WorldWideScience

Sample records for positive sequence variable

  1. Sequence determinants of human microsatellite variability

    Directory of Open Access Journals (Sweden)

    Jakobsson Mattias

    2009-12-01

    Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

  2. Variability of the protein sequences of lcrV between epidemic and atypical rhamnose-positive strains of Yersinia pestis.

    Science.gov (United States)

    Anisimov, Andrey P; Panfertsev, Evgeniy A; Svetoch, Tat'yana E; Dentovskaya, Svetlana V

    2007-01-01

    Sequencing of lcrV genes and comparison of the deduced amino acid sequences from ten Y. pestis strains belonging mostly to the group of atypical rhamnose-positive isolates (non-pestis subspecies or pestoides group) showed that the LcrV proteins analyzed could be classified into five sequence types. This classification was based on major amino acid polymorphisms among LcrV proteins in the four "hot points" of the protein sequences. Some additional minor polymorphisms were found throughout these sequence types. The "hot points" corresponded to amino acids 18 (Lys --> Asn), 72 (Lys --> Arg), 273 (Cys --> Ser), and 324-326 (Ser-Gly-Lys --> Arg) in the LcrV sequence of the reference Y. pestis strain CO92. One possible explanation for polymorphism in amino acid sequences of LcrV among different strains is that strain-specific variation resulted from adaptation of the plague pathogen to different rodent and lagomorph hosts.

  3. Detecting Scareware by Mining Variable Length Instruction Sequences

    OpenAIRE

    Shahzad, Raja Khurram; Lavesson, Niklas

    2011-01-01

    Scareware is a recent type of malicious software that may pose financial and privacy-related threats to novice users. Traditional countermeasures, such as anti-virus software, require regular updates and often lack the capability of detecting novel (unseen) instances. This paper presents a scareware detection method that is based on the application of machine learning algorithms to learn patterns in extracted variable length opcode sequences derived from instruction sequences of binary files....

  4. Accuracy of maxillary positioning after standard and inverted orthognathic sequencing.

    Science.gov (United States)

    Ritto, Fabio G; Ritto, Thiago G; Ribeiro, Danilo Passeado; Medeiros, Paulo José; de Moraes, Márcio

    2014-05-01

    This study aimed to compare the accuracy of maxillary positioning after bimaxillary orthognathic surgery, using 2 sequences. A total of 80 cephalograms (40 preoperative and 40 postoperative) from 40 patients were analyzed. Group 1 included radiographs of patients submitted to conventional sequence, whereas group 2 patients were submitted to inverted sequence. The final position of the maxillary central incisor was obtained after vertical and horizontal measurements of the tracings, and it was compared with what had been planned. The null hypothesis, which stated that there would be no difference between the groups, was tested. After applying the Welch t test for comparison of mean differences between maxillary desired and achieved position, considering a statistical significance of 5% and a 2-tailed test, the null hypothesis was not rejected (P > .05). Thus, there was no difference in the accuracy of maxillary positioning between groups. Conventional and inverted sequencing proved to be reliable in positioning the maxilla after LeFort I osteotomy in bimaxillary orthognathic surgeries. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. SU-E-J-231: Comparison of Delineation Variability of Soft Tissue Volume and Position in Head-And-Neck Between Two T1-Weighted Pulse Sequences Using An MR-Simulator with Immobilization

    Energy Technology Data Exchange (ETDEWEB)

    Wong, O; Lo, G; Yuan, J; Law, M; Ding, A; Cheng, K; Chan, K; Cheung, K; Yu, S [Hong Kong Sanatorium & Hospital, Hong Kong (Hong Kong)

    2015-06-15

    Purpose: There is growing interests in applying MR-simulator(MR-sim) in radiotherapy but MR images subject to hardware, patient and pulse sequence dependent geometric distortion that may potentially influence target definition. This study aimed to evaluate the influence on head-and-neck tissue delineation, in terms of positional and volumetric variability, of two T1-weighted(T1w) MR sequences on a 1.5T MR-sim Methods: Four healthy volunteers were scanned (4 scans for each on different days) using both spin-echo (3DCUBE, TR/TE=500/14ms, TA=183s) and gradient-echo sequences (3DFSPGR, TE/TR=7/4ms, TA=173s) with identical coverage, voxel-size(0.8×0.8×1.0mm3), receiver-bandwidth(62.5kHz/pix) and geometric correction on a 1.5T MR-sim immobilized with personalized thermoplastic cast and head-rest. Under this setting, similar T1w contrast and signal-to-noise ratio were obtained, and factors other than sequence that might bias image distortion and tissue delineation were minimized. VOIs of parotid gland(PGR, PGL), pituitary gland(PIT) and eyeballs(EyeL, EyeR) were carefully drawn, and inter-scan coefficient-of-variation(CV) of VOI centroid position and volume were calculated for each subject. Mean and standard deviation(SD) of the CVs for four subjects were compared between sequences using Wilcoxon ranksum test. Results: The mean positional(<4%) and volumetric(<7%) CVs varied between tissues, majorly dependent on tissue inherent properties like volume, location, mobility and deformability. Smaller mean volumetric CV was found in 3DCUBE, probably due to its less proneness to tissue susceptibility, but only PGL showed significant difference(P<0.05). Positional CVs had no significant differences for all VOIs(P>0.05) between sequences, suggesting volumetric variation might be more sensitive to sequence-dependent delineation difference. Conclusion: Although 3DCUBE is considered less prone to tissue susceptibility-induced artifact and distortion, our preliminary data showed

  6. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  8. Detecting false positive sequence homology: a machine learning approach.

    Science.gov (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Bybee, Seth M

    2016-02-24

    Accurate detection of homologous relationships of biological sequences (DNA or amino acid) amongst organisms is an important and often difficult task that is essential to various evolutionary studies, ranging from building phylogenies to predicting functional gene annotations. There are many existing heuristic tools, most commonly based on bidirectional BLAST searches that are used to identify homologous genes and combine them into two fundamentally distinct classes: orthologs and paralogs. Due to only using heuristic filtering based on significance score cutoffs and having no cluster post-processing tools available, these methods can often produce multiple clusters constituting unrelated (non-homologous) sequences. Therefore sequencing data extracted from incomplete genome/transcriptome assemblies originated from low coverage sequencing or produced by de novo processes without a reference genome are susceptible to high false positive rates of homology detection. In this paper we develop biologically informative features that can be extracted from multiple sequence alignments of putative homologous genes (orthologs and paralogs) and further utilized in context of guided experimentation to verify false positive outcomes. We demonstrate that our machine learning method trained on both known homology clusters obtained from OrthoDB and randomly generated sequence alignments (non-homologs), successfully determines apparent false positives inferred by heuristic algorithms especially among proteomes recovered from low-coverage RNA-seq data. Almost ~42 % and ~25 % of predicted putative homologies by InParanoid and HaMStR respectively were classified as false positives on experimental data set. Our process increases the quality of output from other clustering algorithms by providing a novel post-processing method that is both fast and efficient at removing low quality clusters of putative homologous genes recovered by heuristic-based approaches.

  9. Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein

    Science.gov (United States)

    Lannergård, Jonas; Kristensen, Bodil M; Gustafsson, Mattias C U; Persson, Jenny J; Norrby-Teglund, Anna; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

    2015-01-01

    The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms, sequence variability and weak immunogenicity. However, the properties influencing the immunogenicity of regions in an M protein remain poorly understood. Here, we studied the antibody response to different regions of the classical M1 and M5 proteins, in which not only the HVR but also the adjacent fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant. Thus, we identified a correlation between sequence variability and weak immunogenicity for M protein regions. A potential explanation for the weak immunogenicity was provided by the demonstration that protease digestion selectively eliminated the HVR-B part from whole M protein-expressing bacteria. These data support a coherent model, in which the entire variable HVR-B part evades antibody attack, not only by sequence variability but also by weak immunogenicity resulting from protease attack. PMID:26175306

  10. Relationship between mRNA secondary structure and sequence variability in Chloroplast genes: possible life history implications.

    Science.gov (United States)

    Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J

    2008-01-28

    Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of

  11. Subfamily logos: visualization of sequence deviations at alignment positions with high information content

    Directory of Open Access Journals (Sweden)

    Beitz Eric

    2006-06-01

    Full Text Available Abstract Background Recognition of relevant sequence deviations can be valuable for elucidating functional differences between protein subfamilies. Interesting residues at highly conserved positions can then be mutated and experimentally analyzed. However, identification of such sites is tedious because automated approaches are scarce. Results Subfamily logos visualize subfamily-specific sequence deviations. The display is similar to classical sequence logos but extends into the negative range. Positive, upright characters correspond to residues which are characteristic for the subfamily, negative, upside-down characters to residues typical for the remaining sequences. The symbol height is adjusted to the information content of the alignment position. Residues which are conserved throughout do not appear. Conclusion Subfamily logos provide an intuitive display of relevant sequence deviations. The method has proven to be valid using a set of 135 aligned aquaporin sequences in which established subfamily-specific positions were readily identified by the algorithm.

  12. Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein.

    Science.gov (United States)

    Lannergård, Jonas; Kristensen, Bodil M; Gustafsson, Mattias C U; Persson, Jenny J; Norrby-Teglund, Anna; Stålhammar-Carlemalm, Margaretha; Lindahl, Gunnar

    2015-10-01

    The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms, sequence variability and weak immunogenicity. However, the properties influencing the immunogenicity of regions in an M protein remain poorly understood. Here, we studied the antibody response to different regions of the classical M1 and M5 proteins, in which not only the HVR but also the adjacent fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant. Thus, we identified a correlation between sequence variability and weak immunogenicity for M protein regions. A potential explanation for the weak immunogenicity was provided by the demonstration that protease digestion selectively eliminated the HVR-B part from whole M protein-expressing bacteria. These data support a coherent model, in which the entire variable HVR-B part evades antibody attack, not only by sequence variability but also by weak immunogenicity resulting from protease attack. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  13. Genome-wide SNP identification by high-throughput sequencing and selective mapping allows sequence assembly positioning using a framework genetic linkage map

    Directory of Open Access Journals (Sweden)

    Xu Xiangming

    2010-12-01

    Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.

  14. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  15. Partial summations of stationary sequences of non-Gaussian random variables

    DEFF Research Database (Denmark)

    Mohr, Gunnar; Ditlevsen, Ove Dalager

    1996-01-01

    The distribution of the sum of a finite number of identically distributed random variables is in many cases easily determined given that the variables are independent. The moments of any order of the sum can always be expressed by the moments of the single term without computational problems...... of convergence of the distribution of a sum (or an integral) of mutually dependent random variables to the Gaussian distribution. The paper is closely related to the work in Ditlevsen el al. [Ditlevsen, O., Mohr, G. & Hoffmeyer, P. Integration of non-Gaussian fields. Prob. Engng Mech 11 (1996) 15-23](2)....... lognormal variables or polynomials of standard Gaussian variables. The dependency structure is induced by specifying the autocorrelation structure of the sequence of standard Gaussian variables. Particularly useful polynomials are the Winterstein approximations that distributionally fit with non...

  16. The Effects of Delayed Reinforcement on Variability and Repetition of Response Sequences

    Science.gov (United States)

    Odum, Amy L.; Ward, Ryan D.; Burke, K. Anne; Barnes, Christopher A.

    2006-01-01

    Four experiments examined the effects of delays to reinforcement on key peck sequences of pigeons maintained under multiple schedules of contingencies that produced variable or repetitive behavior. In Experiments 1, 2, and 4, in the repeat component only the sequence right-right-left-left earned food, and in the vary component four-response…

  17. Variability of centric relation position in TMD patients.

    NARCIS (Netherlands)

    Zonnenberg, A.J.J.; Mulder, J.

    2006-01-01

    Reproducibility of the centric relation position for patients with temporomandibular disorders (TMD) is not documented in the current literature. It was the objective of this study to assess clinical variability of the centric relation position for TMD patients with a muscle-determined technique by

  18. Cultural conservatism and variability in the Acheulian sequence of Gesher Benot Ya'aqov.

    Science.gov (United States)

    Sharon, Gonen; Alperson-Afil, Nira; Goren-Inbar, Naama

    2011-04-01

    The Acheulian Technocomplex exhibits two phenomena: variability and conservatism. Variability is expressed in the composition and frequencies of tool types, particularly in the varying frequencies of bifaces (handaxes and cleavers). Conservatism is expressed in the continuous presence of bifaces along an immense time trajectory. The site of Gesher Benot Ya'aqov (GBY) offers a unique opportunity to study aspects of variability and conservatism as a result of its long cultural-stratigraphic sequence containing superimposed lithic assemblages. This study explores aspects of variability and conservatism within the Acheulian lithic assemblages of GBY, with emphasis placed on the bifacial tools. While variability has been studied through a comparison of typological frequencies in a series of assemblages from the site, evidence for conservatism was examined in the production modes expressed by the reduction sequence of the bifaces. We demonstrate that while pronounced typological variability is observed among the GBY assemblages, they were all manufactured by the same technology. The technology, size, and morphology of the bifaces throughout the entire stratigraphic sequence of GBY reflect the strong conservatism of their makers. We conclude that the biface frequency cannot be considered as a chrono/cultural marker that might otherwise allow us to distinguish between different phases within the Acheulian. The variability observed within the assemblages is explained as a result of different activities, tasks, and functions, which were carried out at specific localities along the shores of the paleo-Hula Lake in the early Middle Pleistocene. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. Nonlinear Synchronization for Automatic Learning of 3D Pose Variability in Human Motion Sequences

    Directory of Open Access Journals (Sweden)

    Mozerov M

    2010-01-01

    Full Text Available A dense matching algorithm that solves the problem of synchronizing prerecorded human motion sequences, which show different speeds and accelerations, is proposed. The approach is based on minimization of MRF energy and solves the problem by using Dynamic Programming. Additionally, an optimal sequence is automatically selected from the input dataset to be a time-scale pattern for all other sequences. The paper utilizes an action specific model which automatically learns the variability of 3D human postures observed in a set of training sequences. The model is trained using the public CMU motion capture dataset for the walking action, and a mean walking performance is automatically learnt. Additionally, statistics about the observed variability of the postures and motion direction are also computed at each time step. The synchronized motion sequences are used to learn a model of human motion for action recognition and full-body tracking purposes.

  20. Genome sequence of a urease-positive Campylobacter lari strain

    Science.gov (United States)

    Campylobacter lari is frequently isolated from shore birds and can cause illness in humans. Here we report the draft whole genome sequence of an urease-positive strain of C. lari that was isolated in estuarial water on the coast of Delaware, USA....

  1. Characterization of Campylobacter jejuni applying flaA short variable region sequencing, multilocus sequencing and Fourier transform infrared spectroscopy

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas

    flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...

  2. Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.

    Science.gov (United States)

    Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian

    2017-11-23

    Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.

  3. The Solar Neighborhood. XLI. A Study of the Wide Main Sequence for M Dwarfs—Long-term Photometric Variability

    Energy Technology Data Exchange (ETDEWEB)

    Clements, Tiffany D.; Jao, Wei-Chun; Silverstein, Michele L. [Department of Physics and Astronomy, Georgia State University, Atlanta, GA 30303 (United States); Henry, Todd J.; Hosey, Altonio D. [RECONS Institute, Chambersburg, PA 17201 (United States); Winters, Jennifer G. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Dieterich, Sergio B. [Carnegie Institution for Science, Washington, DC 20015 (United States); Riedel, Adric R., E-mail: pewett@astro.gsu.edu, E-mail: jao@astro.gsu.edu, E-mail: silverstein@astro.gsu.edu, E-mail: toddhenry28@gmail.com, E-mail: altoniohosey@gmail.com, E-mail: jennifer.winters@cfa.harvard.edu, E-mail: sdieterich@carnegiescience.edu, E-mail: adric.riedel@gmail.com [Space Telescope Science Institute, Baltimore, MD 21218 (United States)

    2017-09-01

    We report findings from a long-term photometric variability study of M dwarfs carried out at the SMARTS 0.9 m telescope at the Cerro Tololo Inter-American Observatory. As part of a multi-faceted effort to investigate the range of luminosities of M dwarfs of a given color on the Hertzsprung–Russell Diagram, 76 M dwarfs have been observed for 3–17 years in the Johnson–Kron–Cousins V band. We find that stars elevated above the center of the main sequence distribution tend to have higher levels of variability, likely caused by magnetic activity, than their fainter counterparts below the center. This study provides insight into how the long-term magnetic activity of these stars may be affecting their sizes, luminosities, and thus positions on the H-R Diagram.

  4. Genetic variability of Echinococcus granulosus complex in various geographical populations of Iran inferred by mitochondrial DNA sequences.

    Science.gov (United States)

    Spotin, Adel; Mahami-Oskouei, Mahmoud; Harandi, Majid Fasihi; Baratchian, Mehdi; Bordbar, Ali; Ahmadpour, Ehsan; Ebrahimi, Sahar

    2017-01-01

    To investigate the genetic variability and population structure of Echinococcus granulosus complex, 79 isolates were sequenced from different host species covering human, dog, camel, goat, sheep and cattle as of various geographical sub-populations of Iran (Northwestern, Northern, and Southeastern). In addition, 36 sequences of other geographical populations (Western, Southeastern and Central Iran), were directly retrieved from GenBank database for the mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The confirmed isolates were grouped as G1 genotype (n=92), G6 genotype (n=14), G3 genotype (n=8) and G2 genotype (n=1). 50 unique haplotypes were identified based on the analyzed sequences of cox1. A parsimonious network of the sequence haplotypes displayed star-like features in the overall population containing IR23 (22: 19.1%) as the most common haplotype. According to the analysis of molecular variance (AMOVA) test, the high value of haplotype diversity of E. granulosus complex was shown the total genetic variability within populations while nucleotide diversity was low in all populations. Neutrality indices of the cox1 (Tajima's D and Fu's Fs tests) were shown negative values in Western-Northwestern, Northern and Southeastern populations which indicating significant divergence from neutrality and positive but not significant in Central isolates. A pairwise fixation index (Fst) as a degree of gene flow was generally low value for all populations (0.00647-0.15198). The statistically Fst values indicate that Echinococcus sensu stricto (genotype G1-G3) populations are not genetically well differentiated in various geographical regions of Iran. To appraise the hypothetical evolutionary scenario, further study is needed to analyze concatenated mitogenomes and as well a panel of single locus nuclear markers should be considered in wider areas of Iran and neighboring countries. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Influences on the variability of eruption sequences and style transitions in the Auckland Volcanic Field, New Zealand

    Science.gov (United States)

    Kereszturi, Gábor; Németh, Károly; Cronin, Shane J.; Procter, Jonathan; Agustín-Flores, Javier

    2014-10-01

    Monogenetic basaltic volcanism is characterised by a complex array of eruptive behaviours, reflecting spatial and temporal variability of the magmatic properties (e.g. composition, eruptive volume, magma flux) as well as environmental factors at the vent site (e.g. availability of water, country rock geology, faulting). These combine to produce changes in eruption style over brief periods (minutes to days) in many eruption episodes. Monogenetic eruptions in some volcanic fields often start with a phreatomagmatic vent-opening phase that later transforms into "dry" magmatic explosive or effusive activity, with a strong variation in the duration and importance of this first phase. Such an eruption sequence pattern occurred in 83% of the known eruption in the 0.25 My-old Auckland Volcanic Field (AVF), New Zealand. In this investigation, the eruptive volumes were compared with the sequences of eruption styles preserved in the pyroclastic record at each volcano of the AVF, as well as environmental influencing factors, such as distribution and thickness of water-saturated semi- to unconsolidated sediments, topographic position, distances from known fault lines. The AVF showed that there is no correlation between ejecta ring volumes and environmental influencing factors that is valid for the entire AVF. In contrary, using a set of comparisons of single volcanoes with well-known and documented sequences, resultant eruption sequences could be explained by predominant patterns of the environment in which these volcanoes were erupted. Based on the spatial variability of these environmental factors, a first-order susceptibility hazard map was constructed for the AVF that forecasts areas of largest likelihood for phreatomagmatic eruptions by overlaying topographical and shallow geological information. Combining detailed phase-by-phase breakdowns of eruptive volumes and the event sequences of the AVF, along with the new susceptibility map, more realistic eruption scenarios can be

  6. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...

  7. Cytomegalovirus sequence variability, amplicon length, and DNase-sensitive non-encapsidated genomes are obstacles to standardization and commutability of plasma viral load results.

    Science.gov (United States)

    Naegele, Klaudia; Lautenschlager, Irmeli; Gosert, Rainer; Loginov, Raisa; Bir, Katia; Helanterä, Ilkka; Schaub, Stefan; Khanna, Nina; Hirsch, Hans H

    2018-04-22

    Cytomegalovirus (CMV) management post-transplantation relies on quantification in blood, but inter-laboratory and inter-assay variability impairs commutability. An international multicenter study demonstrated that variability is mitigated by standardizing plasma volumes, automating DNA extraction and amplification, and calibration to the 1st-CMV-WHO-International-Standard as in the FDA-approved Roche-CAP/CTM-CMV. However, Roche-CAP/CTM-CMV showed under-quantification and false-negative results in a quality assurance program (UK-NEQAS-2014). To evaluate factors contributing to quantification variability of CMV viral load and to develop optimized CMV-UL54-QNAT. The UL54 target of the UK-NEQAS-2014 variant was sequenced and compared to 329 available CMV GenBank sequences. Four Basel-CMV-UL54-QNAT assays of 361 bp, 254 bp, 151 bp, and 95 bp amplicons were developed that only differed in reverse primer positions. The assays were validated using plasmid dilutions, UK-NEQAS-2014 sample, as well as 107 frozen and 69 prospectively collected plasma samples from transplant patients submitted for CMV QNAT, with and without DNase-digestion prior to nucleic acid extraction. Eight of 43 mutations were identified as relevant in the UK-NEQAS-2014 target. All Basel-CMV-UL54 QNATs quantified the UK-NEQAS-2014 but revealed 10-fold increasing CMV loads as amplicon size decreased. The inverse correlation of amplicon size and viral loads was confirmed using 1st-WHO-International-Standard and patient samples. DNase pre-treatment reduced plasma CMV loads by >90% indicating the presence of unprotected CMV genomic DNA. Sequence variability, amplicon length, and non-encapsidated genomes obstruct standardization and commutability of CMV loads needed to develop thresholds for clinical research and management. Besides regular sequence surveys, matrix and extraction standardization, we propose developing reference calibrators using 100 bp amplicons. Copyright © 2018 Elsevier B.V. All

  8. Instrumented Impact Testing: Influence of Machine Variables and Specimen Position

    International Nuclear Information System (INIS)

    Lucon, E.; McCowan, C. N.; Santoyo, R. A.

    2008-01-01

    An investigation has been conducted on the influence of impact machine variables and specimen positioning on characteristic forces and absorbed energies from instrumented Charpy tests. Brittle and ductile fracture behavior has been investigated by testing NIST reference samples of low, high and super-high energy levels. Test machine variables included tightness of foundation, anvil and striker bolts, and the position of the center of percussion with respect to the center of strike. For specimen positioning, we tested samples which had been moved away or sideways with respect to the anvils. In order to assess the influence of the various factors, we compared mean values in the reference (unaltered) and altered conditions; for machine variables, t-test analyses were also performed in order to evaluate the statistical significance of the observed differences. Our results indicate that the only circumstance which resulted in variations larger than 5 percent for both brittle and ductile specimens is when the sample is not in contact with the anvils. These findings should be taken into account in future revisions of instrumented Charpy test standards.

  9. Instrumented Impact Testing: Influence of Machine Variables and Specimen Position

    Energy Technology Data Exchange (ETDEWEB)

    Lucon, E.; McCowan, C. N.; Santoyo, R. A.

    2008-09-15

    An investigation has been conducted on the influence of impact machine variables and specimen positioning on characteristic forces and absorbed energies from instrumented Charpy tests. Brittle and ductile fracture behavior has been investigated by testing NIST reference samples of low, high and super-high energy levels. Test machine variables included tightness of foundation, anvil and striker bolts, and the position of the center of percussion with respect to the center of strike. For specimen positioning, we tested samples which had been moved away or sideways with respect to the anvils. In order to assess the influence of the various factors, we compared mean values in the reference (unaltered) and altered conditions; for machine variables, t-test analyses were also performed in order to evaluate the statistical significance of the observed differences. Our results indicate that the only circumstance which resulted in variations larger than 5 percent for both brittle and ductile specimens is when the sample is not in contact with the anvils. These findings should be taken into account in future revisions of instrumented Charpy test standards.

  10. Importance of Viral Sequence Length and Number of Variable and Informative Sites in Analysis of HIV Clustering.

    Science.gov (United States)

    Novitsky, Vlad; Moyo, Sikhulile; Lei, Quanhong; DeGruttola, Victor; Essex, M

    2015-05-01

    To improve the methodology of HIV cluster analysis, we addressed how analysis of HIV clustering is associated with parameters that can affect the outcome of viral clustering. The extent of HIV clustering and tree certainty was compared between 401 HIV-1C near full-length genome sequences and subgenomic regions retrieved from the LANL HIV Database. Sliding window analysis was based on 99 windows of 1,000 bp and 45 windows of 2,000 bp. Potential associations between the extent of HIV clustering and sequence length and the number of variable and informative sites were evaluated. The near full-length genome HIV sequences showed the highest extent of HIV clustering and the highest tree certainty. At the bootstrap threshold of 0.80 in maximum likelihood (ML) analysis, 58.9% of near full-length HIV-1C sequences but only 15.5% of partial pol sequences (ViroSeq) were found in clusters. Among HIV-1 structural genes, pol showed the highest extent of clustering (38.9% at a bootstrap threshold of 0.80), although it was significantly lower than in the near full-length genome sequences. The extent of HIV clustering was significantly higher for sliding windows of 2,000 bp than 1,000 bp. We found a strong association between the sequence length and proportion of HIV sequences in clusters, and a moderate association between the number of variable and informative sites and the proportion of HIV sequences in clusters. In HIV cluster analysis, the extent of detectable HIV clustering is directly associated with the length of viral sequences used, as well as the number of variable and informative sites. Near full-length genome sequences could provide the most informative HIV cluster analysis. Selected subgenomic regions with a high extent of HIV clustering and high tree certainty could also be considered as a second choice.

  11. Genetic variability of Echinococcus granulosus from the Tibetan plateau inferred by mitochondrial DNA sequences.

    Science.gov (United States)

    Yan, Ning; Nie, Hua-Ming; Jiang, Zhong-Rong; Yang, Ai-Guo; Deng, Shi-Jin; Guo, Li; Yu, Hua; Yan, Yu-Bao; Tsering, Dawa; Kong, Wei-Shu; Wang, Ning; Wang, Jia-Hai; Xie, Yue; Fu, Yan; Yang, De-Ying; Wang, Shu-Xian; Gu, Xiao-Bin; Peng, Xue-Rong; Yang, Guang-You

    2013-09-01

    To analyse genetic variability and population structure, 84 isolates of Echinococcus granulosus (Cestoda: Taeniidae) collected from various host species at different sites of the Tibetan plateau in China were sequenced for the whole mitochondrial nad1 (894 bp) and atp6 (513 bp) genes. The vast majority were classified as G1 genotype (n=82), and two samples from human patients in Sichuan province were identified as G3 genotype. Based on the concatenated sequences of nad1+atp6, 28 different haplotypes (NA1-NA28) were identified. A parsimonious network of the concatenated sequence haplotypes showed star-like features in the overall population, with NA1 as the major haplotype in the population networks. By AMOVA it was shown that variation of E. granulosus within the overall population was the main pattern of the total genetic variability. Neutrality indexes of the concatenated sequence (nad1+atp6) were computed by Tajima's D and Fu's Fs tests and showed high negative values for E. granulosus, indicating significant deviations from neutrality. FST and Nm values suggested that the populations were not genetically differentiated. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Heritability of Intraindividual Mean and Variability of Positive and Negative Affect.

    Science.gov (United States)

    Zheng, Yao; Plomin, Robert; von Stumm, Sophie

    2016-12-01

    Positive affect (e.g., attentiveness) and negative affect (e.g., upset) fluctuate over time. We examined genetic influences on interindividual differences in the day-to-day variability of affect (i.e., ups and downs) and in average affect over the duration of a month. Once a day, 17-year-old twins in the United Kingdom ( N = 447) rated their positive and negative affect online. The mean and standard deviation of each individual's daily ratings across the month were used as the measures of that individual's average affect and variability of affect. Analyses revealed that the average of negative affect was significantly heritable (.53), but the average of positive affect was not; instead, the latter showed significant shared environmental influences (.42). Fluctuations across the month were significantly heritable for both negative affect (.54) and positive affect (.34). The findings support the two-factor theory of affect, which posits that positive affect is more situational and negative affect is more dispositional.

  13. Exponential Inequalities for Positively Associated Random Variables and Applications

    Directory of Open Access Journals (Sweden)

    Yang Shanchao

    2008-01-01

    Full Text Available Abstract We establish some exponential inequalities for positively associated random variables without the boundedness assumption. These inequalities improve the corresponding results obtained by Oliveira (2005. By one of the inequalities, we obtain the convergence rate for the case of geometrically decreasing covariances, which closes to the optimal achievable convergence rate for independent random variables under the Hartman-Wintner law of the iterated logarithm and improves the convergence rate derived by Oliveira (2005 for the above case.

  14. Interchangeable Positions in Interaction Sequences in Science Classrooms

    Directory of Open Access Journals (Sweden)

    Carol Rees

    2017-03-01

    Full Text Available Triadic dialogue, the Initiation, Response, Evaluation sequence typical of teacher /student interactions in classrooms, has long been identified as a barrier to students’ access to learning, including science learning. A large body of research on the subject has over the years led to projects and policies aimed at increasing opportunities for students to learn through interactive dialogue in classrooms. However, the triadic dialogue pattern continues to dominate, even when teachers intend changing this. Prior quantitative research on the subject has focused on identifying independent variables such as style of teacher questioning that have an impact, while qualitative researchers have worked to interpret the use of dialogue within the whole context of work in the classroom. A recent paper offers an alternative way to view the triadic dialogue pattern and its origin; the triadic dialogue pattern is an irreducible social phenomenon that arises in a particular situation regardless of the identity of the players who inhabit the roles in the turn-taking sequence (Roth & Gardner, 2012. According to this perspective, alternative patterns of dialogue would exist which are alternative irreducible social phenomena that arise in association with different situations. The aim of this paper is to examine as precisely as possible, the characteristics of dialogue patterns in a seventh-eighth grade classroom during science inquiry, and the precise situations from which these dialogue patterns emerge, regardless of the staffing (teacher or students in the turn-taking sequence. Three different patterns were identified each predominating in a particular situation. This fine-grained analysis could offer valuable insights into ways to support teachers working to alter the kinds of dialogue patterns that arise in their classrooms.

  15. Phylogeny and intraspecific variability of holoparasitic Orobanche (Orobanchaceae) inferred from plastid rbcL sequences.

    Science.gov (United States)

    Manen, Jean-François; Habashi, Christine; Jeanmonod, Daniel; Park, Jeong-Mi; Schneeweiss, Gerald M

    2004-11-01

    The rbcL sequences of 106 specimens representing 28 species of the four recognized sections of Orobanche were analyzed and compared. Most sequences represent pseudogenes with premature stop codons. This study confirms that the American lineage (sects. Gymnocaulis and Myzorrhiza) contains potentially functional rbcL-copies with intact open reading frames and low rates of non-synonymous substitutions. For the first time, this is also shown for a member of the Eurasian lineage, O. coerulescens of sect. Orobanche, while all other investigated species of sects. Orobanche and Trionychon contain pseudogenes with distorted reading frames and significantly higher rates of non-synonymous substitutions. Phylogenetic analyses of the rbcL sequences give equivocal results concerning the monophyly of Orobanche, and the American lineage might be more closely related to Boschniakia and Cistanche than to the other sections of Orobanche. Additionally, species of sect. Trionychon phylogenetically nest in sect. Orobanche. This is in concordance with results from other plastid markers (rps2 and matK), but in disagreement with other molecular (nuclear ITS), morphological, and karyological data. This might indicate that the ancestor of sect. Trionychon has captured the plastid genome, or parts of it, of a member of sect. Orobanche. Apart from the phylogenetically problematic position of sect. Trionychon, the phylogenetic relationships within sect. Orobanche are similar to those inferred from nuclear ITS data and are close to the traditional groupings traditionally recognized based on morphology. The intraspecific variation of rbcL is low and is neither correlated with intraspecific morphological variability nor with host range. Ancestral character reconstruction using parsimony suggests that the ancestor of O. sect. Orobanche had a narrow host range.

  16. A Model for Positively Correlated Count Variables

    DEFF Research Database (Denmark)

    Møller, Jesper; Rubak, Ege Holger

    2010-01-01

    An α-permanental random field is briefly speaking a model for a collection of non-negative integer valued random variables with positive associations. Though such models possess many appealing probabilistic properties, many statisticians seem unaware of α-permanental random fields...... and their potential applications. The purpose of this paper is to summarize useful probabilistic results, study stochastic constructions and simulation techniques, and discuss some examples of α-permanental random fields. This should provide a useful basis for discussing the statistical aspects in future work....

  17. Estimates of statistical significance for comparison of individual positions in multiple sequence alignments

    Directory of Open Access Journals (Sweden)

    Sadreyev Ruslan I

    2004-08-01

    Full Text Available Abstract Background Profile-based analysis of multiple sequence alignments (MSA allows for accurate comparison of protein families. Here, we address the problems of detecting statistically confident dissimilarities between (1 MSA position and a set of predicted residue frequencies, and (2 between two MSA positions. These problems are important for (i evaluation and optimization of methods predicting residue occurrence at protein positions; (ii detection of potentially misaligned regions in automatically produced alignments and their further refinement; and (iii detection of sites that determine functional or structural specificity in two related families. Results For problems (1 and (2, we propose analytical estimates of P-value and apply them to the detection of significant positional dissimilarities in various experimental situations. (a We compare structure-based predictions of residue propensities at a protein position to the actual residue frequencies in the MSA of homologs. (b We evaluate our method by the ability to detect erroneous position matches produced by an automatic sequence aligner. (c We compare MSA positions that correspond to residues aligned by automatic structure aligners. (d We compare MSA positions that are aligned by high-quality manual superposition of structures. Detected dissimilarities reveal shortcomings of the automatic methods for residue frequency prediction and alignment construction. For the high-quality structural alignments, the dissimilarities suggest sites of potential functional or structural importance. Conclusion The proposed computational method is of significant potential value for the analysis of protein families.

  18. Contribution of execution noise to arm movement variability in three-dimensional space.

    Science.gov (United States)

    Apker, Gregory A; Buneo, Christopher A

    2012-01-01

    Reaching movements are subject to noise associated with planning and execution, but precisely how these noise sources interact to determine patterns of endpoint variability in three-dimensional space is not well understood. For frontal plane movements, variability is largest along the depth axis (the axis along which visual planning noise is greatest), with execution noise contributing to this variability along the movement direction. Here we tested whether these noise sources interact in a similar way for movements directed in depth. Subjects performed sequences of two movements from a single starting position to targets that were either both contained within a frontal plane ("frontal sequences") or where the first was within the frontal plane and the second was directed in depth ("depth sequences"). For both sequence types, movements were performed with or without visual feedback of the hand. When visual feedback was available, endpoint distributions for frontal and depth sequences were generally anisotropic, with the principal axes of variability being strongly aligned with the depth axis. Without visual feedback, endpoint distributions for frontal sequences were relatively isotropic and movement direction dependent, while those for depth sequences were similar to those with visual feedback. Overall, the results suggest that in the presence of visual feedback, endpoint variability is dominated by uncertainty associated with planning and updating visually guided movements. In addition, the results suggest that without visual feedback, increased uncertainty in hand position estimation effectively unmasks the effect of execution-related noise, resulting in patterns of endpoint variability that are highly movement direction dependent.

  19. Inter-operator Variability in Defining Uterine Position Using Three-dimensional Ultrasound Imaging

    DEFF Research Database (Denmark)

    Baker, Mariwan; Jensen, Jørgen Arendt; Behrens, Claus F.

    2013-01-01

    significantly larger inter-fractional uterine positional displacement, in some cases up to 20 mm, which outweighs the magnitude of current inter-operator variations. Thus, the current US-phantom-study suggests that the inter-operator variability in addressing uterine position is clinically irrelevant.......In radiotherapy the treatment outcome of gynecological (GYN) cancer patients is crucially related to reproducibility of the actual uterine position. The purpose of this study is to evaluate the inter-operator variability in addressing uterine position using a novel 3-D ultrasound (US) system....... The study is initiated by US-scanning of a uterine phantom (CIRS 404, Universal Medical, Norwood, USA) by seven experienced US operators. The phantom represents a female pelvic region, containing a uterus, bladder and rectal landmarks readily definable in the acquired US-scans. The organs are subjected...

  20. Alignment-free Transcriptomic and Metatranscriptomic Comparison Using Sequencing Signatures with Variable Length Markov Chains.

    Science.gov (United States)

    Liao, Weinan; Ren, Jie; Wang, Kun; Wang, Shun; Zeng, Feng; Wang, Ying; Sun, Fengzhu

    2016-11-23

    The comparison between microbial sequencing data is critical to understand the dynamics of microbial communities. The alignment-based tools analyzing metagenomic datasets require reference sequences and read alignments. The available alignment-free dissimilarity approaches model the background sequences with Fixed Order Markov Chain (FOMC) yielding promising results for the comparison of microbial communities. However, in FOMC, the number of parameters grows exponentially with the increase of the order of Markov Chain (MC). Under a fixed high order of MC, the parameters might not be accurately estimated owing to the limitation of sequencing depth. In our study, we investigate an alternative to FOMC to model background sequences with the data-driven Variable Length Markov Chain (VLMC) in metatranscriptomic data. The VLMC originally designed for long sequences was extended to apply to high-throughput sequencing reads and the strategies to estimate the corresponding parameters were developed. The flexible number of parameters in VLMC avoids estimating the vast number of parameters of high-order MC under limited sequencing depth. Different from the manual selection in FOMC, VLMC determines the MC order adaptively. Several beta diversity measures based on VLMC were applied to compare the bacterial RNA-Seq and metatranscriptomic datasets. Experiments show that VLMC outperforms FOMC to model the background sequences in transcriptomic and metatranscriptomic samples. A software pipeline is available at https://d2vlmc.codeplex.com.

  1. An Adaptive Method for Switching between Pedestrian/Car Indoor Positioning Algorithms based on Multilayer Time Sequences

    Directory of Open Access Journals (Sweden)

    Zhining Gu

    2018-02-01

    Full Text Available Pedestrian dead reckoning (PDR positioning algorithms can be used to obtain a target’s location only for movement with step features and not for driving, for which the trilateral Bluetooth indoor positioning method can be used. In this study, to obtain the precise locations of different states (pedestrian/car using the corresponding positioning algorithms, we propose an adaptive method for switching between the PDR and car indoor positioning algorithms based on multilayer time sequences (MTSs. MTSs, which consider the behavior context, comprise two main aspects: filtering of noisy data in small-scale time sequences and using a state chain to reduce the time delay of algorithm switching in large-scale time sequences. The proposed method can be expected to realize the recognition of stationary, walking, driving, or other states; switch to the correct indoor positioning algorithm; and improve the accuracy of localization compared to using a single positioning algorithm. Our experiments show that the recognition of static, walking, driving, and other states improves by 5.5%, 45.47%, 26.23%, and 21% on average, respectively, compared with convolutional neural network (CNN method. The time delay decreases by approximately 0.5–8.5 s for the transition between states and by approximately 24 s for the entire process.

  2. An Adaptive Method for Switching between Pedestrian/Car Indoor Positioning Algorithms based on Multilayer Time Sequences.

    Science.gov (United States)

    Gu, Zhining; Guo, Wei; Li, Chaoyang; Zhu, Xinyan; Guo, Tao

    2018-02-27

    Pedestrian dead reckoning (PDR) positioning algorithms can be used to obtain a target's location only for movement with step features and not for driving, for which the trilateral Bluetooth indoor positioning method can be used. In this study, to obtain the precise locations of different states (pedestrian/car) using the corresponding positioning algorithms, we propose an adaptive method for switching between the PDR and car indoor positioning algorithms based on multilayer time sequences (MTSs). MTSs, which consider the behavior context, comprise two main aspects: filtering of noisy data in small-scale time sequences and using a state chain to reduce the time delay of algorithm switching in large-scale time sequences. The proposed method can be expected to realize the recognition of stationary, walking, driving, or other states; switch to the correct indoor positioning algorithm; and improve the accuracy of localization compared to using a single positioning algorithm. Our experiments show that the recognition of static, walking, driving, and other states improves by 5.5%, 45.47%, 26.23%, and 21% on average, respectively, compared with convolutional neural network (CNN) method. The time delay decreases by approximately 0.5-8.5 s for the transition between states and by approximately 24 s for the entire process.

  3. Visual Statistical Learning Works after Binding the Temporal Sequences of Shapes and Spatial Positions

    Directory of Open Access Journals (Sweden)

    Osamu Watanabe

    2011-05-01

    Full Text Available The human visual system can acquire the statistical structures in temporal sequences of object feature changes, such as changes in shape, color, and its combination. Here we investigate whether the statistical learning for spatial position and shape changes operates separately or not. It is known that the visual system processes these two types of information separately; the spatial information is processed in the parietal cortex, whereas object shapes and colors are detected in the temporal pathway, and, after that, we perceive bound information in the two streams. We examined whether the statistical learning operates before or after binding the shape and the spatial information by using the “re-paired triplet” paradigm proposed by Turk-Browne, Isola, Scholl, and Treat (2008. The result showed that observers acquired combined sequences of shape and position changes, but no statistical information in individual sequence was obtained. This finding suggests that the visual statistical learning works after binding the temporal sequences of shapes and spatial structures and would operate in the higher-order visual system; this is consistent with recent ERP (Abla & Okanoya, 2009 and fMRI (Turk-Browne, Scholl, Chun, & Johnson, 2009 studies.

  4. Approximation of functions in two variables by some linear positive operators

    Directory of Open Access Journals (Sweden)

    Mariola Skorupka

    1995-12-01

    Full Text Available We introduce some linear positive operators of the Szasz-Mirakjan type in the weighted spaces of continuous functions in two variables. We study the degree of the approximation of functions by these operators. The similar results for functions in one variable are given in [5]. Some operators of the Szasz-Mirakjan type are examined also in [3], [4].

  5. Logo2PWM: a tool to convert sequence logo to position weight matrix.

    Science.gov (United States)

    Gao, Zhen; Liu, Lu; Ruan, Jianhua

    2017-10-03

    position weight matrix (PWM) and sequence logo are the most widely used representations of transcription factor binding site (TFBS) in biological sequences. Sequence logo - a graphical representation of PWM, has been widely used in scientific publications and reports, due to its easiness of human perception, rich information, and simple format. Different from sequence logo, PWM works great as a precise and compact digitalized form, which can be easily used by a variety of motif analysis software. There are a few available tools to generate sequence logos from PWM; however, no tool does the reverse. Such tool to convert sequence logo back to PWM is needed to scan a TFBS represented in logo format in a publication where the PWM is not provided or hard to be acquired. A major difficulty in developing such tool to convert sequence logo to PWM is to deal with the diversity of sequence logo images. We propose logo2PWM for reconstructing PWM from a large variety of sequence logo images. Evaluation results on over one thousand logos from three sources of different logo format show that the correlation between the reconstructed PWMs and the original PWMs are constantly high, where median correlation is greater than 0.97. Because of the high recognition accuracy, the easiness of usage, and, the availability of both web-based service and stand-alone application, we believe that logo2PWM can readily benefit the study of transcription by filling the gap between sequence logo and PWM.

  6. IG and TR single chain fragment variable (scFv) sequence analysis: a new advanced functionality of IMGT/V-QUEST and IMGT/HighV-QUEST.

    Science.gov (United States)

    Giudicelli, Véronique; Duroux, Patrice; Kossida, Sofia; Lefranc, Marie-Paule

    2017-06-26

    IMGT®, the international ImMunoGeneTics information system® ( http://www.imgt.org ), was created in 1989 in Montpellier, France (CNRS and Montpellier University) to manage the huge and complex diversity of the antigen receptors, and is at the origin of immunoinformatics, a science at the interface between immunogenetics and bioinformatics. Immunoglobulins (IG) or antibodies and T cell receptors (TR) are managed and described in the IMGT® databases and tools at the level of receptor, chain and domain. The analysis of the IG and TR variable (V) domain rearranged nucleotide sequences is performed by IMGT/V-QUEST (online since 1997, 50 sequences per batch) and, for next generation sequencing (NGS), by IMGT/HighV-QUEST, the high throughput version of IMGT/V-QUEST (portal begun in 2010, 500,000 sequences per batch). In vitro combinatorial libraries of engineered antibody single chain Fragment variable (scFv) which mimic the in vivo natural diversity of the immune adaptive responses are extensively screened for the discovery of novel antigen binding specificities. However the analysis of NGS full length scFv (~850 bp) represents a challenge as they contain two V domains connected by a linker and there is no tool for the analysis of two V domains in a single chain. The functionality "Analyis of single chain Fragment variable (scFv)" has been implemented in IMGT/V-QUEST and, for NGS, in IMGT/HighV-QUEST for the analysis of the two V domains of IG and TR scFv. It proceeds in five steps: search for a first closest V-REGION, full characterization of the first V-(D)-J-REGION, then search for a second V-REGION and full characterization of the second V-(D)-J-REGION, and finally linker delimitation. For each sequence or NGS read, positions of the 5'V-DOMAIN, linker and 3'V-DOMAIN in the scFv are provided in the 'V-orientated' sense. Each V-DOMAIN is fully characterized (gene identification, sequence description, junction analysis, characterization of mutations and amino

  7. Positive Selection or Free to Vary? Assessing the Functional Significance of Sequence Change Using Molecular Dynamics.

    Directory of Open Access Journals (Sweden)

    Jane R Allison

    Full Text Available Evolutionary arms races between pathogens and their hosts may be manifested as selection for rapid evolutionary change of key genes, and are sometimes detectable through sequence-level analyses. In the case of protein-coding genes, such analyses frequently predict that specific codons are under positive selection. However, detecting positive selection can be non-trivial, and false positive predictions are a common concern in such analyses. It is therefore helpful to place such predictions within a structural and functional context. Here, we focus on the p19 protein from tombusviruses. P19 is a homodimer that sequesters siRNAs, thereby preventing the host RNAi machinery from shutting down viral infection. Sequence analysis of the p19 gene is complicated by the fact that it is constrained at the sequence level by overprinting of a viral movement protein gene. Using homology modeling, in silico mutation and molecular dynamics simulations, we assess how non-synonymous changes to two residues involved in forming the dimer interface-one invariant, and one predicted to be under positive selection-impact molecular function. Interestingly, we find that both observed variation and potential variation (where a non-synonymous change to p19 would be synonymous for the overprinted movement protein does not significantly impact protein structure or RNA binding. Consequently, while several methods identify residues at the dimer interface as being under positive selection, MD results suggest they are functionally indistinguishable from a site that is free to vary. Our analyses serve as a caveat to using sequence-level analyses in isolation to detect and assess positive selection, and emphasize the importance of also accounting for how non-synonymous changes impact structure and function.

  8. Adenosine stress cardiovascular magnetic resonance with variable-density spiral pulse sequences accurately detects coronary artery disease: initial clinical evaluation.

    Science.gov (United States)

    Salerno, Michael; Taylor, Angela; Yang, Yang; Kuruvilla, Sujith; Ragosta, Michael; Meyer, Craig H; Kramer, Christopher M

    2014-07-01

    Adenosine stress cardiovascular magnetic resonance perfusion imaging can be limited by motion-induced dark-rim artifacts, which may be mistaken for true perfusion abnormalities. A high-resolution variable-density spiral pulse sequence with a novel density compensation strategy has been shown to reduce dark-rim artifacts in first-pass perfusion imaging. We aimed to assess the clinical performance of adenosine stress cardiovascular magnetic resonance using this new perfusion sequence to detect obstructive coronary artery disease. Cardiovascular magnetic resonance perfusion imaging was performed during adenosine stress (140 μg/kg per minute) and at rest on a Siemens 1.5-T Avanto scanner in 41 subjects with chest pain scheduled for coronary angiography. Perfusion images were acquired during injection of 0.1 mmol/kg Gadolinium-diethylenetriaminepentacetate at 3 short-axis locations using a saturation recovery interleaved variable-density spiral pulse sequence. Significant stenosis was defined as >50% by quantitative coronary angiography. Two blinded reviewers evaluated the perfusion images for the presence of adenosine-induced perfusion abnormalities and assessed image quality using a 5-point scale (1 [poor] to 5 [excellent]). The prevalence of obstructive coronary artery disease by quantitative coronary angiography was 68%. The average sensitivity, specificity, and accuracy were 89%, 85%, and 88%, respectively, with a positive predictive value and negative predictive value of 93% and 79%, respectively. The average image quality score was 4.4±0.7, with only 1 study with more than mild dark-rim artifacts. There was good inter-reader reliability with a κ statistic of 0.67. Spiral adenosine stress cardiovascular magnetic resonance results in high diagnostic accuracy for the detection of obstructive coronary artery disease with excellent image quality and minimal dark-rim artifacts. © 2014 American Heart Association, Inc.

  9. [Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

    Science.gov (United States)

    Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

    2011-01-01

    The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

  10. Stellar Variability at the Main-sequence Turnoff of the Intermediate-age LMC Cluster NGC 1846

    Science.gov (United States)

    Salinas, R.; Pajkos, M. A.; Vivas, A. K.; Strader, J.; Contreras Ramos, R.

    2018-04-01

    Intermediate-age (IA) star clusters in the Large Magellanic Cloud (LMC) present extended main-sequence turn-offs (MSTO) that have been attributed to either multiple stellar populations or an effect of stellar rotation. Recently it has been proposed that these extended main sequences can also be produced by ill-characterized stellar variability. Here we present Gemini-S/Gemini Multi-Object Spectrometer (GMOS) time series observations of the IA cluster NGC 1846. Using differential image analysis, we identified 73 new variable stars, with 55 of those being of the Delta Scuti type, that is, pulsating variables close the MSTO for the cluster age. Considering completeness and background contamination effects, we estimate the number of δ Sct belonging to the cluster between 40 and 60 members, although this number is based on the detection of a single δ Sct within the cluster half-light radius. This amount of variable stars at the MSTO level will not produce significant broadening of the MSTO, albeit higher-resolution imaging will be needed to rule out variable stars as a major contributor to the extended MSTO phenomenon. Though modest, this amount of δ Sct makes NGC 1846 the star cluster with the highest number of these variables ever discovered. Lastly, our results present a cautionary tale about the adequacy of shallow variability surveys in the LMC (like OGLE) to derive properties of its δ Sct population. Based on observations obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (United States), the National Research Council (Canada), CONICYT (Chile), Ministerio de Ciencia, Tecnología e Innovación Productiva (Argentina), and Ministério da Ciência, Tecnologia e Inovação (Brazil).

  11. The sequence of cortical activity inferred by response latency variability in the human ventral pathway of face processing.

    Science.gov (United States)

    Lin, Jo-Fu Lotus; Silva-Pereyra, Juan; Chou, Chih-Che; Lin, Fa-Hsuan

    2018-04-11

    Variability in neuronal response latency has been typically considered caused by random noise. Previous studies of single cells and large neuronal populations have shown that the temporal variability tends to increase along the visual pathway. Inspired by these previous studies, we hypothesized that functional areas at later stages in the visual pathway of face processing would have larger variability in the response latency. To test this hypothesis, we used magnetoencephalographic data collected when subjects were presented with images of human faces. Faces are known to elicit a sequence of activity from the primary visual cortex to the fusiform gyrus. Our results revealed that the fusiform gyrus showed larger variability in the response latency compared to the calcarine fissure. Dynamic and spectral analyses of the latency variability indicated that the response latency in the fusiform gyrus was more variable than in the calcarine fissure between 70 ms and 200 ms after the stimulus onset and between 4 Hz and 40 Hz, respectively. The sequential processing of face information from the calcarine sulcus to the fusiform sulcus was more reliably detected based on sizes of the response variability than instants of the maximal response peaks. With two areas in the ventral visual pathway, we show that the variability in response latency across brain areas can be used to infer the sequence of cortical activity.

  12. Variability of Actinobacteria, a minor component of rumen microflora.

    Science.gov (United States)

    Suľák, M; Sikorová, L; Jankuvová, J; Javorský, P; Pristaš, P

    2012-07-01

    Actinobacteria (Actinomycetes) are a significant and interesting group of gram-positive bacteria. They are regular, though infrequent, members of the microbial life in the rumen and represent up to 3 % of total rumen bacteria; there is considerable lack of information about ecology and biology of rumen actinobacteria. During the characterization of variability of rumen treponemas using non-cultivation approach, we also noted the variability of rumen actinobacteria. By using Treponema-specific primers a specific 16S rRNA gene library was prepared from cow and sheep rumen total DNA. About 10 % of recombinant clones contained actinobacteria-like sequences. Phylogenetic analyses of 11 clones obtained showed the high variability of actinobacteria in the ruminant digestive system. While some sequences are nearly identical to known sequences of actinobacteria, we detected completely new clusters of actinobacteria-like sequences, representing probably new, as yet undiscovered, group of rumen Actinobacteria. Further research will be necessary for understanding their nature and functions in the rumen.

  13. Protection algorithm for a wind turbine generator based on positive- and negative-sequence fault components

    DEFF Research Database (Denmark)

    Zheng, Tai-Ying; Cha, Seung-Tae; Crossley, Peter A.

    2011-01-01

    A protection relay for a wind turbine generator (WTG) based on positive- and negative-sequence fault components is proposed in the paper. The relay uses the magnitude of the positive-sequence component in the fault current to detect a fault on a parallel WTG, connected to the same power collection...... feeder, or a fault on an adjacent feeder; but for these faults, the relay remains stable and inoperative. A fault on the power collection feeder or a fault on the collection bus, both of which require an instantaneous tripping response, are distinguished from an inter-tie fault or a grid fault, which...... in the fault current is used to decide on either instantaneous or delayed operation. The operating performance of the relay is then verified using various fault scenarios modelled using EMTP-RV. The scenarios involve changes in the position and type of fault, and the faulted phases. Results confirm...

  14. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...... amino acid substitutions. To verify that the gene was expressed in M. hominis, a polyclonal antibody was produced and tested against whole cell protein from 15 strains. The enzyme was expressed in all strains investigated as a 36-kDa protein. All strains except type strain PG21(T) showed reaction...

  15. Dynamic sensorimotor planning during long-term sequence learning: the role of variability, response chunking and planning errors.

    Science.gov (United States)

    Verstynen, Timothy; Phillips, Jeff; Braun, Emily; Workman, Brett; Schunn, Christian; Schneider, Walter

    2012-01-01

    Many everyday skills are learned by binding otherwise independent actions into a unified sequence of responses across days or weeks of practice. Here we looked at how the dynamics of action planning and response binding change across such long timescales. Subjects (N = 23) were trained on a bimanual version of the serial reaction time task (32-item sequence) for two weeks (10 days total). Response times and accuracy both showed improvement with time, but appeared to be learned at different rates. Changes in response speed across training were associated with dynamic changes in response time variability, with faster learners expanding their variability during the early training days and then contracting response variability late in training. Using a novel measure of response chunking, we found that individual responses became temporally correlated across trials and asymptoted to set sizes of approximately 7 bound responses at the end of the first week of training. Finally, we used a state-space model of the response planning process to look at how predictive (i.e., response anticipation) and error-corrective (i.e., post-error slowing) processes correlated with learning rates for speed, accuracy and chunking. This analysis yielded non-monotonic association patterns between the state-space model parameters and learning rates, suggesting that different parts of the response planning process are relevant at different stages of long-term learning. These findings highlight the dynamic modulation of response speed, variability, accuracy and chunking as multiple movements become bound together into a larger set of responses during sequence learning.

  16. Molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer myostatin gene

    Directory of Open Access Journals (Sweden)

    Smith-Keune Carolyn

    2008-02-01

    Full Text Available Abstract Background Myostatin (MSTN is a member of the transforming growth factor-β superfamily that negatively regulates growth of skeletal muscle tissue. The gene encoding for the MSTN peptide is a consolidate candidate for the enhancement of productivity in terrestrial livestock. This gene potentially represents an important target for growth improvement of cultured finfish. Results Here we report molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer MSTN-1 gene. The barramundi MSTN-1 was encoded by three exons 379, 371 and 381 bp in length and translated into a 376-amino acid peptide. Intron 1 and 2 were 412 and 819 bp in length and presented typical GT...AG splicing sites. The upstream region contained cis-regulatory elements such as TATA-box and E-boxes. A first assessment of sequence variability suggested that higher mutation rates are found in the 5' flanking region with several SNP's present in this species. A putative micro RNA target site has also been observed in the 3'UTR (untranslated region and is highly conserved across teleost fish. The deduced amino acid sequence was conserved across vertebrates and exhibited characteristic conserved putative functional residues including a cleavage motif of proteolysis (RXXR, nine cysteines and two glycosilation sites. A qualitative analysis of the barramundi MSTN-1 expression pattern revealed that, in adult fish, transcripts are differentially expressed in various tissues other than skeletal muscles including gill, heart, kidney, intestine, liver, spleen, eye, gonad and brain. Conclusion Our findings provide valuable insights such as sequence variation and genomic information which will aid the further investigation of the barramundi MSTN-1 gene in association with growth. The finding for the first time in finfish MSTN of a miRNA target site in the 3'UTR provides an opportunity for the identification of regulatory mutations on the

  17. Positional variability of a tandem applicator system in HDR brachytherapy for primary treatment of cervix cancer. Analysis of the anatomic pelvic position and comparison of the applicator positions during five insertions

    International Nuclear Information System (INIS)

    Wulf, J.; Popp, K.; Oppitz, U.; Baier, K.; Flentje, M.

    2004-01-01

    Purpose: evaluation of the inter- and intraindividual applicator variability of multiple high-dose-rate (HDR) brachytherapy applications for primary treatment of cancer of the uterine cervix. Material and methods: retrospective analysis of 460 pairs of orthogonal X-ray films for conventional treatment in 92 patients with five intrauterine applications using an HDR tandem applicator. Measurement of the position of the applicator origin relative to a bony reference system in three dimensions. Evaluation of the differences of the applicator position in all 460 applications (interindividual variability), of the five applications in a single patient (intraindividual variability) and of the intraindividual variability relative to the applicator position at the first application. Results: the position of the applicator origin in the pelvis ranged from 23 mm cranial and 55 mm caudal to the top of femoral heads, 23 mm right and 27 mm left to the pelvic midline, and 6-53 mm dorsal to the mid of the femoral heads. Standard deviation (SD) of interindividual applicator variability was 12.9 mm (minimum/maximum -55/+23 mm, mean -13.6 mm) in longitudinal, 5.1 mm (-27/+23 mm, mean 1.6 mm) in lateral, and 7.6 mm (6/53 mm, mean 26 mm) in anterior-posterior [AP] direction. SD of intraindividual variability was 5.5 mm (-21/+23 mm, mean 0 mm) in longitudinal, 2.5 mm (-17/+19 mm, mean 0 mm) in lateral, and 4.2 mm (-15/+18 mm, mean 0 mm) in AP direction compared to intraindividual variability relative to the first insertion with an SD of 8.9 mm (-23/+36 mm, mean 2.8 mm) in longitudinal, 4.0 mm (-11/+23 mm, mean 0 mm) in lateral, and 6.8 mm (-27/+17 mm, mean -0.8 mm) in AP direction. Conclusion: intraindividual applicator variability is significantly smaller than interindividual variability. Applicator-related procedures such as midline shielding or dose matching of tele- and brachytherapy should be performed with information on at least one individual applicator position. (orig.)

  18. Positional variability of a tandem applicator system in HDR brachytherapy for primary treatment of cervix cancer. Analysis of the anatomic pelvic position and comparison of the applicator positions during five insertions

    Energy Technology Data Exchange (ETDEWEB)

    Wulf, J.; Popp, K.; Oppitz, U.; Baier, K.; Flentje, M. [Dept. of Radiotherapy, Univ. of Wuerzburg (Germany)

    2004-04-01

    Purpose: evaluation of the inter- and intraindividual applicator variability of multiple high-dose-rate (HDR) brachytherapy applications for primary treatment of cancer of the uterine cervix. Material and methods: retrospective analysis of 460 pairs of orthogonal X-ray films for conventional treatment in 92 patients with five intrauterine applications using an HDR tandem applicator. Measurement of the position of the applicator origin relative to a bony reference system in three dimensions. Evaluation of the differences of the applicator position in all 460 applications (interindividual variability), of the five applications in a single patient (intraindividual variability) and of the intraindividual variability relative to the applicator position at the first application. Results: the position of the applicator origin in the pelvis ranged from 23 mm cranial and 55 mm caudal to the top of femoral heads, 23 mm right and 27 mm left to the pelvic midline, and 6-53 mm dorsal to the mid of the femoral heads. Standard deviation (SD) of interindividual applicator variability was 12.9 mm (minimum/maximum -55/+23 mm, mean -13.6 mm) in longitudinal, 5.1 mm (-27/+23 mm, mean 1.6 mm) in lateral, and 7.6 mm (6/53 mm, mean 26 mm) in anterior-posterior [AP] direction. SD of intraindividual variability was 5.5 mm (-21/+23 mm, mean 0 mm) in longitudinal, 2.5 mm (-17/+19 mm, mean 0 mm) in lateral, and 4.2 mm (-15/+18 mm, mean 0 mm) in AP direction compared to intraindividual variability relative to the first insertion with an SD of 8.9 mm (-23/+36 mm, mean 2.8 mm) in longitudinal, 4.0 mm (-11/+23 mm, mean 0 mm) in lateral, and 6.8 mm (-27/+17 mm, mean -0.8 mm) in AP direction. Conclusion: intraindividual applicator variability is significantly smaller than interindividual variability. Applicator-related procedures such as midline shielding or dose matching of tele- and brachytherapy should be performed with information on at least one individual applicator position. (orig.)

  19. The monoclonal S9.6 antibody exhibits highly variable binding affinities towards different R-loop sequences.

    Directory of Open Access Journals (Sweden)

    Fabian König

    Full Text Available The monoclonal antibody S9.6 is a widely-used tool to purify, analyse and quantify R-loop structures in cells. A previous study using the surface plasmon resonance technology and a single-chain variable fragment (scFv of S9.6 showed high affinity (0.6 nM for DNA-RNA and also a high affinity (2.7 nM for RNA-RNA hybrids. We used the microscale thermophoresis method allowing surface independent interaction studies and electromobility shift assays to evaluate additional RNA-DNA hybrid sequences and to quantify the binding affinities of the S9.6 antibody with respect to distinct sequences and their GC-content. Our results confirm high affinity binding to previously analysed sequences, but reveals that binding affinities are highly sequence specific. Our study presents R-loop sequences that independent of GC-content and in different sequence variations exhibit either no binding, binding affinities in the micromolar range and as well high affinity binding in the nanomolar range. Our study questions the usefulness of the S9.6 antibody in the quantitative analysis of R-loop sequences in vivo.

  20. Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Nielsen, Morten

    2012-01-01

    Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... related to amino acid enrichment and depletion. Besides allowing input in the format of peptides and MSA, Seq2Logo accepts input as Blast sequence profiles, providing easy access for non-expert end-users to characterize and identify functionally conserved/variable amino acids in any given protein...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...

  1. Respiratory gating during stereotactic body radiotherapy for lung cancer reduces tumor position variability.

    Science.gov (United States)

    Saito, Tetsuo; Matsuyama, Tomohiko; Toya, Ryo; Fukugawa, Yoshiyuki; Toyofuku, Takamasa; Semba, Akiko; Oya, Natsuo

    2014-01-01

    We evaluated the effects of respiratory gating on treatment accuracy in lung cancer patients undergoing lung stereotactic body radiotherapy by using electronic portal imaging device (EPID) images. Our study population consisted of 30 lung cancer patients treated with stereotactic body radiotherapy (48 Gy/4 fractions/4 to 9 days). Of these, 14 were treated with- (group A) and 16 without gating (group B); typically the patients whose tumors showed three-dimensional respiratory motion ≧5 mm were selected for gating. Tumor respiratory motion was estimated using four-dimensional computed tomography images acquired during treatment simulation. Tumor position variability during all treatment sessions was assessed by measuring the standard deviation (SD) and range of tumor displacement on EPID images. The two groups were compared for tumor respiratory motion and position variability using the Mann-Whitney U test. The median three-dimensional tumor motion during simulation was greater in group A than group B (9 mm, range 3-30 mm vs. 2 mm, range 0-4 mm; psimulation, tumor position variability in the EPID images was low and comparable to patients treated without gating. This demonstrates the benefit of respiratory gating.

  2. Comprehensive assessment of sequence variation within the copy number variable defensin cluster on 8p23 by target enriched in-depth 454 sequencing

    Directory of Open Access Journals (Sweden)

    Zhang Xinmin

    2011-05-01

    Full Text Available Abstract Background In highly copy number variable (CNV regions such as the human defensin gene locus, comprehensive assessment of sequence variations is challenging. PCR approaches are practically restricted to tiny fractions, and next-generation sequencing (NGS approaches of whole individual genomes e.g. by the 1000 Genomes Project is confined by an affordable sequence depth. Combining target enrichment with NGS may represent a feasible approach. Results As a proof of principle, we enriched a ~850 kb section comprising the CNV defensin gene cluster DEFB, the invariable DEFA part and 11 control regions from two genomes by sequence capture and sequenced it by 454 technology. 6,651 differences to the human reference genome were found. Comparison to HapMap genotypes revealed sensitivities and specificities in the range of 94% to 99% for the identification of variations. Using error probabilities for rigorous filtering revealed 2,886 unique single nucleotide variations (SNVs including 358 putative novel ones. DEFB CN determinations by haplotype ratios were in agreement with alternative methods. Conclusion Although currently labor extensive and having high costs, target enriched NGS provides a powerful tool for the comprehensive assessment of SNVs in highly polymorphic CNV regions of individual genomes. Furthermore, it reveals considerable amounts of putative novel variations and simultaneously allows CN estimation.

  3. Variable depth recursion algorithm for leaf sequencing

    International Nuclear Information System (INIS)

    Siochi, R. Alfredo C.

    2007-01-01

    The processes of extraction and sweep are basic segmentation steps that are used in leaf sequencing algorithms. A modified version of a commercial leaf sequencer changed the way that the extracts are selected and expanded the search space, but the modification maintained the basic search paradigm of evaluating multiple solutions, each one consisting of up to 12 extracts and a sweep sequence. While it generated the best solutions compared to other published algorithms, it used more computation time. A new, faster algorithm selects one extract at a time but calls itself as an evaluation function a user-specified number of times, after which it uses the bidirectional sweeping window algorithm as the final evaluation function. To achieve a performance comparable to that of the modified commercial leaf sequencer, 2-3 calls were needed, and in all test cases, there were only slight improvements beyond two calls. For the 13 clinical test maps, computation speeds improved by a factor between 12 and 43, depending on the constraints, namely the ability to interdigitate and the avoidance of the tongue-and-groove under dose. The new algorithm was compared to the original and modified versions of the commercial leaf sequencer. It was also compared to other published algorithms for 1400, random, 15x15, test maps with 3-16 intensity levels. In every single case the new algorithm provided the best solution

  4. Universal Quantum Computing with Measurement-Induced Continuous-Variable Gate Sequence in a Loop-Based Architecture.

    Science.gov (United States)

    Takeda, Shuntaro; Furusawa, Akira

    2017-09-22

    We propose a scalable scheme for optical quantum computing using measurement-induced continuous-variable quantum gates in a loop-based architecture. Here, time-bin-encoded quantum information in a single spatial mode is deterministically processed in a nested loop by an electrically programmable gate sequence. This architecture can process any input state and an arbitrary number of modes with almost minimum resources, and offers a universal gate set for both qubits and continuous variables. Furthermore, quantum computing can be performed fault tolerantly by a known scheme for encoding a qubit in an infinite-dimensional Hilbert space of a single light mode.

  5. N-linked glycosylation of the immunoglobulin variable region

    NARCIS (Netherlands)

    van de Bovenkamp, Fleur S.; Derksen, Ninotska I. L.; Ooijevaar-de Heer, Pleuni; van Schie, Karin A.; Kruithof, Simone; Berkowska, Magdalena A.; van der Schoot, C. Ellen; Ijspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E. M.; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S. Marieke; Vidarsson, Gestur; Rispens, Theo

    2018-01-01

    N-glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we

  6. Insertion sequences as variability generators in the Mycoplasma hyopneumoniae and M. synoviae genomes

    Directory of Open Access Journals (Sweden)

    Elgion Lúcio Silva Loreto

    2007-01-01

    Full Text Available We have analyzed the sequenced genomes of three strains of Mycoplasma hyopneumoniae and one strain of M. synoviae, and have found three and two different transposable element families, respectively in each species. In M. hyopneumoniae, the Insertion Sequences of the IS4 family is represented by ISMHp1, a putatively active element. The IS3 family is represented by several degenerated sequences. A third element called tMH was found, which shows some characteristics reminiscent of retrotransposons. In M. synoviae, three different possibly active IS4 elements are present (ISMHp1-like; ISMs1 and IS1634-like elements. The IS30 family is represented by the degenerated IS1630-like element. The IS1634-like element is shown to be involved in chromosomal rearrangements and horizontal gene transfer (HGT. The ISMHp1-like element is shown to relate to the HGT of a 25-kb region from M. gallisepticum to M. synoviae. The fractions of these genomes that correspond to mobile elements varied from 1.35 to 3.13% in M. hyopneumonia strains and was 2.08% in M. synoviae. Although these species possess reduced genomes, they maintain mobile elements, perhaps as a mechanism for genetic variability production.

  7. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    Science.gov (United States)

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  8. Variable-Position Acoustic Levitation

    Science.gov (United States)

    Barmatz, M. B.; Stoneburner, J. D.; Jacobi, N.; Wang, T. G.

    1983-01-01

    Method of acoustic levitation supports objects at positions other than acoustic nodes. Acoustic force is varied so it balances gravitational (or other) force, thereby maintaining object at any position within equilibrium range. Levitation method applicable to containerless processing. Such objects as table-tennis balls, hollow plastic spheres, and balsa-wood spheres levitated in laboratory by new method.

  9. Heart position variability during voluntary moderate deep inspiration breath-hold radiotherapy for breast cancer determined by repeat CBCT scans.

    Science.gov (United States)

    van Haaren, Paul; Claassen-Janssen, Fiere; van de Sande, Ingrid; Boersma, Liesbeth; van der Sangen, Maurice; Hurkmans, Coen

    2017-08-01

    Voluntary moderate deep inspiration breath hold (vmDIBH) in left-sided breast cancer radiotherapy reduces cardiac dose. The aim of this study was to investigate heart position variability in vmDIBH using CBCT and to compare this variability with differences in heart position between vmDIBH and free breathing (FB). For 50 patients initial heart position with respect to the field edge (HP-FE) was measured on a vmDIBH planning CT scan. Breath-hold was monitored using an in-house developed vertical plastic stick. On pre-treatment CBCT scans, heart position variability with respect to the field edge (Δ HP-FE ) was measured, reflecting heart position variability when using an offline correction protocol. After registering the CBCT scan to the planning CT, heart position variability with respect to the chest wall (Δ HP-CW ) was measured, reflecting heart position variability when using an online correction protocol. As a control group, vmDIBH and FB computed tomography (CT) scans were acquired for 30 patients and registering both scans on the chest wall. For 34 out of 50 patients, the average HP-FE and HP-CW increased over the treatment course in comparison to the planning CT. Averaged over all patients and all treatment fractions, the Δ HP-FE and the Δ HP-CW was 0.8±4.2mm (range -9.4-+10.6mm) and 1.0±4.4mm (range -8.3-+10.4mm) respectively. The average gain in heart to chest wall distance was 11.8±4.6mm when using vmDIBH instead of FB. In conclusion, substantial variability in heart position using vmDIBH was observed during the treatment course. Copyright © 2017 Associazione Italiana di Fisica Medica. Published by Elsevier Ltd. All rights reserved.

  10. Adaptive antibody diversification through N-linked glycosylation of the immunoglobulin variable region.

    Science.gov (United States)

    van de Bovenkamp, Fleur S; Derksen, Ninotska I L; Ooijevaar-de Heer, Pleuni; van Schie, Karin A; Kruithof, Simone; Berkowska, Magdalena A; van der Schoot, C Ellen; IJspeert, Hanna; van der Burg, Mirjam; Gils, Ann; Hafkenscheid, Lise; Toes, René E M; Rombouts, Yoann; Plomp, Rosina; Wuhrer, Manfred; van Ham, S Marieke; Vidarsson, Gestur; Rispens, Theo

    2018-02-20

    A hallmark of B-cell immunity is the generation of a diverse repertoire of antibodies from a limited set of germline V(D)J genes. This repertoire is usually defined in terms of amino acid composition. However, variable domains may also acquire N -linked glycans, a process conditional on the introduction of consensus amino acid motifs ( N -glycosylation sites) during somatic hypermutation. High levels of variable domain glycans have been associated with autoantibodies in rheumatoid arthritis, as well as certain follicular lymphomas. However, the role of these glycans in the humoral immune response remains poorly understood. Interestingly, studies have reported both positive and negative effects on antibody affinity. Our aim was to elucidate the role of variable domain glycans during antigen-specific antibody responses. By analyzing B-cell repertoires by next-generation sequencing, we demonstrate that N -glycosylation sites are introduced at positions in which glycans can affect antigen binding as a result of a specific clustering of progenitor glycosylation sites in the germline sequences of variable domain genes. By analyzing multiple human monoclonal and polyclonal (auto)antibody responses, we subsequently show that this process is subject to selection during antigen-specific antibody responses, skewed toward IgG4, and positively contributes to antigen binding. Together, these results highlight a physiological role for variable domain glycosylation as an additional layer of antibody diversification that modulates antigen binding.

  11. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    Science.gov (United States)

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  12. Variability in prostate and seminal vesicle delineations defined on magnetic resonance images, a multi-observer, -center and -sequence study

    DEFF Research Database (Denmark)

    Nyholm, Tufve; Jonsson, Joakim; Söderström, Karin

    2013-01-01

    and approximately equal for the prostate and seminal vesicles. Large differences in variability were observed for individual patients, and also for individual imaging sequences used at the different centers. There was however no indication of decreased variability with higher field strength. CONCLUSION: The overall......BACKGROUND: The use of magnetic resonance (MR) imaging as a part of preparation for radiotherapy is increasing. For delineation of the prostate several publications have shown decreased delineation variability using MR compared to computed tomography (CT). The purpose of the present work....... Two physicians from each center delineated the prostate and the seminal vesicles on each of the 25 image sets. The variability between the delineations was analyzed with respect to overall, intra- and inter-physician variability, and dependence between variability and origin of the MR images, i...

  13. Inter- and intra-strain variability of tandem repeats in Mycoplasma pneumoniae based on next-generation sequencing data.

    Science.gov (United States)

    Zhang, Jing; Song, Xiaohong; Ma, Marella J; Xiao, Li; Kenri, Tsuyoshi; Sun, Hongmei; Ptacek, Travis; Li, Shaoli; Waites, Ken B; Atkinson, T Prescott; Shibayama, Keigo; Dybvig, Kevin; Feng, Yanmei

    2017-02-01

    To characterize inter- and intra-strain variability of variable-number tandem repeats (VNTRs) in Mycoplasma pneumoniae to determine the optimal multilocus VNTR analysis scheme for improved strain typing. Whole genome assemblies and next-generation sequencing data from diverse M. pneumoniae isolates were used to characterize VNTRs and their variability, and to compare the strain discriminability of new VNTR and existing markers. We identified 13 VNTRs including five reported previously. These VNTRs displayed different levels of inter- and intra-strain copy number variations. All new markers showed similar or higher discriminability compared with existing VNTR markers and the P1 typing system. Our study provides novel insights into VNTR variations and potential new multilocus VNTR analysis schemes for improved genotyping of M. pneumoniae.

  14. Improved imaging of cochlear nerve hypoplasia using a 3-Tesla variable flip-angle turbo spin-echo sequence and a 7-cm surface coil.

    Science.gov (United States)

    Giesemann, Anja M; Raab, Peter; Lyutenski, Stefan; Dettmer, Sabine; Bültmann, Eva; Frömke, Cornelia; Lenarz, Thomas; Lanfermann, Heinrich; Goetz, Friedrich

    2014-03-01

    Magnetic resonance imaging of the temporal bone has an important role in decision making with regard to cochlea implantation, especially in children with cochlear nerve deficiency. The purpose of this study was to evaluate the usefulness of the combination of an advanced high-resolution T2-weighted sequence with a surface coil in a 3-Tesla magnetic resonance imaging scanner in cases of suspected cochlear nerve aplasia. Prospective study. Seven patients with cochlear nerve hypoplasia or aplasia were prospectively examined using a high-resolution three-dimensional variable flip-angle turbo spin-echo sequence using a surface coil, and the images were compared with the same sequence in standard resolution using a standard head coil. Three neuroradiologists evaluated the magnetic resonance images independently, rating the visibility of the nerves in diagnosing hypoplasia or aplasia. Eight ears in seven patients with hypoplasia or aplasia of the cochlear nerve were examined. The average age was 2.7 years (range, 9 months-5 years). Seven ears had accompanying malformations. The inter-rater reliability in diagnosing hypoplasia or aplasia was greater using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence (fixed-marginal kappa: 0.64) than with the same sequence in lower resolution (fixed-marginal kappa: 0.06). Examining cases of suspected cochlear nerve aplasia using the high-resolution three-dimensional variable flip-angle turbo spin-echo sequence in combination with a surface coil shows significant improvement over standard methods. © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

  15. Variability in EIT Images of Lung Ventilation as a Function of Electrode Planes and Body Positions.

    Science.gov (United States)

    Zhang, Jie; Patterson, Robert

    2014-01-01

    This study is aimed at investigating the variability in resistivity changes in the lung region as a function of air volume, electrode plane and body position. Six normal subjects (33.8 ± 4.7 years, range from 26 to 37 years) were studied using the Sheffield Electrical Impedance Tomography (EIT) portable system. Three transverse planes at the level of second intercostal space, the level of the xiphisternal joint, and midway between upper and lower locations were chosen for measurements. For each plane, sixteen electrodes were uniformly positioned around the thorax. Data were collected with the breath held at end expiration and after inspiring 0.5, 1.0, or 1.5 liters of air from end expiration, with the subject in both the supine and sitting position. The average resistivity change in five regions, two 8x8 pixel local regions in the right lung, entire right, entire left and total lung regions, were calculated. The results show the resistivity change averaged over electrode positions and subject positions was 7-9% per liter of air, with a slightly larger resistivity change of 10 % per liter air in the lower electrode plane. There was no significant difference (p>0.05) between supine and sitting. The two 8x8 regions show a larger inter individual variability (coefficient of variation, CV, is from 30% to 382%) compared to the entire left, entire right and total lung (CV is from 11% to 51%). The results for the global regions are more consistent. The large inter individual variability appears to be a problem for clinical applications of EIT, such as regional ventilation. The variability may be mitigated by choosing appropriate electrode plane, body position and region of interest for the analysis.

  16. Spatial variability of soil CO2 emission in different topographic positions

    Directory of Open Access Journals (Sweden)

    Liziane de Figueiredo Brito

    2010-01-01

    Full Text Available The spatial variability of soil CO2 emission is controlled by several properties related to the production and transport of CO2 inside the soil. Considering that soil properties are also influenced by topography, the objective of this work was to investigate the spatial variability of soil CO2 emission in three different topographic positions in an area cultivated with sugarcane, just after mechanical harvest. One location was selected on a concave-shaped form and two others on linear-shaped form (in back-slope and foot-slope. Three grids were installed, one in each location, containing 69 points and measuring 90 x 90 m each. The spatial variability of soil CO2 emission was characterized by means of semivariance. Spatial variability models derived from soil CO2 emission were exponential in the concave location while spherical models fitted better in the linear shaped areas. The degree of spatial dependence was moderate in all cases and the range of spatial dependence for the CO2 emission in the concave area was 44.5 m, higher than the mean value obtained for the linear shaped areas (20.65 m. The spatial distribution maps of soil CO2 emission indicate a higher discontinuity of emission in the linear form when compared to the concave form.

  17. Application of the whole-transcriptome shotgun sequencing approach to the study of Philadelphia-positive acute lymphoblastic leukemia

    International Nuclear Information System (INIS)

    Iacobucci, I; Ferrarini, A; Sazzini, M; Giacomelli, E; Lonetti, A; Xumerle, L; Ferrari, A; Papayannidis, C; Malerba, G; Luiselli, D; Boattini, A; Garagnani, P; Vitale, A; Soverini, S; Pane, F; Baccarani, M; Delledonne, M; Martinelli, G

    2012-01-01

    Although the pathogenesis of BCR–ABL1-positive acute lymphoblastic leukemia (ALL) is mainly related to the expression of the BCR–ABL1 fusion transcript, additional cooperating genetic lesions are supposed to be involved in its development and progression. Therefore, in an attempt to investigate the complex landscape of mutations, changes in expression profiles and alternative splicing (AS) events that can be observed in such disease, the leukemia transcriptome of a BCR–ABL1-positive ALL patient at diagnosis and at relapse was sequenced using a whole-transcriptome shotgun sequencing (RNA-Seq) approach. A total of 13.9 and 15.8 million sequence reads was generated from de novo and relapsed samples, respectively, and aligned to the human genome reference sequence. This led to the identification of five validated missense mutations in genes involved in metabolic processes (DPEP1, TMEM46), transport (MVP), cell cycle regulation (ABL1) and catalytic activity (CTSZ), two of which resulted in acquired relapse variants. In all, 6390 and 4671 putative AS events were also detected, as well as expression levels for 18 315 and 18 795 genes, 28% of which were differentially expressed in the two disease phases. These data demonstrate that RNA-Seq is a suitable approach for identifying a wide spectrum of genetic alterations potentially involved in ALL

  18. Neisseria meningitidis antigen NMB0088: sequence variability, protein topology and vaccine potential.

    Science.gov (United States)

    Sardiñas, Gretel; Yero, Daniel; Climent, Yanet; Caballero, Evelin; Cobas, Karem; Niebla, Olivia

    2009-02-01

    The significance of Neisseria meningitidis serogroup B membrane proteins as vaccine candidates is continually growing. Here, we studied different aspects of antigen NMB0088, a protein that is abundant in outer-membrane vesicle preparations and is thought to be a surface protein. The gene encoding protein NMB0088 was sequenced in a panel of 34 different meningococcal strains with clinical and epidemiological relevance. After this analysis, four variants of NMB0088 were identified; the variability was confined to three specific segments, designated VR1, VR2 and VR3. Secondary structure predictions, refined with alignment analysis and homology modelling using FadL of Escherichia coli, revealed that almost all the variable regions were located in extracellular loop domains. In addition, the NMB0088 antigen was expressed in E. coli and a procedure for obtaining purified recombinant NMB0088 is described. The humoral immune response elicited in BALB/c mice was measured by ELISA and Western blotting, while the functional activity of these antibodies was determined in a serum bactericidal assay and an animal protection model. After immunization in mice, the recombinant protein was capable of inducing a protective response when it was administered inserted into liposomes. According to our results, the recombinant NMB0088 protein may represent a novel antigen for a vaccine against meningococcal disease. However, results from the variability study should be considered for designing a cross-protective formulation in future studies.

  19. Single Machine Scheduling and Due Date Assignment with Past-Sequence-Dependent Setup Time and Position-Dependent Processing Time

    Directory of Open Access Journals (Sweden)

    Chuan-Li Zhao

    2014-01-01

    Full Text Available This paper considers single machine scheduling and due date assignment with setup time. The setup time is proportional to the length of the already processed jobs; that is, the setup time is past-sequence-dependent (p-s-d. It is assumed that a job's processing time depends on its position in a sequence. The objective functions include total earliness, the weighted number of tardy jobs, and the cost of due date assignment. We analyze these problems with two different due date assignment methods. We first consider the model with job-dependent position effects. For each case, by converting the problem to a series of assignment problems, we proved that the problems can be solved in On4 time. For the model with job-independent position effects, we proved that the problems can be solved in On3 time by providing a dynamic programming algorithm.

  20. Three monoclonal antibodies to the VHS virus glycoprotein: comparison of reactivity in relation to differences in immunoglobulin variable domain gene sequences

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Cupit, P.M.; Secombes, C.J.

    2000-01-01

    and their neutralising activity was evident. Binding kinetic analyses by plasmon resonance identified differences in the dissociation rate constant (kd) as a possible explanation for the different reactivity levels of the MAbs. The Ig variable heavy (VH) and light (V kappa) domain gene sequences of the three hybridomas...... were compared. The inferred amino acid sequence of the two neutralising antibody VH domains differed by three amino acid residues (97% identity) and only one residue difference was evident in the Vk. domains. In contrast, IP1H3 shared only 38 and 39% identity with the 3F1A2 and 3F1H10 VH domains...... respectively and 49 and 50% identity with the 3F1A2 and 3F1H10 VK domains respectively. The neutralising antibodies were produced by hybridomas originating from the same fusion and the high nucleotide sequence homology of the variable Ig gene regions indicated that the plasma cell partners of the hybridomas...

  1. Effects of High Intensity White Noise on Short-Term Memory for Position in a List and Sequence

    Science.gov (United States)

    Daee, Safar; Wilding, J. M.

    1977-01-01

    Seven experiments are described investigating the effecy of high intensity white noise during the visual presentation of words on a number of short-term memory tasks. Examines results relative to position learning and sequence learning. (Editor/RK)

  2. Sequence Variation in Toxoplasma gondii rop17 Gene among Strains from Different Hosts and Geographical Locations

    Directory of Open Access Journals (Sweden)

    Nian-Zhang Zhang

    2014-01-01

    Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.

  3. Interannual Variability in the Position and Strength of the East Asian Jet Stream and Its Relation to Large - scale Circulation

    Science.gov (United States)

    Chan, Duo; Zhang, Yang; Wu, Qigang

    2013-04-01

    East Asian Jet Stream (EASJ) is charactered by obvious interannual variability in strength and position (latitude), with wide impacts on East Asian climate in all seasons. In this study, two indices are established to measure the interannual variability in intensity and position of EAJS. Possible causing factors, including both local signals and non-local large-scale circulation, are examined using NCAP-NCAR reanalysis data to investigate their relations with jet variation. Our analysis shows that the relationship between the interannual variations of EASJ and these factors depends on seasons. In the summer, both the intensity and position of EASJ are closely related to the meridional gradient of local surface temperature, but display no apparent relationship with the larg-scale circulation. In cold seasons (autumn, winter and spring), both the local factor and the large-scale circulation, i.e. the Pacific/North American teleconnection pattern (PNA), play important roles in the interannual variability of the jet intensity. The variability in the jet position, however, is more correlated to the Arctic Oscillation (AO), especially in winter. Diagnostic analysis indicates that transient eddy activity plays an important role in connecting the interannual variability of EASJ position with AO.

  4. Radiation oncology career decision variables for graduating trainees seeking positions in 2003-2004

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Lynn D [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, CT (United States); Flynn, Daniel F [Department of Radiation Oncology, Holy Family Hospital, Methuen, MA (United States); Haffty, Bruce G [Department of Therapeutic Radiology, Yale University School of Medicine, New Haven, CT (United States)

    2005-06-01

    Purpose: Radiation oncology trainees must consider an array of variables when deciding upon an academic or private practice career path. This prospective evaluation of the 2004 graduating radiation oncology trainees, evaluates such variables and provides additional descriptive data. Methods: A survey that included 15 questions (one subjective, eleven categorical, and 3 continuous variables) was mailed to the 144 graduating radiation oncology trainees in United States programs in January of 2004. Questions were designed to gather information regarding factors that may have influenced career path choices. The responses were anonymous, and no identifying information was sought. Survey data were collated and analyzed for differences in both categorical and continuous variables as they related to choice of academic or private practice career path. Results: Sixty seven (47%) of the surveys were returned. Forty-five percent of respondents indicated pursuit of an academic career. All respondents participated in research during training with 73% participating in research publication authorship. Post graduate year-3 was the median in which career path was chosen, and 20% thought that a fellowship position was 'perhaps' necessary to secure an academic position. Thirty percent of the respondents revealed that the timing of the American Board of Radiology examination influenced their career path decision. Eighteen variables were offered as possibly influencing career path choice within the survey, and the top five identified by those seeking an academic path were: (1) colleagues, (2) clinical research, (3) teaching, (4) geography, (5) and support staff. For those seeking private practice, the top choices were: (1) lifestyle, (2) practice environment, (3) patient care, (4) geography, (5) colleagues. Female gender (p = 0.064), oral meeting presentation (p = 0.053), and international meeting presentation (p 0.066) were the variables most significantly associated with pursuing an

  5. Radiation oncology career decision variables for graduating trainees seeking positions in 2003-2004

    International Nuclear Information System (INIS)

    Wilson, Lynn D.; Flynn, Daniel F.; Haffty, Bruce G.

    2005-01-01

    Purpose: Radiation oncology trainees must consider an array of variables when deciding upon an academic or private practice career path. This prospective evaluation of the 2004 graduating radiation oncology trainees, evaluates such variables and provides additional descriptive data. Methods: A survey that included 15 questions (one subjective, eleven categorical, and 3 continuous variables) was mailed to the 144 graduating radiation oncology trainees in United States programs in January of 2004. Questions were designed to gather information regarding factors that may have influenced career path choices. The responses were anonymous, and no identifying information was sought. Survey data were collated and analyzed for differences in both categorical and continuous variables as they related to choice of academic or private practice career path. Results: Sixty seven (47%) of the surveys were returned. Forty-five percent of respondents indicated pursuit of an academic career. All respondents participated in research during training with 73% participating in research publication authorship. Post graduate year-3 was the median in which career path was chosen, and 20% thought that a fellowship position was 'perhaps' necessary to secure an academic position. Thirty percent of the respondents revealed that the timing of the American Board of Radiology examination influenced their career path decision. Eighteen variables were offered as possibly influencing career path choice within the survey, and the top five identified by those seeking an academic path were: (1) colleagues, (2) clinical research, (3) teaching, (4) geography, (5) and support staff. For those seeking private practice, the top choices were: (1) lifestyle, (2) practice environment, (3) patient care, (4) geography, (5) colleagues. Female gender (p = 0.064), oral meeting presentation (p = 0.053), and international meeting presentation (p 0.066) were the variables most significantly associated with pursuing an

  6. Effects of supine, prone, and lateral positions on cardiovascular and renal variables in humans

    DEFF Research Database (Denmark)

    Pump, Bettina; Talleruphuus, Ulrik; Christensen, Niels Juel

    2002-01-01

    The hypothesis was tested that changing the direction of the transverse gravitational stress in horizontal humans modulates cardiovascular and renal variables. On different study days, 14 healthy males were placed for 6 h in either the horizontal supine or prone position following 3 h of being...... supine. Eight of the subjects were in addition investigated in the horizontal left lateral position. Compared with supine, the prone position slightly increased free water clearance (349 +/- 38 vs. 447 +/- 39 ml/6 h, P = 0.05) and urine output (1,387 +/- 55 vs. 1,533 +/- 52 ml/6 h, P = 0...

  7. Observations of Local Positive Low Cloud Feedback Patterns and Their Role in Internal Variability and Climate Sensitivity

    Science.gov (United States)

    Yuan, Tianle; Oreopoulos, Lazaros; Platnick, Steven E.; Meyer, Kerry

    2018-05-01

    Modeling studies have shown that cloud feedbacks are sensitive to the spatial pattern of sea surface temperature (SST) anomalies, while cloud feedbacks themselves strongly influence the magnitude of SST anomalies. Observational counterparts to such patterned interactions are still needed. Here we show that distinct large-scale patterns of SST and low-cloud cover (LCC) emerge naturally from objective analyses of observations and demonstrate their close coupling in a positive local SST-LCC feedback loop that may be important for both internal variability and climate change. The two patterns that explain the maximum amount of covariance between SST and LCC correspond to the Interdecadal Pacific Oscillation and the Atlantic Multidecadal Oscillation, leading modes of multidecadal internal variability. Spatial patterns and time series of SST and LCC anomalies associated with both modes point to a strong positive local SST-LCC feedback. In many current climate models, our analyses suggest that SST-LCC feedback strength is too weak compared to observations. Modeled local SST-LCC feedback strength affects simulated internal variability so that stronger feedback produces more intense and more realistic patterns of internal variability. To the extent that the physics of the local positive SST-LCC feedback inferred from observed climate variability applies to future greenhouse warming, we anticipate significant amount of delayed warming because of SST-LCC feedback when anthropogenic SST warming eventually overwhelm the effects of internal variability that may mute anthropogenic warming over parts of the ocean. We postulate that many climate models may be underestimating both future warming and the magnitude of modeled internal variability because of their weak SST-LCC feedback.

  8. Reliability of Heart Rate Variability in Children: Influence of Sex and Body Position During Data Collection.

    Science.gov (United States)

    Silva, Carla Cristiane; Bertollo, Maurizio; Reichert, Felipe Fossati; Boullosa, Daniel Alexandre; Nakamura, Fábio Yuzo

    2017-05-01

    To examine which body position and indices present better reliability of heart rate variability (HRV) measures in children and to compare the HRV analyzed in different body positions between sexes. Twenty eutrophic prepubertal children of each sex participated in the study. The RR intervals were recorded using a portable heart rate monitor twice a day for 7 min in the supine, sitting, and standing positions. The reproducibility was analyzed using the intraclass correlation coefficient (ICC; two way mixed) and within-subject coefficient of variation (CV).Two-way ANOVA with repeated measures was used to compare the sexes. High levels of reproducibility were indicated by higher ICC in the root-mean-square difference of successive normal RR intervals (RMSSD: 0.93 and 0.94) and Poincaré plot of the short-term RR interval variability (SD1: 0.92 and 0.94) parameters for boys and girls, respectively, in the supine position. The ICCs were lower in the sitting and standing positions for all HRV indices. In addition, the girls presented significantly higher values than the boys for SDNN and absolute high frequency (HF; p position. The supine position is the most reproducible for the HRV indices in both sexes, especially the vagal related indices.

  9. Short timescale variability in the faint sky variability survey

    NARCIS (Netherlands)

    Morales-Rueda, L.; Groot, P.J.; Augusteijn, T.; Nelemans, G.A.; Vreeswijk, P.M.; Besselaar, E.J.M. van den

    2006-01-01

    We present the V-band variability analysis of the Faint Sky Variability Survey (FSVS). The FSVS combines colour and time variability information, from timescales of 24 minutes to tens of days, down to V = 24. We find that �1% of all point sources are variable along the main sequence reaching �3.5%

  10. Improved protection system for phase faults on marine vessels based on ratio between negative sequence and positive sequence of the fault current

    DEFF Research Database (Denmark)

    Ciontea, Catalin-Iosif; Hong, Qiteng; Booth, Campbell

    2018-01-01

    algorithm is implemented in a programmable digital relay embedded in a hardware-in-the-loop (HIL) test set-up that emulates a typical maritime feeder using a real-time digital simulator. The HIL set-up allows testing of the new protection method under a wide range of faults and network conditions......This study presents a new method to protect the radial feeders on marine vessels. The proposed protection method is effective against phase–phase (PP) faults and is based on evaluation of the ratio between the negative sequence and positive sequence of the fault currents. It is shown...... that the magnitude of the introduced ratio increases significantly during the PP fault, hence indicating the fault presence in an electric network. Here, the theoretical background of the new method of protection is firstly discussed, based on which the new protection algorithm is described afterwards. The proposed...

  11. Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.

    Science.gov (United States)

    Zhao, Xiaoyan; Sze, Sing-Hoi

    2011-05-01

    One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.

  12. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry.

    Science.gov (United States)

    Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert

    2017-10-01

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.

  13. Analysis of Soccer Players’ Positional Variability During the 2012 UEFA European Championship: A Case Study

    Science.gov (United States)

    Moura, Felipe Arruda; Santana, Juliana Exel; Vieira, Nathália Arnosti; Santiago, Paulo Roberto Pereira; Cunha, Sergio Augusto

    2015-01-01

    The purpose of this study was to analyse players’ positional variability during the 2012 UEFA European Championship by applying principal component analysis (PCA) to data gathered from heat maps posted on the UEFA website. We analysed the teams that reached the finals and semi-finals of the competition. The players’ 2D coordinates from each match were obtained by applying an image-processing algorithm to the heat maps. With all the players’ 2D coordinates for each match, we applied PCA to identify the directions of greatest variability. Then, two orthogonal segments were centred on each player’s mean position for all matches. The segments’ directions were driven by the eigenvectors of the PCA, and the length of each segment was defined as one standard deviation around the mean. Finally, an ellipse was circumscribed around both segments. To represent player variability, segment lengths and elliptical areas were analysed. The results demonstrate that Portugal exhibited the lowest variability, followed by Germany, Spain and Italy. Additionally, a graphical representation of every player’s ellipse provided insight into the teams’ organisational features throughout the competition. The presented study provides important information regarding soccer teams’ tactical strategy in high-level championships that allows coaches to better control team organisation on the pitch. PMID:26557206

  14. Analysis of Soccer Players’ Positional Variability During the 2012 UEFA European Championship: A Case Study

    Directory of Open Access Journals (Sweden)

    Moura Felipe Arruda

    2015-09-01

    Full Text Available The purpose of this study was to analyse players’ positional variability during the 2012 UEFA European Championship by applying principal component analysis (PCA to data gathered from heat maps posted on the UEFA website. We analysed the teams that reached the finals and semi-finals of the competition. The players’ 2D coordinates from each match were obtained by applying an image-processing algorithm to the heat maps. With all the players’ 2D coordinates for each match, we applied PCA to identify the directions of greatest variability. Then, two orthogonal segments were centred on each player’s mean position for all matches. The segments’ directions were driven by the eigenvectors of the PCA, and the length of each segment was defined as one standard deviation around the mean. Finally, an ellipse was circumscribed around both segments. To represent player variability, segment lengths and elliptical areas were analysed. The results demonstrate that Portugal exhibited the lowest variability, followed by Germany, Spain and Italy. Additionally, a graphical representation of every player’s ellipse provided insight into the teams’ organisational features throughout the competition. The presented study provides important information regarding soccer teams’ tactical strategy in high-level championships that allows coaches to better control team organisation on the pitch.

  15. Variable Number of Tandem Repeat Markers in the Genome Sequence of Mycosphaerella Fijiensis, the Causal Agent of Black Leaf Streak Disease of Banana (Musa spp.)

    Science.gov (United States)

    Mycosphaerella fijiensis, the causal agent of banana leaf streak disease (commonly known as black Sigatoka), is the most devastating pathogen attacking bananas (Musa spp). Recently the whole genome sequence of M. fijiensis became available. This sequence was screened for the presence of Variable Num...

  16. Complete genome sequence of Paenibacillus riograndensis SBR5(T), a Gram-positive diazotrophic rhizobacterium.

    Science.gov (United States)

    Brito, Luciana Fernandes; Bach, Evelise; Kalinowski, Jörn; Rückert, Christian; Wibberg, Daniel; Passaglia, Luciane M; Wendisch, Volker F

    2015-08-10

    Paenibacillus riograndensis is a Gram-positive rhizobacterium which exhibits plant growth promoting activities. It was isolated from the rhizosphere of wheat grown in the state of Rio Grande do Sul, Brazil. Here we announce the complete genome sequence of P. riograndensis strain SBR5(T). The genome of P. riograndensis SBR5(T) consists of a circular chromosome of 7,893,056bps. The genome was finished and fully annotated, containing 6705 protein coding genes, 87 tRNAs and 27 rRNAs. The knowledge of the complete genome helped to explain why P. riograndensis SBR5(T) can grow with the carbon sources arabinose and mannitol, but not myo-inositol, and to explain physiological features such as biotin auxotrophy and antibiotic resistances. The genome sequence will be valuable for functional genomics and ecological studies as well as for application of P. riograndensis SBR5(T) as plant growth-promoting rhizobacterium. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Positive Feedback Keeps Duration of Mitosis Temporally Insulated from Upstream Cell-Cycle Events.

    Science.gov (United States)

    Araujo, Ana Rita; Gelens, Lendert; Sheriff, Rahuman S M; Santos, Silvia D M

    2016-10-20

    Cell division is characterized by a sequence of events by which a cell gives rise to two daughter cells. Quantitative measurements of cell-cycle dynamics in single cells showed that despite variability in G1-, S-, and G2 phases, duration of mitosis is short and remarkably constant. Surprisingly, there is no correlation between cell-cycle length and mitotic duration, suggesting that mitosis is temporally insulated from variability in earlier cell-cycle phases. By combining live cell imaging and computational modeling, we showed that positive feedback is the molecular mechanism underlying the temporal insulation of mitosis. Perturbing positive feedback gave rise to a sluggish, variable entry and progression through mitosis and uncoupled duration of mitosis from variability in cell cycle length. We show that positive feedback is important to keep mitosis short, constant, and temporally insulated and anticipate it might be a commonly used regulatory strategy to create modularity in other biological systems. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Comparison of variable region 3 sequences of human immunodeficiency virus type 1 from infected children with the RNA and DNA sequences of the virus populations of their mothers.

    Science.gov (United States)

    Scarlatti, G; Leitner, T; Halapi, E; Wahlberg, J; Marchisio, P; Clerici-Schoeller, M A; Wigzell, H; Fenyö, E M; Albert, J; Uhlén, M

    1993-01-01

    We have compared the variable region 3 sequences from 10 human immunodeficiency virus type 1 (HIV-1)-infected infants to virus sequences from the corresponding mothers. The sequences were derived from DNA of uncultured peripheral blood mononuclear cells (PBMC), DNA of cultured PBMC, and RNA from serum collected at or shortly after delivery. The infected infants, in contrast to the mothers, harbored homogeneous virus populations. Comparison of sequences from the children and clones derived from DNA of the corresponding mothers showed that the transmitted virus represented either a minor or a major virus population of the mother. In contrast to an earlier study, we found no evidence of selection of minor virus variants during transmission. Furthermore, the transmitted virus variant did not show any characteristic molecular features. In some cases the transmitted virus was more related to the virus RNA population of the mother and in other cases it was more related to the virus DNA population. This suggests that either cell-free or cell-associated virus may be transmitted. These data will help AIDS researchers to understand the mechanism of transmission and to plan strategies for prevention of transmission. PMID:8446584

  19. Design and Evaluation of a Protection Relay for a Wind Generator Based on the Positive- and Negative-Sequence Fault Components

    DEFF Research Database (Denmark)

    Zheng, T. Y.; Cha, Seung-Tae; Crossley, P. A.

    2013-01-01

    To avoid undesirable disconnection of healthy wind generators (WGs) or a wind power plant, a WG protection relay should discriminate among faults, so that it can operate instantaneously for WG, connected feeder or connection bus faults, it can operate after a delay for inter-tie or grid faults......, and it can avoid operating for parallel WG or adjacent feeder faults. A WG protection relay based on the positive- and negativesequence fault components is proposed in the paper. At stage 1, the proposed relay uses the magnitude of the positive-sequence component in the fault current to distinguish faults...... at a parallel WG connected to the same feeder or at an adjacent feeder, from other faults at a connected feeder, an inter-tie, or a grid. At stage 2, the fault type is first determined using the relationships between the positive- and negative-sequence fault components. Then, the relay differentiates between...

  20. Testing predictive models of positive and negative affect with psychosocial, acculturation, and coping variables in a multiethnic undergraduate sample

    OpenAIRE

    Kuo, Ben CH; Kwantes, Catherine T

    2014-01-01

    Despite the prevalence and popularity of research on positive and negative affect within the field of psychology, there is currently little research on affect involving the examination of cultural variables and with participants of diverse cultural and ethnic backgrounds. To the authors’ knowledge, currently no empirical studies have comprehensively examined predictive models of positive and negative affect based specifically on multiple psychosocial, acculturation, and coping variables as pr...

  1. Profiling dehydrin gene sequence and physiological parameters in drought tolerant and susceptible spring wheat cultivars

    International Nuclear Information System (INIS)

    Baloch, M.J.; Jatoi, W.A.

    2012-01-01

    Physiological and yield traits such as stomatal conductance (mmol m-/sup 2/s/sup -1/), Leaf relative water content (RWC %) and grain yield per plant were studied in a separate experiment. Results revealed that five out of sixteen cultivars viz. Anmol, Moomal, Sarsabz, Bhitai and Pavan, appeared to be relatively more drought tolerant. Based on morphophysiological results, studies were continued to look at these cultivars for drought tolerance at molecular level. Initially, four well recognized primers for dehydrin genes (DHNs) responsible for drought induction in T. durum L., T. aestivum L. and O. sativa L. were used for profiling gene sequence of sixteen wheat cultivars. The primers amplified the DHN genes variably like Primer WDHN13 (T. aestivum L.) amplified the DHN gene in only seven cultivars whereas primer TdDHN15 ( T. durum L.) amplified all the sixteen cultivars with even different DNA banding patterns some showing second weaker DNA bands. Third primer TdDHN16 (T. durum L.) has shown entirely different PCR amplification prototype, specially showing two strong DNA bands while fourth primer RAB16C (O. sativa L.) failed to amplify DHN gene in any of the cultivars. Examination of DNA sequences revealed several interesting features. First, it identified the two exon/one intron structure of this gene (complete sequences were not shown), a feature not previously described in the two database cDNA sequences available from T. aestivum L. (gi|21850). Secondly, the analysis identified several single nucleotide polymorphisms (SNPs), positions in gene sequence. Although complete gene sequence was not obtained for all the cultivars, yet there were a total of 38 variable positions in exonic (coding region) sequence, from a total gene length of 453 nucleotides. Matrix of SNP shows these 37 positions with individual sequence at positions given for each of the 14 cultivars (sequence of two cultivars was not obtained) included in this analysis. It demonstrated a considerab le

  2. Interacting noise sources shape patterns of arm movement variability in three-dimensional space.

    Science.gov (United States)

    Apker, Gregory A; Darling, Timothy K; Buneo, Christopher A

    2010-11-01

    Reaching movements are subject to noise in both the planning and execution phases of movement production. The interaction of these noise sources during natural movements is not well understood, despite its importance for understanding movement variability in neurologically intact and impaired individuals. Here we examined the interaction of planning and execution related noise during the production of unconstrained reaching movements. Subjects performed sequences of two movements to targets arranged in three vertical planes separated in depth. The starting position for each sequence was also varied in depth with the target plane; thus required movement sequences were largely contained within the vertical plane of the targets. Each final target in a sequence was approached from two different directions, and these movements were made with or without visual feedback of the moving hand. These combined aspects of the design allowed us to probe the interaction of execution and planning related noise with respect to reach endpoint variability. In agreement with previous studies, we found that reach endpoint distributions were highly anisotropic. The principal axes of movement variability were largely aligned with the depth axis, i.e., the axis along which visual planning related noise would be expected to dominate, and were not generally well aligned with the direction of the movement vector. Our results suggest that visual planning-related noise plays a dominant role in determining anisotropic patterns of endpoint variability in three-dimensional space, with execution noise adding to this variability in a movement direction-dependent manner.

  3. Ancient, recurrent phage attacks and recombination shaped dynamic sequence-variable mosaics at the root of phytoplasma genome evolution.

    Science.gov (United States)

    Wei, Wei; Davis, Robert E; Jomantiene, Rasa; Zhao, Yan

    2008-08-19

    Mobile genetic elements have impacted biological evolution across all studied organisms, but evidence for a role in evolutionary emergence of an entire phylogenetic clade has not been forthcoming. We suggest that mobile element predation played a formative role in emergence of the phytoplasma clade. Phytoplasmas are cell wall-less bacteria that cause numerous diseases in plants. Phylogenetic analyses indicate that these transkingdom parasites descended from Gram-positive walled bacteria, but events giving rise to the first phytoplasma have remained unknown. Previously we discovered a unique feature of phytoplasmal genome architecture, genes clustered in sequence-variable mosaics (SVMs), and suggested that such structures formed through recurrent, targeted attacks by mobile elements. In the present study, we discovered that cryptic prophage remnants, originating from phages in the order Caudovirales, formed SVMs and comprised exceptionally large percentages of the chromosomes of 'Candidatus Phytoplasma asteris'-related strains OYM and AYWB, occupying nearly all major nonsyntenic sections, and accounting for most of the size difference between the two genomes. The clustered phage remnants formed genomic islands exhibiting distinct DNA physical signatures, such as dinucleotide relative abundance and codon position GC values. Phytoplasma strain-specific genes identified as phage morons were located in hypervariable regions within individual SVMs, indicating that prophage remnants played important roles in generating phytoplasma genetic diversity. Because no SVM-like structures could be identified in genomes of ancestral relatives including Acholeplasma spp., we hypothesize that ancient phage attacks leading to SVM formation occurred after divergence of phytoplasmas from acholeplasmas, triggering evolution of the phytoplasma clade.

  4. Main sequence mass loss

    International Nuclear Information System (INIS)

    Brunish, W.M.; Guzik, J.A.; Willson, L.A.; Bowen, G.

    1987-01-01

    It has been hypothesized that variable stars may experience mass loss, driven, at least in part, by oscillations. The class of stars we are discussing here are the δ Scuti variables. These are variable stars with masses between about 1.2 and 2.25 M/sub θ/, lying on or very near the main sequence. According to this theory, high rotation rates enhance the rate of mass loss, so main sequence stars born in this mass range would have a range of mass loss rates, depending on their initial rotation velocity and the amplitude of the oscillations. The stars would evolve rapidly down the main sequence until (at about 1.25 M/sub θ/) a surface convection zone began to form. The presence of this convective region would slow the rotation, perhaps allowing magnetic braking to occur, and thus sharply reduce the mass loss rate. 7 refs

  5. Prostate position variability and dose-volume histograms in radiotherapy for prostate cancer with full and empty bladder

    International Nuclear Information System (INIS)

    Pinkawa, Michael; Asadpour, Branka; Gagel, Bernd; Piroth, Marc D.; Holy, Richard; Eble, Michael J.

    2006-01-01

    Purpose: To evaluate prostate position variability and dose-volume histograms in prostate radiotherapy with full bladder (FB) and empty bladder (EB). Methods and Materials: Thirty patients underwent planning computed tomography scans in a supine position with FB and EB before and after 4 and 8 weeks of radiation therapy. The scans were matched by alignment of pelvic bones. Displacements of the prostate/seminal vesicle organ borders and center of mass were determined. Treatment plans (FB vs. EB) were compared. Results: Compared with the primary scan, FB volume varied more than EB volume (standard deviation, 106 cm 3 vs. 47 cm 3 ), but the prostate/seminal vesicle center of mass position variability was the same (>3 mm deviation in right-left, anterior-posterior, and superior-inferior directions in 0, 41%, and 33%, respectively, with FB vs. 0, 44%, and 33% with EB). The bladder volume treated with 90% of the prescription dose was significantly larger with EB (39% ± 14% vs. 22% ± 10%; p < 0.01). Bowel loops received ≥90% of prescription dose in 37% (3% with FB; p < 0.01). Conclusion: Despite the larger variability of bladder filling, prostate position stability was the same with FB compared with EB. An increased amount of bladder volume in the high-dose region and a higher dose to bowel loops result from treatment plans with EB

  6. Stereophysicochemical variability plots highlight conserved antigenic areas in Flaviviruses

    Directory of Open Access Journals (Sweden)

    Zhou Bin

    2005-04-01

    Full Text Available Abstract Background Flaviviruses, which include Dengue (DV and West Nile (WN, mutate in response to immune system pressure. Identifying escape mutants, variant progeny that replicate in the presence of neutralizing antibodies, is a common way to identify functionally important residues of viral proteins. However, the mutations typically occur at variable positions on the viral surface that are not essential for viral replication. Methods are needed to determine the true targets of the neutralizing antibodies. Results Stereophysicochemical variability plots (SVPs, 3-D images of protein structures colored according to variability, as determined by our PCPMer program, were used to visualize residues conserved in their physical chemical properties (PCPs near escape mutant positions. The analysis showed 1 that escape mutations in the flavivirus envelope protein are variable residues by our criteria and 2 two escape mutants found at the same position in many flaviviruses sit above clusters of conserved residues from different regions of the linear sequence. Conservation patterns in T-cell epitopes in the NS3- protease suggest a similar mechanism of immune system evasion. Conclusion The SVPs add another dimension to structurally defining the binding sites of neutralizing antibodies. They provide a useful aid for determining antigenically important regions and designing vaccines.

  7. Cross-Contextual Variability in Parents' and School Tutors' Conflict Resolution Styles and Positive Development

    Science.gov (United States)

    Rodríguez-Ruiz, Beatriz; Rodrigo, María José; Martínez-González, Raquel-Amaya

    2015-01-01

    The authors examined how the variability in adult conflict resolution styles in family and school contexts was related to adolescents' positive development. Cluster analysis classified 440 fathers, 440 mothers, and 125 tutors into 4 clusters, based on self-reports of their conflict resolution styles. Adolescents exposed to Cluster 1 (inconsistency…

  8. Kangaroo position: Immediate effects on the physiological variables of preterm and low birth weight newborns

    Directory of Open Access Journals (Sweden)

    Érica Cesário Defilipo

    Full Text Available Abstract Introduction: The Kangaroo Mother Care (KMC method is a significant neonatal alternative that ensures better quality humanized care for preterm and low birth weight newborns. Objective: To analyze the immediate physiological effects of the kangaroo position in critically ill newborns. Methods: Open clinical trial with parallel interventions, involving preterm (up to 28 days old low or very low birth weight newborns (minimum weight of 1,250 grams of both sexes, that were clinically stable and undergoing enteral nutrition. The degree of respiratory distress was assessed and quantified using the Silverman-Anderson scoring system. Heart rate and peripheral oxygen saturation were collected using a pulse oximeter. Respiratory rate was determined by auscultation for one minute. The newborns were submitted to the kangaroo position once only, for 90 minutes. Results: Participants were 30 newborns, 56.7% of which were girls. Comparison of the variables before and after application of the kangaroo position using the Wilcoxon test showed a statistically significant reduction in respiratory rate (p = 0.02 and Silverman-Anderson score (p < 0.01. The remaining variables showed no significant differences: heart rate (p = 0.21, peripheral oxygen saturation (p = 0.26 and axillary temperature (p = 0.12. Conclusion: There was a decline in the respiratory rate and Silverman-Anderson score after application of the kangaroo position, while peripheral oxygen saturation, axillary temperature and heart rate remained stable.

  9. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    Science.gov (United States)

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  10. Learning multiple variable-speed sequences in striatum via cortical tutoring.

    Science.gov (United States)

    Murray, James M; Escola, G Sean

    2017-05-08

    Sparse, sequential patterns of neural activity have been observed in numerous brain areas during timekeeping and motor sequence tasks. Inspired by such observations, we construct a model of the striatum, an all-inhibitory circuit where sequential activity patterns are prominent, addressing the following key challenges: (i) obtaining control over temporal rescaling of the sequence speed, with the ability to generalize to new speeds; (ii) facilitating flexible expression of distinct sequences via selective activation, concatenation, and recycling of specific subsequences; and (iii) enabling the biologically plausible learning of sequences, consistent with the decoupling of learning and execution suggested by lesion studies showing that cortical circuits are necessary for learning, but that subcortical circuits are sufficient to drive learned behaviors. The same mechanisms that we describe can also be applied to circuits with both excitatory and inhibitory populations, and hence may underlie general features of sequential neural activity pattern generation in the brain.

  11. R Aquarii - the large-scale optical nebula and the Mira variable position

    International Nuclear Information System (INIS)

    Michalitsianos, A.G.; Oliversen, R.J.; Hollis, J.M.; Kafatos, M.; Crull, H.E.

    1988-01-01

    The R Aquarii symbiotic star system is surrounded by a large-scale optical nebula. Observations of the nebular forbidden O III structure are presented and its morphological significance are discussed in context with previously observed small-scale radio-continuum features, which may be related. It is suggested that a precessing accretion disk may explain the global features of both the large-scale optical emission and the small-scale radio emission. Moreover, an accurate position has been determined of the system's Mira, which suggests that a recent theoretical model, yielding an egg-shaped central H II region for symbiotic systems with certain physical parameters, may apply to R Aquarii. The optical position of the 387 d period Mira variable is consistent with previous findings in the radio, that SiO maser emission is far removed from the Mira photosphere. 25 references

  12. Finding positives after disaster: Insights from nurses following the 2010-2011 Canterbury, NZ earthquake sequence.

    Science.gov (United States)

    Johal, Sarbjit S; Mounsey, Zoe R

    2015-11-01

    This paper identifies positive aspects of nurse experiences during the Canterbury 2010-2011 earthquake sequence and subsequent recovery process. Qualitative semi-structured interviews were undertaken with 11 nurses from the Christchurch area to explore the challenges faced by the nurses during and following the earthquakes. The interviews took place three years after the start of the earthquake experience to enable exploration of the longer term recovery process. The interview transcripts were analysed and coded using a grounded theory approach. The data analysis identified that despite the many challenges faced by the nurses during and following the earthquakes they were able to identify positives from their experience. A number of themes were identified that are related to posttraumatic growth, including; improvement in relationships with others, change in perspective/values, changed views of self and acknowledgement of the value of the experience. The research indicates that nurses were able to identify positive aspects of their experiences of the earthquakes and recovery process, suggesting that both positive and negative impacts on wellbeing can co-exist. These insights have value for employers designing support processes following disasters as focusing on positive elements could enhance nurse wellbeing during stressful times. Copyright © 2015 College of Emergency Nursing Australasia Ltd. Published by Elsevier Ltd. All rights reserved.

  13. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  14. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  15. Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

    International Nuclear Information System (INIS)

    Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah

    2014-01-01

    Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after 18 F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast-enhanced PET

  16. Evaluation of Dixon Sequence on Hybrid PET/MR Compared with Contrast-Enhanced PET/CT for PET-Positive Lesions

    Energy Technology Data Exchange (ETDEWEB)

    Jeong, Ju Hye; Cho, Ihn Ho; Kong, Eun Jung; Chun, Kyung Ah [Yeungnam Univ. Hospital, Daegu (Korea, Republic of)

    2014-03-15

    Hybrid positron emission tomography and magnetic resonance (PET/MR) imaging performs a two-point Dixon MR sequence for attenuation correction. However, MR data in hybrid PET/MR should provide anatomic and morphologic information as well as an attenuation map. We evaluated the Dixon sequence of hybrid PET/MR for anatomic correlation of PET-positive lesions compared with contrast-enhanced PET/computed tomography (CT) in patients with oncologic diseases. Twelve patients underwent a single injection, dual imaging protocol. PET/CT was performed with an intravenous contrast agent (85±13 min after {sup 18}F-FDG injection of 403± 45 MBq) and then (125±19 min after injection) PET/MR was performed. Attenuation correction and anatomic allocation of PET were performed using contrast-enhanced CT for PET/CT and Dixon MR sequence for hybrid PET/MR. The Dixon MR sequence and contrast-enhanced CT were compared for anatomic correlation of PET-positive lesions (scoring scale ranging from 0 to 3 for visual ratings). Additionally, standardized uptake values (SUVs) for the detected lesions were assessed for quantitative comparison. Both hybrid PET/MR and contrast-enhanced PET/CT identified 55 lesions with increased FDG uptake in ten patients. In total, 28 lymph nodes, 11 bone lesions, 3 dermal nodules, 3 pleural thickening lesions, 2 thyroid nodules, 1 pancreas, 1 liver, 1 ovary, 1 uterus, 1 breast, 1 soft tissue and 2 lung lesions were present. The best performance was observed for anatomic correlation of PET findings by the contrast-enhanced CT scans (contrast-enhanced CT, 2.64± 0.70; in-phase, 1.29±1.01; opposed-phase, 1.29±1.15; water-weighted, 1.71±1.07; fat weighted, 0.56±1.03). A significant difference was observed between the scores obtained from the contrast-enhanced CT and all four coregistered Dixon MR images. Quantitative evaluation revealed a high correlation between the SUVs measured with hybrid PET/MR (SUVmean, 2.63±1.62; SUVmax, 4.30±2.88) and contrast

  17. Phylogenetic tree reconstruction accuracy and model fit when proportions of variable sites change across the tree.

    Science.gov (United States)

    Shavit Grievink, Liat; Penny, David; Hendy, Michael D; Holland, Barbara R

    2010-05-01

    Commonly used phylogenetic models assume a homogeneous process through time in all parts of the tree. However, it is known that these models can be too simplistic as they do not account for nonhomogeneous lineage-specific properties. In particular, it is now widely recognized that as constraints on sequences evolve, the proportion and positions of variable sites can vary between lineages causing heterotachy. The extent to which this model misspecification affects tree reconstruction is still unknown. Here, we evaluate the effect of changes in the proportions and positions of variable sites on model fit and tree estimation. We consider 5 current models of nucleotide sequence evolution in a Bayesian Markov chain Monte Carlo framework as well as maximum parsimony (MP). We show that for a tree with 4 lineages where 2 nonsister taxa undergo a change in the proportion of variable sites tree reconstruction under the best-fitting model, which is chosen using a relative test, often results in the wrong tree. In this case, we found that an absolute test of model fit is a better predictor of tree estimation accuracy. We also found further evidence that MP is not immune to heterotachy. In addition, we show that increased sampling of taxa that have undergone a change in proportion and positions of variable sites is critical for accurate tree reconstruction.

  18. Phylogenetic position of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, as inferred from 16S rDNA sequence analysis.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Domier, L L

    2000-03-01

    A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.

  19. The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists

    OpenAIRE

    Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L

    2015-01-01

    Purpose and scope The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it...

  20. Identification of antigen-specific human monoclonal antibodies using high-throughput sequencing of the antibody repertoire.

    Science.gov (United States)

    Liu, Ju; Li, Ruihua; Liu, Kun; Li, Liangliang; Zai, Xiaodong; Chi, Xiangyang; Fu, Ling; Xu, Junjie; Chen, Wei

    2016-04-22

    High-throughput sequencing of the antibody repertoire provides a large number of antibody variable region sequences that can be used to generate human monoclonal antibodies. However, current screening methods for identifying antigen-specific antibodies are inefficient. In the present study, we developed an antibody clone screening strategy based on clone dynamics and relative frequency, and used it to identify antigen-specific human monoclonal antibodies. Enzyme-linked immunosorbent assay showed that at least 52% of putative positive immunoglobulin heavy chains composed antigen-specific antibodies. Combining information on dynamics and relative frequency improved identification of positive clones and elimination of negative clones. and increase the credibility of putative positive clones. Therefore the screening strategy could simplify the subsequent experimental screening and may facilitate the generation of antigen-specific antibodies. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. A state variable approach to the BESSY II local beam-position-feedback system

    International Nuclear Information System (INIS)

    Gilpatrick, J.D.; Khan, S.; Kraemer, D.

    1996-01-01

    At the BESSY II facility, stability of the electron beam position and angle near insertion devices (IDs) is of utmost importance. Disturbances due to ground motion could result in unwanted broad-bandwidth beam-jitter which decreases the electron (and resultant photon) beam's effective brightness. Therefore, feedback techniques must be used. Operating over a frequency range of 100-Hz, a local feedback system will correct these beam-trajectory errors using the four bumps around IDs. This paper reviews how the state-variable feedback approach can be applied to real-time correction of these beam position and angle errors. A frequency-domain solution showing beam jitter reduction is presented. Finally, this paper reports results of a beam-feedback test at BESSY I

  2. The linear variable differential transformer (LVDT) position sensor for gravitational wave interferometer low-frequency controls

    Energy Technology Data Exchange (ETDEWEB)

    Tariq, Hareem E-mail: htariq@ligo.caltech.edu; Takamori, Akiteru; Vetrano, Flavio; Wang Chenyang; Bertolini, Alessandro; Calamai, Giovanni; DeSalvo, Riccardo; Gennai, Alberto; Holloway, Lee; Losurdo, Giovanni; Marka, Szabolcs; Mazzoni, Massimo; Paoletti, Federico; Passuello, Diego; Sannibale, Virginio; Stanga, Ruggero

    2002-08-21

    Low-power, ultra-high-vacuum compatible, non-contacting position sensors with nanometer resolution and centimeter dynamic range have been developed, built and tested. They have been designed at Virgo as the sensors for low-frequency modal damping of Seismic Attenuation System chains in Gravitational Wave interferometers and sub-micron absolute mirror positioning. One type of these linear variable differential transformers (LVDTs) has been designed to be also insensitive to transversal displacement thus allowing 3D movement of the sensor head while still precisely reading its position along the sensitivity axis. A second LVDT geometry has been designed to measure the displacement of the vertical seismic attenuation filters from their nominal position. Unlike the commercial LVDTs, mostly based on magnetic cores, the LVDTs described here exert no force on the measured structure.

  3. The evolutionary state of the β Canis Majoris variables

    International Nuclear Information System (INIS)

    Shobbrook, R.R.

    1978-01-01

    It is found from accurate β photometry of bright stars in the region of the β CMa instability strip that about three-quarters of the stars in the strip, to a distance modulus of 8.0, are β CMa variables. The strip is not resolved by the data so that its intrinsic width is uncertain, but the conclusion from a consideration of theoretical evolutionary rates is that the variables must be very near the end of core hydrogen burning. Comparison of the relative positions of the empirical and theoretical instability strip and zero age main sequence indicates that the observationally located upper ZAMS is too bright. (author)

  4. Genetic divergence of Asiatic Bdellocephala (Turbellaria, Tricladida, Paludicola) as revealed by partial 18S rRNA gene sequence comparisons.

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A; Goldman, E

    1997-01-01

    Polymerase chain reaction (PCR) and direct sequencing of small ribosomal RNA genes were used for analysis of genetic differences among Asiatic species of freshwater triclad genus Bdellocephala. Representatives of four species and four subspecies of this genus were used to establish homology between nucleotides in the 5'-end portion of small ribosomal RNA gene sequences. Within 552 nucleotide sites of aligned sequences compared, six variable base positions were discovered, dividing Bdellocephala into five different genotypes. Sequence data allow to distinguish two groups of these genotypes. One of them unites species from Kamchatka and Japan, another one unites Baikalian taxa. Agreement between available morphological, cytological and sequence data is discussed.

  5. Two-Agent Scheduling to Minimize the Maximum Cost with Position-Dependent Jobs

    Directory of Open Access Journals (Sweden)

    Long Wan

    2015-01-01

    Full Text Available This paper investigates a single-machine two-agent scheduling problem to minimize the maximum costs with position-dependent jobs. There are two agents, each with a set of independent jobs, competing to perform their jobs on a common machine. In our scheduling setting, the actual position-dependent processing time of one job is characterized by variable function dependent on the position of the job in the sequence. Each agent wants to fulfil the objective of minimizing the maximum cost of its own jobs. We develop a feasible method to achieve all the Pareto optimal points in polynomial time.

  6. SEQUENCING OF FLAX LIS-1 INSERTION SITE IN THE ALBIDUM GENOTYPE

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2012-12-01

    Full Text Available The paper presents a methodology of identifying the insertion site of LIS-1-1 (Linum Insertion Sequence 1 element in flax Albidum variety when growing under the in vitro combined with environmental stress conditions. Abiotic stress was induced by a reduced nutrient content in a growth medium. The LIS-1 insertion site amplification was reaLIS-1ed using the forward LIS-L: 5'-GGG CAG TTT AAC TGT AAC GAA - 3 'and revers LIS-R: 5'-GCT TGG ATT TAG ACT TGG CAA C - 3' primers by PCR. PCR product was sequenced by direct sequencing method to proove the nucleotide sequence for matching with database LIS-1 sequence. A comparison has been matched with the sequence of the amplified segment in the database for all nucleotides except the 11-position in the 5'-3 ' direction, where instead of the three adenine pair is a couple in the Albidum variety. Changes caused by mobile elements or insertion sequences result in common flax in variability that can be used for the purposes of development of effective marker identification or environment based markers development.

  7. The role of positive selection in hepatitis C virus.

    Science.gov (United States)

    Cuevas, José M; Gonzalez, Michael; Torres-Puente, Manuela; Jiménez-Hernández, Nuria; Bracho, María A; García-Robles, Inmaculada; González-Candelas, Fernando; Moya, Andrés

    2009-09-01

    Hepatitis C virus (HCV) is a major health problem worldwide, infecting an estimated 170 million people. In this study, we have employed a large data set of sequences (14,654 sequences from between 25 and 100 clone sequences per analyzed region and per patient) from 67 patients infected with HCV genotype 1 (23 subtype 1a and 44 subtype 1b). For all patients, a sample prior to combined therapy with alpha interferon plus ribavirin was available, whereas for some patients additional samples after 6 or 12 months of treatment were also available. Twenty-seven patients responded to treatment (12 subtype 1a and 15 subtype 1b) and forty patients did not respond to treatment (11 subtype 1a vs. 29 subtype 1b). Two regions of the HCV genome were analyzed, one compressing the hypervariable regions (HVR1, HVR2 and HVR3) of the envelope 2 glycoprotein and another one including the interferon sensitive determining region (ISDR) and the V3 domain of the NS5A protein. Previously (Cuevas, J.M., Torres-Puente, M., Jiménez-Hernández, N., Bracho, M.A., García-Robles, I., Wrobel, B., Carnicer, F., del Olmo, J., Ortega, E., Moya, A., González-Candelas, F., 2008b. Genetic variability of hepatitis C virus before and after combined therapy of interferon plus ribavirin. Plos One 3 (8), e3058), several amino acid positions in both regions analyzed were detected to be under positive selection. Here, we have compared the amino acid composition of each positively selected position between responder and non-responder patients for both subtypes. If we exclude some non-conclusive cases, no clear differences were detected in any case. In conclusion, identifying specific positions as completely discriminatory of treatment response seems to be a difficult task. Our results, in concordance with previous studies, suggest that HCV evasion strategies are more likely based on a global increased variability, which would yield combinations of mutations with an increased resistance, than on the fixation of

  8. Learning and memory for sequences of pictures, words, and spatial locations: an exploration of serial position effects.

    Science.gov (United States)

    Bonk, William J; Healy, Alice F

    2010-01-01

    A serial reproduction of order with distractors task was developed to make it possible to observe successive snapshots of the learning process at each serial position. The new task was used to explore the effect of several variables on serial memory performance: stimulus content (words, blanks, and pictures), presentation condition (spatial information vs. none), semantically categorized item clustering (grouped vs. ungrouped), and number of distractors relative to targets (none, equal, double). These encoding and retrieval variables, along with learning attempt number, affected both overall performance levels and the shape of the serial position function, although a large and extensive primacy advantage and a small 1-item recency advantage were found in each case. These results were explained well by a version of the scale-independent memory, perception, and learning model that accounted for improved performance by increasing the value of only a single parameter that reflects reduced interference from distant items.

  9. Targeting and tracing of specific DNA sequences with dTALEs in living cells

    Science.gov (United States)

    Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich

    2014-01-01

    Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation. PMID:24371265

  10. Targeting and tracing of specific DNA sequences with dTALEs in living cells.

    Science.gov (United States)

    Thanisch, Katharina; Schneider, Katrin; Morbitzer, Robert; Solovei, Irina; Lahaye, Thomas; Bultmann, Sebastian; Leonhardt, Heinrich

    2014-04-01

    Epigenetic regulation of gene expression involves, besides DNA and histone modifications, the relative positioning of DNA sequences within the nucleus. To trace specific DNA sequences in living cells, we used programmable sequence-specific DNA binding of designer transcription activator-like effectors (dTALEs). We designed a recombinant dTALE (msTALE) with variable repeat domains to specifically bind a 19-bp target sequence of major satellite DNA. The msTALE was fused with green fluorescent protein (GFP) and stably expressed in mouse embryonic stem cells. Hybridization with a major satellite probe (3D-fluorescent in situ hybridization) and co-staining for known cellular structures confirmed in vivo binding of the GFP-msTALE to major satellite DNA present at nuclear chromocenters. Dual tracing of major satellite DNA and the replication machinery throughout S-phase showed co-localization during mid to late S-phase, directly demonstrating the late replication timing of major satellite DNA. Fluorescence bleaching experiments indicated a relatively stable but still dynamic binding, with mean residence times in the range of minutes. Fluorescently labeled dTALEs open new perspectives to target and trace DNA sequences and to monitor dynamic changes in subnuclear positioning as well as interactions with functional nuclear structures during cell cycle progression and cellular differentiation.

  11. Unified Deep Learning Architecture for Modeling Biology Sequence.

    Science.gov (United States)

    Wu, Hongjie; Cao, Chengyuan; Xia, Xiaoyan; Lu, Qiang

    2017-10-09

    Prediction of the spatial structure or function of biological macromolecules based on their sequence remains an important challenge in bioinformatics. When modeling biological sequences using traditional sequencing models, characteristics, such as long-range interactions between basic units, the complicated and variable output of labeled structures, and the variable length of biological sequences, usually lead to different solutions on a case-by-case basis. This study proposed the use of bidirectional recurrent neural networks based on long short-term memory or a gated recurrent unit to capture long-range interactions by designing the optional reshape operator to adapt to the diversity of the output labels and implementing a training algorithm to support the training of sequence models capable of processing variable-length sequences. Additionally, the merge and pooling operators enhanced the ability to capture short-range interactions between basic units of biological sequences. The proposed deep-learning model and its training algorithm might be capable of solving currently known biological sequence-modeling problems through the use of a unified framework. We validated our model on one of the most difficult biological sequence-modeling problems currently known, with our results indicating the ability of the model to obtain predictions of protein residue interactions that exceeded the accuracy of current popular approaches by 10% based on multiple benchmarks.

  12. A switched energy saving position controller for variable-pressure electro-hydraulic servo systems.

    Science.gov (United States)

    Tivay, Ali; Zareinejad, Mohammad; Rezaei, S Mehdi; Baghestan, Keivan

    2014-07-01

    The electro-hydraulic servo system (EHSS) demonstrates a relatively low level of efficiency compared to other available actuation methods. The objective of this paper is to increase this efficiency by introducing a variable supply pressure into the system and controlling this pressure during the task of position tracking. For this purpose, an EHSS structure with controllable supply pressure is proposed and its dynamic model is derived from the basic laws of physics. A switching control structure is then proposed to control both the supply pressure and the cylinder position at the same time, in a way that reduces the overall energy consumption of the system. The stability of the proposed switching control system is guaranteed by proof, and its performance is verified by experimental testing. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  13. Simple sequence repeat (SSR)-based genetic variability among ...

    African Journals Online (AJOL)

    The objective of this study was to compare if simple sequence repeat (SSR) markers could correctly identify peanut genotypes with difference in specific leaf weight (SLW) and relative water content (RWC). Four peanut genotypes and two water regimes (FC and 1/3 available water; 1/3 AW) were arranged in factorial ...

  14. Transcriptome Sequencing of Diverse Peanut (Arachis Wild Species and the Cultivated Species Reveals a Wealth of Untapped Genetic Variability

    Directory of Open Access Journals (Sweden)

    Ratan Chopra

    2016-12-01

    Full Text Available To test the hypothesis that the cultivated peanut species possesses almost no molecular variability, we sequenced a diverse panel of 22 Arachis accessions representing Arachis hypogaea botanical classes, A-, B-, and K- genome diploids, a synthetic amphidiploid, and a tetraploid wild species. RNASeq was performed on pools of three tissues, and de novo assembly was performed. Realignment of individual accession reads to transcripts of the cultivar OLin identified 306,820 biallelic SNPs. Among 10 naturally occurring tetraploid accessions, 40,382 unique homozygous SNPs were identified in 14,719 contigs. In eight diploid accessions, 291,115 unique SNPs were identified in 26,320 contigs. The average SNP rate among the 10 cultivated tetraploids was 0.5, and among eight diploids was 9.2 per 1000 bp. Diversity analysis indicated grouping of diploids according to genome classification, and cultivated tetraploids by subspecies. Cluster analysis of variants indicated that sequences of B genome species were the most similar to the tetraploids, and the next closest diploid accession belonged to the A genome species. A subset of 66 SNPs selected from the dataset was validated; of 782 SNP calls, 636 (81.32% were confirmed using an allele-specific discrimination assay. We conclude that substantial genetic variability exists among wild species. Additionally, significant but lesser variability at the molecular level occurs among accessions of the cultivated species. This survey is the first to report significant SNP level diversity among transcripts, and may explain some of the phenotypic differences observed in germplasm surveys. Understanding SNP variants in the Arachis accessions will benefit in developing markers for selection.

  15. Transcriptional analysis of the HeT-A retrotransposon in mutant and wild type stocks reveals high sequence variability at Drosophila telomeres and other unusual features

    Directory of Open Access Journals (Sweden)

    Piñeyro David

    2011-11-01

    Full Text Available Abstract Background Telomere replication in Drosophila depends on the transposition of a domesticated retroelement, the HeT-A retrotransposon. The sequence of the HeT-A retrotransposon changes rapidly resulting in differentiated subfamilies. This pattern of sequence change contrasts with the essential function with which the HeT-A is entrusted and brings about questions concerning the extent of sequence variability, the telomere contribution of different subfamilies, and whether wild type and mutant Drosophila stocks show different HeT-A scenarios. Results A detailed study on the variability of HeT-A reveals that both the level of variability and the number of subfamilies are higher than previously reported. Comparisons between GIII, a strain with longer telomeres, and its parental strain Oregon-R indicate that both strains have the same set of HeT-A subfamilies. Finally, the presence of a highly conserved splicing pattern only in its antisense transcripts indicates a putative regulatory, functional or structural role for the HeT-A RNA. Interestingly, our results also suggest that most HeT-A copies are actively expressed regardless of which telomere and where in the telomere they are located. Conclusions Our study demonstrates how the HeT-A sequence changes much faster than previously reported resulting in at least nine different subfamilies most of which could actively contribute to telomere extension in Drosophila. Interestingly, the only significant difference observed between Oregon-R and GIII resides in the nature and proportion of the antisense transcripts, suggesting a possible mechanism that would in part explain the longer telomeres of the GIII stock.

  16. Paraxial design of an optical element with variable focal length and fixed position of principal planes.

    Science.gov (United States)

    Mikš, Antonín; Novák, Pavel

    2018-05-10

    In this article, we analyze the problem of the paraxial design of an active optical element with variable focal length, which maintains the positions of its principal planes fixed during the change of its optical power. Such optical elements are important in the process of design of complex optical systems (e.g., zoom systems), where the fixed position of principal planes during the change of optical power is essential for the design process. The proposed solution is based on the generalized membrane tunable-focus fluidic lens with several membrane surfaces.

  17. An efficient binomial model-based measure for sequence comparison and its application.

    Science.gov (United States)

    Liu, Xiaoqing; Dai, Qi; Li, Lihua; He, Zerong

    2011-04-01

    Sequence comparison is one of the major tasks in bioinformatics, which could serve as evidence of structural and functional conservation, as well as of evolutionary relations. There are several similarity/dissimilarity measures for sequence comparison, but challenges remains. This paper presented a binomial model-based measure to analyze biological sequences. With help of a random indicator, the occurrence of a word at any position of sequence can be regarded as a random Bernoulli variable, and the distribution of a sum of the word occurrence is well known to be a binomial one. By using a recursive formula, we computed the binomial probability of the word count and proposed a binomial model-based measure based on the relative entropy. The proposed measure was tested by extensive experiments including classification of HEV genotypes and phylogenetic analysis, and further compared with alignment-based and alignment-free measures. The results demonstrate that the proposed measure based on binomial model is more efficient.

  18. Transcriptome sequencing and positive selected genes analysis of Bombyx mandarina.

    Directory of Open Access Journals (Sweden)

    Tingcai Cheng

    Full Text Available The wild silkworm Bombyx mandarina is widely believed to be an ancestor of the domesticated silkworm, Bombyx mori. Silkworms are often used as a model for studying the mechanism of species domestication. Here, we performed transcriptome sequencing of the wild silkworm using an Illumina HiSeq2000 platform. We produced 100,004,078 high-quality reads and assembled them into 50,773 contigs with an N50 length of 1764 bp and a mean length of 941.62 bp. A total of 33,759 unigenes were identified, with 12,805 annotated in the Nr database, 8273 in the Pfam database, and 9093 in the Swiss-Prot database. Expression profile analysis found significant differential expression of 1308 unigenes between the middle silk gland (MSG and posterior silk gland (PSG. Three sericin genes (sericin 1, sericin 2, and sericin 3 were expressed specifically in the MSG and three fibroin genes (fibroin-H, fibroin-L, and fibroin/P25 were expressed specifically in the PSG. In addition, 32,297 Single-nucleotide polymorphisms (SNPs and 361 insertion-deletions (INDELs were detected. Comparison with the domesticated silkworm p50/Dazao identified 5,295 orthologous genes, among which 400 might have experienced or to be experiencing positive selection by Ka/Ks analysis. These data and analyses presented here provide insights into silkworm domestication and an invaluable resource for wild silkworm genomics research.

  19. Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

    Directory of Open Access Journals (Sweden)

    Giovanna Sattin

    Full Text Available Telomeres are guanine-rich sequences that protect the ends of chromosomes. These regions can fold into G-quadruplex structures and their stabilization by G-quadruplex ligands has been employed as an anticancer strategy. Genetic analysis in human telomeres revealed extensive allelic variation restricted to loop bases, indicating that the variant telomeric sequences maintain the ability to fold into G-quadruplex. To assess the effect of mutations in loop bases on G-quadruplex folding and stability, we performed a comprehensive analysis of mutant telomeric sequences by spectroscopic techniques, molecular dynamics simulations and gel electrophoresis. We found that when the first position in the loop was mutated from T to C or A the resulting structure adopted a less stable antiparallel topology; when the second position was mutated to C or A, lower thermal stability and no evident conformational change were observed; in contrast, substitution of the third position from A to C induced a more stable and original hybrid conformation, while mutation to T did not significantly affect G-quadruplex topology and stability. Our results indicate that allelic variations generate G-quadruplex telomeric structures with variable conformation and stability. This aspect needs to be taken into account when designing new potential anticancer molecules.

  20. Rapid-Sequence Intubation in the Left-Lateral Tilt Position in a Pregnant Woman with Premature Placental Abruption Utilizing a Videolaryngoscope

    Directory of Open Access Journals (Sweden)

    Kenta Nakao

    2015-04-01

    Full Text Available Case - A 24-year-old pregnant woman was admitted to our hospital with decreased fetal heart rate. Obstetric examination revealed premature placental abruption; emergent caesarean section was planned under general anesthesia. On entering the operating room, the patient showed severe vital sign deterioration (blood pressure, 75/45 mm Hg; heart rate, 142 beats per minute. As left uterine displacement may worsen the premature placental abruption, the patient was placed in the left-lateral tilt position by rotating the operating table to release compression on the inferior vena cava by theuterus. To avoid circulatory collapse, rapid-sequence intubation was performed in this position. Tracheal intubation was performed with the Pentax-AWS Airwayscope (AWS videolaryngoscope, AWS; HOYA, Japan to obtain a good laryngeal view and minimize stress from laryngoscopy. After sufficient oxygenation, 120 mg of thiopental was administered. A second anesthesiologist performed cricoid pressure and 50 mg of rocuronium was administered after confirming loss of consciousness. This was followed by insertion of the AWS with a thin intlock into the mouth. Tracheal intubation was performed uneventfully. Discussion - Rapid-sequence intubation in the left-lateral tilted position with the AWS videolaryngoscope may be beneficial for pregnant women with vital sign deterioration.

  1. S1 satellite DNA repetitive units display identical structure and overall variability in all Anatolian brown frog taxa.

    Science.gov (United States)

    Picariello, Orfeo; Feliciello, Isidoro; Chinali, Gianni

    2016-02-01

    S1 satellite DNA from Palearctic brown frogs has a species-specific structure in all European species. We characterized S1 satellite DNA from the Anatolian brown frogs Rana macrocnemis, R. camerani, and R. holtzi in order to define their taxonomic rank and the structure of this satellite in this frog lineage. Southern blots of genomic DNA digested with KpnI, EcoRV, NdeI, NheI, or StuI produced the same pattern of satellite DNA bands. Moreover, quantitative dot blots showed that this satellite DNA accounts for 0.1 % of the genome in all taxa. Analysis of the overall genomic variability of the S1a repeat sequence in specimens from various populations demonstrated that this repetitive unit also has the same size (476 bp), the same most common sequence (MCS) and the same overall variability in all three taxa, and also in R. macrocnemis tavasensis. The S1a repetitive unit presents three deletions of 9, 8 and 1 bp compared to the 494-bp S1a repeat from European frogs. The S1a MCS has three variable positions (sequence WWTK in positions 183-186), due to the presence of two repeat subpopulations with motifs AATG and WWTT in all taxa. Unlike previously analyzed mitochondrial and nuclear sequences that show considerable variations among these taxa, no difference could be detected in the structure and variability of the S1 satellite repetitive units. This suggests that these taxa should belong to a single species. Our results indicate that this satellite DNA variety probably formed when the Anatolian lineage radiated from common ancestor about 4 mya, and since then has maintained its structure in all four taxa examined.

  2. Testing predictive models of positive and negative affect with psychosocial, acculturation, and coping variables in a multiethnic undergraduate sample.

    Science.gov (United States)

    Kuo, Ben Ch; Kwantes, Catherine T

    2014-01-01

    Despite the prevalence and popularity of research on positive and negative affect within the field of psychology, there is currently little research on affect involving the examination of cultural variables and with participants of diverse cultural and ethnic backgrounds. To the authors' knowledge, currently no empirical studies have comprehensively examined predictive models of positive and negative affect based specifically on multiple psychosocial, acculturation, and coping variables as predictors with any sample populations. Therefore, the purpose of the present study was to test the predictive power of perceived stress, social support, bidirectional acculturation (i.e., Canadian acculturation and heritage acculturation), religious coping and cultural coping (i.e., collective, avoidance, and engagement coping) in explaining positive and negative affect in a multiethnic sample of 301 undergraduate students in Canada. Two hierarchal multiple regressions were conducted, one for each affect as the dependent variable, with the above described predictors. The results supported the hypotheses and showed the two overall models to be significant in predicting affect of both kinds. Specifically, a higher level of positive affect was predicted by a lower level of perceived stress, less use of religious coping, and more use of engagement coping in dealing with stress by the participants. Higher level of negative affect, however, was predicted by a higher level of perceived stress and more use of avoidance coping in responding to stress. The current findings highlight the value and relevance of empirically examining the stress-coping-adaptation experiences of diverse populations from an affective conceptual framework, particularly with the inclusion of positive affect. Implications and recommendations for advancing future research and theoretical works in this area are considered and presented.

  3. Relations between segmental and motor variability in prosodically complex nonword sequences.

    Science.gov (United States)

    Goffman, Lisa; Gerken, Louann; Lucchesi, Julie

    2007-04-01

    To assess how prosodic prominence and hierarchical foot structure influence segmental and articulatory aspects of speech production, specifically segmental accuracy and variability, and oral movement trajectory variability. Thirty individuals participated: 10 young adults, 10 children who are normally developing, and 10 children diagnosed with specific language impairment. Segmental error and segmental variability and movement trajectory variability were compared in low and high prosodic prominence conditions (i.e., strong and weak syllables) and in different prosodic foot structures. Between-participants findings were that both groups of children showed more segmental error and segmental variability and more movement trajectory variability than did adults. A similar within-participant pattern of results was observed for all 3 groups. Prosodic prominence influenced both segmental and motor levels of analysis, with weak syllables produced less accurately and with more lip and jaw movement trajectory variability than strong syllables. However, hierarchical foot structure affected segmental but not motor measures of speech production accuracy and variability. Motor and segmental variables were not consistently aligned. This pattern of results has clinical implications because inferences about motor variability may not directly follow from observations of segmental variability.

  4. The association of heavy and light chain variable domains in antibodies: implications for antigen specificity.

    KAUST Repository

    Chailyan, Anna

    2011-06-28

    The antigen-binding site of immunoglobulins is formed by six regions, three from the light and three from the heavy chain variable domains, which, on association of the two chains, form the conventional antigen-binding site of the antibody. The mode of interaction between the heavy and light chain variable domains affects the relative position of the antigen-binding loops and therefore has an effect on the overall conformation of the binding site. In this article, we analyze the structure of the interface between the heavy and light chain variable domains and show that there are essentially two different modes for their interaction that can be identified by the presence of key amino acids in specific positions of the antibody sequences. We also show that the different packing modes are related to the type of recognized antigen.

  5. Position error compensation via a variable reluctance sensor applied to a Hybrid Vehicle Electric machine.

    Science.gov (United States)

    Bucak, Ihsan Ömür

    2010-01-01

    In the automotive industry, electromagnetic variable reluctance (VR) sensors have been extensively used to measure engine position and speed through a toothed wheel mounted on the crankshaft. In this work, an application that already uses the VR sensing unit for engine and/or transmission has been chosen to infer, this time, the indirect position of the electric machine in a parallel Hybrid Electric Vehicle (HEV) system. A VR sensor has been chosen to correct the position of the electric machine, mainly because it may still become critical in the operation of HEVs to avoid possible vehicle failures during the start-up and on-the-road, especially when the machine is used with an internal combustion engine. The proposed method uses Chi-square test and is adaptive in a sense that it derives the compensation factors during the shaft operation and updates them in a timely fashion.

  6. Position Error Compensation via a Variable Reluctance Sensor Applied to a Hybrid Vehicle Electric Machine

    Directory of Open Access Journals (Sweden)

    İhsan Ömür Bucak

    2010-03-01

    Full Text Available In the automotive industry, electromagnetic variable reluctance (VR sensors have been extensively used to measure engine position and speed through a toothed wheel mounted on the crankshaft. In this work, an application that already uses the VR sensing unit for engine and/or transmission has been chosen to infer, this time, the indirect position of the electric machine in a parallel Hybrid Electric Vehicle (HEV system. A VR sensor has been chosen to correct the position of the electric machine, mainly because it may still become critical in the operation of HEVs to avoid possible vehicle failures during the start-up and on-the-road, especially when the machine is used with an internal combustion engine. The proposed method uses Chi-square test and is adaptive in a sense that it derives the compensation factors during the shaft operation and updates them in a timely fashion.

  7. Performance Assessment of Full-Scale Wastewater Treatment Plants Based on Seasonal Variability of Microbial Communities via High-Throughput Sequencing.

    Directory of Open Access Journals (Sweden)

    Tang Liu

    Full Text Available Microbial communities of activated sludge (AS play a key role in the performance of wastewater treatment processes. However, seasonal variability of microbial population in varying AS-based processes has been poorly correlated with operation of full-scale wastewater treatment systems (WWTSs. In this paper, significant seasonal variability of AS microbial communities in eight WWTSs located in the city of Guangzhou were revealed in terms of 16S rRNA-based Miseq sequencing. Furthermore, variation redundancy analysis (RDA demonstrated that the microbial community compositions closely correlated with WWTS operation parameters such as temperature, BOD, NH4+-N and TN. Consequently, support vector regression models which reasonably predicted effluent BOD, SS and TN in WWTSs were established based on microbial community compositions. This work provided an alternative tool for rapid assessment on performance of full-scale wastewater treatment plants.

  8. Characterization of race 65 of Colletotrichum lindemuthianum by sequencing ITS regions

    Directory of Open Access Journals (Sweden)

    Marcela Coelho

    2016-09-01

    Full Text Available The present work aimed characterize isolates of C. lindemuthianum race 65 from different regions in Brazil by ITS sequencing. A total of 17 isolates of race 65, collected in the states of Mato Grosso, Minas Gerais, Paraná, Santa Catarina and São Paulo, were studied. Analysis of the sequences of isolates 8, 9, 12, 14 and 15 revealed the presence of two single nucleotide polymorphisms (SNPs in the ITS1 region at the same positions. These isolates, when analyzed together with the sequence of isolate 17, revealed a SNP in the ITS2 region. The highest genetic dissimilarity, observed between isolates 11 and  3 and between isolates 11 and 10, was 0.772. In turn, isolates 7 and 2 were the most similar, with a value of 0.002 for genetic distance. The phylogenetic tree obtained based on the sequences of the ITS1 and ITS2 regions revealed the formation of two groups, one with a subgroup. The results reveal high molecular variability among isolates of race 65 of C. lindemuthianum.

  9. An in vitro-identified high-affinity nucleosome-positioning signal is capable of transiently positioning a nucleosome in vivo

    Directory of Open Access Journals (Sweden)

    Gracey Lia E

    2010-07-01

    Full Text Available Abstract Background The physiological function of eukaryotic DNA occurs in the context of nucleosomal arrays that can expose or obscure defined segments of the genome. Certain DNA sequences are capable of strongly positioning a nucleosome in vitro, suggesting the possibility that favorable intrinsic signals might reproducibly structure chromatin segments. As high-throughput sequencing analyses of nucleosome coverage in vitro and in vivo have become possible, a vigorous debate has arisen over the degree to which intrinsic DNA:nucleosome affinities orchestrate the in vivo positions of nucleosomes, thereby controlling physical accessibility of specific sequences in DNA. Results We describe here the in vivo consequences of placing a synthetic high-affinity nucleosome-positioning signal, the 601 sequence, into a DNA plasmid vector in mice. Strikingly, the 601 sequence was sufficient to position nucleosomes during an early phase after introduction of the DNA into the mice (when the plasmid vector transgene was active. This positioning capability was transient, with a loss of strong positioning at a later time point when the transgenes had become silent. Conclusions These results demonstrate an ability of DNA sequences selected solely for nucleosome affinity to organize chromatin in vivo, and the ability of other mechanisms to overcome these interactions in a dynamic nuclear environment.

  10. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    Science.gov (United States)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  11. Immunoglobulin variable region sequences of two human monoclonal antibodies directed to an onco-developmental carbohydrate antigen, lactotetraosylceramide (LcOse4Cer).

    Science.gov (United States)

    Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M

    1993-11-01

    A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.

  12. Genetic variation of the greenhouse whitefly, Trialeurodes vaporariorum (Hemiptera: Aleyrodidae), among populations from Serbia and neighbouring countries, as inferred from COI sequence variability.

    Science.gov (United States)

    Prijović, M; Skaljac, M; Drobnjaković, T; Zanić, K; Perić, P; Marčić, D; Puizina, J

    2014-06-01

    The greenhouse whitefly Trialeurodes vaporariorum Westwood, 1856 (Hemiptera: Aleyrodidae) is an invasive and highly polyphagous phloem-feeding pest of vegetables and ornamentals. Trialeurodes vaporariorum causes serious damage due to direct feeding and transmits several important plant viruses. Excessive use of insecticides has resulted in significantly reduced levels of susceptibility of various T. vaporariorum populations. To determine the genetic variability within and among populations of T. vaporariorum from Serbia and to explore their genetic relatedness with other T. vaporariorum populations, we analysed the mitochondrial cytochrome c oxidase I (COI) sequences of 16 populations from Serbia and six neighbouring countries: Montenegro (three populations), Macedonia (one population) and Croatia (two populations), for a total of 198 analysed specimens. A low overall level of sequence divergence and only five variable nucleotides and six haplotypes were found. The most frequent haplotype, H1, was identified in all Serbian populations and in all specimens from distant localities in Croatia and Macedonia. The COI sequence data that was retrieved from GenBank and the data from our study indicated that H1 is the most globally widespread T. vaporariorum haplotype. A lack of spatial genetic structure among the studied T. vaporariorum populations, as well as two demographic tests that we performed (Tajima's D value and Fu's Fs statistics), indicate a recent colonisation event and population growth. Phylogenetic analyses of the COI haplotypes in this study and other T. vaporariorum haplotypes that were retrieved from GenBank were performed using Bayesian inference and median-joining (MJ) network analysis. Two major haplogroups with only a single unique nucleotide difference were found: haplogroup 1 (containing the five Serbian haplotypes and those previously identified in India, China, the Netherlands, the United Kingdom, Morocco, Reunion and the USA) and haplogroup 3

  13. Influence of Flow Sequencing Attributed to Climate Change and Climate Variability on the Assessment of Water-dependent Ecosystem Outcomes

    Science.gov (United States)

    Wang, J.; Nathan, R.; Horne, A.

    2017-12-01

    Traditional approaches to characterize water-dependent ecosystem outcomes in response to flow have been based on time-averaged hydrological indicators, however there is increasing recognition for the need to characterize ecological processes that are highly dependent on the sequencing of flow conditions (i.e. floods and droughts). This study considers the representation of flow regimes when considering assessment of ecological outcomes, and in particular, the need to account for sequencing and variability of flow. We conducted two case studies - one in the largely unregulated Ovens River catchment and one in the highly regulated Murray River catchment (both located in south-eastern Australia) - to explore the importance of flow sequencing to the condition of a typical long-lived ecological asset in Australia, the River Red Gum forests. In the first, the Ovens River case study, the implications of representing climate change using different downscaling methods (annual scaling, monthly scaling, quantile mapping, and weather generator method) on the sequencing of flows and resulting ecological outcomes were considered. In the second, the Murray River catchment, sequencing within a historic drought period was considered by systematically making modest adjustments on an annual basis to the hydrological records. In both cases, the condition of River Red Gum forests was assessed using an ecological model that incorporates transitions between ecological conditions in response to sequences of required flow components. The results of both studies show the importance of considering how hydrological alterations are represented when assessing ecological outcomes. The Ovens case study showed that there is significant variation in the predicted ecological outcomes when different downscaling techniques are applied. Similarly, the analysis in the Murray case study showed that the drought as it historically occurred provided one of the best possible outcomes for River Red Gum

  14. Step out - Step in Sequencing Games

    NARCIS (Netherlands)

    Musegaas, M.; Borm, P.E.M.; Quant, M.

    2014-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out - Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order.

  15. A variable geometry truss manipulator for positioning large payloads

    International Nuclear Information System (INIS)

    Stoughton, R.S.; Tucker, J.C.; Horner, C.G.

    1995-02-01

    A major thrust within the Department of Energy's (DOE) Decontamination and Dismantling (D ampersand D) Robotics program is the development of a Selective Equipment Removal System (SERS). SERS will consist of a mobile vehicle, a Dual-Arm Work Module (DAWM), and a deployment manipulator capable of extending the DAWM up to 6.096m (20) from the vehicle. The DAWM, built by RedZone Robotics, includes two Schilling Titan II manipulators, a unique five degree-of-freedom (DOF) module for positioning/orienting the two Schilling arms, and a massive steel backplane to maintain structural rigidity. Together with its payload, the DAWM weighs about 975 kg (2150 pounds). In order to accurately position the DAWM, the Pacific Northwest Laboratory (PNL) together with the National Aeronautics and Space Administration's Langley Research Center (NASA LARC) are developing a deployment manipulator, which includes two double-octahedral Variable Geometry Truss (VGT) modules connected with a static truss section. The entire SERS system (Figure 1) will include the mobile vehicle, a 2-DOF base actuation system (waist rotate and pitch) with an output link approximately 2.134m (7) in length, the VGT system and the DAWM. The VGT system (Figure 2) consists of a 1.067m (42) diameter (∼1.346m (53) long) base VGT, which mounts to the end of the output link of the base actuation system, a 1.524m (60) long static truss section which tapers from 1.067m (42) diameter at its base to 0.8128m (32) diameter at the end, and a 0.8128m (32) diameter (∼1.0922m (43) long) tip VGT to which the DAWM is mounted. The stiffness of the VGT system is such that with the base VGT mounted to a rigid base and the VGT system oriented horizontally (worst case), the static deflection of the DAWM together with full payload will be less than 0.0254m

  16. Maximum Lateness Scheduling on Two-Person Cooperative Games with Variable Processing Times and Common Due Date

    OpenAIRE

    Liu, Peng; Wang, Xiaoli

    2017-01-01

    A new maximum lateness scheduling model in which both cooperative games and variable processing times exist simultaneously is considered in this paper. The job variable processing time is described by an increasing or a decreasing function dependent on the position of a job in the sequence. Two persons have to cooperate in order to process a set of jobs. Each of them has a single machine and their processing cost is defined as the minimum value of maximum lateness. All jobs have a common due ...

  17. Full Genome Sequencing Reveals New Southern African Territories Genotypes Bringing Us Closer to Understanding True Variability of Foot-and-Mouth Disease Virus in Africa

    Science.gov (United States)

    Lasecka-Dykes, Lidia; Wright, Caroline F.; Di Nardo, Antonello; Logan, Grace; Mioulet, Valerie; Jackson, Terry; Tuthill, Tobias J.; Knowles, Nick J.; King, Donald P.

    2018-01-01

    Foot-and-mouth disease virus (FMDV) causes a highly contagious disease of cloven-hooved animals that poses a constant burden on farmers in endemic regions and threatens the livestock industries in disease-free countries. Despite the increased number of publicly available whole genome sequences, FMDV data are biased by the opportunistic nature of sampling. Since whole genomic sequences of Southern African Territories (SAT) are particularly underrepresented, this study sequenced 34 isolates from eastern and southern Africa. Phylogenetic analyses revealed two novel genotypes (that comprised 8/34 of these SAT isolates) which contained unusual 5′ untranslated and non-structural encoding regions. While recombination has occurred between these sequences, phylogeny violation analyses indicated that the high degree of sequence diversity for the novel SAT genotypes has not solely arisen from recombination events. Based on estimates of the timing of ancestral divergence, these data are interpreted as being representative of un-sampled FMDV isolates that have been subjected to geographical isolation within Africa by the effects of the Great African Rinderpest Pandemic (1887–1897), which caused a mass die-out of FMDV-susceptible hosts. These findings demonstrate that further sequencing of African FMDV isolates is likely to reveal more unusual genotypes and will allow for better understanding of natural variability and evolution of FMDV. PMID:29652800

  18. Step out-step in sequencing games

    NARCIS (Netherlands)

    Musegaas, Marieke; Borm, Peter; Quant, Marieke

    2015-01-01

    In this paper a new class of relaxed sequencing games is introduced: the class of Step out–Step in sequencing games. In this relaxation any player within a coalition is allowed to step out from his position in the processing order and to step in at any position later in the processing order. First,

  19. Maximum Lateness Scheduling on Two-Person Cooperative Games with Variable Processing Times and Common Due Date

    Directory of Open Access Journals (Sweden)

    Peng Liu

    2017-01-01

    Full Text Available A new maximum lateness scheduling model in which both cooperative games and variable processing times exist simultaneously is considered in this paper. The job variable processing time is described by an increasing or a decreasing function dependent on the position of a job in the sequence. Two persons have to cooperate in order to process a set of jobs. Each of them has a single machine and their processing cost is defined as the minimum value of maximum lateness. All jobs have a common due date. The objective is to maximize the multiplication of their rational positive cooperative profits. A division of those jobs should be negotiated to yield a reasonable cooperative profit allocation scheme acceptable to them. We propose the sufficient and necessary conditions for the problems to have positive integer solution.

  20. Nucleosome Positioning and Epigenetics

    Science.gov (United States)

    Schwab, David; Bruinsma, Robijn

    2008-03-01

    The role of chromatin structure in gene regulation has recently taken center stage in the field of epigenetics, phenomena that change the phenotype without changing the DNA sequence. Recent work has also shown that nucleosomes, a complex of DNA wrapped around a histone octamer, experience a sequence dependent energy landscape due to the variation in DNA bend stiffness with sequence composition. In this talk, we consider the role nucleosome positioning might play in the formation of heterochromatin, a compact form of DNA generically responsible for gene silencing. In particular, we discuss how different patterns of nucleosome positions, periodic or random, could either facilitate or suppress heterochromatin stability and formation.

  1. Heart rate variability in the standing position reflects training adaptation in professional soccer players.

    Science.gov (United States)

    Ravé, Guillaume; Fortrat, Jacques-Olivier

    2016-08-01

    To show that heart rate variability (HRV) in the standing position better reflects the way in which athletes adapt to training in so-called intermittent sports than the indicator of resting parasympathetic tone usually employed in endurance sports. Twenty professional soccer players (intermittent sport) took part in a 5-week training session divided into three successive periods: "Warm-up", "Intensive training" and "Tapering". At the beginning and end of each of the three periods, a stand test was carried out and the heart rate was recorded, beat by beat (Polar Team 2). We analysed HRV to determine the indicator mostly used to demonstrate training adaptation in endurance sports (lnRMSSD supine, natural logarithm of root mean square of the successive differences) as well as indicators obtained by means of spectral analysis in both supine and standing position. A decrease in heart rate was observed in the supine position at rest during training (-5.2 ± 1.3 bpm) while lnRMSSD and spectral analysis indicators remained unchanged. The "Warm-up" caused an increase in spectral analysis total power in standing position which was further highlighted by "Tapering" (3.39 ± 0.09, 3.61 ± 0.08 and 3.65 ± 0.09 log ms(2), respectively). However, the autonomic changes are probably more complex than a change in autonomic activity or balance since spectral analysis autonomic indicators remained unchanged. HRV in the standing position could monitor training adaptation in intermittent sports contrary to the indicator usually employed in endurance sports. However, the significance of the HRV change in the standing position during training remains unclear.

  2. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

    Energy Technology Data Exchange (ETDEWEB)

    Zemla, A; Lang, D; Kostova, T; Andino, R; Zhou, C

    2010-11-29

    residues at a given sequence position.

  3. Analysis of the variability of occlusal function patterns in masticatory movement--use of the GEMAS software.

    Science.gov (United States)

    Kordass, B

    2006-04-01

    Individual masticatory patterns are similar to chaotic tangles of tortuous paths and are characterized by variability. The analysis of such masticatory patterns is therefore difficult. The new GEMAS software--Greifswald Movement Analyzing System--with which the variability of the masticatory function can be examined, is presented. Intersecting planes are placed through the orbit of the chewing cycles with which it is possible to wonder from the intercuspal position up to the maximum mouth-opening position of the masticatory pattern. The opening and closing points are displayed in different colors. Zones where masticatory paths converge or diverge can be determined, including the fan or funnel-shaped entering and exiting movements close to the centric position and the extent of their spread. A special diagram visualizes the rhythmic sequence of entering and subsequent exiting movement. The relation between restricted variability or monotony and forms of disease of the masticatory system is indicated by reference to case examples. The more monotonous or stereotyped the chewing cycles are, the higher is the risk of permanent wear of anatomical structures. Attention should therefore also be paid to variability in the individual occlusal surface design of dental restorations.

  4. A massively parallel sequencing approach uncovers ancient origins and high genetic variability of endangered Przewalski's horses.

    Science.gov (United States)

    Goto, Hiroki; Ryder, Oliver A; Fisher, Allison R; Schultz, Bryant; Kosakovsky Pond, Sergei L; Nekrutenko, Anton; Makova, Kateryna D

    2011-01-01

    The endangered Przewalski's horse is the closest relative of the domestic horse and is the only true wild horse species surviving today. The question of whether Przewalski's horse is the direct progenitor of domestic horse has been hotly debated. Studies of DNA diversity within Przewalski's horses have been sparse but are urgently needed to ensure their successful reintroduction to the wild. In an attempt to resolve the controversy surrounding the phylogenetic position and genetic diversity of Przewalski's horses, we used massively parallel sequencing technology to decipher the complete mitochondrial and partial nuclear genomes for all four surviving maternal lineages of Przewalski's horses. Unlike single-nucleotide polymorphism (SNP) typing usually affected by ascertainment bias, the present method is expected to be largely unbiased. Three mitochondrial haplotypes were discovered-two similar ones, haplotypes I/II, and one substantially divergent from the other two, haplotype III. Haplotypes I/II versus III did not cluster together on a phylogenetic tree, rejecting the monophyly of Przewalski's horse maternal lineages, and were estimated to split 0.117-0.186 Ma, significantly preceding horse domestication. In the phylogeny based on autosomal sequences, Przewalski's horses formed a monophyletic clade, separate from the Thoroughbred domestic horse lineage. Our results suggest that Przewalski's horses have ancient origins and are not the direct progenitors of domestic horses. The analysis of the vast amount of sequence data presented here suggests that Przewalski's and domestic horse lineages diverged at least 0.117 Ma but since then have retained ancestral genetic polymorphism and/or experienced gene flow.

  5. Nonparametric combinatorial sequence models.

    Science.gov (United States)

    Wauthier, Fabian L; Jordan, Michael I; Jojic, Nebojsa

    2011-11-01

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This article presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three biological sequence families which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution over sequence representations induced by the prior. By integrating out the posterior, our method compares favorably to leading binding predictors.

  6. Sequences of emotional distress expressed by clients and acknowledged by therapists: are they associated more with some therapists than others?

    Science.gov (United States)

    Viney, L L

    1994-11-01

    When clients come to psychotherapy they are distressed, this distress usually being expressed in the form of anxiety, hostility, depression and helplessness. This study explored the sequences of emotional distress expressed by clients and acknowledged by therapists, and examined their associations with other factors. The transcripts of five therapists (two single sessions each) were content-analysed: they used personal construct, client centered, rational-emotive, Gestalt and transactional analysis therapy. Log-linear analyses of appropriate contingency table cell frequencies were conducted to test associations between identified sequences and the two variables of therapist and timing of completion of the sequence. Therapist-client sequences of Anxiety-Anxiety, Anxiety-Hostility and Helplessness-Hostility were found to be associated more with the personal construct and client centred therapists than with the rational-emotive therapist. Client-therapist sequences of Anxiety-Anxiety, Helplessness-Anxiety and Helplessness-Helplessness were more often found with the client centred therapist than the other therapists. For most of these sequences timing had an effect, yet timing rarely interacted with the therapist variable. The findings are discussed in terms of their relevance to the theoretical positions represented, the shortcomings of the research and the value of this methodology in studies linking therapy process with outcome.

  7. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  8. Direct chloroplast sequencing: comparison of sequencing platforms and analysis tools for whole chloroplast barcoding.

    Directory of Open Access Journals (Sweden)

    Marta Brozynska

    Full Text Available Direct sequencing of total plant DNA using next generation sequencing technologies generates a whole chloroplast genome sequence that has the potential to provide a barcode for use in plant and food identification. Advances in DNA sequencing platforms may make this an attractive approach for routine plant identification. The HiSeq (Illumina and Ion Torrent (Life Technology sequencing platforms were used to sequence total DNA from rice to identify polymorphisms in the whole chloroplast genome sequence of a wild rice plant relative to cultivated rice (cv. Nipponbare. Consensus chloroplast sequences were produced by mapping sequence reads to the reference rice chloroplast genome or by de novo assembly and mapping of the resulting contigs to the reference sequence. A total of 122 polymorphisms (SNPs and indels between the wild and cultivated rice chloroplasts were predicted by these different sequencing and analysis methods. Of these, a total of 102 polymorphisms including 90 SNPs were predicted by both platforms. Indels were more variable with different sequencing methods, with almost all discrepancies found in homopolymers. The Ion Torrent platform gave no apparent false SNP but was less reliable for indels. The methods should be suitable for routine barcoding using appropriate combinations of sequencing platform and data analysis.

  9. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    Science.gov (United States)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  10. Next-generation sequencing indicates false-positive MRD results and better predicts prognosis after SCT in patients with childhood ALL.

    Science.gov (United States)

    Kotrova, M; van der Velden, V H J; van Dongen, J J M; Formankova, R; Sedlacek, P; Brüggemann, M; Zuna, J; Stary, J; Trka, J; Fronkova, E

    2017-07-01

    Minimal residual disease (MRD) monitoring via quantitative PCR (qPCR) detection of Ag receptor gene rearrangements has been the most sensitive method for predicting prognosis and making post-transplant treatment decisions for patients with ALL. Despite the broad clinical usefulness and standardization of this method, we and others have repeatedly reported the possibility of false-positive MRD results caused by massive B-lymphocyte regeneration after stem cell transplantation (SCT). Next-generation sequencing (NGS) enables precise and sensitive detection of multiple Ag receptor rearrangements, thus providing a more specific readout compared to qPCR. We investigated two cohorts of children with ALL who underwent SCT (30 patients and 228 samples). The first cohort consisted of 17 patients who remained in long-term CR after SCT despite having low MRD positivity (SCT monitoring using qPCR. Only one of 27 qPCR-positive samples was confirmed to be positive by NGS. Conversely, 10 of 15 samples with low qPCR-detected MRD positivity from 13 patients who subsequently relapsed were also confirmed to be positive by NGS (P=0.002). These data show that NGS has a better specificity in post-SCT ALL management and indicate that treatment interventions aimed at reverting impending relapse should not be based on qPCR only.

  11. Sequence analysis of Leukemia DNA

    Science.gov (United States)

    Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa

    2018-03-01

    Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.

  12. The convergence of the order sequence and the solution function sequence on fractional partial differential equation

    Science.gov (United States)

    Rusyaman, E.; Parmikanti, K.; Chaerani, D.; Asefan; Irianingsih, I.

    2018-03-01

    One of the application of fractional ordinary differential equation is related to the viscoelasticity, i.e., a correlation between the viscosity of fluids and the elasticity of solids. If the solution function develops into function with two or more variables, then its differential equation must be changed into fractional partial differential equation. As the preliminary study for two variables viscoelasticity problem, this paper discusses about convergence analysis of function sequence which is the solution of the homogenous fractional partial differential equation. The method used to solve the problem is Homotopy Analysis Method. The results show that if given two real number sequences (αn) and (βn) which converge to α and β respectively, then the solution function sequences of fractional partial differential equation with order (αn, βn) will also converge to the solution function of fractional partial differential equation with order (α, β).

  13. Perfiles de organizaciones positivas. Análisis de características percibidas según variables individuales, organizacionales y de resultado (Positive organization profiles. Analysis of perceived characteristics according to individual, organizational, and outcome variables

    Directory of Open Access Journals (Sweden)

    María Laura Lupano Perugini

    2016-08-01

    Full Text Available This study analysed the profiles of organizations based on employee perceptions of their workplace. The sample consisted of 459 Argentinian employees (232 men; average age, 36.3 years (SD = 11.7. The participants worked for public companies (17.2%, n = 79 or private companies (82.6%, n = 379. Most of them lived in Buenos Aires and surrounding areas (96.5%, n = 443. A protocol was used for data collection, in which the participants were asked to report positive and negative characteristics associated with their organization. A content analysis of the answers given by the participants was performed, from which different categories of characteristics were derived (e.g., work climate, commitment, values. Several multiple correspondence analyses were conducted to generate profiles according to individual variables (i.e., gender, age, and position, organizational variables (i.e., size, typology, and type, and outcome variables (i.e., performance and job satisfaction. One of the most significant profiles showed associations between the perception of positive characteristics, such as values and outcomes, and high levels of satisfaction and individual/organizational performance.

  14. Situational Variability of Means of Expression of Positive Emotions in Modern English

    Directory of Open Access Journals (Sweden)

    Alina K. Kisil

    2017-06-01

    Full Text Available The article investigates situational variability of means of expression of positive emotions in Modern English. This problem is topical for linguistics of emotions, pragma- and sociolinguistics. The author analyzes verbal, paraverbal and nonverbal means of expressing positive emotions of joy and surprise in three communicative registers: official, neutral and unofficial. These registers are singled out on the basis of situational context and participants of the situation. The investigation gave the author the opportunity to come to the conclusion that in the official register emotions are controlled and very often are subject to strategic purposes. They implement the upgrading strategy the aim of which is to give a high evaluation of the addressee and of everything what is happening. It stipulates the use of corresponding expressive words and word combinations, exclamatory sentences, repetitions and rhetorical questions. Paraverbal means include only light laughter and nonverbal – a smile, the expression of the eyes, nods and tangled breath. The range of the means in question is wider in the neutral register where the speaker can use such verbal means as interjections with long sounds, expletives, pauses, descriptions of own emotions. Such paraverbal means as the emotional color of the voice and its volume, intonation, different kinds of laughter and such nonverbal means as different kinds of smile, the expression of the face, gestures and movements are also used. Unofficial register is especially rich in means of expressing positive emotions. Besides means typical of other registers such verbal means as obscene lexicon, phrasal words and graphical means are used here. Paraverbal means include numerous verbs reflecting the volume of voice and nonverbal – rich mimic, friendly hugs and kisses.

  15. Automated cleaning and pre-processing of immunoglobulin gene sequences from high-throughput sequencing

    Directory of Open Access Journals (Sweden)

    Miri eMichaeli

    2012-12-01

    Full Text Available High throughput sequencing (HTS yields tens of thousands to millions of sequences that require a large amount of pre-processing work to clean various artifacts. Such cleaning cannot be performed manually. Existing programs are not suitable for immunoglobulin (Ig genes, which are variable and often highly mutated. This paper describes Ig-HTS-Cleaner (Ig High Throughput Sequencing Cleaner, a program containing a simple cleaning procedure that successfully deals with pre-processing of Ig sequences derived from HTS, and Ig-Indel-Identifier (Ig Insertion – Deletion Identifier, a program for identifying legitimate and artifact insertions and/or deletions (indels. Our programs were designed for analyzing Ig gene sequences obtained by 454 sequencing, but they are applicable to all types of sequences and sequencing platforms. Ig-HTS-Cleaner and Ig-Indel-Identifier have been implemented in Java and saved as executable JAR files, supported on Linux and MS Windows. No special requirements are needed in order to run the programs, except for correctly constructing the input files as explained in the text. The programs' performance has been tested and validated on real and simulated data sets.

  16. Molecular characterization of Giardia psittaci by multilocus sequence analysis.

    Science.gov (United States)

    Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi

    2012-12-01

    Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. a Continuous-Time Positive Linear System

    Directory of Open Access Journals (Sweden)

    Kyungsup Kim

    2013-01-01

    Full Text Available This paper discusses a computational method to construct positive realizations with sparse matrices for continuous-time positive linear systems with multiple complex poles. To construct a positive realization of a continuous-time system, we use a Markov sequence similar to the impulse response sequence that is used in the discrete-time case. The existence of the proposed positive realization can be analyzed with the concept of a polyhedral convex cone. We provide a constructive algorithm to compute positive realizations with sparse matrices of some positive systems under certain conditions. A sufficient condition for the existence of a positive realization, under which the proposed constructive algorithm works well, is analyzed.

  18. Extra-binomial variation approach for analysis of pooled DNA sequencing data

    Science.gov (United States)

    Wallace, Chris

    2012-01-01

    Motivation: The invention of next-generation sequencing technology has made it possible to study the rare variants that are more likely to pinpoint causal disease genes. To make such experiments financially viable, DNA samples from several subjects are often pooled before sequencing. This induces large between-pool variation which, together with other sources of experimental error, creates over-dispersed data. Statistical analysis of pooled sequencing data needs to appropriately model this additional variance to avoid inflating the false-positive rate. Results: We propose a new statistical method based on an extra-binomial model to address the over-dispersion and apply it to pooled case-control data. We demonstrate that our model provides a better fit to the data than either a standard binomial model or a traditional extra-binomial model proposed by Williams and can analyse both rare and common variants with lower or more variable pool depths compared to the other methods. Availability: Package ‘extraBinomial’ is on http://cran.r-project.org/ Contact: chris.wallace@cimr.cam.ac.uk Supplementary information: Supplementary data are available at Bioinformatics Online. PMID:22976083

  19. The effect of time trial cycling position on physiological and aerodynamic variables.

    Science.gov (United States)

    Fintelman, D M; Sterling, M; Hemida, H; Li, F-X

    2015-01-01

    To reduce aerodynamic resistance cyclists lower their torso angle, concurrently reducing Peak Power Output (PPO). However, realistic torso angle changes in the range used by time trial cyclists have not yet been examined. Therefore the aim of this study was to investigate the effect of torso angle on physiological parameters and frontal area in different commonly used time trial positions. Nineteen well-trained male cyclists performed incremental tests on a cycle ergometer at five different torso angles: their preferred torso angle and at 0, 8, 16 and 24°. Oxygen uptake, carbon dioxide expiration, minute ventilation, gross efficiency, PPO, heart rate, cadence and frontal area were recorded. The frontal area provides an estimate of the aerodynamic drag. Overall, results showed that lower torso angles attenuated performance. Maximal values of all variables, attained in the incremental test, decreased with lower torso angles (P aerodynamic drag and physiological functioning.

  20. Chaos game representation (CGR)-walk model for DNA sequences

    International Nuclear Information System (INIS)

    Jie, Gao; Zhen-Yuan, Xu

    2009-01-01

    Chaos game representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to determine the coordinates of their positions in a continuous space. This distribution of positions has two features: one is unique, and the other is source sequence that can be recovered from the coordinates so that the distance between positions may serve as a measure of similarity between the corresponding sequences. A CGR-walk model is proposed based on CGR coordinates for the DNA sequences. The CGR coordinates are converted into a time series, and a long-memory ARFIMA (p, d, q) model, where ARFIMA stands for autoregressive fractionally integrated moving average, is introduced into the DNA sequence analysis. This model is applied to simulating real CGR-walk sequence data of ten genomic sequences. Remarkably long-range correlations are uncovered in the data, and the results from these models are reasonably fitted with those from the ARFIMA (p, d, q) model. (cross-disciplinary physics and related areas of science and technology)

  1. Delta Scuti variables. Lecture 6

    International Nuclear Information System (INIS)

    Cox, A.N.

    1983-01-01

    The class of variables near or on the upper main sequence, the delta Scuti variables, are not only the usual ones about the masses, radii, and luminosities, but also the age, rotation, element diffusion to change the surface layer composition, the occurance of convection and the presence of radial and nonradial pulsation modes

  2. Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism

  3. Comparative Genetic Variability in HIV-1 Subtype C vpu Gene in Early Age Groups of Infants.

    Science.gov (United States)

    Sharma, Uma; Gupta, Poonam; Gupta, Sunil; Venkatesh, S; Husain, Mohammad

    2018-01-01

    Identifying the genetic variability in vertically transmitted viruses in early infancy is important to understand the disease progression. Being important in HIV-1 disease pathogenesis, vpu gene, isolated from young infants was investigated to understand the viral characteristics. Blood samples were obtained from 80 HIV-1 positive infants, categorized in two age groups; acute (6-18 months). A total of 77 PCR positive samples, amplified for vpu gene, were sequenced and analyzed. 73 isolates belonged to subtype C. Analysis of heterogeneity of amino acid sequences in infant groups showed that in the sequences of acute age group both insertions and deletions were present while in the early age group only deletions were present. In the acute age group, a deletion of 3 residues (RAE) in the first alfa helix in one sequence and insertions of 1-2 residues (DM, GH, G and H) in the second alfa helix in 4 sequences were observed. In the early age group, deletion of 2 residues (VN) in the cytoplasmic tail region in 2 sequences was observed. Length of the amino terminal was observed to be gradually increasing with the increasing age of the infants. Protein Variation Effect Analyzer software showed that deleterious mutations were more in the acute than the early age group. Entropy analysis revealed that heterogeneity of the residues was comparatively higher in the sequences of acute than the early age group. Mutations observed in the helixes may affect the conformation and lose the ability to degrade CD4 receptors. Heterogeneity was decreasing with the increasing ages of the infants, indicating positive selection for robust virion survival. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features

    Directory of Open Access Journals (Sweden)

    Aaron Sievers

    2017-04-01

    Full Text Available In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4 on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs, which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST and the

  5. Amino acid and structural variability of Yersinia pestis LcrV protein

    Energy Technology Data Exchange (ETDEWEB)

    Anisimov, A P; Dentovskaya, S V; Panfertsev, E A; Svetoch, T E; Kopylov, P K; Segelke, B W; Zemla, A; Telepnev, M V; Motin, V L

    2009-11-09

    The LcrV protein is a multifunctional virulence factor and protective antigen of the plague bacterium which is generally conserved between the epidemic strains of Yersinia pestis. They investigated the diversity in the LcrV sequences among non-epidemic Y. pestis strains which have a limited virulence in selected animal models and for humans. Sequencing of lcrV genes from ten Y. pestis strains belonging to different phylogenetic groups (subspecies) showed that the LcrV proteins possess four major variable hotspots at positions 18, 72, 273, and 324-326. These major variations, together with other minor substitutions in amino acid sequences, allowed them to classify the LcrV alleles into five sequence types (A-E). They observed that the strains of different Y. pestis subspecies can have the same typ of LcrV, and different types of LcrV can exist within the same natural plague focus. The LcrV polymorphisms were structurally analyzed by comparing the modeled structures of LcrV from all available strains. All changes except one occurred either in flexible regions or on the surface of the protein, but local chemical properties (i.e. those of a hydrophobic, hydrophilic, amphipathic, or charged nature) were conserved across all of the strains. Polymorphisms in flexible and surface regions are likely subject to less selective pressure, and have a limited impact on the structure. In contrast, the substitution of tryptophan at position 113 with either glutamic acid or glycine likely has a serious influence on the regional structure of the protein, and these mutations might have an effect on the function of LcrV. The polymorphisms at positions 18, 72 and 273 were accountable for differences in oligomerization of LcrV. The importance of the latter property in emergence of epidemic strains of Y. pestis during evolution of this pathogen will need to be further investigated.

  6. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).

  7. Depressed mood, positive affect, and heart rate variability in patients with suspected coronary artery disease.

    Science.gov (United States)

    Bhattacharyya, Mimi R; Whitehead, Daisy L; Rakhit, Roby; Steptoe, Andrew

    2008-11-01

    To test associations between heart rate variability (HRV), depressed mood, and positive affect in patients with suspected coronary artery disease (CAD). Depression is associated with impaired HRV post acute cardiac events, but evidence in patients with stable coronary artery disease (CAD) is inconsistent. Seventy-six patients (52 men, 24 women; mean age = 61.1 years) being investigated for suspected CAD on the basis of symptomatology and positive noninvasive tests, completed 24-hour electrocardiograms. The Beck Depression Inventory (BDI) was administered, and positive and depressed affect was measured over the study period with the Day Reconstruction Method (DRM). A total of 46 (60.5%) patients were later found to have definite CAD. HRV was analyzed, using spectral analysis. Typical diurnal profiles of HRV were observed, with greater normalized high frequency (HF) and lower normalized low frequency (LF) power in the night compared with the day. BDI depression scores were not consistently associated with HRV. But positive affect was associated with greater normalized HF power (p = .039) and reduced normalized LF power (p = .007) independently of age, gender, medication with beta blockers, CAD status, body mass index, smoking, and habitual physical activity level. In patients with definite CAD, depressed affect assessed using the DRM was associated with reduced normalized HF power and heightened normalized LF power (p = .007) independently of covariates. Relationships between depression and HRV in patients with CAD may depend on affective experience over the monitoring period. Enhanced parasympathetic cardiac control may be a process through which positive affect protects against cardiovascular disease.

  8. LZW-Kernel: fast kernel utilizing variable length code blocks from LZW compressors for protein sequence classification.

    Science.gov (United States)

    Filatov, Gleb; Bauwens, Bruno; Kertész-Farkas, Attila

    2018-05-07

    Bioinformatics studies often rely on similarity measures between sequence pairs, which often pose a bottleneck in large-scale sequence analysis. Here, we present a new convolutional kernel function for protein sequences called the LZW-Kernel. It is based on code words identified with the Lempel-Ziv-Welch (LZW) universal text compressor. The LZW-Kernel is an alignment-free method, it is always symmetric, is positive, always provides 1.0 for self-similarity and it can directly be used with Support Vector Machines (SVMs) in classification problems, contrary to normalized compression distance (NCD), which often violates the distance metric properties in practice and requires further techniques to be used with SVMs. The LZW-Kernel is a one-pass algorithm, which makes it particularly plausible for big data applications. Our experimental studies on remote protein homology detection and protein classification tasks reveal that the LZW-Kernel closely approaches the performance of the Local Alignment Kernel (LAK) and the SVM-pairwise method combined with Smith-Waterman (SW) scoring at a fraction of the time. Moreover, the LZW-Kernel outperforms the SVM-pairwise method when combined with BLAST scores, which indicates that the LZW code words might be a better basis for similarity measures than local alignment approximations found with BLAST. In addition, the LZW-Kernel outperforms n-gram based mismatch kernels, hidden Markov model based SAM and Fisher kernel, and protein family based PSI-BLAST, among others. Further advantages include the LZW-Kernel's reliance on a simple idea, its ease of implementation, and its high speed, three times faster than BLAST and several magnitudes faster than SW or LAK in our tests. LZW-Kernel is implemented as a standalone C code and is a free open-source program distributed under GPLv3 license and can be downloaded from https://github.com/kfattila/LZW-Kernel. akerteszfarkas@hse.ru. Supplementary data are available at Bioinformatics Online.

  9. Dissociable effects of practice variability on learning motor and timing skills.

    Science.gov (United States)

    Caramiaux, Baptiste; Bevilacqua, Frédéric; Wanderley, Marcelo M; Palmer, Caroline

    2018-01-01

    Motor skill acquisition inherently depends on the way one practices the motor task. The amount of motor task variability during practice has been shown to foster transfer of the learned skill to other similar motor tasks. In addition, variability in a learning schedule, in which a task and its variations are interweaved during practice, has been shown to help the transfer of learning in motor skill acquisition. However, there is little evidence on how motor task variations and variability schedules during practice act on the acquisition of complex motor skills such as music performance, in which a performer learns both the right movements (motor skill) and the right time to perform them (timing skill). This study investigated the impact of rate (tempo) variability and the schedule of tempo change during practice on timing and motor skill acquisition. Complete novices, with no musical training, practiced a simple musical sequence on a piano keyboard at different rates. Each novice was assigned to one of four learning conditions designed to manipulate the amount of tempo variability across trials (large or small tempo set) and the schedule of tempo change (randomized or non-randomized order) during practice. At test, the novices performed the same musical sequence at a familiar tempo and at novel tempi (testing tempo transfer), as well as two novel (but related) sequences at a familiar tempo (testing spatial transfer). We found that practice conditions had little effect on learning and transfer performance of timing skill. Interestingly, practice conditions influenced motor skill learning (reduction of movement variability): lower temporal variability during practice facilitated transfer to new tempi and new sequences; non-randomized learning schedule improved transfer to new tempi and new sequences. Tempo (rate) and the sequence difficulty (spatial manipulation) affected performance variability in both timing and movement. These findings suggest that there is a

  10. Inter- and Intrafraction Variability in Liver Position in Non-Breath-Hold Stereotactic Body Radiotherapy

    International Nuclear Information System (INIS)

    Case, Robert B.; Sonke, Jan-Jakob; Moseley, Douglas J.; Kim, John; Brock, Kristy K.; Dawson, Laura A.

    2009-01-01

    Purpose: The inter- and intrafraction variability of liver position was assessed in patients with liver cancer treated with kilovoltage cone-beam computed tomography (CBCT)-guided stereotactic body radiotherapy. Methods and Materials: A total of 314 CBCT scans obtained in the treatment position immediately before and after each fraction were evaluated from 29 patients undergoing six-fraction, non-breath-hold stereotactic body radiotherapy for unresectable liver cancer. Off-line, the CBCT scans were sorted into 10 bins, according to the phase of respiration. The liver position (relative to the vertebral bodies) was measured using rigid alignment of the exhale CBCT liver with the exhale planning CT liver, following the alignment of the vertebrae. The interfraction liver position change was measured by comparing the pretreatment CBCT scans, and the intrafraction change was measured from the CBCT scans obtained immediately before and after each fraction. Results: The mean amplitude of liver motion for all patients was 1.8 mm (range, 0.1-5.7), 8.0 mm (range, 0.1-18.8), and 4.3 mm (range 0.1-12.1) in the medial-lateral (ML), craniocaudal (CC), and anteroposterior (AP) directions, respectively. The mean absolute ML, CC, and AP interfraction changes in liver position were 2.0 mm (90th percentile, 4.2), 3.5 mm (90th percentile, 7.3), and 2.3 mm (90th percentile, 4.7). The mean absolute intrafraction ML, CC, and AP changes were 1.3 mm (90th percentile, 2.9), 1.6 mm (90th percentile, 3.6), and 1.5 mm (90th percentile, 3.1), respectively. The interfraction changes were significantly larger than the intrafraction changes, with a CC systematic error of 2.9 and 1.1 mm, respectively. The intraobserver reproducibility (σ, n = 29 fractions) was 1.3 mm in the ML, 1.4 mm in the CC, and 1.6 mm in the AP direction. Conclusion: Interfraction liver position changes relative to the vertebral bodies are an important source of geometric uncertainty, providing a rationale for prefraction

  11. Discovering human germ cell mutagens with whole genome sequencing: Insights from power calculations reveal the importance of controlling for between-family variability.

    Science.gov (United States)

    Webster, R J; Williams, A; Marchetti, F; Yauk, C L

    2018-07-01

    Mutations in germ cells pose potential genetic risks to offspring. However, de novo mutations are rare events that are spread across the genome and are difficult to detect. Thus, studies in this area have generally been under-powered, and no human germ cell mutagen has been identified. Whole Genome Sequencing (WGS) of human pedigrees has been proposed as an approach to overcome these technical and statistical challenges. WGS enables analysis of a much wider breadth of the genome than traditional approaches. Here, we performed power analyses to determine the feasibility of using WGS in human families to identify germ cell mutagens. Different statistical models were compared in the power analyses (ANOVA and multiple regression for one-child families, and mixed effect model sampling between two to four siblings per family). Assumptions were made based on parameters from the existing literature, such as the mutation-by-paternal age effect. We explored two scenarios: a constant effect due to an exposure that occurred in the past, and an accumulating effect where the exposure is continuing. Our analysis revealed the importance of modeling inter-family variability of the mutation-by-paternal age effect. Statistical power was improved by models accounting for the family-to-family variability. Our power analyses suggest that sufficient statistical power can be attained with 4-28 four-sibling families per treatment group, when the increase in mutations ranges from 40 to 10% respectively. Modeling family variability using mixed effect models provided a reduction in sample size compared to a multiple regression approach. Much larger sample sizes were required to detect an interaction effect between environmental exposures and paternal age. These findings inform study design and statistical modeling approaches to improve power and reduce sequencing costs for future studies in this area. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  12. Minimotif Miner 3.0: database expansion and significantly improved reduction of false-positive predictions from consensus sequences.

    Science.gov (United States)

    Mi, Tian; Merlin, Jerlin Camilus; Deverasetty, Sandeep; Gryk, Michael R; Bill, Travis J; Brooks, Andrew W; Lee, Logan Y; Rathnayake, Viraj; Ross, Christian A; Sargeant, David P; Strong, Christy L; Watts, Paula; Rajasekaran, Sanguthevar; Schiller, Martin R

    2012-01-01

    Minimotif Miner (MnM available at http://minimotifminer.org or http://mnm.engr.uconn.edu) is an online database for identifying new minimotifs in protein queries. Minimotifs are short contiguous peptide sequences that have a known function in at least one protein. Here we report the third release of the MnM database which has now grown 60-fold to approximately 300,000 minimotifs. Since short minimotifs are by their nature not very complex we also summarize a new set of false-positive filters and linear regression scoring that vastly enhance minimotif prediction accuracy on a test data set. This online database can be used to predict new functions in proteins and causes of disease.

  13. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  14. Sequence variation of the glycoprotein gene identifies three distinct lineages within field isolates of viral hemorrhagic septicemia virus, a fish rhabdovirus

    Science.gov (United States)

    Benmansour, A.; Bascuro, B.; Monnier, A.F.; Vende, P.; Winton, J.R.; de Kinkelin, P.

    1997-01-01

    To evaluate the genetic diversity of viral haemorrhagic septicaemia virus (VHSV), the sequence of the glycoprotein genes (G) of 11 North American and European isolates were determined. Comparison with the G protein of representative members of the family Rhabdoviridae suggested that VHSV was a different virus species from infectious haemorrhagic necrosis virus (IHNV) and Hirame rhabdovirus (HIRRV). At a higher taxonomic level, VHSV, IHNV and HIRRV formed a group which was genetically closest to the genus Lyssavirus. Compared with each other, the G genes of VHSV displayed a dissimilar overall genetic diversity which correlated with differences in geographical origin. The multiple sequence alignment of the complete G protein, showed that the divergent positions were not uniformly distributed along the sequence. A central region (amino acid position 245-300) accumulated substitutions and appeared to be highly variable. The genetic heterogeneity within a single isolate was high, with an apparent internal mutation frequency of 1.2 x 10(-3) per nucleotide site, attesting the quasispecies nature of the viral population. The phylogeny separated VHSV strains according to the major geographical area of isolation: genotype I for continental Europe, genotype II for the British Isles, and genotype III for North America. Isolates from continental Europe exhibited the highest genetic variability, with sub-groups correlated partially with the serological classification. Neither neutralizing polyclonal sera, nor monoclonal antibodies, were able to discriminate between the genotypes. The overall structure of the phylogenetic tree suggests that VHSV genetic diversity and evolution fit within the model of random change and positive selection operating on quasispecies.

  15. POWRS: position-sensitive motif discovery.

    Directory of Open Access Journals (Sweden)

    Ian W Davis

    Full Text Available Transcription factors and the short, often degenerate DNA sequences they recognize are central regulators of gene expression, but their regulatory code is challenging to dissect experimentally. Thus, computational approaches have long been used to identify putative regulatory elements from the patterns in promoter sequences. Here we present a new algorithm "POWRS" (POsition-sensitive WoRd Set for identifying regulatory sequence motifs, specifically developed to address two common shortcomings of existing algorithms. First, POWRS uses the position-specific enrichment of regulatory elements near transcription start sites to significantly increase sensitivity, while providing new information about the preferred localization of those elements. Second, POWRS forgoes position weight matrices for a discrete motif representation that appears more resistant to over-generalization. We apply this algorithm to discover sequences related to constitutive, high-level gene expression in the model plant Arabidopsis thaliana, and then experimentally validate the importance of those elements by systematically mutating two endogenous promoters and measuring the effect on gene expression levels. This provides a foundation for future efforts to rationally engineer gene expression in plants, a problem of great importance in developing biotech crop varieties.BSD-licensed Python code at http://grassrootsbio.com/papers/powrs/.

  16. Weighted A-statistical convergence for sequences of positive linear operators.

    Science.gov (United States)

    Mohiuddine, S A; Alotaibi, Abdullah; Hazarika, Bipan

    2014-01-01

    We introduce the notion of weighted A-statistical convergence of a sequence, where A represents the nonnegative regular matrix. We also prove the Korovkin approximation theorem by using the notion of weighted A-statistical convergence. Further, we give a rate of weighted A-statistical convergence and apply the classical Bernstein polynomial to construct an illustrative example in support of our result.

  17. Stratigraphic position, origin and characteristics of manganese mineralization horizons in the Late Cretaceous volcano-sedimentary sequence, south-southwest of Sabzevar

    Directory of Open Access Journals (Sweden)

    Sajjad Maghfouri

    2014-10-01

    Full Text Available Introduction The Mn mineralization occurs in the northeastern segment of the Sabzevar zone (SZ, north of the Central Iranian Microcontinent (CIM. This Zone (SZ is located between the CIM fragmentation in the south and the Kopeh dagh sedimentary sequence in the north. The ore deposits of the northeastern segment of the Sabzevar zone can be divided into three groups, each with different metal association and spatial distribution and each related to a major geodynamic event. The first mineralization with associated Ordovician host rock is characterized by Taknar polymetallic (Fe-rich massive sulfide deposit. The Cretaceous mineralization consists of Cr deposits associated with serpentinized peridotites, Cyprus type VMS, Mn deposit in pillow lava, volcano-sedimentary hosted Besshi type VMS and Mn deposit. Paleogene mineralization in eastern segment of the Sabzevar zone began with porphyry deposits, Cu Red Bed mineralization occurs in the Paleogene sandy red marl. Materials and methods A field study and sampling was performed during the autumn of 2012. To assess the geochemical characteristics of 48 systematic samples (least fractured and altered of ore-bearing layers and host rocks were collected from the deposit for polished thin section examination. In order to correctly characterize their chemical compositions, 15 least-altered and fractured samples were chosen for major elements analysis. Results The Late Cretaceous volcano-sedimentary sequence in south-southwest of Sabzevar hosts numerous manganese mineralization. The sequence based on the stratigraphic position, age and composition of the rocks, can be divided into two lower and upper parts. The lower part or K2tv unit mainly formed from marine sediments interbedded with volcanic rocks. The sedimentary rocks of this part include silicified tuff, chert, shale and sandstone, and the volcanic rocks involve pyroclastic rocks of various composition, rhyolite, dacite and andesitic lava. The upper

  18. The reliability of linear position transducer, force plate and combined measurement of explosive power-time variables during a loaded jump squat in elite athletes.

    Science.gov (United States)

    Hansen, Keir T; Cronin, John B; Newton, Michael J

    2011-03-01

    The purpose of this study was to determine the between day reliability of power-time measures calculated with data collected using the linear position transducer or the force plate independently, or a combination of the two technologies. Twenty-five male rugby union players performed three jump squats on two occasions one week apart. Ground reaction forces were measured via a force plate and position data were collected using a linear position transducer. From these data, a number of power-time variables were calculated for each method. The force plate, linear position transducer and a combined method were all found to be a reliable means of measuring peak power (ICC = 0.87-0.95, CV = 3.4%-8.0%). The absolute consistency of power-time measures varied between methods (CV = 8.0%-53.4%). Relative consistency of power-time measures was generally comparable between methods and measures, and for many variables was at an acceptable level (ICC = 0.77-0.94). Although a number of time-dependent power variables can be reliably calculated from data acquired from the three methods investigated, the reliability of a number of these measures is below that which is acceptable for use in research and for practical applications.

  19. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  20. Evaluation of positive Rift Valley fever virus formalin-fixed paraffin embedded samples as a source of sequence data for retrospective phylogenetic analysis.

    Science.gov (United States)

    Mubemba, B; Thompson, P N; Odendaal, L; Coetzee, P; Venter, E H

    2017-05-01

    Rift Valley fever (RVF), caused by an arthropod borne Phlebovirus in the family Bunyaviridae, is a haemorrhagic disease that affects ruminants and humans. Due to the zoonotic nature of the virus, a biosafety level 3 laboratory is required for isolation of the virus. Fresh and frozen samples are the preferred sample type for isolation and acquisition of sequence data. However, these samples are scarce in addition to posing a health risk to laboratory personnel. Archived formalin-fixed, paraffin-embedded (FFPE) tissue samples are safe and readily available, however FFPE derived RNA is in most cases degraded and cross-linked in peptide bonds and it is unknown whether the sample type would be suitable as reference material for retrospective phylogenetic studies. A RT-PCR assay targeting a 490 nt portion of the structural G N glycoprotein encoding gene of the RVFV M-segment was applied to total RNA extracted from archived RVFV positive FFPE samples. Several attempts to obtain target amplicons were unsuccessful. FFPE samples were then analysed using next generation sequencing (NGS), i.e. Truseq ® (Illumina) and sequenced on the Miseq ® genome analyser (Illumina). Using reference mapping, gapped virus sequence data of varying degrees of shallow depth was aligned to a reference sequence. However, the NGS did not yield long enough contigs that consistently covered the same genome regions in all samples to allow phylogenetic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Sequence alignment visualization in HTML5 without Java.

    Science.gov (United States)

    Gille, Christoph; Birgit, Weyand; Gille, Andreas

    2014-01-01

    Java has been extensively used for the visualization of biological data in the web. However, the Java runtime environment is an additional layer of software with an own set of technical problems and security risks. HTML in its new version 5 provides features that for some tasks may render Java unnecessary. Alignment-To-HTML is the first HTML-based interactive visualization for annotated multiple sequence alignments. The server side script interpreter can perform all tasks like (i) sequence retrieval, (ii) alignment computation, (iii) rendering, (iv) identification of a homologous structural models and (v) communication with BioDAS-servers. The rendered alignment can be included in web pages and is displayed in all browsers on all platforms including touch screen tablets. The functionality of the user interface is similar to legacy Java applets and includes color schemes, highlighting of conserved and variable alignment positions, row reordering by drag and drop, interlinked 3D visualization and sequence groups. Novel features are (i) support for multiple overlapping residue annotations, such as chemical modifications, single nucleotide polymorphisms and mutations, (ii) mechanisms to quickly hide residue annotations, (iii) export to MS-Word and (iv) sequence icons. Alignment-To-HTML, the first interactive alignment visualization that runs in web browsers without additional software, confirms that to some extend HTML5 is already sufficient to display complex biological data. The low speed at which programs are executed in browsers is still the main obstacle. Nevertheless, we envision an increased use of HTML and JavaScript for interactive biological software. Under GPL at: http://www.bioinformatics.org/strap/toHTML/.

  2. Use of tuf as a target for sequence-based identification of Gram-positive cocci of the genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus

    Directory of Open Access Journals (Sweden)

    Li Xuerui

    2012-11-01

    Full Text Available Abstract Background Accurate identification of isolates belonging to genus Enterococcus, Streptococcus, coagulase-negative Staphylococcus, and Lactococcus at the species level is necessary to provide a better understanding of their pathogenic potential, to aid in making clinical decisions, and to conduct epidemiologic investigations,especially when large blind samples must be analyzed. It is useful to simultaneously identify species in different genera using a single primer pair. Methods We developed a primer pair based on the tuf gene (encoding elongation factor sequence to identify 56 Gram-positive cocci isolates. Results The target sequences were amplified from all 56 samples. The sequencing results and the phylogenetic tree derived from the partial tuf gene sequences identified the isolates as three enterococcal species, two lactococcal species, two staphylococcal species, and six streptococcal species, as well as eight isolates that were novel species of the genus Streptococcus. Partial gene sequence analysis of the sodA, dnaK, and 16S RNA genes confirmed the results obtained by tuf gene sequencing. Conclusion Based on the uniform amplification of the tuf gene from all samples and the ability to identify all isolates at both the genus and species levels, we conclude that the primer pair developed in this research provides a powerful tool for identifying these organisms in clinical laboratories where large blind samples are used.

  3. Weighted A-Statistical Convergence for Sequences of Positive Linear Operators

    Directory of Open Access Journals (Sweden)

    S. A. Mohiuddine

    2014-01-01

    Full Text Available We introduce the notion of weighted A-statistical convergence of a sequence, where A represents the nonnegative regular matrix. We also prove the Korovkin approximation theorem by using the notion of weighted A-statistical convergence. Further, we give a rate of weighted A-statistical convergence and apply the classical Bernstein polynomial to construct an illustrative example in support of our result.

  4. Genetic Barrier to Direct Acting Antivirals in HCV Sequences Deposited in the European Databank.

    Directory of Open Access Journals (Sweden)

    Dimas Alexandre Kliemann

    Full Text Available Development of resistance results from mutations in the viral genome, and the presence of selective drug pressure leads to the emergence of a resistant virus population. The aim of this study was to analyze the impact of genetic variability on the genetic barrier to drug resistance to DAAs.The genetic barrier was quantified based on the number and type of nucleotide mutations required to impart resistance, considering full-length HCV NS3, NS5A and NS5B regions segregated by genotype into subtypes 1a, 1b, 2a, 2b and 3a. This study analyzeds 789 NS3 sequences, 708 sequences and 536 NS5B sequences deposited in the European Hepatitis C Virus Database, in the following resistance-associated positions: NS3: F43/I/L/S/V, Q80K/R, R155K/G, A156G/S/T and D168A/C/E/G/H/N/T/V/Y; NS5A: L/M28A/T/V, Q30E/H/R, L31F/I/M/V, H58D or P58S and Y93C/F/H/N/S; NS5B: S282P/R/T, C316H/N/Y, S368T, Y448C/H, S556G/R, D559R.Variants that require only one transversion in NS3 were found in 4 positions and include F43S, R80K, R155K/G and A156T. The genetic barrier to resistance shows subtypic differences at position 155 of the NS3 gene where a single transition is necessary in subtype 1a. In the NS5A gene, 5 positions where only one nucleotide change can confer resistance were found, such as L31M which requires one transversion in all subtypes, except in 0.28% of 1b sequences; and R30H, generated by a single transition, which was found in 10.25% of the sequences of genotype 1b. Other subtypic differences were observed at position 58, where resistance is less likely in genotype 1a because a transversion is required to create the variant 58S. For the NS5B inhibitors, the genetic barrier at positions conferring resistance was nearly identical in subtypes 1a and 1b, and single transitions or transversions were necessary in 5 positions to generate a drug-resistant variant of HCV. The positions C316Y and S556D required only one transition in all genotypes, Y448H and S556 G

  5. Value of a dixon-based MR/PET attenuation correction sequence for the localization and evaluation of PET-positive lesions

    International Nuclear Information System (INIS)

    Eiber, Matthias; Holzapfel, Konstantin; Rummeny, Ernst J.; Martinez-Moeller, Axel; Souvatzoglou, Michael; Ziegler, Sibylle; Schwaiger, Markus; Nekolla, Stephan G.; Beer, Ambros J.; Pickhard, Anja; Loeffelbein, Dennys; Santi, Ivan

    2011-01-01

    In this study, the potential contribution of Dixon-based MR imaging with a rapid low-resolution breath-hold sequence, which is a technique used for MR-based attenuation correction (AC) for MR/positron emission tomography (PET), was evaluated for anatomical correlation of PET-positive lesions on a 3T clinical scanner compared to low-dose CT. This technique is also used in a recently installed fully integrated whole-body MR/PET system. Thirty-five patients routinely scheduled for oncological staging underwent 18 F-fluorodeoxyglucose (FDG) PET/CT and a 2-point Dixon 3-D volumetric interpolated breath-hold examination (VIBE) T1-weighted MR sequence on the same day. Two PET data sets reconstructed using attenuation maps from low-dose CT (PET AC C T ) or simulated MR-based segmentation (PET AC M R ) were evaluated for focal PET-positive lesions. The certainty for the correlation with anatomical structures was judged in the low-dose CT and Dixon-based MRI on a 4-point scale (0-3). In addition, the standardized uptake values (SUVs) for PET AC C T and PET AC M R were compared. Statistically, no significant difference could be found concerning anatomical localization for all 81 PET-positive lesions in low-dose CT compared to Dixon-based MR (mean 2.51 ± 0.85 and 2.37 ± 0.87, respectively; p = 0.1909). CT tended to be superior for small lymph nodes, bone metastases and pulmonary nodules, while Dixon-based MR proved advantageous for soft tissue pathologies like head/neck tumours and liver metastases. For the PET AC C T - and PET AC M R -based SUVs (mean 6.36 ± 4.47 and 6.31 ± 4.52, respectively) a nearly complete concordance with a highly significant correlation was found (r = 0.9975, p < 0.0001). Dixon-based MR imaging for MR AC allows for anatomical allocation of PET-positive lesions similar to low-dose CT in conventional PET/CT. Thus, this approach appears to be useful for future MR/PET for body regions not fully covered by diagnostic MRI due to potential time

  6. Proline: the distribution, frequency, positioning, and common functional roles of proline and polyproline sequences in the human proteome.

    Directory of Open Access Journals (Sweden)

    Alexander A Morgan

    Full Text Available Proline is an anomalous amino acid. Its nitrogen atom is covalently locked within a ring, thus it is the only proteinogenic amino acid with a constrained phi angle. Sequences of three consecutive prolines can fold into polyproline helices, structures that join alpha helices and beta pleats as architectural motifs in protein configuration. Triproline helices are participants in protein-protein signaling interactions. Longer spans of repeat prolines also occur, containing as many as 27 consecutive proline residues. Little is known about the frequency, positioning, and functional significance of these proline sequences. Therefore we have undertaken a systematic bioinformatics study of proline residues in proteins. We analyzed the distribution and frequency of 687,434 proline residues among 18,666 human proteins, identifying single residues, dimers, trimers, and longer repeats. Proline accounts for 6.3% of the 10,882,808 protein amino acids. Of all proline residues, 4.4% are in trimers or longer spans. We detected patterns that influence function based on proline location, spacing, and concentration. We propose a classification based on proline-rich, polyproline-rich, and proline-poor status. Whereas singlet proline residues are often found in proteins that display recurring architectural patterns, trimers or longer proline sequences tend be associated with the absence of repetitive structural motifs. Spans of 6 or more are associated with DNA/RNA processing, actin, and developmental processes. We also suggest a role for proline in Kruppel-type zinc finger protein control of DNA expression, and in the nucleation and translocation of actin by the formin complex.

  7. Highly conserved intragenic HSV-2 sequences: Results from next-generation sequencing of HSV-2 UL and US regions from genital swabs collected from 3 continents.

    Science.gov (United States)

    Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M

    2017-10-01

    Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Review of Coconut “Lethal Yellowing” type diseases Diversity, variability and diagnosis

    Directory of Open Access Journals (Sweden)

    Dollet Michel

    2009-03-01

    Full Text Available Coconut palms (Cocos nucifera L. can be affected by several types of Lethal Yellowing (LY diseases worldwide. Some of the syndromes are caused by phytoplasmas, small bacteria that are impossible to detect by light microscopy. Amplification of a given gene of the phytoplasmas by polymerase chain reaction (PCR is the most convenient diagnosis method. The problem is that there are at least 28 “groups” of phytoplasmas and only one pair of primers -P1/P7- commonly used for PCR. As these primers belong to a very conserved gene, false positives are frequent. Consequently, alternative primers specific to one “strain” (or subgroup have to be used, such as LY-F/LY-R for the Caribbean LY, Rohde primers for LD Tanzania. Such specific primers are sometimes restrictive. Indeed, there is variability within each strain and the sequence of the primers has to be adapted to that variability. There are at least five LY subgroups. The subgroups can only be identified by restriction fragment length polymorphism or sequencing. In Africa, two subgroups of LY phytoplasmas have been identified so far.

  9. Viral metagenomics: Analysis of begomoviruses by illumina high-throughput sequencing

    KAUST Repository

    Idris, Ali; Al-Saleh, Mohammed; Piatek, Marek J.; Al-Shahwan, Ibrahim; Ali, Shahjahan; Brown, Judith K.

    2014-01-01

    Traditional DNA sequencing methods are inefficient, lack the ability to discern the least abundant viral sequences, and ineffective for determining the extent of variability in viral populations. Here, populations of single-stranded DNA plant

  10. An intuitive graphical webserver for multiple-choice protein sequence search.

    Science.gov (United States)

    Banky, Daniel; Szalkai, Balazs; Grolmusz, Vince

    2014-04-10

    Every day tens of thousands of sequence searches and sequence alignment queries are submitted to webservers. The capitalized word "BLAST" becomes a verb, describing the act of performing sequence search and alignment. However, if one needs to search for sequences that contain, for example, two hydrophobic and three polar residues at five given positions, the query formation on the most frequently used webservers will be difficult. Some servers support the formation of queries with regular expressions, but most of the users are unfamiliar with their syntax. Here we present an intuitive, easily applicable webserver, the Protein Sequence Analysis server, that allows the formation of multiple choice queries by simply drawing the residues to their positions; if more than one residue are drawn to the same position, then they will be nicely stacked on the user interface, indicating the multiple choice at the given position. This computer-game-like interface is natural and intuitive, and the coloring of the residues makes possible to form queries requiring not just certain amino acids in the given positions, but also small nonpolar, negatively charged, hydrophobic, positively charged, or polar ones. The webserver is available at http://psa.pitgroup.org. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  12. [Hydrologic variability and sensitivity based on Hurst coefficient and Bartels statistic].

    Science.gov (United States)

    Lei, Xu; Xie, Ping; Wu, Zi Yi; Sang, Yan Fang; Zhao, Jiang Yan; Li, Bin Bin

    2018-04-01

    Due to the global climate change and frequent human activities in recent years, the pure stochastic components of hydrological sequence is mixed with one or several of the variation ingredients, including jump, trend, period and dependency. It is urgently needed to clarify which indices should be used to quantify the degree of their variability. In this study, we defined the hydrological variability based on Hurst coefficient and Bartels statistic, and used Monte Carlo statistical tests to test and analyze their sensitivity to different variants. When the hydrological sequence had jump or trend variation, both Hurst coefficient and Bartels statistic could reflect the variation, with the Hurst coefficient being more sensitive to weak jump or trend variation. When the sequence had period, only the Bartels statistic could detect the mutation of the sequence. When the sequence had a dependency, both the Hurst coefficient and the Bartels statistics could reflect the variation, with the latter could detect weaker dependent variations. For the four variations, both the Hurst variability and Bartels variability increased with the increases of variation range. Thus, they could be used to measure the variation intensity of the hydrological sequence. We analyzed the temperature series of different weather stations in the Lancang River basin. Results showed that the temperature of all stations showed the upward trend or jump, indicating that the entire basin had experienced warming in recent years and the temperature variability in the upper and lower reaches was much higher. This case study showed the practicability of the proposed method.

  13. A Pareto-Based Adaptive Variable Neighborhood Search for Biobjective Hybrid Flow Shop Scheduling Problem with Sequence-Dependent Setup Time

    Directory of Open Access Journals (Sweden)

    Huixin Tian

    2016-01-01

    Full Text Available Different from most researches focused on the single objective hybrid flowshop scheduling (HFS problem, this paper investigates a biobjective HFS problem with sequence dependent setup time. The two objectives are the minimization of total weighted tardiness and the total setup time. To efficiently solve this problem, a Pareto-based adaptive biobjective variable neighborhood search (PABOVNS is developed. In the proposed PABOVNS, a solution is denoted as a sequence of all jobs and a decoding procedure is presented to obtain the corresponding complete schedule. In addition, the proposed PABOVNS has three major features that can guarantee a good balance of exploration and exploitation. First, an adaptive selection strategy of neighborhoods is proposed to automatically select the most promising neighborhood instead of the sequential selection strategy of canonical VNS. Second, a two phase multiobjective local search based on neighborhood search and path relinking is designed for each selected neighborhood. Third, an external archive with diversity maintenance is adopted to store the nondominated solutions and at the same time provide initial solutions for the local search. Computational results based on randomly generated instances show that the PABOVNS is efficient and even superior to some other powerful multiobjective algorithms in the literature.

  14. Law of Iterated Logarithm for NA Sequences with Non-Identical ...

    Indian Academy of Sciences (India)

    Based on a law of the iterated logarithm for independent random variables sequences, an iterated logarithm theorem for NA sequences with non-identical distributions is obtained. The proof is based on a Kolmogrov-type exponential inequality.

  15. Assessing positive emotional states in dogs using heart rate and heart rate variability.

    Science.gov (United States)

    Zupan, Manja; Buskas, Julia; Altimiras, Jordi; Keeling, Linda J

    2016-03-01

    Since most animal species have been recognized as sentient beings, emotional state may be a good indicator of welfare in animals. The goal of this study was to manipulate the environment of nine beagle research dogs to highlight physiological responses indicative of different emotional experiences. Stimuli were selected to be a more or a less positive food (meatball or food pellet) or social reward (familiar person or less familiar person). That all the stimuli were positive and of different reward value was confirmed in a runway motivation test. Dogs were tested individually while standing facing a display theatre where the different stimuli could be shown by lifting a shutter. The dogs approached and remained voluntarily in the test system. They were tested in four sessions (of 20s each) for each of the four stimuli. A test session consisted of four presentation phases (1st exposure to stimulus, post exposure, 2nd exposure, and access to reward). Heart rate (HR) and heart rate variability (HRV) responses were recorded during testing in the experimental room and also when lying resting in a quiet familiar room. A new method of 'stitching' short periods of HRV data together was used in the analysis. When testing different stimuli, no significant differences were observed in HR and LF:HF ratio (relative power in low frequency (LF) and the high-frequency (HF) range), implying that the sympathetic tone was activated similarly for all the stimuli and may suggest that dogs were in a state of positive arousal. A decrease of HF was associated with the meatball stimulus compared to the food pellet and the reward phase (interacting with the person or eating the food) was associated with a decrease in HF and RMSSD (root mean square of successive differences of inter-beat intervals) compared to the preceding phase (looking at the person or food). This suggests that parasympathetic deactivation is associated with a more positive emotional state in the dog. A similar reduction

  16. Proteins interacting with cloning scars: a source of false positive protein-protein interactions.

    Science.gov (United States)

    Banks, Charles A S; Boanca, Gina; Lee, Zachary T; Florens, Laurence; Washburn, Michael P

    2015-02-23

    A common approach for exploring the interactome, the network of protein-protein interactions in cells, uses a commercially available ORF library to express affinity tagged bait proteins; these can be expressed in cells and endogenous cellular proteins that copurify with the bait can be identified as putative interacting proteins using mass spectrometry. Control experiments can be used to limit false-positive results, but in many cases, there are still a surprising number of prey proteins that appear to copurify specifically with the bait. Here, we have identified one source of false-positive interactions in such studies. We have found that a combination of: 1) the variable sequence of the C-terminus of the bait with 2) a C-terminal valine "cloning scar" present in a commercially available ORF library, can in some cases create a peptide motif that results in the aberrant co-purification of endogenous cellular proteins. Control experiments may not identify false positives resulting from such artificial motifs, as aberrant binding depends on sequences that vary from one bait to another. It is possible that such cryptic protein binding might occur in other systems using affinity tagged proteins; this study highlights the importance of conducting careful follow-up studies where novel protein-protein interactions are suspected.

  17. The influence of DNA sequence on epigenome-induced pathologies

    Directory of Open Access Journals (Sweden)

    Meagher Richard B

    2012-07-01

    Full Text Available Abstract Clear cause-and-effect relationships are commonly established between genotype and the inherited risk of acquiring human and plant diseases and aberrant phenotypes. By contrast, few such cause-and-effect relationships are established linking a chromatin structure (that is, the epitype with the transgenerational risk of acquiring a disease or abnormal phenotype. It is not entirely clear how epitypes are inherited from parent to offspring as populations evolve, even though epigenetics is proposed to be fundamental to evolution and the likelihood of acquiring many diseases. This article explores the hypothesis that, for transgenerationally inherited chromatin structures, “genotype predisposes epitype”, and that epitype functions as a modifier of gene expression within the classical central dogma of molecular biology. Evidence for the causal contribution of genotype to inherited epitypes and epigenetic risk comes primarily from two different kinds of studies discussed herein. The first and direct method of research proceeds by the examination of the transgenerational inheritance of epitype and the penetrance of phenotype among genetically related individuals. The second approach identifies epitypes that are duplicated (as DNA sequences are duplicated and evolutionarily conserved among repeated patterns in the DNA sequence. The body of this article summarizes particularly robust examples of these studies from humans, mice, Arabidopsis, and other organisms. The bulk of the data from both areas of research support the hypothesis that genotypes predispose the likelihood of displaying various epitypes, but for only a few classes of epitype. This analysis suggests that renewed efforts are needed in identifying polymorphic DNA sequences that determine variable nucleosome positioning and DNA methylation as the primary cause of inherited epigenome-induced pathologies. By contrast, there is very little evidence that DNA sequence directly

  18. Management of High-Throughput DNA Sequencing Projects: Alpheus.

    Science.gov (United States)

    Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F

    2008-12-26

    High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.

  19. Stochastic Analysis of the Efficiency of a Wireless Power Transfer System Subject to Antenna Variability and Position Uncertainties.

    Science.gov (United States)

    Rossi, Marco; Stockman, Gert-Jan; Rogier, Hendrik; Vande Ginste, Dries

    2016-07-19

    The efficiency of a wireless power transfer (WPT) system in the radiative near-field is inevitably affected by the variability in the design parameters of the deployed antennas and by uncertainties in their mutual position. Therefore, we propose a stochastic analysis that combines the generalized polynomial chaos (gPC) theory with an efficient model for the interaction between devices in the radiative near-field. This framework enables us to investigate the impact of random effects on the power transfer efficiency (PTE) of a WPT system. More specifically, the WPT system under study consists of a transmitting horn antenna and a receiving textile antenna operating in the Industrial, Scientific and Medical (ISM) band at 2.45 GHz. First, we model the impact of the textile antenna's variability on the WPT system. Next, we include the position uncertainties of the antennas in the analysis in order to quantify the overall variations in the PTE. The analysis is carried out by means of polynomial-chaos-based macromodels, whereas a Monte Carlo simulation validates the complete technique. It is shown that the proposed approach is very accurate, more flexible and more efficient than a straightforward Monte Carlo analysis, with demonstrated speedup factors up to 2500.

  20. Stochastic Analysis of the Efficiency of a Wireless Power Transfer System Subject to Antenna Variability and Position Uncertainties

    Directory of Open Access Journals (Sweden)

    Marco Rossi

    2016-07-01

    Full Text Available The efficiency of a wireless power transfer (WPT system in the radiative near-field is inevitably affected by the variability in the design parameters of the deployed antennas and by uncertainties in their mutual position. Therefore, we propose a stochastic analysis that combines the generalized polynomial chaos (gPC theory with an efficient model for the interaction between devices in the radiative near-field. This framework enables us to investigate the impact of random effects on the power transfer efficiency (PTE of a WPT system. More specifically, the WPT system under study consists of a transmitting horn antenna and a receiving textile antenna operating in the Industrial, Scientific and Medical (ISM band at 2.45 GHz. First, we model the impact of the textile antenna’s variability on the WPT system. Next, we include the position uncertainties of the antennas in the analysis in order to quantify the overall variations in the PTE. The analysis is carried out by means of polynomial-chaos-based macromodels, whereas a Monte Carlo simulation validates the complete technique. It is shown that the proposed approach is very accurate, more flexible and more efficient than a straightforward Monte Carlo analysis, with demonstrated speedup factors up to 2500.

  1. Stochastic Analysis of the Efficiency of a Wireless Power Transfer System Subject to Antenna Variability and Position Uncertainties

    Science.gov (United States)

    Rossi, Marco; Stockman, Gert-Jan; Rogier, Hendrik; Vande Ginste, Dries

    2016-01-01

    The efficiency of a wireless power transfer (WPT) system in the radiative near-field is inevitably affected by the variability in the design parameters of the deployed antennas and by uncertainties in their mutual position. Therefore, we propose a stochastic analysis that combines the generalized polynomial chaos (gPC) theory with an efficient model for the interaction between devices in the radiative near-field. This framework enables us to investigate the impact of random effects on the power transfer efficiency (PTE) of a WPT system. More specifically, the WPT system under study consists of a transmitting horn antenna and a receiving textile antenna operating in the Industrial, Scientific and Medical (ISM) band at 2.45 GHz. First, we model the impact of the textile antenna’s variability on the WPT system. Next, we include the position uncertainties of the antennas in the analysis in order to quantify the overall variations in the PTE. The analysis is carried out by means of polynomial-chaos-based macromodels, whereas a Monte Carlo simulation validates the complete technique. It is shown that the proposed approach is very accurate, more flexible and more efficient than a straightforward Monte Carlo analysis, with demonstrated speedup factors up to 2500. PMID:27447632

  2. Novel Design of a Soft Lightweight Pneumatic Continuum Robot Arm with Decoupled Variable Stiffness and Positioning.

    Science.gov (United States)

    Giannaccini, Maria Elena; Xiang, Chaoqun; Atyabi, Adham; Theodoridis, Theo; Nefti-Meziani, Samia; Davis, Steve

    2018-02-01

    Soft robot arms possess unique capabilities when it comes to adaptability, flexibility, and dexterity. In addition, soft systems that are pneumatically actuated can claim high power-to-weight ratio. One of the main drawbacks of pneumatically actuated soft arms is that their stiffness cannot be varied independently from their end-effector position in space. The novel robot arm physical design presented in this article successfully decouples its end-effector positioning from its stiffness. An experimental characterization of this ability is coupled with a mathematical analysis. The arm combines the light weight, high payload to weight ratio and robustness of pneumatic actuation with the adaptability and versatility of variable stiffness. Light weight is a vital component of the inherent safety approach to physical human-robot interaction. To characterize the arm, a neural network analysis of the curvature of the arm for different input pressures is performed. The curvature-pressure relationship is also characterized experimentally.

  3. Photometric monitoring of pre-main sequence stars - 2

    International Nuclear Information System (INIS)

    Evans, A.; Davies, J.K.; Kilkenny, D.; Bode, M.F.

    1989-01-01

    A discussion is presented of the infrared and optical photometric variability of the pre-main sequence stars BF Ori and UX Ori. In the former case, the reddening that occurs during decline, at both optical and infrared wavelengths, is consistent with variable extinction by circumstellar grains having an interstellar-like reddening law. While in the case of UX Ori, the data suggest variability due to starspots. In both cases, a study of the polarimetric variability would be valuable to confirm these conclusions. (author)

  4. Performance of Glutamate Dehydrogenase and Triose Phosphate Isomerase Genes in the Analysis of Genotypic Variability of Isolates of Giardia duodenalis from Livestocks

    Science.gov (United States)

    Fava, Natália M. N.; Soares, Rodrigo M.; Scalia, Luana A. M.; Kalapothakis, Evanguedes; Pena, Isabella F.; Vieira, Carlos U.; Faria, Elaine S. M.; Cunha, Maria J.; Couto, Talles R.; Cury, Márcia Cristina

    2013-01-01

    Giardia duodenalis is a small intestinal protozoan parasite of several terrestrial vertebrates. This work aims to assess the genotypic variability of Giardia duodenalis isolates from cattle, sheep and pigs in the Southeast of Brazil, by comparing the standard characterization between glutamate dehydrogenase (gdh) and triose phosphate isomerase (tpi) primers. Fecal samples from the three groups of animals were analyzed using the zinc sulphate centrifugal flotation technique. Out of 59 positive samples, 30 were from cattle, 26 from sheep and 3 from pigs. Cyst pellets were stored and submitted to PCR and nested-PCR reactions with gdh and tpi primers. Fragment amplification of gdh and tpi genes was observed in 25 (42.4%) and 36 (61.0%) samples, respectively. Regarding the sequencing, 24 sequences were obtained with gdh and 20 with tpi. For both genes, there was a prevalence of E specific species assemblage, although some isolates have been identified as A and B, by the tpi sequencing. This has also shown a larger number of heterogeneous sequences, which have been attribute to mixed infections between assemblages B and E. The largest variability of inter-assemblage associated to the frequency of heterogeneity provided by tpi sequencing reinforces the polymorphic nature of this gene and makes it an excellent target for studies on molecular epidemiology. PMID:24308010

  5. Positive integer solutions of certain diophantine equations

    Indian Academy of Sciences (India)

    BIJAN KUMAR PATEL

    2018-03-19

    Mar 19, 2018 ... integer solutions. They also found all the positive integer solutions of the given equations in terms of Fibonacci and Lucas numbers. Another interesting number sequence which is closely related to the sequence of. Fibonacci numbers is the sequence of balancing numbers. In 1999, Behera et al. [1] intro-.

  6. Automatic Sequences and Zip-Specifications

    NARCIS (Netherlands)

    Grabmayer, C.A.; Endrullis, J.; Hendriks, D.; Klop, J.W.; Moss, L.S.

    2012-01-01

    We consider infinite sequences of symbols, also known as streams, and the decidability question for equality of streams defined in a restricted format. This restricted format consists of prefixing a symbol at the head of a stream, of the stream function `zip', and recursion variables. Here `zip'

  7. Network clustering coefficient approach to DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gerhardt, Guenther J.L. [Universidade Federal do Rio Grande do Sul-Hospital de Clinicas de Porto Alegre, Rua Ramiro Barcelos 2350/sala 2040/90035-003 Porto Alegre (Brazil); Departamento de Fisica e Quimica da Universidade de Caxias do Sul, Rua Francisco Getulio Vargas 1130, 95001-970 Caxias do Sul (Brazil); Lemke, Ney [Programa Interdisciplinar em Computacao Aplicada, Unisinos, Av. Unisinos, 950, 93022-000 Sao Leopoldo, RS (Brazil); Corso, Gilberto [Departamento de Biofisica e Farmacologia, Centro de Biociencias, Universidade Federal do Rio Grande do Norte, Campus Universitario, 59072 970 Natal, RN (Brazil)]. E-mail: corso@dfte.ufrn.br

    2006-05-15

    In this work we propose an alternative DNA sequence analysis tool based on graph theoretical concepts. The methodology investigates the path topology of an organism genome through a triplet network. In this network, triplets in DNA sequence are vertices and two vertices are connected if they occur juxtaposed on the genome. We characterize this network topology by measuring the clustering coefficient. We test our methodology against two main bias: the guanine-cytosine (GC) content and 3-bp (base pairs) periodicity of DNA sequence. We perform the test constructing random networks with variable GC content and imposed 3-bp periodicity. A test group of some organisms is constructed and we investigate the methodology in the light of the constructed random networks. We conclude that the clustering coefficient is a valuable tool since it gives information that is not trivially contained in 3-bp periodicity neither in the variable GC content.

  8. Differentiation of Xylella fastidiosa strains via multilocus sequence analysis of environmentally mediated genes (MLSA-E).

    Science.gov (United States)

    Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo

    2012-03-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing improved disease management in economically important crops.

  9. Draft genome sequence of Therminicola potens strain JR

    Energy Technology Data Exchange (ETDEWEB)

    Byrne-Bailey, K.G.; Wrighton, K.C.; Melnyk, R.A.; Agbo, P.; Hazen, T.C.; Coates, J.D.

    2010-07-01

    'Thermincola potens' strain JR is one of the first Gram-positive dissimilatory metal-reducing bacteria (DMRB) for which there is a complete genome sequence. Consistent with the physiology of this organism, preliminary annotation revealed an abundance of multiheme c-type cytochromes that are putatively associated with the periplasm and cell surface in a Gram-positive bacterium. Here we report the complete genome sequence of strain JR.

  10. Position detector

    International Nuclear Information System (INIS)

    Hayakawa, Toshifumi.

    1985-01-01

    Purpose: To enable to detect the position of an moving object in a control rod position detector, stably in a digital manner at a high accuracy and free from the undesired effects of circumstantial conditions such as the reactor temperature. Constitution: Coils connected in parallel with each other are disposed along the passage of a moving object and variable resistors and relays are connected in series with each of the coils respectively. Light emitting diodes is connected in series with the contacts of the respective relays. The resistance value of the variable resistors are adjusted depending on the changes in the circumstantial conditions and temperature distribution upon carrying out the positional detection. When the object is inserted into a coils, the relevant relay is deenergized, by which the relay contacts are closed to light up the diode. In the same manner, as the object is successively inserted into the coils, the diodes are lighted-up successively thereby enabling highly accurate and stable positional detection in a digital manner, free from the undesired effects of the circumstantial conditions. (Horiuchi, T.)

  11. Decreased Heart Rate Variability in HIV Positive Patients Receiving Antiretroviral Therapy: Importance of Blood Glucose and Cholesterol

    DEFF Research Database (Denmark)

    Askgaard, Gro; Kristoffersen, Ulrik Sloth; Mehlsen, Jesper

    2011-01-01

    whether autonomic dysfunction is present in an ART treated HIV population and if so to identify factors of importance. METHODS: HIV patients receiving ART for at least 12 months (n¿=¿97) and an age-matched control group of healthy volunteers (n¿=¿52) were included. All were non-diabetic and had never......-intervals (RMSSD) or the percent of differences between adjacent NN intervals greater than 50 ms (pNN50). In the HIV positives, haemoglobin A1c correlated inversely with SDNN, RMSSD and pNN50 (pcorrelated inversely with RMSSD and pNN50 (p...4 cell count nor CD4 nadir correlated with time or phase domain HRV variables. CONCLUSIONS: Moderate autonomic dysfunction is present in HIV positives patients even with suppressed viral load due to ART. The dysfunction is correlated with HbA1c and hypercholesterolemia but not to duration of HIV...

  12. Towards Efficient Positional Inverted Index †

    Directory of Open Access Journals (Sweden)

    Petr Procházka

    2017-02-01

    Full Text Available We address the problem of positional indexing in the natural language domain. The positional inverted index contains the information of the word positions. Thus, it is able to recover the original text file, which implies that it is not necessary to store the original file. Our Positional Inverted Self-Index (PISI stores the word position gaps encoded by variable byte code. Inverted lists of single terms are combined into one inverted list that represents the backbone of the text file since it stores the sequence of the indexed words of the original file. The inverted list is synchronized with a presentation layer that stores separators, stop words, as well as variants of the indexed words. The Huffman coding is used to encode the presentation layer. The space complexity of the PISI inverted list is O ( ( N − n ⌈ log 2 b N ⌉ + ( ⌊ N − n α ⌋ + n × ( ⌈ log 2 b n ⌉ + 1 where N is a number of stems, n is a number of unique stems, α is a step/period of the back pointers in the inverted list and b is the size of the word of computer memory given in bits. The space complexity of the presentation layer is O ( − ∑ i = 1 N ⌈ log 2 p i n ( i ⌉ − ∑ j = 1 N ′ ⌈ log 2 p j ′ ⌉ + N with respect to p i n ( i as a probability of a stem variant at position i, p j ′ as the probability of separator or stop word at position j and N ′ as the number of separators and stop words.

  13. Evidence for positive, but not negative, behavioral contrast with wheel-running reinforcement on multiple variable-ratio schedules.

    Science.gov (United States)

    Belke, Terry W; Pierce, W David

    2016-12-01

    Rats responded on a multiple variable-ratio (VR) 10 VR 10 schedule of reinforcement in which lever pressing was reinforced by the opportunity to run in a wheel for 30s in both the changed (manipulated) and unchanged components. To generate positive contrast, the schedule of reinforcement in the changed component was shifted to extinction; to generate negative contrast, the schedule was shifted to VR 3. With the shift to extinction in the changed component, wheel-running and local lever-pressing rates increased in the unchanged component, a result supporting positive contrast; however, the shift to a VR 3 schedule in the changed component showed no evidence of negative contrast in the unaltered setting, only wheel running decreased in the unchanged component. Changes in wheel-running rates across components were consistent in showing a compensation effect, depending on whether the schedule manipulation increased or decreased opportunities for wheel running in the changed component. These findings are the first to demonstrate positive behavioral contrast on a multiple schedule with wheel running as reinforcement in both components. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  15. Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

    Science.gov (United States)

    A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.

  16. Genetic variability of attachment (G and Fusion (F protein genes of human metapneumovirus strains circulating during 2006-2009 in Kolkata, Eastern India

    Directory of Open Access Journals (Sweden)

    Chawla-Sarkar Mamta

    2011-02-01

    Full Text Available Abstract Background Human metapneumovirus (hMPV is associated with the acute respiratory tract infection (ARTI in all the age groups. However, there is limited information on prevalence and genetic diversity of human metapneumovirus (hMPV strains circulating in India. Objective To study prevalence and genomic diversity of hMPV strains among ARTI patients reporting in outpatient departments of hospitals in Kolkata, Eastern India. Methods Nasal and/or throat swabs from 2309 patients during January 2006 to December 2009, were screened for the presence of hMPV by RT-PCR of nucleocapsid (N gene. The G and F genes of representative hMPV positive samples were sequenced. Results 118 of 2309 (5.11% clinical samples were positive for hMPV. The majority (≈80% of the positive cases were detected during July−November all through the study period. Genetic analysis revealed that 77% strains belong to A2 subgroup whereas rest clustered in B1 subgroup. G sequences showed higher diversity at the nucleotide and amino acid level. In contrast, less than 10% variation was observed in F gene of representative strains of all four years. Sequence analysis also revealed changes in the position of stop codon in G protein, which resulted in variable length (217-231 aa polypeptides. Conclusion The study suggests that approximately 5% of ARTI in the region were caused by hMPV. This is the first report on the genetic variability of G and F gene of hMPV strains from India which clearly shows that the G protein of hMPV is continuously evolving. Though the study partially fulfills lacunae of information, further studies from other regions are necessary for better understanding of prevalence, epidemiology and virus evolution in Indian subcontinent.

  17. Discovering frequently recurring movement sequences in team-sport athlete spatiotemporal data.

    Science.gov (United States)

    Sweeting, Alice J; Aughey, Robert J; Cormack, Stuart J; Morgan, Stuart

    2017-12-01

    Athlete external load is typically analysed from predetermined movement thresholds. The combination of movement sequences and differences in these movements between playing positions is also currently unknown. This study developed a method to discover the frequently recurring movement sequences across playing position during matches. The external load of 12 international female netball athletes was collected by a local positioning system during four national-level matches. Velocity, acceleration and angular velocity were calculated from positional (X, Y) data, clustered via one-dimensional k-means and assigned a unique alphabetic label. Combinations of velocity, acceleration and angular velocity movement were compared using the Levenshtein distance and similarities computed by the longest common substring problem. The contribution of each movement sequence, according to playing position and relative to the wider data set, was then calculated via the Minkowski distance. A total of 10 frequently recurring combinations of movement were discovered, regardless of playing position. Only the wing attack, goal attack and goal defence playing positions are closely related. We developed a technique to discover the movement sequences, according to playing position, performed by elite netballers. This methodology can be extended to discover the frequently recurring movements within other team sports and across levels of competition.

  18. HIV Sequence Compendium 2010

    Energy Technology Data Exchange (ETDEWEB)

    Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2010-12-31

    This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  19. ReRep: Computational detection of repetitive sequences in genome survey sequences (GSS

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcelo

    2008-09-01

    Full Text Available Abstract Background Genome survey sequences (GSS offer a preliminary global view of a genome since, unlike ESTs, they cover coding as well as non-coding DNA and include repetitive regions of the genome. A more precise estimation of the nature, quantity and variability of repetitive sequences very early in a genome sequencing project is of considerable importance, as such data strongly influence the estimation of genome coverage, library quality and progress in scaffold construction. Also, the elimination of repetitive sequences from the initial assembly process is important to avoid errors and unnecessary complexity. Repetitive sequences are also of interest in a variety of other studies, for instance as molecular markers. Results We designed and implemented a straightforward pipeline called ReRep, which combines bioinformatics tools for identifying repetitive structures in a GSS dataset. In a case study, we first applied the pipeline to a set of 970 GSSs, sequenced in our laboratory from the human pathogen Leishmania braziliensis, the causative agent of leishmaniosis, an important public health problem in Brazil. We also verified the applicability of ReRep to new sequencing technologies using a set of 454-reads of an Escheria coli. The behaviour of several parameters in the algorithm is evaluated and suggestions are made for tuning of the analysis. Conclusion The ReRep approach for identification of repetitive elements in GSS datasets proved to be straightforward and efficient. Several potential repetitive sequences were found in a L. braziliensis GSS dataset generated in our laboratory, and further validated by the analysis of a more complete genomic dataset from the EMBL and Sanger Centre databases. ReRep also identified most of the E. coli K12 repeats prior to assembly in an example dataset obtained by automated sequencing using 454 technology. The parameters controlling the algorithm behaved consistently and may be tuned to the properties

  20. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  1. Daily affect variability and context-specific alcohol consumption.

    Science.gov (United States)

    Mohr, Cynthia D; Arpin, Sarah; McCabe, Cameron T

    2015-11-01

    Research explored the effects of variability in negative and positive affect on alcohol consumption, specifying daily fluctuation in affect as a critical form of emotion dysregulation. Using daily process methodology allows for a more objective calculation of affect variability relative to traditional self-reports. The present study models within-person negative and positive affect variabilities as predictors of context-specific consumption (i.e. solitary vs. social drinking), controlling for mean levels of affect. A community sample of moderate-to-heavy drinkers (n = 47; 49% women) from a US metropolitan area reported on affect and alcohol consumption thrice daily for 30 days via a handheld electronic interviewer. Within-person affect variability was calculated using daily standard deviations in positive and negative affect. Within person, greater negative and positive variabilities are related to greater daily solitary and social consumption. Across study days, mean levels of negative and positive affect variabilities related to greater social consumption between persons; yet, aggregated negative affect variability was related to less solitary consumption. Results affirm affect variability as a unique predictor of alcohol consumption, independent of mean affect levels. Yet, it is important to differentiate social context of consumption, as well as type of affect variability, particularly at the between-person level. These distinctions help clarify inconsistencies in the self-medication literature regarding associations between average levels of affect and consumption. Importantly, consistent within-person relationships for both variabilities support arguments that both negative and positive affect variabilities are detrimental and reflect an inability to regulate emotional experience. © 2015 Australasian Professional Society on Alcohol and other Drugs.

  2. Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

    Science.gov (United States)

    Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

    1997-11-01

    A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

  3. A Method of Approximating Expectations of Functions of Sums of Independent Random Variables

    OpenAIRE

    Klass, Michael J.

    1981-01-01

    Let $X_1, X_2, \\cdots$ be a sequence of independent random variables with $S_n = \\sum^n_{i = 1} X_i$. Fix $\\alpha > 0$. Let $\\Phi(\\cdot)$ be a continuous, strictly increasing function on $\\lbrack 0, \\infty)$ such that $\\Phi(0) = 0$ and $\\Phi(cx) \\leq c^\\alpha\\Phi(x)$ for all $x > 0$ and all $c \\geq 2$. Suppose $a$ is a real number and $J$ is a finite nonempty subset of the positive integers. In this paper we are interested in approximating $E \\max_{j \\in J} \\Phi(|a + S_j|)$. We construct a nu...

  4. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Science.gov (United States)

    Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

    2017-01-01

    The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  5. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Directory of Open Access Journals (Sweden)

    Heewon Seo

    Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  6. Experimental Evaluation of Novel Master-Slave Configurations for Position Control under Random Network Delay and Variable Load for Teleoperation

    Directory of Open Access Journals (Sweden)

    Ahmet Kuzu

    2014-01-01

    Full Text Available This paper proposes two novel master-slave configurations that provide improvements in both control and communication aspects of teleoperation systems to achieve an overall improved performance in position control. The proposed novel master-slave configurations integrate modular control and communication approaches, consisting of a delay regulator to address problems related to variable network delay common to such systems, and a model tracking control that runs on the slave side for the compensation of uncertainties and model mismatch on the slave side. One of the configurations uses a sliding mode observer and the other one uses a modified Smith predictor scheme on the master side to ensure position transparency between the master and slave, while reference tracking of the slave is ensured by a proportional-differentiator type controller in both configurations. Experiments conducted for the networked position control of a single-link arm under system uncertainties and randomly varying network delays demonstrate significant performance improvements with both configurations over the past literature.

  7. [The use of 16S rDNA sequencing in species diversity analysis for sputum of patients with ventilator-associated pneumonia].

    Science.gov (United States)

    Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai

    2014-05-01

    To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium

  8. Serological and genetic characterisation of bovine respiratory syncytial virus (BRSV) indicates that Danish isolates belong to the intermediate subgroup: no evidence of a selective effect on the variability of G protein nucleotide sequence by prior cell culture adaption and passages in cell culture

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.

    1998-01-01

    on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...

  9. [Analysis of COX1 sequences of Taenia isolates from four areas of Guangxi].

    Science.gov (United States)

    Yang, Yi-Chao; Ou-Yang, Yi; Su, Ai-Rong; Wan, Xiao-Ling; Li, Shu-Lin

    2012-06-01

    To analyze the COX1 sequences of Taenia isolates from four areas of Guangxi Zhuang Autonomous Region, and to understand the distribution of Taenia asiatica in Guangxi. Patients with taeniasis in Luzhai, Rongshui, Tiandong and Sanjiang in Guangxi were treated by deworming, and the Taenia isolates were collected. Cyclooxygenase-1 (COX1) sequences of these isolates were amplified by PCR, and the PCR products were sequenced by T-A clone sequencing. The homogeneities and genetic distances were calculated and analyzed, and the phylogenic trees were constructed by some softwares. Meanwhile, the COX1 sequences of the isolates from the 4 areas were compared separately with the sequences of Taenia species in GenBank. The COX1 sequence of the 5 Taenia isolates collected had the same length of 444 bp. There were 5 variable positions between the Luzhai isolate and Taenia asiatica, the homogeneity was 98.87% and their genetic distance was 0.011. The phylogenetic tree analysis revealed that the Luzhai isolate and Taenia asiatica locating at the same node had a close relationship. The homogeneity between Rongshui isolate A and Taenia solium was 100%, while the homogeneity of Rongshui isolate B with Taeniasis saginata and Taenia asiatica were 98.20% and 96.17%, respectively. The homogeneities of the Tiandong and Sanjiang isolates with Taenia solium were 99.55% and 96.40%, respectively, and the genetic distances were 0.005 and 0.037, respectively. The homogeneity between the Luzhai isolate and Taeniasis saginate was 96.40%. Taenia asiatica exists in Luzhai and Taenia solium and Taenia saginata coexist in Rongshui, Guangxi Zhuang Autonomous Region.

  10. Serum bilirubin levels are positively associated with glycemic variability in women with type 2 diabetes.

    Science.gov (United States)

    Kim, Lee Kyung; Roh, Eun; Kim, Min Joo; Kim, Min Kyeong; Park, Kyeong Seon; Kwak, Soo Heon; Cho, Young Min; Park, Kyong Soo; Jang, Hak Chul; Jung, Hye Seung

    2016-11-01

    Glycemic variability is known to induce oxidative stress. We investigated the relationships between glycemic variability and serum bilirubin levels, an endogenous anti-oxidant, in patients with diabetes. A cross-sectional study was carried out with 77 patients with type 2 diabetes who had been recruited to two clinical studies from 2008 to 2014. There were no participants with diseases of the pancreas, liver, biliary tract and chronic renal insufficiency. Glycemic variation was calculated by a continuous glucose monitoring system, and correlation analyses were carried out to evaluate their association with bilirubin levels. Multiple linear regression was carried out to identify independent factors influencing bilirubin levels and glycemic variation. Among the participants, 42.3% were men. The mean (standard deviation) age was 61.5 years (10.4 years), body mass index was 24.2 kg/m 2 (2.8 kg/m 2 ), diabetes duration was 17.7 years (9.5 years), hemoglobin A 1c was 60.7 mmol/mol (7.1 mmol/mol; 7.7 [0.7]%) and bilirubin was 11.8 μmol/L (4.10 μmol/L). Serum bilirubin levels were not different according to age, body mass index and hemoglobin A 1c . However, the mean amplitude of glucose excursion was positively associated with bilirubin levels in women (r = 0.588, P bilirubin and mean amplitude of glucose excursion remained significant (r = 0.566, P bilirubin was an independent determinant for the mean amplitude of glucose excursion in women. 1,5-Anhydroglucitol was also associated with bilirubin levels in women. Bilirubin level within the physiological range might be an independent predictor for glycemic variability in women with type 2 diabetes. © 2016 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, Ltd.

  11. Third-Generation Sequencing and Analysis of Four Complete Pig Liver Esterase Gene Sequences in Clones Identified by Screening BAC Library.

    Science.gov (United States)

    Zhou, Qiongqiong; Sun, Wenjuan; Liu, Xiyan; Wang, Xiliang; Xiao, Yuncai; Bi, Dingren; Yin, Jingdong; Shi, Deshi

    2016-01-01

    Pig liver carboxylesterase (PLE) gene sequences in GenBank are incomplete, which has led to difficulties in studying the genetic structure and regulation mechanisms of gene expression of PLE family genes. The aim of this study was to obtain and analysis of complete gene sequences of PLE family by screening from a Rongchang pig BAC library and third-generation PacBio gene sequencing. After a number of existing incomplete PLE isoform gene sequences were analysed, primers were designed based on conserved regions in PLE exons, and the whole pig genome used as a template for Polymerase chain reaction (PCR) amplification. Specific primers were then selected based on the PCR amplification results. A three-step PCR screening method was used to identify PLE-positive clones by screening a Rongchang pig BAC library and PacBio third-generation sequencing was performed. BLAST comparisons and other bioinformatics methods were applied for sequence analysis. Five PLE-positive BAC clones, designated BAC-10, BAC-70, BAC-75, BAC-119 and BAC-206, were identified. Sequence analysis yielded the complete sequences of four PLE genes, PLE1, PLE-B9, PLE-C4, and PLE-G2. Complete PLE gene sequences were defined as those containing regulatory sequences, exons, and introns. It was found that, not only did the PLE exon sequences of the four genes show a high degree of homology, but also that the intron sequences were highly similar. Additionally, the regulatory region of the genes contained two 720bps reverse complement sequences that may have an important function in the regulation of PLE gene expression. This is the first report to confirm the complete sequences of four PLE genes. In addition, the study demonstrates that each PLE isoform is encoded by a single gene and that the various genes exhibit a high degree of sequence homology, suggesting that the PLE family evolved from a single ancestral gene. Obtaining the complete sequences of these PLE genes provides the necessary foundation for

  12. Sequence analysis-based characterization and identification of neurovirulence-associated variants of 36 EV71 strains from China.

    Science.gov (United States)

    Xu, Jun; Wang, Fang; Zhao, Desheng; Liu, Jiang; Su, Hong; Wang, Baolong

    2018-03-30

    Enterovirus 71 (EV71) is the main pathogen of hand-foot-mouth disease (HFMD) and causes several neurological complications. As new strains of EV71 are constantly discovered, it is important to understand the genomic characteristics of the viruses and the mechanism of virulence. Herein, we isolated five strains of EV71 from HFMD patients with or without neurovirulence and sequenced their whole genomes. We then performed whole genome sequence analysis of totally 36 EV71 strains. The phylogenetic analysis of the VP1 region revealed all five isolated strains are clustered into C4a of C4 subgenotype. In addition, by comparing the complete genome sequences of 36 strains, 253 variable amino acid positions were found, 14 of which were identified to be associated with neurovirulence (P < 0.05). Moreover, a similar pattern of amino acid variants combination was identified in four strains without neurovirulence, indicating this type of variant pattern might be associated with avirulence. The strains with neurovirulence appeared to be distinguished from those without neurovirulence by the variants in VP1 and P2 regions, implying VP1 and P2 are the important regions associated with neurovirulence. Indeed, 3-D modeling of VP1 and P2 regions of non-neurovirulent and neurovirulent strains revealed that the different variants resulted in different protein structures and amino acid composition of ligand binding site, which might account for their difference in neurovirulence. In summary, our study reveals 14 variable amino acid positions of VP1, P2 and P3 regions are related to the virulence and that mutations in the capsid proteins of EV71 might contribute to neurovirulence. © 2018 Wiley Periodicals, Inc.

  13. Photometric search for variable stars in the young open cluster Berkeley 59

    Science.gov (United States)

    Lata, Sneh; Pandey, A. K.; Maheswar, G.; Mondal, Soumen; Kumar, Brijesh

    2011-12-01

    We present the time series photometry of stars located in the extremely young open cluster Berkeley 59. Using the 1.04-m telescope at Aryabhatta Research Institute of Observational Sciences (ARIES), Nainital, we have identified 42 variables in a field of ˜13 × 13 arcmin2 around the cluster. The probable members of the cluster have been identified using a (V, V-I) colour-magnitude diagram and a (J-H, H-K) colour-colour diagram. 31 variables have been found to be pre-main-sequence stars associated with the cluster. The ages and masses of the pre-main-sequence stars have been derived from the colour-magnitude diagram by fitting theoretical models to the observed data points. The ages of the majority of the probable pre-main-sequence variable candidates range from 1 to 5 Myr. The masses of these pre-main-sequence variable stars have been found to be in the range of ˜0.3 to ˜3.5 M⊙, and these could be T Tauri stars. The present statistics reveal that about 90 per cent T Tauri stars have period dispersal of the discs of relatively massive stars.

  14. Central limit theorems for sequences with m(n)-dependent main part

    NARCIS (Netherlands)

    Nieuwenhuis, G.

    1992-01-01

    Let (Xi(n); n ϵ N, 1⩽i⩽h(n)) be a double sequence of random variables with h(n)→∞ as n→∞. Suppose that the sequence can be split into two parts: an m(n)-dependent sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of main terms and a sequence (Xi,m(n); n ϵ N, 1⩽i⩽h(n)) of residual terms. Here (m(n)) may be

  15. Complete sequencing of the bla(NDM-1)-positive IncA/C plasmid from Escherichia coli ST38 isolate suggests a possible origin from plant pathogens.

    Science.gov (United States)

    Sekizuka, Tsuyoshi; Matsui, Mari; Yamane, Kunikazu; Takeuchi, Fumihiko; Ohnishi, Makoto; Hishinuma, Akira; Arakawa, Yoshichika; Kuroda, Makoto

    2011-01-01

    The complete sequence of the plasmid pNDM-1_Dok01 carrying New Delhi metallo-β-lactamase (NDM-1) was determined by whole genome shotgun sequencing using Escherichia coli strain NDM-1_Dok01 (multilocus sequence typing type: ST38) and the transconjugant E. coli DH10B. The plasmid is an IncA/C incompatibility type composed of 225 predicted coding sequences in 195.5 kb and partially shares a sequence with bla(CMY-2)-positive IncA/C plasmids such as E. coli AR060302 pAR060302 (166.5 kb) and Salmonella enterica serovar Newport pSN254 (176.4 kb). The bla(NDM-1) gene in pNDM-1_Dok01 is terminally flanked by two IS903 elements that are distinct from those of the other characterized NDM-1 plasmids, suggesting that the bla(NDM-1) gene has been broadly transposed, together with various mobile elements, as a cassette gene. The chaperonin groES and groEL genes were identified in the bla(NDM-1)-related composite transposon, and phylogenetic analysis and guanine-cytosine content (GC) percentage showed similarities to the homologs of plant pathogens such as Pseudoxanthomonas and Xanthomonas spp., implying that plant pathogens are the potential source of the bla(NDM-1) gene. The complete sequence of pNDM-1_Dok01 suggests that the bla(NDM-1) gene was acquired by a novel composite transposon on an extensively disseminated IncA/C plasmid and transferred to the E. coli ST38 isolate.

  16. A Local Poisson Graphical Model for inferring networks from sequencing data.

    Science.gov (United States)

    Allen, Genevera I; Liu, Zhandong

    2013-09-01

    Gaussian graphical models, a class of undirected graphs or Markov Networks, are often used to infer gene networks based on microarray expression data. Many scientists, however, have begun using high-throughput sequencing technologies such as RNA-sequencing or next generation sequencing to measure gene expression. As the resulting data consists of counts of sequencing reads for each gene, Gaussian graphical models are not optimal for this discrete data. In this paper, we propose a novel method for inferring gene networks from sequencing data: the Local Poisson Graphical Model. Our model assumes a Local Markov property where each variable conditional on all other variables is Poisson distributed. We develop a neighborhood selection algorithm to fit our model locally by performing a series of l1 penalized Poisson, or log-linear, regressions. This yields a fast parallel algorithm for estimating networks from next generation sequencing data. In simulations, we illustrate the effectiveness of our methods for recovering network structure from count data. A case study on breast cancer microRNAs (miRNAs), a novel application of graphical models, finds known regulators of breast cancer genes and discovers novel miRNA clusters and hubs that are targets for future research.

  17. Variable volume combustor

    Science.gov (United States)

    Ostebee, Heath Michael; Ziminsky, Willy Steve; Johnson, Thomas Edward; Keener, Christopher Paul

    2017-01-17

    The present application provides a variable volume combustor for use with a gas turbine engine. The variable volume combustor may include a liner, a number of micro-mixer fuel nozzles positioned within the liner, and a linear actuator so as to maneuver the micro-mixer fuel nozzles axially along the liner.

  18. Loss of genetic variability in a hatchery strain of Senegalese sole (Solea senegalensis revealed by sequence data of the mitochondrial DNA control region and microsatellite markers

    Directory of Open Access Journals (Sweden)

    Pablo Sánchez

    2012-06-01

    Full Text Available Comparisons of the levels of genetic variation within and between a hatchery F1 (FAR, n=116 of Senegalese sole, Solea senegalensis, and its wild donor population (ATL, n = 26, both native to the SW Atlantic coast of the Iberian peninsula, as well as between the wild donor population and a wild western Mediterranean sample (MED, n=18, were carried out by characterizing 412 base pairs of the nucleotide sequence of the mitochondrial DNA control region I, and six polymorphic microsatellite loci. FAR showed a substantial loss of genetic variability (haplotypic diversity, h=0.49±0.066; nucleotide diversity, π=0.006±0.004; private allelic richness, pAg=0.28 to its donor population ATL (h=0.69±0.114; π=0.009±0.006; pAg=1.21. Pairwise FST values of microsatellite data were highly significant (P < 0.0001 between FAR and ATL (0.053 and FAR and MED (0.055. The comparison of wild samples revealed higher values of genetic variability in MED than in ATL, but only with mtDNA CR-I sequence data (h=0.948±0.033; π=0.030±0.016. However, pairwise ΦST and FST values between ATL and MED were highly significant (P < 0.0001 with mtDNA CR-I (0.228 and with microsatellite data (0.095, respectively. While loss of genetic variability in FAR could be associated with the sampling error when the broodstock was established, the results of parental and sibship inference suggest that most of these losses can be attributed to a high variance in reproductive success among members of the broodstock, particularly among females.

  19. Molecular design of sequence specific DNA alkylating agents.

    Science.gov (United States)

    Minoshima, Masafumi; Bando, Toshikazu; Shinohara, Ken-ichi; Sugiyama, Hiroshi

    2009-01-01

    Sequence-specific DNA alkylating agents have great interest for novel approach to cancer chemotherapy. We designed the conjugates between pyrrole (Py)-imidazole (Im) polyamides and DNA alkylating chlorambucil moiety possessing at different positions. The sequence-specific DNA alkylation by conjugates was investigated by using high-resolution denaturing polyacrylamide gel electrophoresis (PAGE). The results showed that polyamide chlorambucil conjugates alkylate DNA at flanking adenines in recognition sequences of Py-Im polyamides, however, the reactivities and alkylation sites were influenced by the positions of conjugation. In addition, we synthesized conjugate between Py-Im polyamide and another alkylating agent, 1-(chloromethyl)-5-hydroxy-1,2-dihydro-3H-benz[e]indole (seco-CBI). DNA alkylation reactivies by both alkylating polyamides were almost comparable. In contrast, cytotoxicities against cell lines differed greatly. These comparative studies would promote development of appropriate sequence-specific DNA alkylating polyamides against specific cancer cells.

  20. Overlapping positive and negative regulatory domains of the human β-interferon gene

    International Nuclear Information System (INIS)

    Goodbourn, S.; Maniatis, T.

    1988-01-01

    Virus of poly(I) x poly(C) induction of human β-interferon gene expression requires a 40-base-pair DNA sequence designated the interferon gene regulatory element (IRE). Previous studies have shown that the IRE contains both positive and negative regulatory DNA sequences. To localize these sequences and study their interactions, the authors have examined the effects of a large number of single-base mutations within the IRE on β-interferon gene regulation. They find that the IRE consists of two genetically separable positive regulatory domains and an overlapping negative control sequence. They propose that the β-interferon gene is switched off in uninduced cells by a repressor that blocks the interaction between one of the two positive regulatory sequences and a specific transcription factor. Induction would then lead to inactivation or displacement of the repressor and binding of transcription factors to both positive regulatory domains

  1. Identification and characterization of the multidrug resistance gene cfr in a Panton-Valentine leukocidin-positive sequence type 8 methicillin-resistant Staphylococcus aureus IVa (USA300) isolate.

    LENUS (Irish Health Repository)

    Shore, Anna C

    2010-12-01

    The staphylococcal cfr gene mediates resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A, a phenotype that has been termed PhLOPS(A). The cfr gene has mainly been associated with coagulase-negative staphylococcal isolates from animals, and only a few cfr-positive methicillin-resistant Staphylococcus aureus (MRSA) isolates have been described so far. This study reports the first description of a cfr-positive MRSA isolate (M05\\/0060) belonging to the pandemic Panton-Valentine leukocidin (PVL)-positive sequence type 8 MRSA IVa\\/USA300 (ST8-MRSA-IVa\\/USA300) clone. The cfr gene was detected in M05\\/0060 using a DNA microarray which was used to screen PVL-positive MRSA isolates for the presence of virulence genes, typing markers, and antimicrobial resistance genes. Antimicrobial susceptibility testing revealed that M05\\/0060 exhibited the cfr-associated resistance phenotype. Molecular analysis identified the presence of cfr and a second phenicol resistance gene, fexA, on a novel 45-kb conjugative plasmid, which was designated pSCFS7. Within pSCFS7, a DNA segment consisting of cfr, a truncated copy of insertion sequence IS21-558, and a region with homology to the DNA invertase gene bin3 of transposon Tn552 from Bacillus mycoides was integrated into the transposase gene tnpB of the fexA-carrying transposon Tn558. The emergence of a multidrug-resistant cfr-positive variant of ST8-MRSA-IVa\\/USA300 is alarming and requires ongoing surveillance. Moreover, the identification of a novel conjugative plasmid carrying the cfr gene indicates the ability of cfr to spread to other MRSA strains.

  2. Implicity Defined Neural Networks for Sequence Labeling

    Science.gov (United States)

    2017-02-13

    assumption - that a hid- den variable changes its state based only on its current state and observables. In finding maximum likelihood state sequences...this setup, we have the following variables : data X labels Y parameters θ and functions: implicit hidden layer definition H = F (θ, ξ,H) loss function L...tagging task. In future work, we intend to consider implicit varia - tions of other archetectures, such as the LSTM, as well as additional, more challenging

  3. Successful treatment of multifocal pedal infection in a feline immunodeficiency virus-positive cat with multiple Bowenoid in situ carcinomas containing papillomaviral DNA sequences

    OpenAIRE

    Allan E Kessell; Derek McNair; John S Munday; Richard Savory; Catriona Halliday; Richard Malik

    2017-01-01

    Case summary A 16-year-old, castrated male, feline immunodeficiency virus (FIV)-positive, domestic shorthair cat developed multiple skin lesions. Most of these were Bowenoid carcinoma in situ and contained DNA sequences consistent with Felis catus papillomavirus type 2. Two additional lesions that developed in the skin and subcutaneous tissues between the digital and carpal pads on the left forelimb and right hindlimb were shown by cytology, histology and culture to be caused by Prototheca wi...

  4. [Whole Genome Sequencing of Human mtDNA Based on Ion Torrent PGM™ Platform].

    Science.gov (United States)

    Cao, Y; Zou, K N; Huang, J P; Ma, K; Ping, Y

    2017-08-01

    To analyze and detect the whole genome sequence of human mitochondrial DNA (mtDNA) by Ion Torrent PGM™ platform and to study the differences of mtDNA sequence in different tissues. Samples were collected from 6 unrelated individuals by forensic postmortem examination, including chest blood, hair, costicartilage, nail, skeletal muscle and oral epithelium. Amplification of whole genome sequence of mtDNA was performed by 4 pairs of primer. Libraries were constructed with Ion Shear™ Plus Reagents kit and Ion Plus Fragment Library kit. Whole genome sequencing of mtDNA was performed using Ion Torrent PGM™ platform. Sanger sequencing was used to determine the heteroplasmy positions and the mutation positions on HVⅠ region. The whole genome sequence of mtDNA from all samples were amplified successfully. Six unrelated individuals belonged to 6 different haplotypes. Different tissues in one individual had heteroplasmy difference. The heteroplasmy positions and the mutation positions on HVⅠ region were verified by Sanger sequencing. After a consistency check by the Kappa method, it was found that the results of mtDNA sequence had a high consistency in different tissues. The testing method used in present study for sequencing the whole genome sequence of human mtDNA can detect the heteroplasmy difference in different tissues, which have good consistency. The results provide guidance for the further applications of mtDNA in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine

  5. Prediction of nucleosome positioning based on transcription factor binding sites.

    Directory of Open Access Journals (Sweden)

    Xianfu Yi

    Full Text Available BACKGROUND: The DNA of all eukaryotic organisms is packaged into nucleosomes, the basic repeating units of chromatin. The nucleosome consists of a histone octamer around which a DNA core is wrapped and the linker histone H1, which is associated with linker DNA. By altering the accessibility of DNA sequences, the nucleosome has profound effects on all DNA-dependent processes. Understanding the factors that influence nucleosome positioning is of great importance for the study of genomic control mechanisms. Transcription factors (TFs have been suggested to play a role in nucleosome positioning in vivo. PRINCIPAL FINDINGS: Here, the minimum redundancy maximum relevance (mRMR feature selection algorithm, the nearest neighbor algorithm (NNA, and the incremental feature selection (IFS method were used to identify the most important TFs that either favor or inhibit nucleosome positioning by analyzing the numbers of transcription factor binding sites (TFBSs in 53,021 nucleosomal DNA sequences and 50,299 linker DNA sequences. A total of nine important families of TFs were extracted from 35 families, and the overall prediction accuracy was 87.4% as evaluated by the jackknife cross-validation test. CONCLUSIONS: Our results are consistent with the notion that TFs are more likely to bind linker DNA sequences than the sequences in the nucleosomes. In addition, our results imply that there may be some TFs that are important for nucleosome positioning but that play an insignificant role in discriminating nucleosome-forming DNA sequences from nucleosome-inhibiting DNA sequences. The hypothesis that TFs play a role in nucleosome positioning is, thus, confirmed by the results of this study.

  6. PEPTIDE SOLUBILITY, STRUCTURE AND CHARGE POSITION EFFECT ON ADSORPTION BY ALUMINIUM HYDROXIDE

    Directory of Open Access Journals (Sweden)

    Mary Trujillo

    2008-04-01

    Full Text Available Solubility, structure and position of charges in a peptide antigen sequence can be mentioned as being amongst the basic features of adsorption. In order to study their effect on adsorption, seven analogue series were synthesized from a MSP-1 peptide sequence by systematically replacing each one of the positions in the peptide sequence by aspartic acid, glutamic acid, serine, alanine, asparagine, glutamine or lysine. Such modifications in analogue peptide sequences showed a non-regular tendency regarding solubility and adsorption data. Aspartic acid and Glutamic acid analogue series showed great improvements in adsorption, especially in peptides where Lysine in position 6 and Arginine in position 13 were replaced. Solubility of position 5 analogue was greater than the position 6 analogue in Aspartic acid series; however, the position 6 analogue showed best adsorption results whilst the Aspartic acid in position 5 analogue showed no adsorption in the same conditions. Nuclear Magnetic Resonance structural analysis revealed differences in the -helical structureextension between these analogues. The Aspartic acid in position 6, located in the polar side of the helix, may allow this analogueto fit better onto the adsorption regions suggesting that the local electrostatic charge is responsible for this behavior.

  7. Sequence recombination and conservation of Varroa destructor virus-1 and deformed wing virus in field collected honey bees (Apis mellifera.

    Directory of Open Access Journals (Sweden)

    Hui Wang

    Full Text Available We sequenced small (s RNAs from field collected honeybees (Apis mellifera and bumblebees (Bombuspascuorum using the Illumina technology. The sRNA reads were assembled and resulting contigs were used to search for virus homologues in GenBank. Matches with Varroadestructor virus-1 (VDV1 and Deformed wing virus (DWV genomic sequences were obtained for A. mellifera but not B. pascuorum. Further analyses suggested that the prevalent virus population was composed of VDV-1 and a chimera of 5'-DWV-VDV1-DWV-3'. The recombination junctions in the chimera genomes were confirmed by using RT-PCR, cDNA cloning and Sanger sequencing. We then focused on conserved short fragments (CSF, size > 25 nt in the virus genomes by using GenBank sequences and the deep sequencing data obtained in this study. The majority of CSF sites confirmed conservation at both between-species (GenBank sequences and within-population (dataset of this study levels. However, conserved nucleotide positions in the GenBank sequences might be variable at the within-population level. High mutation rates (Pi>10% were observed at a number of sites using the deep sequencing data, suggesting that sequence conservation might not always be maintained at the population level. Virus-host interactions and strategies for developing RNAi treatments against VDV1/DWV infections are discussed.

  8. Investigation of occult hepatitis B virus infection in anti-hbc positive patients from a liver clinic.

    Science.gov (United States)

    Martinez, Maria Carmela; Kok, Chee Choy; Baleriola, Cristina; Robertson, Peter; Rawlinson, William D

    2015-01-01

    Occult hepatitis B infection (OBI) is manifested by presence of very low levels (Hepatitis B viral DNA (HBV DNA) in the blood and the liver while exhibiting undetectable HBV surface antigen (HBsAg). The molecular mechanisms underlying this occurrence are still not completely understood. This study investigated the prevalence of OBI in a high-risk Australian population and compared the HBV S gene sequences of our cohort with reference sequences. Serum from HBV DNA positive, HBsAg negative, and hepatitis B core antibody (anti-HBc) positive patients (study cohort) were obtained from samples tested at SEALS Serology Laboratory using the Abbott Architect, as part of screening and diagnostic testing. From a total of 228,108 samples reviewed, 1,451 patients were tested for all three OBI markers. Only 10 patients (0.69%) out of the 1,451 patients were found to fit the selection criteria for OBI. Sequence analysis of the HBV S gene from 5 suspected OBI infected patients showed increased sequence variability in the 'a' epitope of the major hydrophilic region compared to reference sequences. In addition, a total of eight consistent nucleotide substitutions resulting in seven amino acid changes were observed, and three patients had truncated S gene sequence. These mutations appeared to be stable and may result in alterations in HBsAg conformation. These may negatively impact the affinity of hepatitis B surface antibody (anti-HBs) and may explain the false negative results in serological HBV diagnosis. These changes may also enable the virus to persist in the liver by evading immune surveillance. Further studies on a bigger cohort are required to determine whether these amino acid variations have been acquired in the process of immune escape and serve as markers of OBI.

  9. Intracranial cerebrospinal fluid spaces imaging using a pulse-triggered three-dimensional turbo spin echo MR sequence with variable flip-angle distribution

    International Nuclear Information System (INIS)

    Hodel, Jerome; Silvera, Jonathan; Bekaert, Olivier; Decq, Philippe; Rahmouni, Alain; Bastuji-Garin, Sylvie; Vignaud, Alexandre; Petit, Eric; Durning, Bruno

    2011-01-01

    To assess the three-dimensional turbo spin echo with variable flip-angle distribution magnetic resonance sequence (SPACE: Sampling Perfection with Application optimised Contrast using different flip-angle Evolution) for the imaging of intracranial cerebrospinal fluid (CSF) spaces. We prospectively investigated 18 healthy volunteers and 25 patients, 20 with communicating hydrocephalus (CH), five with non-communicating hydrocephalus (NCH), using the SPACE sequence at 1.5T. Volume rendering views of both intracranial and ventricular CSF were obtained for all patients and volunteers. The subarachnoid CSF distribution was qualitatively evaluated on volume rendering views using a four-point scale. The CSF volumes within total, ventricular and subarachnoid spaces were calculated as well as the ratio between ventricular and subarachnoid CSF volumes. Three different patterns of subarachnoid CSF distribution were observed. In healthy volunteers we found narrowed CSF spaces within the occipital aera. A diffuse narrowing of the subarachnoid CSF spaces was observed in patients with NCH whereas patients with CH exhibited narrowed CSF spaces within the high midline convexity. The ratios between ventricular and subarachnoid CSF volumes were significantly different among the volunteers, patients with CH and patients with NCH. The assessment of CSF spaces volume and distribution may help to characterise hydrocephalus. (orig.)

  10. Intracranial cerebrospinal fluid spaces imaging using a pulse-triggered three-dimensional turbo spin echo MR sequence with variable flip-angle distribution

    Energy Technology Data Exchange (ETDEWEB)

    Hodel, Jerome [Unite Analyse et Restauration du Mouvement, UMR-CNRS, 8005 LBM ParisTech Ensam, Paris (France); University Paris Est Creteil (UPEC), Creteil (France); Assistance Publique-Hopitaux de Paris, Paris (France); Hopital Henri Mondor, Department of Neuroradiology, Creteil (France); Hopital Henri Mondor, Creteil (France); Silvera, Jonathan [University Paris Est Creteil (UPEC), Creteil (France); Assistance Publique-Hopitaux de Paris, Paris (France); Hopital Henri Mondor, Department of Neuroradiology, Creteil (France); Bekaert, Olivier; Decq, Philippe [Unite Analyse et Restauration du Mouvement, UMR-CNRS, 8005 LBM ParisTech Ensam, Paris (France); University Paris Est Creteil (UPEC), Creteil (France); Assistance Publique-Hopitaux de Paris, Paris (France); Hopital Henri Mondor, Department of Neurosurgery, Creteil (France); Rahmouni, Alain [University Paris Est Creteil (UPEC), Creteil (France); Assistance Publique-Hopitaux de Paris, Paris (France); Hopital Henri Mondor, Department of Radiology, Creteil (France); Bastuji-Garin, Sylvie [University Paris Est Creteil (UPEC), Creteil (France); Assistance Publique-Hopitaux de Paris, Paris (France); Hopital Henri Mondor, Department of Public Health, Creteil (France); Vignaud, Alexandre [Siemens Healthcare, Saint Denis (France); Petit, Eric; Durning, Bruno [Laboratoire Images Signaux et Systemes Intelligents, UPEC, Creteil (France)

    2011-02-15

    To assess the three-dimensional turbo spin echo with variable flip-angle distribution magnetic resonance sequence (SPACE: Sampling Perfection with Application optimised Contrast using different flip-angle Evolution) for the imaging of intracranial cerebrospinal fluid (CSF) spaces. We prospectively investigated 18 healthy volunteers and 25 patients, 20 with communicating hydrocephalus (CH), five with non-communicating hydrocephalus (NCH), using the SPACE sequence at 1.5T. Volume rendering views of both intracranial and ventricular CSF were obtained for all patients and volunteers. The subarachnoid CSF distribution was qualitatively evaluated on volume rendering views using a four-point scale. The CSF volumes within total, ventricular and subarachnoid spaces were calculated as well as the ratio between ventricular and subarachnoid CSF volumes. Three different patterns of subarachnoid CSF distribution were observed. In healthy volunteers we found narrowed CSF spaces within the occipital aera. A diffuse narrowing of the subarachnoid CSF spaces was observed in patients with NCH whereas patients with CH exhibited narrowed CSF spaces within the high midline convexity. The ratios between ventricular and subarachnoid CSF volumes were significantly different among the volunteers, patients with CH and patients with NCH. The assessment of CSF spaces volume and distribution may help to characterise hydrocephalus. (orig.)

  11. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  12. cis sequence effects on gene expression

    Directory of Open Access Journals (Sweden)

    Jacobs Kevin

    2007-08-01

    Full Text Available Abstract Background Sequence and transcriptional variability within and between individuals are typically studied independently. The joint analysis of sequence and gene expression variation (genetical genomics provides insight into the role of linked sequence variation in the regulation of gene expression. We investigated the role of sequence variation in cis on gene expression (cis sequence effects in a group of genes commonly studied in cancer research in lymphoblastoid cell lines. We estimated the proportion of genes exhibiting cis sequence effects and the proportion of gene expression variation explained by cis sequence effects using three different analytical approaches, and compared our results to the literature. Results We generated gene expression profiling data at N = 697 candidate genes from N = 30 lymphoblastoid cell lines for this study and used available candidate gene resequencing data at N = 552 candidate genes to identify N = 30 candidate genes with sufficient variance in both datasets for the investigation of cis sequence effects. We used two additive models and the haplotype phylogeny scanning approach of Templeton (Tree Scanning to evaluate association between individual SNPs, all SNPs at a gene, and diplotypes, with log-transformed gene expression. SNPs and diplotypes at eight candidate genes exhibited statistically significant (p cis sequence effects in our study, respectively. Conclusion Based on analysis of our results and the extant literature, one in four genes exhibits significant cis sequence effects, and for these genes, about 30% of gene expression variation is accounted for by cis sequence variation. Despite diverse experimental approaches, the presence or absence of significant cis sequence effects is largely supported by previously published studies.

  13. Extreme sequence divergence but conserved ligand-binding specificity in Streptococcus pyogenes M protein.

    Directory of Open Access Journals (Sweden)

    2006-05-01

    Full Text Available Many pathogenic microorganisms evade host immunity through extensive sequence variability in a protein region targeted by protective antibodies. In spite of the sequence variability, a variable region commonly retains an important ligand-binding function, reflected in the presence of a highly conserved sequence motif. Here, we analyze the limits of sequence divergence in a ligand-binding region by characterizing the hypervariable region (HVR of Streptococcus pyogenes M protein. Our studies were focused on HVRs that bind the human complement regulator C4b-binding protein (C4BP, a ligand that confers phagocytosis resistance. A previous comparison of C4BP-binding HVRs identified residue identities that could be part of a binding motif, but the extended analysis reported here shows that no residue identities remain when additional C4BP-binding HVRs are included. Characterization of the HVR in the M22 protein indicated that two relatively conserved Leu residues are essential for C4BP binding, but these residues are probably core residues in a coiled-coil, implying that they do not directly contribute to binding. In contrast, substitution of either of two relatively conserved Glu residues, predicted to be solvent-exposed, had no effect on C4BP binding, although each of these changes had a major effect on the antigenic properties of the HVR. Together, these findings show that HVRs of M proteins have an extraordinary capacity for sequence divergence and antigenic variability while retaining a specific ligand-binding function.

  14. Aerosol Drug Delivery During Noninvasive Positive Pressure Ventilation: Effects of Intersubject Variability and Excipient Enhanced Growth

    Science.gov (United States)

    Walenga, Ross L.; Kaviratna, Anubhav; Hindle, Michael

    2017-01-01

    Abstract Background: Nebulized aerosol drug delivery during the administration of noninvasive positive pressure ventilation (NPPV) is commonly implemented. While studies have shown improved patient outcomes for this therapeutic approach, aerosol delivery efficiency is reported to be low with high variability in lung-deposited dose. Excipient enhanced growth (EEG) aerosol delivery is a newly proposed technique that may improve drug delivery efficiency and reduce intersubject aerosol delivery variability when coupled with NPPV. Materials and Methods: A combined approach using in vitro experiments and computational fluid dynamics (CFD) was used to characterize aerosol delivery efficiency during NPPV in two new nasal cavity models that include face mask interfaces. Mesh nebulizer and in-line dry powder inhaler (DPI) sources of conventional and EEG aerosols were both considered. Results: Based on validated steady-state CFD predictions, EEG aerosol delivery improved lung penetration fraction (PF) values by factors ranging from 1.3 to 6.4 compared with conventional-sized aerosols. Furthermore, intersubject variability in lung PF was very high for conventional aerosol sizes (relative differences between subjects in the range of 54.5%–134.3%) and was reduced by an order of magnitude with the EEG approach (relative differences between subjects in the range of 5.5%–17.4%). Realistic in vitro experiments of cyclic NPPV demonstrated similar trends in lung delivery to those observed with the steady-state simulations, but with lower lung delivery efficiencies. Reaching the lung delivery efficiencies reported with the steady-state simulations of 80%–90% will require synchronization of aerosol administration during inspiration and reducing the size of the EEG aerosol delivery unit. Conclusions: The EEG approach enabled high-efficiency lung delivery of aerosols administered during NPPV and reduced intersubject aerosol delivery variability by an order of magnitude. Use of an in

  15. Aerosol Drug Delivery During Noninvasive Positive Pressure Ventilation: Effects of Intersubject Variability and Excipient Enhanced Growth.

    Science.gov (United States)

    Walenga, Ross L; Longest, P Worth; Kaviratna, Anubhav; Hindle, Michael

    2017-06-01

    Nebulized aerosol drug delivery during the administration of noninvasive positive pressure ventilation (NPPV) is commonly implemented. While studies have shown improved patient outcomes for this therapeutic approach, aerosol delivery efficiency is reported to be low with high variability in lung-deposited dose. Excipient enhanced growth (EEG) aerosol delivery is a newly proposed technique that may improve drug delivery efficiency and reduce intersubject aerosol delivery variability when coupled with NPPV. A combined approach using in vitro experiments and computational fluid dynamics (CFD) was used to characterize aerosol delivery efficiency during NPPV in two new nasal cavity models that include face mask interfaces. Mesh nebulizer and in-line dry powder inhaler (DPI) sources of conventional and EEG aerosols were both considered. Based on validated steady-state CFD predictions, EEG aerosol delivery improved lung penetration fraction (PF) values by factors ranging from 1.3 to 6.4 compared with conventional-sized aerosols. Furthermore, intersubject variability in lung PF was very high for conventional aerosol sizes (relative differences between subjects in the range of 54.5%-134.3%) and was reduced by an order of magnitude with the EEG approach (relative differences between subjects in the range of 5.5%-17.4%). Realistic in vitro experiments of cyclic NPPV demonstrated similar trends in lung delivery to those observed with the steady-state simulations, but with lower lung delivery efficiencies. Reaching the lung delivery efficiencies reported with the steady-state simulations of 80%-90% will require synchronization of aerosol administration during inspiration and reducing the size of the EEG aerosol delivery unit. The EEG approach enabled high-efficiency lung delivery of aerosols administered during NPPV and reduced intersubject aerosol delivery variability by an order of magnitude. Use of an in-line DPI device that connects to the NPPV mask appears to be a

  16. MRI of intracranial vertebral artery dissection: evaluation of intramural haematoma using a black blood, variable-flip-angle 3D turbo spin-echo sequence

    Energy Technology Data Exchange (ETDEWEB)

    Takano, Koichi; Yamashita, Shinnichi; Kuwabara, Yasuo; Yoshimitsu, Kengo [Fukuoka University, Department of Radiology, Faculty of Medicine, Fukuoka-shi, Fukuoka (Japan); Takemoto, Koichiro; Inoue, Tooru [Fukuoka University, Department of Neurosurgery, Faculty of Medicine, Fukuoka (Japan)

    2013-07-15

    We investigated the efficacy of three-dimensional black blood T1-weighted imaging (3D-BB-T1WI) using a variable refocusing flip angle turbo spin-echo sequence in the diagnosis of intracranial vertebral artery dissection (VAD). Sixteen consecutive patients diagnosed with intracranial VAD underwent magnetic resonance imaging that included 3D time-of-flight-MRA, axial spin-echo T1-weighted images (SE-T1WI) and oblique coronal 3D-BB-T1WI sequences. The visualization, morphology and extent of intramural haematomas were assessed and compared among the sequences. Results obtained by digital subtraction angiography (DSA), 3D-angiography and/or 3D-CT angiography (CTA) were used as standards of reference. 3D-BB-T1WI revealed intramural haematomas in all cases, whereas SE-T1WI and magnetic resonance angiography (MRA) failed to reveal a haematoma in one case and three cases, respectively. The mean visualization grading score for the intramural haematoma was the highest for 3D-BB-T1WI, and there was a statistically significant difference among the sequences (p < 0.001). At least a portion of the intramural haematoma was distinguishable from the lumen on 3D-BB-T1WI, whereas the haematomas were entirely indistinguishable from intraluminal signals on MRA in two cases (12.5 %) and on SE-T1WI in one case (6.3 %). 3D-BB-T1WI revealed the characteristic crescent shape of the intramural haematoma in 14 cases (87.5 %), whereas SE-T1WI and MRA revealed a crescent shape in only 7 cases (43.8 %) and 8 cases (50 %), respectively. In a consensus reading, 3D-BB-T1WI was considered the most consistent sequence in representing the extent and morphology of the lesion in 14 cases (87.5 %), compared to DSA and CTA. 3D-BB-T1WI is a promising method to evaluate intramural haematoma in patients with suspected intracranial VAD. (orig.)

  17. Embedded wavelet-based face recognition under variable position

    Science.gov (United States)

    Cotret, Pascal; Chevobbe, Stéphane; Darouich, Mehdi

    2015-02-01

    For several years, face recognition has been a hot topic in the image processing field: this technique is applied in several domains such as CCTV, electronic devices delocking and so on. In this context, this work studies the efficiency of a wavelet-based face recognition method in terms of subject position robustness and performance on various systems. The use of wavelet transform has a limited impact on the position robustness of PCA-based face recognition. This work shows, for a well-known database (Yale face database B*), that subject position in a 3D space can vary up to 10% of the original ROI size without decreasing recognition rates. Face recognition is performed on approximation coefficients of the image wavelet transform: results are still satisfying after 3 levels of decomposition. Furthermore, face database size can be divided by a factor 64 (22K with K = 3). In the context of ultra-embedded vision systems, memory footprint is one of the key points to be addressed; that is the reason why compression techniques such as wavelet transform are interesting. Furthermore, it leads to a low-complexity face detection stage compliant with limited computation resources available on such systems. The approach described in this work is tested on three platforms from a standard x86-based computer towards nanocomputers such as RaspberryPi and SECO boards. For K = 3 and a database with 40 faces, the execution mean time for one frame is 0.64 ms on a x86-based computer, 9 ms on a SECO board and 26 ms on a RaspberryPi (B model).

  18. Systematics of Cladophora spp. (Chlorophyta) from North Carolina, USA, based upon morphology and DNA sequence data with a description of Cladophora subtilissima sp. nov.

    Science.gov (United States)

    Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson

    2017-06-01

    Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.

  19. Real-time learning of predictive recognition categories that chunk sequences of items stored in working memory

    Directory of Open Access Journals (Sweden)

    Stephen eGrossberg

    2014-10-01

    Full Text Available How are sequences of events that are temporarily stored in a cognitive working memory unitized, or chunked, through learning? Such sequential learning is needed by the brain in order to enable language, spatial understanding, and motor skills to develop. In particular, how does the brain learn categories, or list chunks, that become selectively tuned to different temporal sequences of items in lists of variable length as they are stored in working memory, and how does this learning process occur in real time? The present article introduces a neural model that simulates learning of such list chunks. In this model, sequences of items are temporarily stored in an Item-and-Order, or competitive queuing, working memory before learning categorizes them using a categorization network, called a Masking Field, which is a self-similar, multiple-scale, recurrent on-center off-surround network that can weigh the evidence for variable-length sequences of items as they are stored in the working memory through time. A Masking Field hereby activates the learned list chunks that represent the most predictive item groupings at any time, while suppressing less predictive chunks. In a network with a given number of input items, all possible ordered sets of these item sequences, up to a fixed length, can be learned with unsupervised or supervised learning. The self-similar multiple-scale properties of Masking Fields interacting with an Item-and-Order working memory provide a natural explanation of George Miller's Magical Number Seven and Nelson Cowan's Magical Number Four. The article explains why linguistic, spatial, and action event sequences may all be stored by Item-and-Order working memories that obey similar design principles, and thus how the current results may apply across modalities. Item-and-Order properties may readily be extended to Item-Order-Rank working memories in which the same item can be stored in multiple list positions, or ranks, as in the list

  20. The Extremism of Two Variable Function Based on the Positive Definite Property

    Institute of Scientific and Technical Information of China (English)

    Lü Bao-xian; LI Xiu-li

    2004-01-01

    In this paper we give out a sufficientand solution of quadratic function's maximum with theory of quadratic form and give out the definition of the positivedefinite property of the following homogeneous polynomials of degree 2n two variables function, based on the definite of localmaximum of two variables function.

  1. Violation of an evolutionarily conserved immunoglobulin diversity gene sequence preference promotes production of dsDNA-specific IgG antibodies.

    Directory of Open Access Journals (Sweden)

    Aaron Silva-Sanchez

    Full Text Available Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3, which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH gene segment sequence content by reading frame (RF is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1, which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies.

  2. ϕ-statistically quasi Cauchy sequences

    Directory of Open Access Journals (Sweden)

    Bipan Hazarika

    2016-04-01

    Full Text Available Let P denote the space whose elements are finite sets of distinct positive integers. Given any element σ of P, we denote by p(σ the sequence {pn(σ} such that pn(σ=1 for n ∈ σ and pn(σ=0 otherwise. Further Ps={σ∈P:∑n=1∞pn(σ≤s}, i.e. Ps is the set of those σ whose support has cardinality at most s. Let (ϕn be a non-decreasing sequence of positive integers such that nϕn+1≤(n+1ϕn for all n∈N and the class of all sequences (ϕn is denoted by Φ. Let E⊆N. The number δϕ(E=lims→∞1ϕs|{k∈σ,σ∈Ps:k∈E}| is said to be the ϕ-density of E. A sequence (xn of points in R is ϕ-statistically convergent (or Sϕ-convergent to a real number ℓ for every ε > 0 if the set {n∈N:|xn−ℓ|≥ɛ} has ϕ-density zero. We introduce ϕ-statistically ward continuity of a real function. A real function is ϕ-statistically ward continuous if it preserves ϕ-statistically quasi Cauchy sequences where a sequence (xn is called to be ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy when (Δxn=(xn+1−xn is ϕ-statistically convergent to 0. i.e. a sequence (xn of points in R is called ϕ-statistically quasi Cauchy (or Sϕ-quasi Cauchy for every ε > 0 if {n∈N:|xn+1−xn|≥ɛ} has ϕ-density zero. Also we introduce the concept of ϕ-statistically ward compactness and obtain results related to ϕ-statistically ward continuity, ϕ-statistically ward compactness, statistically ward continuity, ward continuity, ward compactness, ordinary compactness, uniform continuity, ordinary continuity, δ-ward continuity, and slowly oscillating continuity.

  3. Enhanced precipitation variability decreases grass- and increases shrub-productivity

    Science.gov (United States)

    Gherardi, Laureano A.; Sala, Osvaldo E.

    2015-01-01

    Although projections of precipitation change indicate increases in variability, most studies of impacts of climate change on ecosystems focused on effects of changes in amount of precipitation, overlooking precipitation variability effects, especially at the interannual scale. Here, we present results from a 6-y field experiment, where we applied sequences of wet and dry years, increasing interannual precipitation coefficient of variation while maintaining a precipitation amount constant. Increased precipitation variability significantly reduced ecosystem primary production. Dominant plant-functional types showed opposite responses: perennial-grass productivity decreased by 81%, whereas shrub productivity increased by 67%. This pattern was explained by different nonlinear responses to precipitation. Grass productivity presented a saturating response to precipitation where dry years had a larger negative effect than the positive effects of wet years. In contrast, shrubs showed an increasing response to precipitation that resulted in an increase in average productivity with increasing precipitation variability. In addition, the effects of precipitation variation increased through time. We argue that the differential responses of grasses and shrubs to precipitation variability and the amplification of this phenomenon through time result from contrasting root distributions of grasses and shrubs and competitive interactions among plant types, confirmed by structural equation analysis. Under drought conditions, grasses reduce their abundance and their ability to absorb water that then is transferred to deep soil layers that are exclusively explored by shrubs. Our work addresses an understudied dimension of climate change that might lead to widespread shrub encroachment reducing the provisioning of ecosystem services to society. PMID:26417095

  4. DNA sequence explains seemingly disordered methylation levels in partially methylated domains of Mammalian genomes.

    Directory of Open Access Journals (Sweden)

    Dimos Gaidatzis

    2014-02-01

    Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.

  5. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria

    Directory of Open Access Journals (Sweden)

    Yunpeng Yang

    2017-01-01

    Full Text Available Catabolite control protein A (CcpA is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR and carbon catabolite activation (CCA, two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt consensus site that is called a catabolite response element (cre within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named crevar, has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA. It was found that the length of the intervening spacer of crevar can affect CcpA binding affinity, and moreover, the core palindromic sequence of crevar is the key structure for regulation. Such a variable architecture of crevar shows potential importance for CcpA’s diverse and fine regulation. A total of 103 potential crevar sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs, and 30 sites were confirmed to be bound by CcpA. These 30 crevar sites are associated with 27 genes involved in many important pathways. Also of significance, the crevar sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria.

  6. The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists

    Science.gov (United States)

    Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L; Nelson, Tanya N; Richer, Julie; Sadikovic, Bekim; Skidmore, David L; Stockley, Tracy; Taylor, Sherry; van Karnebeek, Clara; Zawati, Ma'n H; Lauzon, Julie; Armour, Christine M

    2015-01-01

    Purpose and scope The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it does not address the clinical application of this technology in other fields such as molecular investigation of cancer or for population screening of healthy individuals. Methods of statement development Two multidisciplinary groups consisting of medical geneticists, clinical laboratory geneticists, genetic counsellors, ethicists, lawyers and genetic researchers were assembled to review existing literature and guidelines on genome-wide sequencing for clinical genetic diagnosis in the context of monogenic diseases, and to make recommendations relevant to the Canadian context. The statement was circulated for comment to the Canadian College of Medical Geneticists (CCMG) membership-at-large and, following incorporation of feedback, approved by the CCMG Board of Directors. The CCMG is a Canadian organisation responsible for certifying medical geneticists and clinical laboratory geneticists, and for establishing professional and ethical standards for clinical genetics services in Canada. Results and conclusions Recommendations include (1) clinical genome-wide sequencing is an appropriate approach in the diagnostic assessment of a patient for whom there is suspicion of a significant monogenic disease that is associated with a high degree of genetic heterogeneity, or where specific genetic tests have failed to provide a diagnosis; (2) until the benefits of reporting incidental findings are established, we do not endorse the intentional clinical analysis of disease-associated genes

  7. The clinical application of genome-wide sequencing for monogenic diseases in Canada: Position Statement of the Canadian College of Medical Geneticists.

    Science.gov (United States)

    Boycott, Kym; Hartley, Taila; Adam, Shelin; Bernier, Francois; Chong, Karen; Fernandez, Bridget A; Friedman, Jan M; Geraghty, Michael T; Hume, Stacey; Knoppers, Bartha M; Laberge, Anne-Marie; Majewski, Jacek; Mendoza-Londono, Roberto; Meyn, M Stephen; Michaud, Jacques L; Nelson, Tanya N; Richer, Julie; Sadikovic, Bekim; Skidmore, David L; Stockley, Tracy; Taylor, Sherry; van Karnebeek, Clara; Zawati, Ma'n H; Lauzon, Julie; Armour, Christine M

    2015-07-01

    The aim of this Position Statement is to provide recommendations for Canadian medical geneticists, clinical laboratory geneticists, genetic counsellors and other physicians regarding the use of genome-wide sequencing of germline DNA in the context of clinical genetic diagnosis. This statement has been developed to facilitate the clinical translation and development of best practices for clinical genome-wide sequencing for genetic diagnosis of monogenic diseases in Canada; it does not address the clinical application of this technology in other fields such as molecular investigation of cancer or for population screening of healthy individuals. Two multidisciplinary groups consisting of medical geneticists, clinical laboratory geneticists, genetic counsellors, ethicists, lawyers and genetic researchers were assembled to review existing literature and guidelines on genome-wide sequencing for clinical genetic diagnosis in the context of monogenic diseases, and to make recommendations relevant to the Canadian context. The statement was circulated for comment to the Canadian College of Medical Geneticists (CCMG) membership-at-large and, following incorporation of feedback, approved by the CCMG Board of Directors. The CCMG is a Canadian organisation responsible for certifying medical geneticists and clinical laboratory geneticists, and for establishing professional and ethical standards for clinical genetics services in Canada. Recommendations include (1) clinical genome-wide sequencing is an appropriate approach in the diagnostic assessment of a patient for whom there is suspicion of a significant monogenic disease that is associated with a high degree of genetic heterogeneity, or where specific genetic tests have failed to provide a diagnosis; (2) until the benefits of reporting incidental findings are established, we do not endorse the intentional clinical analysis of disease-associated genes other than those linked to the primary indication; and (3) clinicians should

  8. Variable Cycle Intake for Reverse Core Engine

    Science.gov (United States)

    Suciu, Gabriel L (Inventor); Chandler, Jesse M (Inventor); Staubach, Joseph B (Inventor)

    2016-01-01

    A gas generator for a reverse core engine propulsion system has a variable cycle intake for the gas generator, which variable cycle intake includes a duct system. The duct system is configured for being selectively disposed in a first position and a second position, wherein free stream air is fed to the gas generator when in the first position, and fan stream air is fed to the gas generator when in the second position.

  9. THE HOST GALAXY PROPERTIES OF VARIABILITY SELECTED AGN IN THE PAN-STARRS1 MEDIUM DEEP SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Heinis, S.; Gezari, S.; Kumar, S. [Department of Astronomy, University of Maryland, College Park, MD (United States); Burgett, W. S.; Flewelling, H.; Huber, M. E.; Kaiser, N.; Wainscoat, R. J.; Waters, C. [Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States)

    2016-07-20

    We study the properties of 975 active galactic nuclei (AGNs) selected by variability in the Pan-STARRS1 Medium deep Survey. Using complementary multi-wavelength data from the ultraviolet to the far-infrared, we use spectral energy distribution fitting to determine the AGN and host properties at z < 1 and compare to a well-matched control sample. We confirm the trend previously observed: that the variability amplitude decreases with AGN luminosity, but we also observe that the slope of this relation steepens with wavelength, resulting in a “redder when brighter” trend at low luminosities. Our results show that AGNs are hosted by more massive hosts than control sample galaxies, while the rest frame dust-corrected NUV r color distribution of AGN hosts is similar to control galaxies. We find a positive correlation between the AGN luminosity and star formation rate (SFR), independent of redshift. AGN hosts populate the entire range of SFRs within and outside of the Main Sequence of star-forming galaxies. Comparing the distribution of AGN hosts and control galaxies, we show that AGN hosts are less likely to be hosted by quiescent galaxies and more likely to be hosted by Main Sequence or starburst galaxies.

  10. Understanding north-western Mediterranean climate variability: a multi-proxy and multi-sequence approach based on wavelet analysis.

    Science.gov (United States)

    Azuara, Julien; Lebreton, Vincent; Jalali, Bassem; Sicre, Marie-Alexandrine; Sabatier, Pierre; Dezileau, Laurent; Peyron, Odile; Frigola, Jaime; Combourieu-Nebout, Nathalie

    2017-04-01

    Forcings and physical mechanisms underlying Holocene climate variability still remain poorly understood. Comparison of different paleoclimatic reconstructions using spectral analysis allows to investigate their common periodicities and helps to understand the causes of past climate changes. Wavelet analysis applied on several proxy time series from the Atlantic domain already revealed the first key-issues on the origin of Holocene climate variability. However the differences in duration, resolution and variance between the time-series are important issues for comparing paleoclimatic sequences in the frequency domain. This work compiles 7 paleoclimatic proxy records from 4 time-series from the north-western Mediterranean all ranging from 7000 to 1000 yrs cal BP: -pollen and clay mineral contents from the lagoonal sediment core PB06 recovered in southern France, -Sea Surface Temperatures (SST) derived from alkenones, concentration of terrestrial alkanes and their average chain length (ACL) from core KSGC-31_GolHo-1B recovered in the Gulf of Lion inner-shelf, - δ18O record from speleothems recovered in the Asiul Cave in north-western Spain, -grain size record from the deep basin sediment drift core MD99-2343 north of Minorca island. A comparison of their frequency content is proposed using wavelet analysis and cluster analysis of wavelet power spectra. Common cyclicities are assessed using cross-wavelet analysis. In addition, a new algorithm is used in order to propagate the age model errors within wavelet power spectra. Results are consistents with a non-stationnary Holocene climate variability. The Halstatt cycles (2000-2500 years) depicted in many proxies (ACL, errestrial alkanes and SSTs) demonstrate solar activity influence in the north-western Mediterranean climate. Cluster analysis shows that pollen and ACL proxies, both indicating changes in aridity, are clearly distinct from other proxies and share significant common periodicities around 1000 and 600 years

  11. SOVEREIGN: An autonomous neural system for incrementally learning planned action sequences to navigate towards a rewarded goal.

    Science.gov (United States)

    Gnadt, William; Grossberg, Stephen

    2008-06-01

    How do reactive and planned behaviors interact in real time? How are sequences of such behaviors released at appropriate times during autonomous navigation to realize valued goals? Controllers for both animals and mobile robots, or animats, need reactive mechanisms for exploration, and learned plans to reach goal objects once an environment becomes familiar. The SOVEREIGN (Self-Organizing, Vision, Expectation, Recognition, Emotion, Intelligent, Goal-oriented Navigation) animat model embodies these capabilities, and is tested in a 3D virtual reality environment. SOVEREIGN includes several interacting subsystems which model complementary properties of cortical What and Where processing streams and which clarify similarities between mechanisms for navigation and arm movement control. As the animat explores an environment, visual inputs are processed by networks that are sensitive to visual form and motion in the What and Where streams, respectively. Position-invariant and size-invariant recognition categories are learned by real-time incremental learning in the What stream. Estimates of target position relative to the animat are computed in the Where stream, and can activate approach movements toward the target. Motion cues from animat locomotion can elicit head-orienting movements to bring a new target into view. Approach and orienting movements are alternately performed during animat navigation. Cumulative estimates of each movement are derived from interacting proprioceptive and visual cues. Movement sequences are stored within a motor working memory. Sequences of visual categories are stored in a sensory working memory. These working memories trigger learning of sensory and motor sequence categories, or plans, which together control planned movements. Predictively effective chunk combinations are selectively enhanced via reinforcement learning when the animat is rewarded. Selected planning chunks effect a gradual transition from variable reactive exploratory

  12. Pairwise local structural alignment of RNA sequences with sequence similarity less than 40%

    DEFF Research Database (Denmark)

    Havgaard, Jakob Hull; Lyngsø, Rune B.; Stormo, Gary D.

    2005-01-01

    detect two genes with low sequence similarity, where the genes are part of a larger genomic region. Results: Here we present such an approach for pairwise local alignment which is based on FILDALIGN and the Sankoff algorithm for simultaneous structural alignment of multiple sequences. We include...... the ability to conduct mutual scans of two sequences of arbitrary length while searching for common local structural motifs of some maximum length. This drastically reduces the complexity of the algorithm. The scoring scheme includes structural parameters corresponding to those available for free energy....... The structure prediction performance for a family is typically around 0.7 using Matthews correlation coefficient. In case (2), the algorithm is successful at locating RNA families with an average sensitivity of 0.8 and a positive predictive value of 0.9 using a BLAST-like hit selection scheme. Availability...

  13. RNAPattMatch: a web server for RNA sequence/structure motif detection based on pattern matching with flexible gaps

    Science.gov (United States)

    Drory Retwitzer, Matan; Polishchuk, Maya; Churkin, Elena; Kifer, Ilona; Yakhini, Zohar; Barash, Danny

    2015-01-01

    Searching for RNA sequence-structure patterns is becoming an essential tool for RNA practitioners. Novel discoveries of regulatory non-coding RNAs in targeted organisms and the motivation to find them across a wide range of organisms have prompted the use of computational RNA pattern matching as an enhancement to sequence similarity. State-of-the-art programs differ by the flexibility of patterns allowed as queries and by their simplicity of use. In particular—no existing method is available as a user-friendly web server. A general program that searches for RNA sequence-structure patterns is RNA Structator. However, it is not available as a web server and does not provide the option to allow flexible gap pattern representation with an upper bound of the gap length being specified at any position in the sequence. Here, we introduce RNAPattMatch, a web-based application that is user friendly and makes sequence/structure RNA queries accessible to practitioners of various background and proficiency. It also extends RNA Structator and allows a more flexible variable gaps representation, in addition to analysis of results using energy minimization methods. RNAPattMatch service is available at http://www.cs.bgu.ac.il/rnapattmatch. A standalone version of the search tool is also available to download at the site. PMID:25940619

  14. Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing.

    Science.gov (United States)

    Zhang, Yanying; Yang, Qingsong; Ling, Juan; Van Nostrand, Joy D; Shi, Zhou; Zhou, Jizhong; Dong, Junde

    2017-01-01

    Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata , Avicennia marina , and Ceriops tagal , was undertaken using high - throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

  15. Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Yanying Zhang

    2017-10-01

    Full Text Available Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata, Avicennia marina, and Ceriops tagal, was undertaken using high-throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

  16. Genome sequence of Desulfitobacterium hafniense DCB-2, a Gram-positive anaerobe capable of dehalogenation and metal reduction

    Directory of Open Access Journals (Sweden)

    Kim Sang-Hoon

    2012-02-01

    Full Text Available Abstract Background The genome of the Gram-positive, metal-reducing, dehalorespiring Desulfitobacterium hafniense DCB-2 was sequenced in order to gain insights into its metabolic capacities, adaptive physiology, and regulatory machineries, and to compare with that of Desulfitobacterium hafniense Y51, the phylogenetically closest strain among the species with a sequenced genome. Results The genome of Desulfitobacterium hafniense DCB-2 is composed of a 5,279,134-bp circular chromosome with 5,042 predicted genes. Genome content and parallel physiological studies support the cell's ability to fix N2 and CO2, form spores and biofilms, reduce metals, and use a variety of electron acceptors in respiration, including halogenated organic compounds. The genome contained seven reductive dehalogenase genes and four nitrogenase gene homologs but lacked the Nar respiratory nitrate reductase system. The D. hafniense DCB-2 genome contained genes for 43 RNA polymerase sigma factors including 27 sigma-24 subunits, 59 two-component signal transduction systems, and about 730 transporter proteins. In addition, it contained genes for 53 molybdopterin-binding oxidoreductases, 19 flavoprotein paralogs of the fumarate reductase, and many other FAD/FMN-binding oxidoreductases, proving the cell's versatility in both adaptive and reductive capacities. Together with the ability to form spores, the presence of the CO2-fixing Wood-Ljungdahl pathway and the genes associated with oxygen tolerance add flexibility to the cell's options for survival under stress. Conclusions D. hafniense DCB-2's genome contains genes consistent with its abilities for dehalogenation, metal reduction, N2 and CO2 fixation, anaerobic respiration, oxygen tolerance, spore formation, and biofilm formation which make this organism a potential candidate for bioremediation at contaminated sites.

  17. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  18. Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

    Science.gov (United States)

    Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

    2012-01-01

    Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

  19. Single-base resolution and long-coverage sequencing based on single-molecule nanomanipulation

    International Nuclear Information System (INIS)

    An Hongjie; Huang Jiehuan; Lue Ming; Li Xueling; Lue Junhong; Li Haikuo; Zhang Yi; Li Minqian; Hu Jun

    2007-01-01

    We show new approaches towards a novel single-molecule sequencing strategy which consists of high-resolution positioning isolation of overlapping DNA fragments with atomic force microscopy (AFM), subsequent single-molecule PCR amplification and conventional Sanger sequencing. In this study, a DNA labelling technique was used to guarantee the accuracy in positioning the target DNA. Single-molecule multiplex PCR was carried out to test the contamination. The results showed that the two overlapping DNA fragments isolated by AFM could be successfully sequenced with high quality and perfect contiguity, indicating that single-base resolution and long-coverage sequencing have been achieved simultaneously

  20. Mitochondrial DNA sequence evolution in shorebird populations

    NARCIS (Netherlands)

    Wenink, P.W.

    1994-01-01

    This thesis describes the global molecular population structure of two shorebird species, in particular of the dunlin, Calidris alpina, by means of comparative sequence analysis of the most variable part of the mitochondrial DNA (mtDNA) genome. There are several reasons

  1. Generation of pseudo-random sequences for spread spectrum systems

    Science.gov (United States)

    Moser, R.; Stover, J.

    1985-05-01

    The characteristics of pseudo random radio signal sequences (PRS) are explored. The randomness of the PSR is a matter of artificially altering the sequence of binary digits broadcast. Autocorrelations of the two sequences shifted in time, if high, determine if the signals are the same and thus allow for position identification. Cross-correlation can also be calculated between sequences. Correlations closest to zero are obtained with large volume of prime numbers in the sequences. Techniques for selecting optimal and maximal lengths for the sequences are reviewed. If the correlations are near zero in the sequences, then signal channels can accommodate multiple users. Finally, Gold codes are discussed as a technique for maximizing the code lengths.

  2. How psychological and behavioral team states change during positive and negative momentum.

    Science.gov (United States)

    Den Hartigh, Ruud J R; Gernigon, Christophe; Van Yperen, Nico W; Marin, Ludovic; Van Geert, Paul L C

    2014-01-01

    In business and sports, teams often experience periods of positive and negative momentum while pursuing their goals. However, researchers have not yet been able to provide insights into how psychological and behavioral states actually change during positive and negative team momentum. In the current study we aimed to provide these insights by introducing an experimental dynamical research design. Rowing pairs had to compete against a virtual opponent on rowing ergometers, while a screen in front of the team broadcasted the ongoing race. The race was manipulated so that the team's rowing avatar gradually progressed (positive momentum) or regressed (negative momentum) in relation to the victory. The participants responded verbally to collective efficacy and task cohesion items appearing on the screen each minute. In addition, effort exertion and interpersonal coordination were continuously measured. Our results showed negative psychological changes (perceptions of collective efficacy and task cohesion) during negative team momentum, which were stronger than the positive changes during positive team momentum. Moreover, teams' exerted efforts rapidly decreased during negative momentum, whereas positive momentum accompanied a more variable and adaptive sequence of effort exertion. Finally, the interpersonal coordination was worse during negative momentum than during positive momentum. These results provide the first empirical insights into actual team momentum dynamics, and demonstrate how a dynamical research approach significantly contributes to current knowledge on psychological and behavioral processes.

  3. Analysis of the overdispersed clock in the short-term evolution of hepatitis C virus: Using the E1/E2 gene sequences to infer infection dates in a single source outbreak.

    Science.gov (United States)

    Wróbel, Borys; Torres-Puente, Manuela; Jiménez, Nuria; Bracho, María Alma; García-Robles, Inmaculada; Moya, Andrés; González-Candelas, Fernando

    2006-06-01

    The assumption of a molecular clock for dating events from sequence information is often frustrated by the presence of heterogeneity among evolutionary rates due, among other factors, to positively selected sites. In this work, our goal is to explore methods to estimate infection dates from sequence analysis. One such method, based on site stripping for clock detection, was proposed to unravel the clocklike molecular evolution in sequences showing high variability of evolutionary rates and in the presence of positive selection. Other alternatives imply accommodating heterogeneity in evolutionary rates at various levels, without eliminating any information from the data. Here we present the analysis of a data set of hepatitis C virus (HCV) sequences from 24 patients infected by a single individual with known dates of infection. We first used a simple criterion of relative substitution rate for site removal prior to a regression analysis. Time was regressed on maximum likelihood pairwise evolutionary distances between the sequences sampled from the source individual and infected patients. We show that it is indeed the fastest evolving sites that disturb the molecular clock and that these sites correspond to positively selected codons. The high computational efficiency of the regression analysis allowed us to compare the site-stripping scheme with random removal of sites. We demonstrate that removing the fast-evolving sites significantly increases the accuracy of estimation of infection times based on a single substitution rate. However, the time-of-infection estimations improved substantially when a more sophisticated and computationally demanding Bayesian method was used. This method was used with the same data set but keeping all the sequence positions in the analysis. Consequently, despite the distortion introduced by positive selection on evolutionary rates, it is possible to obtain quite accurate estimates of infection dates, a result of especial relevance for

  4. Mutation of miRNA target sequences during human evolution

    DEFF Research Database (Denmark)

    Gardner, Paul P; Vinther, Jeppe

    2008-01-01

    It has long-been hypothesized that changes in non-protein-coding genes and the regulatory sequences controlling expression could undergo positive selection. Here we identify 402 putative microRNA (miRNA) target sequences that have been mutated specifically in the human lineage and show that genes...... containing such deletions are more highly expressed than their mouse orthologs. Our findings indicate that some miRNA target mutations are fixed by positive selection and might have been involved in the evolution of human-specific traits....

  5. One Basin, One Stress Regime, One Orientation of Seismogenic Basement Faults, Variable Spatio-Temporal Slip Histories: Lessons from Fort Worth Basin Induced Earthquake Sequences

    Science.gov (United States)

    DeShon, H. R.; Brudzinski, M.; Frohlich, C.; Hayward, C.; Jeong, S.; Hornbach, M. J.; Magnani, M. B.; Ogwari, P.; Quinones, L.; Scales, M. M.; Stump, B. W.; Sufri, O.; Walter, J. I.

    2017-12-01

    Since October 2008, the Fort Worth basin in north Texas has experienced over 30 magnitude (M) 3.0+ earthquakes, including one M4.0. Five named earthquake sequences have been recorded by local seismic networks: DFW Airport, Cleburne-Johnson County, Azle, Irving-Dallas, and Venus-Johnson County. Earthquakes have occurred on northeast (NE)-southwest (SW) trending Precambrian basement faults and within the overlying Ellenburger limestone unit used for wastewater disposal. Focal mechanisms indicate primarily normal faulting, and stress inversions indicate maximum regional horizontal stress strikes 20-30° NE. The seismogenic sections of the faults in either the basement or within the Ellenburger appear optimally oriented for failure within the modern stress regime. Stress drop estimates range from 10 to 75 bars, with little variability between and within the named sequences, and the values are consistent with intraplate earthquake stress drops in natural tectonic settings. However, the spatio-temporal history of each sequence relative to wastewater injection data varies. The May 2015 M4.0 Venus earthquake, for example, is only the largest of what is nearly 10 years of earthquake activity on a single fault structure. Here, maximum earthquake size has increased with time and exhibits a log-linear relationship to cumulative injected volume from 5 nearby wells. At the DFW airport, where the causative well was shut-in within a few months of the initial earthquakes and soon after the well began operation, we document migration away from the injector on the same fault for nearly 6 km sporadically over 5 years. The Irving-Dallas and Azle sequences, like DFW airport, appear to have started rather abruptly with just a few small magnitude earthquakes in the weeks or months preceding the significant set of magnitude 3.5+ earthquakes associated with each sequence. There are no nearby (<10 km) injection operations to the Irving-Dallas sequence and the Azle linked wells operated for

  6. Positive random variables with a discrete probability mass at the origin: Parameter estimation for left-censored samples with application to air quality monitoring data

    International Nuclear Information System (INIS)

    Gogolak, C.V.

    1986-11-01

    The concentration of a contaminant measured in a particular medium might be distributed as a positive random variable when it is present, but it may not always be present. If there is a level below which the concentration cannot be distinguished from zero by the analytical apparatus, a sample from such a population will be censored on the left. The presence of both zeros and positive values in the censored portion of such samples complicates the problem of estimating the parameters of the underlying positive random variable and the probability of a zero observation. Using the method of maximum likelihood, it is shown that the solution to this estimation problem reduces largely to that of estimating the parameters of the distribution truncated at the point of censorship. The maximum likelihood estimate of the proportion of zero values follows directly. The derivation of the maximum likelihood estimates for a lognormal population with zeros is given in detail, and the asymptotic properties of the estimates are examined. The estimation method was used to fit several different distributions to a set of severely censored 85 Kr monitoring data from six locations at the Savannah River Plant chemical separations facilities

  7. The mitochondrial genome sequence of the Tasmanian tiger (Thylacinus cynocephalus)

    DEFF Research Database (Denmark)

    Miller, Webb; Drautz, Daniela I; Janecka, Jan E

    2009-01-01

    We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support for the ......We report the first two complete mitochondrial genome sequences of the thylacine (Thylacinus cynocephalus), or so-called Tasmanian tiger, extinct since 1936. The thylacine's phylogenetic position within australidelphian marsupials has long been debated, and here we provide strong support...... for the thylacine's basal position in Dasyuromorphia, aided by mitochondrial genome sequence that we generated from the extant numbat (Myrmecobius fasciatus). Surprisingly, both of our thylacine sequences differ by 11%-15% from putative thylacine mitochondrial genes in GenBank, with one of our samples originating...... at a very low genetic diversity shortly before extinction. Despite the samples' heavy contamination with bacterial and human DNA and their temperate storage history, we estimate that as much as one-third of the total DNA in each sample is from the thylacine. The microbial content of the two thylacine...

  8. A comparative evaluation of sequence classification programs

    Directory of Open Access Journals (Sweden)

    Bazinet Adam L

    2012-05-01

    Full Text Available Abstract Background A fundamental problem in modern genomics is to taxonomically or functionally classify DNA sequence fragments derived from environmental sampling (i.e., metagenomics. Several different methods have been proposed for doing this effectively and efficiently, and many have been implemented in software. In addition to varying their basic algorithmic approach to classification, some methods screen sequence reads for ’barcoding genes’ like 16S rRNA, or various types of protein-coding genes. Due to the sheer number and complexity of methods, it can be difficult for a researcher to choose one that is well-suited for a particular analysis. Results We divided the very large number of programs that have been released in recent years for solving the sequence classification problem into three main categories based on the general algorithm they use to compare a query sequence against a database of sequences. We also evaluated the performance of the leading programs in each category on data sets whose taxonomic and functional composition is known. Conclusions We found significant variability in classification accuracy, precision, and resource consumption of sequence classification programs when used to analyze various metagenomics data sets. However, we observe some general trends and patterns that will be useful to researchers who use sequence classification programs.

  9. The hydrophobic core of twin-arginine signal sequences orchestrates specific binding to Tat-pathway related chaperones.

    Directory of Open Access Journals (Sweden)

    Anitha Shanmugham

    Full Text Available Redox enzyme maturation proteins (REMPs bind pre-proteins destined for translocation across the bacterial cytoplasmic membrane via the twin-arginine translocation system and enable the enzymatic incorporation of complex cofactors. Most REMPs recognize one specific pre-protein. The recognition site usually resides in the N-terminal signal sequence. REMP binding protects signal peptides against degradation by proteases. REMPs are also believed to prevent binding of immature pre-proteins to the translocon. The main aim of this work was to better understand the interaction between REMPs and substrate signal sequences. Two REMPs were investigated: DmsD (specific for dimethylsulfoxide reductase, DmsA and TorD (specific for trimethylamine N-oxide reductase, TorA. Green fluorescent protein (GFP was genetically fused behind the signal sequences of TorA and DmsA. This ensures native behavior of the respective signal sequence and excludes any effects mediated by the mature domain of the pre-protein. Surface plasmon resonance analysis revealed that these chimeric pre-proteins specifically bind to the cognate REMP. Furthermore, the region of the signal sequence that is responsible for specific binding to the corresponding REMP was identified by creating region-swapped chimeric signal sequences, containing parts of both the TorA and DmsA signal sequences. Surprisingly, specificity is not encoded in the highly variable positively charged N-terminal region of the signal sequence, but in the more similar hydrophobic C-terminal parts. Interestingly, binding of DmsD to its model substrate reduced membrane binding of the pre-protein. This property could link REMP-signal peptide binding to its reported proofreading function.

  10. Hybridization properties of long nucleic acid probes for detection of variable target sequences, and development of a hybridization prediction algorithm

    Science.gov (United States)

    Öhrmalm, Christina; Jobs, Magnus; Eriksson, Ronnie; Golbob, Sultan; Elfaitouri, Amal; Benachenhou, Farid; Strømme, Maria; Blomberg, Jonas

    2010-01-01

    One of the main problems in nucleic acid-based techniques for detection of infectious agents, such as influenza viruses, is that of nucleic acid sequence variation. DNA probes, 70-nt long, some including the nucleotide analog deoxyribose-Inosine (dInosine), were analyzed for hybridization tolerance to different amounts and distributions of mismatching bases, e.g. synonymous mutations, in target DNA. Microsphere-linked 70-mer probes were hybridized in 3M TMAC buffer to biotinylated single-stranded (ss) DNA for subsequent analysis in a Luminex® system. When mismatches interrupted contiguous matching stretches of 6 nt or longer, it had a strong impact on hybridization. Contiguous matching stretches are more important than the same number of matching nucleotides separated by mismatches into several regions. dInosine, but not 5-nitroindole, substitutions at mismatching positions stabilized hybridization remarkably well, comparable to N (4-fold) wobbles in the same positions. In contrast to shorter probes, 70-nt probes with judiciously placed dInosine substitutions and/or wobble positions were remarkably mismatch tolerant, with preserved specificity. An algorithm, NucZip, was constructed to model the nucleation and zipping phases of hybridization, integrating both local and distant binding contributions. It predicted hybridization more exactly than previous algorithms, and has the potential to guide the design of variation-tolerant yet specific probes. PMID:20864443

  11. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  12. Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

    Science.gov (United States)

    Chang, B S; Campbell, D L

    2000-08-01

    Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

  13. Identification of Variable-Number Tandem-Repeat (VNTR) Sequences in Acinetobacter baumannii and Interlaboratory Validation of an Optimized Multiple-Locus VNTR Analysis Typing Scheme▿†

    Science.gov (United States)

    Pourcel, Christine; Minandri, Fabrizia; Hauck, Yolande; D'Arezzo, Silvia; Imperi, Francesco; Vergnaud, Gilles; Visca, Paolo

    2011-01-01

    Acinetobacter baumannii is an important opportunistic pathogen responsible for nosocomial outbreaks, mostly occurring in intensive care units. Due to the multiplicity of infection sources, reliable molecular fingerprinting techniques are needed to establish epidemiological correlations among A. baumannii isolates. Multiple-locus variable-number tandem-repeat analysis (MLVA) has proven to be a fast, reliable, and cost-effective typing method for several bacterial species. In this study, an MLVA assay compatible with simple PCR- and agarose gel-based electrophoresis steps as well as with high-throughput automated methods was developed for A. baumannii typing. Preliminarily, 10 potential polymorphic variable-number tandem repeats (VNTRs) were identified upon bioinformatic screening of six annotated genome sequences of A. baumannii. A collection of 7 reference strains plus 18 well-characterized isolates, including unique types and representatives of the three international A. baumannii lineages, was then evaluated in a two-center study aimed at validating the MLVA assay and comparing it with other genotyping assays, namely, macrorestriction analysis with pulsed-field gel electrophoresis (PFGE) and PCR-based sequence group (SG) profiling. The results showed that MLVA can discriminate between isolates with identical PFGE types and SG profiles. A panel of eight VNTR markers was selected, all showing the ability to be amplified and good amounts of polymorphism in the majority of strains. Independently generated MLVA profiles, composed of an ordered string of allele numbers corresponding to the number of repeats at each VNTR locus, were concordant between centers. Typeability, reproducibility, stability, discriminatory power, and epidemiological concordance were excellent. A database containing information and MLVA profiles for several A. baumannii strains is available from http://mlva.u-psud.fr/. PMID:21147956

  14. The Properties of Long Period Variables in the LMC from MACHO

    Energy Technology Data Exchange (ETDEWEB)

    Fraser, O J; Hawley, S L; Cook, K H

    2008-05-06

    We present a new analysis of the long period variables in the Large Magellanic Cloud from the MACHO Variable Star Catalog. Three-quarters of our sample of evolved, variable stars have periodic light curves. We characterize the stars in our sample using the multiple periods found in their frequency spectra. Additionally, we use single-epoch 2MASS measurements to construct the average infrared light curves for different groups of these stars. Comparison with evolutionary models shows that stars on the RGB or the Early AGB often show non-periodic variability, but begin to pulsate with periods on the two shortest period-luminosity sequences (1 & 2) when they brighten to K{sub s} {approx} 13. The stars on the Thermally Pulsing AGB are more likely to pulsate with longer periods that lie on the next two P-L sequences (3 & 4), including the sequence associated with the Miras in the LMC. The Petersen diagram and its variants show that multi-periodic stars on each pair of these sequences (3 & 4, and 1 & 2), typically pulsate with periods associated only with that pair. The periods in these multi-periodic stars become longer and stronger as the star evolves. We further constrain the mechanism behind the long secondary periods (LSPs) seen in half of our sample, and find that there is a close match between the luminosity functions of the LSP stars and all of the stars in our sample, and that these star's pulsation amplitudes are relatively wavelength independent. Although this is characteristic of stellar multiplicity, the large number of these variables is problematic for that explanation.

  15. Effects of sequence on DNA wrapping around histones

    Science.gov (United States)

    Ortiz, Vanessa

    2011-03-01

    A central question in biophysics is whether the sequence of a DNA strand affects its mechanical properties. In epigenetics, these are thought to influence nucleosome positioning and gene expression. Theoretical and experimental attempts to answer this question have been hindered by an inability to directly resolve DNA structure and dynamics at the base-pair level. In our previous studies we used a detailed model of DNA to measure the effects of sequence on the stability of naked DNA under bending. Sequence was shown to influence DNA's ability to form kinks, which arise when certain motifs slide past others to form non-native contacts. Here, we have now included histone-DNA interactions to see if the results obtained for naked DNA are transferable to the problem of nucleosome positioning. Different DNA sequences interacting with the histone protein complex are studied, and their equilibrium and mechanical properties are compared among themselves and with the naked case. NLM training grant to the Computation and Informatics in Biology and Medicine Training Program (NLM T15LM007359).

  16. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  17. An evaluation of Comparative Genome Sequencing (CGS by comparing two previously-sequenced bacterial genomes

    Directory of Open Access Journals (Sweden)

    Herring Christopher D

    2007-08-01

    Full Text Available Abstract Background With the development of new technology, it has recently become practical to resequence the genome of a bacterium after experimental manipulation. It is critical though to know the accuracy of the technique used, and to establish confidence that all of the mutations were detected. Results In order to evaluate the accuracy of genome resequencing using the microarray-based Comparative Genome Sequencing service provided by Nimblegen Systems Inc., we resequenced the E. coli strain W3110 Kohara using MG1655 as a reference, both of which have been completely sequenced using traditional sequencing methods. CGS detected 7 of 8 small sequence differences, one large deletion, and 9 of 12 IS element insertions present in W3110, but did not detect a large chromosomal inversion. In addition, we confirmed that CGS also detected 2 SNPs, one deletion and 7 IS element insertions that are not present in the genome sequence, which we attribute to changes that occurred after the creation of the W3110 lambda clone library. The false positive rate for SNPs was one per 244 Kb of genome sequence. Conclusion CGS is an effective way to detect multiple mutations present in one bacterium relative to another, and while highly cost-effective, is prone to certain errors. Mutations occurring in repeated sequences or in sequences with a high degree of secondary structure may go undetected. It is also critical to follow up on regions of interest in which SNPs were not called because they often indicate deletions or IS element insertions.

  18. Rolling circle amplification-based analysis of Sri Lankan cassava mosaic virus isolates from Tamil Nadu, India, suggests a low level of genetic variability.

    Science.gov (United States)

    Kushawaha, Akhilesh Kumar; Rabindran, Ramalingam; Dasgupta, Indranil

    2018-03-01

    Cassava mosaic disease is a widespread disease of cassava in south Asia and the African continent. In India, CMD is known to be caused by two single-stranded DNA viruses (geminiviruses), Indian cassava mosaic virus (ICMV) and Sri Lankan cassava mosdaic virus (SLCMV). Previously, the diversity of ICMV and SLCMV in India has been studied using PCR, a sequence-dependent method. To have a more in-depth study of the variability of the above viruses and to detect any novel geminiviruses associated with CMD, sequence-independent amplification using rolling circle amplification (RCA)-based methods were used. CMD affected cassava plants were sampled across eighty locations in nine districts of the southern Indian state of Tamil Nadu. Twelve complete sequence of coat protein genes of the resident geminiviruses, comprising 256 amino acid residues were generated from the above samples, which indicated changes at only six positions. RCA followed by RFLP of the 80 samples indicated that most samples (47) contained only SLCMV, followed by 8, which were infected jointly with ICMV and SLCMV. In 11 samples, the pattern did not match the expected patterns from either of the two viruses and hence, were variants. Sequence analysis of an average of 700 nucleotides from 31 RCA-generated fragments of the variants indicated identities of 97-99% with the sequence of a previously reported infectious clone of SLCMV. The evidence suggests low levels of genetic variability in the begomoviruses infecting cassava, mainly in the form of scattered single nucleotide changes.

  19. Molecular characterization of Fasciola spp. from the endemic area of northern Iran based on nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-07-01

    Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic

  20. Statistical Metadata Analysis of the Variability of Latency, Device Transfer Time, and Coordinate Position from Smartphone-Recorded Infrasound Data

    Science.gov (United States)

    Garces, E. L.; Garces, M. A.; Christe, A.

    2017-12-01

    The RedVox infrasound recorder app uses microphones and barometers in smartphones to record infrasound, low-frequency sound below the threshold of human hearing. We study a device's metadata, which includes position, latency time, the differences between the device's internal times and the server times, and the machine time, searching for patterns and possible errors or discontinuities in these scaled parameters. We highlight metadata variability through scaled multivariate displays (histograms, distribution curves, scatter plots), all created and organized through software development in Python. This project is helpful in ascertaining variability and honing the accuracy of smartphones, aiding the emergence of portable devices as viable geophysical data collection instruments. It can also improve the app and cloud service by increasing efficiency and accuracy, allowing to better document and foresee drastic natural movements like tsunamis, earthquakes, volcanic eruptions, storms, rocket launches, and meteor impacts; recorded data can later be used for studies and analysis by a variety of professions. We expect our final results to produce insight on how to counteract problematic issues in data mining and improve accuracy in smartphone data-collection. By eliminating lurking variables and minimizing the effect of confounding variables, we hope to discover efficient processes to reduce superfluous precision, unnecessary errors, and data artifacts. These methods should conceivably be transferable to other areas of software development, data analytics, and statistics-based experiments, contributing a precedent of smartphone metadata studies from geophysical rather than societal data. The results should facilitate the rise of civilian-accessible, hand-held, data-gathering mobile sensor networks and yield more straightforward data mining techniques.

  1. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    Science.gov (United States)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

    2011-07-01

    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that

  2. Short read sequence typing (SRST: multi-locus sequence types from short reads

    Directory of Open Access Journals (Sweden)

    Inouye Michael

    2012-07-01

    Full Text Available Abstract Background Multi-locus sequence typing (MLST has become the gold standard for population analyses of bacterial pathogens. This method focuses on the sequences of a small number of loci (usually seven to divide the population and is simple, robust and facilitates comparison of results between laboratories and over time. Over the last decade, researchers and population health specialists have invested substantial effort in building up public MLST databases for nearly 100 different bacterial species, and these databases contain a wealth of important information linked to MLST sequence types such as time and place of isolation, host or niche, serotype and even clinical or drug resistance profiles. Recent advances in sequencing technology mean it is increasingly feasible to perform bacterial population analysis at the whole genome level. This offers massive gains in resolving power and genetic profiling compared to MLST, and will eventually replace MLST for bacterial typing and population analysis. However given the wealth of data currently available in MLST databases, it is crucial to maintain backwards compatibility with MLST schemes so that new genome analyses can be understood in their proper historical context. Results We present a software tool, SRST, for quick and accurate retrieval of sequence types from short read sets, using inputs easily downloaded from public databases. SRST uses read mapping and an allele assignment score incorporating sequence coverage and variability, to determine the most likely allele at each MLST locus. Analysis of over 3,500 loci in more than 500 publicly accessible Illumina read sets showed SRST to be highly accurate at allele assignment. SRST output is compatible with common analysis tools such as eBURST, Clonal Frame or PhyloViz, allowing easy comparison between novel genome data and MLST data. Alignment, fastq and pileup files can also be generated for novel alleles. Conclusions SRST is a novel

  3. Mobile Variable Depth Sampling System Design Study

    International Nuclear Information System (INIS)

    BOGER, R.M.

    2000-01-01

    A design study is presented for a mobile, variable depth sampling system (MVDSS) that will support the treatment and immobilization of Hanford LAW and HLW. The sampler can be deployed in a 4-inch tank riser and has a design that is based on requirements identified in the Level 2 Specification (latest revision). The waste feed sequence for the MVDSS is based on Phase 1, Case 3S6 waste feed sequence. Technical information is also presented that supports the design study

  4. Mobile Variable Depth Sampling System Design Study

    Energy Technology Data Exchange (ETDEWEB)

    BOGER, R.M.

    2000-08-25

    A design study is presented for a mobile, variable depth sampling system (MVDSS) that will support the treatment and immobilization of Hanford LAW and HLW. The sampler can be deployed in a 4-inch tank riser and has a design that is based on requirements identified in the Level 2 Specification (latest revision). The waste feed sequence for the MVDSS is based on Phase 1, Case 3S6 waste feed sequence. Technical information is also presented that supports the design study.

  5. Parallel arrangements of positive feedback loops limit cell-to-cell variability in differentiation.

    Science.gov (United States)

    Dey, Anupam; Barik, Debashis

    2017-01-01

    Cellular differentiations are often regulated by bistable switches resulting from specific arrangements of multiple positive feedback loops (PFL) fused to one another. Although bistability generates digital responses at the cellular level, stochasticity in chemical reactions causes population heterogeneity in terms of its differentiated states. We hypothesized that the specific arrangements of PFLs may have evolved to minimize the cellular heterogeneity in differentiation. In order to test this we investigated variability in cellular differentiation controlled either by parallel or serial arrangements of multiple PFLs having similar average properties under extrinsic and intrinsic noises. We find that motifs with PFLs fused in parallel to one another around a central regulator are less susceptible to noise as compared to the motifs with PFLs arranged serially. Our calculations suggest that the increased resistance to noise in parallel motifs originate from the less sensitivity of bifurcation points to the extrinsic noise. Whereas estimation of mean residence times indicate that stable branches of bifurcations are robust to intrinsic noise in parallel motifs as compared to serial motifs. Model conclusions are consistent both in AND- and OR-gate input signal configurations and also with two different modeling strategies. Our investigations provide some insight into recent findings that differentiation of preadipocyte to mature adipocyte is controlled by network of parallel PFLs.

  6. An extended sequence specificity for UV-induced DNA damage.

    Science.gov (United States)

    Chung, Long H; Murray, Vincent

    2018-01-01

    The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  7. Sequence analysis in multilevel models. A study on different sources of patient cues in medical consultations.

    Science.gov (United States)

    Del Piccolo, Lidia; Mazzi, Maria Angela; Dunn, Graham; Sandri, Marco; Zimmermann, Christa

    2007-12-01

    The aims of the study were to explore the importance of macro (patient, physician, consultation) and micro (doctor-patient speech sequences) variables in promoting patient cues (unsolicited new information or expressions of feelings), and to describe the methodological implications related to the study of speech sequences. Patient characteristics, a consultation index of partnership and doctor-patient speech sequences were recorded for 246 primary care consultations in six primary care surgeries in Verona, Italy. Homogeneity and stationarity conditions of speech sequences allowed the creation of a hierarchy of multilevel logit models including micro and macro level variables, with the presence/absence of cues as the dependent variable. We found that emotional distress of the patient increased cues and that cues appeared among other patient expressions and were preceded by physicians' facilitations and handling of emotion. Partnership, in terms of open-ended inquiry, active listening skills and handling of emotion by the physician and active participation by the patient throughout the consultation, reduced cue frequency.

  8. Exome sequencing reveals a de novo POLD1 mutation causing phenotypic variability in mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome (MDPL).

    Science.gov (United States)

    Elouej, Sahar; Beleza-Meireles, Ana; Caswell, Richard; Colclough, Kevin; Ellard, Sian; Desvignes, Jean Pierre; Béroud, Christophe; Lévy, Nicolas; Mohammed, Shehla; De Sandre-Giovannoli, Annachiara

    2017-06-01

    Mandibular hypoplasia, deafness, progeroid features, and lipodystrophy syndrome (MDPL) is an autosomal dominant systemic disorder characterized by prominent loss of subcutaneous fat, a characteristic facial appearance and metabolic abnormalities. This syndrome is caused by heterozygous de novo mutations in the POLD1 gene. To date, 19 patients with MDPL have been reported in the literature and among them 14 patients have been characterized at the molecular level. Twelve unrelated patients carried a recurrent in-frame deletion of a single codon (p.Ser605del) and two other patients carried a novel heterozygous mutation in exon 13 (p.Arg507Cys). Additionally and interestingly, germline mutations of the same gene have been involved in familial polyposis and colorectal cancer (CRC) predisposition. We describe a male and a female patient with MDPL respectively affected with mild and severe phenotypes. Both of them showed mandibular hypoplasia, a beaked nose with bird-like facies, prominent eyes, a small mouth, growth retardation, muscle and skin atrophy, but the female patient showed such a severe and early phenotype that a first working diagnosis of Hutchinson-Gilford Progeria was made. The exploration was performed by direct sequencing of POLD1 gene exon 15 in the male patient with a classical MDPL phenotype and by whole exome sequencing in the female patient and her unaffected parents. Exome sequencing identified in the latter patient a de novo heterozygous undescribed mutation in the POLD1 gene (NM_002691.3: c.3209T>A), predicted to cause the missense change p.Ile1070Asn in the ZnF2 (Zinc Finger 2) domain of the protein. This mutation was not reported in the 1000 Genome Project, dbSNP and Exome sequencing databases. Furthermore, the Isoleucine1070 residue of POLD1 is highly conserved among various species, suggesting that this substitution may cause a major impairment of POLD1 activity. For the second patient, affected with a typical MDPL phenotype, direct sequencing

  9. Generic and sequence-variant specific molecular assays for the detection of the highly variable Grapevine leafroll-associated virus 3.

    Science.gov (United States)

    Chooi, Kar Mun; Cohen, Daniel; Pearson, Michael N

    2013-04-01

    Grapevine leafroll-associated virus 3 (GLRaV-3) is an economically important virus, which is found in all grapevine growing regions worldwide. Its accurate detection in nursery and field samples is of high importance for certification schemes and disease management programmes. To reduce false negatives that can be caused by sequence variability, a new universal primer pair was designed against a divergent sequence data set, targeting the open reading frame 4 (heat shock protein 70 homologue gene), and optimised for conventional one-step RT-PCR and one-step SYBR Green real-time RT-PCR assays. In addition, primer pairs for the simultaneous detection of specific GLRaV-3 variants from groups 1, 2, 6 (specifically NZ-1) and the outlier NZ2 variant, and the generic detection of variants from groups 1 to 5 were designed and optimised as a conventional one-step multiplex RT-PCR assay using the plant nad5 gene as an internal control (i.e. one-step hexaplex RT-PCR). Results showed that the generic and variant specific assays detected in vitro RNA transcripts from a range of 1×10(1)-1×10(8) copies of amplicon per μl diluted in healthy total RNA from Vitis vinifera cv. Cabernet Sauvignon. Furthermore, the assays were employed effectively to screen 157 germplasm and 159 commercial field samples. Thus results demonstrate that the GLRaV-3 generic and variant-specific assays are prospective tools that will be beneficial for certification schemes and disease management programmes, as well as biological and epidemiological studies of the divergent GLRaV-3 populations. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Safety Assessment of Advanced Imaging Sequences I: Measurements

    DEFF Research Database (Denmark)

    Jensen, Jørgen Arendt; Rasmussen, Morten Fischer; Pihl, Michael Johannes

    2016-01-01

    intensity measurement program. The approach can measure and store data for a full imaging sequence in 3.8 to 8.2 s per spatial position. Based on Ispta, MI, and probe surface temperature, the method gives the ability to determine whether a sequence is within US FDA limits, or alternatively indicate how......A method for rapid measurement of intensities (Ispta), mechanical index (MI), and probe surface temperature for any ultrasound scanning sequence is presented. It uses the scanner’s sampling capability to give an accurate measurement of the whole imaging sequence for all emissions to yield the true...... measurement system (Onda Corporation, Sunnyvale, CA, USA). Four different sequences have been measured: a fixed focus emission, a duplex sequence containing B-mode and flow emissions, a vector flow sequence with B-mode and flow emissions in 17 directions, and finally a synthetic aperture (SA) duplex flow...

  11. Characterization of expressed sequence tag-derived simple sequence repeat markers for Aspergillus flavus: emphasis on variability of isolates from the southern United States.

    Science.gov (United States)

    Wang, Xinwang; Wadl, Phillip A; Wood-Jones, Alicia; Windham, Gary; Trigiano, Robert N; Scruggs, Mary; Pilgrim, Candace; Baird, Richard

    2012-12-01

    Simple sequence repeat (SSR) markers were developed from Aspergillus flavus expressed sequence tag (EST) database to conduct an analysis of genetic relationships of Aspergillus isolates from numerous host species and geographical regions, but primarily from the United States. Twenty-nine primers were designed from 362 tri-nucleotide EST-SSR sequences. Eighteen polymorphic loci were used to genotype 96 Aspergillus species isolates. The number of alleles detected per locus ranged from 2 to 24 with a mean of 8.2 alleles. Haploid diversity ranged from 0.28 to 0.91. Genetic distance matrix was used to perform principal coordinates analysis (PCA) and to generate dendrograms using unweighted pair group method with arithmetic mean (UPGMA). Two principal coordinates explained more than 75 % of the total variation among the isolates. One clade was identified for A. flavus isolates (n = 87) with the other Aspergillus species (n = 7) using PCA, but five distinct clusters were present when the others taxa were excluded from the analysis. Six groups were noted when the EST-SSR data were compared using UPGMA. However, the latter PCA or UPGMA comparison resulted in no direct associations with host species, geographical region or aflatoxin production. Furthermore, there was no direct correlation to visible morphological features such as sclerotial types. The isolates from Mississippi Delta region, which contained the largest percentage of isolates, did not show any unusual clustering except for isolates K32, K55, and 199. Further studies of these three isolates are warranted to evaluate their pathogenicity, aflatoxin production potential, additional gene sequences (e.g., RPB2), and morphological comparisons.

  12. On the relationship between residue structural environment and sequence conservation in proteins.

    Science.gov (United States)

    Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao

    2017-09-01

    Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.

  13. A universal protocol to generate consensus level genome sequences for foot-and-mouth disease virus and other positive-sense polyadenylated RNA viruses using the Illumina MiSeq.

    Science.gov (United States)

    Logan, Grace; Freimanis, Graham L; King, David J; Valdazo-González, Begoña; Bachanek-Bankowska, Katarzyna; Sanderson, Nicholas D; Knowles, Nick J; King, Donald P; Cottam, Eleanor M

    2014-09-30

    Next-Generation Sequencing (NGS) is revolutionizing molecular epidemiology by providing new approaches to undertake whole genome sequencing (WGS) in diagnostic settings for a variety of human and veterinary pathogens. Previous sequencing protocols have been subject to biases such as those encountered during PCR amplification and cell culture, or are restricted by the need for large quantities of starting material. We describe here a simple and robust methodology for the generation of whole genome sequences on the Illumina MiSeq. This protocol is specific for foot-and-mouth disease virus (FMDV) or other polyadenylated RNA viruses and circumvents both the use of PCR and the requirement for large amounts of initial template. The protocol was successfully validated using five FMDV positive clinical samples from the 2001 epidemic in the United Kingdom, as well as a panel of representative viruses from all seven serotypes. In addition, this protocol was successfully used to recover 94% of an FMDV genome that had previously been identified as cell culture negative. Genome sequences from three other non-FMDV polyadenylated RNA viruses (EMCV, ERAV, VESV) were also obtained with minor protocol amendments. We calculated that a minimum coverage depth of 22 reads was required to produce an accurate consensus sequence for FMDV O. This was achieved in 5 FMDV/O/UKG isolates and the type O FMDV from the serotype panel with the exception of the 5' genomic termini and area immediately flanking the poly(C) region. We have developed a universal WGS method for FMDV and other polyadenylated RNA viruses. This method works successfully from a limited quantity of starting material and eliminates the requirement for genome-specific PCR amplification. This protocol has the potential to generate consensus-level sequences within a routine high-throughput diagnostic environment.

  14. Selenoproteins in Archaea and Gram-positive bacteria.

    Science.gov (United States)

    Stock, Tilmann; Rother, Michael

    2009-11-01

    Selenium is an essential trace element for many organisms by serving important catalytic roles in the form of the 21st co-translationally inserted amino acid selenocysteine. It is mostly found in redox-active proteins in members of all three domains of life and analysis of the ever-increasing number of genome sequences has facilitated identification of the encoded selenoproteins. Available data from biochemical, sequence, and structure analyses indicate that Gram-positive bacteria synthesize and incorporate selenocysteine via the same pathway as enterobacteria. However, recent in vivo studies indicate that selenocysteine-decoding is much less stringent in Gram-positive bacteria than in Escherichia coli. For years, knowledge about the pathway of selenocysteine synthesis in Archaea and Eukarya was only fragmentary, but genetic and biochemical studies guided by analysis of genome sequences of Sec-encoding archaea has not only led to the characterization of the pathways but has also shown that they are principally identical. This review summarizes current knowledge about the metabolic pathways of Archaea and Gram-positive bacteria where selenium is involved, about the known selenoproteins, and about the respective pathways employed in selenoprotein synthesis.

  15. Cloning and sequencing of the gene for human β-casein

    International Nuclear Information System (INIS)

    Loennerdal, B.; Bergstroem, S.; Andersson, Y.; Hialmarsson, K.; Sundgyist, A.; Hernell, O.

    1990-01-01

    Human β-casein is a major protein in human milk. This protein is part of the casein micelle and has been suggested to have several physiological functions in the newborn. Since there is limited information on βcasein and the factors that affect its concentration in human milk, the authors have isolated and sequenced the gene for this protein. A human mammary gland cDNA library (Clontech) in gt 11 was screened by plaque hy-hybridization using a 42-mer synthetic 32 p-labelled oligo-nucleotide. Positive clones were identified and isolated, DNA was prepared and the gene isolated by cleavage with EcoR1. Following subcloning (PUC18), restriction mapping and Southern blotting, DNA for sequencing was prepared. The gene was sequenced by the dideoxy method. Human β-casein has 212 amino acids and the amino acid sequence deducted from the nucleotide sequence is to 91% identical to the published sequence for human β-casein show a high degree of conservation at the leader peptide and the highly phosphorylated sequences, but also deletions and divergence at several positions. These results provide insight into the structure of the human β-casein gene and will facilitate studies on factors affecting its expression

  16. TOUR CONSTRUCTION HEURISTICS FOR AN ORDER SEQUENCING PROBLEM

    Directory of Open Access Journals (Sweden)

    De Villiers, A. P.

    2012-11-01

    Full Text Available An order picking system that requires pickers to move in a clockwise direction around a picking line with fixed locations is considered. The problem is divided into three tiers. The tier in which orders must be sequenced is addressed. Eight tour construction heuristics are developed and implemented for an order picking system operating in unidirectional picking lines. Two classes of tour construction heuristics the tour construction starting position ( and the tour construction ending position ( are developed to sequence orders in a picking line. All algorithms are tested and compared using real life data sets. The best solution quality was obtained by a heuristic with adaptations.

  17. Variable pattern contamination control under positive pressure

    International Nuclear Information System (INIS)

    Philippi, H.M.

    1997-01-01

    Airborne contamination control in nuclear and biological laboratories is traditionally achieved by directing the space ventilation air at subatmospheric pressures in one fixed flow pattern. However, biological and nuclear contamination flow control in the new Biological Research Facility, to be commissioned at the Chalk River Laboratories in 1996, will have the flexibility to institute a number of contamination control patterns, all achieved at positive (above atmospheric) pressures. This flexibility feature, made possible by means of a digitally controlled ventilation system, changes the facility ventilation system from being a relatively rigid building service operated by plant personnel into a flexible building service which can be operated by the facility research personnel. This paper focuses on and describes the application of these unique contamination control features in the design of the new Biological Research Facility. 3 refs., 7 figs

  18. Variable pattern contamination control under positive pressure

    Energy Technology Data Exchange (ETDEWEB)

    Philippi, H.M. [Chalk River Labs., Ontario (Canada)

    1997-08-01

    Airborne contamination control in nuclear and biological laboratories is traditionally achieved by directing the space ventilation air at subatmospheric pressures in one fixed flow pattern. However, biological and nuclear contamination flow control in the new Biological Research Facility, to be commissioned at the Chalk River Laboratories in 1996, will have the flexibility to institute a number of contamination control patterns, all achieved at positive (above atmospheric) pressures. This flexibility feature, made possible by means of a digitally controlled ventilation system, changes the facility ventilation system from being a relatively rigid building service operated by plant personnel into a flexible building service which can be operated by the facility research personnel. This paper focuses on and describes the application of these unique contamination control features in the design of the new Biological Research Facility. 3 refs., 7 figs.

  19. Applications of Next-Generation Sequencing Technologies to Diagnostic Virology

    Directory of Open Access Journals (Sweden)

    Giorgio Palù

    2011-11-01

    Full Text Available Novel DNA sequencing techniques, referred to as “next-generation” sequencing (NGS, provide high speed and throughput that can produce an enormous volume of sequences with many possible applications in research and diagnostic settings. In this article, we provide an overview of the many applications of NGS in diagnostic virology. NGS techniques have been used for high-throughput whole viral genome sequencing, such as sequencing of new influenza viruses, for detection of viral genome variability and evolution within the host, such as investigation of human immunodeficiency virus and human hepatitis C virus quasispecies, and monitoring of low-abundance antiviral drug-resistance mutations. NGS techniques have been applied to metagenomics-based strategies for the detection of unexpected disease-associated viruses and for the discovery of novel human viruses, including cancer-related viruses. Finally, the human virome in healthy and disease conditions has been described by NGS-based metagenomics.

  20. Chaotic orbits of a pendulum with variable length

    Directory of Open Access Journals (Sweden)

    Massimo Furi

    2004-03-01

    Full Text Available The main purpose of this investigation is to show that a pendulum, whose pivot oscillates vertically in a periodic fashion, has uncountably many chaotic orbits. The attribute chaotic is given according to the criterion we now describe. First, we associate to any orbit a finite or infinite sequence as follows. We write 1 or $-1$ every time the pendulum crosses the position of unstable equilibrium with positive (counterclockwise or negative (clockwise velocity, respectively. We write 0 whenever we find a pair of consecutive zero's of the velocity separated only by a crossing of the stable equilibrium, and with the understanding that different pairs cannot share a common time of zero velocity. Finally, the symbol $omega$, that is used only as the ending symbol of a finite sequence, indicates that the orbit tends asymptotically to the position of unstable equilibrium. Every infinite sequence of the three symbols ${1,-1,0}$ represents a real number of the interval $[0,1]$ written in base 3 when $-1$ is replaced with 2. An orbit is considered chaotic whenever the associated sequence of the three symbols ${1,2,0}$ is an irrational number of $[0,1]$. Our main goal is to show that there are uncountably many orbits of this type.

  1. WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

    Science.gov (United States)

    Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

    2010-07-01

    High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

  2. Genetic variability in Brazilian populations of Biomphalaria straminea complex detected by simple sequence repeat anchored polymerase chain reaction amplification

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2001-01-01

    Full Text Available Biomphalaria glabrata, B. tenagophila and B. straminea are intermediate hosts of Schistosoma mansoni, in Brazil. The latter is of epidemiological importance in the northwest of Brazil and, due to morphological similarities, has been grouped with B. intermedia and B. kuhniana in a complex named B. straminea. In the current work, we have standardized the simple sequence repeat anchored polymerase chain reaction (SSR-PCR technique, using the primers (CA8RY and K7, to study the genetic variability of these species. The similarity level was calculated using the Dice coefficient and genetic distance using the Nei and Li coefficient. The trees were obtained by the UPGMA and neighbor-joining methods. We have observed that the most related individuals belong to the same species and locality and that individuals from different localities, but of the same species, present clear heterogeneity. The trees generated using both methods showed similar topologies. The SSR-PCR technique was shown to be very efficient in intrapopulational and intraspecific studies of the B. straminea complex snails.

  3. Analyzing Plasmodium falciparum erythrocyte membrane protein 1 gene expression by a next generation sequencing based method

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Petersen, Bent; Seguin-Orlando, Andaine

    2013-01-01

    at identifying PfEMP1 features associated with high virulence. Here we present the first effective method for sequence analysis of var genes expressed in field samples: a sequential PCR and next generation sequencing based technique applied on expressed var sequence tags and subsequently on long range PCR......, encoded by ~60 highly variable 'var' genes per haploid genome. PfEMP1 is exported to the surface of infected erythrocytes and is thought to be fundamental to immune evasion by adhesion to host and parasite factors. The highly variable nature has constituted a roadblock in var expression studies aimed...

  4. Design of Protein Multi-specificity Using an Independent Sequence Search Reduces the Barrier to Low Energy Sequences.

    Directory of Open Access Journals (Sweden)

    Alexander M Sevy

    2015-07-01

    Full Text Available Computational protein design has found great success in engineering proteins for thermodynamic stability, binding specificity, or enzymatic activity in a 'single state' design (SSD paradigm. Multi-specificity design (MSD, on the other hand, involves considering the stability of multiple protein states simultaneously. We have developed a novel MSD algorithm, which we refer to as REstrained CONvergence in multi-specificity design (RECON. The algorithm allows each state to adopt its own sequence throughout the design process rather than enforcing a single sequence on all states. Convergence to a single sequence is encouraged through an incrementally increasing convergence restraint for corresponding positions. Compared to MSD algorithms that enforce (constrain an identical sequence on all states the energy landscape is simplified, which accelerates the search drastically. As a result, RECON can readily be used in simulations with a flexible protein backbone. We have benchmarked RECON on two design tasks. First, we designed antibodies derived from a common germline gene against their diverse targets to assess recovery of the germline, polyspecific sequence. Second, we design "promiscuous", polyspecific proteins against all binding partners and measure recovery of the native sequence. We show that RECON is able to efficiently recover native-like, biologically relevant sequences in this diverse set of protein complexes.

  5. Hybrid PET/MR imaging: an algorithm to reduce metal artifacts from dental implants in Dixon-based attenuation map generation using a multiacquisition variable-resonance image combination sequence.

    Science.gov (United States)

    Burger, Irene A; Wurnig, Moritz C; Becker, Anton S; Kenkel, David; Delso, Gaspar; Veit-Haibach, Patrick; Boss, Andreas

    2015-01-01

    It was the aim of this study to implement an algorithm modifying Dixon-based MR imaging datasets for attenuation correction in hybrid PET/MR imaging with a multiacquisition variable resonance image combination (MAVRIC) sequence to reduce metal artifacts. After ethics approval, in 8 oncologic patients with dental implants data were acquired in a trimodality setup with PET/CT and MR imaging. The protocol included a whole-body 3-dimensional dual gradient-echo sequence (Dixon) used for MR imaging-based PET attenuation correction and a high-resolution MAVRIC sequence, applied in the oral area compromised by dental implants. An algorithm was implemented correcting the Dixon-based μ maps using the MAVRIC in areas of Dixon signal voids. The artifact size of the corrected μ maps was compared with the uncorrected MR imaging μ maps. The algorithm was robust in all patients. There was a significant reduction in mean artifact size of 70.5% between uncorrected and corrected μ maps from 697 ± 589 mm(2) to 202 ± 119 mm(2) (P = 0.016). The proposed algorithm could improve MR imaging-based attenuation correction in critical areas, when standard attenuation correction is hampered by metal artifacts, using a MAVRIC. © 2015 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

  6. ASAP: Amplification, sequencing & annotation of plastomes

    Directory of Open Access Journals (Sweden)

    Folta Kevin M

    2005-12-01

    comparative genomics studies. Conclusion This simple, inexpensive method now allows immediate access to plastid sequence, increasing experimental throughput and serving generally as a universal platform for plastid genome characterization. The method applies well to whole genome studies and speeds assessment of variability across species, making it a useful tool in plastid structural genomics.

  7. Using structural equation modeling to investigate relationships among ecological variables

    Science.gov (United States)

    Malaeb, Z.A.; Kevin, Summers J.; Pugesek, B.H.

    2000-01-01

    Structural equation modeling is an advanced multivariate statistical process with which a researcher can construct theoretical concepts, test their measurement reliability, hypothesize and test a theory about their relationships, take into account measurement errors, and consider both direct and indirect effects of variables on one another. Latent variables are theoretical concepts that unite phenomena under a single term, e.g., ecosystem health, environmental condition, and pollution (Bollen, 1989). Latent variables are not measured directly but can be expressed in terms of one or more directly measurable variables called indicators. For some researchers, defining, constructing, and examining the validity of latent variables may be the end task of itself. For others, testing hypothesized relationships of latent variables may be of interest. We analyzed the correlation matrix of eleven environmental variables from the U.S. Environmental Protection Agency's (USEPA) Environmental Monitoring and Assessment Program for Estuaries (EMAP-E) using methods of structural equation modeling. We hypothesized and tested a conceptual model to characterize the interdependencies between four latent variables-sediment contamination, natural variability, biodiversity, and growth potential. In particular, we were interested in measuring the direct, indirect, and total effects of sediment contamination and natural variability on biodiversity and growth potential. The model fit the data well and accounted for 81% of the variability in biodiversity and 69% of the variability in growth potential. It revealed a positive total effect of natural variability on growth potential that otherwise would have been judged negative had we not considered indirect effects. That is, natural variability had a negative direct effect on growth potential of magnitude -0.3251 and a positive indirect effect mediated through biodiversity of magnitude 0.4509, yielding a net positive total effect of 0

  8. Distribution of Campylobacter jejuni isolates from turkey farms and different stages at slaughter using pulsed-field gel electrophoresis and flaA-short variable region sequencing.

    Science.gov (United States)

    Perko-Mäkelä, P; Alter, T; Isohanni, P; Zimmermann, S; Lyhs, U

    2011-09-01

    The aim of this study was to assess the diversity of thermotolerant Campylobacter spp. isolated from turkey flocks at six rearing farms 1-2 weeks prior to slaughter (360 faecal swab samples) and from 11 different stages at the slaughterhouse (636 caecal, environmental, neck skin and meat samples). A total of 121 Campylobacter isolates were identified to species level using a multiplex PCR assay and were typed by pulsed-field gel electrophoresis (PFGE) and flaA-short variable region (SVR) sequencing. All Campylobacter isolates were identified as Campylobacter jejuni. PFGE analysis with KpnI restriction enzyme resulted in 11 PFGE types (I-XI) and flaA SVR typing yielded in nine flaA-SVR alleles. The Campylobacter-positive turkey flocks A, C and E were colonized by a limited number of Campylobacter clones at the farm and slaughter. The present study confirms the traceability of flock-specific strains (PFGE types I, V and IX; flaA types 21, 36 and 161) from the farm along the entire processing line to meat cuts. It seems that stress factors such as high temperature of the defeathering water (54-56 °C), drying of the carcass skin during air chilling (24 h at 2 °C), and oxygen in the air could not eliminate Campylobacter completely. Campylobacter-negative flocks became contaminated during processing by the same subtypes of Campylobacter introduced into the slaughter house by preceeding positive flocks even if they were slaughtered on subsequent days. Proper and efficient cleaning and disinfection of slaughter and processing premises are needed to avoid cross-contamination, especially in countries with a low prevalence of Campylobacter spp. The majority of flaA SVR alleles displayed a distinct association with a specific PFGE type. However, a linear relationship for all strains among both typing methods could not be established. To specify genetic relatedness of strains, a combination of different genotyping methods, is needed. © 2011 Blackwell Verlag GmbH.

  9. Bunches of random cross-correlated sequences

    International Nuclear Information System (INIS)

    Maystrenko, A A; Melnik, S S; Pritula, G M; Usatenko, O V

    2013-01-01

    The statistical properties of random cross-correlated sequences constructed by the convolution method (likewise referred to as the Rice or the inverse Fourier transformation) are examined. We clarify the meaning of the filtering function—the kernel of the convolution operator—and show that it is the value of the cross-correlation function which describes correlations between the initial white noise and constructed correlated sequences. The matrix generalization of this method for constructing a bunch of N cross-correlated sequences is presented. Algorithms for their generation are reduced to solving the problem of decomposition of the Fourier transform of the correlation matrix into a product of two mutually conjugate matrices. Different decompositions are considered. The limits of weak and strong correlations for the one-point probability and pair correlation functions of sequences generated by the method under consideration are studied. Special cases of heavy-tailed distributions of the generated sequences are analyzed. We show that, if the filtering function is rather smooth, the distribution function of generated variables has the Gaussian or Lévy form depending on the analytical properties of the distribution (or characteristic) functions of the initial white noise. Anisotropic properties of statistically homogeneous random sequences related to the asymmetry of a filtering function are revealed and studied. These asymmetry properties are expressed in terms of the third- or fourth-order correlation functions. Several examples of the construction of correlated chains with a predefined correlation matrix are given. (paper)

  10. Hypnagogic Exploration: Sleep Positions and Personality.

    Science.gov (United States)

    Domino, George; Bohn, Sarah Ann

    1980-01-01

    Sleep positions, particularly the full fetal position, appear to be related to California Psychological Inventory (CPI) variables of sociability, sense of well being, achievement by conformance, femininity, and social maturity. (Author)

  11. Variability of HIV-1 genomes among children and adolescents from Sao Paulo, Brazil.

    Directory of Open Access Journals (Sweden)

    Sabri Saeed Sanabani

    Full Text Available BACKGROUND: Genetic variability is a major feature of the human immunodeficiency virus type 1 (HIV-1 and considered the key factor to frustrating efforts to halt the virus epidemic. In this study, we aimed to investigate the genetic variability of HIV-1 strains among children and adolescents born from 1992 to 2009 in the state of Sao Paulo, Brazil. METHODOLOGY: Plasma and peripheral blood mononuclear cells (PBMC were collected from 51 HIV-1-positive children and adolescents on ART followed between September 1992 and July 2009. After extraction, the genetic materials were used in a polymerase chain reaction (PCR to amplify the viral near full length genomes (NFLGs from 5 overlapped fragments. NFLGs and partial amplicons were directly sequenced and data were phylogenetically inferred. RESULTS: Of the 51 samples studied, the NFLGs and partial fragments of HIV-1 from 42 PBMCs and 25 plasma were successfully subtyped. Results based on proviral DNA revealed that 22 (52.4% patients were infected with subtype B, 16 (38.1% were infected with BF1 mosaic variants and 4 (9.5% were infected with sub-subtype F1. All the BF1 recombinants were unique and distinct from any previously identified unique or circulating recombinant forms in South America. Evidence of dual infections was detected in 3 patients coinfected with the same or distinct HIV-1 subtypes. Ten of the 31 (32.2% and 12 of the 21 (57.1% subjects with recovered proviral and plasma, respectively, protease sequences were infected with major mutants resistant to protease inhibitors. The V3 sequences of 14 patients with available sequences from PBMC/or plasma were predicted to be R5-tropic virus except for two patients who harbored an X4 strain. CONCLUSIONS: The high proportion of HIV-1 BF1 recombinant, coinfection rate and vertical transmission in Brazil merits urgent attention and effective measures to reduce the transmission of HIV among spouses and sex partners.

  12. Genetic signatures of adaptation revealed from transcriptome sequencing of Arctic and red foxes.

    Science.gov (United States)

    Kumar, Vikas; Kutschera, Verena E; Nilsson, Maria A; Janke, Axel

    2015-08-07

    The genus Vulpes (true foxes) comprises numerous species that inhabit a wide range of habitats and climatic conditions, including one species, the Arctic fox (Vulpes lagopus) which is adapted to the arctic region. A close relative to the Arctic fox, the red fox (Vulpes vulpes), occurs in subarctic to subtropical habitats. To study the genetic basis of their adaptations to different environments, transcriptome sequences from two Arctic foxes and one red fox individual were generated and analyzed for signatures of positive selection. In addition, the data allowed for a phylogenetic analysis and divergence time estimate between the two fox species. The de novo assembly of reads resulted in more than 160,000 contigs/transcripts per individual. Approximately 17,000 homologous genes were identified using human and the non-redundant databases. Positive selection analyses revealed several genes involved in various metabolic and molecular processes such as energy metabolism, cardiac gene regulation, apoptosis and blood coagulation to be under positive selection in foxes. Branch site tests identified four genes to be under positive selection in the Arctic fox transcriptome, two of which are fat metabolism genes. In the red fox transcriptome eight genes are under positive selection, including molecular process genes, notably genes involved in ATP metabolism. Analysis of the three transcriptomes and five Sanger re-sequenced genes in additional individuals identified a lower genetic variability within Arctic foxes compared to red foxes, which is consistent with distribution range differences and demographic responses to past climatic fluctuations. A phylogenomic analysis estimated that the Arctic and red fox lineages diverged about three million years ago. Transcriptome data are an economic way to generate genomic resources for evolutionary studies. Despite not representing an entire genome, this transcriptome analysis identified numerous genes that are relevant to arctic

  13. Effect of the Stroop test performed in supine position on the heart rate variability in both genders.

    Science.gov (United States)

    Vazan, Rastislav; Filcikova, Diana; Mravec, Boris

    2017-12-01

    The effect of Stroop test (ST)-induced stress on autonomic nervous system activity is often examined via measurement of heart rate variability (HRV). However, HRV may be significantly affected by interfering factors, including vocalization and inappropriate body position. Surprisingly, published studies ignore these issues, so the aim of our study was to test the innovative procedure for correct HRV measurement in individuals exposed to ST. Moreover, we examined possible gender differences in HRV and heart rate (HR) during ST. Healthy participants (21 men, 34 women) were placed in a supine position (no orthostatic activation) and then exposed to a 5 min relaxation period and a 5 min period of computerized ST (no vocalization). We found significant differences in HR and HRV parameters in both genders during ST when compared to relaxation (baseline) values. On the other hand, there were no significant differences in HR and HRV between males and females (except for a higher baseline HR in women). Also, reactivity to ST stress (difference between baseline and ST value) showed no gender differences. In conclusion, when performed in a supine position and without vocalization, the ST induces significant stress-related changes of HR and HRV in both genders, with no gender differences in the magnitude of reaction to ST stress. This experimental procedure can be used for correct examination of mental stress-related changes in the autonomic nervous system, and is particularly useful for examining mixed-gender experimental groups. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Automatic identification of temporal sequences in chewing sounds

    NARCIS (Netherlands)

    Amft, O.D.; Kusserow, M.; Tröster, G.

    2007-01-01

    Chewing is an essential part of food intake. The analysis and detection of food patterns is an important component of an automatic dietary monitoring system. However chewing is a time-variable process depending on food properties. We present an automated methodology to extract sub-sequences of

  15. Position specific variation in the rate of evolution intranscription factor binding sites

    Energy Technology Data Exchange (ETDEWEB)

    Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.

    2003-08-28

    The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative

  16. Parallel arrangements of positive feedback loops limit cell-to-cell variability in differentiation.

    Directory of Open Access Journals (Sweden)

    Anupam Dey

    Full Text Available Cellular differentiations are often regulated by bistable switches resulting from specific arrangements of multiple positive feedback loops (PFL fused to one another. Although bistability generates digital responses at the cellular level, stochasticity in chemical reactions causes population heterogeneity in terms of its differentiated states. We hypothesized that the specific arrangements of PFLs may have evolved to minimize the cellular heterogeneity in differentiation. In order to test this we investigated variability in cellular differentiation controlled either by parallel or serial arrangements of multiple PFLs having similar average properties under extrinsic and intrinsic noises. We find that motifs with PFLs fused in parallel to one another around a central regulator are less susceptible to noise as compared to the motifs with PFLs arranged serially. Our calculations suggest that the increased resistance to noise in parallel motifs originate from the less sensitivity of bifurcation points to the extrinsic noise. Whereas estimation of mean residence times indicate that stable branches of bifurcations are robust to intrinsic noise in parallel motifs as compared to serial motifs. Model conclusions are consistent both in AND- and OR-gate input signal configurations and also with two different modeling strategies. Our investigations provide some insight into recent findings that differentiation of preadipocyte to mature adipocyte is controlled by network of parallel PFLs.

  17. Direct typing of Canine parvovirus (CPV) from infected dog faeces by rapid mini sequencing technique.

    Science.gov (United States)

    V, Pavana Jyothi; S, Akila; Selvan, Malini K; Naidu, Hariprasad; Raghunathan, Shwethaa; Kota, Sathish; Sundaram, R C Raja; Rana, Samir Kumar; Raj, G Dhinakar; Srinivasan, V A; Mohana Subramanian, B

    2016-12-01

    Canine parvovirus (CPV) is a non-enveloped single stranded DNA virus with an icosahedral capsid. Mini-sequencing based CPV typing was developed earlier to detect and differentiate all the CPV types and FPV in a single reaction. This technique was further evaluated in the present study by performing the mini-sequencing directly from fecal samples which avoided tedious virus isolation steps by cell culture system. Fecal swab samples were collected from 84 dogs with enteritis symptoms, suggestive of parvoviral infection from different locations across India. Seventy six of these samples were positive by PCR; the subsequent mini-sequencing reaction typed 74 of them as type 2a virus, and 2 samples as type 2b. Additionally, 25 of the positive samples were typed by cycle sequencing of PCR products. Direct CPV typing from fecal samples using mini-sequencing showed 100% correlation with CPV typing by cycle sequencing. Moreover, CPV typing was achieved by mini-sequencing even with faintly positive PCR amplicons which was not possible by cycle sequencing. Therefore, the mini-sequencing technique is recommended for regular epidemiological follow up of CPV types, since the technique is rapid, highly sensitive and high capacity method for CPV typing. Copyright © 2016. Published by Elsevier B.V.

  18. On Szasz-Mirakyan operators of functions of two variables

    Directory of Open Access Journals (Sweden)

    Lucyna Rempulska

    1998-05-01

    Full Text Available We consider Szasz-Mirakyan operators in polynomial and exponential weighted spaces of functions of two variables. We give Voronowskaya type theorem and theorem on convergence of certain sequences.

  19. Mitochondrial D-loop sequence variation among Italian horse breeds

    Directory of Open Access Journals (Sweden)

    Zanotti Marta

    2004-11-01

    Full Text Available Abstract The genetic variability of the mitochondrial D-loop DNA sequence in seven horse breeds bred in Italy (Giara, Haflinger, Italian trotter, Lipizzan, Maremmano, Thoroughbred and Sarcidano was analysed. Five unrelated horses were chosen in each breed and twenty-two haplotypes were identified. The sequences obtained were aligned and compared with a reference sequence and with 27 mtDNA D-loop sequences selected in the GenBank database, representing Spanish, Portuguese, North African, wild horses and an Equus asinus sequence as the outgroup. Kimura two-parameter distances were calculated and a cluster analysis using the Neighbour-joining method was performed to obtain phylogenetic trees among breeds bred in Italy and among Italian and foreign breeds. The cluster analysis indicates that all the breeds but Giara are divided in the two trees, and no clear relationships were revealed between Italian populations and the other breeds. These results could be interpreted as showing the mixed origin of breeds bred in Italy and probably indicate the presence of many ancient maternal lineages with high diversity in mtDNA sequences.

  20. Complete sequencing of IncI1 sequence type 2 plasmid pJIE512b indicates mobilization of blaCMY-2 from an IncA/C plasmid.

    Science.gov (United States)

    Tagg, Kaitlin A; Iredell, Jonathan R; Partridge, Sally R

    2014-08-01

    Sequencing of pJIE512b, a 92.3-kb IncI1 sequence type 2 (ST2) plasmid carrying bla(CMY-2), revealed a bla(CMY-2) context that appeared to have been mobilized from an IncA/C plasmid by the insertion sequence IS1294. A comparison with published plasmids suggests that bla(CMY-2) has been mobilized from IncA/C to IncI1 plasmids more than once by IS1294-like elements. Alignment of pJIE512b with the only other available IncI1 ST2 plasmid revealed differences across the backbones, indicating variability within this sequence type. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Development and analysis of a variable position thermostat for smart cooling system of a light duty diesel vehicles and engine emissions assessment during NEDC

    International Nuclear Information System (INIS)

    Mohamed, Eid S.

    2016-01-01

    Highlights: • A new concept of the variable position electromagnetic thermostat in MCS is proposed. • A series of experiments were conducted on a light duty diesel vehicle operated over the NEDC test. • A comparative study was done on emission characteristics of the MCS and the conventional cooling system. • Engine cold start and steady-state coolant flow rate and emissions are presented. • The effect of MCS on engine accumulation FC and emissions over NEDC are evaluated. - Graphical Abstract: Display Omitted - Abstract: Smart cooling control systems for IC engines can better regulate the combustion process and heat, a variable position thermostat and electric coolant pumps (EWP) for IC engines are under development by a number of researchers. However, the aim of this study is to assess the performance of a variable position electromagnetic thermostat (VPEMT) to provide more flexible control of the engine temperature and coolant mass flow rate of modification cooling system (MCS). The measurement procedure was applied to two phases under new European drive cycle (NEDC) on a chassis dynamometer, with conventional cooling system (baseline engine) and MCS of a light duty diesel engine. The experimental results revealed that MCS using a VPEMT and EWP contributed to a reduction of engine warm-up period. As a consequence, important reduces in coolant flow rate and most exhaust emission compounds (THC, CO_2, CO and smoke opacity) were obtained. In contrast, NOx emission was observed to increase in these conditions. Comparative results are given for various engine speeds during a cold start and engine fully warm-up tests when the engine was equipped by conventional cooling system and MCS operation under NEDC, revealing the effect of MCS on engine fuel consumption and exhaust emissions.

  2. Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

    Science.gov (United States)

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

    2013-01-01

    Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. The influence of psychological variables on health-related quality of life among HIV-positive individuals with a history of intravenous drug use.

    Science.gov (United States)

    Psaros, Christina; O'Cleirigh, Conall; Bullis, Jacqueline R; Markowitz, Sarah M; Safren, Steven A

    2013-01-01

    Intravenous drug use (IDU) remains a prominent pathway of HIV transmission in the United States, though little is known about modifiable factors influencing quality of life among IDUs. The goal of this study was to evaluate the influence of psychological variables (e.g., depression and anxiety) on health-related quality of life among HIV-positive individuals with a history of IDU who were enrolled in outpatient treatment for opioid dependence. 108 HIV-positive individuals with a history of IDU and participating in current outpatient treatment for opiate dependence who were screened for participation in a depression and adherence study reported sociodemographic data, depressive and anxiety symptoms, and health-related quality of life (HRQoL; Multidimensional Health Assessment using the ACTG-SF 21). Multiple regression models controlling for disease stage and background characteristics identified significant negative relationships between General Health Perception and Functioning without Pain for anxiety and depression, and between Role Functioning and Physical Functioning for anxiety. CD4 cell count was significantly related to Physical Functioning only. Results indicate that distress (both depression and anxiety) contribute significantly to variation in HRQoL over and above the effects of disease variables. Effective depression and anxiety treatment may result in improved overall functioning.

  4. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  5. The complete mitochondrial genome sequence of the Tibetan red fox (Vulpes vulpes montana).

    Science.gov (United States)

    Zhang, Jin; Zhang, Honghai; Zhao, Chao; Chen, Lei; Sha, Weilai; Liu, Guangshuai

    2015-01-01

    In this study, the complete mitochondrial genome of the Tibetan red fox (Vulpes Vulpes montana) was sequenced for the first time using blood samples obtained from a wild female red fox captured from Lhasa in Tibet, China. Qinghai--Tibet Plateau is the highest plateau in the world with an average elevation above 3500 m. Sequence analysis showed it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region (CR). The variable tandem repeats in CR is the main reason of the length variability of mitochondrial genome among canide animals.

  6. Sequences of 12 monoclonal anti-dinitrophenyl spin-label antibodies for NMR studies

    International Nuclear Information System (INIS)

    Leahy, D.J.; Rule, G.S.; Whittaker, M.M.; McConnell, H.M.

    1988-01-01

    Eleven monoclonal antibodies specific for a spin-labeled dinitrophenyl hapten (DNP-SL) have been produces for use in NMR studies. They have been named AN01 and ANO3-AN12. The stability constants for the association of these antibodies with DNP-SL and related haptens were measured by fluorescence quenching. cDNA clones coding for the heavy and light chains of each antibody and of an additional anti-DNP-SL monoclonal antibody, ANO2, have been isolated. The nucleic acid sequence of the 5' end of each clone has been determined, and the amino acid sequence of the variable regions of each antibody has been deduced from the cDNA sequence. The sequences are relatively heterogeneous, but both the heavy and the light chains of ANO1 and ANO3 are derived from the same variable-region gene families as those of the ANO2 antibody. ANO7 has a heavy chain that is related to that of ANO2, and ANO9 has a related light chain. ANO5 and ANO6 are unrelated to ANO2 but share virtually identical heavy and light chains. Preliminary NMR difference spectra comparing related antibodies show that sequence-specific assignment of resonances is possible. Such spectra also provide a measure of structural relatedness

  7. Core genome conservation of Staphylococcus haemolyticus limits sequence based population structure analysis.

    Science.gov (United States)

    Cavanagh, Jorunn Pauline; Klingenberg, Claus; Hanssen, Anne-Merethe; Fredheim, Elizabeth Aarag; Francois, Patrice; Schrenzel, Jacques; Flægstad, Trond; Sollid, Johanna Ericson

    2012-06-01

    The notoriously multi-resistant Staphylococcus haemolyticus is an emerging pathogen causing serious infections in immunocompromised patients. Defining the population structure is important to detect outbreaks and spread of antimicrobial resistant clones. Currently, the standard typing technique is pulsed-field gel electrophoresis (PFGE). In this study we describe novel molecular typing schemes for S. haemolyticus using multi locus sequence typing (MLST) and multi locus variable number of tandem repeats (VNTR) analysis. Seven housekeeping genes (MLST) and five VNTR loci (MLVF) were selected for the novel typing schemes. A panel of 45 human and veterinary S. haemolyticus isolates was investigated. The collection had diverse PFGE patterns (38 PFGE types) and was sampled over a 20 year-period from eight countries. MLST resolved 17 sequence types (Simpsons index of diversity [SID]=0.877) and MLVF resolved 14 repeat types (SID=0.831). We found a low sequence diversity. Phylogenetic analysis clustered the isolates in three (MLST) and one (MLVF) clonal complexes, respectively. Taken together, neither the MLST nor the MLVF scheme was suitable to resolve the population structure of this S. haemolyticus collection. Future MLVF and MLST schemes will benefit from addition of more variable core genome sequences identified by comparing different fully sequenced S. haemolyticus genomes. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Effect of antiviral treatment and host susceptibility on positive selection in hepatitis C virus (HCV).

    Science.gov (United States)

    Jiménez-Hernández, Nuria; Sentandreu, Vicente; Castro, José A; Torres-Puente, Manuela; Bracho, Alma; García-Robles, Inmaculada; Ortega, Enrique; Del Olmo, Juan; Carnicer, Fernando; González-Candelas, Fernando; Moya, Andrés

    2008-02-01

    We have conducted a large sequence study of the E1-E2 and NS5A regions of the HCV, subtypes 1a and b, both in patients previously treated with interferon, and untreated patients, who later responded, or not, to a combination therapy based on interferon plus ribavirin. We have examined the role played by the number of positively selected sites on disease progression and its relationship with several variables such as patients' age, sex and their risk of acquiring the disease. We have detected three groups of patients that respond or not to combination therapy: responders of intermediate age, older non-responders and young non-responders, they possess an increasing average number of positively selected sites in the E1-E2 region, respectively. We conclude that the host's genetic factors play an important role in whether the disease is contained or becomes chronic.

  9. A Flexible Binding Site Architecture Provides New Insights into CcpA Global Regulation in Gram-Positive Bacteria.

    Science.gov (United States)

    Yang, Yunpeng; Zhang, Lu; Huang, He; Yang, Chen; Yang, Sheng; Gu, Yang; Jiang, Weihong

    2017-01-24

    Catabolite control protein A (CcpA) is the master regulator in Gram-positive bacteria that mediates carbon catabolite repression (CCR) and carbon catabolite activation (CCA), two fundamental regulatory mechanisms that enable competitive advantages in carbon catabolism. It is generally regarded that CcpA exerts its regulatory role by binding to a typical 14- to 16-nucleotide (nt) consensus site that is called a catabolite response element (cre) within the target regions. However, here we report a previously unknown noncanonical flexible architecture of the CcpA-binding site in solventogenic clostridia, providing new mechanistic insights into catabolite regulation. This novel CcpA-binding site, named cre var , has a unique architecture that consists of two inverted repeats and an intervening spacer, all of which are variable in nucleotide composition and length, except for a 6-bp core palindromic sequence (TGTAAA/TTTACA). It was found that the length of the intervening spacer of cre var can affect CcpA binding affinity, and moreover, the core palindromic sequence of cre var is the key structure for regulation. Such a variable architecture of cre var shows potential importance for CcpA's diverse and fine regulation. A total of 103 potential cre var sites were discovered in solventogenic Clostridium acetobutylicum, of which 42 sites were picked out for electrophoretic mobility shift assays (EMSAs), and 30 sites were confirmed to be bound by CcpA. These 30 cre var sites are associated with 27 genes involved in many important pathways. Also of significance, the cre var sites are found to be widespread and function in a great number of taxonomically different Gram-positive bacteria, including pathogens, suggesting their global role in Gram-positive bacteria. In Gram-positive bacteria, the global regulator CcpA controls a large number of important physiological and metabolic processes. Although a typical consensus CcpA-binding site, cre, has been identified, it remains

  10. Phylogenetic position of Loricifera inferred from nearly complete 18S and 28S rRNA gene sequences.

    Science.gov (United States)

    Yamasaki, Hiroshi; Fujimoto, Shinta; Miyazaki, Katsumi

    2015-01-01

    Loricifera is an enigmatic metazoan phylum; its morphology appeared to place it with Priapulida and Kinorhyncha in the group Scalidophora which, along with Nematoida (Nematoda and Nematomorpha), comprised the group Cycloneuralia. Scarce molecular data have suggested an alternative phylogenetic hypothesis, that the phylum Loricifera is a sister taxon to Nematomorpha, although the actual phylogenetic position of the phylum remains unclear. Ecdysozoan phylogeny was reconstructed through maximum-likelihood (ML) and Bayesian inference (BI) analyses of nuclear 18S and 28S rRNA gene sequences from 60 species representing all eight ecdysozoan phyla, and including a newly collected loriciferan species. Ecdysozoa comprised two clades with high support values in both the ML and BI trees. One consisted of Priapulida and Kinorhyncha, and the other of Loricifera, Nematoida, and Panarthropoda (Tardigrada, Onychophora, and Arthropoda). The relationships between Loricifera, Nematoida, and Panarthropoda were not well resolved. Loricifera appears to be closely related to Nematoida and Panarthropoda, rather than grouping with Priapulida and Kinorhyncha, as had been suggested by previous studies. Thus, both Scalidophora and Cycloneuralia are a polyphyletic or paraphyletic groups. In addition, Loricifera and Nematomorpha did not emerge as sister groups.

  11. Effect of pulse sequence parameter selection on signal strength in positive-contrast MRI markers for MRI-based prostate postimplant assessment

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Tze Yee [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 and The University of Texas at Houston Graduate School of Biomedical Sciences, 6767 Bertner Avenue, Houston, Texas 77030 (United States); Kudchadker, Rajat J., E-mail: rkudchad@mdanderson.org; Wang, Jihong; Ibbott, Geoffrey S. [Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); Stafford, R. Jason [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); MacLellan, Christopher [Department of Imaging Physics, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 and The University of Texas at Houston Graduate School of Biomedical Sciences, 6767 Bertner Avenue, Houston, Texas 77030 (United States); Rao, Arvind [Department of Bioinformatics and Computational Biology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States); Frank, Steven J. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, Texas 77030 (United States)

    2016-07-15

    Purpose: For postimplant dosimetric assessment, computed tomography (CT) is commonly used to identify prostate brachytherapy seeds, at the expense of accurate anatomical contouring. Magnetic resonance imaging (MRI) is superior to CT for anatomical delineation, but identification of the negative-contrast seeds is challenging. Positive-contrast MRI markers were proposed to replace spacers to assist seed localization on MRI images. Visualization of these markers under varying scan parameters was investigated. Methods: To simulate a clinical scenario, a prostate phantom was implanted with 66 markers and 86 seeds, and imaged on a 3.0T MRI scanner using a 3D fast radiofrequency-spoiled gradient recalled echo acquisition with various combinations of scan parameters. Scan parameters, including flip angle, number of excitations, bandwidth, field-of-view, slice thickness, and encoding steps were systematically varied to study their effects on signal, noise, scan time, image resolution, and artifacts. Results: The effects of pulse sequence parameter selection on the marker signal strength and image noise were characterized. The authors also examined the tradeoff between signal-to-noise ratio, scan time, and image artifacts, such as the wraparound artifact, susceptibility artifact, chemical shift artifact, and partial volume averaging artifact. Given reasonable scan time and managable artifacts, the authors recommended scan parameter combinations that can provide robust visualization of the MRI markers. Conclusions: The recommended MRI pulse sequence protocol allows for consistent visualization of the markers to assist seed localization, potentially enabling MRI-only prostate postimplant dosimetry.

  12. Solving the Omitted Variables Problem of Regression Analysis Using the Relative Vertical Position of Observations

    Directory of Open Access Journals (Sweden)

    Jonathan E. Leightner

    2012-01-01

    Full Text Available The omitted variables problem is one of regression analysis’ most serious problems. The standard approach to the omitted variables problem is to find instruments, or proxies, for the omitted variables, but this approach makes strong assumptions that are rarely met in practice. This paper introduces best projection reiterative truncated projected least squares (BP-RTPLS, the third generation of a technique that solves the omitted variables problem without using proxies or instruments. This paper presents a theoretical argument that BP-RTPLS produces unbiased reduced form estimates when there are omitted variables. This paper also provides simulation evidence that shows OLS produces between 250% and 2450% more errors than BP-RTPLS when there are omitted variables and when measurement and round-off error is 1 percent or less. In an example, the government spending multiplier, , is estimated using annual data for the USA between 1929 and 2010.

  13. Detecting Positive Selection of Korean Native Goat Populations Using Next-Generation Sequencing

    Science.gov (United States)

    Lee, Wonseok; Ahn, Sojin; Taye, Mengistie; Sung, Samsun; Lee, Hyun-Jeong; Cho, Seoae; Kim, Heebal

    2016-01-01

    Goats (Capra hircus) are one of the oldest species of domesticated animals. Native Korean goats are a particularly interesting group, as they are indigenous to the area and were raised in the Korean peninsula almost 2,000 years ago. Although they have a small body size and produce low volumes of milk and meat, they are quite resistant to lumbar paralysis. Our study aimed to reveal the distinct genetic features and patterns of selection in native Korean goats by comparing the genomes of native Korean goat and crossbred goat populations. We sequenced the whole genome of 15 native Korean goats and 11 crossbred goats using next-generation sequencing (Illumina platform) to compare the genomes of the two populations. We found decreased nucleotide diversity in the native Korean goats compared to the crossbred goats. Genetic structural analysis demonstrated that the native Korean goat and crossbred goat populations shared a common ancestry, but were clearly distinct. Finally, to reveal the native Korean goat’s selective sweep region, selective sweep signals were identified in the native Korean goat genome using cross-population extended haplotype homozygosity (XP-EHH) and a cross-population composite likelihood ratio test (XP-CLR). As a result, we were able to identify candidate genes for recent selection, such as the CCR3 gene, which is related to lumbar paralysis resistance. Combined with future studies and recent goat genome information, this study will contribute to a thorough understanding of the native Korean goat genome. PMID:27989103

  14. Detecting Positive Selection of Korean Native Goat Populations Using Next-Generation Sequencing.

    Science.gov (United States)

    Lee, Wonseok; Ahn, Sojin; Taye, Mengistie; Sung, Samsun; Lee, Hyun-Jeong; Cho, Seoae; Kim, Heebal

    2016-12-01

    Goats ( Capra hircus ) are one of the oldest species of domesticated animals. Native Korean goats are a particularly interesting group, as they are indigenous to the area and were raised in the Korean peninsula almost 2,000 years ago. Although they have a small body size and produce low volumes of milk and meat, they are quite resistant to lumbar paralysis. Our study aimed to reveal the distinct genetic features and patterns of selection in native Korean goats by comparing the genomes of native Korean goat and crossbred goat populations. We sequenced the whole genome of 15 native Korean goats and 11 crossbred goats using next-generation sequencing (Illumina platform) to compare the genomes of the two populations. We found decreased nucleotide diversity in the native Korean goats compared to the crossbred goats. Genetic structural analysis demonstrated that the native Korean goat and crossbred goat populations shared a common ancestry, but were clearly distinct. Finally, to reveal the native Korean goat's selective sweep region, selective sweep signals were identified in the native Korean goat genome using cross-population extended haplotype homozygosity (XP-EHH) and a cross-population composite likelihood ratio test (XP-CLR). As a result, we were able to identify candidate genes for recent selection, such as the CCR3 gene, which is related to lumbar paralysis resistance. Combined with future studies and recent goat genome information, this study will contribute to a thorough understanding of the native Korean goat genome.

  15. Mythical Maia, ultrashort and 53 PSC variables. Lecture 4

    International Nuclear Information System (INIS)

    Cox, A.N.

    1983-01-01

    Moving down the main sequence from the #betta# Cephei variables, we come to later B-type stars. The suspicion of variability for these stars goes back to Vogel in 1891 who studied the radial velocities of Vega. Since that time there have been numerous studies of Vega (Wisniewski and Johnson 1979, Fernie 1981) and other B and early A stars which hint at variability in both radial velocity and light. Since Struve (1955) discussed these stars 28 years ago, they have been called the Maia stars after the Pleiades star that he thought was the prototype. The uncertainty in their actual variability has led Breger (1980) to call them the mythical Maia variables

  16. Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

    Science.gov (United States)

    Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

    2003-10-01

    The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

  17. Resistance to Change and Preference for Variable versus Fixed Response Sequences

    Science.gov (United States)

    Arantes, Joana; Berg, Mark E.; Le, Dien; Grace, Randolph C.

    2012-01-01

    In Experiment 1, 4 pigeons were trained on a multiple chain schedule in which the initial link was a variable-interval (VI) 20-s schedule signalled by a red or green center key, and terminal links required four responses made to the left (L) and/or right (R) keys. In the REPEAT component, signalled by red keylights, only LRLR terminal-link…

  18. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  19. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  20. Structural conservation, variability, and immunogenicity of the T6 backbone pilin of serotype M6 Streptococcus pyogenes.

    Science.gov (United States)

    Young, Paul G; Moreland, Nicole J; Loh, Jacelyn M; Bell, Anita; Atatoa Carr, Polly; Proft, Thomas; Baker, Edward N

    2014-07-01

    Group A streptococcus (GAS; Streptococcus pyogenes) is a Gram-positive human pathogen that causes a broad range of diseases ranging from acute pharyngitis to the poststreptococcal sequelae of acute rheumatic fever. GAS pili are highly diverse, long protein polymers that extend from the cell surface. They have multiple roles in infection and are promising candidates for vaccine development. This study describes the structure of the T6 backbone pilin (BP; Lancefield T-antigen) from the important M6 serotype. The structure reveals a modular arrangement of three tandem immunoglobulin-like domains, two with internal isopeptide bonds. The T6 pilin lysine, essential for polymerization, is located in a novel VAKS motif that is structurally homologous to the canonical YPKN pilin lysine in other three- and four-domain Gram-positive pilins. The T6 structure also highlights a conserved pilin core whose surface is decorated with highly variable loops and extensions. Comparison to other Gram-positive BPs shows that many of the largest variable extensions are found in conserved locations. Studies with sera from patients diagnosed with GAS-associated acute rheumatic fever showed that each of the three T6 domains, and the largest of the variable extensions (V8), are targeted by IgG during infection in vivo. Although the GAS BP show large variations in size and sequence, the modular nature of the pilus proteins revealed by the T6 structure may aid the future design of a pilus-based vaccine. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  2. Sequencing of bimaxillary surgery in the correction of vertical maxillary excess: retrospective study.

    Science.gov (United States)

    Salmen, F S; de Oliveira, T F M; Gabrielli, M A C; Pereira Filho, V A; Real Gabrielli, M F

    2018-06-01

    The aim of this study was to evaluate the precision of bimaxillary surgery performed to correct vertical maxillary excess, when the procedure is sequenced with mandibular surgery first or maxillary surgery first. Thirty-two patients, divided into two groups, were included in this retrospective study. Group 1 comprised patients who received bimaxillary surgery following the classical sequence with repositioning of the maxilla first. Patients in group 2 received bimaxillary surgery, but the mandible was operated on first. The precision of the maxillomandibular repositioning was determined by comparison of the digital prediction and postoperative tracings superimposed on the cranial base. The data were tabulated and analyzed statistically. In this sample, both surgical sequences provided adequate clinical accuracy. The classical sequence, repositioning the maxilla first, resulted in greater accuracy for A-point and the upper incisor edge vertical position. Repositioning the mandible first allowed greater precision in the vertical position of pogonion. In conclusion, although both surgical sequences may be used, repositioning the mandible first will result in greater imprecision in relation to the predictive tracing than repositioning the maxilla first. The classical sequence resulted in greater accuracy in the vertical position of the maxilla, which is key for aesthetics. Copyright © 2017 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  3. Poly(A) motif prediction using spectral latent features from human DNA sequences

    KAUST Repository

    Xie, Bo; Jankovic, Boris R.; Bajic, Vladimir B.; Song, Le; Gao, Xin

    2013-01-01

    Motivation: Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Identifying DNA sequence motifs that signal the addition of poly(A) tails is essential to improved genome annotation and better understanding of the regulatory mechanisms and stability of mRNA.Existing poly(A) motif predictors demonstrate that information extracted from the surrounding nucleotide sequences of candidate poly(A) motifs can differentiate true motifs from the false ones to a great extent. A variety of sophisticated features has been explored, including sequential, structural, statistical, thermodynamic and evolutionary properties. However, most of these methods involve extensive manual feature engineering, which can be time-consuming and can require in-depth domain knowledge.Results: We propose a novel machine-learning method for poly(A) motif prediction by marrying generative learning (hidden Markov models) and discriminative learning (support vector machines). Generative learning provides a rich palette on which the uncertainty and diversity of sequence information can be handled, while discriminative learning allows the performance of the classification task to be directly optimized. Here, we used hidden Markov models for fitting the DNA sequence dynamics, and developed an efficient spectral algorithm for extracting latent variable information from these models. These spectral latent features were then fed into support vector machines to fine-tune the classification performance.We evaluated our proposed method on a comprehensive human poly(A) dataset that consists of 14 740 samples from 12 of the most abundant variants of human poly(A) motifs. Compared with one of the previous state-of-the-art methods in the literature (the random forest model with expert-crafted features), our method reduces the average error rate, false-negative rate and false-positive rate by 26, 15 and 35%, respectively. Meanwhile, our method makes ?30% fewer error predictions relative to the other

  4. Poly(A) motif prediction using spectral latent features from human DNA sequences

    KAUST Repository

    Xie, Bo

    2013-06-21

    Motivation: Polyadenylation is the addition of a poly(A) tail to an RNA molecule. Identifying DNA sequence motifs that signal the addition of poly(A) tails is essential to improved genome annotation and better understanding of the regulatory mechanisms and stability of mRNA.Existing poly(A) motif predictors demonstrate that information extracted from the surrounding nucleotide sequences of candidate poly(A) motifs can differentiate true motifs from the false ones to a great extent. A variety of sophisticated features has been explored, including sequential, structural, statistical, thermodynamic and evolutionary properties. However, most of these methods involve extensive manual feature engineering, which can be time-consuming and can require in-depth domain knowledge.Results: We propose a novel machine-learning method for poly(A) motif prediction by marrying generative learning (hidden Markov models) and discriminative learning (support vector machines). Generative learning provides a rich palette on which the uncertainty and diversity of sequence information can be handled, while discriminative learning allows the performance of the classification task to be directly optimized. Here, we used hidden Markov models for fitting the DNA sequence dynamics, and developed an efficient spectral algorithm for extracting latent variable information from these models. These spectral latent features were then fed into support vector machines to fine-tune the classification performance.We evaluated our proposed method on a comprehensive human poly(A) dataset that consists of 14 740 samples from 12 of the most abundant variants of human poly(A) motifs. Compared with one of the previous state-of-the-art methods in the literature (the random forest model with expert-crafted features), our method reduces the average error rate, false-negative rate and false-positive rate by 26, 15 and 35%, respectively. Meanwhile, our method makes ?30% fewer error predictions relative to the other

  5. Teachers' and Students' Work-Culture Variables Associated with Positive School Outcome.

    Science.gov (United States)

    Goldwater, Orna D.; Nutt, Roberta L.

    1999-01-01

    Investigates whether goodness of fit between teachers' and students' backgrounds is associated with subjective grading and objective achievement at school. One hundred one seventh graders and twenty of their teachers completed the Self-Report Family Inventory. Similarity between teachers' and students' work-culture variables was associated with…

  6. Identification of optimum sequencing depth especially for de novo genome assembly of small genomes using next generation sequencing data.

    Science.gov (United States)

    Desai, Aarti; Marwah, Veer Singh; Yadav, Akshay; Jha, Vineet; Dhaygude, Kishor; Bangar, Ujwala; Kulkarni, Vivek; Jere, Abhay

    2013-01-01

    Next Generation Sequencing (NGS) is a disruptive technology that has found widespread acceptance in the life sciences research community. The high throughput and low cost of sequencing has encouraged researchers to undertake ambitious genomic projects, especially in de novo genome sequencing. Currently, NGS systems generate sequence data as short reads and de novo genome assembly using these short reads is computationally very intensive. Due to lower cost of sequencing and higher throughput, NGS systems now provide the ability to sequence genomes at high depth. However, currently no report is available highlighting the impact of high sequence depth on genome assembly using real data sets and multiple assembly algorithms. Recently, some studies have evaluated the impact of sequence coverage, error rate and average read length on genome assembly using multiple assembly algorithms, however, these evaluations were performed using simulated datasets. One limitation of using simulated datasets is that variables such as error rates, read length and coverage which are known to impact genome assembly are carefully controlled. Hence, this study was undertaken to identify the minimum depth of sequencing required for de novo assembly for different sized genomes using graph based assembly algorithms and real datasets. Illumina reads for E.coli (4.6 MB) S.kudriavzevii (11.18 MB) and C.elegans (100 MB) were assembled using SOAPdenovo, Velvet, ABySS, Meraculous and IDBA-UD. Our analysis shows that 50X is the optimum read depth for assembling these genomes using all assemblers except Meraculous which requires 100X read depth. Moreover, our analysis shows that de novo assembly from 50X read data requires only 6-40 GB RAM depending on the genome size and assembly algorithm used. We believe that this information can be extremely valuable for researchers in designing experiments and multiplexing which will enable optimum utilization of sequencing as well as analysis resources.

  7. Positive Streptobacillus moniliformis PCR in guinea pigs likely due to Leptotrichia spp.

    Science.gov (United States)

    Boot, Ron; Van de Berg, Lia; Reubsaet, Frans A G; Vlemminx, Maurice J

    2008-04-30

    Streptobacillus moniliformis is a zoonotic bacterium. We obtained positive S. moniliformis PCR results in oral swab samples from guinea pigs from an experimental colony and the breeding colony of origin. Comparison of the DNA sequence of an amplicon with deposited 16S rDNA sequences revealed that Leptotrichia sp. can be the source of a false positive S. moniliformis PCR outcome.

  8. Identification of genomic insertion and flanking sequence of G2-EPSPS and GAT transgenes in soybean using whole genome sequencing method

    Directory of Open Access Journals (Sweden)

    Bingfu Guo

    2016-07-01

    Full Text Available Molecular characterization of sequences flanking exogenous fragment insertions is essential for safety assessment and labeling of genetically modified organisms (GMO. In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS method. About 21 Gb sequence data (~21× coverage for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundary of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of the genomic insertion site of the G2-EPSPS and GAT transgenes will facilitate the use of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS is a cost-effective and rapid method of identifying sites of T-DNA insertions and flanking sequences in soybean.

  9. Combination of cytochrome b heteroduplex-assay and sequencing for identification of triatomine blood meals.

    Science.gov (United States)

    Buitrago, Rosio; Depickère, Stéphanie; Bosseno, Marie-France; Patzi, Edda Siñani; Waleckx, Etienne; Salas, Renata; Aliaga, Claudia; Brenière, Simone Frédérique

    2012-01-01

    The identification of blood meals in vectors contributes greatly to the understanding of interactions between vectors, microorganisms and hosts. The aim of the current work was to complement the validation of cytochrome b (Cytb) heteroduplex assay (HDA) previously described, and to add the sequencing of the Cytb gene of some samples for the identification of blood meals in triatomines. Experimental feedings of reared triatomines helped to clarify the sensitivity of the HDA. Moreover, the sequencing coupled with the HDA, allowed the assessment of the technique's taxonomic level of discrimination. The primers used to produce DNA fragments of Cytb genes for HDA had a very high sensitivity for vertebrate DNAs, rather similar for mammals, birds and reptiles. However, the formation of heteroduplex depended on blood meal's quality rather than its quantity; a correlation was observed between blood meals' color and the positivity of HDA. HDA electrophoresis profiles were reproducible, and allowed the discrimination of blood origins at the species level. However, in some cases, intraspecific variability of Cytb gene generated different HDA profiles. The HDA based on comparison of electrophoresis profiles is a very useful tool for screening large samples to determine blood origins; the subsequent sequencing of PCR products of Cytb corresponding to different HDA profiles allowed the identification of species whatever the biotope in which the vectors were captured. Copyright © 2011. Published by Elsevier B.V.

  10. The evolutionary position of nematodes

    Directory of Open Access Journals (Sweden)

    Gojobori Takashi

    2002-04-01

    Full Text Available Abstract Background The complete genomes of three animals have been sequenced by global research efforts: a nematode worm (Caenorhabditis elegans, an insect (Drosophila melanogaster, and a vertebrate (Homo sapiens. Remarkably, their relationships have yet to be clarified. The confusion concerns the enigmatic position of nematodes. Traditionally, nematodes have occupied a basal position, in part because they lack a true body cavity. However, the leading hypothesis now joins nematodes with arthropods in a molting clade, Ecdysozoa, based on data from several genes. Results We tested the Ecdysozoa hypothesis with analyses of more than 100 nuclear protein alignments, under conditions that would expose biases, and found that it was not supported. Instead, we found significant support for the traditional hypothesis, Coelomata. Our result is robust to different rates of sequence change among genes and lineages, different numbers of taxa, and different species of nematodes. Conclusion We conclude that insects (arthropods are genetically and evolutionarily closer to humans than to nematode worms.

  11. Sequences and timing of dental eruption in semi-free-ranging mandrills (Mandrillus sphinx).

    Science.gov (United States)

    Setchell, Joanna M; Wickings, E Jean

    2004-01-01

    The chronology of tooth emergence is often used to examine the growth and development of individuals and to compare life histories across species. Emergence patterns are also used to age animals and to infer life history influences for extinct species. However, comparative studies of primates are hindered by a lack of dental development data for many species. Here we describe the sequences and timing of tooth emergence for a large sample of semi-free-ranging mandrills (Mandrillus sphinx) and compare this with other life history variables for this species. Deciduous dentition emerged in the sequence i1 i2 c p3 p4. The augmented sequence (including information about variability in emergence sequence) was i1 i2 [c p3] p4 for the female maxilla and the male mandible, and i1 i2 c p3 p4 for the female mandible and the male maxilla. Deciduous dentition was complete by 5.0 months in females and 6.4 months in males. The permanent dentition began to emerge at 26 months, and complete adult dentition had emerged by 68 months for males and 85 months for females. Sex differences occurred in the augmented eruption sequences: females M1 I1 I2 [M2 C] P3 P4 M3, males M1 I1 [I2 M2] [P4 = P3 = C] M3. The order of tooth eruption and the occurrence of sequence polymorphisms were very similar to those observed for baboons and macaques. Comparison with life history variables showed that mandrills have complete deciduous dentition at weaning, females possess both adult incisors and M1 when they first reproduce, but still have deciduous canines and premolars, and that both sexes have full adult dentition before they attain their full adult stature and mass.

  12. Fluency First: Reversing the Traditional ESL Sequence.

    Science.gov (United States)

    MacGowan-Gilhooly, Adele

    1991-01-01

    Describes an ESL department's whole language approach to writing and reading, replacing its traditional grammar-based ESL instructional sequence. Reports the positive quantitative and qualitative results of the first three years of using the new approach. (KEH)

  13. Forward Genetics by Sequencing EMS Variation-Induced Inbred Lines

    Directory of Open Access Journals (Sweden)

    Charles Addo-Quaye

    2017-02-01

    Full Text Available In order to leverage novel sequencing techniques for cloning genes in eukaryotic organisms with complex genomes, the false positive rate of variant discovery must be controlled for by experimental design and informatics. We sequenced five lines from three pedigrees of ethyl methanesulfonate (EMS-mutagenized Sorghum bicolor, including a pedigree segregating a recessive dwarf mutant. Comparing the sequences of the lines, we were able to identify and eliminate error-prone positions. One genomic region contained EMS mutant alleles in dwarfs that were homozygous reference sequences in wild-type siblings and heterozygous in segregating families. This region contained a single nonsynonymous change that cosegregated with dwarfism in a validation population and caused a premature stop codon in the Sorghum ortholog encoding the gibberellic acid (GA biosynthetic enzyme ent-kaurene oxidase. Application of exogenous GA rescued the mutant phenotype. Our method for mapping did not require outcrossing and introduced no segregation variance. This enables work when line crossing is complicated by life history, permitting gene discovery outside of genetic models. This inverts the historical approach of first using recombination to define a locus and then sequencing genes. Our formally identical approach first sequences all the genes and then seeks cosegregation with the trait. Mutagenized lines lacking obvious phenotypic alterations are available for an extension of this approach: mapping with a known marker set in a line that is phenotypically identical to starting material for EMS mutant generation.

  14. Supplementary data: Comparative studies on sequence ...

    Indian Academy of Sciences (India)

    Unknown

    Page 1. Supplementary data: Comparative studies on sequence characteristics around translation initiation codon in four eukaryotes. Qingpo Liu and Qingzhong Xue. J. Genet. 84, 317–322. Table 1. Spearman's rank correlation coefficients of 39 base positions around the AUG codon in the four eukaryotic species studied.

  15. Estimation of heart-position variability in 3D-surface-image-guided deep-inspiration breath-hold radiation therapy for left-sided breast cancer

    International Nuclear Information System (INIS)

    Alderliesten, Tanja; Betgen, Anja; Elkhuizen, Paula H.M.; Vliet-Vroegindeweij, Corine van; Remeijer, Peter

    2013-01-01

    Purpose: To investigate the heart position variability in deep-inspiration breath-hold (DIBH) radiation therapy (RT) for breast cancer when 3D surface imaging would be used for monitoring the BH depth during treatment delivery. For this purpose, surface setup data were compared with heart setup data. Materials and methods: Twenty patients treated with DIBH-RT after breast-conserving surgery were included. Retrospectively, heart registrations were performed for cone-beam computed tomography (CBCT) to planning CT. Further, breast-surface registrations were performed for a surface, captured concurrently with CBCT, to planning CT. The resulting setup errors were compared with linear regression analysis. Furthermore, geometric uncertainties of the heart (systematic [Σ] and random [σ]) were estimated relative to the surface registration. Based on these uncertainties planning organ at risk volume (PRV) margins for the heart were calculated: 1.3Σ − 0.5σ. Results: Moderate correlation between surface and heart setup errors was found: R 2 = 0.64, 0.37, 0.53 in left–right (LR), cranio-caudal (CC), and in anterior–posterior (AP) direction, respectively. When surface imaging would be used for monitoring, the geometric uncertainties of the heart (cm) are [Σ = 0.14, σ = 0.14]; [Σ = 0.66, σ = 0.38]; [Σ = 0.27, σ = 0.19] in LR; CC; AP. This results in PRV margins of 0.11; 0.67; 0.25 cm in LR; CC; AP. Conclusion: When DIBH-RT after breast-conserving surgery is guided by the breast-surface position then PRV margins should be used to take into account the heart-position variability relative to the breast-surface

  16. Structural basis for sequence-specific recognition of DNA by TAL effectors

    KAUST Repository

    Deng, Dong

    2012-01-05

    TAL (transcription activator-like) effectors, secreted by phytopathogenic bacteria, recognize host DNA sequences through a central domain of tandem repeats. Each repeat comprises 33 to 35 conserved amino acids and targets a specific base pair by using two hypervariable residues [known as repeat variable diresidues (RVDs)] at positions 12 and 13. Here, we report the crystal structures of an 11.5-repeat TAL effector in both DNA-free and DNA-bound states. Each TAL repeat comprises two helices connected by a short RVD-containing loop. The 11.5 repeats form a right-handed, superhelical structure that tracks along the sense strand of DNA duplex, with RVDs contacting the major groove. The 12th residue stabilizes the RVD loop, whereas the 13th residue makes a base-specific contact. Understanding DNA recognition by TAL effectors may facilitate rational design of DNA-binding proteins with biotechnological applications.

  17. Sequence variability is correlated with weak immunogenicity in Streptococcus pyogenes M protein

    DEFF Research Database (Denmark)

    Lannergård, Jonas; Kristensen, Bodil M.; Gustafsson, Mattias C. U.

    2015-01-01

    The M protein of Streptococcus pyogenes, a major bacterial virulence factor, has an amino-terminal hypervariable region (HVR) that is a target for type-specific protective antibodies. Intriguingly, the HVR elicits a weak antibody response, indicating that it escapes host immunity by two mechanisms...... fibrinogen-binding B repeat region exhibits extensive sequence divergence. Analysis of antisera from S. pyogenes-infected patients, infected mice, and immunized mice showed that both the HVR and the B repeat region elicited weak antibody responses, while the conserved carboxy-terminal part was immunodominant...

  18. SU-F-J-103: Assessment of Liver Tumor Contrast for Radiation Therapy: Inter-Patient and Inter-Sequence Variability

    Energy Technology Data Exchange (ETDEWEB)

    Moore, B [Duke University Medical Physics Graduate Program, Durham, NC (United States); Yin, F; Cai, J [Duke University Medical Physics Graduate Program, Durham, NC (United States); Duke University Medical Center, Radiation Oncology, Durham, NC (United States); Czito, B; Palta, M [Duke University Medical Center, Radiation Oncology, Durham, NC (United States)

    2016-06-15

    Purpose: To determine the variation in tumor contrast between different MRI sequences and between patients for the purpose of MRI-based treatment planning. Methods: Multiple MRI scans of 11 patients with cancer(s) in the liver were included in this IRB-approved study. Imaging sequences consisted of T1W MRI, Contrast-Enhanced T1W MRI, T2W MRI, and T2*/T1W MRI. MRI images were acquired on a 1.5T GE Signa scanner with a four-channel torso coil. We calculated the tumor-to-tissue contrast to noise ratio (CNR) for each MR sequence by contouring the tumor and a region of interest (ROI) in a homogeneous region of the liver using the Eclipse treatment planning software. CNR was calculated (I-Tum-I-ROI)/SD-ROI, where I-Tum and I-ROI are the mean values of the tumor and the ROI respectively, and SD-ROI is the standard deviation of the ROI. The same tumor and ROI structures were used in all measurements for different MR sequences. Inter-patient Coefficient of variation (CV), and inter-sequence CV was determined. In addition, mean and standard deviation of CNR were calculated and compared between different MR sequences. Results: Our preliminary results showed large inter-patient CV (range: 37.7% to 88%) and inter-sequence CV (range 5.3% to 104.9%) of liver tumor CNR, indicating great variations in tumor CNR between MR sequences and between patients. Tumor CNR was found to be largest in CE-T1W (8.5±7.5), followed by T2W (4.2±2.4), T1W (3.4±2.2), and T2*/T1W (1.7±0.6) MR scans. The inter-patient CV of tumor CNR was also the largest in CE-T1W (88%), followed by T1W (64.3%), T1W (56.2%), and T2*/T1W (37.7) MR scans. Conclusion: Large inter-sequence and inter-patient variations were observed in liver tumor CNR. CE-T1W MR images on average provided the best tumor CNR. Efforts are needed to optimize tumor contrast and its consistency for MRI-based treatment planning of cancer in the liver. This project is supported by NIH grant: 1R21CA165384.

  19. SU-F-J-103: Assessment of Liver Tumor Contrast for Radiation Therapy: Inter-Patient and Inter-Sequence Variability

    International Nuclear Information System (INIS)

    Moore, B; Yin, F; Cai, J; Czito, B; Palta, M

    2016-01-01

    Purpose: To determine the variation in tumor contrast between different MRI sequences and between patients for the purpose of MRI-based treatment planning. Methods: Multiple MRI scans of 11 patients with cancer(s) in the liver were included in this IRB-approved study. Imaging sequences consisted of T1W MRI, Contrast-Enhanced T1W MRI, T2W MRI, and T2*/T1W MRI. MRI images were acquired on a 1.5T GE Signa scanner with a four-channel torso coil. We calculated the tumor-to-tissue contrast to noise ratio (CNR) for each MR sequence by contouring the tumor and a region of interest (ROI) in a homogeneous region of the liver using the Eclipse treatment planning software. CNR was calculated (I_Tum-I_ROI)/SD_ROI, where I_Tum and I_ROI are the mean values of the tumor and the ROI respectively, and SD_ROI is the standard deviation of the ROI. The same tumor and ROI structures were used in all measurements for different MR sequences. Inter-patient Coefficient of variation (CV), and inter-sequence CV was determined. In addition, mean and standard deviation of CNR were calculated and compared between different MR sequences. Results: Our preliminary results showed large inter-patient CV (range: 37.7% to 88%) and inter-sequence CV (range 5.3% to 104.9%) of liver tumor CNR, indicating great variations in tumor CNR between MR sequences and between patients. Tumor CNR was found to be largest in CE-T1W (8.5±7.5), followed by T2W (4.2±2.4), T1W (3.4±2.2), and T2*/T1W (1.7±0.6) MR scans. The inter-patient CV of tumor CNR was also the largest in CE-T1W (88%), followed by T1W (64.3%), T1W (56.2%), and T2*/T1W (37.7) MR scans. Conclusion: Large inter-sequence and inter-patient variations were observed in liver tumor CNR. CE-T1W MR images on average provided the best tumor CNR. Efforts are needed to optimize tumor contrast and its consistency for MRI-based treatment planning of cancer in the liver. This project is supported by NIH grant: 1R21CA165384

  20. MAP Estimation of Chin and Cheek Contours in Video Sequences

    Directory of Open Access Journals (Sweden)

    Kampmann Markus

    2004-01-01

    Full Text Available An algorithm for the estimation of chin and cheek contours in video sequences is proposed. This algorithm exploits a priori knowledge about shape and position of chin and cheek contours in images. Exploiting knowledge about the shape, a parametric 2D model representing chin and cheek contours is introduced. Exploiting knowledge about the position, a MAP estimator is developed taking into account the observed luminance gradient as well as a priori probabilities of chin and cheek contours positions. The proposed algorithm was tested with head and shoulder video sequences (image resolution CIF. In nearly 70% of all investigated video frames, a subjectively error free estimation could be achieved. The 2D estimate error is measured as on average between 2.4 and .

  1. Tufted capuchin monkeys (Sapajus sp) learning how to crack nuts: does variability decline throughout development?

    Science.gov (United States)

    Resende, Briseida Dogo; Nagy-Reis, Mariana Baldy; Lacerda, Fernanda Neves; Pagnotta, Murillo; Savalli, Carine

    2014-11-01

    We investigated the process of nut-cracking acquisition in a semi-free population of tufted capuchin monkeys (Sapajus sp) in São Paulo, Brazil. We analyzed the cracking episodes from monkeys of different ages and found that variability of actions related to cracking declined. Inept movements were more frequent in juveniles, which also showed an improvement on efficient striking. The most effective behavioral sequence for cracking was more frequently used by the most experienced monkeys, which also used non-optimal sequences. Variability in behavior sequences and actions may allow adaptive changes to behavior under changing environmental conditions. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Resources that promote positive youth development

    Directory of Open Access Journals (Sweden)

    Martha Frías Armenta

    2016-12-01

    Full Text Available Adolescence is a crucial developmental phase that shapes people´s futures. Positive psychology investigates the variables that promote the optimal development of human beings. It recognizes that all children and adolescents have strengths that will develop once these strengths match the resources needed to achieve this in the various settings in which they live. The aim of this study was to analyze from a multidisciplinary perspective (e.g. psychological, sociological, and economic the effect of resources that promote positive youth development. The sample consisted of 200 middle school students (15 to 19 years. EQS statistical software was used to analyse a structural equation model in which the study variables comprised 4 factors: one for each resource (economic, psychological, sociological, and one for positive youth development. The results showed a direct association between psychological and social resources and positive development, and between social resources and psychological assets. However, no association was found between economic resources and positive youth development. These results suggest that the main influences on positive youth development are psychological and social resources.

  3. Spatio-temporal alignment of pedobarographic image sequences.

    Science.gov (United States)

    Oliveira, Francisco P M; Sousa, Andreia; Santos, Rubim; Tavares, João Manuel R S

    2011-07-01

    This article presents a methodology to align plantar pressure image sequences simultaneously in time and space. The spatial position and orientation of a foot in a sequence are changed to match the foot represented in a second sequence. Simultaneously with the spatial alignment, the temporal scale of the first sequence is transformed with the aim of synchronizing the two input footsteps. Consequently, the spatial correspondence of the foot regions along the sequences as well as the temporal synchronizing is automatically attained, making the study easier and more straightforward. In terms of spatial alignment, the methodology can use one of four possible geometric transformation models: rigid, similarity, affine, or projective. In the temporal alignment, a polynomial transformation up to the 4th degree can be adopted in order to model linear and curved time behaviors. Suitable geometric and temporal transformations are found by minimizing the mean squared error (MSE) between the input sequences. The methodology was tested on a set of real image sequences acquired from a common pedobarographic device. When used in experimental cases generated by applying geometric and temporal control transformations, the methodology revealed high accuracy. In addition, the intra-subject alignment tests from real plantar pressure image sequences showed that the curved temporal models produced better MSE results (P alignment of pedobarographic image data, since previous methods can only be applied on static images.

  4. Draft genome sequence of the intestinal parasite Blastocystis subtype 4-isolate WR1

    Directory of Open Access Journals (Sweden)

    Ivan Wawrzyniak

    2015-06-01

    Full Text Available The intestinal protistan parasite Blastocystis is characterized by an extensive genetic variability with 17 subtypes (ST1–ST17 described to date. Only the whole genome of a human ST7 isolate was previously sequenced. Here we report the draft genome sequence of Blastocystis ST4-WR1 isolated from a laboratory rodent at Singapore.

  5. Complex analyses of inverted repeats in mitochondrial genomes revealed their importance and variability.

    Science.gov (United States)

    Cechová, Jana; Lýsek, Jirí; Bartas, Martin; Brázda, Václav

    2018-04-01

    The NCBI database contains mitochondrial DNA (mtDNA) genomes from numerous species. We investigated the presence and locations of inverted repeat sequences (IRs) in these mtDNA sequences, which are known to be important for regulating nuclear genomes. IRs were identified in mtDNA in all species. IR lengths and frequencies correlate with evolutionary age and the greatest variability was detected in subgroups of plants and fungi and the lowest variability in mammals. IR presence is non-random and evolutionary favoured. The frequency of IRs generally decreased with IR length, but not for IRs 24 or 30 bp long, which are 1.5 times more abundant. IRs are enriched in sequences from the replication origin, followed by D-loop, stem-loop and miscellaneous sequences, pointing to the importance of IRs in regulatory regions of mitochondrial DNA. Data were produced using Palindrome analyser, freely available on the web at http://bioinformatics.ibp.cz. vaclav@ibp.cz. Supplementary data are available at Bioinformatics online.

  6. The OGCleaner: filtering false-positive homology clusters.

    Science.gov (United States)

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

    2017-01-01

    Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Prediction of Protein Structural Classes for Low-Similarity Sequences Based on Consensus Sequence and Segmented PSSM

    Directory of Open Access Journals (Sweden)

    Yunyun Liang

    2015-01-01

    Full Text Available Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM. Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS, segmented PsePSSM, and segmented autocovariance transformation (ACT based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640 are adopted in this paper. Then a 700-dimensional (700D feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA. To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.

  8. Reconstruction of precipitation variability in the Strait of Yucatan associated with latitudinal shifts in the position of the Intertropical Convergence Zone since the Last Glacial Maximum

    Science.gov (United States)

    Staines-Urías, Francisca; Seidenkrantz, Marit-Solveig; Fischel, Andrea; Kuijpers, Antoon

    2017-04-01

    The elemental composition of sediments from gravity core HOLOVAR11-03 provides a ca. 40 ka record of past climate variability in the Strait of Yucatan, between the Caribbean Sea and the Gulf of Mexico, a region where precipitation variability is determined by the seasonal position of the Intertropical Convergence Zone (ITCZ). Within this region, sea level pressure decreases and rainfall increases as the ITCZ moves north of the equator in response to increased solar insolation in the Northern Hemisphere during boreal summer. In contrast, as the ITCZ retracts southward towards the equator during boreal winter, rainfall diminishes and the regional sea level pressure gradient strengthens. On interannual, multidecadal and millennial timescales, fluctuations in the average latitudinal position of the ITCZ in response to insolation forcing modulate the intensity and duration of the seasonal regimens, determining average regional precipitation and, ultimately, the elemental composition of the marine sedimentary record. Regionally, higher titanium and iron content in marine sediments reflect greater terrigenous input from inland runoff, indicating greater precipitation, hence a more northerly position of the ITCZ. Correspondingly, Ti and Fe concentration data were used to reconstruct regional rainfall variability since the Last Glacial Maxima (LGM ˜24 cal ka BP). HOLOVAR11-03 age model (based on 4 AMS 14C dates obtained from multi-specific samples of planktic foraminifera) shows stable sedimentation rates in the area throughout the cored period. Nonetheless, higher terrestrial mineral input is observed since the LGM and all through the last glacial termination (24 to 12 cal ka BP), indicating a period of increased precipitation. In contrast, lower Ti and Fe values are typical for the period between 12 and 8 cal ka BP, indicating reduced precipitation. A positive trend characterizes the following interval, showing a return to wetter conditions lasting until 5 cal ka BP

  9. Perceptual-gestural (mis)mapping in serial short-term memory: the impact of talker variability.

    Science.gov (United States)

    Hughes, Robert W; Marsh, John E; Jones, Dylan M

    2009-11-01

    The mechanisms underlying the poorer serial recall of talker-variable lists (e.g., alternating female-male voices) as compared with single-voice lists were examined. We tested the novel hypothesis that this talker variability effect arises from the tendency for perceptual organization to partition the list into streams based on voice such that the representation of order maps poorly onto the formation of a gestural sequence-output plan assembled in support of the reproduction of the true temporal order of the items. In line with the hypothesis, (a) the presence of a spoken lead-in designed to further promote by-voice perceptual partitioning accentuates the effect (Experiments 1 and 2); (b) the impairment is larger the greater the acoustic coherence is between nonadjacent items: Alternating-voice lists are more poorly recalled than four-voice lists (Experiment 3); and (c) talker variability combines nonadditively with phonological similarity, consistent with the view that both variables disrupt sequence output planning (Experiment 4). The results support the view that serial short-term memory performance reflects the action of sequencing processes embodied within general-purpose perceptual input-processing and gestural output-planning systems.

  10. Phylogenetic distribution of intron positions in alpha-amylase genes of bilateria suggests numerous gains and losses.

    Directory of Open Access Journals (Sweden)

    Jean-Luc Da Lage

    Full Text Available Most eukaryotes have at least some genes interrupted by introns. While it is well accepted that introns were already present at moderate density in the last eukaryote common ancestor, the conspicuous diversity of intron density among genomes suggests a complex evolutionary history, with marked differences between phyla. The question of the rates of intron gains and loss in the course of evolution and factors influencing them remains controversial. We have investigated a single gene family, alpha-amylase, in 55 species covering a variety of animal phyla. Comparison of intron positions across phyla suggests a complex history, with a likely ancestral intronless gene undergoing frequent intron loss and gain, leading to extant intron/exon structures that are highly variable, even among species from the same phylum. Because introns are known to play no regulatory role in this gene and there is no alternative splicing, the structural differences may be interpreted more easily: intron positions, sizes, losses or gains may be more likely related to factors linked to splicing mechanisms and requirements, and to recognition of introns and exons, or to more extrinsic factors, such as life cycle and population size. We have shown that intron losses outnumbered gains in recent periods, but that "resets" of intron positions occurred at the origin of several phyla, including vertebrates. Rates of gain and loss appear to be positively correlated. No phase preference was found. We also found evidence for parallel gains and for intron sliding. Presence of introns at given positions was correlated to a strong protosplice consensus sequence AG/G, which was much weaker in the absence of intron. In contrast, recent intron insertions were not associated with a specific sequence. In animal Amy genes, population size and generation time seem to have played only minor roles in shaping gene structures.

  11. Dynamical interpretation of the Hubble sequence of galaxies

    Energy Technology Data Exchange (ETDEWEB)

    Dallaporta, N; Secco, L [Padua Univ. (Italy). Istituto di Astronomia

    1977-08-01

    Brosche (1970) has proposed a theory in which the energy loss due to collisions among gas clouds contained in a galaxy constitutes the driving mechanism for its evolution, through virial equilibrium states, which, from an initial spherical shape, makes it to contract towards an elongated form; moreover, the value of the total angular momentum, assumed as given by uniform rotation, is assumed to determine the galaxy type on the Hubble sequence and to influence strongly the contraction time from the initial spherical to the final flat configuration. The authors modify Brosche's scheme by assuming as models the rotating polytropes of Chandrasekhar and Lebovitz with variable density from centre to border. As a consequence of this change, centrifugal shedding of matter is attained at the equator of the contracting ellipsoid for a configuration with an axial ratio different from zero, so that, hereafter, a flat disk is formed surrounding the internal bulge, with a decreasing overall eccentricity; the rotation curve assumes then an aspect qualitatively similar to the one observed for spiral galaxies. The feedback of star formation which, by exhausting the material of the gas clouds, is able to stop the driving mechanism of evolution before the final flat stage is attained has also been considered at several positions according to the value of the angular momentum. Numerical calculations seem to indicate that one can obtain in this way, by varying the angular momentum and the initial number of clouds, different galaxy types (elliptical, lenticular, spiral) resembling those of the Hubble sequence.

  12. Thermodynamic diagnosis of diesel and biodiesel combustion processes during load-increase transient sequences

    International Nuclear Information System (INIS)

    Armas, Octavio; Ballesteros, Rosario; Cardenas, María Dolores

    2012-01-01

    Highlights: ► Thermodynamic diagnosis was applied to diesel combustion process during transient operation. ► Comparative analysis of thermodynamic results with different biodiesel fuels has been carried out. ► Biodiesel fuels studied have a slight effect on timing of the combustion process. ► Methodology used can be applied to improve engine control when using different alternative fuels. -- Abstract: The study of the diesel combustion process is a current topic by the need of thermal efficiency improving and the reduction of pollutant emissions. This circumstance has forced researchers and manufacturers to optimize this process not only in steady state operating conditions but also during transient operation. A zero dimensional thermodynamic diagnostic model, with three species (air, fuel evaporated and burned products), has been used to characterize the combustion process during load increase transient sequences at two different engine speed. In both sequences, three variables were studied: the valve position of the exhaust gas recirculation (EGR), the elapsed time of the transition process and the type of fuel. Three biodiesel fuels were tested pure: rapeseed, soybean and sunflower which were compared to a commercial diesel fuel used as reference. Results are presented comparing the in-cylinder average maximum pressure and temperature, and the phasing of the combustion process based on the calculation of heat release. This study has allowed the detection of the effect of the tested engine parameters and the biodiesel fuels used on the in-cylinder thermodynamic conditions during the load transient sequences studied.

  13. GSTM1, GSTP1, and GSTT1 genetic variability in Turkish and worldwide populations.

    Science.gov (United States)

    Karaca, Sefayet; Karaca, Mehmet; Cesuroglu, Tomris; Erge, Sema; Polimanti, Renato

    2015-01-01

    Glutathione S-transferase (GST) variants have been widely investigated to better understand their role in several pathologic conditions. To our knowledge, no data about these genetic polymorphisms within the Turkish population are currently available. The aim of this study was to analyze GSTM1 positive/null, GSTT1 positive/null, GSTP1*I105V (rs1695), and GSTP1*A114V (rs1138272) variants in the general Turkish population, to provide information about its genetic diversity, and predisposition to GST-related diseases. Genotyping was performed in 500 Turkish individuals using the Sequenom MassARRAY platform. A comparative analysis was executed using the data from the HapMap and Human Genome Diversity Projects (HGDP). Sequence variation was deeply explored using the Phase 1 data of the 1,000 Genomes Project. The variability of GSTM1, GSTT1, and GSTP1 polymorphisms in the Turkish population was similar to that observed in Central Asian, European, and Middle Eastern populations. The high linkage disequilibrium between GSTP1*I105V and GSTP1*A114V in these populations may have a confounding effect on GSTP1 genetic association studies. In analyzing GSTM1, GSTT1, and GSTP1 sequence variation, we observed other common functional variants that may be candidates for associated studies of diseases related to GST genes (e.g., cancer, cardiovascular disease, and allergy). This study provides novel data about GSTM1 positive/null, GSTT1 positive/null, GSTP1*I105V, and GSTP1*A114V variants in the Turkish population, and other functional variants that may affect GSTM1, GSTT1, and GSTP1 functions among worldwide populations. This information can assist in the design of future genetic association studies investigating oxidative stress-related diseases. © 2014 Wiley Periodicals, Inc.

  14. Reducing false-positive incidental findings with ensemble genotyping and logistic regression based variant filtering methods.

    Science.gov (United States)

    Hwang, Kyu-Baek; Lee, In-Hee; Park, Jin-Ho; Hambuch, Tina; Choe, Yongjoon; Kim, MinHyeok; Lee, Kyungjoon; Song, Taemin; Neu, Matthew B; Gupta, Neha; Kohane, Isaac S; Green, Robert C; Kong, Sek Won

    2014-08-01

    As whole genome sequencing (WGS) uncovers variants associated with rare and common diseases, an immediate challenge is to minimize false-positive findings due to sequencing and variant calling errors. False positives can be reduced by combining results from orthogonal sequencing methods, but costly. Here, we present variant filtering approaches using logistic regression (LR) and ensemble genotyping to minimize false positives without sacrificing sensitivity. We evaluated the methods using paired WGS datasets of an extended family prepared using two sequencing platforms and a validated set of variants in NA12878. Using LR or ensemble genotyping based filtering, false-negative rates were significantly reduced by 1.1- to 17.8-fold at the same levels of false discovery rates (5.4% for heterozygous and 4.5% for homozygous single nucleotide variants (SNVs); 30.0% for heterozygous and 18.7% for homozygous insertions; 25.2% for heterozygous and 16.6% for homozygous deletions) compared to the filtering based on genotype quality scores. Moreover, ensemble genotyping excluded > 98% (105,080 of 107,167) of false positives while retaining > 95% (897 of 937) of true positives in de novo mutation (DNM) discovery in NA12878, and performed better than a consensus method using two sequencing platforms. Our proposed methods were effective in prioritizing phenotype-associated variants, and an ensemble genotyping would be essential to minimize false-positive DNM candidates. © 2014 WILEY PERIODICALS, INC.

  15. Zebra finches can use positional and transitional cues to distinguish vocal element strings.

    Science.gov (United States)

    Chen, Jiani; Ten Cate, Carel

    2015-08-01

    Learning sequences is of great importance to humans and non-human animals. Many motor and mental actions, such as singing in birds and speech processing in humans, rely on sequential learning. At least two mechanisms are considered to be involved in such learning. The chaining theory proposes that learning of sequences relies on memorizing the transitions between adjacent items, while the positional theory suggests that learners encode the items according to their ordinal position in the sequence. Positional learning is assumed to dominate sequential learning. However, human infants exposed to a string of speech sounds can learn transitional (chaining) cues. So far, it is not clear whether birds, an increasingly important model for examining vocal processing, can do this. In this study we use a Go-Nogo design to examine whether zebra finches can use transitional cues to distinguish artificially constructed strings of song elements. Zebra finches were trained with sequences differing in transitional and positional information and next tested with novel strings sharing positional and transitional similarities with the training strings. The results show that they can attend to both transitional and positional cues and that their sequential coding strategies can be biased toward transitional cues depending on the learning context. This article is part of a Special Issue entitled: In Honor of Jerry Hogan. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. High-fidelity target sequencing of individual molecules identified using barcode sequences: de novo detection and absolute quantitation of mutations in plasma cell-free DNA from cancer patients.

    Science.gov (United States)

    Kukita, Yoji; Matoba, Ryo; Uchida, Junji; Hamakawa, Takuya; Doki, Yuichiro; Imamura, Fumio; Kato, Kikuya

    2015-08-01

    Circulating tumour DNA (ctDNA) is an emerging field of cancer research. However, current ctDNA analysis is usually restricted to one or a few mutation sites due to technical limitations. In the case of massively parallel DNA sequencers, the number of false positives caused by a high read error rate is a major problem. In addition, the final sequence reads do not represent the original DNA population due to the global amplification step during the template preparation. We established a high-fidelity target sequencing system of individual molecules identified in plasma cell-free DNA using barcode sequences; this system consists of the following two steps. (i) A novel target sequencing method that adds barcode sequences by adaptor ligation. This method uses linear amplification to eliminate the errors introduced during the early cycles of polymerase chain reaction. (ii) The monitoring and removal of erroneous barcode tags. This process involves the identification of individual molecules that have been sequenced and for which the number of mutations have been absolute quantitated. Using plasma cell-free DNA from patients with gastric or lung cancer, we demonstrated that the system achieved near complete elimination of false positives and enabled de novo detection and absolute quantitation of mutations in plasma cell-free DNA. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  17. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  18. Experimental assessment of the importance of amino acid positions identified by an entropy-based correlation analysis of multiple-sequence alignments.

    Science.gov (United States)

    Dietrich, Susanne; Borst, Nadine; Schlee, Sandra; Schneider, Daniel; Janda, Jan-Oliver; Sterner, Reinhard; Merkl, Rainer

    2012-07-17

    The analysis of a multiple-sequence alignment (MSA) with correlation methods identifies pairs of residue positions whose occupation with amino acids changes in a concerted manner. It is plausible to assume that positions that are part of many such correlation pairs are important for protein function or stability. We have used the algorithm H2r to identify positions k in the MSAs of the enzymes anthranilate phosphoribosyl transferase (AnPRT) and indole-3-glycerol phosphate synthase (IGPS) that show a high conn(k) value, i.e., a large number of significant correlations in which k is involved. The importance of the identified residues was experimentally validated by performing mutagenesis studies with sAnPRT and sIGPS from the archaeon Sulfolobus solfataricus. For sAnPRT, five H2r mutant proteins were generated by replacing nonconserved residues with alanine or the prevalent residue of the MSA. As a control, five residues with conn(k) values of zero were chosen randomly and replaced with alanine. The catalytic activities and conformational stabilities of the H2r and control mutant proteins were analyzed by steady-state enzyme kinetics and thermal unfolding studies. Compared to wild-type sAnPRT, the catalytic efficiencies (k(cat)/K(M)) were largely unaltered. In contrast, the apparent thermal unfolding temperature (T(M)(app)) was lowered in most proteins. Remarkably, the strongest observed destabilization (ΔT(M)(app) = 14 °C) was caused by the V284A exchange, which pertains to the position with the highest correlation signal [conn(k) = 11]. For sIGPS, six H2r mutant and four control proteins with alanine exchanges were generated and characterized. The k(cat)/K(M) values of four H2r mutant proteins were reduced between 13- and 120-fold, and their T(M)(app) values were decreased by up to 5 °C. For the sIGPS control proteins, the observed activity and stability decreases were much less severe. Our findings demonstrate that positions with high conn(k) values have an

  19. Evidence for positive selection in putative virulence factors within the Paracoccidioides brasiliensis species complex.

    Directory of Open Access Journals (Sweden)

    Daniel R Matute

    Full Text Available Paracoccidioides brasiliensis is a dimorphic fungus that is the causative agent of paracoccidioidomycosis, the most important prevalent systemic mycosis in Latin America. Recently, the existence of three genetically isolated groups in P. brasiliensis was demonstrated, enabling comparative studies of molecular evolution among P. brasiliensis lineages. Thirty-two gene sequences coding for putative virulence factors were analyzed to determine whether they were under positive selection. Our maximum likelihood-based approach yielded evidence for selection in 12 genes that are involved in different cellular processes. An in-depth analysis of four of these genes showed them to be either antigenic or involved in pathogenesis. Here, we present evidence indicating that several replacement mutations in gp43 are under positive balancing selection. The other three genes (fks, cdc42 and p27 show very little variation among the P. brasiliensis lineages and appear to be under positive directional selection. Our results are consistent with the more general observations that selective constraints are variable across the genome, and that even in the genes under positive selection, only a few sites are altered. We present our results within an evolutionary framework that may be applicable for studying adaptation and pathogenesis in P. brasiliensis and other pathogenic fungi.

  20. Statistical convergence of a non-positive approximation process

    International Nuclear Information System (INIS)

    Agratini, Octavian

    2011-01-01

    Highlights: → A general class of approximation processes is introduced. → The A-statistical convergence is studied. → Applications in quantum calculus are delivered. - Abstract: Starting from a general sequence of linear and positive operators of discrete type, we associate its r-th order generalization. This construction involves high order derivatives of a signal and it looses the positivity property. Considering that the initial approximation process is A-statistically uniform convergent, we prove that the property is inherited by the new sequence. Also, our result includes information about the uniform convergence. Two applications in q-Calculus are presented. We study q-analogues both of Meyer-Koenig and Zeller operators and Stancu operators.

  1. Validation of Genotyping-By-Sequencing Analysis in Populations of Tetraploid Alfalfa by 454 Sequencing

    Science.gov (United States)

    Rocher, Solen; Jean, Martine; Castonguay, Yves; Belzile, François

    2015-01-01

    Genotyping-by-sequencing (GBS) is a relatively low-cost high throughput genotyping technology based on next generation sequencing and is applicable to orphan species with no reference genome. A combination of genome complexity reduction and multiplexing with DNA barcoding provides a simple and affordable way to resolve allelic variation between plant samples or populations. GBS was performed on ApeKI libraries using DNA from 48 genotypes each of two heterogeneous populations of tetraploid alfalfa (Medicago sativa spp. sativa): the synthetic cultivar Apica (ATF0) and a derived population (ATF5) obtained after five cycles of recurrent selection for superior tolerance to freezing (TF). Nearly 400 million reads were obtained from two lanes of an Illumina HiSeq 2000 sequencer and analyzed with the Universal Network-Enabled Analysis Kit (UNEAK) pipeline designed for species with no reference genome. Following the application of whole dataset-level filters, 11,694 single nucleotide polymorphism (SNP) loci were obtained. About 60% had a significant match on the Medicago truncatula syntenic genome. The accuracy of allelic ratios and genotype calls based on GBS data was directly assessed using 454 sequencing on a subset of SNP loci scored in eight plant samples. Sequencing depth in this study was not sufficient for accurate tetraploid allelic dosage, but reliable genotype calls based on diploid allelic dosage were obtained when using additional quality filtering. Principal Component Analysis of SNP loci in plant samples revealed that a small proportion (<5%) of the genetic variability assessed by GBS is able to differentiate ATF0 and ATF5. Our results confirm that analysis of GBS data using UNEAK is a reliable approach for genome-wide discovery of SNP loci in outcrossed polyploids. PMID:26115486

  2. New scoring schema for finding motifs in DNA Sequences

    Directory of Open Access Journals (Sweden)

    Nowzari-Dalini Abbas

    2009-03-01

    Full Text Available Abstract Background Pattern discovery in DNA sequences is one of the most fundamental problems in molecular biology with important applications in finding regulatory signals and transcription factor binding sites. An important task in this problem is to search (or predict known binding sites in a new DNA sequence. For this reason, all subsequences of the given DNA sequence are scored based on an scoring function and the prediction is done by selecting the best score. By assuming no dependency between binding site base positions, most of the available tools for known binding site prediction are designed. Recently Tomovic and Oakeley investigated the statistical basis for either a claim of dependence or independence, to determine whether such a claim is generally true, and they presented a scoring function for binding site prediction based on the dependency between binding site base positions. Our primary objective is to investigate the scoring functions which can be used in known binding site prediction based on the assumption of dependency or independency in binding site base positions. Results We propose a new scoring function based on the dependency between all positions in biding site base positions. This scoring function uses joint information content and mutual information as a measure of dependency between positions in transcription factor binding site. Our method for modeling dependencies is simply an extension of position independency methods. We evaluate our new scoring function on the real data sets extracted from JASPAR and TRANSFAC data bases, and compare the obtained results with two other well known scoring functions. Conclusion The results demonstrate that the new approach improves known binding site discovery and show that the joint information content and mutual information provide a better and more general criterion to investigate the relationships between positions in the TFBS. Our scoring function is formulated by simple

  3. Accuracy of perioperative mandibular positions in orthognathic surgery.

    Science.gov (United States)

    Borba, A M; Ribeiro-Junior, O; Brozoski, M A; Cé, P S; Espinosa, M M; Deboni, M C Z; Miloro, M; Naclério-Homem, M G

    2014-08-01

    Mandibular position is an important parameter used for the diagnosis of dentofacial deformities, as well as for orthognathic surgery planning and execution. Centric relation (anterior and superior relationship of the mandibular condyles interposed by the thinnest portion of their disks against the articular eminencies), centric occlusion (when lower teeth contact upper teeth at centric relation), and maximal intercuspation (complete interdigitation of lower and upper teeth) are not often addressed as factors that influence the results of orthognathic surgery, although these relationships are critical to ensure accuracy during the surgery. The present study assessed occlusal measurements taken before and after the induction of general anaesthesia from consecutive orthognathic surgery subjects. The variables assessed included the differences between these occlusal measurements, patient age, gender, type of deformity, and type of proposed orthognathic surgical procedure. The results demonstrated statistically significant differences for mandibular retrusion from maximal intercuspation to centric occlusion position, whereas the mandible appeared not to change significantly from centric occlusion after the induction of general anaesthesia. Patient age and the type of deformity appeared to influence the results. While in most instances centric occlusion can be adequately reproduced under general anaesthesia, for some specific orthognathic cases more accurate results might be obtained if the mandible-first sequence is used. Copyright © 2014 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  4. Human parainfluenza virus type 2 hemagglutinin-neuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009

    Directory of Open Access Journals (Sweden)

    Almajhdi Fahad N

    2012-12-01

    Full Text Available Abstract Background Although human parainfluenza type 2 (HPIV-2 virus is an important respiratory pathogen, a little is known about strains circulating in Saudi Arabia. Findings Among 180 nasopharyngeal aspirates collected from suspected cases in Riyadh, only one sample (0.56% was confirmed HPIV-2 positive by nested RT-PCR. The sample that was designated Riyadh 105/2009 was used for sequencing and phylogenetic analysis of the most variable virus gene; the haemagglutinin-neuramindase (HN. Comparison of HN gene of Riyadh 105/2009 strain and the relevant sequences available in GenBank revealed a strong relationship with Oklahoma-94-2009 strain. Phylogenetic analysis indicated four different clusters of HPIV-2 strains (G1-4. Twenty-three amino acid substitutions were recorded for Riyadh 105/2009, from which four are unique. The majority of substitutions (n=18 had changed their amino acids characteristics. By analyzing the effect of the recorded substitutions on the protein function using SIFT program, only two located at positions 360 and 571 were predicted to be deleterious. Conclusions The presented changes of Riyadh 105/2009 strain may possess potential effect on the protein structure and/or function level. This is the first report that describes partial characterization of Saudi HPIV-2 strain.

  5. Human pro. cap alpha. 1(III) collagen: cDNA sequence for the 3' end

    Energy Technology Data Exchange (ETDEWEB)

    Mankoo, B S; Dalgleish, R

    1988-03-25

    The authors have previously isolated two overlapping cDNA clones, pIII-21 and pIII-33, which encode the C-terminal end of human type III procollagen. They now present the sequence of 2520 bases encoded in these cDNAs which overlaps other previously published sequences for the same gene. The sequence presented differs from previously published sequences at five positions.

  6. Linear quadratic optimization for positive LTI system

    Science.gov (United States)

    Muhafzan, Yenti, Syafrida Wirma; Zulakmal

    2017-05-01

    Nowaday the linear quadratic optimization subject to positive linear time invariant (LTI) system constitute an interesting study considering it can become a mathematical model of variety of real problem whose variables have to nonnegative and trajectories generated by these variables must be nonnegative. In this paper we propose a method to generate an optimal control of linear quadratic optimization subject to positive linear time invariant (LTI) system. A sufficient condition that guarantee the existence of such optimal control is discussed.

  7. Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

    Science.gov (United States)

    Salinas, Danieli B; Sosnay, Patrick R; Azen, Colleen; Young, Suzanne; Raraigh, Karen S; Keens, Thomas G; Kharrazi, Martin

    2016-01-01

    Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance. We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C); those with one mutation of varying clinic consequence (VCC); and those with one mutation of unknown disease liability (Unknown). Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared. Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78) and 11% of Unknown (27/244) met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing. While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

  8. Prevalence and variability of use of home mechanical ventilators, positive airway pressure and oxygen devices in the Lombardy region, Italy.

    Science.gov (United States)

    Vitacca, Michele; Barbano, Luca; Colombo, Daniele; Leoni, Olivia; Guffanti, Enrico

    2018-01-29

    Few studies have analyzed the prevalence and accessibility of home mechanical ventilation (HMV) in Italy. We aimed to investigate the prevalence and prescription variability of HMV as well as of long-term oxygen therapy (LTOT) and continuous positive airway pressure (CPAP), in the Lombardy Region. Prescribing rates of HMV (both noninvasive and tracheostomies), CPAP (auto-CPAP, CPAP/other sleep machines) and LTOT (liquid-O2, O2-gas, concentrators) in the 15 Local Healthcare districts of Lombardy were gathered from billing data for 2012 and compared. Crude rates (per 100,000 population) and rates for the different healthcare districts were calculated. In 2012, 6325 patients were on HMV (crude prescription rate: 63/100,000) with a high variation across districts (8/100,000 in Milano 1 vs 150/100,000 in Pavia). There were 14,237 patients on CPAP (crude prescription rate: 142/100,000; CPAP/other sleep machines 95.3% vs auto-CPAP 4.7%) with also high intra-regional variation (56/100,000 in Mantova vs. 260/100,000 in Pavia). There were 21,826 patients on LTOT (prescription rate: 217/100,000 rate; liquid-O2 94%, O2-gas 2.08%, O2-concentrators 3.8%), with again high intra-regional variation (100/100,000 in Bergamo vs 410/100,000 in Valle Camonica). The crude rate of HMV prescriptions in Lombardy is very high, with a high intra-regional variability in prescribing HMV, LTOT and CPAP which is partly explainable by the accessibility to specialist centers with HMV/sleep-study facilities. Analysis of administrative data and variability mapping can help identify areas of reduced access for an improved standardization of services. An audit among Health Payer and prescribers to interpret the described huge variability could be welcomed.

  9. Nursing Student Perceptions Regarding Simulation Experience Sequencing.

    Science.gov (United States)

    Woda, Aimee A; Gruenke, Theresa; Alt-Gehrman, Penny; Hansen, Jamie

    2016-09-01

    The use of simulated learning experiences (SLEs) have increased within nursing curricula with positive learning outcomes for nursing students. The purpose of this study is to explore nursing students' perceptions of their clinical decision making (CDM) related to the block sequencing of different patient care experiences, SLEs versus hospital-based learning experiences (HLEs). A qualitative descriptive design used open-ended survey questions to generate information about the block sequencing of SLEs and its impact on nursing students' perceived CDM. Three themes emerged from the data: Preexperience Anxiety, Real-Time Decision Making, and Increased Patient Care Experiences. Nursing students identified that having SLEs prior to HLEs provided several benefits. Even when students preferred SLEs prior to HLEs, the sequence did not impact their CDM. This suggests that alternating block sequencing can be used without impacting the students' perceptions of their ability to make decisions. [J Nurs Educ. 2016;55(9):528-532.]. Copyright 2016, SLACK Incorporated.

  10. Winnowing sequences from a database search.

    Science.gov (United States)

    Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W

    2000-01-01

    In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.

  11. Sequence analysis reveals how G protein-coupled receptors transduce the signal to the G protein.

    NARCIS (Netherlands)

    Oliveira, L.; Paiva, P.B.; Paiva, A.C.; Vriend, G.

    2003-01-01

    Sequence entropy-variability plots based on alignments of very large numbers of sequences-can indicate the location in proteins of the main active site and modulator sites. In the previous article in this issue, we applied this observation to a series of well-studied proteins and concluded that it

  12. Multiple aspects of ATP-dependent nucleosome translocation by RSC and Mi-2 are directed by the underlying DNA sequence.

    Directory of Open Access Journals (Sweden)

    Joke J F A van Vugt

    Full Text Available BACKGROUND: Chromosome structure, DNA metabolic processes and cell type identity can all be affected by changing the positions of nucleosomes along chromosomal DNA, a reaction that is catalysed by SNF2-type ATP-driven chromatin remodelers. Recently it was suggested that in vivo, more than 50% of the nucleosome positions can be predicted simply by DNA sequence, especially within promoter regions. This seemingly contrasts with remodeler induced nucleosome mobility. The ability of remodeling enzymes to mobilise nucleosomes over short DNA distances is well documented. However, the nucleosome translocation processivity along DNA remains elusive. Furthermore, it is unknown what determines the initial direction of movement and how new nucleosome positions are adopted. METHODOLOGY/PRINCIPAL FINDINGS: We have used AFM imaging and high resolution PAGE of mononucleosomes on 600 and 2500 bp DNA molecules to analyze ATP-dependent nucleosome repositioning by native and recombinant SNF2-type enzymes. We report that the underlying DNA sequence can control the initial direction of translocation, translocation distance, as well as the new positions adopted by nucleosomes upon enzymatic mobilization. Within a strong nucleosomal positioning sequence both recombinant Drosophila Mi-2 (CHD-type and native RSC from yeast (SWI/SNF-type repositioned the nucleosome at 10 bp intervals, which are intrinsic to the positioning sequence. Furthermore, RSC-catalyzed nucleosome translocation was noticeably more efficient when beyond the influence of this sequence. Interestingly, under limiting ATP conditions RSC preferred to position the nucleosome with 20 bp intervals within the positioning sequence, suggesting that native RSC preferentially translocates nucleosomes with 15 to 25 bp DNA steps. CONCLUSIONS/SIGNIFICANCE: Nucleosome repositioning thus appears to be influenced by both remodeler intrinsic and DNA sequence specific properties that interplay to define ATPase

  13. Position dependent mismatch discrimination on DNA microarrays – experiments and model

    Directory of Open Access Journals (Sweden)

    Michel Wolfgang

    2008-12-01

    Full Text Available Abstract Background The propensity of oligonucleotide strands to form stable duplexes with complementary sequences is fundamental to a variety of biological and biotechnological processes as various as microRNA signalling, microarray hybridization and PCR. Yet our understanding of oligonucleotide hybridization, in particular in presence of surfaces, is rather limited. Here we use oligonucleotide microarrays made in-house by optically controlled DNA synthesis to produce probe sets comprising all possible single base mismatches and base bulges for each of 20 sequence motifs under study. Results We observe that mismatch discrimination is mostly determined by the defect position (relative to the duplex ends as well as by the sequence context. We investigate the thermodynamics of the oligonucleotide duplexes on the basis of double-ended molecular zipper. Theoretical predictions of defect positional influence as well as long range sequence influence agree well with the experimental results. Conclusion Molecular zipping at thermodynamic equilibrium explains the binding affinity of mismatched DNA duplexes on microarrays well. The position dependent nearest neighbor model (PDNN can be inferred from it. Quantitative understanding of microarray experiments from first principles is in reach.

  14. Positioning and applications

    Directory of Open Access Journals (Sweden)

    Rogowski Jerzy B.

    2015-12-01

    Full Text Available The paper presents national report of Poland for IAG on positioning and applications. The selected research presented was carried out at leading Polish research institutions and concern precise multi-GNSS satellite positioning - relative and absolute - and also GNSS-based ionosphere and troposphere modelling and studies. The research resulted in noticeable advancements in these subjects confirmed by the development of new algorithms and methods. New and improved methods of precise GNSS positioning were developed, and also GNSS metrology was studied. New advanced troposphere models were presented and tested. In particular, these models allowed testing IPW variability on regional and global scales. Also, new regional ionosphere monitoring web-based services were developed and launched.

  15. AlignMe—a membrane protein sequence alignment web server

    Science.gov (United States)

    Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.

    2014-01-01

    We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425

  16. Stratigraphy and stable isotope geochemistry of the carbonate sequence from the Paraguay belt

    International Nuclear Information System (INIS)

    Santos, Roberto Ventura.; Alvarenga, Carlos Jose Souza de; Dantas, Elton Luiz

    2001-01-01

    isotope data across 1300 m of carbonates from the northern Paraguay Belt that are stratigraphically placed above glacial sediments. The whole sequence may be divided into three different horizons that shows a general increase in δ 13 C PDB values from the base to the top: 1) a lower horizon in which the δ 13 C PDB values are negative; 2) a intermediate horizon dominated by slightly positive carbon isotope values; and 3) an upper horizon in which the carbon isotope values vary from -1% o to +9.3% o Compared to the carbonate sequences from the Brasilia Belt (Bambui Group), the amount of high δ 13 C PDB values in the Paraguay belt is much less prominent. Rocks from the lower horizon lay directly above the glacial diamictites and present variable δ 18 O PDB values. Besides presenting negative δ 13 C PDB values, they also display a negative carbon isotope peak that may reach values as low as 10% o . The intermediate horizon is best represented in the Provincia Serrana area and is characterized by homogeneous δ 13 C PDB values through out the sequence. This horizon is dominated by dolostones and present δ 18 O PDB values ranging between + 1.9% o and +2.7% o . The upper horizon is dominated by dolostones and present variable δ 13 C PDB and δ 18 O PDB values. The highest δ 13 C PDB values were found on samples from a narrow layer from the Provincia Serrana area. Although the Guia area also has positive values (+3.8% o , they were not as high as those from the Provincia Serrana. At the end of the profile, and just bellow the contact with the upper siliciclastic unit, there is an abrupt decrease in the δ 13 C PDB values down to -2.0% o (au)

  17. Ecosystem variability in west Greenland waters

    DEFF Research Database (Denmark)

    Buch, E.; Pedersen, Søren Anker; Ribergaard, M. H.

    2004-01-01

    A review of the climate conditions off West Greenland during the past 50 years shows large variability in the atmospheric, oceanographic and sea-ice variables, as well as in fish stocks. A positive relationship is found between water temperature and the recruitment of cod and redfish, whereas the...

  18. Optimization of parameter values for complex pulse sequences by simulated annealing: application to 3D MP-RAGE imaging of the brain.

    Science.gov (United States)

    Epstein, F H; Mugler, J P; Brookeman, J R

    1994-02-01

    A number of pulse sequence techniques, including magnetization-prepared gradient echo (MP-GRE), segmented GRE, and hybrid RARE, employ a relatively large number of variable pulse sequence parameters and acquire the image data during a transient signal evolution. These sequences have recently been proposed and/or used for clinical applications in the brain, spine, liver, and coronary arteries. Thus, the need for a method of deriving optimal pulse sequence parameter values for this class of sequences now exists. Due to the complexity of these sequences, conventional optimization approaches, such as applying differential calculus to signal difference equations, are inadequate. We have developed a general framework for adapting the simulated annealing algorithm to pulse sequence parameter value optimization, and applied this framework to the specific case of optimizing the white matter-gray matter signal difference for a T1-weighted variable flip angle 3D MP-RAGE sequence. Using our algorithm, the values of 35 sequence parameters, including the magnetization-preparation RF pulse flip angle and delay time, 32 flip angles in the variable flip angle gradient-echo acquisition sequence, and the magnetization recovery time, were derived. Optimized 3D MP-RAGE achieved up to a 130% increase in white matter-gray matter signal difference compared with optimized 3D RF-spoiled FLASH with the same total acquisition time. The simulated annealing approach was effective at deriving optimal parameter values for a specific 3D MP-RAGE imaging objective, and may be useful for other imaging objectives and sequences in this general class.

  19. Expressed sequence tags as a tool for phylogenetic analysis of placental mammal evolution.

    Directory of Open Access Journals (Sweden)

    Morgan Kullberg

    Full Text Available BACKGROUND: We investigate the usefulness of expressed sequence tags, ESTs, for establishing divergences within the tree of placental mammals. This is done on the example of the established relationships among primates (human, lagomorphs (rabbit, rodents (rat and mouse, artiodactyls (cow, carnivorans (dog and proboscideans (elephant. METHODOLOGY/PRINCIPAL FINDINGS: We have produced 2000 ESTs (1.2 mega bases from a marsupial mouse and characterized the data for their use in phylogenetic analysis. The sequences were used to identify putative orthologous sequences from whole genome projects. Although most ESTs stem from single sequence reads, the frequency of potential sequencing errors was found to be lower than allelic variation. Most of the sequences represented slowly evolving housekeeping-type genes, with an average amino acid distance of 6.6% between human and mouse. Positive Darwinian selection was identified at only a few single sites. Phylogenetic analyses of the EST data yielded trees that were consistent with those established from whole genome projects. CONCLUSIONS: The general quality of EST sequences and the general absence of positive selection in these sequences make ESTs an attractive tool for phylogenetic analysis. The EST approach allows, at reasonable costs, a fast extension of data sampling from species outside the genome projects.

  20. In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

    Directory of Open Access Journals (Sweden)

    Amit Kumar Dubey

    2010-01-01

    Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

  1. HIV-1 subtype A gag variability and epitope evolution.

    Science.gov (United States)

    Abidi, Syed Hani; Kalish, Marcia L; Abbas, Farhat; Rowland-Jones, Sarah; Ali, Syed

    2014-01-01

    The aim of this study was to examine the course of time-dependent evolution of HIV-1 subtype A on a global level, especially with respect to the dynamics of immunogenic HIV gag epitopes. We used a total of 1,893 HIV-1 subtype A gag sequences representing a timeline from 1985 through 2010, and 19 different countries in Africa, Europe and Asia. The phylogenetic relationship of subtype A gag and its epidemic dynamics was analysed through a Maximum Likelihood tree and Bayesian Skyline plot, genomic variability was measured in terms of G → A substitutions and Shannon entropy, and the time-dependent evolution of HIV subtype A gag epitopes was examined. Finally, to confirm observations on globally reported HIV subtype A sequences, we analysed the gag epitope data from our Kenyan, Pakistani, and Afghan cohorts, where both cohort-specific gene epitope variability and HLA restriction profiles of gag epitopes were examined. The most recent common ancestor of the HIV subtype A epidemic was estimated to be 1956 ± 1. A period of exponential growth began about 1980 and lasted for approximately 7 years, stabilized for 15 years, declined for 2-3 years, then stabilized again from about 2004. During the course of evolution, a gradual increase in genomic variability was observed that peaked in 2005-2010. We observed that the number of point mutations and novel epitopes in gag also peaked concurrently during 2005-2010. It appears that as the HIV subtype A epidemic spread globally, changing population immunogenetic pressures may have played a role in steering immune-evolution of this subtype in new directions. This trend is apparent in the genomic variability and epitope diversity of HIV-1 subtype A gag sequences.

  2. HIV-1 subtype A gag variability and epitope evolution.

    Directory of Open Access Journals (Sweden)

    Syed Hani Abidi

    Full Text Available OBJECTIVE: The aim of this study was to examine the course of time-dependent evolution of HIV-1 subtype A on a global level, especially with respect to the dynamics of immunogenic HIV gag epitopes. METHODS: We used a total of 1,893 HIV-1 subtype A gag sequences representing a timeline from 1985 through 2010, and 19 different countries in Africa, Europe and Asia. The phylogenetic relationship of subtype A gag and its epidemic dynamics was analysed through a Maximum Likelihood tree and Bayesian Skyline plot, genomic variability was measured in terms of G → A substitutions and Shannon entropy, and the time-dependent evolution of HIV subtype A gag epitopes was examined. Finally, to confirm observations on globally reported HIV subtype A sequences, we analysed the gag epitope data from our Kenyan, Pakistani, and Afghan cohorts, where both cohort-specific gene epitope variability and HLA restriction profiles of gag epitopes were examined. RESULTS: The most recent common ancestor of the HIV subtype A epidemic was estimated to be 1956 ± 1. A period of exponential growth began about 1980 and lasted for approximately 7 years, stabilized for 15 years, declined for 2-3 years, then stabilized again from about 2004. During the course of evolution, a gradual increase in genomic variability was observed that peaked in 2005-2010. We observed that the number of point mutations and novel epitopes in gag also peaked concurrently during 2005-2010. CONCLUSION: It appears that as the HIV subtype A epidemic spread globally, changing population immunogenetic pressures may have played a role in steering immune-evolution of this subtype in new directions. This trend is apparent in the genomic variability and epitope diversity of HIV-1 subtype A gag sequences.

  3. A constitutive equation for creep fracture under constant, variable or cyclic positive stress

    International Nuclear Information System (INIS)

    Snedden, J.D.

    1977-01-01

    Prediction of creep fracture of metals under variable stress is one of the most difficult problems of applied mechanics. At NEL this problem is under investigation using an approach in which creep is represented by two macroscopic components: an anelastic (reversible) component and a plastic (irreversible) component. Under variable loading conditions, the anelastic component's behaviour will be most important and, if an experimental programme is logically planned, the structural processes responsible will be implicit in the resulting constitutive equation describing the material's behaviour. The present paper deals with the development and application of a constitutive equation for creep fracture of RR58 Aluminium alloy at 180 0 C under variable stress and such a constitutive equation can be extrapolated to cover long-time behaviour just as with conventional constant stress creep fracture equations. Constant stress, in fact, is one of the boundary conditions of the general constitutive equation, representing zero prior damage. The other boundary condition is that of 'cadence loading' in which the stress is completely removed and then re-applied in a cyclic fashion. (Auth.)

  4. Pulsed-field gel electrophoresis and multi locus sequence typing for characterizing genotype variability of Yersinia ruckeri isolated from farmed fish in France.

    Science.gov (United States)

    Calvez, Ségolène; Fournel, Catherine; Douet, Diane-Gaëlle; Daniel, Patrick

    2015-06-23

    Yersinia ruckeri is a pathogen that has an impact on aquaculture worldwide. The disease caused by this bacterial species, yersiniosis or redmouth disease, generates substantial economic losses due to the associated mortality and veterinary costs. For predicting outbreaks and improving control strategies, it is important to characterize the population structure of the bacteria. The phenotypic and genetic homogeneities described previously indicate a clonal population structure as observed in other fish bacteria. In this study, the pulsed-field gel electrophoresis (PFGE) and multi locus sequence typing (MLST) methods were used to describe a population of isolates from outbreaks on French fish farms. For the PFGE analysis, two enzymes (NotI and AscI) were used separately and together. Results from combining the enzymes showed the great homogeneity of the outbreak population with a similarity > 80.0% but a high variability within the cluster (cut-off value = 80.0%) with a total of 43 pulsotypes described and an index of diversity = 0.93. The dominant pulsotypes described with NotI (PtN4 and PtN7) have already been described in other European countries (Finland, Germany, Denmark, Spain and Italy). The MLST approach showed two dominant sequence types (ST31 and ST36), an epidemic structure of the French Y. ruckeri population and a preferentially clonal evolution for rainbow trout isolates. Our results point to multiple types of selection pressure on the Y. ruckeri population attributable to geographical origin, ecological niche specialization and movements of farmed fish.

  5. Exploring evidence of positive selection reveals genetic basis of meat quality traits in Berkshire pigs through whole genome sequencing.

    Science.gov (United States)

    Jeong, Hyeonsoo; Song, Ki-Duk; Seo, Minseok; Caetano-Anollés, Kelsey; Kim, Jaemin; Kwak, Woori; Oh, Jae-Don; Kim, EuiSoo; Jeong, Dong Kee; Cho, Seoae; Kim, Heebal; Lee, Hak-Kyo

    2015-08-20

    Natural and artificial selection following domestication has led to the existence of more than a hundred pig breeds, as well as incredible variation in phenotypic traits. Berkshire pigs are regarded as having superior meat quality compared to other breeds. As the meat production industry seeks selective breeding approaches to improve profitable traits such as meat quality, information about genetic determinants of these traits is in high demand. However, most of the studies have been performed using trained sensory panel analysis without investigating the underlying genetic factors. Here we investigate the relationship between genomic composition and this phenotypic trait by scanning for signatures of positive selection in whole-genome sequencing data. We generated genomes of 10 Berkshire pigs at a total of 100.6 coverage depth, using the Illumina Hiseq2000 platform. Along with the genomes of 11 Landrace and 13 Yorkshire pigs, we identified genomic variants of 18.9 million SNVs and 3.4 million Indels in the mapped regions. We identified several associated genes related to lipid metabolism, intramuscular fatty acid deposition, and muscle fiber type which attribute to pork quality (TG, FABP1, AKIRIN2, GLP2R, TGFBR3, JPH3, ICAM2, and ERN1) by applying between population statistical tests (XP-EHH and XP-CLR). A statistical enrichment test was also conducted to detect breed specific genetic variation. In addition, de novo short sequence read assembly strategy identified several candidate genes (SLC25A14, IGF1, PI4KA, CACNA1A) as also contributing to lipid metabolism. Results revealed several candidate genes involved in Berkshire meat quality; most of these genes are involved in lipid metabolism and intramuscular fat deposition. These results can provide a basis for future research on the genomic characteristics of Berkshire pigs.

  6. The DUB/USP17 deubiquitinating enzymes: A gene family within a tandemly repeated sequence, is also embedded within the copy number variable Beta-defensin cluster

    Directory of Open Access Journals (Sweden)

    Scott Christopher J

    2010-04-01

    Full Text Available Abstract Background The DUB/USP17 subfamily of deubiquitinating enzymes were originally identified as immediate early genes induced in response to cytokine stimulation in mice (DUB-1, DUB-1A, DUB-2, DUB-2A. Subsequently we have identified a number of human family members and shown that one of these (DUB-3 is also cytokine inducible. We originally showed that constitutive expression of DUB-3 can block cell proliferation and more recently we have demonstrated that this is due to its regulation of the ubiquitination and activity of the 'CAAX' box protease RCE1. Results Here we demonstrate that the human DUB/USP17 family members are found on both chromosome 4p16.1, within a block of tandem repeats, and on chromosome 8p23.1, embedded within the copy number variable beta-defensin cluster. In addition, we show that the multiple genes observed in humans and other distantly related mammals have arisen due to the independent expansion of an ancestral sequence within each species. However, it is also apparent when sequences from humans and the more closely related chimpanzee are compared, that duplication events have taken place prior to these species separating. Conclusions The observation that the DUB/USP17 genes, which can influence cell growth and survival, have evolved from an unstable ancestral sequence which has undergone multiple and varied duplications in the species examined marks this as a unique family. In addition, their presence within the beta-defensin repeat raises the question whether they may contribute to the influence of this repeat on immune related conditions.

  7. Properties of Sequence Conservation in Upstream Regulatory and Protein Coding Sequences among Paralogs in Arabidopsis thaliana

    Science.gov (United States)

    Richardson, Dale N.; Wiehe, Thomas

    Whole genome duplication (WGD) has catalyzed the formation of new species, genes with novel functions, altered expression patterns, complexified signaling pathways and has provided organisms a level of genetic robustness. We studied the long-term evolution and interrelationships of 5’ upstream regulatory sequences (URSs), protein coding sequences (CDSs) and expression correlations (EC) of duplicated gene pairs in Arabidopsis. Three distinct methods revealed significant evolutionary conservation between paralogous URSs and were highly correlated with microarray-based expression correlation of the respective gene pairs. Positional information on exact matches between sequences unveiled the contribution of micro-chromosomal rearrangements on expression divergence. A three-way rank analysis of URS similarity, CDS divergence and EC uncovered specific gene functional biases. Transcription factor activity was associated with gene pairs exhibiting conserved URSs and divergent CDSs, whereas a broad array of metabolic enzymes was found to be associated with gene pairs showing diverged URSs but conserved CDSs.

  8. Optimization of short amino acid sequences classifier

    Science.gov (United States)

    Barcz, Aleksy; Szymański, Zbigniew

    This article describes processing methods used for short amino acid sequences classification. The data processed are 9-symbols string representations of amino acid sequences, divided into 49 data sets - each one containing samples labeled as reacting or not with given enzyme. The goal of the classification is to determine for a single enzyme, whether an amino acid sequence would react with it or not. Each data set is processed separately. Feature selection is performed to reduce the number of dimensions for each data set. The method used for feature selection consists of two phases. During the first phase, significant positions are selected using Classification and Regression Trees. Afterwards, symbols appearing at the selected positions are substituted with numeric values of amino acid properties taken from the AAindex database. In the second phase the new set of features is reduced using a correlation-based ranking formula and Gram-Schmidt orthogonalization. Finally, the preprocessed data is used for training LS-SVM classifiers. SPDE, an evolutionary algorithm, is used to obtain optimal hyperparameters for the LS-SVM classifier, such as error penalty parameter C and kernel-specific hyperparameters. A simple score penalty is used to adapt the SPDE algorithm to the task of selecting classifiers with best performance measures values.

  9. Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja

    2012-08-01

    Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.

  10. Functional regression method for whole genome eQTL epistasis analysis with sequencing data.

    Science.gov (United States)

    Xu, Kelin; Jin, Li; Xiong, Momiao

    2017-05-18

    Epistasis plays an essential rule in understanding the regulation mechanisms and is an essential component of the genetic architecture of the gene expressions. However, interaction analysis of gene expressions remains fundamentally unexplored due to great computational challenges and data availability. Due to variation in splicing, transcription start sites, polyadenylation sites, post-transcriptional RNA editing across the entire gene, and transcription rates of the cells, RNA-seq measurements generate large expression variability and collectively create the observed position level read count curves. A single number for measuring gene expression which is widely used for microarray measured gene expression analysis is highly unlikely to sufficiently account for large expression variation across the gene. Simultaneously analyzing epistatic architecture using the RNA-seq and whole genome sequencing (WGS) data poses enormous challenges. We develop a nonlinear functional regression model (FRGM) with functional responses where the position-level read counts within a gene are taken as a function of genomic position, and functional predictors where genotype profiles are viewed as a function of genomic position, for epistasis analysis with RNA-seq data. Instead of testing the interaction of all possible pair-wises SNPs, the FRGM takes a gene as a basic unit for epistasis analysis, which tests for the interaction of all possible pairs of genes and use all the information that can be accessed to collectively test interaction between all possible pairs of SNPs within two genome regions. By large-scale simulations, we demonstrate that the proposed FRGM for epistasis analysis can achieve the correct type 1 error and has higher power to detect the interactions between genes than the existing methods. The proposed methods are applied to the RNA-seq and WGS data from the 1000 Genome Project. The numbers of pairs of significantly interacting genes after Bonferroni correction

  11. Synchronization and sequencing of data acquisition and control electronics at the European X-ray free electron laser

    International Nuclear Information System (INIS)

    Gessler, Patrick

    2015-11-01

    The 3.5 km long European X-Ray Free Electron Laser, currently under construction in northern Germany, will deliver bursts of up to 2700 short X-ray pulses every 100 ms, providing wavelengths between 0.05 and 6 nm, and a repetition rate of 4.5 MHz to several experiment stations. It allows in-depth research in various scientific fields. In order to set-up the beam, position samples and capture the measured variables, information from the accelerator, diagnostic devices and detectors have to be digitized, converted, processed, transferred, concentrated, distributed, reorganized, controlled and saved. All these steps have to be accurately synchronized and sequenced relative to the actual electron bunch or photon pulse in order to guarantee correct data acquisition timings and unique identification of each bunch passing the beamlines. This document provides a complete description of the planning, design, realization and evaluation of the European XFEL Timing System, which implements the synchronization and sequencing of the data acquisition and control electronics for the European X-Ray Free-Electron Laser Facility.

  12. Design of the AGS Booster Beam Position Monitor electronics

    International Nuclear Information System (INIS)

    Ciardullo, D.J.; Smith, G.A.; Beadle, E.R.

    1991-01-01

    The operational requirements of the AGS Booster Beam Position Monitor system necessitate the use of electronics with wide dynamic range and broad instantaneous bandwidth. Bunch synchronization is provided by a remote timing sequencer coupled to the local ring electronics via digital fiber-optic links. The Sequencer and local ring circuitry work together to provide single turn trajectory or average orbit and intensity information, integrated over 1 to 225 bunches. Test capabilities are built in for the purpose of enhancing BPM system accuracy. This paper describes the design of the Booster Beam Position Monitor electronics, and presents performance details of the front end processing, acquisition and timing circuitry

  13. Variability of Emaravirus Species Associated with Sterility Mosaic Disease of Pigeonpea in India Provides Evidence of Segment Reassortment

    Science.gov (United States)

    Patil, Basavaprabhu L.; Dangwal, Meenakshi; Mishra, Ritesh

    2017-01-01

    Sterility mosaic disease (SMD) of pigeonpea is a serious constraint for cultivation of pigeonpea in India and other South Asian countries. SMD of pigeonpea is associated with two distinct emaraviruses, Pigeonpea sterility mosaic virus 1 (PPSMV-1) and Pigeonpea sterility mosaic virus 2 (PPSMV-2), with genomes consisting of five and six negative-sense RNA segments, respectively. The recently published genome sequences of both PPSMV-1 and PPSMV-2 are from a single location, Patancheru from the state of Telangana in India. However, here we present the first report of sequence variability among 23 isolates of PPSMV-1 and PPSMV-2, collected from ten locations representing six states of India. Both PPSMV-1 and PPSMV-2 are shown to be present across India and to exhibit considerable sequence variability. Variability of RNA3 sequences was higher than the RNA4 sequences for both PPSMV-1 and PPSMV-2. Additionally, the sixth RNA segment (RNA6), previously reported to be associated with only PPSMV-2, is also associated with isolates of PPSMV-1. Multiplex reverse transcription PCR (RT-PCR) analyses show that PPSMV-1 and PPSMV-2 frequently occur as mixed infections. Further sequence analyses indicated the presence of reassortment of RNA4 between isolates of PPSMV-1 and PPSMV-2. PMID:28696402

  14. Transmission Bottleneck Size Estimation from Pathogen Deep-Sequencing Data, with an Application to Human Influenza A Virus.

    Science.gov (United States)

    Sobel Leonard, Ashley; Weissman, Daniel B; Greenbaum, Benjamin; Ghedin, Elodie; Koelle, Katia

    2017-07-15

    The bottleneck governing infectious disease transmission describes the size of the pathogen population transferred from the donor to the recipient host. Accurate quantification of the bottleneck size is particularly important for rapidly evolving pathogens such as influenza virus, as narrow bottlenecks reduce the amount of transferred viral genetic diversity and, thus, may decrease the rate of viral adaptation. Previous studies have estimated bottleneck sizes governing viral transmission by using statistical analyses of variants identified in pathogen sequencing data. These analyses, however, did not account for variant calling thresholds and stochastic viral replication dynamics within recipient hosts. Because these factors can skew bottleneck size estimates, we introduce a new method for inferring bottleneck sizes that accounts for these factors. Through the use of a simulated data set, we first show that our method, based on beta-binomial sampling, accurately recovers transmission bottleneck sizes, whereas other methods fail to do so. We then apply our method to a data set of influenza A virus (IAV) infections for which viral deep-sequencing data from transmission pairs are available. We find that the IAV transmission bottleneck size estimates in this study are highly variable across transmission pairs, while the mean bottleneck size of 196 virions is consistent with a previous estimate for this data set. Furthermore, regression analysis shows a positive association between estimated bottleneck size and donor infection severity, as measured by temperature. These results support findings from experimental transmission studies showing that bottleneck sizes across transmission events can be variable and influenced in part by epidemiological factors. IMPORTANCE The transmission bottleneck size describes the size of the pathogen population transferred from the donor to the recipient host and may affect the rate of pathogen adaptation within host populations. Recent

  15. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  16. Correlates of HIV stigma in HIV-positive women.

    Science.gov (United States)

    Wagner, Anne C; Hart, Trevor A; Mohammed, Saira; Ivanova, Elena; Wong, Joanna; Loutfy, Mona R

    2010-06-01

    We examined the variables associated with HIV stigma in HIV-positive women currently living in Ontario, Canada. Based on previous literature, we predicted that variables of social marginalization (e.g., ethnicity, income, education), medical variables (e.g., higher CD4 count, lower viral load), and increased psychological distress would be associated with higher perceived HIV stigma among HIV-positive women. One hundred fifty-nine HIV-positive women between the ages of 18 and 52 in Ontario completed self-report measures of the aforementioned variables. Women were recruited through 28 AIDS service organizations, eight HIV clinics, and two community health centers. In multiple regression analyses, for women born in Canada, lower educational level and higher anxiety were associated with higher HIV stigma. For women born outside of Canada, having been judged by a physician in Canada for trying to become pregnant was associated with higher HIV stigma. For HIV-positive women born outside of Canada, negative judgment by a physician regarding intentions to become pregnant should be addressed to reduce perceived HIV stigma and vice versa. Health care providers should be trained in the provision of sensitive and effective health care for women living with HIV, especially when providing reproductive health care.

  17. Phylogeography, genetic variability and structure of Acanthamoeba metapopulations in Iran inferred by 18S ribosomal RNA sequences: A systematic review and meta-analysis.

    Science.gov (United States)

    Spotin, Adel; Moslemzadeh, Hamid Reza; Mahami-Oskouei, Mahmoud; Ahmadpour, Ehsan; Niyyati, Maryam; Hejazi, Seyed Hossein; Memari, Fatemeh; Noori, Jafar

    2017-09-01

    To verify phylogeography and genetic structure of Acanthamoeba populations among the Iranian clinical isolates and natural/artificial environments distributed in various regions of the country. We searched electronic databases including Medline, PubMed, Science Direct, Scopus and Google Scholar from 2005 to 2016. To explore the genetic variability of Acanthamoeba sp, 205 sequences were retrieved from keratitis patients, immunosuppressed cases and environmental sources as of various geographies of Iran. T4 genotype was the predominant strain in Iran, and the rare genotypes belonged to T2, T3, T5 (Acanthamoeba lenticulata), T6, T9, T11, T13 and T15 (Acanthamoeba jacobsi). A total of 47 unique haplotypes of T4 were identified. A parsimonious network of the sequence haplotypes demonstrated star-like feature containing haplogroups IR6 (34.1%) and IR7 (31.2%) as the most common haplotypes. In accordance with the analysis of molecular variance, the high value of haplotype diversity (0.612-0.848) of Acanthamoeba T4 represented genetic variability within populations. Neutrality indices of the 18S ribosomal RNA demonstrated negative values in all populations which represented a considerable divergence from neutrality. The majority of genetic diversity belonged to the infected contact lens and dust samples in immunodeficiency and ophthalmology wards, which indicated potential routes for exposure to a pathogenic Acanthamoeba sp. in at-risk individuals. A pairwise fixation index (F ST ) was from low to high values (0.02433-0.41892). The statistically F ST points out that T4 is genetically differentiated between north-west, north-south and central-south metapopulations, but not differentiated between west-central, west-south, central-south, and north-central isolates. An occurrence of IR6 and IR7 displays that possibly a gene flow of Acanthamoeba T4 occurred after the founder effect or bottleneck experience through ecological changes or host mobility. This is the first

  18. Identification of rhabdoviral sequences in oropharyngeal swabs from German and Danish bats.

    Science.gov (United States)

    Fischer, Melina; Freuling, Conrad M; Müller, Thomas; Schatz, Juliane; Rasmussen, Thomas Bruun; Chriel, Mariann; Balkema-Buschmann, Anne; Beer, Martin; Hoffmann, Bernd

    2014-11-25

    In the frame of active lyssavirus surveillance in bats, oropharyngeal swabs from German (N = 2297) and Danish (N = 134) insectivorous bats were investigated using a newly developed generic pan-lyssavirus real-time reverse transcriptase PCR (RT-qPCR). In total, 15 RT-qPCR positive swabs were detected. Remarkably, sequencing of positive samples did not confirm the presence of bat associated lyssaviruses but revealed nine distinct novel rhabdovirus-related sequences. Several novel rhabdovirus-related sequences were detected both in German and Danish insectivorous bats. The results also prove that the novel generic pan-lyssavirus RT-qPCR offers a very broad detection range that allows the collection of further valuable data concerning the broad and complex diversity within the family Rhabdoviridae.

  19. On the edge of language acquisition: inherent constraints on encoding multisyllabic sequences in the neonate brain.

    Science.gov (United States)

    Ferry, Alissa L; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques

    2016-05-01

    To understand language, humans must encode information from rapid, sequential streams of syllables - tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences. After familiarization with a six-syllable sequence, the neonate brain responded to the change (as shown by an increase in oxy-hemoglobin) when the two edge syllables switched positions but not when two middle syllables switched positions (Experiment 1), indicating that they encoded the syllables at the edges of sequences better than those in the middle. Moreover, when a 25 ms pause was inserted between the middle syllables as a segmentation cue, neonates' brains were sensitive to the change (Experiment 2), indicating that subtle cues in speech can signal a boundary, with enhanced encoding of the syllables located at the edges of that boundary. These findings suggest that neonates' brains can encode information from multisyllabic sequences and that this encoding is constrained. Moreover, subtle segmentation cues in a sequence of syllables provide a mechanism with which to accurately encode positional information from longer sequences. Tracking the order of syllables is necessary to understand language and our results suggest that the foundations for this encoding are present at birth. © 2015 John Wiley & Sons Ltd.

  20. A Novel Passive Islanding Detection Scheme for Distributed Generations Based on Rate of Change of Positive Sequence Component of Voltage and Current

    DEFF Research Database (Denmark)

    Rostami, Ali; Jalilian, Amin; Naderi, Seyed Behzad

    2017-01-01

    ) based wind turbine and synchronous diesel generator DGs by MATLAB/Simulink software. Different non-islanding case studies are taken into account to evaluate the effectiveness of the proposed approach. The simulation results show that the proposed method has advantage of detecting the islanding rapidly......Islanding operation is one of serious hazards of distributed generation (DG) applications. According to IEEE 1547 standard, its occurrence must be detected within two seconds. This paper presents a novel passive islanding detection method based on rate of change of positive sequence component...... of RCPSC and RCPSV exceed the predetermined threshold values, it is concluded that the islanding condition has occurred. Otherwise, it is considered as a non-islanding event. The performance of the proposed method is investigated on a sample network in the presence of doubly fed induction generator (DFIG...

  1. Learning predictive statistics from temporal sequences: Dynamics and strategies.

    Science.gov (United States)

    Wang, Rui; Shen, Yuan; Tino, Peter; Welchman, Andrew E; Kourtzi, Zoe

    2017-10-01

    Human behavior is guided by our expectations about the future. Often, we make predictions by monitoring how event sequences unfold, even though such sequences may appear incomprehensible. Event structures in the natural environment typically vary in complexity, from simple repetition to complex probabilistic combinations. How do we learn these structures? Here we investigate the dynamics of structure learning by tracking human responses to temporal sequences that change in structure unbeknownst to the participants. Participants were asked to predict the upcoming item following a probabilistic sequence of symbols. Using a Markov process, we created a family of sequences, from simple frequency statistics (e.g., some symbols are more probable than others) to context-based statistics (e.g., symbol probability is contingent on preceding symbols). We demonstrate the dynamics with which individuals adapt to changes in the environment's statistics-that is, they extract the behaviorally relevant structures to make predictions about upcoming events. Further, we show that this structure learning relates to individual decision strategy; faster learning of complex structures relates to selection of the most probable outcome in a given context (maximizing) rather than matching of the exact sequence statistics. Our findings provide evidence for alternate routes to learning of behaviorally relevant statistics that facilitate our ability to predict future events in variable environments.

  2. Impact of Negative Sequence Current Injection by Wind Power Plants

    DEFF Research Database (Denmark)

    Chaudhary, Sanjay; Göksu, Ömer; Teodorescu, Remus

    2013-01-01

    This paper presents an analysis of the impact from negative sequence current injection by wind power plants in power systems under steady-state and short-term unbalanced conditions, including faults. The separate positive and negative sequence current control capability of the grid-side converters...... of full scale converter type wind turbines may be utilized to alter voltage imbalance at the point of connection and further into the grid, in turn changing the resultant negative sequence current flow in the grid. The effects of such control actions have been analyzed and discussed through theoretical...

  3. Variability of Characteristics Physiologic and Anthropometric in Practitioners of Rugby in Function of the Category and Position of Game: Systematic revision of Literature

    Directory of Open Access Journals (Sweden)

    F.M. Campos

    2008-01-01

    Full Text Available Objectives: Analyse the existence variability of anthropometric and physiologic characteristics in Rugby players according their game position and competitive level. Methodology: enhances the existence of significant variability in matter of different evaluation parameters subordinated to two ranges of characteristics anthropometric (weight, height, % of body mass and age and physiologic (muscular power, maximum aerobic power, speed according the practice status (professionals, semi-professional, amateur and the position in game (forwards, backs. Results: they point with respect to clear differences the anthropometric and physiological level profile of the players, particularly when related to the competitive level. The level half-professional verifies a significant effect of the age in the corporal mass, muscular force, speed, agility and maximum aerobic capacity, with the physiological characteristics of the players to verify an increase in function of the increase of the game level. Conclusions: the results gotten in the different studies for amateur players do not demonstrate linearity what if it must in particular the games with low intensity, with frequency and regularity irregular, of short duration or based in training programs little structuralized or inappropriate. Parameters related with the agility, speed, muscular force and VO2máx present a gradual development in function of the increase of the age and the level the one that the game is practiced. On the other hand, in terms of the position assumed for the player in field, the physiological profile of professional players is similar wants if it deals with advanced wants well of defenses if that the anthropometric variations are in this field particularly well-known. In anthropometrics terms, the practitioners of Rugby present high muscular mass, being the players in the position of advanced older and more weighed than the defenses. Parallel he exists a significant effect of the age

  4. Hydrodynamic ejection of bipolar flows from objects undergoing disk accretion: T Tauri stars, massive pre-main-sequence objects, and cataclysmic variables

    International Nuclear Information System (INIS)

    Torbett, M.V.

    1984-01-01

    A general mechanism is presented for generating pressure-driven winds that are intrinsically bipolar from objects undergoing disk accretion. The energy librated in a boundary layer shock as the disk matter impacts the central object is shown to be sufficient to eject a fraction βapprox.10 -2 to 10 -3 of the accreted mass. These winds are driven by a mechanism that accelerates the flow perpendicular to the plane of the disk and can therefore account for the bipolar geometry of the mass loss observed near young stars. The mass loss contained in these winds is comparable to that inferred for young stars. Thus, disk accretion-driven winds may constitute the T Tauri phase of stellar evolution. This mechanism is generally applicable, and thus massive pre-main-sequence objects as well as cataclysmic variables at times of enhanced accretion are predicted to eject bipolar outflows as well. Unmagnetized accreting neutron stas are also expected to eject bipolar flows. Since this mechanism requires stellar surfaces, however, it will not operate in disk accretion onto black holes

  5. Negative Sequence Droop Method based Hierarchical Control for Low Voltage Ride-Through in Grid-Interactive Microgrids

    DEFF Research Database (Denmark)

    Zhao, Xin; Firoozabadi, Mehdi Savaghebi; Quintero, Juan Carlos Vasquez

    2015-01-01

    . In this paper, a voltage support strategy based on negative sequence droop control, which regulate the positive/negative sequence active and reactive power flow by means of sending proper voltage reference to the inner control loop, is proposed for the grid connected MGs to ride through voltage sags under...... complex line impedance conditions. In this case, the MGs should inject a certain amount of positive and negative sequence power to the grid so that the voltage quality at load side can be maintained at a satisfied level. A two layer hierarchical control strategy is proposed in this paper. The primary...... control loop consists of voltage and current inner loops, conventional droop control and virtual impedance loop while the secondary control loop is based on positive/negative sequence droop control which can achieve power injection under voltage sags. Experimental results with asymmetrical voltage sags...

  6. The Lower Main Sequence of Stars in the Solar Neighborhood: Model Predictions Versus Observation

    Directory of Open Access Journals (Sweden)

    Bartašiūtė S.

    2012-09-01

    Full Text Available We have used the Simbad database and VizieR catalogue access tools to construct the observational color-absolute magnitude diagrams of nearby K-M dwarfs with precise Hipparcos parallaxes (σπ/π ≤ 0:05. Particular attention has been paid to removing unresolved double/multiple stars and variables. In addition to archival data, we have made use of nearly 2000 new radial-velocity measurements of K-M dwarfs to identify spectroscopic binary candidates. The main sequences, cleaned from unresolved binaries, variable stars, and old population stars which can also widen the sequence due to their presumably lower metallicity, were compared to available solar-metallicity models. Significant offsets of most of the model main-sequence lines are seen with respect to observational data, especially for the lower-mass stars. Only the location and slope of the Victoria-Regina and, partly, BaSTI isochrones match the data quite well.

  7. Conservation and variability of dengue virus proteins: implications for vaccine design.

    Directory of Open Access Journals (Sweden)

    Asif M Khan

    2008-08-01

    Full Text Available Genetic variation and rapid evolution are hallmarks of RNA viruses, the result of high mutation rates in RNA replication and selection of mutants that enhance viral adaptation, including the escape from host immune responses. Variability is uneven across the genome because mutations resulting in a deleterious effect on viral fitness are restricted. RNA viruses are thus marked by protein sites permissive to multiple mutations and sites critical to viral structure-function that are evolutionarily robust and highly conserved. Identification and characterization of the historical dynamics of the conserved sites have relevance to multiple applications, including potential targets for diagnosis, and prophylactic and therapeutic purposes.We describe a large-scale identification and analysis of evolutionarily highly conserved amino acid sequences of the entire dengue virus (DENV proteome, with a focus on sequences of 9 amino acids or more, and thus immune-relevant as potential T-cell determinants. DENV protein sequence data were collected from the NCBI Entrez protein database in 2005 (9,512 sequences and again in 2007 (12,404 sequences. Forty-four (44 sequences (pan-DENV sequences, mainly those of nonstructural proteins and representing approximately 15% of the DENV polyprotein length, were identical in 80% or more of all recorded DENV sequences. Of these 44 sequences, 34 ( approximately 77% were present in >or=95% of sequences of each DENV type, and 27 ( approximately 61% were conserved in other Flaviviruses. The frequencies of variants of the pan-DENV sequences were low (0 to approximately 5%, as compared to variant frequencies of approximately 60 to approximately 85% in the non pan-DENV sequence regions. We further showed that the majority of the conserved sequences were immunologically relevant: 34 contained numerous predicted human leukocyte antigen (HLA supertype-restricted peptide sequences, and 26 contained T-cell determinants identified by

  8. Prevalence and Characterization of Oxacillin Susceptible mecA-Positive Clinical Isolates of Staphylococcus aureus Causing Bovine Mastitis in India.

    Directory of Open Access Journals (Sweden)

    Hiral Mistry

    Full Text Available Bovine mastitis caused by multidrug resistant Staphylococcus aureus is a huge problem reported worldwide, resulting in prolonged antibiotic treatment and death of livestock. The current study is focused on surveillance of antibiotic susceptibility along with genotypic and phenotypic characterization of the pathogenic S. aureus strains causing mastitis in India. One hundred and sixty seven milk samples were collected from mastitis-affected cows from different farms in India resulting in thirty nine isolated S. aureus strains. Antibiotic sensitivity profiling revealed the majority of the strains (n = 24 to be multidrug resistant and eleven strains showed reduced susceptibility to vancomycin (MICs = 2μg/ml. All strains were oxacillin sensitive, but 19 strains were positive for the mecA gene, which revealed the occurrence of oxacillin susceptible mecA positive strains (OS-MRSA for the first time from India. Additionally, 32 strains were positive for the pvl gene, a virulence determinant; of these 17 were also OS-MRSA strains. Molecular characterization based on multilocus sequence typing (MLST, spa typing, agr typing and SCCmec classification revealed strains belonging to different groups. Moreover, strains showed spa types (t2526, t9602 and MLST sequence types, ST-72, ST-88 and ST-239 which have been earlier reported in human infections. The prevalence of OS-MRSA strains indicates the importance of including both the genetic and phenotypic tests in characterizing S. aureus strains. Increased genotypic variability with strain related to human infections and pvl positive isolates indicates a worrisome situation with the possibility of bilateral transfer.

  9. Prevalence and Characterization of Oxacillin Susceptible mecA-Positive Clinical Isolates of Staphylococcus aureus Causing Bovine Mastitis in India.

    Science.gov (United States)

    Mistry, Hiral; Sharma, Paresh; Mahato, Sudipta; Saravanan, R; Kumar, P Anand; Bhandari, Vasundhra

    2016-01-01

    Bovine mastitis caused by multidrug resistant Staphylococcus aureus is a huge problem reported worldwide, resulting in prolonged antibiotic treatment and death of livestock. The current study is focused on surveillance of antibiotic susceptibility along with genotypic and phenotypic characterization of the pathogenic S. aureus strains causing mastitis in India. One hundred and sixty seven milk samples were collected from mastitis-affected cows from different farms in India resulting in thirty nine isolated S. aureus strains. Antibiotic sensitivity profiling revealed the majority of the strains (n = 24) to be multidrug resistant and eleven strains showed reduced susceptibility to vancomycin (MICs = 2μg/ml). All strains were oxacillin sensitive, but 19 strains were positive for the mecA gene, which revealed the occurrence of oxacillin susceptible mecA positive strains (OS-MRSA) for the first time from India. Additionally, 32 strains were positive for the pvl gene, a virulence determinant; of these 17 were also OS-MRSA strains. Molecular characterization based on multilocus sequence typing (MLST), spa typing, agr typing and SCCmec classification revealed strains belonging to different groups. Moreover, strains showed spa types (t2526, t9602) and MLST sequence types, ST-72, ST-88 and ST-239 which have been earlier reported in human infections. The prevalence of OS-MRSA strains indicates the importance of including both the genetic and phenotypic tests in characterizing S. aureus strains. Increased genotypic variability with strain related to human infections and pvl positive isolates indicates a worrisome situation with the possibility of bilateral transfer.

  10. Genetic variability among Trichuris ovis isolates from different hosts in Guangdong Province, China revealed by sequences of three mitochondrial genes.

    Science.gov (United States)

    Wang, Yan; Liu, Guo-Hua; Li, Jia-Yuan; Xu, Min-Jun; Ye, Yong-Gang; Zhou, Dong-Hui; Song, Hui-Qun; Lin, Rui-Qing; Zhu, Xing-Quan

    2013-02-01

    This study examined sequence variation in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunit 5 (nad5) and cytochrome b (cytb), among Trichuris ovis isolates from different hosts in Guangdong Province, China. A portion of the cox1 (pcox1), nad5 (pnad5) and cytb (pcytb) genes was amplified separately from individual whipworms by PCR, and was subjected to sequencing from both directions. The size of the sequences of pcox1, pnad5 and pcytb was 618, 240 and 464 bp, respectively. Although the intra-specific sequence variations within T. ovis were 0-0.8% for pcox1, 0-0.8% for pnad5 and 0-1.9% for pcytb, the inter-specific sequence differences among members of the genus Trichuris were significantly higher, being 24.3-26.5% for pcox1, 33.7-56.4% for pnad5 and 24.8-26.1% for pcytb, respectively. Phylogenetic analyses using combined sequences of pcox1, pnad5 and pcytb, with three different computational algorithms (maximum likelihood, maximum parsimony and Bayesian inference), indicated that all of the T. ovis isolates grouped together with high statistical support. These findings demonstrated the existence of intra-specific variation in mtDNA sequences among T. ovis isolates from different hosts, and have implications for studying molecular epidemiology and population genetics of T. ovis.

  11. Scheduling Aircraft Landings under Constrained Position Shifting

    Science.gov (United States)

    Balakrishnan, Hamsa; Chandran, Bala

    2006-01-01

    Optimal scheduling of airport runway operations can play an important role in improving the safety and efficiency of the National Airspace System (NAS). Methods that compute the optimal landing sequence and landing times of aircraft must accommodate practical issues that affect the implementation of the schedule. One such practical consideration, known as Constrained Position Shifting (CPS), is the restriction that each aircraft must land within a pre-specified number of positions of its place in the First-Come-First-Served (FCFS) sequence. We consider the problem of scheduling landings of aircraft in a CPS environment in order to maximize runway throughput (minimize the completion time of the landing sequence), subject to operational constraints such as FAA-specified minimum inter-arrival spacing restrictions, precedence relationships among aircraft that arise either from airline preferences or air traffic control procedures that prevent overtaking, and time windows (representing possible control actions) during which each aircraft landing can occur. We present a Dynamic Programming-based approach that scales linearly in the number of aircraft, and describe our computational experience with a prototype implementation on realistic data for Denver International Airport.

  12. Molecular profiling of microbial communities from contaminated sources: Use of subtractive cloning methods and rDNA spacer sequences. 1998 annual progress report

    International Nuclear Information System (INIS)

    Robb, F.T.

    1998-01-01

    'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been identified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'

  13. Hypervariable minisatellite DNA sequences in the Indian peafowl Pavo cristatus.

    Science.gov (United States)

    Hanotte, O; Burke, T; Armour, J A; Jeffreys, A J

    1991-04-01

    We report here for the first time the large-scale isolation of hypervariable minisatellite DNA sequences from a non-human species, the Indian peafowl (Pavo cristatus). A size-selected genomic DNA fraction, rich in hypervariable minisatellites, was cloned into Charomid 9-36. This library was screened using two multilocus hypervariable probes, 33.6 and 33.15 and also, in a "probe-walking" approach, with five of the peafowl minisatellites initially isolated. Forty-eight positively hybridizing clones were characterized and found to originate from 30 different loci, 18 of which were polymorphic. Five of these variable minisatellite loci were studied further. They all showed Mendelian inheritance. The heterozygosities of these loci were relatively low (range 22-78%) in comparison with those of previously cloned human loci, as expected in view of inbreeding in our semicaptive study population. No new length allele mutations were observed in families and the mean mutation rate per locus is low (less than 0.004, 95% confidence maximum). These loci were also investigated by cross-species hybridization in related taxa. The ability of the probes to detect hypervariable sequences in other species within the same avian family was found to vary, from those probes that are species-specific to those that are apparently general to the family. We also illustrate the potential usefulness of these probes for paternity analysis in a study of sexual selection, and discuss the general application of specific hypervariable probes in behavioral and evolutionary studies.

  14. Vocabulary relearning in semantic dementia: Positive and negative consequences of increasing variability in the learning experience.

    Science.gov (United States)

    Hoffman, Paul; Clarke, Natasha; Jones, Roy W; Noonan, Krist A

    2015-09-01

    Anomia therapy typically aims to improve patients' communication ability through targeted practice in naming a set of particular items. For such interventions to be of maximum benefit, the use of trained (or relearned) vocabulary must generalise from the therapy setting into novel situations. We investigated relearning in three patients with semantic dementia, a condition that has been associated with poor generalisation of relearned vocabulary. We tested two manipulations designed to improve generalisation of relearned words by introducing greater variation into the learning experience. In the first study, we found that trained items were retained more successfully when they were presented in a variety of different sequences during learning. In the second study, we found that training items using a range of different pictured exemplars improved the patients' ability to generalise words to novel instances of the same object. However, in one patient this came at the cost of inappropriate over-generalisations, in which trained words were incorrectly used to name semantically or visually similar objects. We propose that more variable learning experiences benefit patients because they shift responsibility for learning away from the inflexible hippocampal learning system and towards the semantic system. The success of this approach therefore depends critically on the integrity of the semantic representations of the items being trained. Patients with naming impairments in the context of relatively mild comprehension deficits are most likely to benefit from this approach, while avoiding the negative consequences of over-generalisation. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

    Science.gov (United States)

    Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

    2013-08-01

    To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Serial position learning in honeybees.

    Directory of Open Access Journals (Sweden)

    Randolf Menzel

    Full Text Available Learning of stimulus sequences is considered as a characteristic feature of episodic memory since it contains not only a particular item but also the experience of preceding and following events. In sensorimotor tasks resembling navigational performance, the serial order of objects is intimately connected with spatial order. Mammals and birds develop episodic(-like memory in serial spatio-temporal tasks, and the honeybee learns spatio-temporal order when navigating between the nest and a food source. Here I examine the structure of the bees' memory for a combined spatio-temporal task. I ask whether discrimination and generalization are based solely on simple forms of stimulus-reward learning or whether they require sequential configurations. Animals were trained to fly either left or right in a continuous T-maze. The correct choice was signaled by the sequence of colors (blue, yellow at four positions in the access arm. If only one of the possible 4 signals is shown (either blue or yellow, the rank order of position salience is 1, 2 and 3 (numbered from T-junction. No learning is found if the signal appears at position 4. If two signals are shown, differences at positions 1 and 2 are learned best, those at position 3 at a low level, and those at position 4 not at all. If three or more signals are shown these results are corroborated. This salience rank order again appeared in transfer tests, but additional configural phenomena emerged. Most of the results can be explained with a simple model based on the assumption that the four positions are equipped with different salience scores and that these add up independently. However, deviations from the model are interpreted by assuming stimulus configuration of sequential patterns. It is concluded that, under the conditions chosen, bees rely most strongly on memories developed during simple forms of associative reward learning, but memories of configural serial patterns contribute, too.

  17. Gelada vocal sequences follow Menzerath’s linguistic law

    Science.gov (United States)

    Gustison, Morgan L.; Semple, Stuart; Ferrer-i-Cancho, Ramon; Bergman, Thore J.

    2016-01-01

    Identifying universal principles underpinning diverse natural systems is a key goal of the life sciences. A powerful approach in addressing this goal has been to test whether patterns consistent with linguistic laws are found in nonhuman animals. Menzerath’s law is a linguistic law that states that, the larger the construct, the smaller the size of its constituents. Here, to our knowledge, we present the first evidence that Menzerath’s law holds in the vocal communication of a nonhuman species. We show that, in vocal sequences of wild male geladas (Theropithecus gelada), construct size (sequence size in number of calls) is negatively correlated with constituent size (duration of calls). Call duration does not vary significantly with position in the sequence, but call sequence composition does change with sequence size and most call types are abbreviated in larger sequences. We also find that intercall intervals follow the same relationship with sequence size as do calls. Finally, we provide formal mathematical support for the idea that Menzerath’s law reflects compression—the principle of minimizing the expected length of a code. Our findings suggest that a common principle underpins human and gelada vocal communication, highlighting the value of exploring the applicability of linguistic laws in vocal systems outside the realm of language. PMID:27091968

  18. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

  19. A Streamlined Artificial Variable Free Version of Simplex Method

    OpenAIRE

    Inayatullah, Syed; Touheed, Nasir; Imtiaz, Muhammad

    2015-01-01

    This paper proposes a streamlined form of simplex method which provides some great benefits over traditional simplex method. For instance, it does not need any kind of artificial variables or artificial constraints; it could start with any feasible or infeasible basis of an LP. This method follows the same pivoting sequence as of simplex phase 1 without showing any explicit description of artificial variables which also makes it space efficient. Later in this paper, a dual version of the new ...

  20. Induction position for spinal anaesthesia: Sitting versus lateral position

    International Nuclear Information System (INIS)

    Shahzad, K.; Afshan, G.

    2013-01-01

    Objective: To compare the effect of induction position on block characteristics (sensory and motor nerves) and haemodynamic stability in elderly patients with isobaric bupivacaine. Patient comfort was also looked at. Methods: The randomized single blinded study was conducted at the Aga Khan University Hospital, Karachi, from September 2007 to August 2008. A total of 70 patients aged >60 years of both genders were included. Spinal anaesthesia was performed either in sitting or lateral position according to random allocation. Assessments of sensory, motor block and heart rate, systolic and diastolic blood pressure were recorded for 20 minutes. SPSS 16 was used for statistical analysis. Results: There was no significant difference for haemodynamic variables heart rate, systolic and diastolic blood pressure. The onset of anaesthesia was faster in the sitting group (4.5 minutes vs 5.4 minutes). The motor block characteristics were similar in both the groups. The majority of patients who reported 'very comfortable' for induction position belonged to the lateral group. Conclusion: Both sitting and lateral positions have similar effects on sensory and motor blockade and haemodynamic stability. However, patients generally found lateral position very comfortable. (author)

  1. Serial postural and motor assessment of Fetal Akinesia Deformation Sequence (FADS)

    NARCIS (Netherlands)

    Donker, M.E.; Eijckelhof, B.H.; Tan, G.M.; de Vries, J.I.

    2009-01-01

    Background: Fetal Akinesia Deformation Sequence (FADS) is a rare, in most cases autosomal recessive, disorder. Its heterogeneous origin results in variable onset and expression of motor and postural anomalies. DNA-diagnostic possibilities are limited, thus prenatal diagnosis is chiefly dependent on

  2. Self-Exciting Point Process Modeling of Conversation Event Sequences

    Science.gov (United States)

    Masuda, Naoki; Takaguchi, Taro; Sato, Nobuo; Yano, Kazuo

    Self-exciting processes of Hawkes type have been used to model various phenomena including earthquakes, neural activities, and views of online videos. Studies of temporal networks have revealed that sequences of social interevent times for individuals are highly bursty. We examine some basic properties of event sequences generated by the Hawkes self-exciting process to show that it generates bursty interevent times for a wide parameter range. Then, we fit the model to the data of conversation sequences recorded in company offices in Japan. In this way, we can estimate relative magnitudes of the self excitement, its temporal decay, and the base event rate independent of the self excitation. These variables highly depend on individuals. We also point out that the Hawkes model has an important limitation that the correlation in the interevent times and the burstiness cannot be independently modulated.

  3. Novel approach for identification of influenza virus host range and zoonotic transmissible sequences by determination of host-related associative positions in viral genome segments.

    Science.gov (United States)

    Kargarfard, Fatemeh; Sami, Ashkan; Mohammadi-Dehcheshmeh, Manijeh; Ebrahimie, Esmaeil

    2016-11-16

    Recent (2013 and 2009) zoonotic transmission of avian or porcine influenza to humans highlights an increase in host range by evading species barriers. Gene reassortment or antigenic shift between viruses from two or more hosts can generate a new life-threatening virus when the new shuffled virus is no longer recognized by antibodies existing within human populations. There is no large scale study to help understand the underlying mechanisms of host transmission. Furthermore, there is no clear understanding of how different segments of the influenza genome contribute in the final determination of host range. To obtain insight into the rules underpinning host range determination, various supervised machine learning algorithms were employed to mine reassortment changes in different viral segments in a range of hosts. Our multi-host dataset contained whole segments of 674 influenza strains organized into three host categories: avian, human, and swine. Some of the sequences were assigned to multiple hosts. In point of fact, the datasets are a form of multi-labeled dataset and we utilized a multi-label learning method to identify discriminative sequence sites. Then algorithms such as CBA, Ripper, and decision tree were applied to extract informative and descriptive association rules for each viral protein segment. We found informative rules in all segments that are common within the same host class but varied between different hosts. For example, for infection of an avian host, HA14V and NS1230S were the most important discriminative and combinatorial positions. Host range identification is facilitated by high support combined rules in this study. Our major goal was to detect discriminative genomic positions that were able to identify multi host viruses, because such viruses are likely to cause pandemic or disastrous epidemics.

  4. Statistical inference of the generation probability of T-cell receptors from sequence repertoires.

    Science.gov (United States)

    Murugan, Anand; Mora, Thierry; Walczak, Aleksandra M; Callan, Curtis G

    2012-10-02

    Stochastic rearrangement of germline V-, D-, and J-genes to create variable coding sequence for certain cell surface receptors is at the origin of immune system diversity. This process, known as "VDJ recombination", is implemented via a series of stochastic molecular events involving gene choices and random nucleotide insertions between, and deletions from, genes. We use large sequence repertoires of the variable CDR3 region of human CD4+ T-cell receptor beta chains to infer the statistical properties of these basic biochemical events. Because any given CDR3 sequence can be produced in multiple ways, the probability distribution of hidden recombination events cannot be inferred directly from the observed sequences; we therefore develop a maximum likelihood inference method to achieve this end. To separate the properties of the molecular rearrangement mechanism from the effects of selection, we focus on nonproductive CDR3 sequences in T-cell DNA. We infer the joint distribution of the various generative events that occur when a new T-cell receptor gene is created. We find a rich picture of correlation (and absence thereof), providing insight into the molecular mechanisms involved. The generative event statistics are consistent between individuals, suggesting a universal biochemical process. Our probabilistic model predicts the generation probability of any specific CDR3 sequence by the primitive recombination process, allowing us to quantify the potential diversity of the T-cell repertoire and to understand why some sequences are shared between individuals. We argue that the use of formal statistical inference methods, of the kind presented in this paper, will be essential for quantitative understanding of the generation and evolution of diversity in the adaptive immune system.

  5. Finding a (pine) needle in a haystack: chloroplast genome sequence divergence in rare and widespread pines

    Science.gov (United States)

    J.B. Whittall; J. Syring; M. Parks; J. Buenrostro; C. Dick; A. Liston; R. Cronn

    2010-01-01

    Critical to conservation efforts and other investigations at low taxonomic levels, DNA sequence data offer important insights into the distinctiveness, biogeographic partitioning, and evolutionary histories of species. The resolving power of DNA sequences is often limited by insufficient variability at the intraspecific level. This is particularly true of studies...

  6. Subjective Positive and Negative Sleep Variables Differentially Affect Cellular Immune Activity in a Breast Cancer Survivor: A Time-series Analysis Approach

    Directory of Open Access Journals (Sweden)

    Magdalena Singer

    2018-01-01

    Full Text Available This study on a breast cancer survivor suffering from cancer-related fatigue (CaRF and depression investigated the bidirectional relationship between cellular immune activity and subjective sleep. The 49-year-old patient (breast cancer diagnosis 5 years before the study, currently in remission collected her full urine output for 28 days in 12-h intervals (8:00 p.m. to 8:00 a.m. and 8:00 a.m. to 8:00 p.m.. These urine samples were used to determine urinary neopterin (cellular immune activation marker and creatinine concentrations via high-pressure liquid chromatography (HPLC. Each morning, the patient answered questions on five sleep variables: sleep quality (SQ, sleep recreational value (SRV, total sleep time (TST, total wake time (TWT, and awakenings during sleep period (ADS. For the purpose of this study, the time series of the nighttime urinary neopterin levels and the five sleep variables were determined. Using centered moving average (CMA smoothing and cross-correlational analysis, this study showed that increases in the positive sleep variables SQ and SRV were followed by urinary neopterin concentration decreases after 96–120 h (SQ, lag 4: r = −0.411; p = 0.044; SRV: lag 4: r = −0.472; p = 0.021 and 120–144 h (SRV, lag 5: r = −0.464; p = 0.026. Increases in the negative sleep variable TWT, by contrast, were followed by increases in urinary neopterin concentrations 72–96 h later (lag 3: r = 0.522; p = 0.009. No systematic effects in the other direction, i.e., from urinary neopterin levels to sleep, were observed in this study. Although preliminary, the findings of this study highlight the benefit of carefully investigating temporal delays and directions of effects when studying the dynamic relationship between sleep and immune variables in the natural context of everyday life.

  7. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  8. Identification of Y-Chromosome Sequences in Turner Syndrome.

    Science.gov (United States)

    Silva-Grecco, Roseane Lopes da; Trovó-Marqui, Alessandra Bernadete; Sousa, Tiago Alves de; Croce, Lilian Da; Balarin, Marly Aparecida Spadotto

    2016-05-01

    To investigate the presence of Y-chromosome sequences and determine their frequency in patients with Turner syndrome. The study included 23 patients with Turner syndrome from Brazil, who gave written informed consent for participating in the study. Cytogenetic analyses were performed in peripheral blood lymphocytes, with 100 metaphases per patient. Genomic DNA was also extracted from peripheral blood lymphocytes, and gene sequences DYZ1, DYZ3, ZFY and SRY were amplified by Polymerase Chain Reaction. The cytogenetic analysis showed a 45,X karyotype in 9 patients (39.2 %) and a mosaic pattern in 14 (60.8 %). In 8.7 % (2 out of 23) of the patients, Y-chromosome sequences were found. This prevalence is very similar to those reported previously. The initial karyotype analysis of these patients did not reveal Y-chromosome material, but they were found positive for Y-specific sequences in the lymphocyte DNA analysis. The PCR technique showed that 2 (8.7 %) of the patients with Turner syndrome had Y-chromosome sequences, both presenting marker chromosomes on cytogenetic analysis.

  9. ERP Indices of Stimulus Prediction in Letter Sequences

    Directory of Open Access Journals (Sweden)

    Edith Kaan

    2014-10-01

    Full Text Available Given the current focus on anticipation in perception, action and cognition, including language processing, there is a need for a method to tap into predictive processing in situations in which cue and feedback stimuli are not explicitly marked as such. To this aim, event related potentials (ERPs were obtained while participants viewed alphabetic letter sequences (“A”, “B”, “C”, “D”, “E”, …, in which the letters were highly predictable, and random sequences (“S”, “B”, “A”, “I”, “F”, “M”, …, without feedback. Occasionally, the presentation of a letter in a sequence was delayed by 300 ms. During this delay period, an increased negativity was observed for predictive versus random sequences. In addition, the early positivity following the delay was larger for predictive compared with random sequences. These results suggest that expectation-sensitive ERP modulations can be elicited in anticipation of stimuli that are not explicit targets, rewards, feedback or instructions, and that a delay can strengthen the prediction for a particular stimulus. Applications to language processing will be discussed.

  10. Study of the kinematic variables of unilateral and habitual mastication of healthy individuals.

    Science.gov (United States)

    Pasinato, Fernanda; Oliveira, Andréia Gussi de; Santos-Couto-Paz, Clarissa C; Zeredo, Jorge Luis Lopes; Bolzan, Geovana de Paula; Macedo, Sergio Bruzadelli; Corrêa, Eliane C R

    2017-03-30

    To describe and compare the temporal-spatial kinematic variables of mandibular movement during deliberate unilateral and habitual mastication in healthy young-adult individuals. The study sample was composed of eight male healthy volunteers aged 19 to 24 years. The kinematic data were obtained using a motion analysis system - Qualisys Track Manager (QTM) ProReflex MCU. Recordings were performed during deliberate unilateral mastication (UM) and habitual mastication (HM) of firm-consistency gummy candy. The following variables were analyzed: (1) masticatory sequence: duration, number of masticatory cycles, and chewing rate; (2) masticatory cycle: duration, vertical and medial-lateral mandibular range of motion in relation to the skull, and maximum velocity during the opening and closing phases. Data of the variables were compared during UM and HM by the paired t test, and the effect sizes ('d' Cohen) were calculated. Regarding the variables of the masticatory sequence, smaller chewing rate was observed for UM compared with that for HM (1.19±0.21Hz and 1.29±0.16Hz, respectively, p=0.004, d=0.53). Smaller values of maximum velocity during the opening (MU=67.4 mm/s and MH=80.02, p=0.053, d=0.80) and closing (MU=71.77±9.35mm/s and MH=3.51±7mm/s, p=0.014, d=0.79) phases of the masticatory cycle were observed in deliberate unilateral mastication compared with those in habitual mastication. Kinematic variables associated with the sequence and cycle of mastication are influenced by the chewing pattern adopted - deliberate unilateral or habitual.

  11. SU-F-T-350: Continuous Leaf Optimization (CLO) for IMRT Leaf Sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Long, T; Chen, M; Jiang, S; Lu, W [UT Southwestern Medical Center, Dallas, TX (United States)

    2016-06-15

    Purpose: To study a new step-and-shoot IMRT leaf sequencing model that avoids the two main pitfalls of conventional leaf sequencing: (1) target fluence being stratified into a fixed number of discrete levels and/or (2) aperture leaf positions being restricted to a discrete set of locations. These assumptions induce error into the sequence or reduce the feasible region of potential plans, respectively. Methods: We develop a one-dimensional (single leaf pair) methodology that does not make assumptions (1) or (2) that can be easily extended to a multi-row model. The proposed continuous leaf optimization (CLO) methodology takes in an existing set of apertures and associated intensities, or solution “seed,” and improves the plan without the restrictiveness of 1or (2). It then uses a first-order descent algorithm to converge onto a locally optimal solution. A seed solution can come from models that assume (1) and (2), thus allowing the CLO model to improve upon existing leaf sequencing methodologies. Results: The CLO model was applied to 208 generated target fluence maps in one dimension. In all cases for all tested sequencing strategies, the CLO model made improvements on the starting seed objective function. The CLO model also was able to keep MUs low. Conclusion: The CLO model can improve upon existing leaf sequencing methods by avoiding the restrictions of (1) and (2). By allowing for more flexible leaf positioning, error can be reduced when matching some target fluence. This study lays the foundation for future models and solution methodologies that can incorporate continuous leaf positions explicitly into the IMRT treatment planning model. Supported by Cancer Prevention & Research Institute of Texas (CPRIT) - ID RP150485.

  12. ASSOCIATION BETWEEN EMOTIONAL VARIABLES AND SCHOOL ACHIEVEMENT

    Directory of Open Access Journals (Sweden)

    Christoph Randler

    2009-07-01

    Full Text Available Recent psychological studies highlight emotional aspects, and they show an important role within individual learning processes. Hereby, positive emotions were supposed to positively influence learning and achievement processes and negative ones do the contrary. In this study, an educational unit “ecosystem lake” was used during which achievement (three tests and emotional variables (interest, well-being, anxiety and boredom; measured at the end of three pre-selected lessons were monitored. The research question was to explore correlations between emotional variables and the learning outcome of the teaching unit. Prior knowledge was regressed against the subsequent tests to account for its confounding effect. Regressions showed a highly significant influence of prior knowledge on the subsequent measurements of achievement. However, after accounting for prior knowledge, a positive correlation between interest/well-being and achievement and a negative correlation between anxiety/boredom and achievement was found. Further research and interventions should try to enhance positive emotions in biology lessons to positively influence achievement.

  13. Masking as an effective quality control method for next-generation sequencing data analysis.

    Science.gov (United States)

    Yun, Sajung; Yun, Sijung

    2014-12-13

    Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

  14. Benign and Deleterious Cystic Fibrosis Transmembrane Conductance Regulator Mutations Identified by Sequencing in Positive Cystic Fibrosis Newborn Screen Children from California.

    Directory of Open Access Journals (Sweden)

    Danieli B Salinas

    Full Text Available Of the 2007 Cystic Fibrosis Transmembrane Conductance Regulator (CFTR mutations, 202 have been assigned disease liability. California's racially diverse population, along with CFTR sequencing as part of newborn screening model, provides the opportunity to examine the phenotypes of children with uncategorized mutations to help inform disease liability and penetrance.We conducted a retrospective cohort study based on children screened from 2007 to 2011 and followed for two to six years. Newborns that screened positive were divided into three genotype groups: those with two CF-causing mutations (CF-C; those with one mutation of varying clinic consequence (VCC; and those with one mutation of unknown disease liability (Unknown. Sweat chloride tests, pancreatic sufficiency status, and Pseudomonas aeruginosa colonization were compared.Children with two CF-causing mutations had a classical CF phenotype, while 5% of VCC (4/78 and 11% of Unknown (27/244 met diagnostic criteria of CF. Children carrying Unknown mutations 2215insG with D836Y, and T1036N had early and classical CF phenotype, while others carrying 1525-42G>A, L320V, L967S, R170H, and 296+28A>G had a benign clinical presentation, suggesting that these are non-CF causing.While most infants with VCC and Unknown CFTR mutations do not meet diagnostic criteria for CF, a small proportion do. These findings highlight the range of genotypes and phenotypes in the first few years of life following CF newborn screening when CFTR sequencing is performed.

  15. [Sequence polymorphism of mtDNA HVR Iand HVR II of Oroqen ethnic group in Inner Mongolia].

    Science.gov (United States)

    Yan, Chun-Xia; Chen, Feng; Dang, Yong-Hui; Li, Tao; Zheng, Hai-Bo; Chen, Teng; Li, Sheng-Bin

    2008-04-01

    Venous blood samples from 50 unrelated Oroqen individuals living in Inner Mongolia were collected and their mtDNA HVR I and HVR II sequences were detected by using ABI PRISM377 sequencers. The number of polymorphic loci, haplotype, haplotype frequence, average nucleotide variability and other polymorphic parameters were calculated. Based on Oroqen mtDNA sequence data obtained in our experiments and published data, genetic distance between Oroqen ethnic group and other populations were computered by Nei's measure. Phylogenetic tree was constructed by Neighbor Joining method. Comparing with Anderson sequence, 52 polymorphic loci in HVR I and 24 loci in HVR II were found in Oroqen mtDNA sequence, 38 and 27 haplotypes were defined herewith. Haplotype diversity and average nucleotide variability were 0.964+/-0.018 and 7.379 in HVR I, 0.929+/-0.019 and 2.408 in HVR II respectively. Fst and dA genetic distance between 12 populations were calculated based on HVR I sequence, and their relative coefficients were 0.993(P HVR I and HVR II in Oroqen ethnic group has some specificities compared with that of other populations. These data provide a useful tool in forensic identification, population genetic study and other research fields.

  16. Successful treatment of multifocal pedal infection in a feline immunodeficiency virus-positive cat with multiple Bowenoid in situ carcinomas containing papillomaviral DNA sequences

    Directory of Open Access Journals (Sweden)

    Allan E Kessell

    2017-01-01

    Full Text Available Case summary A 16-year-old, castrated male, feline immunodeficiency virus (FIV-positive, domestic shorthair cat developed multiple skin lesions. Most of these were Bowenoid carcinoma in situ and contained DNA sequences consistent with Felis catus papillomavirus type 2. Two additional lesions that developed in the skin and subcutaneous tissues between the digital and carpal pads on the left forelimb and right hindlimb were shown by cytology, histology and culture to be caused by Prototheca wickerhamii . These lesions failed to improve in response to systemic therapy treatment with itraconazole, but excision by sharp en bloc resection with follow-up oral itraconazole therapy proved curative for one lesion, although the other lesion recurred, necessitating a second surgery. Relevance and novel information This is only the second reported case of feline protothecosis from Australia and the first case that has been cultured and identified to the species level. Also of great interest was the presence of multiple papillomavirus-associated neoplastic lesions, which may have afforded a portal of entry for the algal pathogen and the cat’s positive FIV status; the latter might have impacted on both viral and algal pathogenesis by effects on immunocompetence.

  17. Prediction of glutathionylation sites in proteins using minimal sequence information and their experimental validation.

    Science.gov (United States)

    Pal, Debojyoti; Sharma, Deepak; Kumar, Mukesh; Sandur, Santosh K

    2016-09-01

    S-glutathionylation of proteins plays an important role in various biological processes and is known to be protective modification during oxidative stress. Since, experimental detection of S-glutathionylation is labor intensive and time consuming, bioinformatics based approach is a viable alternative. Available methods require relatively longer sequence information, which may prevent prediction if sequence information is incomplete. Here, we present a model to predict glutathionylation sites from pentapeptide sequences. It is based upon differential association of amino acids with glutathionylated and non-glutathionylated cysteines from a database of experimentally verified sequences. This data was used to calculate position dependent F-scores, which measure how a particular amino acid at a particular position may affect the likelihood of glutathionylation event. Glutathionylation-score (G-score), indicating propensity of a sequence to undergo glutathionylation, was calculated using position-dependent F-scores for each amino-acid. Cut-off values were used for prediction. Our model returned an accuracy of 58% with Matthew's correlation-coefficient (MCC) value of 0.165. On an independent dataset, our model outperformed the currently available model, in spite of needing much less sequence information. Pentapeptide motifs having high abundance among glutathionylated proteins were identified. A list of potential glutathionylation hotspot sequences were obtained by assigning G-scores and subsequent Protein-BLAST analysis revealed a total of 254 putative glutathionable proteins, a number of which were already known to be glutathionylated. Our model predicted glutathionylation sites in 93.93% of experimentally verified glutathionylated proteins. Outcome of this study may assist in discovering novel glutathionylation sites and finding candidate proteins for glutathionylation.

  18. Analyzing State Sequences with Probabilistic Suffix Trees: The PST R Package

    Directory of Open Access Journals (Sweden)

    Alexis Gabadinho

    2016-08-01

    Full Text Available This article presents the PST R package for categorical sequence analysis with probabilistic suffix trees (PSTs, i.e., structures that store variable-length Markov chains (VLMCs. VLMCs allow to model high-order dependencies in categorical sequences with parsimonious models based on simple estimation procedures. The package is specifically adapted to the field of social sciences, as it allows for VLMC models to be learned from sets of individual sequences possibly containing missing values; in addition, the package is extended to account for case weights. This article describes how a VLMC model is learned from one or more categorical sequences and stored in a PST. The PST can then be used for sequence prediction, i.e., to assign a probability to whole observed or artificial sequences. This feature supports data mining applications such as the extraction of typical patterns and outliers. This article also introduces original visualization tools for both the model and the outcomes of sequence prediction. Other features such as functions for pattern mining and artificial sequence generation are described as well. The PST package also allows for the computation of probabilistic divergence between two models and the fitting of segmented VLMCs, where sub-models fitted to distinct strata of the learning sample are stored in a single PST.

  19. Exactly solvable position dependent mass schroedinger equation

    International Nuclear Information System (INIS)

    Koc, R.; Tuetuencueler, H.; Koercuek, E.

    2002-01-01

    Exact solution of the Schrodinger equation with a variable mass is presented. We have derived general expressions for the eigenstates and eigenvalues of the position dependent mass systems. We provide supersymmetric and Lie algebraic methods to discuss the position dependent mass systems

  20. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis

    NARCIS (Netherlands)

    Kunst, F; Ogasawara, N; Moszer, [No Value; Albertini, AM; Alloni, G; Azevedo, [No Value; Bertero, MG; Bessieres, P; Bolotin, A; Borchert, S; Borriss, R; Boursier, L; Brans, A; Brignell, SC; Bron, S; Brouillet, S; Bruschi, CV; Caldwell, B; Capuano, [No Value; Carter, NM; Choi, SK; Codani, JJ; Connerton, IF; Cummings, NJ; Daniel, RA; Denizot, F; Devine, KM; Dusterhoft, A; Ehrlich, SD; Emmerson, PT; Entian, KD; Errington, J; Fabret, C; Ferrari, E; Foulger, D; Fujita, M; Fujita, Y; Fuma, S; Galizzi, A; Galleron, N; Ghim, SY; Glaser, P; Goffeau, A; Golightly, EJ; Grandi, G; Guiseppi, G; Guy, BJ; Haga, K; Haiech, J; Harwood, CR; Henaut, A; Hilbert, H; Holsappel, S; Hosono, S; Hullo, MF; Itaya, M; Jones, L; Joris, B; Karamata, D; Kasahara, Y; KlaerrBlanchard, M; Klein, C; Kobayashi, Y; Koetter, P; Koningstein, G; Krogh, S; Kumano, M; Kurita, K; Lapidus, A; Lardinois, S; Lauber, J; Lazarevic, [No Value; Lee, SM; Levine, A; Liu, H; Masuda, S; Mauel, C; Medigue, C; Medina, N; Mellado, RP; Mizuno, M; Moestl, D; Nakai, S; Noback, M; Noone, D; OReilly, M; Ogawa, K; Ogiwara, A; Oudega, B; Park, SH; Parro, [No Value; Pohl, TM; Portetelle, D; Porwollik, S; Prescott, AM; Presecan, E; Pujic, P; Purnelle, B; Rapoport, G; Rey, M; Reynolds, S; Rieger, M; Rivolta, C; Rocha, E; Roche, B; Rose, M; Sadaie, Y; Sato, T; Scanlan, E; Schleich, S; Schroeter, R; Scoffone, F; Sekiguchi, J; Sekowska, A; Seror, SJ; Serror, P; Shin, BS; Soldo, B; Sorokin, A; Tacconi, E; Takagi, T; Takahashi, H; Takemaru, K; Takeuchi, M; Tamakoshi, A; Tanaka, T; Terpstra, P; Tognoni, A; Tosato, [No Value; Uchiyama, S; Vandenbol, M; Vannier, F; Vassarotti, A; Viari, A; Wambutt, R; Wedler, E; Wedler, H; Weitzenegger, T; Winters, P; Wipat, A; Yamamoto, H; Yamane, K; Yasumoto, K; Yata, K; Yoshida, K; Yoshikawa, HF; Zumstein, E; Yoshikawa, H; Danchin, A

    1997-01-01

    Bacillus subtilis is the best-characterized member of the Gram-positive bacteria. Its genome of 4,214,810 base pairs comprises 4,100 protein-coding genes. Of these protein-coding genes, 53% are represented once, while a quarter of the genome corresponds to several gene families that have been