. Since no information is required on the location of the molecule between consecutive departure and arrival events at lattice sites, the technique is ideally suited to measurements on weakly emitting entities such as single molecules.

  7. Dynamics of Activated Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)

    2016-11-16

    Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.

  8. Floating liquid bridge charge dynamics

    Science.gov (United States)

    Teschke, Omar; Soares, David Mendez; Gomes, Whyllerson Evaristo; Valente Filho, Juracyr Ferraz

    2016-01-01

    The interaction of liquid with electric fields is investigated in a configuration where up to 13 kV are applied between electrodes resulting in a 106 V/m electric field in the capillaries and where there is the formation of a free-standing fluid bridge in the interelectrode gap. The Mott-Gurney equation was fitted to the measured ionization current vs applied voltage curve which indicates that the ionization rate at the high-voltage anode electrode dimethylsulfoxide (DMSO) interface and space charging in the interelectrode gap determine the floating liquid bridge current for a given cathode-to-anode voltage. Space charge effects were measured in the cathode becker and also at the liquid bridge since the ionized charges at the anode migrate to the bridge outer surface and decrease the interfacial tension from 43 mJ/m2 to 29 mJ/m2. Two distinct structural regions then form the bridge, a charged plastic (bulk modulus ˜100 MPa) conducting outer layer with a surface conductivity of ˜10-9 Ω-1, which shapes and supports the floating fluid structure, and an inner liquid cylinder, where DMSO molecules flow.

  9. Dissociation in small molecules

    International Nuclear Information System (INIS)

    Dehmer, P.M.

    1982-01-01

    The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2

  10. Electrochemically-gated single-molecule electrical devices

    International Nuclear Information System (INIS)

    Guo, Shaoyin; Artés, Juan Manuel; Díez-Pérez, Ismael

    2013-01-01

    In the last decade, single-molecule electrical contacts have emerged as a new experimental platform that allows exploring charge transport phenomena in individual molecular blocks. This novel tool has evolved into an essential element within the Molecular Electronics field to understand charge transport processes in hybrid (bio)molecule/electrode interfaces at the nanoscale, and prospect the implementation of active molecular components into functional nanoscale optoelectronic devices. Within this area, three-terminal single-molecule devices have been sought, provided that they are highly desired to achieve full functionality in logic electronic circuits. Despite the latest experimental developments offer consistent methods to bridge a molecule between two electrodes (source and drain in a transistor notation), placing a third electrode (gate) close to the single-molecule electrical contact is still technically challenging. In this vein, electrochemically-gated single-molecule devices have emerged as an experimentally affordable alternative to overcome these technical limitations. In this review, the operating principle of an electrochemically-gated single-molecule device is presented together with the latest experimental methodologies to built them and characterize their charge transport characteristics. Then, an up-to-date comprehensive overview of the most prominent examples will be given, emphasizing on the relationship between the molecular structure and the final device electrical behaviour

  11. Nano-manipulation of single DNA molecules

    International Nuclear Information System (INIS)

    Hu Jun; Shanghai Jiaotong Univ., Shanghai; Lv Junhong; Wang Guohua; Wang Ying; Li Minqian; Zhang Yi; Li Bin; Li Haikuo; An Hongjie

    2004-01-01

    Nano-manipulation of single atoms and molecules is a critical technique in nanoscience and nanotechnology. This review paper will focus on the recent development of the manipulation of single DNA molecules based on atomic force microscopy (AFM). Precise manipulation has been realized including varied manipulating modes such as 'cutting', 'pushing', 'folding', 'kneading', 'picking up', 'dipping', etc. The cutting accuracy is dominated by the size of the AFM tip, which is usually 10 nm or less. Single DNA fragments can be cut and picked up and then amplified by single molecule PCR. Thus positioning isolation and sequencing can be performed. (authors)

  12. Limits to differences in active and passive charges

    OpenAIRE

    Laemmerzahl, C.; Macias, A.; Mueller, H.

    2007-01-01

    We explore consequences of a hypothetical difference between active charges, which generate electric fields, and passive charges, which respond to them. A confrontation to experiments using atoms, molecules, or macroscopic matter yields limits on their fractional difference at levels down to 10^-21, which at the same time corresponds to an experimental confirmation of Newtons third law.

  13. Two-Dimensional Charge Transport in Disordered Organic Semiconductors

    NARCIS (Netherlands)

    Brondijk, J. J.; Roelofs, W. S. C.; Mathijssen, S. G. J.; Shehu, A.; Cramer, T.; Biscarini, F.; Blom, P. W. M.; de Leeuw, D. M.

    2012-01-01

    We analyze the effect of carrier confinement on the charge-transport properties of organic field-effect transistors. Confinement is achieved experimentally by the use of semiconductors of which the active layer is only one molecule thick. The two-dimensional confinement of charge carriers provides

  14. Influence of solvent polarization and non-uniform ion size on electrostatic properties between charged surfaces in an electrolyte solution

    Science.gov (United States)

    Sin, Jun-Sik

    2017-12-01

    In this paper, we study electrostatic properties between two similar or oppositely charged surfaces immersed in an electrolyte solution by using the mean-field approach accounting for solvent polarization and non-uniform size effects. Applying a free energy formalism accounting for unequal ion sizes and orientational ordering of water dipoles, we derive coupled and self-consistent equations to calculate electrostatic properties between charged surfaces. Electrostatic properties for similarly charged surfaces depend on the counterion size but not on the coion size. Moreover, electrostatic potential and osmotic pressure between similarly charged surfaces are found to be increased with increasing counterion size. On the other hand, the corresponding ones between oppositely charged surfaces are related to both sizes of positive and negative ions. For oppositely charged surfaces, the electrostatic potential, number density of solvent molecules, and relative permittivity of an electrolyte having unequal ion sizes are not symmetric about the centerline between the charged surfaces. For either case, the consideration of solvent polarization results in a decrease in the electrostatic potential and the osmotic pressure compared to the case without the effect.

  15. Bane of Hydrogen-Bond Formation on the Photoinduced Charge-Transfer Process in Donor–Acceptor Systems

    KAUST Repository

    Alsam, Amani Abdu

    2017-03-14

    Controlling the ultrafast dynamical process of photoinduced charge transfer at donor acceptor interfaces remains a major challenge for physical chemistry and solar cell communities. The process is complicated by the involvement of other complex dynamical processes, including hydrogen bond formation, energy transfer, and solvation dynamics occurring on similar time scales. In this study, we explore the remarkable impact of hydrogen-bond formation on the interfacial charge transfer between a negatively charged electron donating anionic porphyrin and a positively charged electron accepting pi-conjugated polymer, as a model system in solvents with different polarities and capabilities for hydiogen bonding using femtosecond transient absorption spectroscopy. Unlike the conventional understanding of the key role of hydrogen bonding in promoting the charge-transfer process, our steadystate and time-resolved results reveal that the intervening hydrogen-bonding environment and, consequently, the probable longer spacing between the donor and acceptor molecules significantly hinders the charge-transfer process between them. These results show that site-specific hydrogen bonding and geometric considerations between donor and acceptor can be exploited to control both the charge-transfer dynamics and its efficiency not only at donor acceptor interfaces but also in complex biological systems.

  16. Mobilities of positive ions in gas ionization chambers

    International Nuclear Information System (INIS)

    Kusumegi, Asao

    1990-01-01

    Observed ion mobilities of organic molecules in Ar are compared with a complete polarization model to examine the performance of the model, and its applicability is discussed. In spite of its simplicity, the polarization model (small sphere limit) is found to agree satisfactorily with observed mobilities in the case of alkali ions in Ar. However, the model fails to account for the mobility of Ar + in Ar due to a resonant charge transfer interaction between the ion and the parent gas. On the other hand, the values of k, a parameter which depends on the kinetic and the potential energy of the relevant ion, derived from observed ion mobilities of organic molecules in Ar and in the parent gas are found to be close to each other. Except for few cases, it appears that the complete polarization model gives a reasonable approximation for the positive ion mobilities of organic molecules in Ar, though the importance of the ion mass identification is significant in considering the applicability of the model to the positive ion mobility of those organic molecules in Ar used in a gas ionization chamber. (N.K.)

  17. Molecules to Materials

    Indian Academy of Sciences (India)

    asymmetric distribution of charge could act as rectifiers and lead to vectorial ... system was deposited as a multilayer Langmuir-Blodgett film ... film surface and the current-voltage characteristics were recorded ... Gain drop with gold wire.

  18. Lexan Linear Shaped Charge Holder with Magnets and Backing Plate

    Science.gov (United States)

    Maples, Matthew W.; Dutton, Maureen L.; Hacker, Scott C.; Dean, Richard J.; Kidd, Nicholas; Long, Chris; Hicks, Robert C.

    2013-01-01

    A method was developed for cutting a fabric structural member in an inflatable module, without damaging the internal structure of the module, using linear shaped charge. Lexan and magnets are used in a charge holder to precisely position the linear shaped charge over the desired cut area. Two types of charge holders have been designed, each with its own backing plate. One holder cuts fabric straps in the vertical configuration, and the other charge holder cuts fabric straps in the horizontal configuration.

  19. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  20. Electron-molecule collisions

    CERN Document Server

    Takayanagi, Kazuo

    1984-01-01

    Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

  1. Molecules to Materials

    Indian Academy of Sciences (India)

    evolved as a new line of thinking wherein a single molecule or perhaps a collection .... In photonic communication processes, laser light has to be modulated and .... The author wishes to thank G Rajaram for a critical reading of the manuscript.

  2. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    IAS Admin

    overall absorption spectrum of a molecule is a superposition of many such sharp lines .... dilute solution of the enzyme and the substrate over few drops of silicone oil placed ..... Near-field Scanning Optical Microscopy (NSOM): Development.

  3. Quantum dot molecules

    CERN Document Server

    Wu, Jiang

    2014-01-01

    This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.

  4. Molecule of the Month

    Indian Academy of Sciences (India)

    Molecule of the Month - Adamantane - A Plastic Piece of Diamond. J Chandrasekhar. Volume 16 Issue 12 ... Keywords. Adamantane; diamondoid systems; plastic crystals. ... Resonance – Journal of Science Education | News. © 2017 Indian ...

  5. Multiple ionization dynamics of molecules in intense laser fields

    International Nuclear Information System (INIS)

    Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko

    2005-01-01

    A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)

  6. Fluctuation charge effects in ionization fronts

    International Nuclear Information System (INIS)

    Arrayas, Manuel; Trueba, Jose L; Baltanas, J P

    2008-01-01

    In this paper, we study the effects of charge fluctuations on the propagation of both negative and positive ionization fronts in streamer discharges. We show that fronts accelerate when random charge creation events are present. This effect might play a similar role to photoionization in order to make the front move faster

  7. Fluctuation charge effects in ionization fronts

    Energy Technology Data Exchange (ETDEWEB)

    Arrayas, Manuel; Trueba, Jose L [Area de Electromagnetismo, Universidad Rey Juan Carlos, Camino del Molino s/n, 28943 Fuenlabrada, Madrid (Spain); Baltanas, J P [Departamento de Fisica Aplicada II, Universidad de Sevilla, Av. Reina Mercedes 2, 41012 Sevilla (Spain)

    2008-05-21

    In this paper, we study the effects of charge fluctuations on the propagation of both negative and positive ionization fronts in streamer discharges. We show that fronts accelerate when random charge creation events are present. This effect might play a similar role to photoionization in order to make the front move faster.

  8. Charging machine for a fast production reactor

    International Nuclear Information System (INIS)

    Artem'ev, L.N.; Kurilkin, V.V.

    1971-01-01

    Charging machine for a fast production reactor is described. The machine contains charging mechanism, mechanism for positioning fresh fuel and spent fuel assemtlies, storage drums with sockets for control rod assemtlies and collet tongs for control rods. Recharging is conducted by means of ramp channel

  9. Charge ratio of muons from atmospheric neutrinos

    Energy Technology Data Exchange (ETDEWEB)

    Gaisser, T.K.; Stanev, Todor

    2003-05-22

    We calculate the intensities and angular distributions of positive and negative muons produced by atmospheric neutrinos. We comment on some sources of uncertainty in the charge ratio. We also draw attention to a potentially interesting signature of neutrino oscillations in the muon charge ratio, and we discuss the prospects for its observation (which are not quite within the reach of currently planned magnetized detectors)

  10. Long-Ranged Oppositely Charged Interactions for Designing New Types of Colloidal Clusters

    Directory of Open Access Journals (Sweden)

    Ahmet Faik Demirörs

    2015-04-01

    Full Text Available Getting control over the valency of colloids is not trivial and has been a long-desired goal for the colloidal domain. Typically, tuning the preferred number of neighbors for colloidal particles requires directional bonding, as in the case of patchy particles, which is difficult to realize experimentally. Here, we demonstrate a general method for creating the colloidal analogs of molecules and other new regular colloidal clusters without using patchiness or complex bonding schemes (e.g., DNA coating by using a combination of long-ranged attractive and repulsive interactions between oppositely charged particles that also enable regular clusters of particles not all in close contact. We show that, due to the interplay between their attractions and repulsions, oppositely charged particles dispersed in an intermediate dielectric constant (4<ϵ<10 provide a viable approach for the formation of binary colloidal clusters. Tuning the size ratio and interactions of the particles enables control of the type and shape of the resulting regular colloidal clusters. Finally, we present an example of clusters made up of negatively charged large and positively charged small satellite particles, for which the electrostatic properties and interactions can be changed with an electric field. It appears that for sufficiently strong fields the satellite particles can move over the surface of the host particles and polarize the clusters. For even stronger fields, the satellite particles can be completely pulled off, reversing the net charge on the cluster. With computer simulations, we investigate how charged particles distribute on an oppositely charged sphere to minimize their energy and compare the results with the solutions to the well-known Thomson problem. We also use the simulations to explore the dependence of such clusters on Debye screening length κ^{−1} and the ratio of charges on the particles, showing good agreement with experimental observations.

  11. Radiocarbon positive-ion mass spectrometry

    International Nuclear Information System (INIS)

    Freeman, Stewart P.H.T.; Shanks, Richard P.; Donzel, Xavier; Gaubert, Gabriel

    2015-01-01

    Proof-of-principle of a new mass spectrometric technique for radiocarbon measurement is demonstrated. Interfering nitrogen and hydrocarbon molecules are largely eliminated in a charge-exchange cell operating on non-metallic gas. The positive-to-negative ion conversion is the reverse of that conventionally used in accelerator mass spectrometry (AMS) and is compatible with plasma ion sources that may be significantly more efficient and capable of greater output than are AMS sputter ion sources. The Nanogan electron cyclotron resonance (ECR) ion source employed exhibited no sample memory and the >50 kyrs age range of AMS was reproduced. A bespoke prototype new instrument is now required to optimise the plasma and cell physics and to realise hypothetical performance gains over AMS.

  12. Radiocarbon positive-ion mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, Stewart P.H.T.; Shanks, Richard P. [Scottish Universities Environmental Research Centre (SUERC), Scottish Enterprise Technology Park, East Kilbride G75 0QF (United Kingdom); Donzel, Xavier; Gaubert, Gabriel [Pantechnik S.A., 13 Rue de la Résistance, 14400 Bayeux (France)

    2015-10-15

    Proof-of-principle of a new mass spectrometric technique for radiocarbon measurement is demonstrated. Interfering nitrogen and hydrocarbon molecules are largely eliminated in a charge-exchange cell operating on non-metallic gas. The positive-to-negative ion conversion is the reverse of that conventionally used in accelerator mass spectrometry (AMS) and is compatible with plasma ion sources that may be significantly more efficient and capable of greater output than are AMS sputter ion sources. The Nanogan electron cyclotron resonance (ECR) ion source employed exhibited no sample memory and the >50 kyrs age range of AMS was reproduced. A bespoke prototype new instrument is now required to optimise the plasma and cell physics and to realise hypothetical performance gains over AMS.

  13. Theoretical aspects of electron transfer reactions of complex molecules

    DEFF Research Database (Denmark)

    Kuznetsov, A. M.; Ulstrup, Jens

    2001-01-01

    Features of electron transfer involving complex molecules are discussed. This notion presently refers to molecular reactants where charge transfer is accompanied by large molecular reorganization, and commonly used displaced harmonic oscillator models do not apply. It is shown that comprehensive...... theory of charge transfer in polar media offers convenient tools for the treatment of experimental data for such systems, with due account of large-amplitude strongly anharmonic intramolecular reorganization. Equations for the activation barrier and free energy relationships are provided, incorporating...

  14. Fragmentation and mean kinetic energy release of the nitrogen molecule

    International Nuclear Information System (INIS)

    Santos, A.C.F.; Melo, W.S.; Sant'Anna, M.M.; Sigaud, G.M.; Montenegro, E.C.

    2007-01-01

    Ionization and fragmentation of the N 2 molecule in coincidence with the final projectile charge state have been measured for the impact of 0.188-0.875 MeV/amu He + projectiles. The average kinetic energy release (KER) of the target ionic fragments is derived from the peak widths of their time-of-flight distributions. It is shown that the KER's for singly-charged products follow scaling laws irrespectively to the collision channel

  15. Charge changing cross sections for heavy-particle collisions in the energy range from 0.1 eV to 10 MeV, 1

    International Nuclear Information System (INIS)

    Okuno, Kazuhiko

    1978-12-01

    This paper presents a compilation of the experimental works on charge changing cross sections for neutral atoms, negative- and positive-atomic ions of atomic numbers Z = 2 - 5 in collisions with atoms and simple molecules. A systematic survey of the literature has been made through October 1977. Some recent data are also included. The result is summarized in graphical forms with reference lists attached. (author)

  16. Charge changing cross sections for heavy-particle collisions in the energy range from 0.1 eV to 10 MeV, 3

    International Nuclear Information System (INIS)

    Okuno, Kazuhiko

    1978-12-01

    This paper presents a compilation of the experimental works on charge changing cross sections for neutral atoms, negative- and positive-atomic ions of atomic numbers Z = 9 - 11 in collisions with atoms and simple molecules. A systematic survey of the leterature has been made through October 1977. Some recent data are also included. The result is summarized in graphical forms with reference lists attached. (author)

  17. Charge changing cross sections for heavy-particle collisions in the energy range from 0.1 eV to 10 MeV, 2

    International Nuclear Information System (INIS)

    Okuno, Kazuhiko

    1978-12-01

    This paper presents a compilation of the experimental works on charge changing cross sections for neutral atoms, negative- and positive-atomic ions of atomic numbers Z = 6 - 8 in collisions with atoms and simple molecules. A systematic survey of the literature has been made through October 1977. Some recent data are also included. The result is summarized in graphical forms with reference lists attached. (author)

  18. Study of ionization process of matrix molecules in matrix-assisted laser desorption ionization

    Energy Technology Data Exchange (ETDEWEB)

    Murakami, Kazumasa; Sato, Asami; Hashimoto, Kenro; Fujino, Tatsuya, E-mail: fujino@tmu.ac.jp

    2013-06-20

    Highlights: ► Proton transfer and adduction reaction of matrix in MALDI were studied. ► Hydroxyl group forming intramolecular hydrogen bond was related to the ionization. ► Intramolecular proton transfer in the electronic excited state was the initial step. ► Non-volatile analytes stabilized protonated matrix in the ground state. ► A possible mechanism, “analyte support mechanism”, has been proposed. - Abstract: Proton transfer and adduction reaction of matrix molecules in matrix-assisted laser desorption ionization were studied. By using 2,4,6-trihydroxyacetophenone (THAP), 2,5-dihydroxybenzoic acid (DHBA), and their related compounds in which the position of a hydroxyl group is different, it was clarified that a hydroxyl group forming an intramolecular hydrogen bond is related to the ionization of matrix molecules. Intramolecular proton transfer in the electronic excited state of the matrix and subsequent proton adduction from a surrounding solvent to the charge-separated matrix are the initial steps for the ionization of matrix molecules. Nanosecond pump–probe NIR–UV mass spectrometry confirmed that the existence of analyte molecules having large dipole moment in their structures is necessary for the stabilization of [matrix + H]{sup +} in the electronic ground state.

  19. What Is the Structure of the Naphthalene-Benzene Heterodimer Radical Cation? Binding Energy, Charge Delocalization, and Unexpected Charge-Transfer Interaction in Stacked Dimer and Trimer Radical Cations.

    Science.gov (United States)

    Attah, Isaac K; Platt, Sean P; Meot-Ner Mautner, Michael; El-Shall, M Samy; Peverati, Roberto; Head-Gordon, Martin

    2015-04-02

    The binding energy of the naphthalene(+•)(benzene) heterodimer cation has been determined to be 7.9 ± 1 kcal/mol for C10H8(+•)(C6H6) and 8.1 ± 1 kcal/mol for C10H8(+•)(C6D6) by equilibrium thermochemical measurements using the mass-selected drift cell technique. A second benzene molecule binds to the C10H8(+•)(C6D6) dimer with essentially the same energy (8.4 ± 1 kcal/mol), suggesting that the two benzene molecules are stacked on opposite sides of the naphthalene cation in the (C6D6)C10H8(+•)(C6D6) heterotrimer. The lowest-energy isomers of the C10H8(+•)(C6D6) and (C6D6)C10H8(+•)(C6D6) dimer and trimer calculated using the M11/cc-pVTZ method have parallel stacked structures with enthalpies of binding (-ΔH°) of 8.4 and 9.0 kcal/mol, respectively, in excellent agreement with the experimental values. The stacked face-to-face class of isomers is calculated to have substantial charge-transfer stabilization of about 45% of the total interaction energy despite the large difference between the ionization energies of benzene and naphthalene. Similarly, significant delocalization of the positive charge is found among all three fragments of the (C6D6)C10H8(+•)(C6D6) heterotrimer, thus leaving only 46% of the total charge on the central naphthalene moiety. This unexpectedly high charge-transfer component results in activating two benzene molecules in the naphthalene(+•)(benzene)2 heterotrimer cation to associate with a third benzene molecule at 219 K to form a benzene trimer cation and a neutral naphthalene molecule. The global minimum of the C10H8(+•)(C6H6)2 heterotrimer is found to be the one where the naphthalene cation is sandwiched between two benzene molecules. It is remarkable, and rather unusual, that the binding energy of the second benzene molecule is essentially the same as that of the first. This is attributed to the enhanced charge-transfer interaction in the stacked trimer radical cation.

  20. Characterization of Protein and Peptide Binding to Nanogels Formed by Differently Charged Chitosan Derivatives

    Directory of Open Access Journals (Sweden)

    Anastasia Zubareva

    2013-07-01

    Full Text Available Chitosan (Chi is a natural biodegradable cationic polymer with remarkable potency as a vehicle for drug or vaccine delivery. Chi possesses multiple groups, which can be used both for Chi derivatization and for particle formation. The aim of this work was to produce stable nanosized range Chi gels (nanogels, NGs with different charge and to study the driving forces of complex formation between Chi NGs and proteins or peptides. Positively charged NGs of 150 nm in diameter were prepared from hexanoyl chitosan (HC by the ionotropic gelation method while negatively charged NGs of 190 nm were obtained from succinoyl Chi (SC by a Ca2+ coacervation approach. NGs were loaded with a panel of proteins or peptides with different weights and charges. We show that NGs preferentially formed complexes with oppositely charged molecules, especially peptides, as was demonstrated by gel-electrophoresis, confocal microscopy and HPLC. Complex formation was accompanied by a change in zeta-potential and decrease in size. We concluded that complex formation between Chi NGs and peptide/proteins is mediated mostly by electrostatic interactions.

  1. Electron-molecule collisions

    International Nuclear Information System (INIS)

    Shimamura, I.; Takayanagi, K.

    1984-01-01

    The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

  2. Charge Transport Processes in Molecular Junctions

    Science.gov (United States)

    Smith, Christopher Eugene

    Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.

  3. Adsorption behavior of Co anchored on graphene sheets toward NO, SO{sub 2}, NH{sub 3}, CO and HCN molecules

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Yanan, E-mail: yntang2010@hotmail.com [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Chen, Weiguang; Li, Chenggang; Pan, Lijun [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Dai, Xianqi, E-mail: xqdai@henannu.edu.cn [College of Physics and Electronic Engineering, Zhengzhou Normal University, Zhengzhou, Henan 450044 (China); Quantum Materials Research Center, Zhengzhou Normal University, Henan 450044 (China); Ma, Dongwei [College of Physics and Electrical Engineering, Anyang Normal University, Anyang, Henan 455000 (China)

    2015-07-01

    Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH{sub 3} molecule, the adsorbed NO, SO{sub 2}, CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO{sub 2}. The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device.

  4. Dosimeter charging and/or reading apparatus

    International Nuclear Information System (INIS)

    Fine, L.T.; Jackson, T.P.

    1980-01-01

    A device is disclosed for charging and/or reading a capacitor associated with an electrometer incorporated in a radiation dosimeter for the purpose of initializing or ''zeroing'', the dosimeter at the commencement of a radiation measurement cycle or reading it at any time thereafter. The dosimeter electrometer has a movable electrode the position of which is indicative of the charge remaining on the dosimeter capacitor and in turn the amount of radiation incident on the dosimeter since it was zeroed. The charging device also includes means for discharging, immediately upon conclusion of the dosimeter capacitor charging operation, stray capacitance inherent in the dosimeter by reason of its mechanical construction. The charge on the stray capacitance, if not discharged at the conclusion of the dosimeter capacitor charging operation, leaks off during the measurement cycle, introducing measurement errors. A light source and suitable switch means are provided for automatically illuminating the movable electrode of the dosimeter electrometer as an incident to charging the dosimeter capacitor to facilitate reading the initial, or ''zero'', position of the movable electrometer electrode after the dosimeter capacitor has been charged and the stray capacitance discharged. Also included is a manually actuatable switch means, which is operable independently of the aforementioned automatic switch means, to energize the lamp and facilitate reading of the dosimeter without charging

  5. MOLECULES IN η CARINAE

    International Nuclear Information System (INIS)

    Loinard, Laurent; Menten, Karl M.; Güsten, Rolf; Zapata, Luis A.; Rodríguez, Luis F.

    2012-01-01

    We report the detection toward η Carinae of six new molecules, CO, CN, HCO + , HCN, HNC, and N 2 H + , and of two of their less abundant isotopic counterparts, 13 CO and H 13 CN. The line profiles are moderately broad (∼100 km s –1 ), indicating that the emission originates in the dense, possibly clumpy, central arcsecond of the Homunculus Nebula. Contrary to previous claims, CO and HCO + do not appear to be underabundant in η Carinae. On the other hand, molecules containing nitrogen or the 13 C isotope of carbon are overabundant by about one order of magnitude. This demonstrates that, together with the dust responsible for the dimming of η Carinae following the Great Eruption, the molecules detected here must have formed in situ out of CNO-processed stellar material.

  6. Electron Accumulative Molecules.

    Science.gov (United States)

    Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc

    2018-02-28

    With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can

  7. On Dust Charging Equation

    OpenAIRE

    Tsintsadze, Nodar L.; Tsintsadze, Levan N.

    2008-01-01

    A general derivation of the charging equation of a dust grain is presented, and indicated where and when it can be used. A problem of linear fluctuations of charges on the surface of the dust grain is discussed.

  8. Electron-vibron coupling effects on electron transport via a single-molecule magnet

    Science.gov (United States)

    McCaskey, Alexander; Yamamoto, Yoh; Warnock, Michael; Burzurí, Enrique; van der Zant, Herre S. J.; Park, Kyungwha

    2015-03-01

    We investigate how the electron-vibron coupling influences electron transport via an anisotropic magnetic molecule, such as a single-molecule magnet (SMM) Fe4, by using a model Hamiltonian with parameter values obtained from density-functional theory (DFT). The magnetic anisotropy parameters, vibrational energies, and electron-vibron coupling strengths of the Fe4 are computed using DFT. A giant spin model is applied to the Fe4 with only two charge states, specifically a neutral state with a total spin S =5 and a singly charged state with S =9 /2 , which is consistent with our DFT result and experiments on Fe4 single-molecule transistors. In sequential electron tunneling, we find that the magnetic anisotropy gives rise to new features in the conductance peaks arising from vibrational excitations. In particular, the peak height shows a strong, unusual dependence on the direction as well as magnitude of applied B field. The magnetic anisotropy also introduces vibrational satellite peaks whose position and height are modified with the direction and magnitude of applied B field. Furthermore, when multiple vibrational modes with considerable electron-vibron coupling have energies close to one another, a low-bias current is suppressed, independently of gate voltage and applied B field, although that is not the case for a single mode with a similar electron-vibron coupling. In the former case, the conductance peaks reveal a stronger B -field dependence than in the latter case. The new features appear because the magnetic anisotropy barrier is of the same order of magnitude as the energies of vibrational modes with significant electron-vibron coupling. Our findings clearly show the interesting interplay between magnetic anisotropy and electron-vibron coupling in electron transport via the Fe4. Similar behavior can be observed in transport via other anisotropic magnetic molecules.

  9. Tunnel magnetoresistance of magnetic molecules with spin-vibron coupling

    Directory of Open Access Journals (Sweden)

    Ahmed Kenawy

    2017-05-01

    Full Text Available The effect of molecular vibrations on the tunnel magnetoresistance (TMR of a magnetic tunnel junction with a single spin-anisotropic molecule interconnecting its electrodes is investigated theoretically. We demonstrate that if these vibrations couple at the same time to the charge of tunneling electrons and to the spin of the molecule, the spin anisotropy of such a molecule becomes enhanced. This has, in turn, a profound impact on the TMR of such a device showing that molecular vibrations lead to a significant change of spin-polarized transport, differing for the parallel and antiparallel magnetic configuration of the junction.

  10. Charging and Screening in Nonpolar Solutions of Nonionizable Surfactants

    Science.gov (United States)

    Behrens, Sven

    2010-03-01

    Nonpolar liquids do not easily accommodate electric charges, but surfactant additives are often found to dramatically increase the solution conductivity and promote surface charging of suspended colloid particles. Such surfactant-mediated electrostatic effects have been associated with equilibrium charge fluctuations among reverse surfactant micelles and in some cases with the statistically rare ionization of individual surfactant molecules. Here we present experimental evidence that even surfactants without any ionizable group can mediate charging and charge screening in nonpolar oils, and that they can do so at surfactant concentrations well below the critical micelle concentration (cmc). Precision conductometry, light scattering, and Karl-Fischer titration of sorbitan oleate solutions in hexane, paired with electrophoretic mobility measurements on suspended polymer particles, reveal a distinctly electrostatic action of the surfactant. We interpret our observations in terms of a charge fluctuation model and argue that the observed charging processes are likely facilitated, but not limited, by the presence of ionizable impurities.

  11. Linear shaped charge

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, David; Stofleth, Jerome H.; Saul, Venner W.

    2017-07-11

    Linear shaped charges are described herein. In a general embodiment, the linear shaped charge has an explosive with an elongated arrowhead-shaped profile. The linear shaped charge also has and an elongated v-shaped liner that is inset into a recess of the explosive. Another linear shaped charge includes an explosive that is shaped as a star-shaped prism. Liners are inset into crevices of the explosive, where the explosive acts as a tamper.

  12. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 1; Issue 2. Molecule of the Month Isomers of Benzene - Still Pursuing Dreams. J Chandrasekhar. Feature Article Volume 1 Issue 2 February 1996 pp 80-83. Fulltext. Click here to view fulltext PDF. Permanent link:

  13. Atoms, Molecules, and Compounds

    CERN Document Server

    Manning, Phillip

    2007-01-01

    Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

  14. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule of the Month - A Stable Dibismuthene - A Compound with a Bi-Bi Double Bond. V Chandrasekhar. Volume 16 ... Author Affiliations. V Chandrasekhar1. Department of Chemistry, Indian Institute of Technology, Kanpur 208 016, India.

  15. OMG: Open molecule generator

    NARCIS (Netherlands)

    Peironcely, J.E.; Rojas-Chertó, M.; Fichera, D.; Reijmers, T.; Coulier, L.; Faulon, J.-L.; Hankemeier, T.

    2012-01-01

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical

  16. Molecule-based magnets

    Indian Academy of Sciences (India)

    Administrator

    Employing self-assembly methods, it is possible to engineer a bulk molecular material ... synthesis of molecular magnets in 1986, a large variety of them have been synthesized, which can be catego- ... maintained stably per organic molecule, stabilization of a ..... rotating freely under an applied field because it is a magne-.

  17. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 5. Molecule of the Month Molecular–Chameleon: Solvatochromism at its Iridescent Best! Photon Rao. Feature Article Volume 2 Issue 5 May 1997 pp 69-72. Fulltext. Click here to view fulltext PDF. Permanent link:

  18. Molecular structure of the discotic liquid crystalline phase of hexa-peri-hexabenzocoronene/oligothiophene hybrid and their charge transport properties

    International Nuclear Information System (INIS)

    Bag, Saientan; Maingi, Vishal; Maiti, Prabal K.; Yelk, Joe; Glaser, Matthew A.; Clark, Noel A.; Walba, David M.

    2015-01-01

    Using atomistic molecular dynamics simulation, we study the discotic columnar liquid crystalline (LC) phases formed by a new organic compound having hexa-peri-Hexabenzocoronene (HBC) core with six pendant oligothiophene units recently synthesized by Nan Hu et al. [Adv. Mater. 26, 2066 (2014)]. This HBC core based LC phase was shown to have electric field responsive behavior and has important applications in organic electronics. Our simulation results confirm the hexagonal arrangement of columnar LC phase with a lattice spacing consistent with that obtained from small angle X-ray diffraction data. We have also calculated various positional and orientational correlation functions to characterize the ordering of the molecules in the columnar arrangement. The molecules in a column are arranged with an average twist of 25° having an average inter-molecular separation of ∼5 Å. Interestingly, we find an overall tilt angle of 43° between the columnar axis and HBC core. We also simulate the charge transport through this columnar phase and report the numerical value of charge carrier mobility for this liquid crystal phase. The charge carrier mobility is strongly influenced by the twist angle and average spacing of the molecules in the column

  19. Color and magnetic charge

    International Nuclear Information System (INIS)

    Kim, B.R.

    1976-01-01

    Schwinger's conjecture that the color degree of freedom of a quark is equivalent to its degree of freedom of taking different magnetic charges provides a plausible motivation for extending color to leptons. Leptons are just quarks with zero magnetic charges. It is shown that baryon number and lepton number can be replaced by fermion number and magnetic charge

  20. Exotic helium molecules

    International Nuclear Information System (INIS)

    Portier, M.

    2007-12-01

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)