WorldWideScience

Sample records for positive pcr results

  1. False-positive results after environmental pinworm PCR testing due to Rhabditid nematodes in Corncob bedding.

    Science.gov (United States)

    Leblanc, Mathias; Berry, Kristina; Graciano, Sandy; Becker, Brandon; Reuter, Jon D

    2014-11-01

    Modern rodent colonies are housed in individually ventilated cages to protect the animals from contamination with adventitious pathogens. Standard health monitoring through soiled-bedding sentinels does not always detect infections, especially in the context of low pathogen prevalence. Recently proposed alternatives include analyzing environmental samples from the cages or rack exhaust by PCR to improve the detection of rodent pathogens but optimal sampling strategies have not yet been established for different microorganisms. Although generally very sensitive and specific, these molecular assays are not foolproof and subject to false-positive and -negative results and should always be interpreted cautiously with an overall understanding of the intrinsic controls and all the variables that may affect the results. Here, we report a limited Aspiculuris tetraptera outbreak in a mouse barrier facility that was detected by fecal PCR in sentinels and confirmed by fecal flotation and direct cecal examination of both sentinels and colony animals. The outbreak led to a widespread survey of all facilities for pinworms by using environmental PCR from ventilated rack exhaust plenums. Environmental PCR suggested an unexpected widespread contamination of all ventilated racks holding nonautoclaved cages, but results could not be confirmed in sentinel or colony animals by fecal flotation, cecal and colonic examination, or cage PCR testing. After additional investigation, the unexpected environmental PCR results were confirmed as false-positive findings due to the nonspecificity of the assay, leading to the amplification of rhabditid nematodes, which are not infectious in rodents but which contaminated the corncob bedding.

  2. Positive Streptobacillus moniliformis PCR in guinea pigs likely due to Leptotrichia spp.

    Science.gov (United States)

    Boot, Ron; Van de Berg, Lia; Reubsaet, Frans A G; Vlemminx, Maurice J

    2008-04-30

    Streptobacillus moniliformis is a zoonotic bacterium. We obtained positive S. moniliformis PCR results in oral swab samples from guinea pigs from an experimental colony and the breeding colony of origin. Comparison of the DNA sequence of an amplicon with deposited 16S rDNA sequences revealed that Leptotrichia sp. can be the source of a false positive S. moniliformis PCR outcome.

  3. Retrospective Review of Treponema pallidum PCR and Serology Results: Are Both Tests Necessary?

    Science.gov (United States)

    Brischetto, Anna; Gassiep, Ian; Whiley, David; Norton, Robert

    2018-05-01

    There has been a resurgence of syphilis diagnoses in Australia. We investigated whether our Treponema pallidum PCR test provides any additional diagnostic information over syphilis serology (chemiluminescence immunoassay [CMIA], Treponema pallidum particle agglutination [TPPA] assay, and the rapid plasma reagin [RPR] flocculation test). A retrospective audit of all T. pallidum PCR requests that came through our laboratory from January 2010 to June 2017 was conducted; data collected included age, gender, site of swab, and results from T. pallidum PCR, syphilis serology, and herpes simplex virus 1 (HSV-1) and HSV-2 PCRs. A total of 441 T. pallidum PCR tests were performed; on average, 3 T. pallidum PCRs per month were requested in 2011, and this rate increased to 17.2 requests per month in 2017. A total of 323 patients had both T. pallidum PCR and syphilis serology performed, with 67% of swabs taken from the genitals. T. pallidum PCR gave positive results for 61/323 (19%) patients; of these 61 patients, 59 (97%) also had positive syphilis serology results ( T. pallidum PCR sensitivity, 68%; specificity, 99%; positive predictive value, 97%; negative predictive value, 89%). Syphilis serology was positive for 91/323 patients (28%); of these 91 patients, 61 (66%) were also T. pallidum PCR positive (syphilis serology sensitivity, 97%; specificity, 88%; positive predictive value, 60%; negative predictive value, 99%). The Cohen's kappa value was 0.74, indicating substantial agreement between the two tests. Our results show that most patients with positive T. pallidum PCR results also had positive syphilis serology. Therefore, T. pallidum PCR adds little clinical value over serology for the diagnosis of syphilis in certain clinical settings. Copyright © 2018 American Society for Microbiology.

  4. Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR

    Directory of Open Access Journals (Sweden)

    Cattoir Vincent

    2010-08-01

    Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (

  5. PCR

    African Journals Online (AJOL)

    Elham

    2013-07-03

    Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.

  6. Result Variation and Efficiency Kinetics in Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Reza Shahsiah

    2010-10-01

    Full Text Available Fluorescent monitoring of DNA amplification is the basis of real-time PCR. Absolute quantification can be achieved using a standard curve method. The standard curve is constructed by amplifying known amounts of standards under identical conditions to that of the samples.The objective of the current study is to propose a mathematical model to assess the acceptability of PCR resulys.Four commercial standards for HCV-RNA (hepatitis C virus RNA along with 6 patient samples were measured by real-time PCR, using two different RT-PCR reagents. The standard deviation of regression (Sy,x was calculated for each group of standard and compared by F-Test. The efficiency kinetics was computed by logistic regression, c2 goodness of fit test was preformed to assess the appropriateness of the efficiency curves.Calculated efficiencies were not significantly different from the value predicted by logistic regression model. Reactions with more variation showed less stable efficiency curves, with wider range of amplification efficiencies.Amplification efficiency kinetics can be computed by fitting a logistic regression curve to the gathered fluorescent data of each reaction. This model can be employed to assess the acceptability of PCR results calculated by standard curve method.

  7. Application of a PCR method for the diagnosis of ulcerative enteritis: preliminary results

    Directory of Open Access Journals (Sweden)

    Fabrizio Agnoletti

    2010-01-01

    Full Text Available Ulcerative enteritis or “quail disease” is an acute clostridial infection of young birds reported in many avian species, chicken and turkey included. Clostridium colinum is the causative agent of ulcerative enteritis and because of the difficulties bound to the isolation and identification of this bacterium by means of classic bacteriological techniques, its detection appears very hard and the prevalence of this disease could be underestimated. To investigate the diffusion of C. colinum in enteric disease of birds, a recently developed PCR protocol was applied to 42 cultural broths previously inoculated with organs and intestinal samples collected from diseased subjects. PCR-positive broths were cultivated to attempt the isolation of C. colinum. Samples collected from positive birds were subjected to histological examinations. 4 birds (3 broilers chickens and 1 pigeon resulted PCR-positive and, in one case, C. colinum was isolated. Gross and histological lesions of positive birds were compatible with those described in other ulcerative enteritis outbreaks. These preliminary results demonstrates that C. colinum is sporadically implicated in enteric diseases of broiler chickens (14.2%. In addition, the PCR assay proved to be an useful and reliable instrument to support the diagnosis of ulcerative enteritis and to facilitate the isolation of C. colinum.

  8. [Tropheryma whipplei and Whipple disease: false positive PCR detections of Tropheryma whipplei in diagnostic samples are rare].

    Science.gov (United States)

    Le Scanff, J; Gaultier, J B; Durand, D Vital; Durieu, I; Celard, M; Benito, Y; Vandenesch, F; Rousset, H

    2008-11-01

    PCR can be used to detect T. whipplei (Tw) in samples from variable tissue types and body fluids. We report clinical, evolutive characteristics and final diagnosis in patients with positive Tw PCR assay. Retrospective study of Tw PCR realized since 10years in a microbiology laboratory. Twenty-five Tw PCR assays were positive among 200 realized. Diagnosis was not confirmed in six cases. One patient was missing for follow up. Eighteen patients presented with Whipple's disease. Among these 18 patients, 14 had a classic Whipple's disease, three patients presented an endocarditis and one patient isolated neurological manifestations. Ten patients presented fever, seven a weight loss and 12 joint involvement. Four patients presented cutaneous manifestations, only six had gastrointestinal symptoms. Neurological involvement was reported in five cases, pulmonary symptoms in four cases, cardiac involvement in six cases and ocular signs in two cases. Anemia was reported in four patients and elevated levels of acute-phase reactants in 14 cases. Positive predictive value of Tw PCR for Whipple's disease diagnosis was 75%. Thirteen patients had a good evolution with antibiotics. Three patients presented recurrence and two cases with cardiovascular involvement died. Whipple's disease is rare but often mentioned in internist experience. The diagnosis should be every time confirmed. Tw PCR assay is an important diagnostic tool but is not sufficient to establish the diagnosis and must be interpreted with histopathology and immunohistochemical testing results.

  9. Urine-Based Nested PCR for the Diagnosis of Mycobacterium tuberculosis: A Comparative Study Between HIV-Positive and HIV-Negative Patients.

    Science.gov (United States)

    Jamshidi Makiani, Mahin; Davoodian, Parivash; Baghershiroodi, Mahnaz; Nejatizadeh, Abdol Azim; Fakkhar, Farideh; Zangeneh, Mehrangiz; Jahangiri, Nadia

    2016-08-01

    While tuberculosis (TB) can be diagnosed by microscopy and culture, the sensitivity of Ziehl-Neelsen staining is variable and culture results require 4 - 8 weeks to be determined. Polymerase chain reaction (PCR) and its modifications, including nested PCR, might be promising methods for the rapid diagnosis of TB. This study aimed to evaluate the performance of nested PCR on urine samples of human immunodeficiency virus (HIV)-positive and -negative patients with different manifestations of clinical TB. In a prospective study, three early-morning urine samples from 100 patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were evaluated using a molecular target with insertion element IS6110, specific to the Mycobacterium tuberculosis genome, and nested PCR was performed. The results were analyzed with SPSS version 22. A total of 100 patients, including 74 (74%) with PTB and 26 (26%) with EPTB, were enrolled. Positive smears were seen in 38 patients (38%). Lymph nodes were the most commonly involved organ in 14 of the 26 (53.8%) EPTB patients (13.5%). Seven (23.1%) of the EPTB patients were HIV-positive. Urine PCR was positive in only 28 patients (28%). Seven HIV-positive patients with PTB showed positive urine PCR results. Moreover, PCR results were positive in only one of the seven HIV-positive subjects with EPTB. Positive PCR results were found in 20 of the 73 HIV-negative patients (27.4%) and in 8 of the 27 HIV-positive patients (29.6%). Therefore, there was no significant difference between the HIV-negative and HIV-positive patients for urine PCR (sensitivity 29.6%, specificity 72.6%; positive and negative predictive values 28% and 72%, respectively; P = 0.138). Nested PCR showed the same sensitivity in HIV-positive and HIV-negative patients. It can be applied as a rapid technique for the diagnosis of TB.

  10. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178

  11. A Nested PCR Assay to Avoid False Positive Detection of the Microsporidian Enterocytozoon hepatopenaei (EHP) in Environmental Samples in Shrimp Farms.

    Science.gov (United States)

    Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma

    2016-01-01

    Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.

  12. Evaluation of clinical pathology parameters in fecal PCR-positive or PCR-negative goats for Johne's disease.

    Science.gov (United States)

    Bonelli, Francesca; Fratini, F; Turchi, B; Cantile, C; Ebani, V V; Colombani, G; Galiero, A; Sgorbini, M

    2017-10-01

    Johne's disease (JD) is an economically important infectious disease of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP). This study evaluated the differences in various hematological and biochemical parameters between healthy goats and goats with JD. Forty goats were chosen randomly from a herd endemic for JD. A complete physical examination was performed. Blood and fresh fecal samples were collected from each goat. A complete blood cell (CBC) count and a protein electrophoresis were performed. Polymerase chain reaction (PCR) on fecal samples was performed in order to divide goats into two groups: group A "positive PCR on feces"; and group B "control (negative)." A Student's t test was performed for each parameter to verify differences between groups A vs B. Twenty goats were included in each group. Clinical signs likely related to JD were found in the history of 4/40 (10%) goats, while 36/40 (90%) goats were reported to be asymptomatic. CBC and electrophoresis values were within reference intervals in both groups. No differences were found for CBC parameters between the two groups. Values for alpha 1, beta, gamma globulins, and total protein (TP) were statistically higher in group A vs those in group B, while those for albumin and albumin/globulin (A/G) ratio were lower. An increase in TP, hypoalbuminemia, and hypergammaglobulinemia has been reported in group A, while no abnormalities were found concerning CBC. JD-positive goats seem to show earlier clinical pathological alternations than clinical signs. Protein electrophoresis may help the diagnosis of JD in asymptomatic goat herds, acting as an economical screening method.

  13. Diagnosis of pulmonary infection with Toxoplasma gondii in immunocompromised HIV-positive patients by real-time PCR

    DEFF Research Database (Denmark)

    Petersen, E.; Edvinsson, B.; Lundgren, Bettina

    2006-01-01

    . In positive samples, the genotype of the parasite was determined by sequence analysis of the GRA6 gene. Positive results were achieved for 2% (7/332) of the samples tested. Genotyping was possible in two samples and revealed GRA6 type II T. gondii. PCR for detecting T. gondii in BAL samples should...... be performed in all immunosuppressed HIV-positive patients with symptoms of a systemic infection of unknown etiology. Trimethoprim-sulfamethoxazole prophylaxis does not exclude concomitant infection with T. gondii....

  14. Detecting the presence of infectious hepatitis A virus in molluscs positive to RT-nested-PCR

    NARCIS (Netherlands)

    Medici, de D.; Croci, L.; Pasquale, di S.; Fiore, A.; Toti, L.

    2001-01-01

    Aims: The objective of this study was to det. the presence of infectious hepatitis A virus (HAV) in molluscs naturally contaminated with viral HAV-RNA. Methods and Results: One hundred and forty-two mollusc samples were analyzed for the presence of viral HAV-RNA using RT-nested-PCR; pos. samples

  15. PCR-based verification of positive rapid diagnostic tests for intestinal protozoa infections with variable test band intensity.

    Science.gov (United States)

    Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg

    2017-10-01

    Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. An investigation of false positive dosimetry results

    International Nuclear Information System (INIS)

    Lewandowski, M.A.; Davis, S.A.; Goff, T.E.; Wu, C.F.

    1996-01-01

    The Waste Isolation Pilot Plant (WIPP) is a facility designed for the demonstration of the safe disposal of transuranic waste. Currently, the radiation source term is confined to sealed calibration and check sources since WIPP has not received waste for disposal. For several years the WIPP Dosimetry Group has operated a Harshaw Model 8800C reader to analyze Harshaw 8801-7776 thermoluminescent cards (3 TLD-700 and 1 TLD-600) with 8805 holder. The frequency of false positive results for quarterly dosimeter exchanges is higher than desired by the Dosimetry Group management. Initial observations suggested that exposure to intense ambient sunlight may be responsible for the majority of the false positive readings for element 3. A study was designed to investigate the possibility of light leaking through the holder and inducing a signal in element 3. This paper discusses the methods and results obtained, with special emphasis placed on recommendations to reduce the frequency of light-induced false positive readings

  17. Global Positioning System receiver evaluation results

    Energy Technology Data Exchange (ETDEWEB)

    Byrne, R.H.

    1993-09-01

    A Sandia project currently uses an outdated Magnavox 6400 Global Positioning System (GPS) receiver as the core of its navigation system. The goal of this study was to analyze the performance of the current GPS receiver compared to newer, less expensive models and to make recommendations on how to improve the performance of the overall navigation system. This paper discusses the test methodology used to experimentally analyze the performance of different GPS receivers, the test results, and recommendations on how an upgrade should proceed. Appendices contain detailed information regarding the raw data, test hardware, and test software.

  18. Determining the prevalence of inv-positive and ail-positive Yersinia enterocolitica in pig tonsils using PCR and culture methods.

    Science.gov (United States)

    Stachelska, Milena Alicja

    2017-01-01

    Yersiniosis is believed to be the third most common intestinal zoonosis in the European Union, after campylobacteriosis and salmonellosis. Yersinia enterocolitica is the most common species responsible for human infections. Pigs are regarded as the biggest reservoir of pathogenic Y. enterocolitica strains, which are mainly isolated from pig tonsils. The aim of this paper is to examine the prevalence of inv-positive and ail-positive Y. enterocolitica in pigs which were slaughtered in a Polish abattoir. Real-time PCR and culture methods were used to assess the prevalence of patho- genic Y. enterocolitica strains in pig tonsils. Real-time PCR was applied to detect inv-positive and ail-positive Y. enterocolitica. Y. enterocolitica was also isolated by applying direct plating, unselective (tryptic soy broth) and selective (irgasan-ticarcillin-potassium chlorate bouillon) enrichment. A total of 180 pigs were studied, of which 85% and 32% respectively were found to be infected with inv-positive and ail-positive Y. enterocolitica. The 92 inv-positive and ail-positive isolates, from 57 culture- positive tonsils, underwent bio- and serotyping. The most common was bioserotype 4/O:3, which was found in 53 (93%) out of 57 culture-positive tonsils. Strains of bioserotypes 2/O:5, 2/O:9 and 2/O:5.27 occurred in significantly lower numbers. The prevalence of inv-positive and ail-positive Y. enterocolitica was found to be high in the ton- sils of slaughtered pigs, using real-time PCR. The real-time PCR method for the detection and identification of pathogenic Y. enterocolitica is sensitive and specific, which has been verified by specificity and sensitivity tests using the pure cultures. Serotypes were distinguished from each other using PCR serotyping. The PCR method was essential in forming our conclusions.

  19. Comparison of Antigen Detection and Nested PCR in CSF Samples of HIV Positive and Negative Patients with Suspected Cryptococcal Meningitis in a Tertiary Care Hospital.

    Science.gov (United States)

    Kumari, Sunita; Verma, Rajesh Kumar; Singh, Dharmendra Prasad; Yadav, Ramakant

    2016-04-01

    The cases of cryptococcal meningitis and other forms of cryptococcosis have increased in recent time and the present scenario of the condition with significant morbidity and mortality is actually posing a serious threat to the community, so an early and prompt diagnosis is necessary to prevent serious complications and thus improving the overall disease outcome. Comparison of diagnostic efficacy of nested Polymerase Chain Reaction (PCR) with Latex Agglutination Test (LAT) in the Cerebro Spinal Fluid (CSF) samples of the cases of meningitis in HIV positive and negative cases. We have compared the diagnostic efficacy of Latex Agglutination Test (LAT) with nested Polymerase Chain Reaction (PCR) in 200 Cerebrospinal Fluid (CSF) samples, including 14 HIV positive also, in the cases of suspected cryptococcal meningitis. Nested PCR was done in all cases reporting positive by LAT and results were then compared with that of India ink and culture on Sabouraud Dextrose Agar (SDA), and the isolates were further identified by urease, nitrate and sugar assimilation tests. Of the 200 cases, including 14 HIV positive, LAT was positive in 46 cases while 154 were negative. Out of these 46 LAT positive cases, nested PCR was positive in 40 cases only, while culture and India ink was positive in 38 and 33 cases respectively. Majority of the cases, 30 (65.2%) were between age group 21-50 years, while 2 (4.3%) in 0-20, and 14 (30.4%) in 51-80 years age group. Although negative staining like India ink and nigrosin are most widely used techniques, but these suffer with subjective error. Rapid method like LAT is available but it always has the scope of false positive and negative results. In such cases nested PCR can help in establishing final diagnosis.

  20. Effect of carryover and presampling procedures on the results of real-time PCR used for diagnosis of bovine intramammary infections with Streptococcus agalactiae at routine milk recordings

    DEFF Research Database (Denmark)

    Mahmmod, Yasser; Mweu, Marshal Mutinda; Nielsen, Søren Saxmose

    2014-01-01

    with Streptococcus agalactiae (S. agalactiae) in dairy herds with conventional milking parlours. Misclassification may result in unnecessary costs for treatment and culling. The objectives of this study were to (1) determine the effect of carryover on PCR-positivity for S. agalactiae at different PCR cycle threshold...... (Ct) cut-offs by estimating the between-cow correlation while accounting for the milking order, and (2) evaluate the effect of aseptic presampling procedures (PSP) on PCR-positivity at the different Ct-value cut-offs. The study was conducted in four herds with conventional milking parlours at routine...

  1. PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.

    Science.gov (United States)

    Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R

    2017-10-01

    High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.

  2. A Highly Sensitive Telomerase Activity Assay that Eliminates False-Negative Results Caused by PCR Inhibitors

    Directory of Open Access Journals (Sweden)

    Hidenobu Yaku

    2013-09-01

    Full Text Available An assay for telomerase activity based on asymmetric polymerase chain reaction (A-PCR on magnetic beads (MBs and subsequent application of cycling probe technology (CPT is described. In this assay, the telomerase reaction products are immobilized on MBs, which are then washed to remove PCR inhibitors that are commonly found in clinical samples. The guanine-rich sequences (5'-(TTAGGGn-3' of the telomerase reaction products are then preferentially amplified by A-PCR, and the amplified products are subsequently detected via CPT, where a probe RNA with a fluorophore at the 5' end and a quencher at the 3' end is hydrolyzed by RNase H in the presence of the target DNA. The catalyst-mediated cleavage of the probe RNA enhances fluorescence from the 5' end of the probe. The assay allowed us to successfully detect HeLa cells selectively over normal human dermal fibroblast (NHDF cells. Importantly, this selectivity produced identical results with regard to detection of HeLa cells in the absence and presence of excess NHDF cells; therefore, this assay can be used for practical clinical applications. The lower limit of detection for HeLa cells was 50 cells, which is lower than that achieved with a conventional telomeric repeat amplification protocol assay. Our assay also eliminated false-negative results caused by PCR inhibitors. Furthermore, we show that this assay is appropriate for screening among G-quadruplex ligands to find those that inhibit telomerase activity.

  3. A locked nucleic acid (LNA-based real-time PCR assay for the rapid detection of multiple bacterial antibiotic resistance genes directly from positive blood culture.

    Directory of Open Access Journals (Sweden)

    Lingxiang Zhu

    Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.

  4. Evaluation of Coxiella burnetii status in dairy cattle herds with bulk-tank milk positive by ELISA and PCR.

    Science.gov (United States)

    Piñero, A; Barandika, J F; Hurtado, A; García-Pérez, A L

    2014-04-01

    Bulk-tank milk (BTM) samples are frequently used to evaluate the health status of dairy livestock. A large-scale investigation carried out in BTM samples from dairy cattle herds from a Q fever-endemic region in Northern Spain revealed a high degree of exposure to Coxiella burnetii. This study was aimed at assessing the value of BTM samples analysis as an indicator of the C. burnetii status in dairy cattle herds. Three herds with BTM samples positive for C. burnetii by ELISA and PCR were selected, and blood, faeces and individual milk and BTM samples were analysed by serology and PCR. In spite of the high antibodies titres found in BTM samples, only one of the three farms presented an active infection by C. burnetii, as revealed by the presence of bacterial DNA in vaginal mucus and in environmental samples collected in the calving area, a seroprevalence around 40% in heifers and the seroconversion rate observed in cows. Results obtained indicated that the analysis of BTM samples is a good epidemiological tool at the population level that can be used to discriminate between seropositive and seronegative herds, but at the herd level, additional tests are necessary to evaluate whether Q fever is a potential problem in the farm. When Q fever is suspected in a cattle herd, sera from a small group of 1- to 3-year-old animals need to be analysed to investigate recent contact with C. burnetii. © 2012 Blackwell Verlag GmbH.

  5. Potential for false positive HIV test results with the serial rapid HIV testing algorithm

    Directory of Open Access Journals (Sweden)

    Baveewo Steven

    2012-03-01

    Full Text Available Abstract Background Rapid HIV tests provide same-day results and are widely used in HIV testing programs in areas with limited personnel and laboratory infrastructure. The Uganda Ministry of Health currently recommends the serial rapid testing algorithm with Determine, STAT-PAK, and Uni-Gold for diagnosis of HIV infection. Using this algorithm, individuals who test positive on Determine, negative to STAT-PAK and positive to Uni-Gold are reported as HIV positive. We conducted further testing on this subgroup of samples using qualitative DNA PCR to assess the potential for false positive tests in this situation. Results Of the 3388 individuals who were tested, 984 were HIV positive on two consecutive tests, and 29 were considered positive by a tiebreaker (positive on Determine, negative on STAT-PAK, and positive on Uni-Gold. However, when the 29 samples were further tested using qualitative DNA PCR, 14 (48.2% were HIV negative. Conclusion Although this study was not primarily designed to assess the validity of rapid HIV tests and thus only a subset of the samples were retested, the findings show a potential for false positive HIV results in the subset of individuals who test positive when a tiebreaker test is used in serial testing. These findings highlight a need for confirmatory testing for this category of individuals.

  6. Potential for false positive HIV test results with the serial rapid HIV testing algorithm.

    Science.gov (United States)

    Baveewo, Steven; Kamya, Moses R; Mayanja-Kizza, Harriet; Fatch, Robin; Bangsberg, David R; Coates, Thomas; Hahn, Judith A; Wanyenze, Rhoda K

    2012-03-19

    Rapid HIV tests provide same-day results and are widely used in HIV testing programs in areas with limited personnel and laboratory infrastructure. The Uganda Ministry of Health currently recommends the serial rapid testing algorithm with Determine, STAT-PAK, and Uni-Gold for diagnosis of HIV infection. Using this algorithm, individuals who test positive on Determine, negative to STAT-PAK and positive to Uni-Gold are reported as HIV positive. We conducted further testing on this subgroup of samples using qualitative DNA PCR to assess the potential for false positive tests in this situation. Of the 3388 individuals who were tested, 984 were HIV positive on two consecutive tests, and 29 were considered positive by a tiebreaker (positive on Determine, negative on STAT-PAK, and positive on Uni-Gold). However, when the 29 samples were further tested using qualitative DNA PCR, 14 (48.2%) were HIV negative. Although this study was not primarily designed to assess the validity of rapid HIV tests and thus only a subset of the samples were retested, the findings show a potential for false positive HIV results in the subset of individuals who test positive when a tiebreaker test is used in serial testing. These findings highlight a need for confirmatory testing for this category of individuals.

  7. A sensitive one-step real-time PCR for detection of avian influenza viruses using a MGB probe and an internal positive control

    Directory of Open Access Journals (Sweden)

    Delogu Mauro

    2006-05-01

    Full Text Available Abstract Background Avian influenza viruses (AIVs are endemic in wild birds and their introduction and conversion to highly pathogenic avian influenza virus in domestic poultry is a cause of serious economic losses as well as a risk for potential transmission to humans. The ability to rapidly recognise AIVs in biological specimens is critical for limiting further spread of the disease in poultry. The advent of molecular methods such as real time polymerase chain reaction has allowed improvement of detection methods currently used in laboratories, although not all of these methods include an Internal Positive Control (IPC to monitor for false negative results. Therefore we developed a one-step reverse transcription real time PCR (RRT-PCR with a Minor Groove Binder (MGB probe for the detection of different subtypes of AIVs. This technique also includes an IPC. Methods RRT-PCR was developed using an improved TaqMan technology with a MGB probe to detect AI from reference viruses. Primers and probe were designed based on the matrix gene sequences from most animal and human A influenza virus subtypes. The specificity of RRT-PCR was assessed by detecting influenza A virus isolates belonging to subtypes from H1–H13 isolated in avian, human, swine and equine hosts. The analytical sensitivity of the RRT-PCR assay was determined using serial dilutions of in vitro transcribed matrix gene RNA. The use of a rodent RNA as an IPC in order not to reduce the efficiency of the assay was adopted. Results The RRT-PCR assay is capable to detect all tested influenza A viruses. The detection limit of the assay was shown to be between 5 and 50 RNA copies per reaction and the standard curve demonstrated a linear range from 5 to 5 × 108 copies as well as excellent reproducibility. The analytical sensitivity of the assay is 10–100 times higher than conventional RT-PCR. Conclusion The high sensitivity, rapidity, reproducibility and specificity of the AIV RRT-PCR with

  8. Eliminating PCR contamination

    International Nuclear Information System (INIS)

    Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.

    1991-01-01

    The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs

  9. [Frequency of intestinal microsporidian infections in HIV-positive patients, as diagnosis by quick hot Gram chromotrope staining and PCR].

    Science.gov (United States)

    Botero, Jorge H; Montoya, Martha Nelly; Vanegas, Adriana Lucía; Díaz, Abel; Navarro-i-Martínez, Luis; Bornay, Fernando Jorge; Izquierdo, Fernando; del Aguila, Carmen; Agudelo, Sonia del Pilar

    2004-12-01

    Microsporidia are intracellular obligate parasites, today mainly associated with diarrhea in AIDS patients. Microsporidia prevalence ranges from 8% to 52% in different countries, as evaluated by several diagnostic methods, such as the stain test and PCR. In Medellín, Colombia, its frequency is unknown, and hence, a study was undertaken to determine the frequency of intestinal microsporidiosis in HIV patients, by means of the quick-hot Gram chromotrope test and the PCR. A prospective and descriptive study of an intentional population of all HIV-positive patients was sent to the Grupo Interdisciplinario para el Estudio de las Parasitosis Intestinales laboratory by institutions treating the HIV-positive patients of Medellín between August 2001 and September 2002. The clinical-epidemiological survey included a serial stool test with direct concentration and special stains for coccidiae and intestinal microsporidia. In addition, counts of lymphocytes TCD4+ and viral load were requested. One hundred and three patients with ages ranging from 2-74 years were evaluated. Seventy percent presented with diarrhea--mostly in men (83.5%). The overall frequency of intestinal microsporidiosis was 3.9% and that of other intestinal parasitic infections was 39.8%. Three of the four patients positive for microsporida were infected with Enterocytozoon bieneusi and one with Encephalitozoon intestinalis. The microsporidiosis frequency was relatively low with 3 of the 4 cases associated with protracted diarrhea, counts of LTCD4+ below 100 cel/microl and viral loads up to 100,000 copies.

  10. Avian metapneumovirus RT-nested-PCR: a novel false positive reducing inactivated control virus with potential applications to other RNA viruses and real time methods.

    Science.gov (United States)

    Falchieri, Marco; Brown, Paul A; Catelli, Elena; Naylor, Clive J

    2012-12-01

    Using reverse genetics, an avian metapneumovirus (AMPV) was modified for use as a positive control for validating all stages of a popular established RT-nested PCR, used in the detection of the two major AMPV subtypes (A and B). Resultant amplicons were of increased size and clearly distinguishable from those arising from unmodified virus, thus allowing false positive bands, due to control virus contamination of test samples, to be identified readily. Absorption of the control virus onto filter paper and subsequent microwave irradiation removed all infectivity while its function as an efficient RT-nested-PCR template was unaffected. Identical amplicons were produced after storage for one year. The modified virus is likely to have application as an internal standard as well as in real time methods. Additions to AMPV of RNA from other RNA viruses, including hazardous examples such HIV and influenza, are likely to yield similar safe RT-PCR controls. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi

    Directory of Open Access Journals (Sweden)

    Danielle C. Leal

    2011-07-01

    Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.

  12. Assessment of real-time PCR cycle threshold values in Microsporum canis culture-positive and culture-negative cats in an animal shelter: a field study.

    Science.gov (United States)

    Jacobson, Linda S; McIntyre, Lauren; Mykusz, Jenny

    2018-02-01

    Objectives Real-time PCR provides quantitative information, recorded as the cycle threshold (Ct) value, about the number of organisms detected in a diagnostic sample. The Ct value correlates with the number of copies of the target organism in an inversely proportional and exponential relationship. The aim of the study was to determine whether Ct values could be used to distinguish between culture-positive and culture-negative samples. Methods This was a retrospective analysis of Ct values from dermatophyte PCR results in cats with suspicious skin lesions or suspected exposure to dermatophytosis. Results One hundred and thirty-two samples were included. Using culture as the gold standard, 28 were true positives, 12 were false positives and 92 were true negatives. The area under the curve for the pretreatment time point was 96.8% (95% confidence interval [CI] 94.2-99.5) compared with 74.3% (95% CI 52.6-96.0) for pooled data during treatment. Before treatment, a Ct cut-off of value between culture-positive and culture-negative samples during treatment. Ct values prior to treatment differed significantly between the true-positive and false-positive groups ( P = 0.0056). There was a significant difference between the pretreatment and first and second negative culture time points ( P = 0.0002 and P values for true positives and true negatives, and for pre- and intra-treatment time points. Conclusions and relevance Ct values had limited usefulness for distinguishing between culture-positive and culture-negative cases when field study samples were analyzed. In addition, Ct values were less reliable than fungal culture for determining mycological cure.

  13. Ligation-mediated PCR with a back-to-back adapter reduces amplification bias resulting from variations in GC content.

    Science.gov (United States)

    Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi

    2017-08-15

    Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Inverse fusion PCR cloning.

    Directory of Open Access Journals (Sweden)

    Markus Spiliotis

    Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.

  15. Implications of false-positive results for future cancer screenings.

    Science.gov (United States)

    Taksler, Glen B; Keating, Nancy L; Rothberg, Michael B

    2018-06-01

    False-positive cancer screening results may affect a patient's willingness to obtain future screening. The authors conducted logistic regression analysis of 450,484 person-years of electronic medical records (2006-2015) in 92,405 individuals aged 50 to 75 years. Exposures were false-positive breast, prostate, or colorectal cancer screening test results (repeat breast imaging or negative breast biopsy ≤3 months after screening mammography, repeat prostate-specific antigen [PSA] test ≤3 months after PSA test result ≥4.0 ng/mL or negative prostate biopsy ≤3 months after any PSA result, or negative colonoscopy [without biopsy/polypectomy] ≤6 months after a positive fecal occult blood test). Outcomes were up-to-date status with breast or colorectal cancer screening. Covariates included prior screening history, clinical information (eg, family history, obesity, and smoking status), comorbidity, and demographics. Women were more likely to be up to date with breast cancer screening if they previously had false-positive mammography findings (adjusted odds ratio [AOR], 1.43 [95% confidence interval, 1.34-1.51] without breast biopsy and AOR, 2.02 [95% confidence interval, 1.56-2.62] with breast biopsy; both Pfalse-positive PSA testing were more likely to be up to date with colorectal cancer screening (AOR, 1.22 [P = .039] without prostate imaging/biopsy and AOR, 1.60 [P = .028] with imaging/biopsy). Results were stronger for individuals with more false-positive results (all P≤.005). However, women with previous false-positive colorectal cancer fecal occult blood test screening results were found to be less likely to be up to date with breast cancer screening (AOR, 0.73; Pfalse-positive breast or prostate cancer screening test were more likely to engage in future screening. Cancer 2018;124:2390-8. © 2018 American Cancer Society. © 2018 American Cancer Society.

  16. Consequences of a false-positive mammography result

    DEFF Research Database (Denmark)

    von Euler-Chelpin, My; Bæksted, Christina; Vejborg, Ilse

    2016-01-01

    group used anxiolytic and antidepressant drugs. There was no difference in use of beta blockers. Hormone therapy was used more frequently by the false-positive, 36.6% versus 28.7%. The proportion of women using anxiolytic and antidepressant drugs increased with 19% from the before to the after period...... in the false-positive group, and with 16% in the normal group, resulting in an RRR of 1.02 (95% CI 0.92-1.14). RRR was 1.03 for beta blockers, 0.97 for hormone therapy. Conclusion(s): Drugs used to mitigate mood disorders were used more frequently by women with false-positive than by women with normal......Background: Previous research showed women experiencing false-positive mammograms to have greater anxiety about breast cancer than women with normal mammograms. To elucidate psychological effects of false-positive mammograms, we studied impact on drug intake.  Methods: We calculated the ratio...

  17. Long-term frozen storage of urine samples: a trouble to get PCR results in Schistosoma spp. DNA detection?

    Science.gov (United States)

    Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio

    2013-01-01

    Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples' storage or conditions for handling and DNA preservation and extraction methods. We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patients urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used.

  18. Long-term frozen storage of urine samples: a trouble to get PCR results in Schistosoma spp. DNA detection?

    Directory of Open Access Journals (Sweden)

    Pedro Fernández-Soto

    Full Text Available BACKGROUND: Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples' storage or conditions for handling and DNA preservation and extraction methods. METHODOLOGY/PRINCIPAL FINDINGS: We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patients urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. CONCLUSIONS/SIGNIFICANCE: Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA

  19. Radiotherapy Results of Carcinoma of Cervix with positive Resection Margin

    International Nuclear Information System (INIS)

    Huh, Seung Jae; Kim, Dae Yong; Ahn, Yong Chan; Kim, Won Dong; Wu, Hong Gyun; Ha, Sung Whan; Kim, Il Han; Park, Charn Il

    1996-01-01

    Purpose : Patients with cervical cancer who have positive resection margins after radical hysterectomy are at increased risk for local recurrence. The results of postoperative pelvic radiotherapy for cervix cancer with positive resection margins were analyzed to evaluated the role of radiotherapy. Materials and Methods : Between 1979 and 1992, 60 patients of cervix carcinoma were treated with postoperative radiotherapy after radical hysterectomy because of positive vaginal(48 patients) or parametrial resection margins(12 patients). Patients were treated with external beam radiation therapy(EBRT) alone (12 patients) or EBRT plus vaginal ovoid irradiation (VOI) (48 patients). The median follow-up period was 5 months. Results : The 5-year actuarial disease free and overall survival rates for all patients were 75.2%, 84.1%, respectively. The overall recurrence rate was 23%(14/60). In 48 patients with positive vaginal resection margins, the pelvic recurrence was 8%(4/48). Distant metastasis was 15%(7/48). Of the 43 patients with positive vaginal resection margins treated with EBRT and VOI, recurrence rate was 21%(9/43), while recurrence rate was 40%(2/5) in the EBRT only treated group. In 12 patients with positive parametrial margins, three patients (25%) had distant metastases. The most significant prognostic factor was lymph node metastasis. Complications resulting from radiotherapy occurred at a rate of 32%(19/60) and grade III complications occurred in three patients (5%). Conclusion : Postoperative radiotherapy can produce excellent pelvic control rates in patients with positive resection margins. In patients with positive vaginal margins, whole pelvic EBRT and BOI is recommended

  20. Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

    Science.gov (United States)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

    2018-03-01

    The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

  1. Diagnosis of pulmonary infection with Toxoplasma gondii in immunocompromised HIV-positive patients by real-time PCR

    DEFF Research Database (Denmark)

    Petersen, E; Edvinsson, B; Lundgren, B

    2006-01-01

    The aim of the study presented here was to evaluate the use of PCR for improving the diagnosis of Toxoplasma gondii infection in immunocompromised hosts. Three hundred thirty-two bronchoalveolar lavage (BAL) fluid samples were analyzed by real-time PCR targeting a 529 bp element of T. gondii. In ...

  2. False-positive results in pharmacoepidemiology and pharmacovigilance.

    Science.gov (United States)

    Bezin, Julien; Bosco-Levy, Pauline; Pariente, Antoine

    2017-09-01

    False-positive constitute an important issue in scientific research. In the domain of drug evaluation, it affects all phases of drug development and assessment, from the very early preclinical studies to the late post-marketing evaluations. The core concern associated with this false-positive is the lack of replicability of the results. Aside from fraud or misconducts, false-positive is often envisioned from the statistical angle, which considers them as a price to pay for type I error in statistical testing, and its inflation in the context of multiple testing. If envisioning this problematic in the context of pharmacoepidemiology and pharmacovigilance however, that both evaluate drugs in an observational settings, information brought by statistical testing and the significance of such should only be considered as additional to the estimates provided and their confidence interval, in a context where differences have to be a clinically meaningful upon everything, and the results appear robust to the biases likely to have affected the studies. In the following article, we consequently illustrate these biases and their consequences in generating false-positive results, through studies and associations between drug use and health outcomes that have been widely disputed. Copyright © 2017 Société française de pharmacologie et de thérapeutique. Published by Elsevier Masson SAS. All rights reserved.

  3. The effects of metal ion PCR inhibitors on results obtained with the Quantifiler(®) Human DNA Quantification Kit.

    Science.gov (United States)

    Combs, Laura Gaydosh; Warren, Joseph E; Huynh, Vivian; Castaneda, Joanna; Golden, Teresa D; Roby, Rhonda K

    2015-11-01

    targets human DNA in the Quantifiler(®) kit. Evidence of inhibition was observed for the human-specific assay at a lower metal concentration than detected by the IPC, for all metals examined except calcium. These results strongly suggest that determination of a "true negative" sample should not be based solely on the failure of the IPC to indicate the presence of a PCR inhibitor and indicate that amplification of all samples should be attempted, regardless of the quantification results. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Next-generation sequencing indicates false-positive MRD results and better predicts prognosis after SCT in patients with childhood ALL.

    Science.gov (United States)

    Kotrova, M; van der Velden, V H J; van Dongen, J J M; Formankova, R; Sedlacek, P; Brüggemann, M; Zuna, J; Stary, J; Trka, J; Fronkova, E

    2017-07-01

    Minimal residual disease (MRD) monitoring via quantitative PCR (qPCR) detection of Ag receptor gene rearrangements has been the most sensitive method for predicting prognosis and making post-transplant treatment decisions for patients with ALL. Despite the broad clinical usefulness and standardization of this method, we and others have repeatedly reported the possibility of false-positive MRD results caused by massive B-lymphocyte regeneration after stem cell transplantation (SCT). Next-generation sequencing (NGS) enables precise and sensitive detection of multiple Ag receptor rearrangements, thus providing a more specific readout compared to qPCR. We investigated two cohorts of children with ALL who underwent SCT (30 patients and 228 samples). The first cohort consisted of 17 patients who remained in long-term CR after SCT despite having low MRD positivity (SCT monitoring using qPCR. Only one of 27 qPCR-positive samples was confirmed to be positive by NGS. Conversely, 10 of 15 samples with low qPCR-detected MRD positivity from 13 patients who subsequently relapsed were also confirmed to be positive by NGS (P=0.002). These data show that NGS has a better specificity in post-SCT ALL management and indicate that treatment interventions aimed at reverting impending relapse should not be based on qPCR only.

  5. Development of a multiplex methylation-specific PCR as candidate triage test for women with an HPV-positive cervical scrape

    International Nuclear Information System (INIS)

    Snellenberg, Suzanne; Strooper, Lise MA De; Hesselink, Albertus T; Meijer, Chris JLM; Snijders, Peter JF; Heideman, Daniëlle AM; Steenbergen, Renske DM

    2012-01-01

    Quantitative methylation-specific PCR (qMSP) analysis for determining the methylation status of (candidate) tumor suppressor genes has potential as objective and valuable test to triage high-risk human papillomavirus (hrHPV) positive women in cervical screening. Particularly combined methylation analysis of a panel of genes shows most promising clinical performance, with sensitivity levels that equal or exceed that of cytology. However, the wide application of such methylation marker panels is hampered by the lack of effective multiplex assays allowing simultaneous methylation detection of various targets in a single reaction. Here, we designed and analyzed a multiplex qMSP assay for three genes whose methylation was previously found to be informative for cervical (pre)cancer (i.e. CADM1, MAL and hsa-miR-124-2) as well as a reference gene β-actin. Based on our experience, we discuss the optimization of the parameters that provide a practical approach towards multiplex qMSP design. Primers and PCR reagents were optimized for multiplex qMSP purposes and the resulting assay was analytically validated on serial dilutions of methylated DNA in unmethylated DNA, and compared with singleplex counterparts on hrHPV-positive cervical scrapings. Upon optimization, including primer redesign and primer limiting assays, the multiplex qMSP showed the same analytical performance as the singleplex qMSPs. A strong correlation between the obtained normalized ratios of the singleplex and multiplex qMSPs on cervical scrapes was found for all three markers: CADM1 (R 2 =0.985), MAL (R 2 =0.986) and hsa-miR-124-2 (R 2 =0.944). Multiplex qMSP offers a promising approach for high-throughput diagnostic analysis of the methylation status of multiple genes, which after proper design and validation can be equally specific, sensitive and reproducible as its singleplex versions

  6. Success of benznidazole chemotherapy in chronic Trypanosoma cruzi-infected patients with a sustained negative PCR result.

    Science.gov (United States)

    Murcia, L; Carrilero, B; Ferrer, F; Roig, M; Franco, F; Segovia, M

    2016-11-01

    Cure assessment in chronic Trypanosoma cruzi infection is controversial, mainly because of the lack of reliable tests to ensure parasite elimination. Here, we assess the impact of benznidazole therapy on the conventional serology and parasitaemia in chronic Chagas disease. A total of 455 patients with long-term Trypanosoma cruzi infection underwent specific chemotherapy with benznidazole. Their parasitological status was assessed by polymerase chain reaction (PCR) detection of T. cruzi DNA. Drops in the titres of antibody levels were serially measured by indirect immunofluorescence assay (IFI) and chemiluminescent microparticle immunoassay (CMIA). Patients were monitored during the treatment period and for a further 90, 150 and 240 days. Controls were repeated yearly during the 7-year follow-up. The PCR result was negative in all patients between 60-day (n = 22) and 90-day (n = 294) controls. Treatment failure was detected in 45 patients and was significantly more frequent in those who did not complete the therapy [12 out of 13 (92 %) vs. 33 out of 442 (7 %)] (p = 0.0001). A significant drop in serum titres was detected after the first follow-up year in patients with sustained negative PCR results: 2nd year (p = 0.029 by IFI; p = 0.002 by CMIA), 5th year (p = 0.036 by IFI; p = 0.039 by CMIA) and 6th year (p = 0.028 by IFI; p = 0.019 by CMIA). The results point to a beneficial effect of benznidazole and may be the cure of chronic patients who had a consistently negative PCR result throughout the follow-up period.

  7. Detection of negative and positive RNA strand of poliovirus Sabin 1 and echovirus E19 by a stem-loop reverse transcription PCR.

    Science.gov (United States)

    Fikatas, A; Dimitriou, T G; Kyriakopoulou, Z; Moschonas, G D; Amoutzias, G D; Mossialos, D; Gartzonika, C; Levidiotou-Stefanou, S; Markoulatos, P

    2017-09-01

    In this report a strand specific RT-PCR was established for the detection of the replicative negative RNA strand of poliovirus sabin 1 (Sabin1) and Echovirus 19 (E19) strains. The key for the successful conduction of the assay was the use of a specific reverse transcription primer targeting the 5'-UTR of enteroviruses that consisted of a stem-loop structure at the 5'-end and an enteroviral-specific sequence at the 3'-end. The stem loop RT-PCR was found to be an accurate and sensitive method, detecting even 10 -2 CCID 50 of poliovirus sabin 1 (Sabin1) and E19 strains 6 h postinfection (p.i.), while CPE appeared 3 days later. This assay was also validated in SiHa and Caski cell lines that are not used for the detection of enteroviruses. The negative RNA strand was detected 6 h and 12 h p.i. in SiHa and Caski cells, when these cell lines were inoculated with 10 5 and 1 CCID 50 respectively, whereas CPE was observed 5 days p.i for SiHa cells and 8 days p.i for Caski cells and that only at 10 5 CCID 50 . The results show that this approach may be used for replacing the time-consuming cell cultures in order to detect the active replication of enteroviruses. Enteroviruses are positive stranded RNA viruses that may cause severe diseases. The conventional method for detection of active viral replication involves virus isolation in sensitive cell cultures followed by titration and seroneutralization. In this report, we describe the use of a stem-loop secondary structured oligonucleotide in RT-PCR assay for the detection of the replicative negative strand of the positive-stranded RNA of poliovirus sabin 1 and E19 strains. This approach proved to be a useful tool that may be used for replacing the time-consuming cell culture assays in order to detect the active replication of enteroviruses. © 2017 The Society for Applied Microbiology.

  8. Paradoxical results of two automated real-time PCR assays in the diagnosis of pleural tuberculosis

    Directory of Open Access Journals (Sweden)

    Soraya E. Morales-López

    2017-01-01

    Full Text Available Tuberculosis (TB is a major cause of worldwide mortality. We report the case of a non-HIV-infected woman with clinical suspicion of pleural tuberculosis and contradictory results between Xpert® MTB/RIF and Abbott RealTime MTB assays from pleural fluid specimen. Liquid and solid cultures for tuberculosis were performed with negative results. The patient received treatment, and clinical improvement was observed. Both techniques detect Mycobacterium tuberculosis complex, but they have different targets and limits of detection. Abbott RealTime MTB results correlated well with the clinical findings of the patient.

  9. Paradoxical results of two automated real-time PCR assays in the diagnosis of pleural tuberculosis.

    Science.gov (United States)

    Morales-López, Soraya E; Yepes, Jayr A; Anzola, Irina; Aponte, Hernán; Llerena-Polo, Claudia R

    2017-01-01

    Tuberculosis (TB) is a major cause of worldwide mortality. We report the case of a non-HIV-infected woman with clinical suspicion of pleural tuberculosis and contradictory results between Xpert ® MTB/RIF and Abbott RealTime MTB assays from pleural fluid specimen. Liquid and solid cultures for tuberculosis were performed with negative results. The patient received treatment, and clinical improvement was observed. Both techniques detect Mycobacterium tuberculosis complex, but they have different targets and limits of detection. Abbott RealTime MTB results correlated well with the clinical findings of the patient. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Inhibiting HER3-mediated tumor cell growth with affibody molecules engineered to low picomolar affinity by position-directed error-prone PCR-like diversification.

    Science.gov (United States)

    Malm, Magdalena; Kronqvist, Nina; Lindberg, Hanna; Gudmundsdotter, Lindvi; Bass, Tarek; Frejd, Fredrik Y; Höidén-Guthenberg, Ingmarie; Varasteh, Zohreh; Orlova, Anna; Tolmachev, Vladimir; Ståhl, Stefan; Löfblom, John

    2013-01-01

    The HER3 receptor is implicated in the progression of various cancers as well as in resistance to several currently used drugs, and is hence a potential target for development of new therapies. We have previously generated Affibody molecules that inhibit heregulin-induced signaling of the HER3 pathways. The aim of this study was to improve the affinity of the binders to hopefully increase receptor inhibition efficacy and enable a high receptor-mediated uptake in tumors. We explored a novel strategy for affinity maturation of Affibody molecules that is based on alanine scanning followed by design of library diversification to mimic the result from an error-prone PCR reaction, but with full control over mutated positions and thus less biases. Using bacterial surface display and flow-cytometric sorting of the maturation library, the affinity for HER3 was improved more than 30-fold down to 21 pM. The affinity is among the higher that has been reported for Affibody molecules and we believe that the maturation strategy should be generally applicable for improvement of affinity proteins. The new binders also demonstrated an improved thermal stability as well as complete refolding after denaturation. Moreover, inhibition of ligand-induced proliferation of HER3-positive breast cancer cells was improved more than two orders of magnitude compared to the previously best-performing clone. Radiolabeled Affibody molecules showed specific targeting of a number of HER3-positive cell lines in vitro as well as targeting of HER3 in in vivo mouse models and represent promising candidates for future development of targeted therapies and diagnostics.

  11. Positive Community Norm Survey 2011 : Methodology and Results

    Science.gov (United States)

    2012-09-01

    This survey established a baseline understanding of the positive norms that exist in Idaho, plus reveal the gaps in knowledge and perceived norms with regard to impaired driving. These gaps will indicate the most effective opportunities for future co...

  12. Experimental Results from a Microwave Cavity Beam Position Monitor

    International Nuclear Information System (INIS)

    Balakin, V.; Bazhan, A.; Lunev, P.; Solyak, N.; Vogel, V.; Zhogolev, P.; Lisitsyn, A.; Yakimenko, V.

    1999-01-01

    Future Linear Colliders have hard requirements for the beam transverse position stability in the accelerator. A beam Position Monitor (BPM) with the resolution better than 0.1 micron in the single bunch regime is needed to control the stability of the beam position along the linac. Proposed BPM is based on the measurement of the asymmetrical mode excited by single bunch in the cavity. Four stages of signal processing (space-, time-, frequency- and phase-filtering providing the required signal-to-noise ratio) are used to obtain extremely high resolution. The measurement set-up was designed by BINP and installed at ATF/BNL to test experimentally this concept. The set-up includes three two-coordinates BPM's at the frequency of 13.566 GHz, and reference intensity/phase cavity. BPM's were mounted on support table. The two-coordinates movers allow to move and align BPM's along the straight line, using the signals from the beam. The position of each monitor is controlled by the sensors with the accuracy 0.03 micron. The information from three monitors allows to exclude angle and position jitter of the beam and measure BPM resolution. In the experiments the resolution of about 0.15 micron for 0.25 nC beam intensity was obtained, that is close to the value required

  13. In-house PCR with DNA extracted directly from positive slides to confirm or exclude the diagnosis of tuberculosis: focus on biosafety.

    Science.gov (United States)

    de Almeida, Isabela Neves; Aleixo, Agdemir Valéria; Carvalho, Wânia da Silva; de Miranda, Silvana Spindola

    2015-01-01

    The possibility to obtain DNA from smears is a valuable alternative to remedy the lack of samples when they are totally used for bacilloscopy; this technique solves the biosafety problem related to a possible accident with the transportation of flasks containing potentially transmissible clinical samples. Hence, the purpose of this study was to utilize the insertion sequence IS6110 for amplification of DNA from a smear-positive sample for tuberculosis (TB) diagnosis. Among the 52 positive bacilloscopies, sensitivity, specificity, positive predictive value and negative predictive value were 52.3%, 100%, 100% and 89.7%, respectively whereas accuracy was 90.7%. The IS6110-based PCR for TB diagnosis developed in DNA extracted from a positive smear is a fast, simple, specific, and safe method. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Percutaneous peritoneovenous shunt positioning: technique and preliminary results

    International Nuclear Information System (INIS)

    Orsi, Franco; Grasso, Rosario Francesco; Bonomo, Guido; Marinucci, Irene; Monti, Cinzia; Bellomi, Massimo

    2002-01-01

    Nine peritoneovenous shunts were positioned by percutaneous technique in seven patients with advanced malignancy causing severe refractory ascites, and in two patients with hepatic cirrhosis (one with hepatocarcinoma). In all patients the shunts were percutaneously placed through the subclavian vein in the angiographic suite under digital fluoroscopic guide. No complications directly related to the procedure occurred. The shunt was successfully positioned in all patients in 60 min average time. No patient showed symptoms related to pulmonary overload or to disseminated intravascular coagulation. All patients had a significant improvement of the objective symptoms related to ascites such as respiratory symptoms, dyspepsia, and functional impairment to evacuation describing an improvement of their quality of life. Maximum shunt patency was 273 days. Percutaneous placement of peritoneovenous shunt is a safe, fast, and inexpensive procedure, extremely useful in resolution of refractory ascites, reducing symptoms, and allowing effective palliation, with a great improvement in quality of life. (orig.)

  15. Percutaneous peritoneovenous shunt positioning: technique and preliminary results

    Energy Technology Data Exchange (ETDEWEB)

    Orsi, Franco; Grasso, Rosario Francesco; Bonomo, Guido; Marinucci, Irene [Division of Radiology, European Institute of Oncology, Milan (Italy); Monti, Cinzia [Institute of Radiology, University of Milan (Italy); Bellomi, Massimo [Division of Radiology, European Institute of Oncology, Milan (Italy); Institute of Radiology, University of Milan (Italy)

    2002-05-01

    Nine peritoneovenous shunts were positioned by percutaneous technique in seven patients with advanced malignancy causing severe refractory ascites, and in two patients with hepatic cirrhosis (one with hepatocarcinoma). In all patients the shunts were percutaneously placed through the subclavian vein in the angiographic suite under digital fluoroscopic guide. No complications directly related to the procedure occurred. The shunt was successfully positioned in all patients in 60 min average time. No patient showed symptoms related to pulmonary overload or to disseminated intravascular coagulation. All patients had a significant improvement of the objective symptoms related to ascites such as respiratory symptoms, dyspepsia, and functional impairment to evacuation describing an improvement of their quality of life. Maximum shunt patency was 273 days. Percutaneous placement of peritoneovenous shunt is a safe, fast, and inexpensive procedure, extremely useful in resolution of refractory ascites, reducing symptoms, and allowing effective palliation, with a great improvement in quality of life. (orig.)

  16. FERMILAB SWITCHYARD RESONANT BEAM POSITION MONITOR ELECTRONICS UPGRADE RESULTS

    Energy Technology Data Exchange (ETDEWEB)

    Petersen, T. [Fermilab; Diamond, J. [Fermilab; Liu, N. [Fermilab; Prieto, P. S. [Fermilab; Slimmer, D. [Fermilab; Watts, A. [Fermilab

    2016-10-12

    The readout electronics for the resonant beam position monitors (BPMs) in the Fermilab Switchyard (SY) have been upgraded, utilizing a low noise amplifier transition board and Fermilab designed digitizer boards. The stripline BPMs are estimated to have an average signal output of between -110 dBm and -80 dBm, with an estimated peak output of -70 dBm. The external resonant circuit is tuned to the SY machine frequency of 53.10348 MHz. Both the digitizer and transition boards have variable gain in order to accommodate the large dynamic range and irregularity of the resonant extraction spill. These BPMs will aid in auto-tuning of the SY beamline as well as enabling operators to monitor beam position through the spill.

  17. Selective bowel decontamination results in gram-positive translocation.

    Science.gov (United States)

    Jackson, R J; Smith, S D; Rowe, M I

    1990-05-01

    Colonization by enteric gram-negative bacteria with subsequent translocation is believed to be a major mechanism for infection in the critically ill patient. Selective bowel decontamination (SBD) has been used to control gram-negative infections by eliminating these potentially pathogenic bacteria while preserving anaerobic and other less pathogenic organisms. Infection with gram-positive organisms and anaerobes in two multivisceral transplant patients during SBD led us to investigate the effect of SBD on gut colonization and translocation. Twenty-four rats received enteral polymixin E, tobramycin, amphotericin B, and parenteral cefotaxime for 7 days (PTA + CEF); 23 received parenteral cefotaxime alone (CEF), 19 received the enteral antibiotics alone (PTA), 21 controls received no antibiotics. Cecal homogenates, mesenteric lymph node (MLN), liver, and spleen were cultured. Only 8% of the PTA + CEF group had gram-negative bacteria in cecal culture vs 52% CEF, 84% PTA, and 100% in controls. Log Enterococcal colony counts were higher in the PTA + CEF group (8.0 + 0.9) vs controls (5.4 + 0.4) P less than 0.01. Translocation of Enterococcus to the MLN was significantly increased in the PTA + CEF group (67%) vs controls (0%) P less than 0.01. SBD effectively eliminates gram-negative organisms from the gut in the rat model. Overgrowth and translocation of Enterococcus suggests that infection with gram-positive organisms may be a limitation of SBD.

  18. Synthesis of O-serogroup specific positive controls and real-time PCR standards for nine clinically relevant non-O157 STECs.

    Science.gov (United States)

    Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim

    2012-10-01

    Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Real-time PCR for type-specific identification of herpes simplex in clinical samples: evaluation of type-specific results in the context of CNS diseases.

    Science.gov (United States)

    Meylan, Sylvain; Robert, Daniel; Estrade, Christine; Grimbuehler, Valérie; Péter, Olivier; Meylan, Pascal R; Sahli, Roland

    2008-02-01

    HSV-1 and HSV-2 cause CNS infections of dissimilar clinico-pathological characteristics with prognostic and therapeutic implications. To validate a type-specific real-time PCR that uses MGB/LNA Taqman probes and to review the virologico-clinical data of 25 eligible patients with non-neonatal CNS infections. This real-time PCR was evaluated against conventional PCR (26 CSF and 20 quality controls), and LightCycler assay (51 mucocutaneous, 8 CSF and 32 quality controls) and culture/immunofluorescence (75 mucocutaneous) to assess typing with independent methods. Taqman real-time PCR detected 240 HSV genomes per ml CSF, a level appropriate for the management of patients, and provided unambiguous typing for the 104 positive (62 HSV-1 and 42 HSV-2) out the 160 independent clinical samples tested. HSV type diagnosed by Taqman real-time PCR predicted final diagnosis (meningitis versus encephalitis/meningoencephalitis, p<0.001) in 24/25 patients at time of presentation, in contrast to clinical evaluation. Our real-time PCR, as a sensitive and specific means for type-specific HSV diagnosis, provided rapid prognostic information for patient management.

  20. Quantitation of HBV cccDNA in anti-HBc-positive liver donors by droplet digital PCR: a new tool to detect occult infection.

    Science.gov (United States)

    Caviglia, Gian Paolo; Abate, Maria Lorena; Tandoi, Francesco; Ciancio, Alessia; Amoroso, Antonio; Salizzoni, Mauro; Saracco, Giorgio Maria; Rizzetto, Mario; Romagnoli, Renato; Smedile, Antonina

    2018-04-02

    The accurate diagnosis of occult HBV infection (OBI) requires the demonstration of HBV DNA in liver biopsies of HBsAg-negative subjects. However, in clinical practice a latent OBI is deduced by the finding of the antibody to the HB-core antigen (anti-HBc). We investigated the true prevalence of OBI and the molecular features of intrahepatic HBV in anti-HBc-positive subjects. The livers of 100 transplant donors (median age 68.2 years; 64 males, 36 females) positive for anti-HBc at standard serologic testing, were examined for total HBV DNA by nested-PCR and for the HBV covalently closed circular DNA (HBV cccDNA) with an in-house droplet digital PCR assay (ddPCR) (Linearity: R 2 = 0.9998; lower limit of quantitation and detection of 2.4 and 0.8 copies/10 5 cells, respectively). A true OBI status was found in 52% (52/100) of the subjects and cccDNA was found in 52% (27/52) of the OBI-positive, with a median 13 copies/10 5 cells (95% confidence interval 5-25). Using an assay specific for anti-HBc of IgG class, the median antibody level was significantly higher in HBV cccDNA-positive than negative donors (5.7 [3.6-9.7] vs. 17.0 [7.0-39.2] COI, p = 0.007). By multivariate analysis, an anti-HBc IgG value above a 4.4 cut-off index (COI) was associated with the finding of intrahepatic HBV cccDNA (OR = 8.516, p = 0.009); a lower value ruled out its presence with a negative predictive value of 94.6%. With a new in-house ddPCR-based method, intrahepatic HBV cccDNA was detectable in quantifiable levels in about half of the OBI cases examined. The titer of anti-HBc IgG may be a useful surrogate to predict the risk of OBI reactivation in immunosuppressed patients. The covalently closed circular DNA (cccDNA) form of the Hepatitis B virus (HBV) sustains the persistence of the virus even after decades of resolution of the florid infection (Occult HBV infection=OBI). In the present study we developed an highly sensitive method based on droplet digital PCR technology for the detection

  1. Diagnosis of trichomonas vaginalis infection by PCR

    International Nuclear Information System (INIS)

    Issa, R.M.; Shalaby, M.A.

    2007-01-01

    To compare the sensitivity of PCR, wet preparation and culture in detecting Trichomonas vaginalis in urine and vaginal fluid. A PCR targeting the beta-tubulin genes of T. vaginalis was used for the detection of the organism in both vaginal swab and urine specimens from infected patients. Random urine samples were collected from 30 patients (23 females and 7 males), and tested for T. vaginalis by wet preparation and the Inpouch T. vaginalis culture systeme. Two vaginal swabs were collected by each woman. PCR detection. was carried out on samples negative by first methods. The positive result was found in 28.57% in male urine and 39.13% in female urine samples, 65.21% in 1st swab and 78.26 % in 2nd swab by wet preparation. By culture, the male urine samples showed 42.85% positive, female urine 69.56% while 1st swab showed 86.95% positive and 2nd swab 91.30% positive. All negative cases by culture in urine and vaginal samples were tested by PCR, which showed 2 cases to be positive in male urine samples and 5 cases positive in female urine sample. PCR assay was as good as or more sensitive than wet preparation and culture and resulted in practical advantage of providing results in shorter time. However, PCR test is still very expensive. (author)

  2. Evaluation of positive and false-positive results in syphilis screening of blood donors in Rio de Janeiro, Brazil.

    Science.gov (United States)

    Sandes, V S; Silva, S G C; Motta, I J F; Velarde, L G C; de Castilho, S R

    2017-06-01

    We propose to analyse the positive and false-positive results of treponemal and nontreponemal tests in blood donors from Brazil and to evaluate possible factors associated with the results of treponemal tests. Treponemal tests have been used widely for syphilis screening in blood banks. The introduction of these tests in donor screening has caused an impact and a loss of donors who need to be assessed. This was a retrospective cross-sectional study of syphilis screening and confirmatory test results of blood donors that were obtained before and after adopting a chemiluminescent immunoassay (CLIA). A comparative analysis was performed using a second sample drawn from positive donors. The possible factors associated with CLIA-positive or CLIA-false-positive results were investigated in a subgroup. Statistical tests were used to compare the proportions and adjusted estimates of association. The reactivity rate increased from 1·01% (N = 28 158) to 2·66% (N = 25 577) after introducing the new test. Among Venereal Disease Research Laboratory (VDRL)- and CLIA-confirmed results, the false-positive rates were 40·5% (N = 180) and 37·4% (N = 359), respectively (P = 0·5266). Older donors (OR = 1·04; P = 0·0010) and donors with lower education levels (OR = 6·59; P = 0·0029) were associated with a higher risk of positivity for syphilis. CLIA represents an improvement in blood bank serological screening. However, its use in a healthy population appears to result in high rates of false positives. Identifying which characteristics can predict false positives, however, remains a challenge. © 2017 British Blood Transfusion Society.

  3. Clinical applicability and prognostic significance of molecular response assessed by fluorescent-PCR of immunoglobulin genes in multiple myeloma. Results from a GEM/PETHEMA study.

    Science.gov (United States)

    Martinez-Lopez, Joaquin; Fernández-Redondo, Elena; García-Sánz, Ramón; Montalbán, María Angeles; Martínez-Sánchez, Pilar; Pavia, Bruno; Mateos, María Victoria; Rosiñol, Laura; Martín, Marisa; Ayala, Rosa; Martínez, Rafael; Blanchard, María Jesus; Alegre, Adrian; Besalduch, Joan; Bargay, Joan; Hernandez, Miguel T; Sarasquete, María Eugenia; Sanchez-Godoy, Pedro; Fernández, Manuela; Blade, Joan; San Miguel, Jesús F; Lahuerta, Juan Jose

    2013-12-01

    Minimal residual disease monitoring is becoming increasingly important in multiple myeloma (MM), but multiparameter flow cytometry (MFC) and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) techniques are not routinely available. This study investigated the prognostic influence of achieving molecular response assessed by fluorescent-PCR (F-PCR) in 130 newly diagnosed MM patients from Grupo Español Multidisciplinar de Melanoma (GEM)2000/GEM05 trials (NCT00560053, NCT00443235, NCT00464217) who achieved almost very good partial response after induction therapy. As a reference, we used the results observed with simultaneous MFC. F-PCR at diagnosis was performed on DNA using three different multiplex PCRs: IGH D-J, IGK V-J and KDE rearrangements. The applicability of F-PCR was 91·5%. After induction therapy, 64 patients achieved molecular response and 66 non-molecular response; median progression-free survival (PFS) was 61 versus 36 months, respectively (P = 0·001). Median overall survival (OS) was not reached (NR) in molecular response patients (5-year survival: 75%) versus 66 months in the non-molecular response group (P = 0·03). The corresponding PFS and OS values for patients with immunophenotypic versus non-immunophenotypic response were 67 versus 42 months (P = 0·005) and NR (5-year survival: 95%) versus 69 months (P = 0·004), respectively. F-PCR analysis is a rapid, affordable, and easily performable technique that, in some circumstances, may be a valid approach for minimal residual disease investigations in MM. © 2013 John Wiley & Sons Ltd.

  4. Green positive guidance and green positive life counseling for decent work and decent lives:Some empirical results

    Directory of Open Access Journals (Sweden)

    Annamaria eDi Fabio

    2016-03-01

    Full Text Available This article discusses green positive guidance and green positive life counseling for decent work and decent lives. From a green guidance perspective, the connectedness to nature construct is important both in terms of the meaning of work and life construction. The study discussed in this article analyzed the relationship between empathy and connectedness to nature, controlling for the effects of fluid intelligence and personality traits. In this connection, the Advanced Progressive Matrices (APM, the Big Five Questionnaire (BFQ, and the Interpersonal Reactivity Index (IRI were administered to 144 Italian high school students. The study revealed that connecteness to nature was not associated with fluid intelligence and was only moderately associated with personality traits. It was empathy that showed the highest association with connectedness to nature. The results open new opportunities for future research and interventions in green positive guidance/life counseling and green positive decent work.

  5. A rapid Q-PCR titration protocol for adenovirus and helper-dependent adenovirus vectors that produces biologically relevant results

    Science.gov (United States)

    Gallaher, Sean D.; Berk, Arnold J.

    2013-01-01

    Adenoviruses are employed in the study of cellular processes and as expression vectors used in gene therapy. The success and reproducibility of these studies is dependent in part on having accurate and meaningful titers of replication competent and helper-dependent adenovirus stocks, which is problematic due to the use of varied and divergent titration protocols. Physical titration methods, which quantify the total number of viral particles, are used by many, but are poor at estimating activity. Biological titration methods, such as plaque assays, are more biologically relevant, but are time consuming and not applicable to helper-dependent gene therapy vectors. To address this, a protocol was developed called “infectious genome titration” in which viral DNA is isolated from the nuclei of cells ~3 h post-infection, and then quantified by Q-PCR. This approach ensures that only biologically active virions are counted as part of the titer determination. This approach is rapid, robust, sensitive, reproducible, and applicable to all forms of adenovirus. Unlike other Q-PCR-based methods, titers determined by this protocol are well correlated with biological activity. PMID:23624118

  6. Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

    Science.gov (United States)

    Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

    2004-01-01

    A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner. PMID:15071047

  7. Nested PCR Assay for Detection of Leishmania donovani in Slit Aspirates from Post-Kala-Azar Dermal Leishmaniasis Lesions

    OpenAIRE

    Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam

    2004-01-01

    A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner.

  8. Occurrence of false positive results for the detection of carbapenemases in carbapenemase-negative Escherichia coli and Klebsiella pneumoniae isolates.

    Directory of Open Access Journals (Sweden)

    Peng Wang

    Full Text Available Adequate detection of the production of carbapenemase in Enterobacteriaceae isolates is crucial for infection control measures and the appropriate choice of antimicrobial therapy. In this study, we investigated the frequency of false positive results for the detection of carbapenemases in carbapenemase-negative Escherichia coli and Klebsiella pneumoniae clinical isolates by the modified Hodge test (MHT. Three hundred and one E. coli and K. pneumoniae clinical isolates were investigated. All produced extended spectrum β-lactamases (ESBLs but were susceptible to carbapenems. Antimicrobial susceptibility testing was performed by the disk diffusion and agar dilution methods. The MHT was performed using the standard inoculum of test organisms recommended by the CLSI. Genes that encoded ESBLs and carbapenemases were identified by PCR and DNA sequencing. Among the 301 clinical isolates, none of the isolates conformed to the criteria for carbapenemase screening recommended by the CLSI. The susceptibility rates for imipenem, meropenem, and ertapenem all were 100.0%, 100.0%, and 100.0%, respectively. Of the 301 E. coli and K. pneumoniae isolates, none produced carbapenemase. The MHT gave a positive result for 3.3% (10/301 of the isolates. False positive results can occur when the MHT is used to detect carbapenemase in ESBL-producing isolates and clinical laboratories must be aware of this fact.

  9. Evaluation of PCR for diagnosis of visceral leishmaniasis

    NARCIS (Netherlands)

    Osman, O. F.; Oskam, L.; Zijlstra, E. E.; Kroon, N. C.; Schoone, G. J.; Khalil, E. T.; El-Hassan, A. M.; Kager, P. A.

    1997-01-01

    An evaluation of Leishmania PCR was performed with bone marrow, lymph node, and blood samples from 492 patients, 60 positive controls, and 90 negative controls. Results were compared with microscopy results for Giemsa-stained smears. PCR and microscopy of lymph node and bone marrow aspirates from

  10. Accurate quantification of supercoiled DNA by digital PCR

    Science.gov (United States)

    Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul

    2016-01-01

    Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649

  11. When can real-time quantitative RT-PCR effectively define molecular relapse in acute promyelocytic leukemia patients? (Results of the French Belgian Swiss APL Group).

    Science.gov (United States)

    Cassinat, Bruno; de Botton, Stéphane; Kelaidi, Charikleia; Ades, Lionel; Zassadowski, Fabien; Guillemot, Isabelle; Schlageter, Marie-Helene; Raffoux, Emmanuel; Harousseau, Jean-Luc; Legrand, Olivier; Escoffre-Barbe, Martine; Reman, Oumedaly; Gardembas, Martine; Himberlin, Chantal; Cahn, Jean Yves; Guyotat, Denis; Bouscary, Didier; Parry, Anne; Rousselot, Philippe; Baruchel, Andre; Dombret, Hervé; Chevret, Sylvie; Fenaux, Pierre; Chomienne, Christine

    2009-09-01

    10-20% of APL patients relapse and the challenge remains to early identify these patients to improve survival rate. We report PML-RARalpha transcript detection by RQ-PCR in 260 consecutive APL patients (n = 970 samples). 223 patients with samples of sufficient RNA quality to demonstrate they reached molecular remission were monitored for MRD. During follow-up, 38 of these patients were tested positive for PML-RARalpha mRNA. 13 out of the 38 patients (34%) effectively developed hematological relapse. In the first positive sample, specific PML-RARalpha NCN thresholds over which, or under which, patients could effectively be predicted to relapse or not, were identified and subsequently validated in a second cohort.

  12. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis. Copyright © 2012 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  13. Normalization with Corresponding Naïve Tissue Minimizes Bias Caused by Commercial Reverse Transcription Kits on Quantitative Real-Time PCR Results.

    Directory of Open Access Journals (Sweden)

    Andreas Garcia-Bardon

    Full Text Available Real-time reverse transcription polymerase chain reaction (PCR is the gold standard for expression analysis. Designed to improve reproducibility and sensitivity, commercial kits are commonly used for the critical step of cDNA synthesis. The present study was designed to determine the impact of these kits. mRNA from mouse brains were pooled to create serial dilutions ranging from 0.0625 μg to 2 μg, which were transcribed into cDNA using four different commercial reverse-transcription kits. Next, we transcribed mRNA from brain tissue after acute brain injury and naïve mice into cDNA for qPCR. Depending on tested genes, some kits failed to show linear results in dilution series and revealed strong variations in cDNA yield. Absolute expression data in naïve and trauma settings varied substantially between these kits. Normalization with a housekeeping gene failed to reduce kit-dependent variations, whereas normalization eliminated differences when naïve samples from the same region were used. The study shows strong evidence that choice of commercial cDNA synthesis kit has a major impact on PCR results and, consequently, on comparability between studies. Additionally, it provides a solution to overcome this limitation by normalization with data from naïve samples. This simple step helps to compare mRNA expression data between different studies and groups.

  14. False-positive results in mammographic screening for breast cancer in Europe

    DEFF Research Database (Denmark)

    Hofvind, Solveig; Ponti, Antonio; Patnick, Julietta

    2012-01-01

    To estimate the cumulative risk of a false-positive screening result in European mammographic screening programmes, and examine the rates and procedures of further assessment.......To estimate the cumulative risk of a false-positive screening result in European mammographic screening programmes, and examine the rates and procedures of further assessment....

  15. Comparison of Nested-PCR technique and culture method in ...

    African Journals Online (AJOL)

    USER

    2010-04-05

    Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.

  16. Comparison of the Multiple-sample means with composite sample results for fecal indicator bacteria by quantitative PCR and culture

    Science.gov (United States)

    ABSTRACT: Few studies have addressed the efficacy of composite sampling for measurement of indicator bacteria by QPCR. In this study, composite results were compared to single sample results for culture- and QPCR-based water quality monitoring. Composite results for both methods ...

  17. Reproducibility of positive results for the detection of serum galactomannan by Platelia™ aspergillus EIA.

    Science.gov (United States)

    Pedroza, Kelly C M C; de Matos, Sócrates B; de Moura, Daniel L; Oliveira, Mônica B B; Araújo, Marco A S; Nascimento, Roberto J M; Lima, Fernanda W M

    2013-10-01

    Galactomannan (GM) was recently included in consensus guidelines as an indirect mycological criterion for the diagnosis of invasive aspergillosis. Currently, there is an enzyme immunoassay available to detect GM in biological samples, the Platelia™ Aspergillus EIA. In this study, the reproducibility of positive results obtained using this assay was evaluated using serum samples from neutropenic patients. A trend toward lower values was observed, and 55 %(27/49) of positive results were negative after retesting. A low reproducibility of positive results for the detection of GM in serum was observed.

  18. Are Positive Illusions about Academic Competence always Adaptive, under All Circumstances: New Results and Future Directions

    Science.gov (United States)

    Butler, Ruth

    2011-01-01

    The papers in this special issue provide a comprehensive examination of the prevalence and implications of positive biases in perceived academic competence at different ages in different countries. Main results showed that marked positive biases were rare, were associated with performance goals, were more adaptive than negative biases, but were…

  19. Risk of breast cancer after false-positive results in mammographic screening

    DEFF Research Database (Denmark)

    Roman, Marta; Castells, Xavier; Hofvind, Solveig

    2016-01-01

    risk (RR) of screen-detected cancer for women with false-positive versus negative results. We analyzed information from 1,935,093 women 50–69 years who underwent 6,094,515 screening exams. During an average 5.8 years of follow-up, 230,609 (11.9%) women received a false-positive result and 27,849 (1......Women with false-positive results are commonly referred back to routine screening. Questions remain regarding their long-term outcome of breast cancer. We assessed the risk of screen-detected breast cancer in women with false-positive results. We conducted a joint analysis using individual level.......4%) were diagnosed with screen-detected cancer. The adjusted RR of screen-detected cancer after a false-positive result was 2.01 (95% CI: 1.93–2.09). Women who tested false-positive at first screen had a RR of 1.86 (95% CI: 1.77–1.96), whereas those who tested false-positive at third screening had a RR...

  20. Psychological effects of false-positive results in expanded newborn screening in China.

    Directory of Open Access Journals (Sweden)

    Wen-Jun Tu

    Full Text Available OBJECTIVES: As more families participate expanded newborn screening for metabolic disorders in China, the overall number of false positives increases. Our goal was to assess the potential impact on parental stress, perceptions of the child's health, and family relationships. METHODS: Parents of 49 infants with false-positive screening results for metabolic disorders in the expanded newborn screening panel were compared with parents of 42 children with normal screening results. Parents first completed structured interview using likert scales, closed and open questions. Parents also completed the parenting stress index. RESULTS: A total of 88 mothers and 41 fathers were interviewed. More mothers in the false-positive group reported that their children required extra parental care (21%, compared with 5% of mothers in the normal-screened group (P<0.001. 39% of mothers in the false-positive group reported that they worry about their child's future development, compared with 10% of mothers in the normal-screened group (P<0.001. Fathers in the false-positive group did not differ from fathers in the normal-screened group in reporting worry about their child's extra care requirements, and their child's future development. Children with false-positive results compared with children with normal results were triple as likely to experience hospitalization (27%vs 9%, respectively; P<0.001. CONCLUSIONS: The results showing false-positive screening results may affect parental stress and the parent-child relationship. Parental stress and anxiety can be reduced with improved education and communication to parents about false-positive results.

  1. Methods used by accredited dental specialty programs to advertise faculty positions: results of a national survey.

    Science.gov (United States)

    Ballard, Richard W; Hagan, Joseph L; Armbruster, Paul C; Gallo, John R

    2011-01-01

    The various reasons for the current and projected shortages of dental faculty members in the United States have received much attention. Dental school deans have reported that the top three factors impacting their ability to fill faculty positions are meeting the requirements of the position, lack of response to position announcement, and salary/budget limitations. An electronic survey sent to program directors of specialty programs at all accredited U.S. dental schools inquired about the number of vacant positions, advertised vacant positions, reasons for not advertising, selection of advertising medium, results of advertising, and assistance from professional dental organizations. A total of seventy-three permanently funded full-time faculty positions were reported vacant, with 89.0 percent of these positions having been advertised in nationally recognized professional journals and newsletters. Networking or word-of-mouth was reported as the most successful method for advertising. The majority of those responding reported that professional dental organizations did not help with filling vacant faculty positions, but that they would utilize the American Dental Association's website or their specialty organization's website to post faculty positions if they were easy to use and update.

  2. Risk of breast cancer after false-positive results in mammographic screening.

    Science.gov (United States)

    Román, Marta; Castells, Xavier; Hofvind, Solveig; von Euler-Chelpin, My

    2016-06-01

    Women with false-positive results are commonly referred back to routine screening. Questions remain regarding their long-term outcome of breast cancer. We assessed the risk of screen-detected breast cancer in women with false-positive results. We conducted a joint analysis using individual level data from the population-based screening programs in Copenhagen and Funen in Denmark, Norway, and Spain. Overall, 150,383 screened women from Denmark (1991-2008), 612,138 from Norway (1996-2010), and 1,172,572 from Spain (1990-2006) were included. Poisson regression was used to estimate the relative risk (RR) of screen-detected cancer for women with false-positive versus negative results. We analyzed information from 1,935,093 women 50-69 years who underwent 6,094,515 screening exams. During an average 5.8 years of follow-up, 230,609 (11.9%) women received a false-positive result and 27,849 (1.4%) were diagnosed with screen-detected cancer. The adjusted RR of screen-detected cancer after a false-positive result was 2.01 (95% CI: 1.93-2.09). Women who tested false-positive at first screen had a RR of 1.86 (95% CI: 1.77-1.96), whereas those who tested false-positive at third screening had a RR of 2.42 (95% CI: 2.21-2.64). The RR of breast cancer at the screening test after the false-positive result was 3.95 (95% CI: 3.71-4.21), whereas it decreased to 1.25 (95% CI: 1.17-1.34) three or more screens after the false-positive result. Women with false-positive results had a twofold risk of screen-detected breast cancer compared to women with negative tests. The risk remained significantly higher three or more screens after the false-positive result. The increased risk should be considered when discussing stratified screening strategies. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  3. Hemorrhoids detected at colonoscopy: an infrequent cause of false-positive fecal immunochemical test results.

    NARCIS (Netherlands)

    Turenhout, S.T. van; Oort, F.A.; Terhaar sive Droste, J.S.; Coupe, V.M.; Hulst, R.W. van der; Loffeld, R.J.; Scholten, P.; Depla, A.C.; Bouman, A.A.; Meijer, G.A.; Mulder, C.J.; Rossum, L.G.M. van

    2012-01-01

    BACKGROUND: Colorectal cancer screening by fecal immunochemical tests (FITs) is hampered by frequent false-positive (FP) results and thereby the risk of complications and strain on colonoscopy capacity. Hemorrhoids might be a plausible cause of FP results. OBJECTIVE: To determine the contribution of

  4. 'False-positive' and 'false-negative' test results in clinical urine drug testing.

    Science.gov (United States)

    Reisfield, Gary M; Goldberger, Bruce A; Bertholf, Roger L

    2009-08-01

    The terms 'false-positive' and 'false-negative' are widely used in discussions of urine drug test (UDT) results. These terms are inadequate because they are used in different ways by physicians and laboratory professionals and they are too narrow to encompass the larger universe of potentially misleading, inappropriate and unexpected drug test results. This larger universe, while not solely comprised of technically 'true' or 'false' positive or negative test results, presents comparable interpretive challenges with corresponding clinical implications. In this review, we propose the terms 'potentially inappropriate' positive or negative test results in reference to UDT results that are ambiguous or unexpected and subject to misinterpretation. Causes of potentially inappropriate positive UDT results include in vivo metabolic conversions of a drug, exposure to nonillicit sources of a drug and laboratory error. Causes of potentially inappropriate negative UDT results include limited assay specificity, absence of drug in the urine, presence of drug in the urine, but below established assay cutoff, specimen manipulation and laboratory error. Clinical UDT interpretation is a complicated task requiring knowledge of recent prescription, over-the-counter and herbal drug administration, drug metabolism and analytical sensitivities and specificities.

  5. Preliminary Results on Setup Precision of Prone-Lateral Patient Positioning for Whole Breast Irradiation

    International Nuclear Information System (INIS)

    Veldeman, Liv; Speleers, Bruno; Bakker, Marlies; Jacobs, Filip; Coghe, Marc; De Gersem, Werner; Impens, Aline; Nechelput, Sarah; De Wagter, Carlos

    2010-01-01

    Purpose: The aim of this study was to develop a rapid and reproducible technique for prone positioning and to compare dose-volume indices in prone and supine positions. Methods and Materials: Eighteen patients underwent computed tomography imaging for radiotherapy planning in prone and supine position. Experience was gained in the first eight patients, which lead to modifications of the Horizon prone breast board (Civco Medical Solutions, Orange City, Iowa, USA) and the patient setup technique. A unilateral breast holder (U-BH) was developed (Van de Velde, Schellebelle, Belgium) to retract the contralateral breast away from the treated breast. The technique was then applied to an additional 10 patients. The setup precision was evaluated using daily cone-beam CT. Results: Modifications to the breast board were made to secure a prone-lateral rather then a pure prone position. We evolved from a classical setup using laser marks on the patients' body to a direct breast setup using marks on the breast only. The setup precision of the direct positioning procedure with the modified breast board and the U-BH is comparable to supine setup data in the literature. Dose-volume indices for heart and lung show significantly better results for prone than for supine position, and dose homogeneity within the treated breast did not differ according to the treatment position. Conclusions: The setup precision of our prone-lateral positioning technique is comparable to supine data in literature. Our data show the advantage of prone radiotherapy to spare the lung and heart. Further research is necessary to reduce the duration of prone setup.

  6. Clinical Assessment of a Nocardia PCR-Based Assay for Diagnosis of Nocardiosis.

    Science.gov (United States)

    Rouzaud, Claire; Rodriguez-Nava, Véronica; Catherinot, Emilie; Méchaï, Frédéric; Bergeron, Emmanuelle; Farfour, Eric; Scemla, Anne; Poirée, Sylvain; Delavaud, Christophe; Mathieu, Daniel; Durupt, Stéphane; Larosa, Fabrice; Lengelé, Jean-Philippe; Christophe, Jean-Louis; Suarez, Felipe; Lortholary, Olivier; Lebeaux, David

    2018-06-01

    The diagnosis of nocardiosis, a severe opportunistic infection, is challenging. We assessed the specificity and sensitivity of a 16S rRNA Nocardia PCR-based assay performed on clinical samples. In this multicenter study (January 2014 to April 2015), patients who were admitted to three hospitals and had an underlying condition favoring nocardiosis, clinical and radiological signs consistent with nocardiosis, and a Nocardia PCR assay result for a clinical sample were included. Patients were classified as negative control (NC) (negative Nocardia culture results and proven alternative diagnosis or improvement at 6 months without anti- Nocardia treatment), positive control (PC) (positive Nocardia culture results), or probable nocardiosis (positive Nocardia PCR results, negative Nocardia culture results, and no alternative diagnosis). Sixty-eight patients were included; 47 were classified as NC, 8 as PC, and 13 as probable nocardiosis. PCR results were negative for 35/47 NC patients (74%). For the 12 NC patients with positive PCR results, the PCR assay had been performed with respiratory samples. These NC patients had chronic bronchopulmonary disease more frequently than did the NC patients with negative PCR results (8/12 patients [67%] versus 11/35 patients [31%]; P = 0.044). PCR results were positive for 7/8 PC patients (88%). There were 13 cases of probable nocardiosis, diagnosed solely using the PCR results; 9 of those patients (69%) had lung involvement (consolidation or nodule). Nocardia PCR testing had a specificity of 74% and a sensitivity of 88% for the diagnosis of nocardiosis. Nocardia PCR testing may be helpful for the diagnosis of nocardiosis in immunocompromised patients but interpretation of PCR results from respiratory samples is difficult, because the PCR assay may also detect colonization. Copyright © 2018 American Society for Microbiology.

  7. Extending positive CLASS results across multiple instructors and multiple classes of Modeling Instruction

    Science.gov (United States)

    Brewe, Eric; Traxler, Adrienne; de la Garza, Jorge; Kramer, Laird H.

    2013-12-01

    We report on a multiyear study of student attitudes measured with the Colorado Learning Attitudes about Science Survey in calculus-based introductory physics taught with the Modeling Instruction curriculum. We find that five of six instructors and eight of nine sections using Modeling Instruction showed significantly improved attitudes from pre- to postcourse. Cohen’s d effect sizes range from 0.08 to 0.95 for individual instructors. The average effect was d=0.45, with a 95% confidence interval of (0.26-0.64). These results build on previously published results showing positive shifts in attitudes from Modeling Instruction classes. We interpret these data in light of other published positive attitudinal shifts and explore mechanistic explanations for similarities and differences with other published positive shifts.

  8. Extending positive CLASS results across multiple instructors and multiple classes of Modeling Instruction

    Directory of Open Access Journals (Sweden)

    Eric Brewe

    2013-10-01

    Full Text Available We report on a multiyear study of student attitudes measured with the Colorado Learning Attitudes about Science Survey in calculus-based introductory physics taught with the Modeling Instruction curriculum. We find that five of six instructors and eight of nine sections using Modeling Instruction showed significantly improved attitudes from pre- to postcourse. Cohen’s d effect sizes range from 0.08 to 0.95 for individual instructors. The average effect was d=0.45, with a 95% confidence interval of (0.26–0.64. These results build on previously published results showing positive shifts in attitudes from Modeling Instruction classes. We interpret these data in light of other published positive attitudinal shifts and explore mechanistic explanations for similarities and differences with other published positive shifts.

  9. False-positive buprenorphine EIA urine toxicology results due to high dose morphine: a case report.

    Science.gov (United States)

    Tenore, Peter L

    2012-01-01

    In monitoring a patient with chronic pain who was taking high-dose morphine and oxycodone with weekly urine enzymatic immunoassay (EIA) toxicology testing, the authors noted consistent positives for buprenorphine. The patient was not taking buprenorphine, and gas chromatography/mass spectroscopy (GCMS) testing on multiple samples revealed no buprenorphine, indicating a case of false-positive buprenorphine EIAs in a high-dose opiate case. The authors discontinued oxycodone for a period of time and then discontinued morphine. Urine monitoring with EIAs and GCMS revealed false-positive buprenorphine EIAs, which remained only when the patient was taking morphine. When taking only oxycodone and no morphine, urine samples became buprenorphine negative. When morphine was reintroduced, false-positive buprenorphine results resumed. Medical practitioners should be aware that high-dose morphine (with morphine urine levels turning positive within the 15,000 to 28,000 mg/mL range) may produce false-positive buprenorphine EIAs with standard urine EIA toxicology testing.

  10. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  11. Group B Streptococcus Positive Culture’s Results in Pregnants with Preterm Premature Rupture of Membranes

    Directory of Open Access Journals (Sweden)

    Farzaneh Broomand

    2008-09-01

    Full Text Available Objective: Preterm premature rupture of membranes (PPROM occurs in 2% of all pregnancies. The aim of this study was to compare positive cultures of GBS in two groups of pregnant women.Materials and methods: This case control research was conducted on 242 pregnant women: first group was consisted of 117 pregnant with PPROM and gestational ages between 26-37 weeks; second group was consisted of 125 term pregnant women with intact membranes and before onset of labor. Rectovaginal and urine samples were studied using specific culture medium of GBS, "Todd Hewitt Broth". The percentage of positive results was calculated using odds ratio and chi-square test.Results: GBS cultures were positive in 20 cases (17% in PPROM group and 5 cases in group of term pregnant (4% (Odds ratio=4.95 CI= 1.79-13.67, p=0.001. Past history of preterm labor and neonate hospitalization were more common in PPROM group but without any significant relationship to positive cultures.Conclusion: Our study showed significant difference of GBS colonization rate between two groups (p=0.001. According to CDC and ACOG guidelines routine screening and treatment of positive cases are indicated.

  12. Are Hemorrhoids Associated with False-Positive Fecal Immunochemical Test Results?

    Science.gov (United States)

    Kim, Nam Hee; Park, Jung Ho; Park, Dong Il; Sohn, Chong Il; Choi, Kyuyong; Jung, Yoon Suk

    2017-01-01

    False-positive (FP) results of fecal immunochemical tests (FITs) conducted in colorectal cancer (CRC) screening could lead to performing unnecessary colonoscopies. Hemorrhoids are a possible cause of FP FIT results; however, studies on this topic are extremely rare. We investigated whether hemorrhoids are associated with FP FIT results. A retrospective study was conducted at a university hospital in Korea from June 2013 to May 2015. Of the 34547 individuals who underwent FITs, 3946 aged ≥50 years who underwent colonoscopies were analyzed. Logistic regression analysis was performed to determine factors associated with FP FIT results. Among 3946 participants, 704 (17.8%) showed positive FIT results and 1303 (33.0%) had hemorrhoids. Of the 704 participants with positive FIT results, 165 had advanced colorectal neoplasia (ACRN) and 539 had no ACRN (FP results). Of the 1303 participants with hemorrhoids, 291 showed FP results, of whom 81 showed FP results because of hemorrhoids only. Participants with hemorrhoids had a higher rate of FP results than those without hemorrhoids (291/1176, 24.7% vs. 248/2361, 10.5%; phemorrhoids as the only abnormality had a higher rate of FP results than those experiencing no such abnormalities (81/531, 15.3% vs. 38/1173, 3.2%; phemorrhoids was identified as an independent predictor of FP results (adjusted odds ratio, 2.76; 95% confidence interval, 2.24-3.40; pHemorrhoids are significantly associated with FP FIT results. Their presence seemed to be a non-negligible contributor of FP results in FIT-based CRC screening programs.

  13. Results from multipoint alignment monitoring using the new generation of amorphous silicon position detectors

    Energy Technology Data Exchange (ETDEWEB)

    Alberdi, J.; Arce, P.; Barcala, J.M.; Calvo, E. [CIEMAT, 28040 Madrid (Spain); Ferrando, A. [CIEMAT, 28040 Madrid (Spain)], E-mail: antonio.ferrando@ciemat.es; Josa, M.I.; Molinero, A.; Navarrete, J.; Oller, J.C.; Yuste, C. [CIEMAT, 28040 Madrid (Spain); Calderon, A.; Gomez, G.; Gonzalez-Sanchez, F.J.; Martinez-Rivero, C.; Matorras, F.; Rodrigo, T.; Ruiz-Arbol, P.; Sobron, M.; Vila, I.; Virto, A.L. [Instituto de Fisica de Cantabria (IFCA), CSIC-University of Cantabria Santander (Spain)] (and others)

    2008-08-11

    We present the measured performance of a new generation of large sensitive area (28x28 mm{sup 2}) semitransparent amorphous silicon position detector sensors. More than 100 units have been characterized. They show a very high performance. To illustrate a multipoint application, we present results from the monitoring of five sensors placed in a 5.5-m-long light path.

  14. Results from multipoint alignment monitoring using the new generation of amorphous silicon position detectors

    International Nuclear Information System (INIS)

    Alberdi, J.; Arce, P.; Barcala, J.M.; Calvo, E.; Ferrando, A.; Josa, M.I.; Molinero, A.; Navarrete, J.; Oller, J.C.; Yuste, C.; Calderon, A.; Gomez, G.; Gonzalez-Sanchez, F.J.; Martinez-Rivero, C.; Matorras, F.; Rodrigo, T.; Ruiz-Arbol, P.; Sobron, M.; Vila, I.; Virto, A.L.

    2008-01-01

    We present the measured performance of a new generation of large sensitive area (28x28 mm 2 ) semitransparent amorphous silicon position detector sensors. More than 100 units have been characterized. They show a very high performance. To illustrate a multipoint application, we present results from the monitoring of five sensors placed in a 5.5-m-long light path

  15. Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.

    Science.gov (United States)

    Doyle, Laura; Vogel, Sherilynn; Procop, Gary W

    2017-01-01

    The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.

  16. Rapid differentiation of Staphylococcus aureus, Staphylococcus epidermidis and other coagulase-negative staphylococci and meticillin susceptibility testing directly from growth-positive blood cultures by multiplex real-time PCR.

    Science.gov (United States)

    Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich

    2010-12-01

    This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.

  17. [Clinical manifestation of Lyme borreliosis in children with positive and negatiwe western blot results].

    Science.gov (United States)

    Ołdak, Elzbieta; Rozkiewicz, Doroto; Sulik, Artur

    2008-01-01

    In the afforested area of North-Eastern Poland the risk of Borrelia burgdorferi infection seems to be higher compared to the other regions. Because of unspecific clinical manifestation of Lyme borreliosis in children the positive ELISA IgM results should be confirmed with Western blot IgM tests. Retrospective analysis of clinical signs and symptoms of Lyme borreliosis in children with positive ELISA IgM and positive Western blot IgM results and in children with positive ELISA IgM and negative Western blot IgM results. The study included 20 children reactive with ELISA IgM (Bellco Biomedica, Austria), hospitalized in Pediatric Infectious Diseases Clinic in 2007 due to probable diagnosis of Lyme disease. All children were tested with B. burgdorferi Western blot IgM and/or IgG assay (DRG, Diagnostics, Germany) as a second-step diagnosis. In 10 (50% females, 50% males) out of 20 children the results were positive (borreliosis) and in other 10 (80% females, 20% males) the results were negative (controls). In both groups of patients the retrospective analysis of signs and symptoms was done. The most often clinical manifestation of Lyme borreliosis in children was neuroborreliosis. Children presented Lyme meningitis (30%), facial nerve palsy (10%) and chronic or recurrent headaches (40%), associated with vertigo (20%), weakness (30%), fever (40%), and fatigue syndrome (30%). One patient presented Lyme arthritis. Children of control group presented with unspecific symptoms like isolated headaches (40%), arthralgias (70%), myalgias (10%) and abdomen pain (20%) (1) The most frequent clinical presentation of Lyme borreliosis in analyzed children was neuroborreliosis; (2) Isolated arthralgias in children reactive with B. burgdorferi ELISA IgM need to be confirmed with Western blot assay before implementing the antibiotic therapy.

  18. Positive Result by Serology Indicates Active Helicobacter pylori Infection in Patients with Atrophic Gastritis

    OpenAIRE

    Kokkola, Arto; Rautelin, Hilpi; Puolakkainen, Pauli; Sipponen, Pentti; Färkkilä, Martti; Haapiainen, Reijo; Kosunen, Timo U.

    1998-01-01

    Patients with atrophic corpus gastritis and elevated Helicobacter pylori antibody titers but 13C-urea breath test (13C-UBT) and histology results negative for H. pylori were randomized into eradication therapy or follow-up only. Antibody levels decreased significantly in six out of seven patients in the eradication group, while in the follow-up group, the titers declined in only one out of eight patients. In patients with atrophic corpus gastritis, positive serology results may indicate an on...

  19. The First Result of Relative Positioning and Velocity Estimation Based on CAPS

    Science.gov (United States)

    Zhao, Jiaojiao; Ge, Jian; Wang, Liang; Wang, Ningbo; Zhou, Kai; Yuan, Hong

    2018-01-01

    The Chinese Area Positioning System (CAPS) is a new positioning system developed by the Chinese Academy of Sciences based on the communication satellites in geosynchronous orbit. The CAPS has been regarded as a pilot system to test the new technology for the design, construction and update of the BeiDou Navigation Satellite System (BDS). The system structure of CAPS, including the space, ground control station and user segments, is almost like the traditional Global Navigation Satellite Systems (GNSSs), but with the clock on the ground, the navigation signal in C waveband, and different principles of operation. The major difference is that the CAPS navigation signal is first generated at the ground control station, before being transmitted to the satellite in orbit and finally forwarded by the communication satellite transponder to the user. This design moves the clock from the satellite in orbit to the ground. The clock error can therefore be easily controlled and mitigated to improve the positioning accuracy. This paper will present the performance of CAPS-based relative positioning and velocity estimation as assessed in Beijing, China. The numerical results show that, (1) the accuracies of relative positioning, using only code measurements, are 1.25 and 1.8 m in the horizontal and vertical components, respectively; (2) meanwhile, they are about 2.83 and 3.15 cm in static mode and 6.31 and 10.78 cm in kinematic mode, respectively, when using the carrier-phase measurements with ambiguities fixed; and (3) the accuracy of the velocity estimation is about 0.04 and 0.11 m/s in static and kinematic modes, respectively. These results indicate the potential application of CAPS for high-precision positioning and velocity estimation and the availability of a new navigation mode based on communication satellites. PMID:29757204

  20. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  1. Multiplex enrichment quantitative PCR (ME-qPCR): a high-throughput, highly sensitive detection method for GMO identification.

    Science.gov (United States)

    Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang

    2017-04-01

    Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for

  2. Way forward in case of a false positive in vitro genotoxicity result for a cosmetic substance?

    Science.gov (United States)

    Doktorova, Tatyana Y; Ates, Gamze; Vinken, Mathieu; Vanhaecke, Tamara; Rogiers, Vera

    2014-02-01

    The currently used regulatory in vitro mutagenicity/genotoxicity test battery has a high sensitivity for detecting genotoxicants, but it suffers from a large number of irrelevant positive results (i.e. low specificity) thereby imposing the need for additional follow-up by in vitro and/or in vivo genotoxicity tests. This could have a major impact on the cosmetic industry in Europe, seen the imposed animal testing and marketing bans on cosmetics and their ingredients. Afflicted, but safe substances could therefore be lost. Using the example of triclosan, a cosmetic preservative, we describe here the potential applicability of a human toxicogenomics-based in vitro assay as a potential mechanistically based follow-up test for positive in vitro genotoxicity results. Triclosan shows a positive in vitro chromosomal aberration test, but is negative during in vivo follow-up tests. Toxicogenomics analysis unequivocally shows that triclosan is identified as a compound acting through non-DNA reactive mechanisms. This proof-of-principle study illustrates the potential of genome-wide transcriptomics data in combination with in vitro experimentation as a possible weight-of-evidence follow-up approach for de-risking a positive outcome in a standard mutagenicity/genotoxicity battery. As such a substantial number of cosmetic compounds wrongly identified as genotoxicants could be saved for the future. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Reporting of Positive Results in Randomized Controlled Trials of Mindfulness-Based Mental Health Interventions.

    Directory of Open Access Journals (Sweden)

    Stephanie Coronado-Montoya

    Full Text Available A large proportion of mindfulness-based therapy trials report statistically significant results, even in the context of very low statistical power. The objective of the present study was to characterize the reporting of "positive" results in randomized controlled trials of mindfulness-based therapy. We also assessed mindfulness-based therapy trial registrations for indications of possible reporting bias and reviewed recent systematic reviews and meta-analyses to determine whether reporting biases were identified.CINAHL, Cochrane CENTRAL, EMBASE, ISI, MEDLINE, PsycInfo, and SCOPUS databases were searched for randomized controlled trials of mindfulness-based therapy. The number of positive trials was described and compared to the number that might be expected if mindfulness-based therapy were similarly effective compared to individual therapy for depression. Trial registries were searched for mindfulness-based therapy registrations. CINAHL, Cochrane CENTRAL, EMBASE, ISI, MEDLINE, PsycInfo, and SCOPUS were also searched for mindfulness-based therapy systematic reviews and meta-analyses.108 (87% of 124 published trials reported ≥1 positive outcome in the abstract, and 109 (88% concluded that mindfulness-based therapy was effective, 1.6 times greater than the expected number of positive trials based on effect size d = 0.55 (expected number positive trials = 65.7. Of 21 trial registrations, 13 (62% remained unpublished 30 months post-trial completion. No trial registrations adequately specified a single primary outcome measure with time of assessment. None of 36 systematic reviews and meta-analyses concluded that effect estimates were overestimated due to reporting biases.The proportion of mindfulness-based therapy trials with statistically significant results may overstate what would occur in practice.

  4. [Molecular tests in diagnosis of Cytomegalovirus (CMV), human herpesvirus 6 (HHV-6) and Epstein-Barr virus (EBV) using real-time PCR in HIV positive and HIV-negative pregnant women in Ouagadougou, Burkina Faso].

    Science.gov (United States)

    Ouedraogo, Alice Rogomenoma; Kabre, Madeleine; Bisseye, Cyrille; Zohoncon, Théodora Mahoukèdè; Asshi, Maleki; Soubeiga, Serge Théophile; Diarra, Birama; Traore, Lassina; Djigma, Florencia Wendkuuni; Ouermi, Djénéba; Pietra, Virginio; Barro, Nicolas; Simpore, Jacques

    2016-01-01

    Herpesvirus EBV, CMV and HHV-6 are viruses that evolve based on pandemic modeling and are responsible for congenital infections causing severe sequelae in infants. This study aims to determine the prevalence of CMV, EBV and HHV-6 among HIV (+) and HIV (-) pregnant women in Ouagadougou. In this study 200 blood plasma samples taken from pregnant women, of whom 100 with HIV(+) and 100 with HIV(-), were analyzed using multiplex real-time PCR which detected three infections (EBV, CMV and HHV-6). Out of the 200 samples tested, 18(9.0%) were positive for at least one of the three viruses, 12(6.0%) were positive for EBV, 13(6.5%) were positive for CMV and 12(6.0%) were positive for HHV-6. Among the 18 cases with infections, 10 cases (55.6%) had co-infections of whom 90.0% (9/10) with multiple EBV/CMV/HHV6 infection and 10.0% with EBV/HHV6 co-infection. HHVs infection rate was higher among HIV (-) pregnant women than among HIV (+) pregnant women (12.0% versus 6.0%). Among HIV (+) pregnant women, PCR showed 7.1% (6/85) of HHVs infection in patients who were not treated with ARV against 0% in those treated with ARVs. Herpes virus infections are a common condition in pregnant women in Burkina Faso. They may represent a real threat to pregnant women because of complications and risks of infection in infants.

  5. Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams

    Directory of Open Access Journals (Sweden)

    L.F. Costa

    2013-02-01

    Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.

  6. Buffer substitution in malaria rapid diagnostic tests causes false-positive results

    Directory of Open Access Journals (Sweden)

    Van den Ende Jef

    2010-07-01

    Full Text Available Abstract Background Malaria rapid diagnostic tests (RDTs are kits that generally include 20 to 25 test strips or cassettes, but only a single buffer vial. In field settings, laboratory staff occasionally uses saline, distilled water (liquids for parenteral drugs dilution or tap water as substitutes for the RDT kit's buffer to compensate for the loss of a diluent bottle. The present study assessed the effect of buffer substitution on the RDT results. Methods Twenty-seven RDT brands were run with EDTA-blood samples of five malaria-free subjects, who were negative for rheumatoid factor and antinuclear antibodies. Saline, distilled water and tap water were used as substitute liquids. RDTs were also run with distilled water, without adding blood. Results were compared to those obtained with the RDT kit's buffer and Plasmodium positive samples. Results Only eight cassettes (in four RDT brands showed no control line and were considered invalid. Visible test lines occurred for at least one malaria-free sample and one of the substitutes in 20/27 (74% RDT brands (saline: n = 16; distilled water: n = 17; and tap water: n = 20, and in 15 RDTs which were run with distilled water only. They occurred for all Plasmodium antigens and RDT formats (two-, three- and four-band RDTs. Clearance of the background of the strip was excellent except for saline. The aspects (colour, intensity and crispness of the control and the false-positive test lines were similar to those obtained with the RDT kits' buffer and Plasmodium positive samples. Conclusion Replacement of the RDT kit's dedicated buffer by saline, distilled water and tap water can cause false-positive test results.

  7. Scientific citations favor positive results: a systematic review and meta-analysis.

    Science.gov (United States)

    Duyx, Bram; Urlings, Miriam J E; Swaen, Gerard M H; Bouter, Lex M; Zeegers, Maurice P

    2017-08-01

    Citation bias concerns the selective citation of scientific articles based on their results. We brought together all available evidence on citation bias across scientific disciplines and quantified its impact. An extensive search strategy was applied to the Web of Science Core Collection and Medline, yielding 52 studies in total. We classified these studies on scientific discipline, selection method, and other variables. We also performed random-effects meta-analyses to pool the effect of positive vs. negative results on subsequent citations. Finally, we checked for other determinants of citation as reported in the citation bias literature. Evidence for the occurrence of citation bias was most prominent in the biomedical sciences and least in the natural sciences. Articles with statistically significant results were cited 1.6 (95% confidence interval [CI] 1.3-1.8) times more often than articles with nonsignificant results. Articles in which the authors explicitly conclude to have found support for their hypothesis were cited 2.7 (CI 2.0-3.7) times as often. Article results and journal impact factor were associated with citation more often than any other reported determinant. Similar to what we already know on publication bias, also citation bias can lead to an overrepresentation of positive results and unfounded beliefs. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. PCR em tempo real para diagnóstico da leucose enzoótica bovina Enzootic bovine leukosis real time PCR

    Directory of Open Access Journals (Sweden)

    Natanael Lamas Dias

    2012-08-01

    cases. The qPCR presented high specificity and sensitivity values. The observed qPCR negative and positive predictive values show that the qPCR has a high capacity to correctly classify positive and negative results. The qPCR was not able to detect three positive animals and has a lightly higher cost than the nPCR. However, the qPCR its faster, less prone to contamination, has a high sensitivity and does not use or generate carcinogenic residues. We conclude that the qPCR may be used to replace the OIE nPCR technique in routine diagnosis in areas where EBL is endemic, as is the case of Brazil.

  9. First results from Position-Sensitive quantum calorimeters using Mo/Au Transition-Edge Sensors

    International Nuclear Information System (INIS)

    Figueroa-Feliciano, Enectali; Chervenak, Jay; Finkbeiner, Fred M.; Li, Mary; Lindeman, Mark A.; Stahle, Caroline K.; Stahle, Carl M.

    2002-01-01

    We report the first results from a high-energy-resolution imaging spectrometer called a Position-Sensitive Transition-Edge Sensor (PoST). A PoST is a quantum calorimeter consisting of two Transition Edge Sensors (TESs) on the ends of a long absorber to do one dimensional imaging spectroscopy. Comparing rise time and energy information, the position of the event in the PoST is determined. Energy is inferred from the sum of the two pulses. We have fabricated 7- and 15-pixel PoSTs using Mo-Au TESs and Au absorbers. We have achieved 32 eV FWHM energy resolution at 1.5 keV with a 7-pixel PoST calorimeter

  10. MULTIPLEX SYBR® GREEN-REAL TIME PCR (qPCR ASSAY FOR THE DETECTION AND DIFFERENTIATION OF Bartonella henselae AND Bartonella clarridgeiae IN CATS

    Directory of Open Access Journals (Sweden)

    Rodrigo Staggemeier

    2014-04-01

    Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.

  11. Quantitative (real-time) PCR

    International Nuclear Information System (INIS)

    Denman, S.E.; McSweeney, C.S.

    2005-01-01

    Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later

  12. Expert Knowledge Influences Decision-Making for Couples Receiving Positive Prenatal Chromosomal Microarray Testing Results.

    Science.gov (United States)

    Rubel, M A; Werner-Lin, A; Barg, F K; Bernhardt, B A

    2017-09-01

    To assess how participants receiving abnormal prenatal genetic testing results seek information and understand the implications of results, 27 US female patients and 12 of their male partners receiving positive prenatal microarray testing results completed semi-structured phone interviews. These interviews documented participant experiences with chromosomal microarray testing, understanding of and emotional response to receiving results, factors affecting decision-making about testing and pregnancy termination, and psychosocial needs throughout the testing process. Interview data were analyzed using a modified grounded theory approach. In the absence of certainty about the implications of results, understanding of results is shaped by biomedical expert knowledge (BEK) and cultural expert knowledge (CEK). When there is a dearth of BEK, as in the case of receiving results of uncertain significance, participants rely on CEK, including religious/spiritual beliefs, "gut instinct," embodied knowledge, and social network informants. CEK is a powerful platform to guide understanding of prenatal genetic testing results. The utility of culturally situated expert knowledge during testing uncertainty emphasizes that decision-making occurs within discourses beyond the biomedical domain. These forms of "knowing" may be integrated into clinical consideration of efficacious patient assessment and counseling.

  13. Results of neutron measurements in the spectral position of the Juelich FKS steel irradiation capsules

    International Nuclear Information System (INIS)

    Schneider, W.

    1986-10-01

    This is a report on the planning and results of neutron monitoring in the capsules of the Juelich steel irradiation for the research project on component safety (FKS). The table of results and their discussion is provided specifically for the spectral positions (for characterising the neutron spectrum) in each of the types of irradiation capsules used. The results are given for the reaction rates of the neutron measurement reactions used (activation or fission reactions), for the neutron flux densities and fluxes derived from them related to the actual or at least plausible neutron spectra and finally for the radiation damage (or exposure) of the irradiated material calculated from them, expressed as the atomic displacement figure (dpa) and its percentage in sections of the neutron spectrum. (orig.) [de

  14. Investor Outlook: Significance of the Positive LCA2 Gene Therapy Phase III Results.

    Science.gov (United States)

    Schimmer, Joshua; Breazzano, Steven

    2015-12-01

    Spark Therapeutics recently reported positive phase III results for SPK-RPE65 targeting the treatment of visual impairment caused by RPE65 gene mutations (often referred to as Leber congenital amaurosis type 2, or LCA2, but may include other retinal disorders), marking an important inflection point for the field of gene therapy. The results highlight the ability to successfully design and execute a randomized trial of a gene therapy and also reinforce the potentially predictive nature of early preclinical and clinical data. The results are expected to pave the way for the first approved gene therapy product in the United States and should sustain investor interest and confidence in gene therapy for many approaches, including retina targeting and beyond.

  15. [EXPERIENCE OF STUDY AND POSSIBLE WAYS OF ELIMINATION OF FALSE POSITIVE AND FALSE NEGATIVE RESULTS DURING EXECUTION OF POLYMERASE CHAIN REACTION ON AN EXAMPLE OF JUNIN VIRUS RNA DETECTION].

    Science.gov (United States)

    Sizikova, T E; Lebedev, V N; Pantyukhov, V B; Borisevich, S V; Merkulov, V A

    2015-01-01

    Experience of study and possible ways of elimination of false positive and false negative results during execution of polymerase chain reaction on an example of Junin virus RNA detection. MATERIALSS AND METHODS: Junin virus--causative agent of Argentine hemorrhagic fever (AHF) strain XJpR37/5787 was obtained from the State collection of pathogenicity group I causative agents of the 48th Central Research Institute. Reagent kit for detection of Junin virus RNA by RT-PCR was developed in the Institute and consists of 4 sets: for isolation of RNA, execution of reverse-transcription reaction, execution of PCR and electrophoretic detection of PCR products. RT-PCR was carried out by a standard technique. Continuous cell cultures of African green monkey Vero B, GMK-AH-1(D) were obtained from the museum of cell culture department of the Centre. An experimental study of the effect of various factors of impact on the sample under investigation ("thawing-freezing", presence of formaldehyde, heparin) on the obtaining of false negative results during Junin virus RNA detection by using RT-PCR was studied. Addition of 0.01% heparin to the samples was shown to completely inhibit PCR. Addition of 0.05% formaldehyde significantly reduces sensitivity of the method. A possibility of reduction of analysis timeframe from 15 to 5 days was shown during detection of the causative agent in samples with low concentration of the latter by growing the samples and subsequent analysis of the material obtained by using RT-PCR. During detection of causative agent by using RT-PCR false negative results could appear in the presence of formaldehyde and heparin in the sample. A possibility of elimination of false negative PCR results due to concentration of the causative agent in the sample under investigation at a level below sensitivity threshold was shown on the example of Junin virus RNA detection by using growing of the pathogen in appropriate accumulation system with subsequent analysis of the

  16. Low incidence of minor BRAF V600 mutation-positive subclones in primary and metastatic melanoma determined by sensitive and quantitative real-time PCR

    DEFF Research Database (Denmark)

    Kielsgaard Kristensen, Thomas; Clemmensen, Ole; Hoejberg, Lise

    2013-01-01

    BRAF V600 mutation is an important biological marker for therapeutic guidance in melanoma, where mutation-positive cases are candidates for therapy targeting mutant B-Raf. Recent studies showing intratumor variation in BRAF mutation status have caused concern that sensitive mutation analysis can ...

  17. Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

    Science.gov (United States)

    Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

    2015-01-01

    Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100

  18. Accelerated Intensity-Modulated Radiotherapy to Breast in Prone Position: Dosimetric Results

    International Nuclear Information System (INIS)

    De Wyngaert, J. Keith; Jozsef, Gabor; Mitchell, James; Rosenstein, Barry; Formenti, Silvia C.

    2007-01-01

    Purpose: To report the physics and dosimetry results of a trial of accelerated intensity-modulated radiotherapy to the whole breast with a concomitant boost to the tumor bed in patients treated in the prone position. Methods and Materials: Patients underwent computed tomography planning and treatment in the prone position on a dedicated treatment platform. The platform has an open aperture on the side to allow for the index breast to fall away from the chest wall. Noncontrast computed tomography images were acquired at 2.5- or 3.75-mm-thick intervals, from the level of the mandible to below the diaphragm. A dose of 40.5 Gy was delivered to the entire breast at 2.7-Gy fractions in 15 fractions. An additional dose of 0.5 Gy was delivered as a concomitant boost to the lumpectomy site, with a 1-cm margin, using inverse planning, for a total dose of 48 Gy in 15 fractions. No more than 10% of the heart and lung volume was allowed to receive >18 and >20 Gy, respectively. Results: Between September 2003 and August 2005, 91 patients were enrolled in the study. The median volume of heart that received ≥18 Gy was 0.5%, with a maximal value of 4.7%. The median volume of ipsilateral lung that received ≥20 Gy was 0.8%, with a maximum of 7.2%. Conclusion: This technique for whole breast radiotherapy is feasible and enables an accelerated regimen in the prone position while sparing the lung and heart

  19. Inflammatory disorders mimicking periprosthetic joint infections may result in false positive α-defensin.

    Science.gov (United States)

    Plate, Andreas; Stadler, Laura; Sutter, Reto; Anagnostopoulos, Alexia; Frustaci, Dario; Zbinden, Reinhard; Fucentese, Sandro F; Zinkernagel, Annelies S; Zingg, Patrick O; Achermann, Yvonne

    2018-02-26

    The antimicrobial peptide α-defensin has recently been introduced as potential "single" biomarker with a high sensitivity and specificity for the preoperative diagnosis of periprosthetic joint infections (PJIs). However, most studies assessed the benefits of the test with exclusion of patients with rheumatic diseases. We aimed to evaluate the α-defensin test in a cohort study without exclusion of cases with inflammatory diseases. Between June 2016 and June 2017, we prospectively included cases with a suspected PJI and an available lateral flow test α-defensin (Synovasure®) in synovial fluid. We compared the test result to the diagnostic criteria for PJIs published by an International Consensus Group in 2013. We included 109 cases (49 hips, 60 knees) in which preoperative α-defensin tests had been performed. Thereof, 20 PJIs (16 hips, 4 knees) were diagnosed. Preoperative α-defensin tests were positive in 25 cases (22.9%) with a test sensitivity and specificity of 90% and 92.1% (95% confidence interval [CI], 68.3 - 98.8% and 84.5 - 96.8%, respectively), and a high negative predictive value of 97.6% (95% CI, 91.7 - 99.4%). We interpreted seven α-defensin tests as false positive, mainly in cases with inflammatory rheumatic diseases, including crystal deposition diseases. A negative synovial α-defensin test can reliably rule out a PJI. However, the test can be false positive in conjunction with an underlying non-infectious inflammatory disease. We therefore propose to use the α-defensin test only in addition to MSIS criteria and assessment for crystals in synovial aspirates. Copyright © 2018. Published by Elsevier Ltd.

  20. One-stop polymerase chain reaction (PCR): An improved PCR ...

    African Journals Online (AJOL)

    Yomi

    2011-12-21

    Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.

  1. Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.

    Science.gov (United States)

    Keane, O M; Budd, K E; Flynn, J; McCoy, F

    2013-09-21

    Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.

  2. Preliminary results on ghrelin mRNA quantification in buffalo calves during fasting and refeeding by real-time reverse transcription PCR assay

    Directory of Open Access Journals (Sweden)

    G. Neglia

    2010-02-01

    Full Text Available The aim of this trial was to evaluate ghrelin response to milk administration in 20 days old buffalo calves. The trial was carried out on 5 female buffalo calves with a mean age of 21.2±2.8 days. Five blood samples were collected from each animal into EDTA tubes, starting at 07.00 until 15.00, at 2-h intervals. At 09.00, after the second blood sample, replaced milk was administered to the calves. Blood samples were immediately placed at 4°C until processing, which was performed on the same day. We used real-time reverse transcription PCR system to detect the expression of ghrelin mRNA levels in blood of buffalo calves. Two calves showed a low ghrelin concentration at the start of the trial (Group A = low ghrelin concentration and three calves a high ghrelin concentration (Group B = high ghrelin concentration. Ghrelin expression was significantly higher either two hours (P<0.01 and just before feeding (P<0.05 in Group B vs. Group A. However, in both cases, a significant (P<0.05 difference was observed within each group between -2 and 6 hours after feeding. Therefore, ghrelin concentration tended to increase in animals that showed low levels and, similarly, it lowered in animals that showed high concentration. If these results will be confirmed, may represent the evidence that also in buffalo calves the ghrelin system may affect feed intake. Further studies are needed in order to better evaluate the ghrelin system in buffalo calves.

  3. Oscillation for equations with positive and negative coefficients and with distributed delay I: General results

    Directory of Open Access Journals (Sweden)

    Leonid Berezansky

    2003-02-01

    Full Text Available We study a scalar delay differential equation with a bounded distributed delay, $$ dot{x}(t+ int_{h(t}^t x(s,d_s R(t,s - int_{g(t}^t x(s,d_s T(t,s=0, $$ where $R(t,s$, $T(t,s$ are nonnegative nondecreasing in $s$ for any $t$, $$ R(t,h(t=T(t,g(t=0, quad R(t,s geq T(t,s. $$ We establish a connection between non-oscillation of this differential equation and the corresponding differential inequalities, and between positiveness of the fundamental function and the existence of a nonnegative solution for a nonlinear integral inequality that constructed explicitly. We also present comparison theorems, and explicit non-oscillation and oscillation results. In a separate publication (part II, we will consider applications of this theory to differential equations with several concentrated delays, integrodifferential, and mixed equations.

  4. The Hourglass Model: Are There Structural Problems with the Scarcity of Positive Results for Flexible ACT?

    Science.gov (United States)

    Norlander, Torsten; Nordén, Tommy

    2015-01-01

    The aim of the present article was to discuss the commentary by van Veldhuizen, Delespaul and Mulder (2015) regarding the review by Nordén and Norlander (2014) based on five empirical articles about Flexible Assertive Community Treatment (FACT). Veldhuizen et al. agree on that there is insufficient evidence for the effectiveness of FACT. However, van Veldhuizen et al. avoid a discussion of the lack of positive results despite extensive research during several years and therefore an analysis of why FACT did not fare better is missing. According to FACT it is an advantage that one single team spans the entire chain of care and rehabilitation, but no evidence is given for such an opinion. Instead there may be difficulties for the staff to shift between psychiatric care and psychiatric rehabilitation and the clients perhaps don't want to encounter the same professional team during all phases of care and rehabilitation.

  5. Risk of breast cancer after false-positive test results in screening mammography

    DEFF Research Database (Denmark)

    von Euler-Chelpin, My Catarina; Risør, Louise Madeleine; Thorsted, Brian Larsen

    2012-01-01

    Screening for disease in healthy people inevitably leads to some false-positive tests in disease-free individuals. Normally, women with false-positive screening tests for breast cancer are referred back to routine screening. However, the long-term outcome for women with false-positive tests...

  6. Clinical use of fungal PCR from deep tissue samples in the diagnosis of invasive fungal diseases: a retrospective observational study.

    Science.gov (United States)

    Ala-Houhala, M; Koukila-Kähkölä, P; Antikainen, J; Valve, J; Kirveskari, J; Anttila, V-J

    2018-03-01

    To assess the clinical use of panfungal PCR for diagnosis of invasive fungal diseases (IFDs). We focused on the deep tissue samples. We first described the design of panfungal PCR, which is in clinical use at Helsinki University Hospital. Next we retrospectively evaluated the results of 307 fungal PCR tests performed from 2013 to 2015. Samples were taken from normally sterile tissues and fluids. The patient population was nonselected. We classified the likelihood of IFD according to the criteria of the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG), comparing the fungal PCR results to the likelihood of IFD along with culture and microscopy results. There were 48 positive (16%) and 259 negative (84%) PCR results. The sensitivity and specificity of PCR for diagnosing IFDs were 60.5% and 91.7%, respectively, while the negative predictive value and positive predictive value were 93.4% and 54.2%, respectively. The concordance between the PCR and the culture results was 86% and 87% between PCR and microscopy, respectively. Of the 48 patients with positive PCR results, 23 had a proven or probable IFD. Fungal PCR can be useful for diagnosing IFDs in deep tissue samples. It is beneficial to combine fungal PCR with culture and microscopy. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  7. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    Science.gov (United States)

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  8. Breast cancer-specific survival in patients with lymph node-positive hormone receptor-positive invasive breast cancer and Oncotype DX Recurrence Score results in the SEER database.

    Science.gov (United States)

    Roberts, Megan C; Miller, Dave P; Shak, Steven; Petkov, Valentina I

    2017-06-01

    The Oncotype DX ® Breast Recurrence Score™ (RS) assay is validated to predict breast cancer (BC) recurrence and adjuvant chemotherapy benefit in select patients with lymph node-positive (LN+), hormone receptor-positive (HR+), HER2-negative BC. We assessed 5-year BC-specific survival (BCSS) in LN+ patients with RS results in SEER databases. In this population-based study, BC cases in SEER registries (diagnosed 2004-2013) were linked to RS results from assays performed by Genomic Health (2004-2014). The primary analysis included only patients (diagnosed 2004-2012) with LN+ (including micrometastases), HR+ (per SEER), and HER2-negative (per RT-PCR) primary invasive BC (N = 6768). BCSS, assessed by RS category and number of positive lymph nodes, was calculated using the actuarial method. The proportion of patients with RS results and LN+ disease (N = 8782) increased over time between 2004 and 2013, and decreased with increasing lymph node involvement from micrometastases to ≥4 lymph nodes. Five-year BCSS outcomes for those with RS < 18 ranged from 98.9% (95% CI 97.4-99.6) for those with micrometastases to 92.8% (95% CI 73.4-98.2) for those with ≥4 lymph nodes. Similar patterns were found for patients with RS 18-30 and RS ≥ 31. RS group was strongly predictive of BCSS among patients with micrometastases or up to three positive lymph nodes (p < 0.001). Overall, 5-year BCSS is excellent for patients with RS < 18 and micrometastases, one or two positive lymph nodes, and worsens with additionally involved lymph nodes. Further analyses should account for treatment variables, and longitudinal updates will be important to better characterize utilization of Oncotype DX testing and long-term survival outcomes.

  9. Development of RT-PCR and Nested PCR for Detecting Four Quarantine Plant Viruses Belonging to Nepovirus

    Directory of Open Access Journals (Sweden)

    Siwon Lee

    2013-09-01

    Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.

  10. Positive Psychotherapy for Smoking Cessation: Treatment Development, Feasibility and Preliminary Results.

    Science.gov (United States)

    Kahler, Christopher W; Spillane, Nichea S; Day, Anne; Clerkin, Elise; Parks, Acacia; Leventhal, Adam M; Brown, Richard A

    2014-01-01

    Low positive and high negative affect predict low rates of smoking abstinence among smokers making a quit attempt. Positive Psychotherapy can both increase positive affect and decrease negative affect and therefore may be a useful adjunct to behavioral smoking counseling. The purpose of the present study was to assess the feasibility and acceptability of a Positive Psychotherapy for Smoking Cessation (PPT-S) intervention that integrates standard smoking cessation counseling with nicotine patch and a package of positive psychology interventions. We delivered PPT-S to 19 smokers who were low in positive affect at baseline. Rates of session attendance and satisfaction with treatment were high, and most participants reported using and benefiting from the positive psychology interventions. Almost one-third of participants (31.6%) sustained smoking abstinence for 6 months after their quit date. Future studies to assess the relative efficacy of PPT-S compared to standard smoking cessation treatment are warranted.

  11. [A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].

    Science.gov (United States)

    Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan

    2015-04-01

    To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.

  12. Amplification of Mycoplasma haemofelis DNA by a PCR for point-of-care use.

    Science.gov (United States)

    Hawley, Jennifer; Yaaran, Tal; Maurice, Sarah; Lappin, Michael R

    2018-01-01

    We compared a qualitative in-clinic (IC)-PCR for the detection of Mycoplasma haemofelis DNA with the results of a commercial qualitative laboratory-based, conventional (c)PCR. In order to determine the specificity of both tests, Bartonella spp. samples were included. Forty-three previously tested blood samples with known PCR results for hemoplasmas and Bartonella spp. were selected. The samples were split between 2 laboratories. At the first laboratory, DNA was purified and run on 2 cPCR assays for the detection of hemoplasmas and Bartonella spp. At the second laboratory, DNA was purified using 2 purification protocols and both run in the IC-PCR assay. The cPCR results confirmed that 18 samples were positive for M. haemofelis, 5 for ' Candidatus M. haemominutum', 8 for Bartonella henselae, 2 for Bartonella clarridgeiae, and 10 were negative for both genera. No mixed infections were observed. The IC-PCR assay for the detection of M. haemofelis had a sensitivity of 94.4% and specificity of 96%, when using the same DNA purification method as the first laboratory. Using the second purification method, the sensitivity of the IC-PCR assay was 77.8% and specificity was 96%. Bartonella species were not detected by the IC-PCR M. haemofelis assay. The IC-PCR assay decreased the amount of time to final result compared to a cPCR assay.

  13. Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

    Science.gov (United States)

    Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

    2014-05-01

    A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR

    Directory of Open Access Journals (Sweden)

    M Heiat

    2010-07-01

    Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.

  15. An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection

    Directory of Open Access Journals (Sweden)

    Amanda de Faveri Pitz

    2013-12-01

    Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.

  16. Positive EtG findings in hair as a result of a cosmetic treatment.

    Science.gov (United States)

    Sporkert, Frank; Kharbouche, Hicham; Augsburger, Marc P; Klemm, Clementine; Baumgartner, Markus R

    2012-05-10

    In a case of a driving ability assessment, hair analysis for ethyl glucuronide (EtG) was requested by the authorities. The person concerned denied alcohol consumption and did not present any clinical sign of alcoholism. However, EtG was found in concentrations of up to 910pg/mg in hair from different sampling dates suggesting an excessive drinking behavior. The person declared to use a hair lotion on a regularly base. To evaluate a possible effect of the hair lotion, prospective blood and urine controls as well as hair sampling of scalp and pubic hair were performed. The traditional clinical biomarkers of ethanol consumption, CDT and GGT, were inconspicuous in three blood samples taken. EtG was not detected in all collected urine samples. The hair lotion was transmitted to our laboratory. The ethanol concentration in this lotion was determined with 35g/L. The EtG immunoassay gave a positive result indicating EtG, which could be confirmed by GC-MS/MS-NCI. In a follow-up experiment the lotion was applied to the hair of a volunteer over a period of six weeks. After this treatment, EtG could be measured in the hair at a concentration of 72pg/mg suggesting chronic and excessive alcohol consumption. Overnight incubation of EtG free hair in the lotion yielded an EtG concentration of 140pg/mg. In the present case, the positive EtG hair findings could be interpreted as the result of an EtG containing hair care product. To our knowledge, the existence of such a product has not yet been reported, and it is exceptionally unusual to find EtG in cosmetics. Therefore, external sources for hair contamination should always be taken into account when unusual cosmetic treatment is mentioned. In those cases, it is recommended to analyze the hair product for a possible contamination with EtG. The analysis of body hair can help to reveal problems occurring from cosmetic treatment of head hair. As a consequence, the assessment of drinking behavior should be based on more than one

  17. Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

    Science.gov (United States)

    Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

    2016-02-01

    Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. Risk estimation of distant metastasis in node-negative, estrogen receptor-positive breast cancer patients using an RT-PCR based prognostic expression signature

    International Nuclear Information System (INIS)

    Tutt, Andrew; Shu, Henry; Springall, Robert; Cane, Paul; McCallie, Blair; Kam-Morgan, Lauren; Anderson, Steve; Buerger, Horst; Gray, Joe; Bennington, James; Esserman, Laura; Wang, Alice; Hastie, Trevor; Broder, Samuel; Sninsky, John; Brandt, Burkhard; Waldman, Fred; Rowland, Charles; Gillett, Cheryl; Lau, Kit; Chew, Karen; Dai, Hongyue; Kwok, Shirley; Ryder, Kenneth

    2008-01-01

    Given the large number of genes purported to be prognostic for breast cancer, it would be optimal if the genes identified are not confounded by the continuously changing systemic therapies. The aim of this study was to discover and validate a breast cancer prognostic expression signature for distant metastasis in untreated, early stage, lymph node-negative (N-) estrogen receptor-positive (ER+) patients with extensive follow-up times. 197 genes previously associated with metastasis and ER status were profiled from 142 untreated breast cancer subjects. A 'metastasis score' (MS) representing fourteen differentially expressed genes was developed and evaluated for its association with distant-metastasis-free survival (DMFS). Categorical risk classification was established from the continuous MS and further evaluated on an independent set of 279 untreated subjects. A third set of 45 subjects was tested to determine the prognostic performance of the MS in tamoxifen-treated women. A 14-gene signature was found to be significantly associated (p < 0.05) with distant metastasis in a training set and subsequently in an independent validation set. In the validation set, the hazard ratios (HR) of the high risk compared to low risk groups were 4.02 (95% CI 1.91–8.44) for the endpoint of DMFS and 1.97 (95% CI 1.28 to 3.04) for overall survival after adjustment for age, tumor size and grade. The low and high MS risk groups had 10-year estimates (95% CI) of 96% (90–99%) and 72% (64–78%) respectively, for DMFS and 91% (84–95%) and 68% (61–75%), respectively for overall survival. Performance characteristics of the signature in the two sets were similar. Ki-67 labeling index (LI) was predictive for recurrent disease in the training set, but lost significance after adjustment for the expression signature. In a study of tamoxifen-treated patients, the HR for DMFS in high compared to low risk groups was 3.61 (95% CI 0.86–15.14). The 14-gene signature is significantly

  19. Screening tests for Chlamydia trachomatis or Neisseria gonorrhoeae using the cobas 4800 PCR system do not require a second test to confirm: an audit of patients issued with equivocal results at a sexual health clinic in the Northwest of England, U.K.

    Science.gov (United States)

    Hopkins, Mark J; Smith, Godfrey; Hart, Ian J; Alloba, Fath

    2012-11-01

    To assess the clinical utility of supplementary PCRs following a positive cobas 4800 CT/NG PCR screening test result. Laboratory reports, for Chlamydia trachomatis or Neisseria gonorrhoeae, issued to genitourinary medicine patients between April 2010 and April 2011 were reviewed retrospectively. Positive reports were routinely confirmed by supplementary PCRs and N gonorrhoeae culture. Clinical records of patients with unconfirmed positive (equivocal) reports were retrieved to determine if the infection was confirmed by a second sample obtained at patient recall and the impact of this process on antibiotic management. Over 15 000 patients were tested during the study period. The prevalence of chlamydia and gonorrhoea was 972 (5.75%) and 76 (0.50%), respectively. A further 78 chlamydia and 2 gonorrhoea equivocal reports were issued. Only 56 (72%) patients with an equivocal chlamydia report returned to the clinic, and of these, only 41 (73%) gave a second sample to retest. Positive predictive value (PPV) of the PCR screening test was calculated at 98.0% and 97.5% for detection of chlamydia infection from urine and rectal swabs, respectively. Most patients accepted antibiotic treatment before their infection status had been confirmed. Prevalence of gonorrhoea infection was low but the PPV of the screening PCR in urine specimens remained high (98.75%). Equivocal reports introduce delays to patient management, while the risk of unnecessary antibiotic therapy appears acceptable to most patients. The cobas 4800 CT/NG PCR screening assay can achieve UK testing standards (PPV >90%) for chlamydia, and low prevalence gonorrhoea in urine without supplementary tests. A patient-led confirmation algorithm is proposed.

  20. Variations of Blood Pressure in Stroke Unit Patients May Result from Alternating Body Positions

    NARCIS (Netherlands)

    Aries, M.J.H.; Elting, Jan Willem; Stewart, Roy E.; de Keyser, Jacques; Thien, Theo; Kremer, Berry P.; Vroomen, Patrick C. A. J.

    Background: Blood pressure (BP) is one of the major vital parameters monitored in the stroke unit. The accuracy of indirect BP measurement is strongly influenced by the position of both patient and arm during the measurement. Acute stroke patients are often nursed in lateral decubitus positions. The

  1. HISTOPLASMIN SURVEY IN HIV-POSITIVE PATIENTS: RESULTS FROM AN ENDEMIC AREA IN NORTHEASTERN BRAZIL

    Directory of Open Access Journals (Sweden)

    Fabricia Salvador Bezerra

    2013-07-01

    Full Text Available SUMMARY Background. Disseminated histoplasmosis is common in AIDS patients with advanced immunosuppression in Ceará, Northeastern Brazil. The goal of this study was to determine the prevalence of Histoplasma infection in patients with HIV/AIDS living in Fortaleza, the capital of Ceará. Methods. Intradermal tests with histoplasmin (mycelial phase were performed in 161 HIV patients with CD4 ≥ 350 cells/mm 3 . Evidence of recent illness was evaluated with immunodiffusion (ID tests in 76 of these individuals. Results. A total of 11.8% of patients reacted to histoplasmin and 2.63% had ID test positive to Histoplasma. The presence of mango trees (Mangifera indica in the patient neighborhood (OR = 2.870; 95% CI = 1.081-7.617; p = 0.040 and past activity involving soil (OR = 2.834; 95% CI = 1.045-7.687; p = 0.045 or visits to a farm (OR = 3.869; 95% CI = 1.189-12.591; p = 0.033 were significantly associated with Histoplasma infection. Conclusions. Patients with HIV living in Fortaleza have an expressive prevalence of infection with Histoplasma.

  2. Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.

    Science.gov (United States)

    Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D

    1996-11-01

    A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.

  3. Real Time Precise Point Positioning: Preliminary Results for the Brazilian Region

    Science.gov (United States)

    Marques, Haroldo; Monico, João.; Hirokazu Shimabukuro, Milton; Aquino, Marcio

    2010-05-01

    GNSS positioning can be carried out in relative or absolute approach. In the last years, more attention has been driven to the real time precise point positioning (PPP). To achieve centimeter accuracy with this method in real time it is necessary to have available the satellites precise coordinates as well as satellites clocks corrections. The coordinates can be used from the predicted IGU ephemeris, but the satellites clocks must be estimated in a real time. It can be made from a GNSS network as can be seen from EUREF Permanent Network. The infra-structure to realize the PPP in real time is being available in Brazil through the Brazilian Continuous Monitoring Network (RBMC) together with the Sao Paulo State GNSS network which are transmitting GNSS data using NTRIP (Networked Transport of RTCM via Internet Protocol) caster. Based on this information it was proposed a PhD thesis in the Univ. Estadual Paulista (UNESP) aiming to investigate and develop the methodology to estimate the satellites clocks and realize PPP in real time. Then, software is being developed to process GNSS data in the real time PPP mode. A preliminary version of the software was called PPP_RT and is able to process GNSS code and phase data using precise ephemeris and satellites clocks. The PPP processing can be accomplished considering the absolute satellite antenna Phase Center Variation (PCV), Ocean Tide Loading (OTL), Earth Body Tide, among others. The first order ionospheric effects can be eliminated or minimized by ion-free combination or parameterized in the receiver-satellite direction using a stochastic process, e.g. random walk or white noise. In the case of ionosphere estimation, a pseudo-observable is introduced in the mathematical model for each satellite and the initial value can be computed from Klobuchar model or from Global Ionospheric Map (GIM). The adjustment is realized in the recursive mode and the DIA (Detection Identification and Adaptation) is used for quality control. In

  4. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  5. Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear

    Directory of Open Access Journals (Sweden)

    Gholamreza HASSANPOUR

    2016-12-01

    Full Text Available Background: We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan-Plasmodium real-time PCR for accurate screening of individuals suspected of malaria.Methods: A single primer/probe set for pan-species Plasmodium-specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction.Results: The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum. All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR.Conclusion: By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.

  6. Disclosure of HIV Positive Result to a Sexual Partner among Adult ...

    African Journals Online (AJOL)

    HP

    360 HIV positive individuals selected by systematic random sampling. ... The main reasons for not disclosing were fear of divorce [32%], fear of stigma and .... associated with having children and high self- .... negative effect on service provided.

  7. Financial hardship, socio-economic position and depression: results from the PATH Through Life Survey.

    Science.gov (United States)

    Butterworth, Peter; Rodgers, Bryan; Windsor, Tim D

    2009-07-01

    There is a strong association between financial hardship and the experience of depression. Previous longitudinal research differs in whether this association is viewed as a contemporaneous relationship between depression and hardship or whether hardship has a role in the maintenance of existing depression. In this study we investigate the association between depression and hardship over time and seek to resolve these contradictory perspectives. We also investigate the consistency of the association across the lifecourse. This study reports analysis of two waves of data from a large community survey conducted in the city of Canberra and the surrounding region in south-east Australia. The PATH Through Life Study used a narrow-cohort design, with 6715 respondents representing three birth cohorts (1975-1979; 1956-1960; and 1937-1941) assessed on the two measurement occasions (4 years apart). Depression was measured using the Goldberg Depression Scale and hardship assessed by items measuring aspects of deprivation due to lack of resources. A range of measures of socio-economic circumstance and demographic characteristics were included in logistic regression models to predict wave 2 depression. The results showed that current financial hardship was strongly and independently associated with depression, above the effects of other measures of socio-economic position and demographic characteristics. In contrast, the effect of prior financial difficulty was explained by baseline depression symptoms. There were no reliable cohort differences in the association between hardship and depression having controlled for socio-demographic characteristics. There was some evidence that current hardship was more strongly associated with depression for those who were not classified as depressed at baseline than for those identified with depression at baseline. The evidence of the contemporaneous association between hardship and depression suggests that addressing deprivation may be an

  8. Design of a multiplex PCR assay for the simultaneous detection and confirmation of Neisseria gonorrhoeae.

    LENUS (Irish Health Repository)

    O'Callaghan, Isabelle

    2010-05-01

    To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.

  9. [Optimized application of nested PCR method for detection of malaria].

    Science.gov (United States)

    Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

    2017-04-28

    Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

  10. Parental knowledge reduces long term anxiety induced by false-positive test results after newborn screening for cystic fibrosis

    NARCIS (Netherlands)

    Vernooij-van Langen, A.M.M.; Pal, S.M. van der; Reijntjens, A.J.T.; Loeber, J.G.; Dompeling, E.; Dankert-Roelse, J.E.

    2014-01-01

    Background: False-positive screening results in newborn screening for cystic fibrosis may lead to parental stress, family relationship problems and a changed perception of the child's health. Aim of the study: To evaluate whether parental anxiety induced by a false positive screening result

  11. Evaluation of ethical position in eight CEE countries and Finland – results of an empirical research

    Directory of Open Access Journals (Sweden)

    József Poór

    2016-12-01

    Full Text Available The objective of this paper is to explore the ethical perspectives of respondents in Hungary, Slovakia, Romania, Serbia, Croatia, the Czech Republic, Poland, Estonia and Finland, and, to this end, to show the similarities and differences among these nine, mainly Central and Eastern European countries. Their ethical positions are defined by examining the related cultural dimensions. The obvious differences in national history and culture may well suggest that ethical positions will differ in these countries, but we believe that our findings do contribute to a better understanding of moral standards in relation to business in the Central and East European (CEE area.

  12. Abdominal and pelvic CT: is positive enteric contrast still necessary? Results of a retrospective observational study.

    Science.gov (United States)

    Kammerer, S; Höink, A J; Wessling, J; Heinzow, H; Koch, R; Schuelke, C; Heindel, W; Buerke, B

    2015-03-01

    Evaluation of diagnostic accuracy of abdominal CT depending on the type of enteric contrast agent. Multislice CTs of 2,008 patients with different types of oral preparation (positive with barium, n = 576; neutral with water, n = 716; and no enteric contrast, n = 716) were retrospectively evaluated by two radiologists including delineation of intestinal segments and influence on diagnosis and diagnostic reliability exerted by the enteric contrast, using a three-point scale. Furthermore, diagnostic reliability of the delineation of selected enteric pathologies was noted. CT data were assigned into groups: oncology, inflammation, vascular, pathology, trauma and gastrointestinal pathology. Delineation of the bowel was clearly practicable across all segments irrespective of the type of enteric contrast, though a slight impairment was observed without enteric contrast. Although delineation of intestinal pathologies was mostly classified "clearly delimitable" more difficulties occurred without oral contrast (neutral/positive/no contrast, 0.8 %/3.8 %/6.5 %). Compared to examinations without enteric contrast, there was a significant improvement in diagnosis that was even increased regarding the reader's diagnostic reliability. Positive opacification impaired detection of mucosal enhancement or intestinal bleeding. Water can replace positive enteric contrast agents in abdominal CTs. However, selected clinical questions require individual enteric contrast preparations. Pathology detection is noticeably impaired without any enteric contrast.

  13. Predictors of positive mental health among refugees: Results from Canada's General Social Survey.

    Science.gov (United States)

    Beiser, Morton; Hou, Feng

    2017-01-01

    Do refugees have lower levels of positive mental health than other migrants? If so, to what extent is this attributable to post-migration experiences, including discrimination? How does gender affect the relationships between post-migration experience and positive mental health? To address these questions, the current study uses data from Statistics Canada's 2013 General Social Survey (GSS), a nationally representative household study that included 27,695 Canadians 15 years of age and older. The study compares self-reported positive mental health among 651 refugees, 309 economic immigrants, and 448 family class immigrants from 50 source countries. Immigration-related predictors of mental health were examined including sociodemographic characteristics, discrimination, acculturation variables, and experiences of reception. Separate analyses were carried out for women and men. Refugees had lower levels of positive mental health than other migrants. Affiliative feelings towards the source country jeopardized refugee, but not immigrant mental health. A sense of belonging to Canada was a significant predictor of mental health. Perceived discrimination explained refugee mental health disadvantage among men, but not women. Bridging social networks were a mental health asset, particularly for women. The implications of anti-refugee discrimination net of the effects of anti-immigrant and anti-visible minority antipathies are discussed, as well as possible reasons for gender differences in the salience of mental health predictors.

  14. Abdominal and pelvic CT: is positive enteric contrast still necessary? Results of a retrospective observational study

    Energy Technology Data Exchange (ETDEWEB)

    Kammerer, S.; Hoeink, A.J.; Wessling, J.; Schuelke, C.; Heindel, W.; Buerke, B. [University Hospital Muenster, Department of Clinical Radiology, Muenster (Germany); Heinzow, H. [University Hospital Muenster, Department of Gastroenterology and Metabolic Diseases, Muenster (Germany); Koch, R. [University Muenster, Institute of Biostatistics and Clinical Research, Muenster (Germany)

    2014-10-15

    Evaluation of diagnostic accuracy of abdominal CT depending on the type of enteric contrast agent. Multislice CTs of 2,008 patients with different types of oral preparation (positive with barium, n = 576; neutral with water, n = 716; and no enteric contrast, n = 716) were retrospectively evaluated by two radiologists including delineation of intestinal segments and influence on diagnosis and diagnostic reliability exerted by the enteric contrast, using a three-point scale. Furthermore, diagnostic reliability of the delineation of selected enteric pathologies was noted. CT data were assigned into groups: oncology, inflammation, vascular, pathology, trauma and gastrointestinal pathology. Delineation of the bowel was clearly practicable across all segments irrespective of the type of enteric contrast, though a slight impairment was observed without enteric contrast. Although delineation of intestinal pathologies was mostly classified ''clearly delimitable'' more difficulties occurred without oral contrast (neutral/positive/no contrast, 0.8 %/3.8 %/6.5 %). Compared to examinations without enteric contrast, there was a significant improvement in diagnosis that was even increased regarding the reader's diagnostic reliability. Positive opacification impaired detection of mucosal enhancement or intestinal bleeding. Water can replace positive enteric contrast agents in abdominal CTs. However, selected clinical questions require individual enteric contrast preparations. Pathology detection is noticeably impaired without any enteric contrast. circle Neutral oral contrast ensures an equivalent delineation of the bowel. (orig.)

  15. [Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].

    Science.gov (United States)

    Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan

    2015-02-01

    To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.

  16. Tape functionality: position, change in shape, and outcome after TVT procedure--mid-term results.

    Science.gov (United States)

    Kociszewski, Jacek; Rautenberg, Oliver; Kolben, Sebastian; Eberhard, Jakob; Hilgers, Reinhard; Viereck, Volker

    2010-07-01

    This study evaluates the relevance of the tape position and change in shape (tape functionality) under in vivo conditions for mid-term outcome. Changes in the sonographic tension-free vaginal tape (TVT) position relative to the percentage urethral length and the tape-urethra distance were determined after 6 and 48 months in 41 women with stress urinary incontinence. At 48 months, 76% (31/41) of women were cured, 17% (7/41) were improved, and 7% (3/41) were failures. Disturbed bladder voiding was present in 12% (5/41), de novo urge incontinence in 7% (3/41). The median TVT position was at 63% of urethral length. Median tape-urethra distance was 2.7 mm, ranging from 2.9 mm in continent patients without complications to 1.1 mm in those with obstructive complications. Patients with postoperative urine loss had a median distance of 3.9 mm. The tape was stretched at rest and C-shaped during straining in 15 of 41 women (37%) at 48 months (all continent). Patients with this tape functionality at 6 months were also cured at 48 months in 86% of cases (19/22), and only 14% (3/22) showed recurrent incontinence. Mid-term data suggest an optimal outcome if the tape is positioned at least 2 mm from the urethra at the junction of the middle and distal thirds. Patients with optimal tape functionality at 6 months are likely to show mid-term therapeutic success.

  17. Perceived Family Support and Antiretroviral Adherence in HIV-Positive Individuals: Results from a Community-Based Positive Living With HIV Study.

    Science.gov (United States)

    Poudel, Krishna C; Buchanan, David R; Amiya, Rachel M; Poudel-Tandukar, Kalpana

    2015-01-01

    The purpose of this study was to examine the association between perceived family support, either positive or negative, and adherence to antiretroviral medication regimens among HIV-positive individuals in the Kathmandu Valley, Nepal. We measured past 3-month antiretroviral adherence among 233 HIV-positive individuals, in relation to perceived family support, both positive (in terms of emotional and instrumental support) and negative (in the form of negative interactions), using the 10-item Nepali Family Support and Difficulty Scale. Medium and high levels of perceived emotional support from family were associated with reduced risk of antiretroviral nonadherence, compared with low levels of perceived emotional support (adjusted odds ratio [AOR]  = 0.37, 95% confidence interval [CI] [0.16, 0.88], and AOR  = 0.23, 95% CI [0.08, 0.64], respectively). Conversely, higher levels of felt emotional distance (AOR  = 1.46, 95% CI [1.00, 2.14]) and experienced physical harm (AOR  = 2.04, 95% CI [1.07, 3.91]) were associated with increased risk of nonadherence. The results support the recommendation that service providers need to be aware of the significant role of family support in shaping antiretroviral adherence and to consider ways to strengthen positive family support while minimizing negative family interactions to increase adherence rates. © The Author(s) 2015.

  18. Positive results of serological tests for syphilis in pregnancy – diagnostic and therapeutic problems, report of two cases

    OpenAIRE

    Marta Koper; Agnieszka B. Serwin; Anna Baran; Iwona Flisiak

    2015-01-01

    Introduction. Undiagnosed and untreated syphilis in pregnancy may result in subsequent complications: early fetal loss, stillbirth, low birth weight of infants and newborns with congenital syphilis. Objective. To analyze diagnostic and therapeutic dilemmas of positive results of serological tests for syphilis (STS) in pregnancy. Case reports. We present two cases of pregnant women, hospitalized in our department due to positive results of serological tests for syphilis, pe...

  19. Development and Evaluation of a PCR and Mass Spectroscopy-based (PCR-MS) Method for Quantitative, Type-specific Detection of Human Papillomavirus

    Science.gov (United States)

    Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.

    2010-01-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602

  20. Development and evaluation of a PCR and mass spectroscopy (PCR-MS)-based method for quantitative, type-specific detection of human papillomavirus.

    Science.gov (United States)

    Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M

    2009-09-01

    Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.

  1. Risk factors for false positive and for false negative test results in screening with fecal occult blood testing

    NARCIS (Netherlands)

    Stegeman, Inge; de Wijkerslooth, Thomas R.; Stoop, Esther M.; van Leerdam, Monique; van Ballegooijen, M.; Kraaijenhagen, Roderik A.; Fockens, Paul; Kuipers, Ernst J.; Dekker, Evelien; Bossuyt, Patrick M.

    2013-01-01

    Differences in the risk of a false negative or a false positive fecal immunochemical test (FIT) across subgroups may affect optimal screening strategies. We evaluate whether subgroups are at increased risk of a false positive or a false negative FIT result, whether such variability in risk is

  2. Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.

    Science.gov (United States)

    West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D

    1995-01-01

    A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625

  3. Critical assessment of digital PCR for the detection and quantification of genetically modified organisms.

    Science.gov (United States)

    Demeke, Tigst; Dobnik, David

    2018-07-01

    The number of genetically modified organisms (GMOs) on the market is steadily increasing. Because of regulation of cultivation and trade of GMOs in several countries, there is pressure for their accurate detection and quantification. Today, DNA-based approaches are more popular for this purpose than protein-based methods, and real-time quantitative PCR (qPCR) is still the gold standard in GMO analytics. However, digital PCR (dPCR) offers several advantages over qPCR, making this new technique appealing also for GMO analysis. This critical review focuses on the use of dPCR for the purpose of GMO quantification and addresses parameters which are important for achieving accurate and reliable results, such as the quality and purity of DNA and reaction optimization. Three critical factors are explored and discussed in more depth: correct classification of partitions as positive, correctly determined partition volume, and dilution factor. This review could serve as a guide for all laboratories implementing dPCR. Most of the parameters discussed are applicable to fields other than purely GMO testing. Graphical abstract There are generally three different options for absolute quantification of genetically modified organisms (GMOs) using digital PCR: droplet- or chamber-based and droplets in chambers. All have in common the distribution of reaction mixture into several partitions, which are all subjected to PCR and scored at the end-point as positive or negative. Based on these results GMO content can be calculated.

  4. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  5. Neratinib in HER-2-positive breast cancer: results to date and clinical usefulness.

    Science.gov (United States)

    Chan, Arlene

    2016-09-01

    The management of HER-2-positive breast cancer has improved significantly with the use of targeted agents to the HER-2 signaling pathway. Despite the improved survival achieved with the use of trastuzumab and chemotherapy in both the adjuvant and metastatic setting, patients may still recur or progress; whilst preclinical data demonstrate that these cancer cells remain addicted to the HER-2 oncogene. Neratinib, an oral small molecule tyrosine-kinase inhibitor has efficacy in the metastatic and adjuvant setting of patients who have previously received trastuzumab-based treatment. Diarrhea, being a class effect of tyrosine-kinase inhibitor, is the most common side effect seen following neratinib administration, but recent data suggests that a prophylactic loperamide regimen can reduce the incidence of grade 3 diarrhea. Phase I through to III clinical trials of neratinib will be reviewed, with discussion of the postulated mechanism underlying diarrheal events and its management.

  6. Commissioning results of the APS storage ring rf beam position monitors

    International Nuclear Information System (INIS)

    Kahana, E.; Chung, Y.

    1996-01-01

    The commissioning of the 360 rf beam position monitors (BPMs) in the Advanced Photon Source (APS) storage ring (SR) is nearing completion. After using the single-turn capability of the BPM electronics in the early ring commissioning phase, resolution measurements versus current and bandwidth were successfully performed. In the standard Sr vacuum chamber geometry, the resolution was measured with beam as 0.16 micromA/√(Hz). For the insertion device vacuum chamber geometry, the resolution was measured to be 0.1 micromA/√(Hz). Since the photon beam stability requirement for the users is only 4.5 microns rms in the vertical direction, investigations of rf BPM offset versus current and bunch pattern have also been initiated. Both single bunch and multibunch beam patterns with varying intensity were used to determine offset stability for both the global and the local orbit feedback applications

  7. Development of a Real-time PCR test for porcine group A rotavirus diagnosis

    Directory of Open Access Journals (Sweden)

    Elizabeth C.M. Marconi

    2015-01-01

    Full Text Available Group A Rotavirus (RVA is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5 gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing. The overall agreement (kappa was 0.843, indicating 'very good' concordance between tests, presenting 100% of relative sensitivity (25+ Real Time PCR/25+ Conventional PCR and 87.5% of relative sensitivity (35- Real Time PCR/40- Conventional PCR. The results also demonstrated high intra- and inter-assay reproducibility (coefficient of variation ≤1.42%; thus, this method proved to be a fast and sensitive approach for the diagnosis of RVA in pigs.

  8. Effect of radiologist experience on the risk of false-positive results in breast cancer screening programs

    International Nuclear Information System (INIS)

    Zubizarreta Alberdi, Raquel; Llanes, Ana B.F.; Ortega, Raquel Almazan; Exposito, Ruben Roman; Collado, Jose M.V.; Oliveres, Xavier Castells; Queiro Verdes, Teresa; Natal Ramos, Carmen; Sanz, Maria Ederra; Salas Trejo, Dolores

    2011-01-01

    To evaluate the effect of radiologist experience on the risk of false-positive results in population-based breast cancer screening programmes. We evaluated 1,440,384 single-read screening mammograms, corresponding to 471,112 women aged 45-69 years participating in four Spanish programmes between 1990 and 2006. The mammograms were interpreted by 72 radiologists. The overall percentage of false-positive results was 5.85% and that for false-positives resulting in an invasive procedure was 0.38%. Both the risk of false-positives overall and of false-positives leading to an invasive procedure significantly decreased (p 14,999 mammograms with respect to the reference category (<500). The risk of both categories of false-positives was also significantly reduced (p < 0.001) as radiologists' years of experience increased: OR 0.96 and OR 0.84, respectively, for 1 year's experience and OR 0.72 and OR 0.73, respectively, for more than 4 years' experience with regard to the category of <1 year's experience. Radiologist experience is a determining factor in the risk of a false-positive result in breast cancer screening. (orig.)

  9. Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.

    Science.gov (United States)

    Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S

    2015-11-01

    The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  10. False positive results using calcitonin as a screening method for medullary thyroid carcinoma

    Directory of Open Access Journals (Sweden)

    Rafael Loch Batista

    2013-01-01

    Full Text Available The role of serum calcitonin as part of the evaluation of thyroid nodules has been widely discussed in literature. However there still is no consensus of measurement of calcitonin in the initial evaluation of a patient with thyroid nodule. Problems concerning cost-benefit, lab methods, false positive and low prevalence of medullary thyroid carcinoma (MTC are factors that limit this approach. We have illustrated two cases where serum calcitonin was used in the evaluation of thyroid nodule and rates proved to be high. A stimulation test was performed, using calcium as secretagogue, and calcitonin hyper-stimulation was confirmed, but anatomopathologic examination did not evidence medullar neoplasia. Anatomopathologic diagnosis detected Hashimoto thyroiditis in one case and adenomatous goiter plus an occult papillary thyroid carcinoma in the other one. Recommendation for routine use of serum calcitonin in the initial diagnostic evaluation of a thyroid nodule, followed by a confirming stimulation test if basal serum calcitonin is showed to be high, is the most currently recommended approach, but questions concerning cost-benefit and possibility of diagnosis error make the validity of this recommendation discussible.

  11. Positive results of clinical educational support in situations of psychological distress.

    Science.gov (United States)

    Tavormina, Dominique

    2014-11-01

    Education is a complex process that involves the individual in the course of his entire life and leads to the maturation and the overall development of his personality. The educational process involves the complete growth of each and completes the infinite possibilities that every child has potential since birth. Education also is a necessity for the human being, as only adequate environmental stimulation causes the mental processes to begin. In fact, the higher intellectual functions, such as language, thought, memory, emerge only from social and educational experiences of the child. The educational surgery creates experiences and learning that allow the person to change by improving the efficiency of synaptic connections. Clinical pedagogy has developed in Italy in the last decades of the twentieth century with the aim of research and experimenting educational purposes suitable for different situations in order to provide each subject with appropriate development opportunities. Clinical pedagogical support is offered in the form of artistic or bodily activities and represents for the individual a positive environment that allows the development of different brain areas and the potential inherent in them. The various methods are suitable for any situation of existential discomfort, which are understood as moments of personal growth.

  12. Is a positive L-dimer result a sufficient indication for performing a V/Q lung scan?

    International Nuclear Information System (INIS)

    Salanitri, G.C.; Kelly, M.J.; O'Donnell, M.; Kalff, V.

    2002-01-01

    Full text: At our institution there has developed a practice of referring some patients for assessment of pulmonary embolism (PE) because of a positive L-dimer test but without standard clinical indications. Therefore this study aimed to determine whether a positive L-dimer test result by itself is a sufficient indication to perform a ventilation/perfusion V/Q study. V/Q lung scan results, L-dimer test results and appropriate radiology results of 949 consecutive patients from August 2000 to October 2001 were retrospectively reviewed. Prediction of V/Q results by L-dimer results was compared with that of clinical risk factors for PE (Risk factor + or -) These factors were dyspnoea, current deep vein thrombosis (DVT), recent orthopaedic procedure or a past history of PE/DVT, Of the 949 patients in the study population, 254 patients had an L-dimer study, with 206 positive and 48 negative L-dimer results. Helical CT was performed in 8 patients with an equivocal V/Q - 4 showed PE and 4 did not. In the 27 patients with a positive L-dimer result and PE on either V-Q scan or CT, 25 (92.6%) had additional recognised major risk factors for PE. A positive L-dimer test is a poor predictor of a positive V/Q scan compared to conventional clinical indications. Thus, a positive L-dimer test result in isolation does not constitute an appropriate indication to perform a V/Q scan. Copyright (2002) The Australian and New Zealand Society of Nuclear Medicine Inc

  13. Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

    Science.gov (United States)

    Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

    2013-05-01

    Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

  14. False Positive Functional Analysis Results as a Contributor of Treatment Failure during Functional Communication Training

    Science.gov (United States)

    Mann, Amanda J.; Mueller, Michael M.

    2009-01-01

    Research has shown that functional analysis results are beneficial for treatment selection because they identify reinforcers for severe behavior that can then be used to reinforce replacement behaviors either differentially or noncontingently. Theoretically then, if a reinforcer is identified in a functional analysis erroneously, a well researched…

  15. Scientific citations favor positive results : a systematic review and meta-analysis

    NARCIS (Netherlands)

    Duyx, Bram; Urlings, Miriam J.E.; Swaen, Gerard M.H.; Bouter, Lex M.; Zeegers, Maurice P.

    2017-01-01

    Objectives Citation bias concerns the selective citation of scientific articles based on their results. We brought together all available evidence on citation bias across scientific disciplines and quantified its impact. Study Design and Setting An extensive search strategy was applied to the Web of

  16. Incidence of DWI-positive stroke in patients with vertigo of unclear etiology, preliminary results.

    Science.gov (United States)

    Leker, Ronen R; Hur, Tamir Ben; Gomori, John M; Paniri, R; Eichel, Roni; Cohen, Jose E

    2013-03-01

    Acute vertigo may be secondary to stroke or to non-ischemic causes. Accurate identification of vertigo secondary to ischemia may lead to appropriate timely intervention that can minimize stroke-related damage and can help in tailoring the most appropriate individual therapy for affected patients. Diffusion weighted MRI (DWI) is very accurate for diagnosing stroke and we therefore aimed to test whether it can aid in making a correct diagnosis of vertigo secondary to stroke. All patients presenting with vertigo in which the diagnosis of stroke was considered underwent DWI only MRI. Data regarding the symptoms and neurological deficits, vascular risk factors, imaging findings, and outcomes was accrued. Patients with stroke on DWI were compared with those without ischemia. Between June 2010 and August 2011, 28 patients fulfilling the entry criteria were identified with a mean age of 62·2±12·8 (60% male). The final diagnosis was stroke in 11 patients (39%). Patients with stroke did not differ from those without stroke in their risk factor profile. However, patients with stroke more often tended to present with vertigo accompanied by other neurological symptoms (73% versus 12% respectively, P = 0·001). After adjusting for age and the presence of diabetes, the presence of multiple symptoms remained the only variable that was associated with a positive DWI scan (odds ratio: 30: 95% confidence interval: 2·6-349). Most patients with stroke had very mild strokes with a median admission NIHSS score of 3 and DWI lesion volumes >2 cm were found in only three patients. Most stroke patients made a good recovery (modified Rankin score ≤2 in seven of nine patients with 90 day data). The most common diagnosis in patients without stroke was of vertigo of peripheral origin (14/17). DWI only MRI can be used to rapidly screen patients presenting with vertigo and suspected vertebrobasilar stroke. The occurrence of vertigo in combination with other focal neurological symptoms may

  17. The inhibition of PARP but not EGFR results in the radiosensitization of HPV/p16-positive HNSCC cell lines

    International Nuclear Information System (INIS)

    Güster, Julian David; Weissleder, Stephanie Valerie; Busch, Chia-Jung; Kriegs, Malte; Petersen, Cordula; Knecht, Rainald; Dikomey, Ekkehard; Rieckmann, Thorsten

    2014-01-01

    Background and purpose: HPV-negative and HPV-positive HNSCC comprise distinct tumor entities with different biological characteristics. Specific regimens for the comparably well curable HPV-positive entity that reduce side effects without compromising outcome have yet to be established. Therefore, we tested here whether the inhibition of EGFR or PARP may be used to specifically enhance the radiosensitivity of HPV-positive HNSCC cells. Materials and methods: Experiments were performed with five HPV/p16-positive HNSCC cell lines. Inhibitors used were cetuximab, olaparib and PF-00477736. The respective inhibition of EGFR, PARP and Chk1 was evaluated by Western blot, immunofluorescence analysis and assessment of cell cycle distribution. Cell survival was assessed by colony formation assay. Results: Inhibition of EGFR by cetuximab failed to radiosensitize any of the HPV-positive HNSCC cell lines tested. In contrast, PARP-inhibition resulted in a substantial radiosensitization of all strains, with the sensitization being further enhanced by the additional inhibition of Chk1. Conclusions: PARP-inhibition effectively radiosensitizes HPV-positive HNSCC cells and may therefore represent a viable alternative to chemotherapy possibly even allowing for a reduction in radiation dose. For the latter, PARP-inhibition may be combined with the inhibition of Chk1. In contrast, the inhibition of EGFR cannot be expected to radiosensitize HPV-positive HNSCC through the modulation of cellular radiosensitivity

  18. Special neutron measurement results from the spectral positions of the Juelich FKS steel irradiation capsules

    International Nuclear Information System (INIS)

    Schneider, W.; Kuepper, H.; Pott, G.; Borchardt, G.; Segelhorst, G.; Thoene, L.; Weise, L.

    1986-10-01

    For the German project 'Forschungsvorhaben Komponentensicherheit' (FKS, i.e., Structural Integrity of Components) steel specimen irradiations have been carried out in the Juelich Merlin-type reactor (FRJ-1). The neutron monitoring to these irradiations is described in a German report (Juel-2087). In this context, some special considerations and results are given here, i.e., an experimental investigation of the fast neutron spectrum variation over a thick steel plate (in a special dosimetry test experiment); a comparison of the outcome of this investigation with the results from other FKS participants; and finally, the evaluation of the neutron exposure expressed in displacements per atom (dpa) in the centre of that steel plate. (orig.)

  19. Variable Entry Biased Paracentric Hemispherical Deflector: Experimental results on energy resolution for different entry positions

    Science.gov (United States)

    Dogan, Mevlut; Ulu, Melike; Gennerakis, Giannis; Zouros, Theo J. M.

    2014-04-01

    A new hemispherical deflector analyzer (HDA) which is designed for electron energy analysis in atomic collisions has been constructed and tested. Using the crossed beam technique at the electron spectrometer, test measurements were performed for electron beam (200 eV) - Helium atoms interactions. These first experimental results show that the paracentric entries give almost twice as good resolution as that for the conventional entry. Supporting simulations of the entire lens+HDA spectrometer are found in relatively good agreement with experiment.

  20. Results of daily monitoring of positioning MLC multileaf collimator for Siemens 160 with an array of cameras

    International Nuclear Information System (INIS)

    Lopez Fernandez, A.; Rodriguez Rodriguez, C.; Martin Martin, G.; Saez Beltran, M.

    2011-01-01

    Modern techniques of radiotherapy, and in particular the intensity-modulated radiotherapy (IMRT), require sub-millimeter accuracy in the positioning of multileaf collimators to ensure that patients receive the prescribed dose. It is difficult to include checks of positioning accuracy as high on the agendas of regular monitoring of the accelerators of a hospital. This paper presents the results of a method that enables rapid verification of the position of the sheets with an accuracy of tenths of a millimeter by using an ionization chamber array. The procedure has been applied to the daily control of the two accelerators of our service for 12 months.

  1. Detection of Leishmania infantum in animals and their ectoparasites by conventional PCR and real time PCR.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena

    2013-04-01

    Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.

  2. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  3. Positive results of serological tests for syphilis in pregnancy – diagnostic and therapeutic problems, report of two cases

    Directory of Open Access Journals (Sweden)

    Marta Koper

    2015-06-01

    Full Text Available Introduction. Undiagnosed and untreated syphilis in pregnancy may result in subsequent complications: early fetal loss, stillbirth, low birth weight of infants and newborns with congenital syphilis. Objective. To analyze diagnostic and therapeutic dilemmas of positive results of serological tests for syphilis (STS in pregnancy. Case reports. We present two cases of pregnant women, hospitalized in our department due to positive results of serological tests for syphilis, performed during the antenatal visit. On the basis of patients' history, physical examination and STS results, early latent syphilis was diagnosed in the first patient; biological false positive reactions were considered in the second one. Both patients received procaine penicillin treatment. Conclusions. Screening for syphilis in pregnancy as a part of antenatal care and appropriate treatment with penicillin are the most effective interventions to prevent complications of syphilis in pregnancy. It is also important to adapt modern European Guidelines for management of syphilis to Polish conditions.

  4. Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

    Science.gov (United States)

    Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

    2014-03-01

    The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

  5. The management of isolated positive syphilis enzyme immunoassay results in HIV-negative patients attending a sexual health clinic.

    Science.gov (United States)

    Thorley, Nicola; Adebayo, Michael; Smit, Erasmus; Radcliffe, Keith

    2016-08-01

    An unconfirmed positive treponemal enzyme immunoassay (enzyme immunoassay positive, Treponema pallidum particle agglutination negative and rapid plasma reagin negative) presents a clinical challenge to distinguish early syphilis infection from false-positive results. These cases are referred for syphilis line assay (INNO-LIA) and recalled for repeat syphilis serology. We performed a retrospective audit to establish the proportion of HIV-negative cases with unconfirmed positive enzyme immunoassay results, the proportion of these cases that received an INNO-LIA test and repeat syphilis serology testing and reviewed the clinical outcomes; 0.35% (80/22687) cases had an unconfirmed positive treponemal enzyme immunoassay result. Repeat syphilis serology was performed in 80% (64/80) cases, but no additional cases of syphilis were identified. Eighty-eight per cent (70/80) received an INNO-LIA test; 14% (5/37) unconfirmed enzyme immunoassay-positive cases with no prior history of syphilis were confirmed on INNO-LIA assay, supporting a diagnosis of latent syphilis. As a confirmatory treponemal test, the INNO-LIA assay may be more useful than repeat syphilis serological testing. © The Author(s) 2016.

  6. Malaria diagnosis from pooled blood samples: comparative analysis of real-time PCR, nested PCR and immunoassay as a platform for the molecular and serological diagnosis of malaria on a large-scale

    Directory of Open Access Journals (Sweden)

    Giselle FMC Lima

    2011-09-01

    Full Text Available Malaria diagnoses has traditionally been made using thick blood smears, but more sensitive and faster techniques are required to process large numbers of samples in clinical and epidemiological studies and in blood donor screening. Here, we evaluated molecular and serological tools to build a screening platform for pooled samples aimed at reducing both the time and the cost of these diagnoses. Positive and negative samples were analysed in individual and pooled experiments using real-time polymerase chain reaction (PCR, nested PCR and an immunochromatographic test. For the individual tests, 46/49 samples were positive by real-time PCR, 46/49 were positive by nested PCR and 32/46 were positive by immunochromatographic test. For the assays performed using pooled samples, 13/15 samples were positive by real-time PCR and nested PCR and 11/15 were positive by immunochromatographic test. These molecular methods demonstrated sensitivity and specificity for both the individual and pooled samples. Due to the advantages of the real-time PCR, such as the fast processing and the closed system, this method should be indicated as the first choice for use in large-scale diagnosis and the nested PCR should be used for species differentiation. However, additional field isolates should be tested to confirm the results achieved using cultured parasites and the serological test should only be adopted as a complementary method for malaria diagnosis.

  7. The acceptance of virtual reality devices for cognitive rehabilitation: a report of positive results with schizophrenia.

    Science.gov (United States)

    da Costa, Rosa Maria Esteves Moreira; de Carvalho, Luís Alfredo Vidal

    2004-03-01

    This study presents a process of virtual environment development supported by a cognitive model that is specific to cognitive deficits of diverse disorders or traumatic brain injury, and evaluates the acceptance of computer devices by a group of schizophrenic patients. The subjects that participated in this experiment accepted to work with computers and immersive glasses and demonstrated a high level of interest in the proposed tasks. No problems of illness have been observed. This experiment indicated that further research projects must be carried out to verify the value of virtual reality technology for cognitive rehabilitation of psychiatric patients. The results of the current study represent a small but necessary step in the realization of that potential.

  8. Patterns of repeated anal cytology results among HIV-positive and HIV-negative men who have sex with men

    Directory of Open Access Journals (Sweden)

    Hilary A. Robbins

    2018-06-01

    Full Text Available Background: Men who have sex with men (MSM are at increased risk for anal cancer. In cervical cancer screening, patterns of repeated cytology results are used to identify low- and high-risk women, but little is known about these patterns for anal cytology among MSM. Methods: We analyzed Multicenter AIDS Cohort Study (MACS data for MSM who were offered anal cytology testing annually (HIV-positive or every 2 years (HIV-negative for 4 years. Results: Following an initial negative (normal cytology, the frequency of a second negative cytology was lower among HIV-positive MSM with CD4 ≥ 500 (74% or CD4 < 500 (68% than HIV-negative MSM (83% (p < 0.001. After an initial abnormal cytology, the frequency of a second abnormal cytology was highest among HIV-positive MSM with CD4 < 500 (70% compared to CD4 ≥ 500 (53% or HIV-negative MSM (46% (p = 0.003. Among HIV-positive MSM with at least three results, 37% had 3 consecutive negative results; 3 consecutive abnormal results were more frequent among CD4 < 500 (22% than CD4 ≥ 500 (10% (p = 0.008. Conclusions: More than one-third of HIV-positive MSM have consistently negative anal cytology over three years. Following abnormal anal cytology, a repeated cytology is commonly negative in HIV-negative or immunocompetent HIV-positive men, while persistent cytological abnormality is more likely among HIV-positive men with CD4 < 500. Keywords: Anal cancer, Anal cytology, HIV, MSM, Anal cancer screening

  9. Comparison of PCR with Standard Method (MPN for detection of bacterial contamination in drinking water

    Directory of Open Access Journals (Sweden)

    Fatemeh Dehghan

    2014-11-01

    Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.

  10. Universality Conjecture and Results for a Model of Several Coupled Positive-Definite Matrices

    Science.gov (United States)

    Bertola, Marco; Bothner, Thomas

    2015-08-01

    The paper contains two main parts: in the first part, we analyze the general case of matrices coupled in a chain subject to Cauchy interaction. Similarly to the Itzykson-Zuber interaction model, the eigenvalues of the Cauchy chain form a multi level determinantal point process. We first compute all correlations functions in terms of Cauchy biorthogonal polynomials and locate them as specific entries of a matrix valued solution of a Riemann-Hilbert problem. In the second part, we fix the external potentials as classical Laguerre weights. We then derive strong asymptotics for the Cauchy biorthogonal polynomials when the support of the equilibrium measures contains the origin. As a result, we obtain a new family of universality classes for multi-level random determinantal point fields, which include the Bessel universality for 1-level and the Meijer-G universality for 2-level. Our analysis uses the Deift-Zhou nonlinear steepest descent method and the explicit construction of a origin parametrix in terms of Meijer G-functions. The solution of the full Riemann-Hilbert problem is derived rigorously only for p = 3 but the general framework of the proof can be extended to the Cauchy chain of arbitrary length p.

  11. Evaluation of a PCR Assay for Detection of Streptococcus pneumoniae in Respiratory and Nonrespiratory Samples from Adults with Community-Acquired Pneumonia

    Science.gov (United States)

    Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.

    2003-01-01

    Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826

  12. Droplet Digital PCR for BCR/ABL(P210) Detecting of CML: A High Sensitive Method of the Minimal Residual Disease& Disease Progression.

    Science.gov (United States)

    Wang, Wen-Jun; Zheng, Chao-Feng; Liu, Zhuang; Tan, Yan-Hong; Chen, Xiu-Hua; Zhao, Bin-Liang; Li, Guo-Xia; Xu, Zhi-Fang; Ren, Fang-Gang; Zhang, Yao-Fang; Chang, Jian-Mei; Wang, Hong-Wei

    2018-04-25

    The present study intended to establish a droplet digital PCR (dd-PCR) for monitoring minimal residual disease (MRD) in patients with BCR/ABL (P210)-positive CML, thereby achieving deep-level monitoring of tumor load and determining the efficacy for guided clinically individualized treatment. Using dd-PCR and RT-qPCR, two cell suspensions were obtained from K562 cells and normal peripheral blood mononuclear cells by gradient dilution and were measured at the cellular level. At peripheral blood(PB) level, 61 cases with CML-chronic phase (CML-CP) were obtained after tyrosine kinase inhibitors (TKIs) treatment and regular follow-ups. By RT-qPCR, BCR/ABL (P210) fusion gene was undetectable in PB after three successive analyses, which were performed once every three months. At the same time, dd-PCR was performed simultaneously with the last equal amount of cDNA. Ten CML patients with MR4.5 were followed up by the two methods. At the cellular level, consistency of results of dd-PCR and RT-qPCR reached R 2 ≥0.99, with conversion equation of Y=33.148X 1.222 (Y: dd-PCR results; X: RT-qPCR results). In the dd-PCR test, 11 of the 61 CML patients (18.03%) tested positive and showed statistically significant difference (PPCR 3 months earlier than by RT-qPCR. In contrast with RT-qPCR, dd-PCR is more sensitive, thus enabling accurate conversion of dd-PCR results into internationally standard RT-qPCR results by conversion equation, to achieve a deeper molecular biology-based stratification of BCR/ABL(P210) MRD. It has some reference value to monitor disease progression in clinic. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  13. Anthropometric and Athletic Performance Combine Test Results Among Positions Within Grade Levels of High School-Aged American Football Players.

    Science.gov (United States)

    Leutzinger, Todd J; Gillen, Zachary M; Miramonti, Amelia M; McKay, Brianna D; Mendez, Alegra I; Cramer, Joel T

    2018-05-01

    Leutzinger, TJ, Gillen, ZM, Miramonti, AM, McKay, BD, Mendez, AI, and Cramer, JT. Anthropometric and athletic performance combine test results among positions within grade levels of high school-aged American football players. J Strength Cond Res 32(5): 1288-1296, 2018-The purpose of this study was to investigate differences among player positions at 3 grade levels in elite, collegiate-prospective American football players. Participants' data (n = 7,160) were analyzed for this study (mean height [Ht] ± SD = 178 ± 7 cm, mass [Bm] = 86 ± 19 kg). Data were obtained from 12 different high school American football recruiting combines hosted by Zybek Sports (Boulder, Colorado). Eight 2-way (9 × 3) mixed factorial analysis of variances {position (defensive back [DB], defensive end, defensive lineman, linebacker, offensive lineman [OL], quarterback, running back, tight end, and wide receiver [WR]) × grade (freshmen, sophomores, and juniors)} were used to test for differences among the mean test scores for each combine measure (Ht, Bm, 40-yard [40 yd] dash, proagility [PA] drill, L-cone [LC] drill, vertical jump [VJ], and broad jump [BJ]). There were position-related differences (p ≤ 0.05) for Ht, 40 yd dash, and BJ, within each grade level and for Bm, PA, LC, and VJ independent of grade level. Generally, the results showed that OL were the tallest, weighed the most, and exhibited the lowest performance scores among positions. Running backs were the shortest, whereas DBs and WRs weighed the least and exhibited the highest performance scores among positions. These results demonstrate the value of classifying high school-aged American football players according to their specific position rather than categorical groupings such as "line" vs. "skill" vs. "big skill" when evaluating anthropometric and athletic performance combine test results.

  14. Effect of radiologist experience on the risk of false-positive results in breast cancer screening programs

    Energy Technology Data Exchange (ETDEWEB)

    Zubizarreta Alberdi, Raquel [Galician Breast Cancer Screening Programme, Public Health and Planning Directorate, Health Office, Galicia (Spain); Edificio Administrativo da Conselleria de Sanidade, Servicio de Programas Poboacionais de Cribado, Direccion Xeral de Saude Publica e Planificacion, Santiago de Compostela, Galicia (Spain); Llanes, Ana B.F.; Ortega, Raquel Almazan [Galician Breast Cancer Screening Programme, Public Health and Planning Directorate, Health Office, Galicia (Spain); Exposito, Ruben Roman; Collado, Jose M.V.; Oliveres, Xavier Castells [Department of Epidemiology and Evaluation, Institut Municipal d' Investigacio Medica-Parc de Salut Mar. CIBERESP, Barcelona (Spain); Queiro Verdes, Teresa [Galician Agency for Health Technology Assessment, Public Health and Planning Directorate, Health Office, Galicia (Spain); Natal Ramos, Carmen [Principality of Asturias Breast Cancer Screening Programme, Principality of Asturias (Spain); Sanz, Maria Ederra [Public Health Institute, Navarra Breast Cancer Screening Programme, Pamplona (Spain); Salas Trejo, Dolores [General Directorate Public Health and Centre for Public Health Research (CSISP), Valencia Breast Cancer Screening Programme, Valencia (Spain)

    2011-10-15

    To evaluate the effect of radiologist experience on the risk of false-positive results in population-based breast cancer screening programmes. We evaluated 1,440,384 single-read screening mammograms, corresponding to 471,112 women aged 45-69 years participating in four Spanish programmes between 1990 and 2006. The mammograms were interpreted by 72 radiologists. The overall percentage of false-positive results was 5.85% and that for false-positives resulting in an invasive procedure was 0.38%. Both the risk of false-positives overall and of false-positives leading to an invasive procedure significantly decreased (p < 0.001) with greater reading volume in the previous year: OR 0.77 and OR 0.78, respectively, for a reading volume 500-1,999 mammograms and OR 0.59 and OR 0.60 for a reading volume of >14,999 mammograms with respect to the reference category (<500). The risk of both categories of false-positives was also significantly reduced (p < 0.001) as radiologists' years of experience increased: OR 0.96 and OR 0.84, respectively, for 1 year's experience and OR 0.72 and OR 0.73, respectively, for more than 4 years' experience with regard to the category of <1 year's experience. Radiologist experience is a determining factor in the risk of a false-positive result in breast cancer screening. (orig.)

  15. A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.

    1999-01-01

    The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...

  16. Multiplex Amplification Refractory Mutation System PCR (ARMS-PCR) provides sequencing independent typing of canine parvovirus.

    Science.gov (United States)

    Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K

    2016-12-01

    Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. The cumulative risk of false-positive screening results across screening centres in the Norwegian Breast Cancer Screening Program

    Energy Technology Data Exchange (ETDEWEB)

    Roman, M., E-mail: Marta.Roman@kreftregisteret.no [Cancer Registry of Norway, Oslo (Norway); Department of Women and Children’s Health, Oslo University Hospital, Oslo (Norway); Skaane, P., E-mail: PERSK@ous-hf.no [Department of Radiology, Oslo University Hospital Ullevaal, University of Oslo, Oslo (Norway); Hofvind, S., E-mail: Solveig.Hofvind@kreftregisteret.no [Cancer Registry of Norway, Oslo (Norway); Oslo and Akershus University College of Applied Sciences, Faculty of Health Science, Oslo (Norway)

    2014-09-15

    Highlights: • We found variation in early performance measures across screening centres. • Radiologists’ performance may play a key role in the variability. • Potential to improve the effectiveness of breast cancer screening programs. • Continuous surveillance of screening centres and radiologists is essential. - Abstract: Background: Recall for assessment in mammographic screening entails an inevitable number of false-positive screening results. This study aimed to investigate the variation in the cumulative risk of a false positive screening result and the positive predictive value across the screening centres in the Norwegian Breast Cancer Screening Program. Methods: We studied 618,636 women aged 50–69 years who underwent 2,090,575 screening exams (1996–2010. Recall rate, positive predictive value, rate of screen-detected cancer, and the cumulative risk of a false positive screening result, without and with invasive procedures across the screening centres were calculated. Generalized linear models were used to estimate the probability of a false positive screening result and to compute the cumulative false-positive risk for up to ten biennial screening examinations. Results: The cumulative risk of a false-positive screening exam varied from 10.7% (95% CI: 9.4–12.0%) to 41.5% (95% CI: 34.1–48.9%) across screening centres, with a highest to lowest ratio of 3.9 (95% CI: 3.7–4.0). The highest to lowest ratio for the cumulative risk of undergoing an invasive procedure with a benign outcome was 4.3 (95% CI: 4.0–4.6). The positive predictive value of recall varied between 12.0% (95% CI: 11.0–12.9%) and 19.9% (95% CI: 18.3–21.5%), with a highest to lowest ratio of 1.7 (95% CI: 1.5–1.9). Conclusions: A substantial variation in the performance measures across the screening centres in the Norwegian Breast Cancer Screening Program was identified, despite of similar administration, procedures, and quality assurance requirements. Differences in the

  18. The cumulative risk of false-positive screening results across screening centres in the Norwegian Breast Cancer Screening Program

    International Nuclear Information System (INIS)

    Roman, M.; Skaane, P.; Hofvind, S.

    2014-01-01

    Highlights: • We found variation in early performance measures across screening centres. • Radiologists’ performance may play a key role in the variability. • Potential to improve the effectiveness of breast cancer screening programs. • Continuous surveillance of screening centres and radiologists is essential. - Abstract: Background: Recall for assessment in mammographic screening entails an inevitable number of false-positive screening results. This study aimed to investigate the variation in the cumulative risk of a false positive screening result and the positive predictive value across the screening centres in the Norwegian Breast Cancer Screening Program. Methods: We studied 618,636 women aged 50–69 years who underwent 2,090,575 screening exams (1996–2010. Recall rate, positive predictive value, rate of screen-detected cancer, and the cumulative risk of a false positive screening result, without and with invasive procedures across the screening centres were calculated. Generalized linear models were used to estimate the probability of a false positive screening result and to compute the cumulative false-positive risk for up to ten biennial screening examinations. Results: The cumulative risk of a false-positive screening exam varied from 10.7% (95% CI: 9.4–12.0%) to 41.5% (95% CI: 34.1–48.9%) across screening centres, with a highest to lowest ratio of 3.9 (95% CI: 3.7–4.0). The highest to lowest ratio for the cumulative risk of undergoing an invasive procedure with a benign outcome was 4.3 (95% CI: 4.0–4.6). The positive predictive value of recall varied between 12.0% (95% CI: 11.0–12.9%) and 19.9% (95% CI: 18.3–21.5%), with a highest to lowest ratio of 1.7 (95% CI: 1.5–1.9). Conclusions: A substantial variation in the performance measures across the screening centres in the Norwegian Breast Cancer Screening Program was identified, despite of similar administration, procedures, and quality assurance requirements. Differences in the

  19. External PCR, ASN's decision

    International Nuclear Information System (INIS)

    Anon.

    2012-01-01

    The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)

  20. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  1. Detection of adenoviruses in shellfish by means of conventional-PCR, nested-PCR, and integrated cell culture PCR (ICC/PCR).

    Science.gov (United States)

    Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M

    2005-01-01

    We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.

  2. PCR for diagnosis of male Trichomonas vaginalis infection with chronic prostatitis and urethritis.

    Science.gov (United States)

    Lee, Jong Jin; Moon, Hong Sang; Lee, Tchun Yong; Hwang, Hwan Sik; Ahn, Myoung-Hee; Ryu, Jae-Sook

    2012-06-01

    The aim of this study was to assess the usefulness of PCR for diagnosis of Trichomonas vaginalis infection among male patients with chronic recurrent prostatitis and urethritis. Between June 2001 and December 2003, a total of 33 patients visited the Department of Urology, Hanyang University Guri Hospital and were examined for T. vaginalis infection by PCR and culture in TYM medium. For the PCR, we used primers based on a repetitive sequence cloned from T. vaginalis (TV-E650). Voided bladder urine (VB1 and VB3) was sampled from 33 men with symptoms of lower urinary tract infection (urethral charge, residual urine sensation, and frequency). Culture failed to detect any T. vaginalis infection whereas PCR identified 7 cases of trichomoniasis (21.2%). Five of the 7 cases had been diagnosed with prostatitis and 2 with urethritis. PCR for the 5 prostatitis cases yielded a positive 330 bp band from bothVB1 and VB3, whereas positive results were only obtained from VB1 for the 2 urethritis patients. We showed that the PCR method could detect T. vaginalis when there was only 1 T. vaginalis cell per PCR mixture. Our results strongly support the usefulness of PCR on urine samples for detecting T. vaginalis in chronic prostatitis and urethritis patients.

  3. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  4. The Normal Position of Umbilicus in the Newborn: An Aid to Improve Cosmetic Result in Exomphalos Major

    Directory of Open Access Journals (Sweden)

    H Davari

    2004-02-01

    Full Text Available Background: Position of umbilicus is an important esthetic landmark and its absence or deformity may be associated with poor self-image. In abdominoplasty, the creation of a normal-looking, well shaped and sufficiently deep umbilicus on a normal position seems essential. The aim of this study was to determine the normal position of umbilicus and hence to improve the cosmetic result of exomphalos major repair. Methods: In a cross-sectional study the position of umbilicus was determined in a random sample of 200 healthy and normal neonates (107 boys and 93 girls who were born in Isfahan University hospitals from Oct. 2002 till Mar. 2003, with respect to the xiphisternum and pubis. Results: The normal umbilical position was 59.3 ± 5.2 percent of the way from the inferior border of xiphisternum to the superior border of the pubis in the midline and it was independent of gender and neonatal Conclusions: Recent years have witnessed major improvements in the survival of newborns with exomphalocele. The primary repair of the abdominal wall with umbilicoplasty is generally considered the treatment of choice, and the cosmetic appearance of the navel becomes increasingly important as children grow older. In repair of exomphalos major, the most esthetically pleasing result is obtained if the umbilicus is placed 59.3% of the way from the xiphisternum to the pubis. Keywords: Umbilicus, Exomphalos, Neonate, Umbilicoplasty, Isfahan

  5. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

    Science.gov (United States)

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-07-07

    To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

  6. PR Means Positive Results.

    Science.gov (United States)

    Foree, Marilyn

    1992-01-01

    Describes the advantages of public relations to a school music program. Suggests that, to succeed, a music program must have the support of school administrators, teachers, parents, and students alike. Recommends means of attracting support from the four groups. Stresses the importance of effective local publicity. (SG)

  7. Real-time PCR improves Helicobacter pylori detection in patients with peptic ulcer bleeding.

    Directory of Open Access Journals (Sweden)

    María José Ramírez-Lázaro

    Full Text Available BACKGROUND AND AIMS: Histological and rapid urease tests to detect H. pylori in biopsy specimens obtained during peptic ulcer bleeding episodes (PUB often produce false-negative results. We aimed to examine whether immunohistochemistry and real-time PCR can improve the sensitivity of these biopsies. PATIENTS AND METHODS: We selected 52 histology-negative formalin-fixed paraffin-embedded biopsy specimens obtained during PUB episodes. Additional tests showed 10 were true negatives and 42 were false negatives. We also selected 17 histology-positive biopsy specimens obtained during PUB to use as controls. We performed immunohistochemistry staining and real-time PCR for 16S rRNA, ureA, and 23S rRNA for H. pylori genes on all specimens. RESULTS: All controls were positive for H. pylori on all PCR assays and immunohistochemical staining. Regarding the 52 initially negative biopsies, all PCR tests were significantly more sensitive than immunohistochemical staining (p<0.01. Sensitivity and specificity were 55% and 80% for 16S rRNA PCR, 43% and 90% for ureA PCR, 41% and 80% for 23S rRNA PCR, and 7% and 100% for immunohistochemical staining, respectively. Combined analysis of PCR assays for two genes were significantly more sensitive than ureA or 23S rRNA PCR tests alone (p<0.05 and marginally better than 16S rRNA PCR alone. The best combination was 16S rRNA+ureA, with a sensitivity of 64% and a specificity of 80%. CONCLUSIONS: Real-time PCR improves the detection of H. pylori infection in histology-negative formalin-fixed paraffin-embedded biopsy samples obtained during PUB episodes. The low reported prevalence of H. pylori in PUB may be due to the failure of conventional tests to detect infection.

  8. Does Gender Influence Emotions Resulting from Positive Applause Feedback in Self-Assessment Testing? Evidence from Neuroscience

    Science.gov (United States)

    Liu, Chia-Ju; Huang, Chin-Fei; Liu, Ming-Chi; Chien, Yu-Cheng; Lai, Chia-Hung; Huang, Yueh-Min

    2015-01-01

    Computerized self-assessment testing can help learners reflect on learning content and can also promote their motivation toward learning. However, a positive affective state is the key to achieving these learning goals. This study aims to examine learning gains and emotional reactions resulting from receiving emotional feedback in the form of…

  9. Identification of hazelnut major allergens in sensitive patients with positive double-blind, placebo-controlled food challenge results

    DEFF Research Database (Denmark)

    Pastorello, Elide A; Vieths, Stefan; Pravettoni, Valerio

    2002-01-01

    The hazelnut major allergens identified to date are an 18-kd protein homologous to Bet v 1 and a 14-kd allergen homologous to Bet v 2. No studies have reported hazelnut allergens recognized in patients with positive double-blind, placebo-controlled food challenge (DBPCFC) results or in patients...

  10. What Lies beneath Seemingly Positive Campus Climate Results: Institutional Sexism, Racism, and Male Hostility toward Equity Initiatives and Liberal Bias

    Science.gov (United States)

    Vaccaro, Annemarie

    2010-01-01

    This article presents qualitative results from a campus climate study at one predominately white university. Data analysis uncovered "what lies beneath" a seemingly positive campus climate. Gender differences in survey responses suggest that men and women experienced the climate in vastly different ways. Additionally, lack of deep diversity…

  11. A misleading false-negative result using Neisseria gonorrhoeae opa MGB multiplex PCR assay in patient's rectal sample due to partial mutations of the opa gene.

    Science.gov (United States)

    Vahidnia, Ali; van Empel, Pieter Jan; Costa, Sandra; Oud, Rob T N; van der Straaten, Tahar; Bliekendaal, Harry; Spaargaren, Joke

    2015-07-01

    A 53-year-old homosexual man presented at his general practitioner (GP) practice with a suspicion of sexually transmitted infection. Initial NAAT screening was performed for Chlamydia trachomatis and Neisseria gonorrhoeae. The patient was positive for Neisseria gonorrhoeae both for his urine and rectal sample. The subsequent confirmation test for Neisseria gonorrhoeae by a second laboratory was only confirmed for the urine sample and the rectal sample was negative. We report a case of a potential false-negative diagnosis of Neisseria gonorrhoeae due to mutations of DNA sequence in the probe region of opa-MGB assay of the rectal sample. The patient did not suffer any discomfort as diagnosis of Neisseria gonorrhoeae in his urine sample had already led to treatment by prescribing the patient with Ceftriaxone 500 mg IV dissolved in 1 ml lidocaine 2% and 4 mL saline. The patient also received a prescription for Azithromycin (2x500 mg).

  12. A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

    Science.gov (United States)

    Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

    2016-01-01

    To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

  13. [False positive results or what's the probability that a significant P-value indicates a true effect?

    Science.gov (United States)

    Cucherat, Michel; Laporte, Silvy

    2017-09-01

    The use of statistical test is central in the clinical trial. At the statistical level, obtaining a Pinformation about the plausibility of the existence of treatment effect. With "Pfalse positive is very high. This is the case if the power is low, if there is an inflation of the alpha risk or if the result is exploratory or chance discoveries. This possibility is important to take into consideration when interpreting the results of clinical trials in order to avoid pushing ahead significant results in appearance, but which are likely to be actually false positive results. Copyright © 2017 Société française de pharmacologie et de thérapeutique. Published by Elsevier Masson SAS. All rights reserved.

  14. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi

    International Nuclear Information System (INIS)

    Andrade, Antero Silva Ribeiro de; Moreno, Elizabeth Castro; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela; Fernandes, Octavio

    2002-01-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with 32 P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with 32 P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  15. Detection and Differentiation of Leishmania spp. in Clinical Specimens by Use of a SYBR Green-Based Real-Time PCR Assay.

    Science.gov (United States)

    de Almeida, Marcos E; Koru, Ozgur; Steurer, Francis; Herwaldt, Barbara L; da Silva, Alexandre J

    2017-01-01

    Leishmaniasis in humans is caused by Leishmania spp. in the subgenera Leishmania and Viannia Species identification often has clinical relevance. Until recently, our laboratory relied on conventional PCR amplification of the internal transcribed spacer 2 (ITS2) region (ITS2-PCR) followed by sequencing analysis of the PCR product to differentiate Leishmania spp. Here we describe a novel real-time quantitative PCR (qPCR) approach based on the SYBR green technology (LSG-qPCR), which uses genus-specific primers that target the ITS1 region and amplify DNA from at least 10 Leishmania spp., followed by analysis of the melting temperature (T m ) of the amplicons on qPCR platforms (the Mx3000P qPCR system [Stratagene-Agilent] and the 7500 real-time PCR system [ABI Life Technologies]). We initially evaluated the assay by testing reference Leishmania isolates and comparing the results with those from the conventional ITS2-PCR approach. Then we compared the results from the real-time and conventional molecular approaches for clinical specimens from 1,051 patients submitted to the reference laboratory of the Centers for Disease Control and Prevention for Leishmania diagnostic testing. Specimens from 477 patients tested positive for Leishmania spp. with the LSG-qPCR assay, specimens from 465 of these 477 patients also tested positive with the conventional ITS2-PCR approach, and specimens from 10 of these 465 patients had positive results because of retesting prompted by LSG-qPCR positivity. On the basis of the T m values of the LSG-qPCR amplicons from reference and clinical specimens, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate; the Leishmania (Leishmania) donovani complex in aggregate; the species L (L) tropica; and the species L (L) mexicana, L (L) amazonensis, L (L) major, and L (L) aethiopica in aggregate. Copyright © 2016 American Society for Microbiology.

  16. A custom-made guide-wire positioning device for Hip Surface Replacement Arthroplasty: description and first results

    Directory of Open Access Journals (Sweden)

    Clijmans Tim

    2010-07-01

    Full Text Available Abstract Background Hip surface replacement arthroplasty (SRA can be an alternative for total hip arthroplasty. The short and long-term outcome of hip surface replacement arthroplasty mainly relies on the optimal size and position of the femoral component. This can be defined before surgery with pre-operative templating. Reproducing the optimal, templated femoral implant position during surgery relies on guide wire positioning devices in combination with visual inspection and experience of the surgeon. Another method of transferring the templated position into surgery is by navigation or Computer Assisted Surgery (CAS. Though CAS is documented to increase accurate placement particularly in case of normal hip anatomy, it requires bulky equipment that is not readily available in each centre. Methods A custom made neck jig device is presented as well as the results of a pilot study. The device is produced based on data pre-operatively acquired with CT-scan. The position of the guide wire is chosen as the anatomical axis of the femoral neck. Adjustments to the design of the jig are made based on the orthopedic surgeon's recommendations for the drill direction. The SRA jig is designed as a slightly more-than-hemispherical cage to fit the anterior part of the femoral head. The cage is connected to an anterior neck support. Four knifes are attached on the central arch of the cage. A drill guide cylinder is attached to the cage, thus allowing guide wire positioning as pre-operatively planned. Custom made devices were tested in 5 patients scheduled for total hip arthroplasty. The orthopedic surgeons reported the practical aspects of the use of the neck-jig device. The retrieved femoral heads were analyzed to assess the achieved drill place in mm deviation from the predefined location and orientation compared to the predefined orientation. Results The orthopedic surgeons rated the passive stability, full contact with neck portion of the jig and knife

  17. Galactomannan and Real-Time PCR in the diagnosis of invasive Aspergillosis: preliminary data

    Directory of Open Access Journals (Sweden)

    Cristina Pedrotti

    2014-03-01

    Full Text Available The diagnosis of invasive aspergillosis is notoriously difficult. The standard culture-based methods have shown considerable limitations in performance. For this reason, non-culture methods have been increasingly employed for the diagnosis of invasive aspergillosis, and, among them, the methods based on Real-Time polymerase chain reaction (RT-PCR. In this study we assess the contribution in lowering diagnosis errors provided by the RT-PCR method when run alongside other methods. We analyzed 23 biological samples, 14 serum samples, and 9 bronchoalveolar lavage samples (BAL from 10 immunocompromised patients who were selected according to EORTC/MSG criteria (European Organization for Research and Treatment of Cancer/Mycoses Study Group. On the serum sample we searched the galactomannan (GM (Platelia Aspergillus® and the fungal genome (MycAssayTMAspergillus; the BAL samples were subjected also to the culture tests. In 11 serum samples the results showed concordance between GM and RT–PCR tests, while in 3 samples we report discordance: 2 results were GM positive and RT-PCR negative, and 1 results GM negative and RT-PCR indeterminate. In 5 BAL samples the results showed concordance between the two methods, while 4 were GM positive and RT-PCR negative. The data, although still preliminary, suggest an increased accuracy in the diagnosis of suspected invasive aspergillosis when employing both RT-PCR and GM tests given that the RT-PCR test eliminates the false positive results of the GM test. The PCR methods require, however, further applications of this type of diagnostic because of the severe limit given by the lack of standardization.

  18. The Relationship between Positive Well-Being and Academic Assessment: Results from a Prospective Study on Dental Students

    Directory of Open Access Journals (Sweden)

    Cristina Teodora Preoteasa

    2016-01-01

    Full Text Available Background. Presumably, the academic stress that builds throughout the academic year has a negative effect on dental students’ psychological well-being and may have a relationship with academic performance. This research aimed to analyse the variation of positive well-being in second-year dental students, across the academic semester, in relation to consecutive examinations as part of academic assessment system (1 and to observe the relationship between academic performance during semester evaluation period and dental students’ positive well-being (2. Methods. A prospective study was conducted on second-year dental students, data on positive well-being being collected with WHO-Five Well-Being Index (WHO-5, at the beginning of the semester and after three consecutive mandatory examinations. Results. One hundred and forty-six dental students were included (77% response rate. Repeated ANOVA showed a significant progressive decline of positive well-being over the semester, which was clinically significant for an important part of them. Students who performed better in the semester evaluation period registered higher well-being levels at the beginning of the semester but a more pronounced decline of it until the semester evaluation period. Conclusion. Based on this research, a relationship between positive well-being, academic assessments, and academic performance is suggested, when evaluating them in a prospective frame.

  19. Single-Lung Transplant Results in Position Dependent Changes in Regional Ventilation: An Observational Case Series Using Electrical Impedance Tomography

    Directory of Open Access Journals (Sweden)

    Kollengode Ramanathan

    2016-01-01

    Full Text Available Background. Lung transplantation is the optimal treatment for end stage lung disease. Donor shortage necessitates single-lung transplants (SLT, yet minimal data exists regarding regional ventilation in diseased versus transplanted lung measured by Electrical Impedance Tomography (EIT. Method. We aimed to determine regional ventilation in six SLT outpatients using EIT. We assessed end expiratory volume and tidal volumes. End expiratory lung impedance (EELI and Global Tidal Variation of Impedance were assessed in supine, right lateral, left lateral, sitting, and standing positions in transplanted and diseased lungs. A mixed model with random intercept per subject was used for statistical analysis. Results. EELI was significantly altered between diseased and transplanted lungs whilst lying on right and left side. One patient demonstrated pendelluft between lungs and was therefore excluded for further comparison of tidal variation. Tidal variation was significantly higher in the transplanted lung for the remaining five patients in all positions, except when lying on the right side. Conclusion. Ventilation to transplanted lung is better than diseased lung, especially in lateral positions. Positioning in patients with active unilateral lung pathologies will be implicated. This is the first study demonstrating changes in regional ventilation, associated with changes of position between transplanted and diseased lung.

  20. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  1. Positive outcomes influence the rate and time to publication, but not the impact factor of publications of clinical trial results.

    Directory of Open Access Journals (Sweden)

    Pilar Suñé

    Full Text Available OBJECTIVES: Publication bias may affect the validity of evidence based medical decisions. The aim of this study is to assess whether research outcomes affect the dissemination of clinical trial findings, in terms of rate, time to publication, and impact factor of journal publications. METHODS AND FINDINGS: All drug-evaluating clinical trials submitted to and approved by a general hospital ethics committee between 1997 and 2004 were prospectively followed to analyze their fate and publication. Published articles were identified by searching Pubmed and other electronic databases. Clinical study final reports submitted to the ethics committee, final reports synopses available online and meeting abstracts were also considered as sources of study results. Study outcomes were classified as positive (when statistical significance favoring experimental drug was achieved, negative (when no statistical significance was achieved or it favored control drug and descriptive (for non-controlled studies. Time to publication was defined as time from study closure to publication. A survival analysis was performed using a Cox regression model to analyze time to publication. Journal impact factors of identified publications were recorded. Publication rate was 48·4% (380/785. Study results were identified for 68·9% of all completed clinical trials (541/785. Publication rate was 84·9% (180/212 for studies with results classified as positive and 68·9% (128/186 for studies with results classified as negative (p<0·001. Median time to publication was 2·09 years (IC95 1·61-2·56 for studies with results classified as positive and 3·21 years (IC95 2·69-3·70 for studies with results classified as negative (hazard ratio 1·99 (IC95 1·55-2·55. No differences were found in publication impact factor between positive (median 6·308, interquartile range: 3·141-28·409 and negative result studies (median 8·266, interquartile range: 4·135-17·157. CONCLUSIONS

  2. Evaluation of nested PCR in diagnosis of fungal rhinosinusitis.

    Science.gov (United States)

    Badiee, Parisa; Gandomi, Behrooz; Sabz, Gholamabbass; Khodami, Bijan; Choopanizadeh, Maral; Jafarian, Hadis

    2015-02-01

    Given the importance of rapid diagnosis for fungal rhinosinusitis, this study aimed to evaluate the use of nested PCR to identify Aspergillus and Mucor species in clinical samples from patients with suspected fungal rhinosinusitis. Functional endoscopic sinus surgery specimens were collected from 98 patients with rhinosinusitis from 2012 to 2013. All samples were ground and cultured on sabouraud dextrose agar. The isolated fungi were identified based on their macroscopic and microscopic features. Fungal DNA was extracted from the tissue samples and nested PCR was performed with two sets of primers for Mucor and Aspergillus. Direct microscopic showed that 5.1% contained fungal components and 9.2% exhibited growth of fungi in culture. The most common agents isolated were Aspergillus fumigatus (n= 3), Aspergillus flavus (n=2), Penicillium sp (n=3) and Alternaria sp. (n=1). Mucor sp. was identified in the pathology smear from 1 patient. Positive results for fungal rhinosinusitis were obtained for a total of 10.2% by culture or pathology smear. Positive PCR results were obtained in 72 samples for Aspergillus and 31 samples for Mucor. Our results suggest that endoscopic sinus surgery specimens are not suitable for nested PCR, probably because of the accumulation of fungi that contaminate the environmental air. This drawback is a limiting factor for diagnosis with nasal cavity specimens. Therefore, molecular methods and conventional culture techniques are helpful complementary diagnostic methods to detect fungal rhinosinusitis and determine appropriate management for these patients.

  3. Detection of Hepatitis B Virus (HBV) in Blood Serum By Means of PCR (Polymerase Chain Reaction) Technique

    International Nuclear Information System (INIS)

    Lina, M.; Dadang, S.; Suhadi, F.

    2002-01-01

    Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer

  4. Antimicrobial susceptibility of quinupristin/dalfopristin tested against gram-positive cocci from Latin America: results from the Global SMART (GSMART surveillance study

    Directory of Open Access Journals (Sweden)

    Sader Helio S.

    2001-01-01

    Full Text Available Gram-positive cocci are important causes of both nosocomial and community-acquired infections, and antimicrobial resistance among these pathogens has become an important problem worldwide. Since resistance among these organisms can vary substantially by geographic location, we conducted a multicenter surveillance study with isolates from five Latin American countries (15 medical centers. Quinupristin/dalfopristin (formerly RP-59500 is a novel streptogramin combination with focused activity against Gram-positive cocci, many exhibiting emerging resistance. The in vitro activity of quinupristin/dalfopristin and 12 other antimicrobial agents were evaluated against 1,948 strains including Staphylococcus aureus (747 strains, coagulase-negative staphylococci (CoNS; 446 strains, enterococci (429 strains, and various Streptococcus spp. (326 strains. Oxacillin resistance was observed in 41% of S. aureus (MIC, or = 13 mm and 40% of CoNS (MIC, or = 18 mm. Vancomycin, teicoplanin, and quinupristin/dalfopristin (MIC90, 0.25 - 1 mug/ml remained effective against all strains, but cross-resistance was high among other tested drugs. The quinupristin/dalfopristin MIC50 for Streptococcus pneumoniae and other streptococci was only 0.5 mug/ml (13% to 28% were penicillin-resistant; 12% to 22% were macrolide-resistant. Enterococci demonstrated variable inhibition by quinupristin/dalfopristin depending upon identification and the susceptibility testing method used. The demonstrated quinupristin/dalfopristin activity against Enterococcus faecium was confirmed, but potential species identification errors with various commercial systems continue to confuse susceptibility statistics, even though some strains of E. faecium confirmed by PCR-based or other molecular identification techniques did have quinupristin/dalfopristin MICs of > or = 4 mug/mL. Most important, glycopeptide-resistant enterococci are rapidly emerging in Latin America, and quinupristin/dalfopristin appears

  5. Automated 5 ' nuclease PCR assay for identification of Salmonella enterica

    DEFF Research Database (Denmark)

    Hoorfar, Jeffrey; Ahrens, Peter; Rådström, P.

    2000-01-01

    -point fluorescence (FAM) signals for the samples and positive control (TET) signals (relative sensitivity [Delta Rn], >0.6). The diagnostic specificity of the method was assessed using 120 non-Salmonella strains, which all resulted in negative FAM signals (Delta Rn, less than or equal to 0.5). All 100 rough...... Salmonella strains tested resulted in positive FAM and TET signals. In addition, it was found that the complete PCR mixture, predispensed in microwell plates, could be stored for up to 3 months at -20 degrees C, Thus, the diagnostic TaqMan assay developed can be a useful and simple alternative method......A simple and ready-to-go test based on a 5' nuclease (TaqMan) PCR technique was developed for identification of presumptive Salmonella enterica isolates. The results were compared with those of conventional methods. The TaqMan assay was evaluated for its ability to accurately detect 210 S. enterica...

  6. False positive results occurring in a radioimmunoassay for hepatitis A IgM antibody of the IgM class

    Energy Technology Data Exchange (ETDEWEB)

    Bucens, M R; Pietroboni, G R; Harnett, G B [Virus Lab., Combined Microbiology Service, Queen Elizabeth II Medical Centre, Perth, Western Australia

    1983-12-01

    The diagnosis of hepatitis A infection is usually based on the presence of hepatitis A specific IgM in a single serum sample. The fortuitous observation in one patient that this reactivity was apparently still present 19 mth after her original illness led to the discovery that the ABBOTT HAVAB-M kit method may produce false positive results. A series of patients who had previously had hepatitis A was retested and false positive results were found in 6% of this group. Control groups consisted of patients with other acute and chronic liver disorders and other acute viral diseases. No reactivity was detected in the control sera. Sucrose gradient fractionation revealed that the factor responsible for the false positive results was associated only with serum fractions containing IgA and IgG and that it could be removed by absorption of sera with staphylococcal protein A but not by absorption with streptococcus AR1 or by 2-mercaptoethanol treatment. It was concluded that following hepatitis A infection some patients produce a rheumatoid factor-like substance (not of IgM class) which is cleared from the serum in 2-3 yr. The presence of this factor may lead to a misdiagnosis in patients presenting with jaundice.

  7. The effect of different position of grape clusters on the bearing shoot on production results of Cabernet Sauvignon clones

    Directory of Open Access Journals (Sweden)

    Čoloveić Ana

    2014-01-01

    Full Text Available In this paper the differences were examined between clones of Cabernet sauvignon (clones ISV-F-V5, ISV-F-V6 and R5, i.e. the difference between uvological properties of grape clusters and grape berries, based on the different positions on the bearing shoot. Tests were conducted at the experimental field of the Faculty of Agriculture 'Radmilovac'. Standard ampelographic methods were used in numerous analyses of grape yield, as well as uvological properties of clones. All data were statistically analyzed and processed by the method of two-factor analysis of variance with repeated measuring of one factor (height and Tukey HSD test. Analysis of variance showed no significant differences between clones. The best results were achieved with grape clusters positioned in the base of bearing shoot. The first positioned grape clusters on the bearing shoot had the highest share in the total grape yield, the highest amount of sugar, and the highest positioned grape clusters had higher content of total acids. The differences determined between examined clones were in regard to productivity and quality of grapes which reflected also on production value.

  8. When it hurts, a positive attitude may help: association of positive affect with daily walking in knee osteoarthritis. Results from a multicenter longitudinal cohort study.

    Science.gov (United States)

    White, Daniel K; Keysor, Julie J; Neogi, Tuhina; Felson, David T; LaValley, Michael; Gross, K Doug; Niu, Jingbo; Nevitt, Michael; Lewis, Cora E; Torner, Jim; Fredman, Lisa

    2012-09-01

    While depressive symptoms and knee pain are independently known to impede daily walking in older adults, it is unknown whether positive affect promotes daily walking. This study investigated this association among adults with knee osteoarthritis (OA) and examined whether knee pain modified this association. This study is a cross-sectional analysis of the Multicenter Osteoarthritis Study. We included 1,018 participants (mean ± SD age 63.1 ± 7.8 years, 60% women) who had radiographic knee OA and had worn a StepWatch monitor to record their number of steps per day. High and low positive affect and depressive symptoms were based on the Center for Epidemiologic Studies Depression Scale. Knee pain was categorized as present in respondents who reported pain on most days at both a clinic visit and a telephone screening. Compared to respondents with low positive affect (27% of all respondents), those with high positive affect (63%) walked a similar number of steps per day, while those with depressive symptoms (10%) walked less (adjusted β -32.6 [95% confidence interval (95% CI) -458.9, 393.8] and -579.1 [95% CI -1,274.9, 116.7], respectively). There was a statistically significant interaction of positive affect by knee pain (P = 0.0045). Among the respondents with knee pain (39%), those with high positive affect walked significantly more steps per day (adjusted β 711.0 [95% CI 55.1, 1,366.9]) than those with low positive affect. High positive affect was associated with more daily walking among adults with painful knee OA. Positive affect may be an important psychological factor to consider for promoting physical activity among people with painful knee OA. Copyright © 2012 by the American College of Rheumatology.

  9. Pitfalls in PCR troubleshooting: Expect the unexpected?

    Directory of Open Access Journals (Sweden)

    Livia Schrick

    2016-01-01

    Full Text Available PCR is a well-understood and established laboratory technique often used in molecular diagnostics. Huge experience has been accumulated over the last years regarding the design of PCR assays and their set-up, including in-depth troubleshooting to obtain the optimal PCR assay for each purpose. Here we report a PCR troubleshooting that came up with a surprising result never observed before. With this report we hope to sensitize the reader to this peculiar problem and to save troubleshooting efforts in similar situations, especially in time-critical and ambitious diagnostic settings.

  10. Diversity of Clostridium difficile PCR ribotypes in Europe: results from the European, multicentre, prospective, biannual, point-prevalence study of Clostridium difficile infection in hospitalised patients with diarrhoea (EUCLID), 2012 and 2013.

    Science.gov (United States)

    Davies, Kerrie A; Ashwin, Helen; Longshaw, Christopher M; Burns, David A; Davis, Georgina L; Wilcox, Mark H

    2016-07-21

    Clostridium difficile infection (CDI) is the major cause of infective diarrhoea in healthcare environments. As part of the European, multicentre, prospective, biannual, point-prevalence study of Clostridium difficile infection in hospitalised patients with diarrhoea (EUCLID), the largest C. difficile epidemiological study of its type, PCR ribotype distribution of C. difficile isolates in Europe was investigated. PCR ribotyping was performed on 1,196 C. difficile isolates from diarrhoeal samples sent to the European coordinating laboratory in 2012-13 and 2013 (from two sampling days) by 482 participating hospitals from 19 European countries. A total of 125 ribotypes were identified, of which ribotypes 027 (19%, n =222), 001/072 (11%, n = 134) and 014/020 (10%, n = 119) were the most prevalent. Distinct regional patterns of ribotype distribution were noted. Of 596 isolates from patients with toxin-positive stools (CDI cases), ribotype 027 accounted for 22% (32/144) of infections in cases aged from 18 to less than 65 years, but the prevalence decreased in those aged ≥ 65 years (14% (59/412)) and further decreased in those aged ≥ 81 years (9% (18/195)). The prevalence of ribotype 027 and 176, but not other epidemic strains, was inversely proportional to overall ribotype diversity (R(2) = 0.717). This study highlights an increased diversity of C. difficile ribotypes across Europe compared with previous studies, with considerable intercountry variation in ribotype distribution. Continuous surveillance programmes are necessary to monitor the changing epidemiology of C. difficile. This article is copyright of The Authors, 2016.

  11. Knowledge, attitudes and practices of HIV-positive patients regarding disclosure of HIV results at Betesda Clinic in Namibia

    Directory of Open Access Journals (Sweden)

    Penelope Tom

    2013-02-01

    Full Text Available Background: This study examined the practices, knowledge, attitudes, and the reasons for disclosure and non-disclosure of HIV-positive patients with regard to the disclosure of HIV results at Betesda Clinic in Windhoek, Namibia.Objectives: The objectives of the study were to determine knowledge, attitudes, and practices of HIV-positive patients regarding the disclosure of HIV status at Betesda Clinic in Namibia, and to determine the reasons for disclosure and non-disclosure.Methods: This was a cross-sectional descriptive study and 263 HIV-positive patients were enrolled in the study.Results: Analyses revealed that knowledge on disclosure was good, with 68% who thought it was important. The majority (73% have disclosed and 60% disclosed within 1 week of receiving their results. The most common reasons for disclosure were that 32% needed help, 25% wanted his or her partner to go for testing, and 20% wanted to let relatives know. Reasons for non-disclosure were mainly the fear of gossip (79%. Seventy-three per cent had disclosed to their partners, and 23% had disclosed to more than one person. People’s reactions were supportive in 43%, whereas 29% understood, 9% accepted and 6% were angry. Upon disclosure 40% received help, 24% of partners were tested, 23% received psychological support and 5% were stigmatised. Disclosure was higher amongst the married and cohabitating.Conclusion: The attitude was positive with regard to knowledge of disclosure, with most participants thinking that disclosure was important and good. The attitudes and actual practices of disclosure were encouraging; however, people are disclosing only to trustedindividuals in the society and the fear of stigma is still present although the actual stigma was very low.

  12. Droplet digital PCR (ddPCR) vs quantitative real-time PCR (qPCR) approach for detection and quantification of Merkel cell polyomavirus (MCPyV) DNA in formalin fixed paraffin embedded (FFPE) cutaneous biopsies.

    Science.gov (United States)

    Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna

    2017-08-01

    Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Droplet digital PCR technology promises new applications and research areas.

    Science.gov (United States)

    Manoj, P

    2016-01-01

    Digital Polymerase Chain Reaction (dPCR) is used to quantify nucleic acids and its applications are in the detection and precise quantification of low-level pathogens, rare genetic sequences, quantification of copy number variants, rare mutations and in relative gene expressions. Here the PCR is performed in large number of reaction chambers or partitions and the reaction is carried out in each partition individually. This separation allows a more reliable collection and sensitive measurement of nucleic acid. Results are calculated by counting amplified target sequence (positive droplets) and the number of partitions in which there is no amplification (negative droplets). The mean number of target sequences was calculated by Poisson Algorithm. Poisson correction compensates the presence of more than one copy of target gene in any droplets. The method provides information with accuracy and precision which is highly reproducible and less susceptible to inhibitors than qPCR. It has been demonstrated in studying variations in gene sequences, such as copy number variants and point mutations, distinguishing differences between expression of nearly identical alleles, assessment of clinically relevant genetic variations and it is routinely used for clonal amplification of samples for NGS methods. dPCR enables more reliable predictors of tumor status and patient prognosis by absolute quantitation using reference normalizations. Rare mitochondrial DNA deletions associated with a range of diseases and disorders as well as aging can be accurately detected with droplet digital PCR.

  14. Knowledge, attitudes and practices of HIV-positive patients regarding disclosure of HIV results at Betesda Clinic in Namibia

    Directory of Open Access Journals (Sweden)

    Penelope Tom

    2013-02-01

    Objectives: The objectives of the study were to determine knowledge, attitudes, and practices of HIV-positive patients regarding the disclosure of HIV status at Betesda Clinic in Namibia, and to determine the reasons for disclosure and non-disclosure. Methods: This was a cross-sectional descriptive study and 263 HIV-positive patients were enrolled in the study. Results: Analyses revealed that knowledge on disclosure was good, with 68% who thought it was important. The majority (73% have disclosed and 60% disclosed within 1 week of receiving their results. The most common reasons for disclosure were that 32% needed help, 25% wanted his or her partner to go for testing, and 20% wanted to let relatives know. Reasons for non-disclosure were mainly the fear of gossip (79%. Seventy-three per cent had disclosed to their partners, and 23% had disclosed to more than one person. People’s reactions were supportive in 43%, whereas 29% understood, 9% accepted and 6% were angry. Upon disclosure 40% received help, 24% of partners were tested, 23% received psychological support and 5% were stigmatised. Disclosure was higher amongst the married and cohabitating. Conclusion: The attitude was positive with regard to knowledge of disclosure, with most participants thinking that disclosure was important and good. The attitudes and actual practices of disclosure were encouraging; however, people are disclosing only to trusted individuals in the society and the fear of stigma is still present although the actual stigma was very low.

  15. Development and application of a universal Hemoplasma screening assay based on the SYBR green PCR principle.

    Science.gov (United States)

    Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina

    2009-12-01

    Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.

  16. False-positive result when a diphenylcarbazide spot test is used on trivalent chromium-passivated zinc surfaces

    DEFF Research Database (Denmark)

    Reveko, Valeriia; Lampert, Felix; Din, Rameez Ud

    2018-01-01

    chromium passivation on zinc; however, subsequent analysis by XPS could not confirm the presence of chromium in a hexavalent state. Conclusions Unintended oxidation of DPC induced by atmospheric corrosion is suggested as a possible reason for the false-positive reaction of the DPC test on a trivalent......A colorimetric 1,5-diphenylcarbazide (DPC)-based spot test can be used to identify hexavalent chromium on various metallic and leather surfaces. DPC testing on trivalent chromium-passivated zinc surfaces has unexpectedly given positive results in some cases, apparently indicating the presence...... of hexavalent chromium; however, the presence of hexavalent chromium has never been confirmed with more sensitive and accurate test methods. Objectives To examine the presence of hexavalent chromium on trivalent chromium-passivated zinc surfaces with a DPC-based spot test. Methods A colorimetric DPC spot test...

  17. Latest Performance Results from the FONT5 Intra-train Beam Position and Angle Feedback System at ATF2

    CERN Document Server

    Christian, G B; Bett, D R; Blaskovic Kraljevic, N; Burrows, P N; Davis, M R; Gerbershagen, A; Perry, C; Constance, B; Resta-Lopez, J

    2012-01-01

    A prototype Interaction Point beam-based feedback system for future electron-positron colliders, such as the International Linear Collider, has been designed and tested on the extraction line of the KEK Accelerator Test Facility (ATF). The FONT5 intra-train feedback system aims to stabilize the beam orbit by correcting both the position and angle jitter in the vertical plane on bunch-tobunch time scales, providing micron-level stability at the entrance to the ATF2 final-focus system. The system comprises three stripline beam position monitors (BPMs) and two stripline kickers, custom low-latency analogue front-end BPM processors, a custom FPGA-based digital processing board with fast ADCs, and custom kickerdrive amplifiers. The latest results from beam tests at ATF2 will be presented, including the system latency and correction performance.

  18. Development and first evaluation of a novel multiplex real-time PCR on whole blood samples for rapid pathogen identification in critically ill patients with sepsis.

    Science.gov (United States)

    van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L

    2018-04-26

    Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.

  19. A nested real-time PCR assay for the quantification of Plasmodium falciparum DNA extracted from dried blood spots.

    Science.gov (United States)

    Tran, Tuan M; Aghili, Amirali; Li, Shanping; Ongoiba, Aissata; Kayentao, Kassoum; Doumbo, Safiatou; Traore, Boubacar; Crompton, Peter D

    2014-10-04

    As public health efforts seek to eradicate malaria, there has been an emphasis on eliminating low-density parasite reservoirs in asymptomatic carriers. As such, diagnosing submicroscopic Plasmodium infections using PCR-based techniques has become important not only in clinical trials of malaria vaccines and therapeutics, but also in active malaria surveillance campaigns. However, PCR-based quantitative assays that rely on nucleic acid extracted from dried blood spots (DBS) have demonstrated lower sensitivity than assays that use cryopreserved whole blood as source material. The density of Plasmodium falciparum asexual parasites was quantified using genomic DNA extracted from dried blood spots (DBS) and the sensitivity of two approaches was compared: quantitative real-time PCR (qPCR) targeting the P. falciparum 18S ribosomal RNA gene, either with an initial conventional PCR amplification prior to qPCR (nested qPCR), or without an initial amplification (qPCR only). Parasite densities determined by nested qPCR, qPCR only, and light microscopy were compared. Nested qPCR results in 10-fold higher sensitivity (0.5 parasites/μl) when compared to qPCR only (five parasites/ul). Among microscopy-positive samples, parasite densities calculated by nested qPCR correlated strongly with microscopy for both asymptomatic (Pearson's r=0.58, PNested qPCR improves the sensitivity for the detection of P. falciparum blood-stage infection from clinical DBS samples. This approach may be useful for active malaria surveillance in areas where submicroscopic asymptomatic infections are prevalent.

  20. Comparison of phenotypic and PCR methods for detection of carbapenemases production by Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Maryam AlTamimi

    2017-01-01

    Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.

  1. Public health consequences of a false-positive laboratory test result for Brucella--Florida, Georgia, and Michigan, 2005.

    Science.gov (United States)

    2008-06-06

    Human brucellosis, a nationally notifiable disease, is uncommon in the United States. Most human cases have occurred in returned travelers or immigrants from regions where brucellosis is endemic, or were acquired domestically from eating illegally imported, unpasteurized fresh cheeses. In January 2005, a woman aged 35 years who lived in Nassau County, Florida, received a diagnosis of brucellosis, based on results of a Brucella immunoglobulin M (IgM) enzyme immunoassay (EIA) performed in a commercial laboratory using analyte specific reagents (ASRs); this diagnosis prompted an investigation of dairy products in two other states. Subsequent confirmatory antibody testing by Brucella microagglutination test (BMAT) performed at CDC on the patient's serum was negative. The case did not meet the CDC/Council of State and Territorial Epidemiologists' (CSTE) definition for a probable or confirmed brucellosis case, and the initial EIA result was determined to be a false positive. This report summarizes the case history, laboratory findings, and public health investigations. CDC recommends that Brucella serology testing only be performed using tests cleared or approved by the Food and Drug Administration (FDA) or validated under the Clinical Laboratory Improvement Amendments (CLIA) and shown to reliably detect the presence of Brucella infection. Results from these tests should be considered supportive evidence for recent infection only and interpreted in the context of a clinically compatible illness and exposure history. EIA is not considered a confirmatory Brucella antibody test; positive screening test results should be confirmed by Brucella-specific agglutination (i.e., BMAT or standard tube agglutination test) methods.

  2. Comparison of clinical samples for visceral Leishmaniasis diagnosis in asymptomatic dogs by PCR hybridization

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Sidney A.; Ituassu, Leonardo T.; Melo, Maria N. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com, e-mail: Itituassu@yahoo.com.br, e-mail: melo@icb.ufmg.br; Leite, Rodrigo S.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN/MG), Belo Horizonte, MG (Brazil)], e-mail: rleite2005@gmail.com, e-mail: antero@cdtn.br

    2009-07-01

    The canine visceral leishmaniasis (CVL) diagnosis still represents a challenge because of complexity of this disease. The aim of present study was to compare different clinical samples for diagnosis of CVL by Polymerase Chain Reaction (PCR) combined with hybridization of {sup 32}P labeled probes. Bone marrow (BM), skin biopsy (SB), peripheral blood (PB) and conjunctival swab (CS) were used in this work. With this purpose 40 asymptomatic dogs, all positive by parasitological test, were obtained. From each animal were collected SB with sterile punches from ear internal surface, 1.0 mL of PB, BM aspirates from sternum and CS from both lower eyelid. Each clinical sample was submitted to suitable DNA purification process and PCR-hybridization assays. The positive results obtained with PCR were 55%, 25%, 30% and 22.5% for CS, BM, SB and PB respectively while the PCR followed by hybridization showed a positivity of 87.5%, 50%, 45% and 27.5% respectively. The hybridization assay was able to increase the PCR positivity in all kinds of clinical samples. The best performance was obtained using CS samples. We concluded that the PCR associated with DNA radioactive probes was a very sensitive tool for diagnosis of CVL in asymptomatic dogs and the CS has an important potential for regular screening of dogs. (author)

  3. Comparison of clinical samples for visceral Leishmaniasis diagnosis in asymptomatic dogs by PCR hybridization

    International Nuclear Information System (INIS)

    Ferreira, Sidney A.; Ituassu, Leonardo T.; Melo, Maria N.

    2009-01-01

    The canine visceral leishmaniasis (CVL) diagnosis still represents a challenge because of complexity of this disease. The aim of present study was to compare different clinical samples for diagnosis of CVL by Polymerase Chain Reaction (PCR) combined with hybridization of 32 P labeled probes. Bone marrow (BM), skin biopsy (SB), peripheral blood (PB) and conjunctival swab (CS) were used in this work. With this purpose 40 asymptomatic dogs, all positive by parasitological test, were obtained. From each animal were collected SB with sterile punches from ear internal surface, 1.0 mL of PB, BM aspirates from sternum and CS from both lower eyelid. Each clinical sample was submitted to suitable DNA purification process and PCR-hybridization assays. The positive results obtained with PCR were 55%, 25%, 30% and 22.5% for CS, BM, SB and PB respectively while the PCR followed by hybridization showed a positivity of 87.5%, 50%, 45% and 27.5% respectively. The hybridization assay was able to increase the PCR positivity in all kinds of clinical samples. The best performance was obtained using CS samples. We concluded that the PCR associated with DNA radioactive probes was a very sensitive tool for diagnosis of CVL in asymptomatic dogs and the CS has an important potential for regular screening of dogs. (author)

  4. A longitudinal evaluation of Treponema pallidum PCR testing in early syphilis

    Directory of Open Access Journals (Sweden)

    Shields Matt

    2012-12-01

    Full Text Available Abstract Background Syphilis is a growing public health problem among men who have sex with men (MSM globally. Rapid and accurate detection of syphilis is vital to ensure patients and their contacts receive timely treatment and reduce ongoing transmission. Methods We evaluated a PCR assay for the diagnosis of Treponema pallidum using swabs of suspected early syphilis lesions in longitudinally assessed MSM. Results We tested 260 MSM for T pallidum by PCR on 288 occasions: 77 (26.7% had early syphilis that was serologically confirmed at baseline or within six weeks, and 211 (73.3% remained seronegative for syphilis. Of 55 men with primary syphilis, 49 were PCR positive, giving a sensitivity of 89.1% (95% CI: 77.8%-95.9% and a specificity of 99.1% (95% CI: 96.5%-99.9%. Of 22 men with secondary syphilis, 11 were PCR positive, giving a sensitivity of 50% (95% CI: 28.2%-71.8% and a specificity of 100% (95% CI: 66.4%-71.8%. Of the 77 syphilis cases, 43 (56% were HIV positive and the sensitivity and specificity of the PCR test did not vary by HIV status. The PCR test was able to detect up to five (10% primary infections that were initially seronegative, including one HIV positive man with delayed seroconversion to syphilis (72 to 140 days and one HIV positive man who did not seroconvert to syphilis over 14 months follow-up. Both men had been treated for syphilis within a week of the PCR test. Conclusions T pallidum PCR is a potentially powerful tool for the early diagnosis of primary syphilis, particularly where a serological response has yet to develop.

  5. Comparison of real-time quantitative PCR and culture for the diagnosis of emerging Rickettsioses.

    Directory of Open Access Journals (Sweden)

    Emmanouil Angelakis

    Full Text Available BACKGROUND: Isolation of Rickettsia species from skin biopsies may be replaced by PCR. We evaluated culture sensitivity compared to PCR based on sampling delay and previous antibiotic treatment. METHODOLOGY/PRINCIPAL FINDINGS: Skin biopsies and ticks from patients with suspected Rickettsia infection were screened for Rickettsia spp. using qPCR, and positive results were amplified and sequenced for the gltA and ompA genes. Immunofluorescence for spotted fever group rickettsial antigens was done for 79 patients. All skin biopsies and only ticks that tested positive using qPCR were cultured in human embryonic lung (HEL fibroblasts using the centrifugation-shell vial technique. Patients and ticks were classified as definitely having rickettsioses if there was direct evidence of infection with a Rickettsia sp. using culture or molecular assays or in patients if serology was positive. Data on previous antibiotic treatments were obtained for patients with rickettsiosis. Rickettsia spp. infection was diagnosed in 47 out of 145 patients (32%, 41 by PCR and 12 by culture, whereas 3 isolates were obtained from PCR negative biopsies. For 3 of the patients serology was positive although PCR and culture were negative. Rickettsia africae was the most common detected species (n = 25, [17.2%] and isolated bacterium (n = 5, [3.4%]. The probability of isolating Rickettsia spp. was 12 times higher in untreated patients and 5.4 times higher in patients from our hometown. Rickettsia spp. was amplified in 24 out of 95 ticks (25% and we isolated 7 R. slovaca and 1 R. raoultii from Dermacentor marginatus. CONCLUSIONS/SIGNIFICANCE: We found a positive correlation between the bacteria copies and the isolation success in skin biopsies and ticks. Culture remains critical for strain analysis but is less sensitive than serology and PCR for the diagnosis of a Rickettsia infection.

  6. Efficacy of a novel PCR- and microarray-based method in diagnosis of a prosthetic joint infection

    Science.gov (United States)

    2014-01-01

    Background and purpose Polymerase chain reaction (PCR) methods enable detection and species identification of many pathogens. We assessed the efficacy of a new PCR and microarray-based platform for detection of bacteria in prosthetic joint infections (PJIs). Methods This prospective study involved 61 suspected PJIs in hip and knee prostheses and 20 negative controls. 142 samples were analyzed by Prove-it Bone and Joint assay. The laboratory staff conducting the Prove-it analysis were not aware of the results of microbiological culture and clinical findings. The results of the analysis were compared with diagnosis of PJIs defined according to the Musculoskeletal Infection Society (MSIS) criteria and with the results of microbiological culture. Results 38 of 61 suspected PJIs met the definition of PJI according to the MSIS criteria. Of the 38 patients, the PCR detected bacteria in 31 whereas bacterial culture was positive in 28 patients. 15 of the PJI patients were undergoing antimicrobial treatment as the samples for analysis were obtained. When antimicrobial treatment had lasted 4 days or more, PCR detected bacteria in 6 of the 9 patients, but positive cultures were noted in only 2 of the 9 patients. All PCR results for the controls were negative. Of the 61 suspected PJIs, there were false-positive PCR results in 6 cases. Interpretation The Prove-it assay was helpful in PJI diagnostics during ongoing antimicrobial treatment. Without preceding treatment with antimicrobials, PCR and microarray-based assay did not appear to give any additional information over culture. PMID:24564748

  7. Semi-robotic 6 degree of freedom positioning for intracranial high precision radiotherapy; first phantom and clinical results

    Directory of Open Access Journals (Sweden)

    Flentje Michael

    2010-05-01

    Full Text Available Abstract Background To introduce a novel method of patient positioning for high precision intracranial radiotherapy. Methods An infrared(IR-array, reproducibly attached to the patient via a vacuum-mouthpiece(vMP and connected to the table via a 6 degree-of-freedom(DoF mechanical arm serves as positioning and fixation system. After IR-based manual prepositioning to rough treatment position and fixation of the mechanical arm, a cone-beam CT(CBCT is performed. A robotic 6 DoF treatment couch (HexaPOD™ then automatically corrects all remaining translations and rotations. This absolute position of infrared markers at the first fraction acts as reference for the following fractions where patients are manually prepositioned to within ± 2 mm and ± 2° of this IR reference position prior to final HexaPOD-based correction; consequently CBCT imaging is only required once at the first treatment fraction. The preclinical feasibility and attainable repositioning accuracy of this method was evaluated on a phantom and human volunteers as was the clinical efficacy on 7 pilot study patients. Results Phantom and volunteer manual IR-based prepositioning to within ± 2 mm and ± 2° in 6DoF was possible within a mean(± SD of 90 ± 31 and 56 ± 22 seconds respectively. Mean phantom translational and rotational precision after 6 DoF corrections by the HexaPOD was 0.2 ± 0.2 mm and 0.7 ± 0.8° respectively. For the actual patient collective, the mean 3D vector for inter-treatment repositioning accuracy (n = 102 was 1.6 ± 0.8 mm while intra-fraction movement (n = 110 was 0.6 ± 0.4 mm. Conclusions This novel semi-automatic 6DoF IR-based system has been shown to compare favourably with existing non-invasive intracranial repeat fixation systems with respect to handling, reproducibility and, more importantly, intra-fraction rigidity. Some advantages are full cranial positioning flexibility for single and fractionated IGRT treatments and possibly increased patient

  8. Frequency of Pathological Changes in Lungs of Bodies with Positive Postmortem Toxicology Results for Narcotics and Psychotropic Substances

    Directory of Open Access Journals (Sweden)

    Babak Mostafazadeh

    2017-01-01

    Full Text Available Background: The pattern of drug abuse in Iran has dramatically changed in recent years, turning from the traditional opioids [opium, opium dross, and refined opium dross (Shireh] into drugs with newer forms. The present study is aimed at investigating the frequency of pathological changes in the lungs of bodies with positive postmortem toxicology results for narcotics and psychotropic substances autopsied in the forensic dissection hall of Tehran, Iran [the Iranian Legal Medicine Organization (LMO]. Methods: The present study is a cross-sectional descriptive study. The sample consisted of 153 bodies, which had been referred to the LMO with positive results in postmortem toxicology for narcotics and psychotropic substances. Results: We found that narcotic drugs and psychotropic substances were used more in men than women. Moreover, the average age of death due to drug use was 36 years old. In addition, methamphetamine was the mostly-used type of substances, and smoking was the most widely used method to use the drugs. Besides, the dominant consistency and color of the lungs of half of the bodies investigated were elastic brown-gray. Moreover, the most common pathologic changes observed in the lungs of the bodies investigated were congestion and edema. Conclusion: Given the prevalence of pathological changes in the lungs of the examined bodies and congestion, edema, and pulmonary hemorrhage, the results of the present study can be particularly effective in determining the drug use and the resultant death in the absence of any previous records and/or a negative result of toxicology.

  9. Diagnostic value of nested-PCR for identification of Malassezia species in dandruff

    Science.gov (United States)

    Jusuf, N. K.; Nasution, T. A.; Ullyana, S.

    2018-03-01

    Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.

  10. USING A MULTIFACETED APPROACH TO IMPROVE THE FOLLOW-UP OF POSITIVE FECAL OCCULT BLOOD TEST RESULTS

    Science.gov (United States)

    Singh, Hardeep; Kadiyala, Himabindu; Bhagwath, Gayathri; Shethia, Anila; El-Serag, Hashem; Walder, Annette; Velez, Maria; Petersen, Laura A.

    2010-01-01

    Background Inadequate follow-up of abnormal fecal occult blood test (FOBT) results occurs in several types of practice settings. Our institution implemented multifaceted quality improvement (QI) activities in 2004–2005 to improve follow-up of FOBT positive results. Activities addressed pre-colonoscopy referral processes and system-level factors such as electronic communication and provider education and feedback. We evaluated their effects on timeliness and appropriateness of positive FOBT follow-up and identified factors that affect colonoscopy performance. Methods Retrospective electronic medical record (EMR) review was used to determine outcomes pre- and post-QI activities in a multi-specialty ambulatory clinic of a tertiary care Veterans Affairs facility and its affiliated satellite clinics. From 1869 FOBT positive cases, 800 were randomly selected from time periods before and after QI activities. Two reviewers used a pretested standardized data collection form to determine whether colonoscopy was appropriate or indicated based on pre-determined criteria and if so, the timeliness of colonoscopy referral and performance pre- and post-QI activities. Results In cases where a colonoscopy was indicated, the proportion of patients who received a timely colonoscopy referral and performance were significantly higher post implementation (60.5% vs. 31.7%, pperformance (6 vs. 19 days pperformance of an indicated colonoscopy included performance of a non-colonoscopy procedure such as barium enema or flexible sigmoidoscopy (OR=16.9; 95% CI 1.9–145.1), patient non-adherence (OR=33.9; 95% CI 17.3–66.6), not providing an appropriate provisional diagnosis on the consultation (OR= 17.9; 95% CI 11.3–28.1) and gastroenterology service not rescheduling colonoscopies after an initial cancellation (OR= 11.0; 95% CI 5.1–23.7) Conclusions Multifaceted QI activities improved rates of timely colonoscopy referral and performance in an EMR system. However, colonoscopy was not

  11. Depressive symptoms and depression in people screened positive for dementia in primary care - results of the DelpHi-study.

    Science.gov (United States)

    Thyrian, Jochen René; Eichler, Tilly; Reimann, Melanie; Wucherer, Diana; Dreier, Adina; Michalowsky, Bernhard; Hoffmann, Wolfgang

    2016-06-01

    Dementia and depression are common syndromes in the elderly. There is lack of knowledge concerning the frequency of depressive symptoms in people with dementia (PWD) and factors associated with depression. The aim of this analysis is to (a) describe the frequency of depressive symptoms in people screened positive for dementia, (b) describe differences between PWD with and without depressive symptoms, and (c) analyze associations between depressive symptoms and other dementia-related variables. Analyses are based on data of the GP-based intervention trial DelpHi-MV. A sample of 430 (6.29%) people screened positive for dementia in primary care was analyzed regarding depression according to the German version of the Geriatric Depression Scale (GDS, 15-items), demographic variables, and dementia/depression-related variables. Multivariate analyses were conducted to identify factors associated with depressive symptoms. The mean GDS-score of depressive symptoms in n = 430 PWD was m = 3.21 (SD 2.45) with 67 PWD (15.55%) showing clinically relevant depression (GDS depression and n = 62 (14.42%) received antidepressive drug treatment. Depressive symptoms are significantly associated with age (OR = 0.93), functional impairment (OR = 1.36), and quality of life (OR = 0.01, CI: 0.00-0.06). Our results support previous findings that clinically relevant depressive symptoms are more common in people screened positive for dementia than in the general population and are often missed or mismanaged. Our findings underline the importance of managing quality of life, functional status, or depressive symptoms. Also, the results highlight the benefit of including the partner (and probably other carers) for adequate treatment of PWD.

  12. SU-E-J-94: Positioning Errors Resulting From Using Bony Anatomy Alignment for Treating SBRT Lung Tumor

    International Nuclear Information System (INIS)

    Frame, C; Ding, G

    2014-01-01

    Purpose: To quantify patient setups errors based on bony anatomy registration rather than 3D tumor alignment for SBRT lung treatments. Method: A retrospective study was performed for patients treated with lung SBRT and imaged with kV cone beam computed tomography (kV-CBCT) image-guidance. Daily CBCT images were registered to treatment planning CTs based on bony anatomy alignment and then inter-fraction tumor movement was evaluated by comparing shift in the tumor center in the medial-lateral, anterior-posterior, and superior-inferior directions. The PTV V100% was evaluated for each patient based on the average daily tumor displacement to assess the impact of the positioning error on the target coverage when the registrations were based on bony anatomy. Of the 35 patients studied, 15 were free-breathing treatments, 10 used abdominal compression with a stereotactic body frame, and the remaining 10 were performed with BodyFIX vacuum bags. Results: For free-breathing treatments, the range of tumor displacement error is between 1–6 mm in the medial-lateral, 1–13 mm in the anterior-posterior, and 1–7 mm in the superior-inferior directions. These positioning errors lead to 6–22% underdose coverage for PTV - V100% . Patients treated with abdominal compression immobilization showed positional errors of 0–4mm mediallaterally, 0–3mm anterior-posteriorly, and 0–2 mm inferior-superiorly with PTV - V100% underdose ranging between 6–17%. For patients immobilized with the vacuum bags, the positional errors were found to be 0–1 mm medial-laterally, 0–1mm anterior-posteriorly, and 0–2 mm inferior-superiorly with PTV - V100% under dose ranging between 5–6% only. Conclusion: It is necessary to align the tumor target by using 3D image guidance to ensure adequate tumor coverage before performing SBRT lung treatments. The BodyFIX vacuum bag immobilization method has the least positioning errors among the three methods studied when bony anatomy is used for

  13. Impact of intermediate mammography assessment on the likelihood of false-positive results in breast cancer screening programmes

    Energy Technology Data Exchange (ETDEWEB)

    Ascunce, Nieves [Public Health Institute, CIBERESP, Navarra Breast Cancer Screening Programme, Pamplona (Spain); Instituto de Salud Publica, Navarra Breast Cancer Screening Programme, Pamplona (Spain); Ederra, Maria; Delfrade, Josu; Erdozain, Nieves [Public Health Institute, CIBERESP, Navarra Breast Cancer Screening Programme, Pamplona (Spain); Baroja, Araceli [Fundacion Rioja Salud, Logrono (Spain); Zubizarreta, Raquel [Public Health and Planning Directorate, Health Office, Galician Breast Cancer Screening Programme, Galicia (Spain); Salas, Dolores [General Directorate Public Health and Centre for Public Health Research (CSISP), Valencia (Spain); Castells, Xavier [Mar Teaching Hospital, CIBERESP, Department of Clinical Epidemiology, Barcelona (Spain)

    2012-02-15

    Breast cancer screening is offered to 100% of the target population in Spain and intermediate mammograms (IMs) are sometimes indicated. This study was aimed at analysing the frequency of IMs, the factors determining their recommendation, and their impact on the risk of false-positive results and the detection rate. Data from 3,471,307 mammograms from Spanish breast cancer screening programmes were included. 3.36% of the mammograms were IMs. The factors associated with the use of IMs were age, initial screening, previous invasive tests, a familial history of breast cancer and use of hormone replacement therapy. In screening episodes with an IM, the probability of a false-positive result was 13.74% (95% CI: 13.43-14.05), almost double that in episodes without IMs (6.02%, 95% CI 5.99-6.05). In young women with previous invasive procedures, a familial history of breast cancer or hormone replacement therapy use who were undergoing their initial screen, this probability was lower when IMs were performed. IMs always increased the detection rate. The factors prompting IMs should be characterised so that radiologists can systematise their recommendations according to the presence of the factors maximising the benefits and minimising the adverse effects of this procedure. (orig.)

  14. Impact of intermediate mammography assessment on the likelihood of false-positive results in breast cancer screening programmes

    International Nuclear Information System (INIS)

    Ascunce, Nieves; Ederra, Maria; Delfrade, Josu; Erdozain, Nieves; Baroja, Araceli; Zubizarreta, Raquel; Salas, Dolores; Castells, Xavier

    2012-01-01

    Breast cancer screening is offered to 100% of the target population in Spain and intermediate mammograms (IMs) are sometimes indicated. This study was aimed at analysing the frequency of IMs, the factors determining their recommendation, and their impact on the risk of false-positive results and the detection rate. Data from 3,471,307 mammograms from Spanish breast cancer screening programmes were included. 3.36% of the mammograms were IMs. The factors associated with the use of IMs were age, initial screening, previous invasive tests, a familial history of breast cancer and use of hormone replacement therapy. In screening episodes with an IM, the probability of a false-positive result was 13.74% (95% CI: 13.43-14.05), almost double that in episodes without IMs (6.02%, 95% CI 5.99-6.05). In young women with previous invasive procedures, a familial history of breast cancer or hormone replacement therapy use who were undergoing their initial screen, this probability was lower when IMs were performed. IMs always increased the detection rate. The factors prompting IMs should be characterised so that radiologists can systematise their recommendations according to the presence of the factors maximising the benefits and minimising the adverse effects of this procedure. (orig.)

  15. Polymerase chain reaction methods (PCR in agrobiotechnology

    Directory of Open Access Journals (Sweden)

    Taški-Ajduković Ksenija

    2006-01-01

    Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  16. Final results of the cadmium and spectral ratios obtained inside of the fuel rod positioned in the central position of the IPEN/MB-01 nuclear reactor

    Energy Technology Data Exchange (ETDEWEB)

    Bitelli, Ulysses d' Utra; Mura, Luiz Ernesto C.; Santos, Diogo Feliciano dos, E-mail: ubitelli@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Lambiasi, Beatriz G.N. [Centro Tecnologico da Marinha em Sao Paulo (CTMSP), SP (Brazil)

    2015-07-01

    The spectral ratios are very important to determine some nuclear reactors parameters such as reaction rates, fuel lifetime, etc and some safety operational conditions. This study aims to determine the spectral ratios in 2 (two) spatial positions located inside the core of the Nuclear Reactor IPEN/MB-01. These places are at the central position of the nuclear reactor core in an asymptotic neutron flux region. The experiment consists in inserting different activation foil detectors inside an experimental fuel rod. The experimental rod is assembled at the central position of the reactor core. Activation neutron foil detectors of different elements such as {sup 197}Au, {sup 238}U, {sup 45}Sc, {sup 58}Ni, {sup 24}Mg, {sup 47}Ti and {sup 115m}In were used to cover a large range of neutron spectrum. Saturation activity per target nucleus was obtained by gamma spectrometry using a HPGe system. The experimental cadmium ratios compared with values computed by MCNP-4C code show good agreement. (author)

  17. SU-C-210-06: Quantitative Evaluation of Dosimetric Effects Resulting From Positional Variations of Pancreatic Tumor Volumes

    Energy Technology Data Exchange (ETDEWEB)

    Yu, S; Sehgal, V; Wei, R; Lawrenson, L; Kuo, J; Hanna, N; Ramsinghani, N; Daroui, P; Al-Ghazi, M [University of California, Orange, CA (United States)

    2015-06-15

    Purpose: The aim of this study is to quantify dosimetric effects resulting from variation in pancreatic tumor position assessed by bony anatomy and implanted fiducial markers Methods: Twelve pancreatic cancer patients were retrospectively analyzed for this study. All patients received modulated arc therapy (VMAT) treatment using fiducial-based Image Guided Radiation Therapy (IGRT) to the intact pancreas. Using daily orthogonal kV and/or Cone beam CT images, the shift needed to co-register the daily pre-treatment images to reference CT from fiducial to bone (Fid-Bone) were recorded as Left-Right (LR), Anterior-Posterior (AP) and Superior-Inferior (SI). The original VMAT plan iso-center was shifted based on KV bone matching positions at 5 evenly spaced fractions. Dose coverage of the planning target volumes (PTVs) (V100%), mean dose to liver, kidney and stomach/duodenum were assessed in the modified plans. Results: A total of 306 fractions were analyzed. The absolute fiducial-bone positional shifts were greatest in the SI direction, (AP = 2.7 ± 3.0, LR = 2.8 ± 2.8, and SI 6.3 ± 7.9 mm, mean ± SD). The V100% was significantly reduced by 13.5%, (Fid-Bone = 95.3 ± 2.0 vs. 82.3 ± 11.8%, p=0.02). This varied widely among patients (Fid-Bone V100% Range = 2–60%), where 33% of patients had a reduction in V100% of more than 10%. The impact on OARs was greatest to the liver (Fid-Bone= 14.6 vs. 16.1 Gy, 10%), and stomach, (Fid-Bone = 23.9 vx. 25.5 Gy, 7%), however was not statistically significant (p=0.10 both). Conclusion: Compared to matching by fiducial markers, matching by bony anatomy would have substantially reduced the PTV coverage by 13.5%. This reinforces the importance of online position verification based on fiducial markers. Hence, implantation of fiducial markers is strongly recommended for pancreatic cancer patients undergoing intensity modulated radiation therapy treatments.

  18. Application of PCR-Based Tools to Explore Strongyloides Infection in People in Parts of Northern Australia

    Directory of Open Access Journals (Sweden)

    Gemma J. Robertson

    2017-12-01

    Full Text Available Strongyloidiasis, which is caused by infection with the nematode Strongyloides stercoralis, is endemic to areas of northern Australia. Diagnosis in this region remains difficult due to the distances between endemic communities and diagnostic laboratories, leading to lengthy delays in stool processing for microscopy and culture. PCR represents a viable solution to this difficulty, having potential for high sensitivity detection of S. stercoralis, even in older, unpreserved faecal samples. We prospectively collected 695 faecal specimens that were submitted to The Townsville Hospital Microbiology Laboratory from the North Queensland region for routine parasitological examination, and subjected them to a Strongyloides sp. real-time (qPCR. Results were confirmed with a novel nested conventional PCR assay targeting the 18S rRNA gene, followed by single-strand conformation polymorphism analysis (SSCP. Of the 695 specimens tested, S. stercoralis was detected in three specimens (0.4% by classical parasitological methods (direct microscopy and formyl-ether acetate concentration, whereas 42 positives were detected by qPCR (6.0%. Conventional PCR confirmed the real-time PCR results in 24 of the samples (3.5%. Several apparent false-positive results occurred at higher cycle times (Ct in the qPCR. Use of real-time PCR in these populations is promising for the enhanced detection of disease and to support eradication efforts.

  19. Molecular detection of Toxoplasma gondii in water samples from Scotland and a comparison between the 529bp real-time PCR and ITS1 nested PCR.

    Science.gov (United States)

    Wells, Beth; Shaw, Hannah; Innocent, Giles; Guido, Stefano; Hotchkiss, Emily; Parigi, Maria; Opsteegh, Marieke; Green, James; Gillespie, Simon; Innes, Elisabeth A; Katzer, Frank

    2015-12-15

    Waterborne transmission of Toxoplasma gondii is a potential public health risk and there are currently no agreed optimised methods for the recovery, processing and detection of T. gondii oocysts in water samples. In this study modified methods of T. gondii oocyst recovery and DNA extraction were applied to 1427 samples collected from 147 public water supplies throughout Scotland. T. gondii DNA was detected, using real time PCR (qPCR) targeting the 529bp repeat element, in 8.79% of interpretable samples (124 out of 1411 samples). The samples which were positive for T. gondii DNA originated from a third of the sampled water sources. The samples which were positive by qPCR and some of the negative samples were reanalysed using ITS1 nested PCR (nPCR) and results compared. The 529bp qPCR was the more sensitive technique and a full analysis of assay performance, by Bayesian analysis using a Markov Chain Monte Carlo method, was completed which demonstrated the efficacy of this method for the detection of T. gondii in water samples. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Human papillomavirus detection using PCR and ATR-FTIR for cervical cancer screening

    Science.gov (United States)

    Rymsza, Taciana; Ribeiro, Eliane Aline; de Carvalho, Luis Felipe das Chagas e. Silva; Bhattacharjee, Tanmoy; de Azevedo Canevari, Renata

    2018-05-01

    The human papillomavirus (HPV) genital infection is considered one of the most common sexually transmitted diseases worldwide, and has been associated with cervical cancer. The objective of this study was to investigate the efficacy of the diagnostic methods: polymerase chain reaction (PCR) and Fourier transform infrared (FTIR) equipped with an ATR (Attenuated Total Reflectance) unit (Pike Tech) spectroscopy, to diagnose HPV infection in women undergoing gynecological examination. Seventeen patients (41.46%) of the 41 patients analyzed were diagnosed with exophytic/condyloma acuminate lesions by clinical analysis, 29 patients (70.7%) (G1 group) of the 41 patients, showed positive result for HPV cell injury by oncotic colpocitology and 12 patients (29.3%) (G2 group), presented negative result for cellular lesion and absence of clinical HPV lesion. Four samples were obtained per patient, which were submitted oncotic colpocitology analysis (Papanicolau staining, two samples), PCR (one sample) and ATR-FTIR analysis (one sample). L1 gene was amplified by PCR technique with specific GP5+/GP6+ and MY09/MY11 primers. PCR results were uniformly positive for presence of HPV in all analyzed samples. Multivariate analysis of ATR-FTIR spectra suggests no significant biochemical changes between groups and no clustering formed, concurring with results of PCR. This study suggests that PCR and ATR-FTIR are highly sensitive technique for HPV detection.

  1. The potential of TaqMan Array Cards for detection of multiple biological agents by real-time PCR.

    Directory of Open Access Journals (Sweden)

    Phillip A Rachwal

    Full Text Available The TaqMan Array Card architecture, normally used for gene expression studies, was evaluated for its potential to detect multiple bacterial agents by real-time PCR. Ten PCR assays targeting five biological agents (Bacillus anthracis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, and Yersinia pestis were incorporated onto Array Cards. A comparison of PCR performance of each PCR in Array Card and singleplex format was conducted using DNA extracted from pure bacterial cultures. When 100 fg of agent DNA was added to Array Card channels the following levels of agent detection (where at least one agent PCR replicate returned a positive result were observed: Y. pestis 100%, B. mallei & F. tularensis 93%; B. anthracis 71%; B. pseudomallei 43%. For B. mallei & pseudomallei detection the BPM2 PCR, which detects both species, outperformed PCR assays specific to each organism indicating identification of the respective species would not be reproducible at the 100 fg level. Near 100% levels of detection were observed when 100 fg of DNA was added to each PCR in singleplex format with singleplex PCRs also returning sporadic positives at the 10 fg per PCR level. Before evaluating the use of Array Cards for the testing of environmental and clinical sample types, with potential levels of background DNA and PCR inhibitors, users would therefore have to accept a 10-fold reduction in sensitivity of PCR assays on the Array Card format, in order to benefit for the capacity to test multiple samples for multiple agents. A two PCR per agent strategy would allow the testing of 7 samples for the presence of 11 biological agents or 3 samples for 23 biological agents per card (with negative control channels.

  2. Performance of a Highly Sensitive Mycobacterium tuberculosis Complex Real-Time PCR Assay for Diagnosis of Pulmonary Tuberculosis in a Low-Prevalence Setting: a Prospective Intervention Study.

    Science.gov (United States)

    Vinuesa, Víctor; Borrás, Rafael; Briones, María Luisa; Clari, María Ángeles; Cresencio, Vicenta; Giménez, Estela; Muñoz, Carmen; Oltra, Rosa; Servera, Emilio; Scheelje, Talia; Tornero, Carlos; Navarro, David

    2018-05-01

    The potential impact of routine real-time PCR testing of respiratory specimens from patients with presumptive tuberculosis in terms of diagnostic accuracy and time to tuberculosis treatment inception in low-prevalence settings remains largely unexplored. We conducted a prospective intervention cohort study. Respiratory specimens from 1,020 patients were examined by acid-fast bacillus smear microscopy, tested by a real-time Mycobacterium tuberculosis complex PCR assay (Abbott RealTi me MTB PCR), and cultured in mycobacterial media. Seventeen patients tested positive by PCR (5 were acid-fast bacillus smear positive and 12 acid-fast bacillus smear negative), and Mycobacterium tuberculosis was recovered from cultures for 12 of them. Patients testing positive by PCR and negative by culture ( n = 5) were treated and deemed to have responded to antituberculosis therapy. There were no PCR-negative/culture-positive cases, and none of the patients testing positive for nontuberculous mycobacteria ( n = 20) yielded a positive PCR result. The data indicated that routine testing of respiratory specimens from patients with presumptive tuberculosis by the RealTi me MTB PCR assay improves the tuberculosis diagnostic yield and may reduce the time to antituberculosis treatment initiation. On the basis of our data, we propose a novel mycobacterial laboratory algorithm for tuberculosis diagnosis. Copyright © 2018 American Society for Microbiology.

  3. Lateral expansion and carbon exchange of a boreal peatland in Finland resulting in 7000 years of positive radiative forcing

    Science.gov (United States)

    Mathijssen, Paul J. H.; Kähkölä, Noora; Tuovinen, Juha-Pekka; Lohila, Annalea; Minkkinen, Kari; Laurila, Tuomas; Väliranta, Minna

    2017-03-01

    Data on past peatland growth patterns, vegetation development, and carbon (C) dynamics during the various Holocene climate phases may help us to understand possible future climate-peatland feedback mechanisms. In this study, we analyzed and radiocarbon dated several peat cores from Kalevansuo, a drained bog in southern Finland. We investigated peatland succession and C dynamics throughout the Holocene. These data were used to reconstruct the long-term atmospheric radiative forcing, i.e., climate impact of the peatland since initiation. Kalevansuo peat records revealed a general development from fen to bog, typical for the southern boreal zone, but the timing of ombrotrophication varied in different parts of the peatland. Peat accumulation patterns and lateral expansion through paludification were influenced by fires and climate conditions. Long-term C accumulation rates were overall lower than the average values found from literature. We suggest the low accumulation rates are due to repeated burning of the peat surface. Drainage for forestry resulted in a nearly complete replacement of typical bog mosses by forest species within 40 years after drainage. The radiative forcing reconstruction suggested positive values (warming) for the first 7000 years following initiation. The change from positive to negative forcing was triggered by an expansion of bog vegetation cover and later by drainage. The strong relationship between peatland area and peat type with radiative forcing suggests a possible feedback for future changing climate, as high-latitude peatlands may experience prominent regime shifts, such as fen to bog transitions.

  4. Real-time PCR-based detection of Bordetella pertussis and Bordetella parapertussis in an Irish paediatric population.

    LENUS (Irish Health Repository)

    Grogan, Juanita A

    2011-06-01

    Novel real-time PCR assays targeting the Bordetella pertussis insertion sequence IS481, the toxin promoter region and Bordetella parapertussis insertion sequence IS1001 were designed. PCR assays were capable of detecting ≤10 copies of target DNA per reaction, with an amplification efficiency of ≥90 %. From September 2003 to December 2009, per-nasal swabs and nasopharyngeal aspirates submitted for B. pertussis culture from patients ≤1 month to >15 years of age were examined by real-time PCR. Among 1324 patients, 76 (5.7 %) were B. pertussis culture positive and 145 (10.95 %) were B. pertussis PCR positive. Of the B. pertussis PCR-positive patients, 117 (81 %) were aged 6 months or less. A total of 1548 samples were examined, of which 87 (5.6 %) were culture positive for B. pertussis and 169 (10.92 %) were B. pertussis PCR positive. All culture-positive samples were PCR positive. Seven specimens (0.5 %) were B. parapertussis culture positive and 10 (0.8 %) were B. parapertussis PCR positive, with all culture-positive samples yielding PCR-positive results. A review of patient laboratory records showed that of the 1324 patients tested for pertussis 555 (42 %) had samples referred for respiratory syncytial virus (RSV) testing and 165 (30 %) were positive, as compared to 19.4 % of the total 5719 patients tested for RSV in this period. Analysis of the age distribution of RSV-positive patients identified that 129 (78 %) were aged 6 months or less, similar to the incidence observed for pertussis in that patient age group. In conclusion, the introduction of the real-time PCR assays for the routine detection of B. pertussis resulted in a 91 % increase in the detection of the organism as compared to microbiological culture. The incidence of infection with B. parapertussis is low while the incidence of RSV infection in infants suspected of having pertussis is high, with a similar age distribution to B. pertussis infection.

  5. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  6. A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic

    Science.gov (United States)

    Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.

    2007-01-01

    Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.

  7. Viability qPCR, a new tool for Legionella risk management.

    Science.gov (United States)

    Lizana, X; López, A; Benito, S; Agustí, G; Ríos, M; Piqué, N; Marqués, A M; Codony, F

    2017-11-01

    Viability quantitative Polymerase Chain Reaction (v-qPCR) is a recent analytical approach for only detecting live microorganisms by DNA amplification-based methods This approach is based on the use of a reagent that irreversibly fixes dead cells DNA. In this study, we evaluate the utility of v-qPCR versus culture method for Legionellosis risk management. The present study was performed using 116 real samples. Water samples were simultaneously analysed by culture, v-qPCR and qPCR methods. Results were compared by means of a non-parametric test. In 11.6% of samples using both methods (culture method and v-qPCR) results were positive, in 50.0% of samples both methods gave rise to negative results. As expected, equivalence between methods was not observed in all cases, as in 32.1% of samples positive results were obtained by v-qPCR and all of them gave rise to negative results by culture. Only in 6.3% of samples, with very low Legionella levels, was culture positive and v-qPCR negative. In 3.5% of samples, overgrowth of other bacteria did not allow performing the culture. When comparing both methods, significant differences between culture and v-qPCR were in the samples belonging to the cooling towers-evaporative condensers group. The v-qPCR method detected greater presence and obtained higher concentrations of Legionella spp. (p<0.001). Otherwise, no significant differences between methods were found in the rest of the groups. The v-qPCR method can be used as a quick tool to evaluate Legionellosis risk, especially in cooling towers-evaporative condensers, where this technique can detect higher levels than culture. The combined interpretation of PCR results along with the ratio of live cells is proposed as a tool for understanding the sample context and estimating the Legionellosis risk potential according to 4 levels of hierarchy. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. Trial sequential analysis reveals insufficient information size and potentially false positive results in many meta-analyses

    DEFF Research Database (Denmark)

    Brok, J.; Thorlund, K.; Gluud, C.

    2008-01-01

    in 80% (insufficient information size). TSA(15%) and TSA(LBHIS) found that 95% and 91% had absence of evidence. The remaining nonsignificant meta-analyses had evidence of lack of effect. CONCLUSION: TSA reveals insufficient information size and potentially false positive results in many meta......OBJECTIVES: To evaluate meta-analyses with trial sequential analysis (TSA). TSA adjusts for random error risk and provides the required number of participants (information size) in a meta-analysis. Meta-analyses not reaching information size are analyzed with trial sequential monitoring boundaries...... analogous to interim monitoring boundaries in a single trial. STUDY DESIGN AND SETTING: We applied TSA on meta-analyses performed in Cochrane Neonatal reviews. We calculated information sizes and monitoring boundaries with three different anticipated intervention effects of 30% relative risk reduction (TSA...

  9. Clinical and epidemiological use of nested PCR targeting the repetitive element IS1111 associated with the transposase gene from Coxiella burnetii.

    Science.gov (United States)

    Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S

    Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.

  10. [PCR testing for Bordetella pertussis in household contacts as a diagnostic tool for atypical whooping cough in unvaccinated young infants].

    Science.gov (United States)

    Cosnes-Lambe, Cecile; Raymond, Josette; Vallet, Christelle; Armengaud, Jean-Baptiste; Bosdure, Emmanuelle; Catalano-Pons, Charlotte; Chalumeau, Martin; El Hajje, Marie-Joelle; Moulin, Florence; de Suremain, Nathalie; Reglier-Poupet, Hélène; Poyart, Claire; Gendrel, Dominique

    2008-10-01

    False-negative findings of polymerase chain reaction (PCR) for genuine pertussis as well as the numerous atypical forms of whooping cough make it difficult to diagnose this disease in young babies. For two years, real-time PCR was performed to test for Bordetella pertussis in 86 infants younger than 6 months hospitalized for apnea or paroxysmal and/or vomiting cough and in 205 of their household contacts, whether or not they coughed. Group 1 included 30 infants for whom PCR detected B. pertussis (25 of whom were also RSV+). PCR was also positive for at least one household contact in 25/30 families. This group included 16 babies with apnea and 12 who developed a whooping cough during follow-up. Group 2 comprised 12 infants whose PCR was negative while at least one household contact had positive results. Five of these infants had severe apnea and 6 developed a whooping cough. Group 3 included 44 infants (28 RSV +) for whom PCR was negative in the index case and in the household contacts: none developed a whooping cough during follow-up. Only 3 of the 54 positive household contacts had a paroxysmal cough or a typical whooping cough and 12 had no cough at all. Positive PCR in a household contact, symptomatic or not, is helpful for the diagnosis of atypical whooping cough in young infants.

  11. Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease

    Directory of Open Access Journals (Sweden)

    Manoj Kumar

    2013-01-01

    Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.

  12. Assessment of Duplex PCR for the simultaneous diagnose of Mycobacterium spp. and Brucella spp. in cattle

    Directory of Open Access Journals (Sweden)

    Ariel Escobar

    2013-03-01

    Full Text Available Tuberculosis and brucellosis remain important causes of morbidity and mortality in many countries, for the detection of both diseases requires efficient and sensitive tool for effectuate the diagnosis. This study was aimed to evaluate and compare the duplex PCR versus the nested PCR, for detection of Brucella spp. (BR and Mycobacterium spp. (TB. A total of 100 samples of tissues from tracheo-bronchial lymph nodes, bovine lung and bacterial isolate as positive controls were used. Were evaluated ten combinations of primers which were designed to flank the segment of the 16S rRNA sequence (RB and antigen gen MPB70 (TB, the best result for the Duplex PCR was obtained with the primers Bru-2F/Bru-2R for BR and Tub-1F/Tub-N-R for TB. The amplification of the products was 225 and 230-bp respectively. In order to compare the results of the proposed technique, all samples were initially analyzed and compared between PCR and nested PCR (Kappa, k = 0.85 and the concordance between Duplex PCR and nested PCR (k = 0.88 for the two bacteria was very good.

  13. Virus detection by PCR following vaccination of naive calves with intranasal or injectable multivalent modified-live viral vaccines.

    Science.gov (United States)

    Walz, Paul H; Newcomer, Benjamin W; Riddell, Kay P; Scruggs, Daniel W; Cortese, Victor S

    2017-09-01

    We evaluated duration of PCR-positive results following administration of modified-live viral (MLV) vaccines to beef calves. Twenty beef calves were randomly assigned to either group 1 and vaccinated intranasally with a MLV vaccine containing bovine alphaherpesvirus 1 (BoHV-1), bovine respiratory syncytial virus (BRSV), and bovine parainfluenza virus 3 (BPIV-3), or to group 2 and vaccinated subcutaneously with a MLV vaccine containing bovine viral diarrhea virus 1 and 2 (BVDV-1, -2), BoHV-1, BRSV, and BPIV-3. Deep nasopharyngeal swabs (NPS) and transtracheal washes (TTW) were collected from all calves, and whole blood was collected from group 2 calves and tested by PCR. In group 1, the proportions of calves that tested PCR-positive to BVDV, BoHV-1, BRSV, and BPIV-3 on any sample at any time were 0%, 100%, 100%, and 10%, respectively. In group 1 calves, 100% of calves became PCR-positive for BoHV-1 by day 3 post-vaccination and 100% of calves became PCR-positive for BRSV by day 7 post-vaccination. In group 2, the proportions of calves that tested positive to BVDV, BoHV-1, BRSV, and BPIV-3 on any sample at any time were 50%, 40%, 10%, and 0%, respectively. All threshold cycle (Ct) values were >30 in group 2 calves, irrespective of virus; however, Ct values PCR-positive results for BoHV-1 and BRSV. All calves were PCR-negative for all viruses after day 28. Following intranasal MLV viral vaccination, PCR results and Ct values for BRSV and BoHV-1 suggest that attempts to differentiate vaccine virus from natural infection is unreliable.

  14. Canine distemper virus detection by different methods of One-Step RT-qPCR

    Directory of Open Access Journals (Sweden)

    Claudia de Camargo Tozato

    2016-01-01

    Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

  15. Detection by PCR of pathogenic protozoa in raw and drinkable water samples in Colombia.

    Science.gov (United States)

    Triviño-Valencia, Jessica; Lora, Fabiana; Zuluaga, Juan David; Gomez-Marin, Jorge E

    2016-05-01

    We evaluated the presence of DNA of Giardia, Toxoplasma, and Cryptosporidium by PCR, and of Giardia and Cryptosporidium genera by immunofluorescence antibody test (IFAT), in water samples, before, during, and after plant treatment for drinkable water. We applied this method in 38 samples of 10 l of water taken from each of the water treatment steps and in 8 samples taken at home (only for Toxoplasma PCR) in Quindio region in Colombia. There were 8 positive samples for Cryptosporidium parvum (21 %), 4 for Cryptosporidium hominis (10.5 %), 27 for Toxoplasma gondii (58.6 %), 2 for Giardia duodenalis assemblage A (5.2 %), and 5 for G. duodenalis assemblage B (13.1 %). By IFAT, 23 % were positive for Giardia and 21 % for Cryptosporidium. An almost perfect agreement was found between IFAT and combined results of PCR, by Kappa composite proportion analysis. PCR positive samples were significantly more frequent in untreated raw water for C. parvum (p = 0.02). High mean of fecal coliforms, high pH values, and low mean of chlorine residuals were strongly correlated with PCR positivity for G. duodenalis assemblage B. High pH value was correlated with PCR positivity for C. parvum. Phylogenetic analysis of DNA sequences was possible, showing water and human clinical sequences for Toxoplasma within the same phylogenetic group for B1 repeated sequence. PCR assay is complementary to IFAT assay for monitoring of protozoa in raw and drinkable water, enabling species identification and to look for phylogenetic analysis in protozoa from human and environmental sources.

  16. Disclosure of HIV positive result to a sexual partner among adult clinical service users in Kemissie district, northeast Ethiopia.

    Science.gov (United States)

    Seid, Mohammed; Wasie, Belaynew; Admassu, Mengesha

    2012-03-01

    HIV Status disclosure is vital for HIV prevention efforts and the couple's health in the context of accelerated highly active antiretroviral therapy. This study aimed to identify factors associated with disclosure of HIV Status to a sexual partner and its outcomes. A facility based cross-sectional study was conducted at Kemissie Health center on 360 HIV positive individuals selected by systematic random sampling. Data were collected using a structured, interviewer administered questionnaire. The level of disclosure to a sexual partner was 93.1%. Among those who disclosed, 74.5% were accepted, 10.8% minor challenges or suspicion of result and the last 7.8% faced physical abuse and blame. The main reasons for not disclosing were fear of divorce [32%], fear of stigma and discrimination [32%] and fear of physical abuse [16%]. Prior discussion, disclosure to family, smooth relationship and knowing partner status were significantly associated with disclosure. HIV prevention programs and counseling efforts should focus on mutual disclosure of HIV test results, by encouraging discussion, reduction of stigma, for better disclosure and continuing care.

  17. Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Kláudia S G; Ramos, Carlos Alberto N; Filho, Antonio Francisco S; Vidal, Carlos Eugênio S; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F; Júnior, Antônio A F; Silva, Marcio R; Neto, José Diomedes B; Cerqueira, Valíria D; Zumárraga, Martín J; Araújo, Flábio R

    2014-01-01

    In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  18. A multiplex nested PCR for the detection and identification of Candida species in blood samples of critically ill paediatric patients.

    Science.gov (United States)

    Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro

    2014-07-21

    Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.

  19. Comparison of COBAS AMPLICOR Neissefia gonorrhoeae PCR, including confirmation with N-gonorrhoeae-specific 16S rRNA PCR, with traditional culture

    NARCIS (Netherlands)

    Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J

    A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased

  20. Evaluation of Legionella real-time PCR against traditional culture for routine and public health testing of water samples.

    Science.gov (United States)

    Collins, S; Stevenson, D; Walker, J; Bennett, A

    2017-06-01

    To evaluate the usefulness of Legionella qPCR alongside traditional culture for enumeration of Legionella from water samples as part of both routine and public health investigation testing. Routine water samples (n = 2002) and samples from public health investigations (n = 215) were analysed by culture and qPCR for Legionella spp., Legionella pneumophila and L. pneumophila sg-1. A negative qPCR result was highly predictive of a negative culture result for all water systems (negative predictive values, NPV from 97·4 to 100%). Positive predictive values (PPV) were lower (0-50%). Results for qPCR were generally larger than culture with average log 10 differences of 1·1 for Legionella spp. and 1·2 for L. pneumophila. Alert and action levels of 1000 and 10 000 GU per litre, respectively, are proposed for Legionella qPCR for hot and cold water systems (HCWS). The use of qPCR significantly reduced the time to results for public health investigations by rapidly identifying potential sources and ruling out others, thus enabling a more rapid and efficient response. The high NPV of qPCR supports its use to rapidly screen out negative samples without culture. Alert and action levels for Legionella qPCR for HCWS are proposed. Quantitative PCR will be a valuable tool for both routine and public health testing. This study generated comparative data of >2000 water samples by qPCR and culture. Action and alert levels have been recommended that could enable duty holders to interpret qPCR results to facilitate timely Legionella control and public health protection. © 2017 Crown copyright. Journal of Applied Microbiology © 2017 The Society for Applied Microbiology.

  1. Optimization and Evaluation of a PCR Assay for Detecting Toxoplasmic Encephalitis in Patients with AIDS

    Science.gov (United States)

    Joseph, Priya; Calderón, Maritza M.; Gilman, Robert H.; Quispe, Monica L.; Cok, Jaime; Ticona, Eduardo; Chavez, Victor; Jimenez, Juan A.; Chang, Maria C.; Lopez, Martín J.; Evans, Carlton A.

    2002-01-01

    Toxoplasma gondii is a common life-threatening opportunistic infection. We used experimental murine T. gondii infection to optimize the PCR for diagnostic use, define its sensitivity, and characterize the time course and tissue distribution of experimental toxoplasmosis. PCR conditions were adjusted until the assay reliably detected quantities of DNA derived from less than a single parasite. Forty-two mice were inoculated intraperitoneally with T. gondii tachyzoites and sacrificed from 6 to 72 h later. Examination of tissues with PCR and histology revealed progression of infection from blood to lung, heart, liver, and brain, with PCR consistently detecting parasites earlier than microscopy and with no false-positive results. We then evaluated the diagnostic value of this PCR assay in human patients. We studied cerebrospinal fluid and serum samples from 12 patients with AIDS and confirmed toxoplasmic encephalitis (defined as positive mouse inoculation and/or all of the Centers for Disease Control clinical diagnostic criteria), 12 human immunodeficiency virus-infected patients with suspected cerebral toxoplasmosis who had neither CDC diagnostic criteria nor positive mouse inoculation, 26 human immunodeficiency virus-infected patients with other opportunistic infections and no signs of cerebral toxoplasmosis, and 18 immunocompetent patients with neurocysticercosis. Eleven of the 12 patients with confirmed toxoplasmosis had positive PCR results in either blood or cerebrospinal fluid samples (6 of 9 blood samples and 8 of 12 cerebrospinal fluid samples). All samples from control patients were negative. This study demonstrates the high sensitivity, specificity, and clinical utility of PCR in the diagnosis of toxoplasmic encephalitis in a resource-poor setting. PMID:12454142

  2. FTA card utility for PCR detection of Mycobacterium leprae.

    Science.gov (United States)

    Aye, Khin Saw; Matsuoka, Masanori; Kai, Masanori; Kyaw, Kyaw; Win, Aye Aye; Shwe, Mu Mu; Thein, Min; Htoo, Maung Maung; Htoon, Myo Thet

    2011-01-01

    The suitability of the FTA® elute card for the collection of slit skin smear (SSS) samples for PCR detection of Mycobacterium leprae was evaluated. A total of 192 SSS leprosy samples, of bacillary index (BI) 1 to 5, were collected from patients attending two skin clinics in Myanmar and preserved using both FTA® elute cards and 70% ethanol tubes. To compare the efficacy of PCR detection of DNA from each BI class, PCR was performed to amplify an M. leprae-specific repetitive element. Of the 192 samples, 116 FTA® elute card and 112 70% ethanol samples were PCR positive for M. leprae DNA. When correlated with BI, area under the curve (AUC) values of the respective receiver-operating characteristic curves were similar for the FTA® elute card and ethanol collection methods (AUC=0.6). Taken together, our results indicate that the FTA® elute card, which enables the collection, transport, and archiving of clinical samples, is an attractive alternative to ethanol preservation for the detection of M. leprae DNA.

  3. PCR in forensic genetics

    DEFF Research Database (Denmark)

    Morling, Niels

    2009-01-01

    Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...... and more advanced, special investigations in cases concerning crime, paternity, relationship, disaster victim identification etc. The present review gives an update on the use of DNA investigations in forensic genetics.......Since the introduction in the mid-1980s of analyses of minisatellites for DNA analyses, a revolution has taken place in forensic genetics. The subsequent invention of the PCR made it possible to develop forensic genetics tools that allow both very informative routine investigations and still more...

  4. Cara Preservasi Fitoplasma dari Jaringan Kacang Tanah Bergejala Sapu untuk Deteksi DNA dengan Teknik PCR

    Directory of Open Access Journals (Sweden)

    Siska Irhamnawati Pulogu

    2017-07-01

    Full Text Available Witches‘ broom of peanut caused by phytoplasma is a common disease found in Indonesia. Phytoplasma is able to be detected using polymerase chain reaction (PCR technique. One of important factor which determine the successful of phytoplasma amplification is the DNA availability from fresh tissues. The research was aimed to evaluate some preservation methods of phytoplasma from infected plant samples. The aspects to be evaluated consisted of time (1, 2, 3, and 4 weeks, temperature (-20 °C, 4 °C, and 25 °C, and preservation medium (1X PGB buffer, 3 M NaCl, CTAB buffer, 70% ethanol, non medium, and FTA-card for storing the fresh phytoplasma infected samples. Good preservation method will optimize the phytoplasma DNA amplification using PCR standard technique followed by nested-PCR. The results showed that preservation of samples at -20 °C, 4 °C, and 25 °C in CTAB buffer was able to maintain the tissue freshness for 4 weeks and was able to provide the DNA of either quality or quantity sufficiently for PCR detection. PCR standard using a primer pair P1/P7 showed that not all of the preserved DNA of phytoplasma were amplified positively. However, standard PCR followed by nested-PCR using primer pair fU5/rU3 was able to increase the DNA detectability. Preserved samples derived from various medium and stored for 4 weeks gave positive results.  This results were in contrary with previous same samples which were detected negatively by standard PCR technique.

  5. Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.

    Science.gov (United States)

    Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N

    2012-04-01

    Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.

  6. Development and Validation of a Real-Time PCR Assay for Rapid Detection of Candida auris from Surveillance Samples.

    Science.gov (United States)

    Leach, L; Zhu, Y; Chaturvedi, S

    2018-02-01

    Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.

  7. A grounded theory of positive youth development through sport based on results from a qualitative meta-study

    Science.gov (United States)

    Holt, Nicholas L.; Neely, Kacey C.; Slater, Linda G.; Camiré, Martin; Côté, Jean; Fraser-Thomas, Jessica; MacDonald, Dany; Strachan, Leisha; Tamminen, Katherine A.

    2017-01-01

    ABSTRACT The overall purpose of this study was to create a model of positive youth development (PYD) through sport grounded in the extant qualitative literature. More specifically, the first objective was to review and evaluate qualitative studies of PYD in sport. The second objective was to analyze and synthesize findings from these studies. Following record identification and screening, 63 articles were retained for analysis. Meta-method analysis revealed strengths of studies were the use of multiple data collection and validity techniques, which produced high-quality data. Weaknesses were limited use of ‘named’ methodologies and inadequate reporting of sampling procedures. Philosophical perspectives were rarely reported, and theory was used sparingly. Results of an inductive meta-data analysis produced three categories: PYD climate (adult relationships, peer relationships, and parental involvement), life skills program focus (life skill building activities and transfer activities), and PYD outcomes (in personal, social, and physical domains). A model that distinguishes between implicit and explicit processes to PYD is presented. PMID:27695511

  8. Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis

    Directory of Open Access Journals (Sweden)

    V Hallur

    2015-01-01

    Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.

  9. Detection of Cutaneous Leishmaniasis by PCR in Fasa district in 2012

    Directory of Open Access Journals (Sweden)

    Mehdi Sharafi

    2013-09-01

    Material & Methods: Slit biopsies were collected from 138 suspected cases of cutaneous leishmaniasis who were presented, consecutively, in Fasa district from April 2011 to February 2012. After the microscopy, the entire smear was then scraped off the slide surface for DNA extraction and PCR assay. Results: All 138 investigated smears were reported positive by microscopy and nested PCR assay. In PCR, One of the smears had the 750-bp band, indicative of L. tropica and the rest had the 560-bp band indicative of L. major. Conclusion: In conclusion, the cutaneous leishmaniasis found in Fasa district is predominantly Rural Cutaneous Leishmaniasis. The PCR-based assay used in the present study appears to be a suitable and powerful tool for the characterization of Leishmanial species.

  10. Simultaneous detection of Legionella species and Legionella pneumophila by duplex PCR (dPCR assay in cooling tower water samples from Jakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Andi Yasmon

    2010-11-01

    Full Text Available Aim: Since culture method is time-consuming and has low  sensitivity, we developed a duplex PCR (dPCR assay for the detection of Legionella sp. and L. pneumophila in cooling tower samples. We used culture method as a gold standard.Methods: Optimization of dPCR method was performed to obtain an assay with high sensitivity and specifi city. The optimized method was used to detect Legionella sp. dan L. pneumophila in 9 samples obtained from 9 buildings in Jakarta. For culture method, the bacteria were grown or isolated on selective growth factor supplemented-buffered charcoal yeast extract (BCYE media.Results: Of 9 samples tested by dPCR assay, 6 were positive for Legionella species,1 was positive for L. pneumophila, and 2 showed negative results. For the same samples, no Legionella sp. was detected by the culture method.Conclusion: dPCR assay was much more sensitive than the culture method and was potentially used as a rapid, specifi c and sensitive test for routine detection of Legionella sp. dan for L. pneumophila in water samples. (Med J Indones 2010; 19:223-7Keywords: BCYE media, mip gene, 16S-rRNA gene

  11. Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

    Science.gov (United States)

    Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

    2013-12-01

    Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.

    Directory of Open Access Journals (Sweden)

    Daijun Ling

    Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.

  13. PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains

    Directory of Open Access Journals (Sweden)

    Nowak Magdalena

    2009-11-01

    Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.

  14. Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.

    Science.gov (United States)

    Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2018-02-15

    Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Test Results of an F/A-18 Automatic Carrier Landing Using Shipboard Relative Global Positioning System

    National Research Council Canada - National Science Library

    Sousa, Paul

    2003-01-01

    Under the U.S. Department of Defense's Joint Precision Approach and Landing System program, the Navy is responsible for developing the shipboard coreponent, termed Shipboard Relative Global Positioning System (SRGPS...

  16. Performance of Aspergillus PCR in cerebrospinal fluid for the diagnosis of cerebral aspergillosis.

    Science.gov (United States)

    Imbert, S; Brossas, J-Y; Palous, M; Joly, I; Meyer, I; Fekkar, A

    2017-11-01

    Cerebral aspergillosis is a rare but often fatal form of invasive aspergillosis that remains difficult to diagnose. The literature has shown the value of Aspergillus PCR in blood-derived samples for the diagnosis of invasive aspergillosis but provides far less information for cerebrospinal fluid (CSF) in cerebral aspergillosis. Here, we evaluated the usefulness of an Aspergillus PCR assay performed on CSF for the diagnosis of cerebral aspergillosis. This retrospective study involved 72 patients with suspected cerebral aspergillosis for a total of 88 CSF samples in whom CSF Aspergillus PCR was performed. Seventeen patients had proven/probable invasive aspergillosis according to the European Organization for Research and Treatment of Cancer/Mycoses Study Group criteria, including 12 cases of proven/probable cerebral aspergillosis. Aspergillus PCR in CSF was positive in nine of the twelve patients with cerebral aspergillosis, i.e. 75% sensitivity. In contrast, CSF culture was positive for Aspergillus in only two patients. In the non-cerebral aspergillosis group (60 patients), PCR was positive in one patient, i.e. 98.3% specificity. In this particular population of high-risk patients with suspicion of cerebral aspergillosis, the disease incidence was 16.7%. Therefore, the positive and negative predictive values of PCR were 90% and 95.2%, respectively. The results of this study indicate that Aspergillus PCR in CSF is an interesting tool that may eliminate the need for cerebral biopsy in patients with suspected cerebral aspergillosis. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  17. Constitutional variants are not associated with HER2-positive breast cancer: results from the SIGNAL/PHARE clinical cohort

    OpenAIRE

    Pivot, Xavier; Romieu, Gilles; Fumoleau, Pierre; Rios, Maria; Bonnefoi, Herv?; Bachelot, Thomas; Souli?, Patrick; Jouannaud, Christelle; Bourgeois, Hugues; Petit, Thierry; Tennevet, Isabelle; Assouline, David; Mathieu, Marie-Christine; Jacquin, Jean-Philippe; Lavau-Denes, Sandrine

    2017-01-01

    Human epidermal growth factor receptor 2-positive breast cancer is a subtype of interest regarding its outcome and the impressive impact of human epidermal growth factor receptor 2 targeted therapy. Constitutional variants may be involved in the aetiology of human epidermal growth factor receptor 2-positive breast cancer, and we propose a case?case study to test the hypothesis that single nucleotide polymorphisms may be associated with human epidermal growth factor receptor 2 status. A Genome...

  18. Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model

    Directory of Open Access Journals (Sweden)

    Francielle Gibson da Silva-Zacarias

    2009-11-01

    Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre

  19. Assessment of sputum smear-positive but culture-negative results among newly diagnosed pulmonary tuberculosis patients in Tanzania

    Directory of Open Access Journals (Sweden)

    Mnyambwa NP

    2017-07-01

    Full Text Available Nicholaus Peter Mnyambwa,1,2 Esther S Ngadaya,2 Godfather Kimaro,2 Dong-Jin Kim,1 Rudovick Kazwala,3 Pammla Petrucka,1,4 Sayoki G Mfinanga2 1School of Life Sciences and Bioengineering, Nelson Mandela African Institution of Science and Technology, Arusha, Tanzania; 2National Institute for Medical Research, Muhimbili Medical Research Center, Dar es Salaam, Tanzania; 3Department of Veterinary Medicine, Sokoine University of Agriculture, Morogoro, Tanzania; 4College of Nursing, University of Saskatchewan, Saskatoon, Canada Abstract: Diagnosis of pulmonary tuberculosis (TB in technology-limited countries is widely achieved by smear microscopy, which has limited sensitivity and specificity. The frequency and clinical implication of smear-positive but culture-negative among presumptive TB patients remains unclear. A cross-sectional substudy was conducted which aimed to identify the proportion of nontuberculous mycobacteria (NTM infections among 94 “smear-positive culture-negative” patients diagnosed between January 2013 and June 2016 in selected health facilities in Tanzania. Out of 94 sputa, 25 (26.60% were GeneXpert® mycobacteria TB positive and 11/94 (11.70% repeat-culture positive; 5 were Capilia TB-Neo positive and confirmed by GenoType MTBC to be Mycobacterium tuberculosis/Mycobacterium canettii. The remaining 6 Capilia TB-Neo negative samples were genotyped by GenoType® CM/AS, identifying 3 (3.19% NTM, 2 Gram positive bacteria, and 1 isolate testing negative, together, making a total of 6/94 (6.38% confirmed false smear-positives. Twenty-eight (29.79% were confirmed TB cases, while 60 (63.83% remained unconfirmed cases. Out of 6 (6.38% patients who were HIV positive, 2 patients were possibly coinfected with mycobacteria. The isolation of NTM and other bacteria among smear-positive culture-negative samples and the presence of over two third of unconfirmed TB cases emphasize the need of both advanced differential TB diagnostic techniques and

  20. Quantitative threefold allele-specific PCR (QuanTAS-PCR) for highly sensitive JAK2 V617F mutant allele detection

    International Nuclear Information System (INIS)

    Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander

    2013-01-01

    The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a

  1. Digital PCR as a tool to measure HIV persistence.

    Science.gov (United States)

    Rutsaert, Sofie; Bosman, Kobus; Trypsteen, Wim; Nijhuis, Monique; Vandekerckhove, Linos

    2018-01-30

    Although antiretroviral therapy is able to suppress HIV replication in infected patients, the virus persists and rebounds when treatment is stopped. In order to find a cure that can eradicate the latent reservoir, one must be able to quantify the persisting virus. Traditionally, HIV persistence studies have used real-time PCR (qPCR) to measure the viral reservoir represented by HIV DNA and RNA. Most recently, digital PCR is gaining popularity as a novel approach to nucleic acid quantification as it allows for absolute target quantification. Various commercial digital PCR platforms are nowadays available that implement the principle of digital PCR, of which Bio-Rad's QX200 ddPCR is currently the most used platform in HIV research. Quantification of HIV by digital PCR is proving to be a valuable improvement over qPCR as it is argued to have a higher robustness to mismatches between the primers-probe set and heterogeneous HIV, and forfeits the need for a standard curve, both of which are known to complicate reliable quantification. However, currently available digital PCR platforms occasionally struggle with unexplained false-positive partitions, and reliable segregation between positive and negative droplets remains disputed. Future developments and advancements of the digital PCR technology are promising to aid in the accurate quantification and characterization of the persistent HIV reservoir.

  2. Detection of Mycoplasma synoviae infection in broiler breeder farms of Tehran province using PCR and culture methods

    Directory of Open Access Journals (Sweden)

    Elhamnia, F.

    2010-07-01

    Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.

  3. Identification of Tilletia species using rep-PCR fingerprinting technique

    Directory of Open Access Journals (Sweden)

    Župunski Vesna

    2011-01-01

    Full Text Available Analyzing 167 non-processed seed samples of wheat, it was found that 145 samples (86.8 % were contaminated with Tilletia species, while 22 (13.2 % samples were not contaminated. By using rep-PCR fingerprinting technique, it was found that DNA isolates of T. tritici originated from Serbian wheat samples had 80 % similarity with positive control for T. tritici. One isolate shared similarity of 60% with T. tritici, T. controversa and T. laevis. It was supposed that this isolate belongs to T. bromi. Isolate of T. laevis shared a similarity of 70 % with isolates of T. tritici and T. controversa, while T. walkeri was more than 10 % similar with T. tritici, T. controversa and T. laevis. Although T. controversa and T. tritici had high percent of genetic similarity, they were clustered separately. Our results suggest that rep-PCR fingerprinting could be a useful tool for monitoring presence of morphologically similar Tilletia species in wheat production areas.

  4. Targeted resequencing and variant validation using pxlence PCR assays

    Directory of Open Access Journals (Sweden)

    Frauke Coppieters

    2016-01-01

    Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.

  5. Study the Three Extraction Methods for HBV DNA to Use in PCR

    Directory of Open Access Journals (Sweden)

    N. Sheikh

    2004-07-01

    Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.

  6. Detection of sexually transmitted infection and human papillomavirus in negative cytology by multiplex-PCR

    Directory of Open Access Journals (Sweden)

    Chung Hyun-Jae

    2010-09-01

    Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.

  7. Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India.

    Science.gov (United States)

    Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P

    2016-01-01

    Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.

  8. Establishment of a minor groove binder-probe based quantitative real time PCR to detect Borrelia burgdorferi sensu lato and differentiation of Borrelia spielmanii by ospA-specific conventional PCR

    Directory of Open Access Journals (Sweden)

    Strube Christina

    2010-08-01

    Full Text Available Abstract Background Borrelia burgdorferi sensu lato (sl, the causative agent of Lyme borreliosis, is transmitted by ticks of the genus Ixodes as vector. For identification of Borrelia infections in ticks a TaqMan™ minor groove binder (MGB probe-based quantitative real time PCR (qPCR was established targeting the 5S-23S intergenic spacer. Extension to a duplex qPCR included an Ixodes spp. positive control to verify successful DNA isolation. Besides qPCR, an ospA-specific conventional PCR for species-specific identification of B. spielmanii was established. Afterwards 1000 I. ricinus flagged in the city of Hanover, Germany, were investigated for B. burgdorferi sl infections followed by species identification. Furthermore, I. hexagonus ticks were investigated to proof applicability of the PCRs. Results Quantitative real time PCR (qPCR identifying B. burgdorferi sl in ticks was able to detect 1-10 copies per reaction. B. spielmanii ospA-specific conventional PCR was also highly specific and showed no cross reactions with the other tested Borrelia species. From 1000 hanoveranian ticks 24.3% were positive compared to only 7.4% positives by dark-field microscopy. Related to tick stage 1.7% larvae, 18.1% nymphs, and 34.6% adults were positive. The most frequent species was B. garinii, followed by B. afzelii, B. spielmanii, B. valaisiana and B. burgdorferi sensu stricto (ss. 70.6% of I. ricinus were mono-infected, whereas 28.0% and 1.4% were infected with two and three Borrelia species, respectively. From 232 I. hexagonus collected from hedgehogs in different sites of Germany, qPCR detected 5.7% to be infected with B. burgdorferi sl, which were identified as B. afzelii, B. garinii and B. spielmanii. Conclusions The evaluated qPCR to detect B. burgdorferi sl in Ixodes spp. is highly specific and sensitive. As a duplex qPCR including detection of Ixodes spp. DNA it is the first DNA based technique incorporating a control for successful DNA isolation from

  9. Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)

    2011-07-01

    Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

  10. Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

    International Nuclear Information System (INIS)

    Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.

    2011-01-01

    Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

  11. IgG4-positive cell infiltration in various cardiovascular disorders - results from histopathological analysis of surgical samples.

    Science.gov (United States)

    Hourai, Ryoto; Kasashima, Satomi; Sohmiya, Koichi; Yamauchi, Yohei; Ozawa, Hideki; Hirose, Yoshinobu; Ogino, Yasuhiro; Katsumata, Takahiro; Daimon, Masahiro; Fujita, Shu-Ichi; Hoshiga, Masaaki; Ishizaka, Nobukazu

    2017-02-03

    The diagnosis of Immunoglobulin G4 (IgG4)-related disease (IgG4-RD), in general, depends on serum IgG4 concentrations and histopathological findings; therefore, diagnosis of IgG4-RD in cardiovascular organs/tissues is often difficult owing to the risk of tissue sampling. Prevalence of IgG4-positive lymphoplasmacytic infiltration in 103 consecutive cardiovascular surgical samples from 98 patients with various cardiovascular diseases was analyzed immunohistochemically. The diagnoses of the enrolled patients included aortic aneurysm (abdominal, n = 8; thoracic, n = 9); aortic dissection (n = 20); aortic stenosis (n = 24), aortic regurgitation (n = 10), and mitral stenosis/regurgitation (n = 17). In total, 10 (9.7%) of the 103 specimens showed IgG4-positive cell infiltration with various intensities; five of these were aortic valve specimens from aortic stenosis, and IgG4-positive cell infiltration was present at >10 /HPF in three of them. In one aortic wall sample from an abdominal aortic aneurysm, various histopathological features of IgG4-RD, such as IgG4-positive cell infiltration, obliterating phlebitis, and storiform fibrosis, were observed. IgG4-positive cell infiltration was observed in 9.7% of the surgical cardiovascular specimens, mainly in the aortic valve from aortic stenosis and in the aortic wall from aortic aneurysm. Whether IgG4-positive cell infiltration has pathophysiological importance in the development or progression of cardiovascular diseases should be investigated in future studies.

  12. Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

    OpenAIRE

    Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

    2015-01-01

    Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

  13. The Laguna Verde Central by it results in maintenance and operation consolidates it position of world class enterprise

    International Nuclear Information System (INIS)

    Rivera C, A.

    2008-01-01

    This work has the objective of showing the results of the Laguna VerdeCentral in the maintenance and the operation that in the short term the generation of electricity in Mexico by nuclear means is a viable option, in virtue of their positioning like Company of World Class, when winning March 25, 2008 the National Prize of Quality with the more high qualification in the history of this prize, same that allows us to be very optimistic in increasing the possibility to that the Nuclear Industry in Mexico grows. The focus of the comparative graphs, with official data of the Comision Federal de Electricidad (CFE), it is so that it is observed that the Laguna Verde Central is above those the other types of generation like they are the Coal power stations, Thermoelectric, Hydroelectric, likewise they can see that we are for up of the Independent Producers of Energy. The information of the electric power generation is presented by reactors nuclear at world level that is growing, in having 31 Generating Units in the construction process that favors the decisions making in the Government federal, likewise contributed data of the increment projected for 2016 in the country of 380,102 GWh that equivalent to 63% of growth, where it exists without place to doubts a good opportunity for the nucleoelectricity. The Investment Works Program of Public Sector (POISE), it shows the information that 6,178 Mwe will be installed settled of a Non-defined Technology in Mexico, information that specifies the opportunity to be a viable option, because the one Plant Factor, the Production of Electric power, and the Variable Cost of Production, the energy generation by nuclear means is the more competitiveness. Finally this work stood out the effort that communitary works are developed to benefit to the society and the environment to be one Viable option not only for their high performance, or competitive for those more low costs, but also to improve the public opinion with the sustainable

  14. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms

    Directory of Open Access Journals (Sweden)

    Michelle de Campos Soriani Azevedo

    2017-01-01

    Full Text Available Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR, a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV and negative (NPV predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H, the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease.

  15. qPCR detection of Mycobacterium leprae in biopsies and slit skin smear of different leprosy clinical forms.

    Science.gov (United States)

    Azevedo, Michelle de Campos Soriani; Ramuno, Natália Mortari; Fachin, Luciana Raquel Vincenzi; Tassa, Mônica; Rosa, Patrícia Sammarco; Belone, Andrea de Faria Fernandes; Diório, Suzana Madeira; Soares, Cleverson Teixeira; Garlet, Gustavo Pompermaier; Trombone, Ana Paula Favaro

    Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR), a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy) and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA) and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV) and negative (NPV) predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H), the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

  16. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi; PCR associado a hibridizacao com sondas radioativas de DNA para a identificacao de infeccao subclinica causada por Leishmania Chagasi

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN), Belo Horizonte, MG (Brazil); Moreno, Elizabeth Castro [Fundacao Nacional de Saude, Belo Horizonte, MG (Brazil). Coordenacao Regional de Minas Gerais; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela [Minas Gerais Univ., Belo Horizonte, MG (Brazil). Dept. de Parasitologia; Fernandes, Octavio [Fundacao Inst. Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Medicina Tropical

    2002-07-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with {sup 32} P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with {sup 32} P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  17. Avaliação das técnicas de RT-PCR e heminested RT-PCR em cérebros de cães com sinais neurológicos compatíveis com cinomose

    Directory of Open Access Journals (Sweden)

    Adriana Cortez

    2015-12-01

    Full Text Available The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS were collected from 68 dogs and tested by direct immunofluorescence test (RFID and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotein decoding. Fifty-nine samples were positive for RIFD, 40 for RT-PCR (Kappa = 0.358 and 54 for hnRT-PCR (Kappa = 0.740. All nine RIFD negative samples were also negative for RT-PCR and hnRT-PCR. In spite of the storage duration and proper sample conditions, the estimated accordance between hnRT-PCR and RIFD demonstrated that hnRT-PCR technique can be applied in retrospective studies.

  18. PCR, exit stage left ...

    CERN Multimedia

    2004-01-01

    The Prevessin Control Room during LEP's start up in 1989. The Prévessin Control Room (PCR) was recently engulfed in a wave of nostalgia. The PCR, scene of some of the greatest moments in CERN's history, is being dismantled to prepare for a complete overhaul. In February 2006, a new combined control centre for all the accelerators will open its doors on the same site, together with a new building currently under construction (see Bulletin issue 27/2004 of 28 June 2004). This marks the end of an important chapter in CERN's history. The Prévessin Control Room saw its first momentous event 28 years ago when the 400 GeV beam for the SPS was commissioned in the presence of Project Leader John Adams. It was also here that the first proton-antiproton collisions were observed, in 1981. Eight years later, in 1989, operators and directors alike jumped for joy at the announcement of the first electron-positron collisions at the start up of LEP, the biggest accelerator in the world. Today the 80 terminals and PCs have b...

  19. Detection of intestinal protozoa in paediatric patients with gastrointestinal symptoms by multiplex real-time PCR.

    Science.gov (United States)

    Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E

    2014-06-01

    The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  20. Massive venlafaxine overdose resulted in a false positive Abbott AxSYM (R) urine immunoassay for phencyclidine

    NARCIS (Netherlands)

    Bond, GR; Steele, PE; Uges, DRA

    2003-01-01

    Case report: A 13-yr-old girl overdosed on 48 x 150 mg venlafaxine (Effexor XR(R)). She was taking venlafaxine regularly for depression. Her only other medications included topical Benzamycin and pyridoxine 50 mg daily for acne. The Abbott AxSYM(R) assay was positive only for phencyclidine, but

  1. What is found positive in healthcare information and communication technology implementation?-the results of a nationwide survey in Finland.

    Science.gov (United States)

    Winblad, Ilkka; Hämäläinen, Päivi; Reponen, Jarmo

    2011-03-01

    Considerable expectations have been placed on information and communication technology (ICT) in improving the processes and quality of healthcare. Our purpose was to find out which element is found positive in healthcare ICT implementation. An online questionnaire on e-Health implementation submitted to all Finnish public health service providers and a sample from the private sector included an open question about which the electronic working methods, systems, or applications have most positively influenced the fluency or quality of service processes. The electronic health record was mentioned as an item that has positive influence by 52% of the respondents from the hospital districts, 27% of those from the primary healthcare centers, and 38% of those from the private providers. Digital radiology systems (including teleradiology) were mentioned by 52% of the hospital districts and 27% of the primary healthcare centers. The figures for digital laboratory systems (including telelaboratory) were 5% and 11%, respectively. The figures for teleradiology itself were 5% for the hospital districts and 15% for the primary healthcare centers; the figures for telelaboratory systems were 5% and 9%, respectively. The specialized healthcare seem to experience intraorganizational electronic services integrated to the electronic health record, such as digital radiology and laboratory services as exerting a positive influence, whereas the primary healthcare find such influence from different functions such as interorganizational data exchange and telemedicine services. These might indicate where the efforts should be focused when implementing ICT in healthcare.

  2. Increasing Elementary School Students' Subjective Well-Being through a Classwide Positive Psychology Intervention: Results of a Pilot Study

    Science.gov (United States)

    Suldo, Shannon M.; Hearon, Brittany V.; Bander, Bryan; McCullough, Mollie; Garofano, Jeffrey; Roth, Rachel A.; Tan, Sim Yin

    2015-01-01

    There is growing interest in school-based programs to promote students' subjective well-being (SWB). Students with greater SWB tend to have stronger relationships with their teachers and classmates, as well as behave in more positive ways. Drawing from theory and research pertinent to promoting children's SWB, we developed an 11-session classwide…

  3. Knowledge and causal attributions for mental disorders in HIV-positive children and adolescents: results from rural and urban Uganda.

    Science.gov (United States)

    Nalukenge, W; Martin, F; Seeley, J; Kinyanda, E

    2018-05-02

    Increasing availability of antiretroviral treatment (ART) has led HIV to be considered a chronic disease, shifting attention to focus on quality of life including mental wellbeing. We investigated knowledge and causal attributions for mental disorders in HIV-positive children and adolescents in rural and urban Uganda. This qualitative study was nested in an epidemiological mental health study among HIV-positive children and adolescents aged 5-17 years in rural and urban Uganda. In-depth interviews were conducted with caregivers of HIV-positive children (5-11 years) and adolescents (12-17 years) in HIV care. Interviews were audio recorded with permission from participants and written consent and assent sought before study procedures. Thirty eight participants (19 caregivers, 19 children/adolescents) were interviewed. Age range of caregivers was 28-69 years; majority were female (17). Caregivers had little knowledge on mental disorders ;only 3 related the vignette to a mental problem  and attributed it to: improper upbringing, violence, poverty and bereavement. Five adolescents identified vignettes as portraying mental disorders caused by: ill-health of parents, bereavement, child abuse, discrimination, HIV and poverty. Caregivers are not knowledgeable about behavioural and emotional challenges in HIV-positive children/adolescents. Mental health literacy programmes at HIV care clinics are essential to enhance treatment-seeking for mental health.

  4. Broad-Range PCR Coupled with Electrospray Ionization Time of Flight Mass Spectrometry for Detection of Bacteremia and Fungemia in Patients with Neutropenic Fever

    Science.gov (United States)

    Maertens, J.; Bueselinck, K.; Lagrou, K.

    2016-01-01

    Infection is an important complication in patients with hematologic malignancies or solid tumors undergoing intensive cytotoxic chemotherapy. In only 20 to 30% of the febrile neutropenic episodes, an infectious agent is detected by conventional cultures. In this prospective study, the performance of broad-range PCR coupled with electrospray ionization time of flight mass spectrometry (PCR/ESI-MS) technology was compared to conventional blood cultures (BC) in a consecutive series of samples from high-risk hematology patients. In 74 patients, BC and a whole-blood sample for PCR/ESI-MS (Iridica BAC BSI; Abbott, Carlsbad, CA, USA) were collected at the start of each febrile neutropenic episode and, in case of persistent fever, also at day 5. During 100 different febrile episodes, 105 blood samples were collected and analyzed by PCR/ESI-MS. There was evidence of a bloodstream infection (BSI) in 36/105 cases (34%), based on 14 cases with both PCR/ESI-MS and BC positivity, 17 cases with BC positivity only, and 5 cases with PCR/ESI-MS positivity only. The sensitivity of PCR/ESI-MS was 45%, specificity was 93%, and the negative predictive value was 80% compared to blood culture. PCR/ESI-MS detected definite pathogens (Fusobacterium nucleatum and Streptococcus pneumoniae) missed by BC, whereas it missed both Gram-negative and Gram-positive organisms detected by BC. PCR/ESI-MS testing detected additional microorganisms but showed a low sensitivity (45%) compared to BC in neutropenic patients. Our results indicate a lower concordance between BC and PCR/ESI-MS in the neutropenic population than what has been previously reported in other patient groups with normal white blood cell distribution, and a lower sensitivity than other PCR-based methods. PMID:27440820

  5. Correlation of HBV DNA PCR and HBeAg in hepatitis carriers

    International Nuclear Information System (INIS)

    Hussain, A.B.; Karamat, K.A.; Kazmi, S.Y.; Anwar, M.; Tariq, W.Z.

    2004-01-01

    Objective: To correlate hepatitis B HBV DNA polymerase chain reaction (PCR) results with HBeAg and serum ala- nine transferase (ALT) in carriers. Materials and Methods: Fifty hepatitis B carriers, with known HBsAg positive serostatus, raised serum ALT and detectable HBV DNA, were selected out of the patients reporting at AFIP for their blood test for HBV DNA. HBV DNA testing in these cases was carried out using PCR kit of Accugen-USA. After confirmation of their carrier status and raised serum ALT levels, the sera were tested for HBeAg and results of HBeAg testing were correlated with those of HBV DNA testing. Results: Out of the total 50 HBV DNA PCR positive hepatitis B carriers, 48 samples were positive for HBeAg. All the 50 HBV DNA positive cases had raised serum ALT levels. Conclusion: In case of non-availability of facility for HBV PCR, detectable HBeAg should be taken as a surrogate marker for HBV DNA in hepatitis B carriers with raised serum ALT. (author)

  6. Body position and motor imagery strategy effects on imagining gait in healthy adults: Results from a cross-sectional study.

    Science.gov (United States)

    Beauchet, Olivier; Launay, Cyrille P; Sekhon, Harmehr; Gautier, Jennifer; Chabot, Julia; Levinoff, Elise J; Allali, Gilles

    2018-01-01

    Assessment of changes in higher levels of gait control with aging is important to better understand age-related gait instability, with the perspective to improve the screening of individuals at risk for falls. The comparison between actual Timed Up and Go test (aTUG) and its imagined version (iTUG) is a simple clinical way to assess age-related changes in gait control. The modulations of iTUG performances by body positions and motor imagery (MI) strategies with normal aging have not been evaluated yet. This study aims 1) to compare the aTUG time with the iTUG time under different body positions (i.e., sitting, standing or supine) in healthy young and middle age, and older adults, and 2) to examine the associations of body positions and MI strategies (i.e., egocentric versus allocentric) with the time needed to complete the iTUG and the delta TUG time (i.e., relative difference between aTUG and iTUG) while taking into consideration clinical characteristics of participants. A total of 60 healthy individuals (30 young and middle age participants 26.6±7.4 years, and 30 old participants 75.0±4.4 years) were recruited in this cross-sectional study. The iTUG was performed while sitting, standing and in supine position. Times of the aTUG, the iTUG under the three body positions, the TUG delta time and the strategies of MI (i.e., ego representation, defined as representation of the location of objects in space relative to the body axes of the self, versus allocentric representation defined as encoding information about body movement with respect to other object, the location of body being defined relative to the location of other objects) were used as outcomes. Age, sex, height, weight, number of drugs taken daily, level of physical activity and prevalence of closed eyes while performing iTUG were recorded. The aTUG time is significantly greater than iTUG while sitting and standing (Pposition. The multiple linear regressions confirm that the supine position is associated

  7. Isolation and identification of Mycoplasma agalactiae by culture and polymerase chain reaction (PCR from sheep of Qom province, Iran

    Directory of Open Access Journals (Sweden)

    Abtin, A.R.

    2013-05-01

    Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.

  8. Semi-robotic 6 degree of freedom positioning for intracranial high precision radiotherapy; first phantom and clinical results

    International Nuclear Information System (INIS)

    Wilbert, Jürgen; Guckenberger, Matthias; Polat, Bülent; Sauer, Otto; Vogele, Michael; Flentje, Michael; Sweeney, Reinhart A

    2010-01-01

    To introduce a novel method of patient positioning for high precision intracranial radiotherapy. An infrared(IR)-array, reproducibly attached to the patient via a vacuum-mouthpiece(vMP) and connected to the table via a 6 degree-of-freedom(DoF) mechanical arm serves as positioning and fixation system. After IR-based manual prepositioning to rough treatment position and fixation of the mechanical arm, a cone-beam CT(CBCT) is performed. A robotic 6 DoF treatment couch (HexaPOD™) then automatically corrects all remaining translations and rotations. This absolute position of infrared markers at the first fraction acts as reference for the following fractions where patients are manually prepositioned to within ± 2 mm and ± 2° of this IR reference position prior to final HexaPOD-based correction; consequently CBCT imaging is only required once at the first treatment fraction. The preclinical feasibility and attainable repositioning accuracy of this method was evaluated on a phantom and human volunteers as was the clinical efficacy on 7 pilot study patients. Phantom and volunteer manual IR-based prepositioning to within ± 2 mm and ± 2° in 6DoF was possible within a mean(± SD) of 90 ± 31 and 56 ± 22 seconds respectively. Mean phantom translational and rotational precision after 6 DoF corrections by the HexaPOD was 0.2 ± 0.2 mm and 0.7 ± 0.8° respectively. For the actual patient collective, the mean 3D vector for inter-treatment repositioning accuracy (n = 102) was 1.6 ± 0.8 mm while intra-fraction movement (n = 110) was 0.6 ± 0.4 mm. This novel semi-automatic 6DoF IR-based system has been shown to compare favourably with existing non-invasive intracranial repeat fixation systems with respect to handling, reproducibility and, more importantly, intra-fraction rigidity. Some advantages are full cranial positioning flexibility for single and fractionated IGRT treatments and possibly increased patient comfort

  9. [Retrospective study of the implementation of the qualitative PCR technique in biological samples for monitoring toxoplasmosis in pediatric patients receiving hematopoietic stem cell transplantation].

    Science.gov (United States)

    Nigro, Mónica G; Figueroa, Carlos; Ledesma, Bibiana A

    2014-01-01

    Toxoplasmosis is an opportunistic infection caused by the parasite Toxoplasma gondii. The infection is severe and difficult to diagnose in patients receiving allogeneic hematopoietic stem cell transplantation (HSCT). Twelve patients receiving HSCT were monitored post-transplant, by qualitative PCR at the Children's Hospital S.A.M.I.C. "Prof. Dr. Juan P. Garrahan". The monitoring of these patients was defined by a history of positive serology for toxoplasmosis in the donor or recipient and because their hematologic condition did not allow the use of trimethoprim-sulfamethoxazole for prophylaxis. During the patients' monitoring, two of them with positive PCR results showed signs of illness by T. gondii and were treated with pyrimethamine-clindamycin. In two other patients, toxoplasmosis was the cause of death and an autopsy finding, showing negative PCR results. Four patients without clinical manifestations received treatment for toxoplasmosis because of positive PCR detection. In four patients there were no signs of toxoplasmosis disease and negative PCR results during follow-up. The qualitative PCR technique proved useful for the detection of toxoplasmosis reactivation in HSCT recipients, but has limitations in monitoring and making clinical decisions due to the persistence of positive PCR over time and manifestations of toxicity caused by the treatment. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  10. Mycobacterium paratuberculosis detection in cow's milk in Argentina by immunomagnetic separation-PCR.

    Science.gov (United States)

    Gilardoni, Liliana Rosa; Fernández, Bárbara; Morsella, Claudia; Mendez, Laura; Jar, Ana María; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor

    2016-01-01

    The aim of this study was to standardize a diagnosis procedure to detect Mycobacterium avium subsp. paratuberculosis (Map) DNA in raw cow milk samples under field conditions. A procedure that combines both immunomagnetic separation and IS900-PCR detection (IMS-IS1 PCR) was employed on milk samples from 265 lactating Holstein cows from Map infected and uninfected herds in Argentina. IMS-IS1 PCR results were analyzed and compared with those obtained from milk and fecal culture and serum ELISA. The extent of agreement between both tests was determined by the Kappa test. IMS-IS1 PCR showed a detection limit of 10(1) CFU of Map/mL of milk, when 50:50 mix of monoclonal and polyclonal antibodies were used to coat magnetic beads. All of the 118 samples from the Map uninfected herds were negative for the set of the tests. In Map infected herds, 80 out of 147 cows tested positive by milk IMS-IS1 PCR (55%), of which 2 (1.4%) were also positive by milk culture, 15 (10%) by fecal culture, and 20 (14%) by serum ELISA. Kappa statistics (95% CI) showed a slight agreement between the different tests (<0.20), and the proportions of agreement were ≤0.55. The IMS-IS1 PCR method detected Map in milk of the cows that were not positive in other techniques. This is the first report dealing with the application of IMS-IS1 PCR in the detection of Map in raw milk samples under field conditions in Argentina. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  11. [Evaluation of cytomegalovirus quantification in blood by the R-gene real-time PCR test].

    Science.gov (United States)

    Marque-Juillet, S; Touzard, A; Monnier, S; Fernand-Laurent, C; Therby, A; Rigaudeau, S; Harzic, M

    2010-04-01

    Diagnosing the presence of cytomegalovirus (CMV) in the blood of immunodepressed patients is often done by quantitative polymerase chain reaction (Q-PCR) even though the reference method remains the antigenemia pp65 (Ag-pp65) test. To define the predictive value of the Q-PCR in the diagnosis of CMV disease and assess treatment efficacy using the CMV R-gene test. To compare the Q-PCR results and feasibility with those of the Ag-pp65 test. The Q-PCR was performed in 34 whole blood samples (frozen at -80 degrees C until use) from five patients diagnosed with CMV disease, defined as the presence of clinical signs and Ag-pp65 in the nuclei of more than two cells. After extraction, viral DNA was quantified in each sample using the Q-PCR CMV R-gene kit according to the manufacturer's instructions. Immediately after blood was drawn, the Ag-pp65 test had been performed in 32 samples using CINAkit (Argene). The 16 samples positive by the Ag-pp65 test were also positive by PCR; six samples negative by the Ag-pp65 test were positive by PCR; and the remaining 10 samples were negative by both techniques. During treatment, the two markers' kinetics were similar. The CMV R-gene test has a predictive value as good as that of the Ag-pp65 test but is fast and easier to use. A prospective study with a greater number of patients is needed to define the prediction threshold for CMV disease. Copyright 2009 Elsevier Masson SAS. All rights reserved.

  12. Detection and discrimination of two Brucella species by multiplex real-time PCR and high-resolution melt analysis curve from human blood and comparison of results using RFLP

    Directory of Open Access Journals (Sweden)

    Vahhab Piranfar

    2015-09-01

    Conclusion: The present study showed that this technique, which scans gene segments and creates an analysis pattern for detection of clinical samples, is useful and more dominant compared with PCR-RFLP. Thus, this method can be used for brucellosis detection, and clinical and epidemiological research.

  13. Unambiguous determination of H-atom positions: comparing results from neutron and high-resolution X-ray crystallography.

    Science.gov (United States)

    Gardberg, Anna S; Del Castillo, Alexis Rae; Weiss, Kevin L; Meilleur, Flora; Blakeley, Matthew P; Myles, Dean A A

    2010-05-01

    The locations of H atoms in biological structures can be difficult to determine using X-ray diffraction methods. Neutron diffraction offers a relatively greater scattering magnitude from H and D atoms. Here, 1.65 A resolution neutron diffraction studies of fully perdeuterated and selectively CH(3)-protonated perdeuterated crystals of Pyrococcus furiosus rubredoxin (D-rubredoxin and HD-rubredoxin, respectively) at room temperature (RT) are described, as well as 1.1 A resolution X-ray diffraction studies of the same protein at both RT and 100 K. The two techniques are quantitatively compared in terms of their power to directly provide atomic positions for D atoms and analyze the role played by atomic thermal motion by computing the sigma level at the D-atom coordinate in simulated-annealing composite D-OMIT maps. It is shown that 1.65 A resolution RT neutron data for perdeuterated rubredoxin are approximately 8 times more likely overall to provide high-confidence positions for D atoms than 1.1 A resolution X-ray data at 100 K or RT. At or above the 1.0sigma level, the joint X-ray/neutron (XN) structures define 342/378 (90%) and 291/365 (80%) of the D-atom positions for D-rubredoxin and HD-rubredoxin, respectively. The X-ray-only 1.1 A resolution 100 K structures determine only 19/388 (5%) and 8/388 (2%) of the D-atom positions above the 1.0sigma level for D-rubredoxin and HD-rubredoxin, respectively. Furthermore, the improved model obtained from joint XN refinement yielded improved electron-density maps, permitting the location of more D atoms than electron-density maps from models refined against X-ray data only.

  14. Positive selection results in frequent reversible amino acid replacements in the G protein gene of human respiratory syncytial virus.

    Science.gov (United States)

    Botosso, Viviane F; Zanotto, Paolo M de A; Ueda, Mirthes; Arruda, Eurico; Gilio, Alfredo E; Vieira, Sandra E; Stewien, Klaus E; Peret, Teresa C T; Jamal, Leda F; Pardini, Maria I de M C; Pinho, João R R; Massad, Eduardo; Sant'anna, Osvaldo A; Holmes, Eddie C; Durigon, Edison L

    2009-01-01

    Human respiratory syncytial virus (HRSV) is the major cause of lower respiratory tract infections in children under 5 years of age and the elderly, causing annual disease outbreaks during the fall and winter. Multiple lineages of the HRSVA and HRSVB serotypes co-circulate within a single outbreak and display a strongly temporal pattern of genetic variation, with a replacement of dominant genotypes occurring during consecutive years. In the present study we utilized phylogenetic methods to detect and map sites subject to adaptive evolution in the G protein of HRSVA and HRSVB. A total of 29 and 23 amino acid sites were found to be putatively positively selected in HRSVA and HRSVB, respectively. Several of these sites defined genotypes and lineages within genotypes in both groups, and correlated well with epitopes previously described in group A. Remarkably, 18 of these positively selected tended to revert in time to a previous codon state, producing a "flip-flop" phylogenetic pattern. Such frequent evolutionary reversals in HRSV are indicative of a combination of frequent positive selection, reflecting the changing immune status of the human population, and a limited repertoire of functionally viable amino acids at specific amino acid sites.

  15. Positive selection results in frequent reversible amino acid replacements in the G protein gene of human respiratory syncytial virus.

    Directory of Open Access Journals (Sweden)

    Viviane F Botosso

    2009-01-01

    Full Text Available Human respiratory syncytial virus (HRSV is the major cause of lower respiratory tract infections in children under 5 years of age and the elderly, causing annual disease outbreaks during the fall and winter. Multiple lineages of the HRSVA and HRSVB serotypes co-circulate within a single outbreak and display a strongly temporal pattern of genetic variation, with a replacement of dominant genotypes occurring during consecutive years. In the present study we utilized phylogenetic methods to detect and map sites subject to adaptive evolution in the G protein of HRSVA and HRSVB. A total of 29 and 23 amino acid sites were found to be putatively positively selected in HRSVA and HRSVB, respectively. Several of these sites defined genotypes and lineages within genotypes in both groups, and correlated well with epitopes previously described in group A. Remarkably, 18 of these positively selected tended to revert in time to a previous codon state, producing a "flip-flop" phylogenetic pattern. Such frequent evolutionary reversals in HRSV are indicative of a combination of frequent positive selection, reflecting the changing immune status of the human population, and a limited repertoire of functionally viable amino acids at specific amino acid sites.

  16. Diagnostic accuracy of the ROCHE Septifast PCR system for the rapid detection of blood pathogens in neonatal sepsis-A prospective clinical trial.

    Science.gov (United States)

    Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith

    2017-01-01

    Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.

  17. Detection of Mycoplasma hyopneumoniae in Bronchoalveolar Lavage Fluids of Pigs by PCR

    Science.gov (United States)

    Baumeister, A. Katrin; Runge, Martin; Ganter, Martin; Feenstra, Anne A.; Delbeck, Friedrich; Kirchhoff, Helga

    1998-01-01

    In the present investigation we developed a method for the detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluid (BALF) of pigs by PCR with a primer pair flanking a DNA fragment of 853 bp specific for M. hyopneumoniae. Several methods were tested to eliminate the amplification inhibitors present in BALFs. The best results were obtained by the extraction of the DNA from the BALFs. By the PCR performed with the extracted DNA, 102 CFU of M. hyopneumoniae could be detected in 1 ml of BALF from specific-pathogen-free swine experimentally inoculated with M. hyopneumoniae. DNA from 11 other mycoplasma species and 17 cell-walled bacterial species colonizing the respiratory tracts of pigs was not amplified. In a field study BALFs from 40 pigs from farms with a history of chronic pneumonia were tested for M. hyopneumoniae by cultivation and by PCR (i) with BALFs incubated in Friis medium and (ii) with DNA extracted from the BALFs. In addition, PCR was performed with postmortem lung washings from 19 of the 40 pigs, and immunofluorescence tests were carried out with sections of lungs from 18 of the 40 pigs. M. hyopneumoniae could not be detected in 18 of the 40 pigs by any of the five methods tested. The remaining 22 pigs showed a positive reaction by the PCR with DNA extracted from the BALFs and variable positive reactions by the other tests. A complete correspondence could be observed between the immunofluorescence test result and the result of PCR with DNA. The investigation shows that the PCR with DNA extracted from BALFs is a suitable technique for the sensitive and specific in vivo detection of M. hyopneumoniae. PMID:9650949

  18. MIS Single-position Lateral and Oblique Lateral Lumbar Interbody Fusion and Bilateral Pedicle Screw Fixation: Feasibility and Perioperative Results.

    Science.gov (United States)

    Blizzard, Daniel J; Thomas, J Alex

    2018-03-15

    Retrospective review of prospectively collected data of the first 72 consecutive patients treated with single-position one- or two-level lateral (LLIF) or oblique lateral interbody fusion (OLLIF) with bilateral percutaneous pedicle screw and rod fixation by a single spine surgeon. To evaluate the clinical feasibility, accuracy, and efficiency of a single-position technique for LLIF and OLLIF with bilateral pedicle screw and rod fixation. Minimally-invasive lateral interbody approaches are performed in the lateral decubitus position. Subsequent repositioning prone for bilateral pedicle screw and rod fixation requires significant time and resources and does not facilitate increased lumbar lordosis. The first 72 consecutive patients (300 screws) treated with single-position LLIF or OLLIF and bilateral pedicle screws by a single surgeon between December 2013 and August 2016 were included in the study. Screw accuracy and fusion were graded using computed tomography and several timing parameters were recorded including retractor, fluoroscopy, and screw placement time. Complications including reoperation, infection, and postoperative radicular pain and weakness were recorded. Average screw placement time was 5.9 min/screw (standard deviation, SD: 1.5 min; range: 3-9.5 min). Average total operative time (interbody cage and pedicle screw placement) was 87.9 minutes (SD: 25.1 min; range: 49-195 min). Average fluoroscopy time was 15.0 s/screw (SD: 4.7 s; range: 6-25 s). The pedicle screw breach rate was 5.1% with 10/13 breaches measured as < 2 mm in magnitude. Fusion rate at 6-months postoperative was 87.5%. Two (2.8%) patients underwent reoperation for malpositioned pedicle screws with subsequent resolution of symptoms. The single-position, all-lateral technique was found to be feasible with accuracy, fluoroscopy usage, and complication rates comparable with the published literature. This technique eliminates the time and staffing associated with

  19. A study of HPV typing for the management of HPV-positive ASC-US cervical cytologic results.

    Science.gov (United States)

    Schiffman, Mark; Vaughan, Laurence M; Raine-Bennett, Tina R; Castle, Philip E; Katki, Hormuzd A; Gage, Julia C; Fetterman, Barbara; Befano, Brian; Wentzensen, Nicolas

    2015-09-01

    In US cervical screening, immediate colposcopy is recommended for women with HPV-positive ASC-US (equivocal) cytology. We evaluated whether partial typing by Onclarity™ (BD) might identify HPV-positive women with low enough CIN3+ risk to permit 1-year follow-up instead. The NCI-Kaiser Permanente Northern California Persistence and Progression cohort includes a subset of 13,890 women aged 21+ with HC2 (Qiagen)-positive ASC-US at enrollment; current median follow-up is 3.0years. Using stratified random sampling, we typed 2079 archived enrollment specimens including 329 women subsequently diagnosed with CIN3+, 563 with CIN2, and 1187 with positive women with ASC-US was 5.2%; this establishes the "benchmark" risk for colposcopic referral. Hierarchically, 3-year cumulative risks for each typing channel were 16.0% for HPV16, 7.4% for HPV18, 7.0% for HPV31, 7.1% for grouped HPV33/58, 4.3% for HPV52, 3.9% for HPV45, 2.7% for HPV51, 1.6% for HPV39/68/35, and 1.3% for HPV59/56/66. ASC-US linked to HPV16, HPV18, HPV31, or HPV33/58 warrants immediate colposcopy. Optimal management of women with HPV52 or HPV45 is uncertain. Risk of women with only HPV51, HPV39/68/35, or HPV59/56/66 might be low enough to recommend 1-year retesting permitting viral clearance. This strategy would defer colposcopy for 40% of women with HPV-positive ASC-US, half of whom would be cotest-negative at 1-year return. Approximately 10% of those with CIN3 diagnosable at enrollment would be delayed 1year instead. Cost-effectiveness analyses are needed. Published by Elsevier Inc.

  20. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com

    2009-07-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  1. Comparison of kDNA PCR-hybridization assay with three PCR methods for canines visceral Leishmaniasis diagnosis

    International Nuclear Information System (INIS)

    Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.

    2009-01-01

    The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)

  2. Detection of Campylobacter in Stool and Determination of Significance by Culture, Enzyme Immunoassay, and PCR in Developing Countries

    Science.gov (United States)

    Platts-Mills, James A.; Liu, Jie; Gratz, Jean; Mduma, Esto; Amour, Caroline; Swai, Ndealilia; Taniuchi, Mami; Begum, Sharmin; Peñataro Yori, Pablo; Tilley, Drake H.; Lee, Gwenyth; Shen, Zeli; Whary, Mark T.; Fox, James G.; McGrath, Monica; Kosek, Margaret; Haque, Rashidul

    2014-01-01

    Campylobacter is a common bacterial enteropathogen that can be detected in stool by culture, enzyme immunoassay (EIA), or PCR. We compared culture for C. jejuni/C. coli, EIA (ProSpecT), and duplex PCR to distinguish Campylobacter jejuni/C. coli and non-jejuni/coli Campylobacter on 432 diarrheal and matched control stool samples from infants in a multisite longitudinal study of enteric infections in Tanzania, Bangladesh, and Peru. The sensitivity and specificity of culture were 8.5% and 97.6%, respectively, compared with the results of EIA and 8.7% and 98.0%, respectively, compared with the results of PCR for C. jejuni/C. coli. Most (71.6%) EIA-positive samples were positive by PCR for C. jejuni/C. coli, but 27.6% were positive for non-jejuni/coli Campylobacter species. Sequencing of 16S rRNA from 53 of these non-jejuni/coli Campylobacter samples showed that it most closely matched the 16S rRNA of C. hyointestinalis subsp. lawsonii (56%), C. troglodytis (33%), C. upsaliensis (7.7%), and C. jejuni/C. coli (2.6%). Campylobacter-negative stool spiked with each of the above-mentioned Campylobacter species revealed reactivity with EIA. PCR detection of Campylobacter species was strongly associated with diarrhea in Peru (odds ratio [OR] = 3.66, P < 0.001) but not in Tanzania (OR = 1.56, P = 0.24) or Bangladesh (OR = 1.13, P = 0.75). According to PCR, Campylobacter jejuni/C. coli infections represented less than half of all infections with Campylobacter species. In sum, in infants in developing country settings, the ProSpecT EIA and PCR for Campylobacter reveal extremely high rates of positivity. We propose the use of PCR because it retains high sensitivity, can ascertain burden, and can distinguish between Campylobacter infections at the species level. PMID:24452175

  3. PCR testing can be as accurate as culture for diagnosis of Ichthyophonus hoferi in Yukon River Chinook salmon Oncorhynchus tshawytscha .

    Science.gov (United States)

    Hamazaki, Toshihide; Kahler, Eryn; Borba, Bonnie M; Burton, Tamara

    2013-07-09

    We evaluated the comparability of culture and PCR tests for detecting Ichthyophonus in Yukon River Chinook salmon Oncorhynchus tshawytscha from field samples collected at 3 locations (Emmonak, Chena, and Salcha, Alaska, USA) in 2004, 2005, and 2006. Assuming diagnosis by culture as the 'true' infection status, we calculated the sensitivity (correctly identifying fish positive for Ichthyophonus), specificity (correctly identifying fish negative for Ichthyophonus), and accuracy (correctly identifying both positive and negative fish) of PCR. Regardless of sampling locations and years, sensitivity, specificity, and accuracy exceeded 90%. Estimates of infection prevalence by PCR were similar to those by culture, except for Salcha 2005, where prevalence by PCR was significantly higher than that by culture (p < 0.0001). These results show that the PCR test is comparable to the culture test for diagnosing Ichthyophonus infection.

  4. results

    Directory of Open Access Journals (Sweden)

    Salabura Piotr

    2017-01-01

    Full Text Available HADES experiment at GSI is the only high precision experiment probing nuclear matter in the beam energy range of a few AGeV. Pion, proton and ion beams are used to study rare dielectron and strangeness probes to diagnose properties of strongly interacting matter in this energy regime. Selected results from p + A and A + A collisions are presented and discussed.

  5. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  6. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Development and comparison of a real-time PCR assay for detection of Dichelobacter nodosus with culturing and conventional PCR: harmonisation between three laboratories

    DEFF Research Database (Denmark)

    Frosth, Sara; Slettemeås, Jannice S.; Jørgensen, Hannah J.

    2012-01-01

    BACKGROUND: Ovine footrot is a contagious disease with worldwide occurrence in sheep. The main causative agent is the fastidious bacterium Dichelobacter nodosus. In Scandinavia, footrot was first diagnosed in Sweden in 2004 and later also in Norway and Denmark. Clinical examination of sheep feet...... was tested using 55 bacterial and two fungal strains. To evaluate the sensitivity and harmonisation of results between different laboratories, aliquots of a single DNA preparation were analysed at three Scandinavian laboratories. The developed real-time PCR assay was compared to culturing by analysing 126...... laboratories and corresponds to approximately three copies of the D. nodosus genome per reaction. The assay showed 100% inclusivity and 100% exclusivity for the strains tested. The real-time PCR assay found 54.8% more positive samples than by culturing and 8% more than conventional PCR. CONCLUSIONS...

  8. Diagnostic efficacy of a real time-PCR assay for Chlamydia trachomatis infection in infertile women in north India

    Directory of Open Access Journals (Sweden)

    Benu Dhawan

    2014-01-01

    Full Text Available Background & objectives: Little is known about the prevalence of Chlamydia trachomatis infection in Indian women with infertility. To improve the diagnosis of C. trachomatis infection in developing countries, there is an urgent need to establish cost-effective molecular test with high sensitivity and specificity. This study was conducted to determine the diagnostic utility of a real time-PCR assay for detention of C. trachomatis infection in infertile women attending an infertility clinic in north India. The in house real time-PCR assay was also compared with a commercial real-time PCR based detection system. Methods: Endocervical swabs, collected from 200 infertile women were tested for C. trachomatis by three different PCR assays viz. in-house real time-PCR targeting the cryptic plasmid using published primers, along with omp1 gene and cryptic plasmid based conventional PCR assays. Specimens were also subjected to direct fluorescence assay (DFA and enzyme immunoassay (EIA Performance of in-house real time-PCR was compared with that of COBAS Taqman C. trachomatis Test, version 2.0 on all in-house real time-PCR positive sample and 30 consecutive negative samples. Results: C. trachomatis infection was found in 13.5 per cent (27/200 infertile women by in-house real time-PCR, 11.5 per cent (23/200 by cryptic plasmid and/or omp1 gene based conventional PCR, 9 per cent (18/200 by DFA and 6.5 per cent (7/200 by EIA. The in-house real time-PCR exhibited a sensitivity and specificity of 100 per cent, considering COBAS Taqman CT Test as the gold standard. The negative and positive predictive values of the in-house real time-PCR were 100 per cent. The in-house real time-PCR could detect as low as 10 copies of C. trachomatis DNA per reaction. Interpretation & conclusions: In-house real time-PCR targeting the cryptic plasmid of C. trachomatis exhibited an excellent sensitivity and specificity similar to that of COBAS Taqman CT Test, v2.0 for detection of C

  9. Direct detection of Mycobacterium tuberculosis complex in bovine and bubaline tissues through nested-PCR.

    Science.gov (United States)

    Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R

    2014-01-01

    Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

  10. First postoperative PSA is associated with outcomes in patients with node positive prostate cancer: Results from the SEARCH database.

    Science.gov (United States)

    McDonald, Michelle L; Howard, Lauren E; Aronson, William J; Terris, Martha K; Cooperberg, Matthew R; Amling, Christopher L; Freedland, Stephen J; Kane, Christopher J

    2018-05-01

    To analyze factors associated with metastases, prostate cancer-specific mortality, and all-cause mortality in pN1 patients. We analyzed 3,642 radical prostatectomy patients within the Shared Equal Access Regional Cancer Hospital (SEARCH) database. Pathologic Gleason grade, number of lymph nodes (LN) removed, and first postoperative prostate-specific antigen (PSA) (PSA. Of 3,642 patients, 124 (3.4%) had pN1. There were 71 (60%) patients with 1 positive LN, 32 (27%) with 2 positive LNs, and 15 (13%) with ≥3. Among men with pN1, first postoperative PSA wasPSA ≥0.2 ng/ml (P = 0.005) were associated with metastases. First postoperative PSA ≥0.2ng/ml was associated with metastasis on multivariable analysis (P = 0.046). Log-rank analysis revealed a more favorable metastases-free survival in patients with a first postoperative PSAPSAPSA ≥0.2ng/ml were more likely to develop metastases. First postoperative PSA may be useful in identifying pN1 patients who harbor distant disease and aid in secondary treatment decisions. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. One-step cross-genogroup multiplex RT-qPCR with an internal control system for the detection of infectious pancreatic necrosis virus (IPNV).

    Science.gov (United States)

    Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard

    2017-09-01

    Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Principal component reconstruction (PCR) for cine CBCT with motion learning from 2D fluoroscopy.

    Science.gov (United States)

    Gao, Hao; Zhang, Yawei; Ren, Lei; Yin, Fang-Fang

    2018-01-01

    This work aims to generate cine CT images (i.e., 4D images with high-temporal resolution) based on a novel principal component reconstruction (PCR) technique with motion learning from 2D fluoroscopic training images. In the proposed PCR method, the matrix factorization is utilized as an explicit low-rank regularization of 4D images that are represented as a product of spatial principal components and temporal motion coefficients. The key hypothesis of PCR is that temporal coefficients from 4D images can be reasonably approximated by temporal coefficients learned from 2D fluoroscopic training projections. For this purpose, we can acquire fluoroscopic training projections for a few breathing periods at fixed gantry angles that are free from geometric distortion due to gantry rotation, that is, fluoroscopy-based motion learning. Such training projections can provide an effective characterization of the breathing motion. The temporal coefficients can be extracted from these training projections and used as priors for PCR, even though principal components from training projections are certainly not the same for these 4D images to be reconstructed. For this purpose, training data are synchronized with reconstruction data using identical real-time breathing position intervals for projection binning. In terms of image reconstruction, with a priori temporal coefficients, the data fidelity for PCR changes from nonlinear to linear, and consequently, the PCR method is robust and can be solved efficiently. PCR is formulated as a convex optimization problem with the sum of linear data fidelity with respect to spatial principal components and spatiotemporal total variation regularization imposed on 4D image phases. The solution algorithm of PCR is developed based on alternating direction method of multipliers. The implementation is fully parallelized on GPU with NVIDIA CUDA toolbox and each reconstruction takes about a few minutes. The proposed PCR method is validated and

  13. A robust internal control for high-precision DNA methylation analyses by droplet digital PCR.

    Science.gov (United States)

    Pharo, Heidi D; Andresen, Kim; Berg, Kaja C G; Lothe, Ragnhild A; Jeanmougin, Marine; Lind, Guro E

    2018-01-01

    Droplet digital PCR (ddPCR) allows absolute quantification of nucleic acids and has potential for improved non-invasive detection of DNA methylation. For increased precision of the methylation analysis, we aimed to develop a robust internal control for use in methylation-specific ddPCR. Two control design approaches were tested: (a) targeting a genomic region shared across members of a gene family and (b) combining multiple assays targeting different pericentromeric loci on different chromosomes. Through analyses of 34 colorectal cancer cell lines, the performance of the control assay candidates was optimized and evaluated, both individually and in various combinations, using the QX200™ droplet digital PCR platform (Bio-Rad). The best-performing control was tested in combination with assays targeting methylated CDO1 , SEPT9 , and VIM . A 4Plex panel consisting of EPHA3 , KBTBD4 , PLEKHF1 , and SYT10 was identified as the best-performing control. The use of the 4Plex for normalization reduced the variability in methylation values, corrected for differences in template amount, and diminished the effect of chromosomal aberrations. Positive Droplet Calling (PoDCall), an R-based algorithm for standardized threshold determination, was developed, ensuring consistency of the ddPCR results. Implementation of a robust internal control, i.e., the 4Plex, and an algorithm for automated threshold determination, PoDCall, in methylation-specific ddPCR increase the precision of DNA methylation analysis.

  14. Detection of Echinococcus multilocularis by MC-PCR: evaluation of diagnostic sensitivity and specificity without gold standard

    Directory of Open Access Journals (Sweden)

    Helene Wahlström

    2016-03-01

    Full Text Available Introduction: A semi-automated magnetic capture probe-based DNA extraction and real-time PCR method (MC-PCR, allowing for a more efficient large-scale surveillance of Echinococcus multilocularis occurrence, has been developed. The test sensitivity has previously been evaluated using the sedimentation and counting technique (SCT as a gold standard. However, as the sensitivity of the SCT is not 1, test characteristics of the MC-PCR was also evaluated using latent class analysis, a methodology not requiring a gold standard. Materials and methods: Test results, MC-PCR and SCT, from a previous evaluation of the MC-PCR using 177 foxes shot in the spring (n=108 and autumn 2012 (n=69 in high prevalence areas in Switzerland were used. Latent class analysis was used to estimate the test characteristics of the MC-PCR. Although it is not the primary aim of this study, estimates of the test characteristics of the SCT were also obtained. Results and discussion: This study showed that the sensitivity of the MC-PCR was 0.88 [95% posterior credible interval (PCI 0.80–0.93], which was not significantly different than the SCT, 0.83 (95% PCI 0.76–0.88, which is currently considered as the gold standard. The specificity of both tests was high, 0.98 (95% PCI 0.94–0.99 for the MC-PCR and 0.99 (95% PCI 0.99–1 for the SCT. In a previous study, using fox scats from a low prevalence area, the specificity of the MC-PCR was higher, 0.999% (95% PCI 0.997–1. One reason for the lower estimate of the specificity in this study could be that the MC-PCR detects DNA from infected but non-infectious rodents eaten by foxes. When using MC-PCR in low prevalence areas or areas free from the parasite, a positive result in the MC-PCR should be regarded as a true positive. Conclusion: The sensitivity of the MC-PCR (0.88 was comparable to the sensitivity of SCT (0.83.

  15. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    DEFF Research Database (Denmark)

    Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

    2007-01-01

    in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...

  16. An insulated isothermal PCR method on a field-deployable device for rapid and sensitive detection of canine parvovirus type 2 at points of need.

    Science.gov (United States)

    Wilkes, Rebecca P; Lee, Pei-Yu A; Tsai, Yun-Long; Tsai, Chuan-Fu; Chang, Hsiu-Hui; Chang, Hsiao-Fen G; Wang, Hwa-Tang T

    2015-08-01

    Canine parvovirus type 2 (CPV-2), including subtypes 2a, 2b and 2c, causes an acute enteric disease in both domestic and wild animals. Rapid and sensitive diagnosis aids effective disease management at points of need (PON). A commercially available, field-deployable and user-friendly system, designed with insulated isothermal PCR (iiPCR) technology, displays excellent sensitivity and specificity for nucleic acid detection. An iiPCR method was developed for on-site detection of all circulating CPV-2 strains. Limit of detection was determined using plasmid DNA. CPV-2a, 2b and 2c strains, a feline panleukopenia virus (FPV) strain, and nine canine pathogens were tested to evaluate assay specificity. Reaction sensitivity and performance were compared with an in-house real-time PCR using serial dilutions of a CPV-2b strain and 100 canine fecal clinical samples collected from 2010 to 2014, respectively. The 95% limit of detection of the iiPCR method was 13 copies of standard DNA and detection limits for CPV-2b DNA were equivalent for iiPCR and real-time PCR. The iiPCR reaction detected CPV-2a, 2b and 2c and FPV. Non-targeted pathogens were not detected. Test results of real-time PCR and iiPCR from 99 fecal samples agreed with each other, while one real-time PCR-positive sample tested negative by iiPCR. Therefore, excellent agreement (k = 0.98) with sensitivity of 98.41% and specificity of 100% in detecting CPV-2 in feces was found between the two methods. In conclusion, the iiPCR system has potential to serve as a useful tool for rapid and accurate PON, molecular detection of CPV-2. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Evaluation of a duplex reverse-transcription real-time PCR assay for the detection of encephalomyocarditis virus.

    Science.gov (United States)

    Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D

    2018-06-01

    We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.

  18. Impact of somatic PI3K pathway and ERBB family mutations on pathological complete response (pCR) in HER2-positive breast cancer patients who received neoadjuvant HER2-targeted therapies.

    LENUS (Irish Health Repository)

    Toomey, Sinead

    2017-07-27

    The Cancer Genome Atlas analysis revealed that somatic EGFR, receptor tyrosine-protein kinase erbB-2 (ERBB2), Erb-B2 receptor tyrosine kinase 3 (ERBB3) and Erb-B2 receptor tyrosine kinase 4 (ERBB4) gene mutations (ERBB family mutations) occur alone or co-occur with somatic mutations in the gene encoding the phosphatidylinositol 3-kinase (PI3K) catalytic subunit (PIK3CA) in 19% of human epidermal growth factor receptor 2 (HER2)-positive breast cancers. Because ERBB family mutations can activate the PI3K\\/AKT pathway and likely have similar canonical signalling effects to PI3K pathway mutations, we investigated their combined impact on response to neoadjuvant HER2-targeted therapies.

  19. Evaluation of PMS-PCR technology for detection of Mycobacterium avium subsp. paratuberculosis directly from bovine fecal specimens.

    Science.gov (United States)

    Salgado, M; Steuer, P; Troncoso, E; Collins, M T

    2013-12-27

    Mycobacterium avium subsp. paratuberculosis (MAP) causes paratuberculosis, or Johne's disease, in animals. Diagnosis of MAP infection is challenging because of the pathogen's fastidious in vitro growth requirements and low-level intermittent shedding in feces during the preclinical phase of the infection. Detection of these "low-shedders" is important for effective control of paratuberculosis as these animals serve as sources of infection for susceptible calves. Magnetic separation technology, used in combination with culture or molecular methods for the isolation and detection of pathogenic bacteria, enhances the analytical sensitivity and specificity of detection methods. The aim of the present study was to evaluate peptide-mediated magnetic separation (PMS) capture technology coupled with IS900 PCR using the Roche real-time PCR system (PMS-PCR), in comparison with fecal culture using BACTEC-MGIT 960 system, for detection of MAP in bovine fecal samples. Among the 351 fecal samples 74.9% (263/351) were PMS-PCR positive while only 12.3% (43/351) were MGIT culture-positive (p=0.0001). All 43 MGIT culture-positive samples were also positive by PMS-PCR. Mean PMS-PCR crossing-point (Cp) values for the 13 fecal samples with the highest number of MAP, based on time to detection, (26.3) were significantly lower than for the 17 fecal samples with technology provided results in a shorter time and yielded a higher number of positive results than MGIT culture. Earlier and faster detection of animals shedding MAP by PMS-PCR should significantly strengthen control efforts for MAP-infected cattle herds by helping to limit infection transmission at earlier stages of the infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  1. Identification of a patient with Streptococcus pneumoniae bacteremia and meningitis by the polymerase chain reaction (PCR).

    Science.gov (United States)

    Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D

    1995-06-01

    A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.

  2. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  3. Food insufficiency, housing and health-related quality of life: results from the Positive Spaces, Healthy Places study.

    Science.gov (United States)

    Choi, Stephanie K Y; Fielden, Sarah; Globerman, Jason; Koornstra, J J Jay; Hambly, Keith; Walker, Glen; Sobota, Michael; O'Brien-Teengs, Doe; Watson, James; Bekele, Tsegaye; Greene, Saara; Tucker, Ruthann; Hwang, Stephen W; Rourke, Sean B; Healthy Places Team, The Positive Spaces

    2015-01-01

    Studies of people living with HIV who are homeless or unstably housed show a high prevalence of food insufficiency (>50%) and associated poor health outcomes; however, most evidence is in the form of cross-sectional studies. To better understand this issue, we conducted a longitudinal study to examine the impact of food insufficiency and housing instability on overall physical and mental health-related quality of life (HRQoL) among people living with HIV in Ontario. Six hundred and two adults living with HIV were enrolled in the Positive Spaces, Healthy Places study and followed from 2006 to 2009. Interviewer-administered questionnaires were used, and generalized linear mixed-effects models constructed to examine longitudinal associations between food insufficiency, housing instability and physical and mental HRQoL. At baseline, 57% of participants were classified as food insufficient. After adjusting for potential confounders, longitudinal analyses revealed a significant, negative association between food insufficiency and physical and mental HRQoL outcomes, respectively [effect size (ES) with 95% confidence interval (CI): (ES = -2.1, CI = -3.9,-0.3); (ES = -3.5, CI = -6.1,-1.5)]. Furthermore, difficulties meeting housing costs were shown to have additional negative impacts on mental HRQoL. Food insufficiency is highly prevalent among people living with HIV in Ontario, particularly for those with unstable housing. This vulnerable group of individuals is in urgent need of changes to current housing programmes, services and policies, as well as careful consideration of their unmet nutritional needs.

  4. Results of using the global positioning system to maintain the time and frequency synchronization in the Deep Space Network

    Science.gov (United States)

    Clements, P. A.; Kirk, A.; Unglaub, R.

    1987-01-01

    There are two hydrogen maser clocks located at each signal processing center (SPC) in the DSN. Close coordination of the time and frequency of the SPC clocks is needed to navigate spacecraft to the outer planets. A recent example was the Voyager spacecraft's encounter with Uranus in January 1986. The clocks were adjusted with the goal of minimizing time and frequency offsets between the SPCs at encounter. How time and frequency at each SPC is estimated using data acquired from the Global Positioning System Timing Receivers operating on the NBS-BIH (National Bureau of Standards-Bureau International de l'Heure) tracking schedule is described. These data are combined with other available timing receiver data to calculate the time offset estimates. The adjustment of the clocks is described. It was determined that long range hydrogen maser drift is quite predictable and adjustable within limits. This enables one to minimize time and frequency differences between the three SPCs for many months by matching the drift rates of the three standards. Data acquisition and processing techniques using a Kalman filter to make estimates of time and frequency offsets between the clocks at the SPCs and UTC(NBS) (Coordinated Universal Time realized at NBS) are described.

  5. [Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].

    Science.gov (United States)

    Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu

    2005-07-01

    To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.

  6. Improved detection of canine Angiostrongylus vasorum infection using real-time PCR and indirect ELISA.

    Science.gov (United States)

    Jefferies, Ryan; Morgan, Eric R; Helm, Jenny; Robinson, Matthew; Shaw, Susan E

    2011-12-01

    This study reports the development of a real-time PCR assay and an indirect ELISA to improve on current detection of canine Angiostrongylus vasorum infection. A highly specific fluorescent probe-based, real-time PCR assay was developed to target the A. vasorum second internal transcribed spacer region and detected DNA in EDTA blood, lung tissue, broncho-alveolar larvage fluid, endotracheal mucus, pharyngeal swabs and faecal samples. PCR was fast (∼1 h), highly efficient when using EDTA blood samples, consistently detected a single molecule of parasite DNA and did not amplify DNA from other parasitic nematodes or definitive host species. An indirect ELISA was also developed using the soluble protein fraction from adult A. vasorum worms. Some cross-reactive antigen recognition was observed when tested against sera from dogs infected with Crenosoma vulpis (n = 8), Toxocara canis (n = 5) and Dirofilaria immitis (n = 5). This was largely overcome by setting the cut-off for a positive result at an appropriately high level. Field evaluation of the real-time PCR and ELISA was conducted by testing sera and EDTA blood from dogs with suspected A. vasorum infection (n = 148) and compared with the Baermann's larval migration test in faeces. Thirty-one dogs were positive by at least one test. Of these, 20 (65%) were detected by the Baermann method, 18 (58%) by blood PCR, 24 (77%) by ELISA and 28 (90%) by blood PCR and ELISA together. Combined testing using real-time PCR and ELISA therefore improved the detection rate of A. vasorum infection and holds promise for improved clinical diagnosis and epidemiological investigation.

  7. Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus

    International Nuclear Information System (INIS)

    Lina MR; Dadang S; Budiman Bela

    2004-01-01

    Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)

  8. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  9. A comparison of QuantStudio™ 3D Digital PCR and ARMS-PCR for measuring plasma EGFR T790M mutations of NSCLC patients

    Directory of Open Access Journals (Sweden)

    Feng Q

    2018-01-01

    Full Text Available Qin Feng,1,* Fei Gai,2,* Yaxiong Sang,2 Jie Zhang,3 Ping Wang,1 Yue Wang,1 Bing Liu,2 Dongmei Lin,1 Yang Yu,2 Jian Fang3 1Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education, Department of Pathology, Peking University Cancer Hospital & Institute, 2Oncology Business Division, Beijing Novogene Bioinformatics Technology Co., Ltd, 3Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education, Department of Thoracic Oncology II, Peking University Cancer Hospital & Institute, Beijing, China *These authors contributed equally to this work Background: The AURA3 clinical trial has shown that advanced non-small cell lung cancer (NSCLC patients with EGFR T790M mutations in circulating tumor DNA (ctDNA could benefit from osimertinib.Purpose: The aim of this study was to assess the usefulness of QuantStudio™ 3D Digital PCR System platform for the detection of plasma EGFR T790M mutations in NSCLC patients, and compare the performances of 3D Digital PCR and ARMS-PCR.Patients and methods: A total of 119 Chinese patients were enrolled in this study. Mutant allele frequency of plasma EGFR T790M was detected by 3D Digital PCR, then 25 selected samples were verified by ARMS-PCR and four of them were verified by next generation sequencing (NGS.Results: In total, 52.94% (69/119 had EGFR T790M mutations detected by 3D Digital PCR. In 69 positive samples, the median mutant allele frequency (AF was 1.09% and three cases presented low concentration (AF <0.1%. Limited by the amount of plasma DNA, 17 samples (AF <2.5% and eight samples (T790M- were selected for verification by ARMS-PCR. Four of those samples were verified by NGS as a third verification method. Among the selected 17 positive cases, ten samples presented mutant allele frequency <0.5%, and seven samples presented intermediate mutant allele frequency (0.5%<AF<2.5%. However, only three samples (3/17 were identified as positive by ARMS-PCR, namely, P6

  10. Alcohol use and positive screening results for depression and anxiety are highly prevalent among Chinese children with strabismus.

    Science.gov (United States)

    Lin, Shibin; Congdon, Nathan; Yam, Jason C S; Huang, Yuqiang; Qiu, Kunliang; Ma, Di; Chen, Bin; Li, Liping; Zhang, Mingzhi

    2014-04-01

    To study associations between strabismus and alcohol use, anxiety, and depression among 10- to 17-year-old children in Guangdong, southern China. Cross-sectional, population-based study. Among 7537 children aged 6-17 years from 9 randomly selected primary and middle schools, ocular alignment was assessed with the Hirschberg light reflex, cover-uncover testing, and alternate cover testing at distance (6 m) and near (40 cm). Additionally, 4000 children (53.1%) aged 10+ years received self-administered questionnaires containing screening questions on alcohol use, anxiety, and depression. Examinations were completed on 7464 of 7537 subjects (99.0%), including 3928 boys (52.6%), with a mean age of 11.1 ± 1.8 years. The prevalence of any strabismus, including exotropia (2.7%), esotropia (0.2%), and intermittent exotropia (3.9%), was 6.8%. Strabismus was more prevalent in urban students (7.3%) and female subjects (7.4%) compared to rural students (6.0%) and male subjects (6.2%) (all P children (97.6%) answering questionnaires, history of alcohol use (62.3% vs 36.3%) and positive screening responses for depression (26.0% vs 11.6%) and anxiety (10.3% vs 4.9%) were significantly (P children with strabismus. These Chinese children with strabismus had a significantly higher prevalence of alcohol use and possible markers of emotional problems than children without strabismus. Further research should focus on the appropriateness of classifying surgical treatment for strabismus as "cosmetic" (ineligible for reimbursement) under China's rural health insurance. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Cognitive behavioral therapy positively affects fatigue in patients with multiple sclerosis: Results of a randomized controlled trial.

    Science.gov (United States)

    van den Akker, Lizanne E; Beckerman, Heleen; Collette, Emma H; Twisk, Jos Wr; Bleijenberg, Gijs; Dekker, Joost; Knoop, Hans; de Groot, Vincent

    2017-10-01

    Fatigue is a common symptom in multiple sclerosis (MS) and often restricts societal participation. Cognitive behavioral therapy (CBT) may alleviate MS-related fatigue, but evidence in literature is inconclusive. To evaluate the effectiveness of CBT to improve MS-related fatigue and participation. In a multi-center, assessor-masked, randomized controlled trial, participants with severe MS-related fatigue were assigned to CBT or control treatment. CBT consisted of 12 individual sessions with a psychologist trained in CBT, the control treatment consisted of three consultations with a MS nurse, both delivered over 16 weeks. Assessments were at baseline, 8, 16 (i.e. post-intervention), 26, and 52 weeks post-baseline. Primary outcomes were the Checklist Individual Strength-fatigue subscale (CIS20r fatigue) and the Impact on Participation and Autonomy questionnaire (IPA). Data were analyzed according to the intention-to-treat principle, using mixed-model analysis. Between 2011 and 2014, 91 patients were randomized (CBT: n = 44; control: n = 47). Between-group analysis showed a positive post-intervention effect for CBT on CIS20r fatigue (T16: -6.7 (95% confidence interval (CI) = -10.7; -2.7) points) that diminished during follow-up (T52: 0.5 (95% CI = -3.6; 4.4)). No clinically relevant effects were found on societal participation. Severe MS-related fatigue can be reduced effectively with CBT in the short term. More research is needed on how to maintain this effect over the long term.

  12. Molecular quantification of environmental DNA using microfluidics and digital PCR.

    Science.gov (United States)

    Hoshino, Tatsuhiko; Inagaki, Fumio

    2012-09-01

    Real-time PCR has been widely used to evaluate gene abundance in natural microbial habitats. However, PCR-inhibitory substances often reduce the efficiency of PCR, leading to the underestimation of target gene copy numbers. Digital PCR using microfluidics is a new approach that allows absolute quantification of DNA molecules. In this study, digital PCR was applied to environmental samples, and the effect of PCR inhibitors on DNA quantification was tested. In the control experiment using λ DNA and humic acids, underestimation of λ DNA at 1/4400 of the theoretical value was observed with 6.58 ng μL(-1) humic acids. In contrast, digital PCR provided accurate quantification data with a concentration of humic acids up to 9.34 ng μL(-1). The inhibitory effect of paddy field soil extract on quantification of the archaeal 16S rRNA gene was also tested. By diluting the DNA extract, quantified copy numbers from real-time PCR and digital PCR became similar, indicating that dilution was a useful way to remedy PCR inhibition. The dilution strategy was, however, not applicable to all natural environmental samples. For example, when marine subsurface sediment samples were tested the copy number of archaeal 16S rRNA genes was 1.04×10(3) copies/g-sediment by digital PCR, whereas real-time PCR only resulted in 4.64×10(2) copies/g-sediment, which was most likely due to an inhibitory effect. The data from this study demonstrated that inhibitory substances had little effect on DNA quantification using microfluidics and digital PCR, and showed the great advantages of digital PCR in accurate quantifications of DNA extracted from various microbial habitats. Copyright © 2012 Elsevier GmbH. All rights reserved.

  13. Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

    Science.gov (United States)

    Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

    2012-03-23

    Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

  14. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    Science.gov (United States)

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  15. PCR+ In Diesel Fuels and Emissions Research

    Energy Technology Data Exchange (ETDEWEB)

    McAdams, H.T.

    2002-04-15

    In past work for the U.S. Department of Energy (DOE) and Oak Ridge National Laboratory (ORNL), PCR+ was developed as an alternative methodology for building statistical models. PCR+ is an extension of Principal Components Regression (PCR), in which the eigenvectors resulting from Principal Components Analysis (PCA) are used as predictor variables in regression analysis. The work was motivated by the observation that most heavy-duty diesel (HDD) engine research was conducted with test fuels that had been ''concocted'' in the laboratory to vary selected fuel properties in isolation from each other. This approach departs markedly from the real world, where the reformulation of diesel fuels for almost any purpose leads to changes in a number of interrelated properties. In this work, we present new information regarding the problems encountered in the conventional approach to model-building and how the PCR+ method can be used to improve research on the relationship between fuel characteristics and engine emissions. We also discuss how PCR+ can be applied to a variety of other research problems related to diesel fuels.

  16. Risk stratification of women with false-positive test results in mammography screening based on mammographic morphology and density

    DEFF Research Database (Denmark)

    Winkel, Rikke Rass; von Euler-Chelpin, My Catarina; Lynge, Elsebeth

    2017-01-01

    a case-control study nested in the population-based screening programme in Copenhagen, Denmark. We included 288 cases and 288 controls based on a cohort of 4743 women with at least one FP-test result in 1991–2005 who were followed up until 17 April 2008. Film-based mammograms were assessed using...... the Breast Imaging-Reporting and Data System (BI-RADS) density classification, the Tabár classification, and two automated techniques quantifying percentage mammographic density (PMD) and mammographic texture (MTR), respectively. The association with breast cancer was estimated using binary logistic...

  17. Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Krause, Michael; Hansen, F.

    2007-01-01

    no positive effects and resulted in decreased reproducibility. Increasing the amount of PCR template DNA from 5 to 20 mu l improved the threshold cycle value by approximately 2. The improved 12-h PCR method was successfully compared to a reference culture method with 100 minced meat and poultry samples...... the highest number of salmonellae. When analyzing minced meat samples, positive effects of increasing the initial sampling volume from 1 to 5 ml and increasing the amount of paramagnetic particles to 90 mu l were observed. However, washing the pellet and eluting the DNA in reduced volumes (25 and 50 mu l) had...

  18. Effects of a health education and telephone counseling program on patients with a positive fecal occult blood test result for colorectal cancer screening: A randomized controlled trial.

    Science.gov (United States)

    Chiu, Hui-Chuan; Hung, Hsin-Yuan; Lin, Hsiu-Chen; Chen, Shu-Ching

    2017-10-01

    Our purpose was to evaluate the effects of a health education and telephone counseling program on knowledge and attitudes about colorectal cancer and screening and the psychological impact of positive screening results. A randomized controlled trial was conducted with 2 groups using a pretest and posttest measures design. Patients with positive colorectal cancer screening results were selected and randomly assigned to an experimental (n = 51) or control (n = 51) group. Subjects in the experimental group received a health education and telephone counseling program, while the control group received routine care only. Patients were assessed pretest before intervention (first visit to the outpatient) and posttest at 4 weeks after intervention (4 weeks after first visit to the outpatient). Patients in the experimental group had a significantly better level of knowledge about colorectal cancer and the psychological impact of a positive screening result than did the control group. Analysis of covariance revealed that the health education and telephone counseling program had a significant main effect on colorectal cancer knowledge. A health education and telephone counseling program can improve knowledge about colorectal cancer and about the psychological impact in patients with positive colorectal cancer screening results. The health education and telephone counseling program is an easy, simple, and convenient method of improving knowledge, improving attitudes, and alleviating psychological distress in patients with positive colorectal cancer screening results, and this program can be expanded to other types of cancer screening. Copyright © 2016 John Wiley & Sons, Ltd.

  19. Results of the Ongoing Monitoring of the Position of a Geostationary Telecommunication Satellite by the Method of Spatially Separated Basis Receiving of Digital Satellite Television Signals

    Directory of Open Access Journals (Sweden)

    Bushuev F.

    2016-10-01

    Full Text Available The results of the ongoing monitoring of the position of geostationary telecommunication satellite Eutelsat-13B (13° East are presented in the article. The results were obtained using a radio engineering complex (RC of four stations receiving digital satellite television and a data processing centre. The stations are located in Kyiv, Mukachevo, Kharkiv and Mykolaiv.

  20. Perception of taste in HIV-positive individuals in treatment antiretroviral: results of a case-control study.

    Science.gov (United States)

    Henn, Indiara Welter; da Silva, Ruann Oswaldo Carvalho; Chaiben, Cassiano Lima; Fernandes, Ângela; Naval Machado, Maria Ângela; de Lima, Antonio Adilson Soares

    2017-01-01

    The aim of this study was to evaluate the perception of taste in HIV-infected patients. One hundred males and females (11 to 60 years old) were divided into two groups (50 patients infected by HIV and 50 controls) and evaluated for gustatory function. The results revealed that the mean score in the evaluation of taste was significantly lower in individuals with HIV when compared to controls for both sides of the tongue (p < 0.05). Patients with HIV infection had difficulty recognizing the bitter taste, followed by salty and sweet. When each side of the tongue was evaluated separately and compared, the Wilcoxon test showed that there was no significant difference on the tongue of individuals with HIV. The prevalence of hypogeusia was 20% in individuals with this disease. Individuals with HIV infection may have a deficit in taste that can affect your general and oral health. © 2016 Special Care Dentistry Association and Wiley Periodicals, Inc.

  1. Combination of RT-PCR and proteomics for the identification of Crimean-Congo hemorrhagic fever virus in ticks

    Directory of Open Access Journals (Sweden)

    Isabel G. Fernández de Mera

    2017-07-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging tick-borne zoonotic disease caused by the CCHF virus (CCHFV. In this study, an experimental approach combining RT-PCR and proteomics was used for the identification and characterization of CCHFV in 106 ticks from 7 species that were collected from small ruminants in Greece. The methodological approach included an initial screening for CCHFV by RT-PCR followed by proteomics analysis of positive and control negative tick samples. This novel approach allowed the identification of CCHFV-positive ticks and provided additional information to corroborate the RT-PCR findings using a different approach. Two ticks, Dermacentor marginatus and Haemaphysalis parva collected from a goat and a sheep, respectively were positive for CCHFV. The sequences for CCHFV RNA segments S and L were characterized by RT-PCR and proteomics analysis of tick samples, respectively. These results showed the possibility of combining analyses at the RNA and protein levels using RT-PCR and proteomics for the characterization of CCHFV in ticks. The results supported that the CCHFV identified in ticks are genetic variants of the AP92 strain. Although the AP92-like strains probably do not represent a high risk of CCHF to the population, the circulation of genetically diverse CCHFV strains could potentially result in the appearance of novel viral genotypes with increased pathogenicity and fitness.

  2. Validation of the Pockit Dengue Virus Reagent Set for Rapid Detection of Dengue Virus in Human Serum on a Field-Deployable PCR System.

    Science.gov (United States)

    Tsai, Jih-Jin; Liu, Li-Teh; Lin, Ping-Chang; Tsai, Ching-Yi; Chou, Pin-Hsing; Tsai, Yun-Long; Chang, Hsiao-Fen Grace; Lee, Pei-Yu Alison

    2018-05-01

    Dengue virus (DENV) infection, a mosquito-borne disease, is a major public health problem in tropical countries. Point-of-care DENV detection with good sensitivity and specificity enables timely early diagnosis of DENV infection, facilitating effective disease management and control, particularly in regions of low resources. The Pockit dengue virus reagent set (GeneReach Biotech), a reverse transcription insulated isothermal PCR (RT-iiPCR), is available to detect all four serotypes of DENV on the field-deployable Pockit system, which is ready for on-site applications. In this study, analytical and clinical performances of the assay were evaluated. The index assay did not react with 14 non-DENV human viruses, indicating good specificity. Compared to the U.S. CDC DENV-1-4 real-time quantitative RT-PCR (qRT-PCR) assay, testing with serial dilutions of virus-spiked human sera demonstrated that the index assay had detection endpoints that were separately comparable with the 4 serotypes. Excellent reproducibility was observed among repeat tests done by six operators at three sites. In clinical performance, 195 clinical sera collected around Kaohsiung city in 2012 and 21 DENV-4-spiked sera were tested with the RT-iiPCR and qRT-PCR assays in parallel. The 121 (11 DENV-1, 78 DENV-2, 11 DENV-3, and 21 DENV-4) qRT-PCR-positive and 95 qRT-PCR-negative samples were all positive and negative by the RT-iiPCR reagent results, respectively, demonstrating high (100%) interrater agreement (95% confidence interval [CI 95% ], ∼98.81% to 100%; κ = 1). With analytical and clinical performance equivalent to those of the reference qRT-PCR assay, the index PCR assay on the field-deployable system can serve as a highly sensitive and specific on-site tool for DENV detection. Copyright © 2018 American Society for Microbiology.

  3. Gamification and the Internet: Experts Expect Game Layers to Expand in the Future, with Positive and Negative Results.

    Science.gov (United States)

    Anderson, Janna; Rainie, Lee

    2012-08-01

    This analysis of the opinions of 1,021 Internet stakeholders was aimed at gauging current opinions about the potential future of game mechanics online. Nearly 5,000 people who are engaged in some way in Internet-related leadership or interests were invited to read a pair of opposing 2020 gamification scenarios and offer their written views on the likely future of gamification online by 2020. The result is not projectable to any population other than these respondents. A slight majority of 53 percent agreed with a proposed scenario that game mechanics will become a part of everyday life for most Internet users by 2020; a great majority of respondents said game elements will play a vital role in specific realms such as health and education by then. Some respondents said people will be resistant if game layers are built into too many aspects of people's daily lives. Some shared concerns that game-design approaches can be used to manipulate people without their knowledge.

  4. Quantification of integrated HIV DNA by repetitive-sampling Alu-HIV PCR on the basis of poisson statistics.

    Science.gov (United States)

    De Spiegelaere, Ward; Malatinkova, Eva; Lynch, Lindsay; Van Nieuwerburgh, Filip; Messiaen, Peter; O'Doherty, Una; Vandekerckhove, Linos

    2014-06-01

    Quantification of integrated proviral HIV DNA by repetitive-sampling Alu-HIV PCR is a candidate virological tool to monitor the HIV reservoir in patients. However, the experimental procedures and data analysis of the assay are complex and hinder its widespread use. Here, we provide an improved and simplified data analysis method by adopting binomial and Poisson statistics. A modified analysis method on the basis of Poisson statistics was used to analyze the binomial data of positive and negative reactions from a 42-replicate Alu-HIV PCR by use of dilutions of an integration standard and on samples of 57 HIV-infected patients. Results were compared with the quantitative output of the previously described Alu-HIV PCR method. Poisson-based quantification of the Alu-HIV PCR was linearly correlated with the standard dilution series, indicating that absolute quantification with the Poisson method is a valid alternative for data analysis of repetitive-sampling Alu-HIV PCR data. Quantitative outputs of patient samples assessed by the Poisson method correlated with the previously described Alu-HIV PCR analysis, indicating that this method is a valid alternative for quantifying integrated HIV DNA. Poisson-based analysis of the Alu-HIV PCR data enables absolute quantification without the need of a standard dilution curve. Implementation of the CI estimation permits improved qualitative analysis of the data and provides a statistical basis for the required minimal number of technical replicates. © 2014 The American Association for Clinical Chemistry.

  5. Clinical experience of laboratory follow-up with noninvasive prenatal testing using cell-free DNA and positive microdeletion results in 349 cases.

    Science.gov (United States)

    Schwartz, S; Kohan, M; Pasion, R; Papenhausen, P R; Platt, L D

    2018-02-01

    Screening via noninvasive prenatal testing (NIPT) involving the analysis of cell-free DNA (cfDNA) from plasma has become readily available to screen for chromosomal and DNA aberrations through maternal blood. This report reviews a laboratory's experience with follow-up of positive NIPT screens for microdeletions. Patients that were screened positive by NIPT for a microdeletion involving 1p, 4p, 5p, 15q, or 22q who underwent diagnostic studies by either chorionic villus sampling or amniocentesis were evaluated. The overall positive predictive value for 349 patients was 9.2%. When a microdeletion was confirmed, 39.3% of the cases had additional abnormal microarray findings. Unrelated abnormal microarray findings were detected in 11.8% of the patients in whom the screen positive microdeletion was not confirmed. Stretches of homozygosity in the microdeletion were frequently associated with a false positive cfDNA microdeletion result. Overall, this report reveals that while cfDNA analysis will screen for microdeletions, the positive predictive value is low; in our series it is 9.2%. Therefore, the patient should be counseled accordingly. Confirmatory diagnostic microarray studies are imperative because of the high percentage of false positives and the frequent additional abnormalities not delineated by cfDNA analysis. © 2018 John Wiley & Sons, Ltd.

  6. [Factors which influence the position towards euthanasia : Results of a representative survey among older people in Germany].

    Science.gov (United States)

    Roesinger, Mathias; Prudlik, Laura; Pauli, Sara; Hendlmeier, Ingrid; Noyon, Alexander; Schäufele, Martina

    2018-02-01

    Until now older adults have not been a target group for surveys regarding their personal attitudes towards euthanasia, although they are closest to chronic illness and death. To determine the attitudes of older adults towards euthanasia and controversial topics in the context of illness, euthanasia and care (e. g. palliative care) on the basis of a representative sample. The study was based on a postal survey of a representative random sample of the population aged 65 years and older (n = 3500) from a city in southern Germany using a standardized questionnaire. A total of 1068 persons completed the questionnaire (response rate 30.5%). Assisted death was supported by 74.2% of the respondants and assisted suicide by 80.4%. According to multiple logistic regression analysis the support decreased with increasing strength of religious faith and a non-German country of origin. Of the participants 53.3% were worried about being a burden to their family, especially people with a limited state of health. People who shared this concern showed significantly more support for both types of euthanasia. More than 40% feared that people with severe and incurable illnesses would be more likely to be forced into a premature death (slippery slope argument). This concern was associated with a decreasing support of euthanasia. The results indicate that the strong approval of the legalization of assisted death and assisted suicide by older people is motivated not only by their desire for a self-determined death but also by fears and concerns. The findings have important implications for counseling, palliative care and treatment.

  7. Feasibility of shortening isolation of TB-suspects by first-sample PCR

    DEFF Research Database (Denmark)

    Fløe, Andreas; Wejse, Christian; Thomsen, Vibeke Østergaard

    Rationale: Isolation of patients suspected for tuberculosis (TB) is usually guided by serial sputum smears. Many of patients initially isolated will turn out not to have TB, or will not be regarded as contagious. Current standards imply isolation for hours or days until contagiousness has been...... excluded. Objective: To evaluate the utility of single-specimen polymerase chain-reaction (PCR) for Mycobacterium tuberculosis complex (MTBC) as a parameter to cease isolation when negative. Methods: We evaluated all patients in Denmark who had sputa investigated for MTBC at the National Reference......-positive on the sample that produced the PCR-negative result. Conclusion: Though adequate sensitivity in diagnosing TB still requires serial samples for microbiological examination, the question of isolation can be determined by first-sample PCR in the majority of cases, when the test is negative. In our study, less...

  8. Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.

    Science.gov (United States)

    Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin

    2017-05-01

    Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.

  9. PCR-based techniques for leprosy diagnosis: from the laboratory to the clinic.

    Directory of Open Access Journals (Sweden)

    Alejandra Nóbrega Martinez

    2014-04-01

    Full Text Available In leprosy, classic diagnostic tools based on bacillary counts and histopathology have been facing hurdles, especially in distinguishing latent infection from active disease and diagnosing paucibacillary clinical forms. Serological tests and IFN-gamma releasing assays (IGRA that employ humoral and cellular immune parameters, respectively, are also being used, but recent results indicate that quantitative PCR (qPCR is a key technique due to its higher sensitivity and specificity. In fact, advances concerning the structure and function of the Mycobacterium leprae genome led to the development of specific PCR-based gene amplification assays for leprosy diagnosis and monitoring of household contacts. Also, based on the validation of point-of-care technologies for M. tuberculosis DNA detection, it is clear that the same advantages of rapid DNA detection could be observed in respect to leprosy. So far, PCR has proven useful in the determination of transmission routes, M. leprae viability, and drug resistance in leprosy. However, PCR has been ascertained to be especially valuable in diagnosing difficult cases like pure neural leprosy (PNL, paucibacillary (PB, and patients with atypical clinical presentation and histopathological features compatible with leprosy. Also, the detection of M. leprae DNA in different samples of the household contacts of leprosy patients is very promising. Although a positive PCR result is not sufficient to establish a causal relationship with disease outcome, quantitation provided by qPCR is clearly capable of indicating increased risk of developing the disease and could alert clinicians to follow these contacts more closely or even define rules for chemoprophylaxis.

  10. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  11. Cervical cancer screening by high risk HPV testing in routine practice: results at one year recall of high risk HPV-positive and cytology-negative women.

    Science.gov (United States)

    Del Mistro, Annarosa; Frayle, Helena; Ferro, Antonio; Callegaro, Susanna; Del Sole, Annamaria; Stomeo, Anna; Cirillo, Emanuela; Fedato, Chiara; Pagni, Silvana; Barzon, Luisa; Zorzi, Manuel

    2014-03-01

    Cervical cancer screening by human papillomavirus (HPV) testing requires the use of additional triage and follow-up analyses. We evaluated women's compliance with and the performance of this strategy in a routine setting. Five cervical service screening programmes in North-East Italy. Eligible women aged 25-64 invited for a new screening episode underwent HPV testing for high risk types (hrHPV by Hybrid Capture 2) and cytology triage. Women with positive HPV and cytology results were referred for colposcopy; women with positive HPV but negative cytology results were referred to 1-year repeat hrHPV testing. Of 46,694 women screened by HPV testing up to December 2011, 3,211 (6.9%) tested hrHPV positive; 45% of these had a positive triage cytology. Those with negative cytology were invited for 1-yr repeat testing. Compliance with invitation was 61.6% at baseline and 85.3% at 1-yr repeat. Rate of persistent hrHPV positivity was 58% (830/1,435). Colposcopy performed in women with a positive hrHPV test at 1-yr repeat accounted for 36% of all colposcopies performed within the screening programmes. Cumulatively, a histological high-grade lesion was detected in 276 women (5.9‰ detection rate), 234 at baseline (85%), and 42 (15%) at 1-yr repeat. Compliance with hrHPV-based screening programmes was high both at baseline and at 1-yr repeat. Compared with the randomized trials, a higher proportion of triage cytology was read as positive, and only a small number of high-grade lesions were detected among the group of hrHPV positive cytology negative women who repeated testing 1-yr after baseline.

  12. Real-time PCR for Leishmania species identification: Evaluation and comparison with classical techniques.

    Science.gov (United States)

    de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena

    2016-06-01

    Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing

  13. SNPs and real-time quantitative PCR method for constitutional allelic copy number determination, the VPREB1 marker case

    Directory of Open Access Journals (Sweden)

    Costa Elena

    2011-05-01

    Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.

  14. An analysis of true- and false-positive results of vocal fold uptake in positron emission tomography-computed tomography imaging.

    Science.gov (United States)

    Seymour, N; Burkill, G; Harries, M

    2018-03-01

    Positron emission tomography-computed tomography with fluorine-18 fluorodeoxy-D-glucose has a major role in the investigation of head and neck cancers. Fluorine-18 fluorodeoxy-D-glucose is not a tumour-specific tracer and can also accumulate in benign pathology. Therefore, positron emission tomography-computed tomography scan interpretation difficulties are common in the head and neck, which can produce false-positive results. This study aimed to investigate patients detected as having abnormal vocal fold uptake on fluorine-18 fluorodeoxy-D-glucose positron emission tomography-computed tomography. Positron emission tomography-computed tomography scans were identified over a 15-month period where reports contained evidence of unilateral vocal fold uptake or vocal fold pathology. Patients' notes and laryngoscopy results were analysed. Forty-six patients were identified as having abnormal vocal fold uptake on positron emission tomography-computed tomography. Twenty-three patients underwent positron emission tomography-computed tomography and flexible laryngoscopy: 61 per cent of patients had true-positive positron emission tomography-computed tomography scans and 39 per cent had false-positive scan results. Most patients referred to ENT for abnormal findings on positron emission tomography-computed tomography scans had true-positive findings. Asymmetrical fluorine-18 fluorodeoxy-D-glucose uptake should raise suspicion of vocal fold pathology, accepting a false-positive rate of approximately 40 per cent.

  15. RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

    Directory of Open Access Journals (Sweden)

    Edith Burbano

    2006-05-01

    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  16. Digital PCR: A brief history

    OpenAIRE

    Morley, Alexander A.

    2014-01-01

    Digital PCR for quantification of a target of interest has been independently developed several times, being described in 1990 and 1991 using the term “limiting dilution PCR” and in 1999 using the term “digital PCR”. It came into use in the decade following its first development but its use was cut short by the description of real-time PCR in 1996. However digital PCR has now had a renaissance due to the recent development of new instruments and chemistry which have made it a much simpler and...

  17. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR

    Directory of Open Access Journals (Sweden)

    Rodolakis Annie

    2009-07-01

    Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and

  18. Application of PCR-based DNA sequencing technique for the detection of Leptospira in peripheral blood of septicemia patients

    Directory of Open Access Journals (Sweden)

    Ram, S.

    2012-01-01

    Full Text Available Aim: Isolation, dark field detection and microscopic agglutination test (MAT are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septicemia. Methodology and Results: Two hundred and seven (207 blood samples from patients were diagnosed with septicemia which includes 100 bacterial (other than Leptospira culture positive and 107 bacterial culture negative samples were studied. Primers for Nested PCR targeting LipL32 gene of Leptospira interrogans were designed and the specificity of primers was tested against serum samples positive/negative by either MAT or dark field microscopy. PCR amplified products were further confirmed by DNA sequencing. The standardized nPCR was sensitive and specific to Leptospira interrogans. Twenty-one (21% out of 100 culture positive blood samples, three (2.8% out of 107 culture negative samples showed nPCR positivity and were confirmed as Leptospira interrogans by DNA sequencing (p<0.001. A sensitive nPCR specific to Leptospira interrogans was developed. Conclusion, significance and impact of study: The p value (<0.001 signifies that Leptospira is commonly associated with other bacteria circulating in blood indicating that a decreased immune status is created primarily by a bacterium with enhanced possibility of development of Leptospiral infection probably be of an endogenous origin.

  19. Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia

    2013-07-01

    Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83

  20. Evaluation of kDNA PCR hybridization and ITS1 nPCR methods in different clinical samples for visceral leishmaniasis diagnosis in dogs with and without clinical signs

    International Nuclear Information System (INIS)

    Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.

    2013-01-01

    Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25

  1. Diagnosis of Hepatozoon canis in young dogs by cytology and PCR

    Directory of Open Access Journals (Sweden)

    Decaprariis Donato

    2011-04-01

    Full Text Available Abstract Background Hepatozoon canis is a widespread tick-borne protozoan affecting dogs. The diagnosis of H. canis infection is usually performed by cytology of blood or buffy coat smears, but this method may not be sensitive. Our study aimed to evaluate the best method to achieve a parasitological diagnosis of H. canis infection in a population of receptive young dogs, previously negative by cytology and exposed to tick infestation for one summer season. Results A total of 73 mongrel dogs and ten beagles younger than 18 months of age, living in an animal shelter in southern Italy where dogs are highly infested by Rhipicephalus sanguineus, were included in this study. In March-April 2009 and in October 2009, blood and bone marrow were sampled from each dog. Blood, buffy coat and bone marrow were examined by cytology only (at the first sampling and also by PCR for H. canis (second sampling. In March-April 2009, only one dog was positive for H. canis by cytological examination, whereas in October 2009 (after the summer season, the overall incidence of H. canis infection by cytological examinations was 43.9%. Molecular tests carried out on samples taken in October 2009 showed a considerably higher number of dogs positive by PCR (from 27.7% up to 51.2% on skin and buffy coat tissues, respectively, with an overall positivity of 57.8%. All animals, but one, which were positive by cytology were also PCR-positive. PCR on blood or buffy coat detected the highest number of H. canis-positive dogs displaying a sensitivity of 85.7% for both tissues that increased up to 98% when used in parallel. Twenty-six (74.8% out of the 28 H. canis-positive dogs presented hematological abnormalities, eosinophilia being the commonest alteration observed. Conclusions The results suggest that PCR on buffy coat and blood is the best diagnostic assay for detecting H. canis infection in dogs, although when PCR is not available, cytology on buffy coat should be preferred to

  2. Diagnosis of Hepatozoon canis in young dogs by cytology and PCR

    Science.gov (United States)

    2011-01-01

    Background Hepatozoon canis is a widespread tick-borne protozoan affecting dogs. The diagnosis of H. canis infection is usually performed by cytology of blood or buffy coat smears, but this method may not be sensitive. Our study aimed to evaluate the best method to achieve a parasitological diagnosis of H. canis infection in a population of receptive young dogs, previously negative by cytology and exposed to tick infestation for one summer season. Results A total of 73 mongrel dogs and ten beagles younger than 18 months of age, living in an animal shelter in southern Italy where dogs are highly infested by Rhipicephalus sanguineus, were included in this study. In March-April 2009 and in October 2009, blood and bone marrow were sampled from each dog. Blood, buffy coat and bone marrow were examined by cytology only (at the first sampling) and also by PCR for H. canis (second sampling). In March-April 2009, only one dog was positive for H. canis by cytological examination, whereas in October 2009 (after the summer season), the overall incidence of H. canis infection by cytological examinations was 43.9%. Molecular tests carried out on samples taken in October 2009 showed a considerably higher number of dogs positive by PCR (from 27.7% up to 51.2% on skin and buffy coat tissues, respectively), with an overall positivity of 57.8%. All animals, but one, which were positive by cytology were also PCR-positive. PCR on blood or buffy coat detected the highest number of H. canis-positive dogs displaying a sensitivity of 85.7% for both tissues that increased up to 98% when used in parallel. Twenty-six (74.8%) out of the 28 H. canis-positive dogs presented hematological abnormalities, eosinophilia being the commonest alteration observed. Conclusions The results suggest that PCR on buffy coat and blood is the best diagnostic assay for detecting H. canis infection in dogs, although when PCR is not available, cytology on buffy coat should be preferred to blood smear evaluation

  3. Importance of Local Control in Early-Stage Prostate Cancer: Outcomes of Patients With Positive Post-Radiation Therapy Biopsy Results Treated in RTOG 9408

    International Nuclear Information System (INIS)

    Krauss, Daniel J.; Hu, Chen; Bahary, Jean-Paul; Souhami, Luis; Gore, Elizabeth M.; Chafe, Susan Maria Jacinta; Leibenhaut, Mark H.; Narayan, Samir; Torres-Roca, Javier; Michalski, Jeff; Zeitzer, Kenneth L.; Donavanik, Viroon; Sandler, Howard; McGowan, David G.; Jones, Christopher U.; Shipley, William U.

    2015-01-01

    Purpose: The purpose of this study was to assess the association between positive post-radiation therapy (RT) biopsy results and subsequent clinical outcomes in males with localized prostate cancer. Methods and Materials: Radiation Therapy Oncology Group study 94-08 analyzed 1979 males with prostate cancer, stage T1b-T2b and prostate-specific antigen concentrations of ≤20 ng/dL, to investigate whether 4 months of total androgen suppression (TAS) added to RT improved survival compared to RT alone. Patients randomized to receive TAS received flutamide with luteinizing hormone releasing hormone (LHRH) agonist. According to protocol, patients without evidence of clinical recurrence or initiation of additional endocrine therapy underwent repeat prostate biopsy 2 years after RT completion. Statistical analysis was performed to evaluate the impact of positive post-RT biopsy results on clinical outcomes. Results: A total of 831 patients underwent post-RT biopsy, 398 were treated with RT alone and 433 with RT plus TAS. Patients with positive post-RT biopsy results had higher rates of biochemical failure (hazard ratio [HR] = 1.7; 95% confidence interval [CI] = 1.3-2.1) and distant metastasis (HR = 2.4; 95% CI = 1.3-4.4) and inferior disease-specific survival (HR = 3.8; 95% CI = 1.9-7.5). Positive biopsy results remained predictive of such outcomes after correction for potential confounders such as Gleason score, tumor stage, and TAS administration. Prior TAS therapy did not prevent elevated risk of adverse outcome in the setting of post-RT positive biopsy results. Patients with Gleason score ≥7 with a positive biopsy result additionally had inferior overall survival compared to those with a negative biopsy result (HR = 1.56; 95% CI = 1.04-2.35). Conclusions: Positive post-RT biopsy is associated with increased rates of distant metastases and inferior disease-specific survival in patients treated with definitive RT and was associated with inferior overall

  4. What would PCR assessment change in the management of fevers in a malaria endemic area? A school-based study in Benin in children with and without fever

    Directory of Open Access Journals (Sweden)

    Faucher Jean-François

    2010-08-01

    Full Text Available Abstract Background A recent school-based study in Benin showed that applying a policy of anti-malarial prescriptions restricted to parasitologically-confirmed cases on the management of fever is safe and feasible. Additional PCR data were analysed in order to touch patho-physiological issues, such as the usefulness of PCR in the management of malaria in an endemic area or the triggering of a malaria attack in children with submicroscopic malaria. Methods PCR data were prospectively collected in the setting of an exposed (with fever/non exposed (without fever study design. All children had a negative malaria rapid diagnostic test (RDT at baseline, were followed up to day 14 and did not receive drugs with anti-malarial activity. The index group was defined by children with fever at baseline and the control group by children without fever at baseline. Children with submicroscopic malaria in these two groups were defined by a positive PCR at baseline. Results PCR was positive in 66 (27% children of the index group and in 104 (44% children of the control group respectively. The only significant factor positively related to PCR positivity at baseline was the clinical status (control group. When definition of malaria attacks included PCR results, no difference of malaria incidence was observed between the index and control groups, neither in the whole cohort, nor in children with submicroscopic malaria. The rate of undiagnosed malaria at baseline was estimated to 3.7% at baseline in the index group. Conclusions Treating all children with fever and a positive PCR would have led to a significant increase of anti-malarial consumption, with few benefits in terms of clinical events. Non malarial fevers do not or do not frequently trigger malaria attacks in children with submicroscopic malaria.

  5. Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

    Science.gov (United States)

    Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

    2016-02-01

    Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

  6. Simultaneous VENTANA IHC and RT-PCR testing of ALK status in Chinese non-small cell lung cancer patients and response to crizotinib.

    Science.gov (United States)

    Xu, Chun-Wei; Wang, Wen-Xian; Chen, Yan-Ping; Chen, Yu; Liu, Wei; Zhong, Li-Hua; Chen, Fang-Fang; Zhuang, Wu; Song, Zheng-Bo; Chen, Xiao-Hui; Huang, Yun-Jian; Guan, Yan-Fang; Yi, Xin; Lv, Tang-Feng; Zhu, Wei-Feng; Lu, Jian-Ping; Wang, Xiao-Jiang; Shi, Yi; Lin, Xian-Dong; Chen, Gang; Song, Yong

    2018-04-11

    ALK rearrangement-advanced NSCLC patients respond to crizotinib. ALK rearrangement is currently determined with RT-PCR. VENTANA IHC is a standard method to identify ALK protein overexpression in NSCLC; however, VENTANA IHC has rarely been used to determine the response to crizotinib in Chinese patients with NSCLC and ALK overexpression. To better clarify the clinical implication of VENTANA IHC to detect ALK rearrangements, we conducted this study to analyze VENTANA IHC and RT-PCR in a large cohort of Chinese patients with NSCLC undergoing screening for ALK rearrangements. A total of 1720 patients with NSCLC who had ALK rearrangements detected by VENTANA IHC and/or RT-PCR were included in this analysis. We compared the efficacy and survival of ALK-positive patients detected by VENTANA IHC and RT-PCR. We used NGS to identify patients in whom the two methods were inconsistent. Among 1720 patients, 187 (10.87%) were shown to be ALK-positive by VENTANA IHC and/or RT-PCR, and 66 received crizotinib treatment. We identified 10.27% (172/1674) of patients as ALK-positive by the VENTANA IHC method, and 12.73% (41/322) of patients had ALK rearrangements by the RT-PCR method. Twenty-nine of 276 (10.51%) ALK-positive patients were simultaneously analyzed using VENTANA IHC and RT-PCR. The overall response rates were 65.90% (29/44) by VENTANA IHC and 55.88% (19/34) by RT-PCR. The disease control rates were 86.36% (38/44) by VENTANA IHC and 76.47% (26/34) by RT-PCR. In contrast, the median progression-free survival for VENTANA IHC and RT-PCR was 8.5 and 9.2 months, respectively. The VENTANA IHC and RT-PCR results obtained for 6 of 17 ALK-positive patients were inconsistent based on NGS; specifically, 4 patients had EML4-ALK fusions, 2 patients had non EML4-ALK fusions, 1 patient had a KCL1-ALK fusion, and one patient had a FBXO36-ALK fusion. VENTANA IHC is a reliable and rapid screening tool used in routine pathologic laboratories for the identification of suitable candidates for

  7. A comparison of the impact of screen-positive results obtained from ultrasound and biochemical screening for Down syndrome in the first trimester : a pilot study

    NARCIS (Netherlands)

    Weinans, M.J.; Kooij, L.; Muller, M.A.; Bilardo, K.M.; van Lith, J.M.; Tymstra, T.

    2004-01-01

    OBJECTIVE: To compare the experiences of women who received a screen-positive test result for Down syndrome after nuchal translucency screening or after biochemical screening in the first trimester of pregnancy in the Netherlands. METHOD: Semi-quantitative questionnaires were sent to 40 women with a

  8. Fifteen to Twenty Seconds of Eye Movements Have No Effect on Believability of Positive Personal Verbal Statements : Results From a Working Memory Study

    NARCIS (Netherlands)

    Matthijssen, S.J.M.A.; van den Hout, M.A.

    2016-01-01

    According to working memory theory, a task that taxes working memory during simultaneous focus on a memory will tend to reduce memory vividness and emotional intensity. Results have been found for both negative and positive memories. Some studies have shown the necessity of modality-specific tasks,

  9. Comparison of PCR and common clinical tests for the diagnosis of H. pylori in dyspeptic patients.

    Science.gov (United States)

    Pacheco, N; Mago, V; Gómez, I; Gueneau, P; Guelrud, M; Reyes, N; Pericchi, L R; Domínguez-Bello, M G

    2001-04-01

    Helicobacter pylori has been recognized as a major gastric pathogen. The objective of this study was to assess the diagnostic value of common clinical tests to detect H. pylori infection, by comparison with PCR. Serum and gastric biopsy specimens from 106 dyspeptic patients were examined. Serology was performed with Pyloriset Dry test, and biopsies were examined histologically, for rapid urease activity and PCR amplification of an ureA gene segment of H. pylori. PCR primers were specific for H. pylori and required at least 1.47 pg of H. pylori DNA, corresponding to about 800 bacterial cells. According to serology, histology, rapid urease, and PCR, positive results were respectively found in 56%, 86%, 64%, and 85% of dyspeptic patients, primarily with gastritis. Relative to PCR, the sensitivity (and specificity) was 55% (38%) for serology, 86% (13%) for histology, 70% (69%) for urease. When combining histology and urease, Bayesian analysis of data indicated no advantage of using combined methods over rapid urease test alone. Histology should not any longer be considered a gold standard test for Helicobacter pylori. Urea breath test still seems the first option for non invasive diagnostic. If an invasive diagnostic is justified, highly specific and sensitive molecular methods should be used to examine specimens.

  10. Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.

    Science.gov (United States)

    Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H

    Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.

  11. Application of multiplex nested methylated specific PCR in early diagnosis of epithelial ovarian cancer.

    Science.gov (United States)

    Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin

    2015-01-01

    To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.

  12. Spatiotemporal Dynamics of Vibrio cholerae in Turbid Alkaline Lakes as Determined by Quantitative PCR.

    Science.gov (United States)

    Bliem, Rupert; Reischer, Georg; Linke, Rita; Farnleitner, Andreas; Kirschner, Alexander

    2018-06-01

    In recent years, global warming has led to a growing number of Vibrio cholerae infections in bathing water users in regions formerly unaffected by this pathogen. It is therefore of high importance to monitor V. cholerae in aquatic environments and to elucidate the main factors governing its prevalence and abundance. For this purpose, rapid and standardizable methods that can be performed by routine water laboratories are prerequisite. In this study, we applied a recently developed multiplex quantitative PCR (qPCR) strategy (i) to monitor the spatiotemporal variability of V. cholerae abundance in two small soda pools and a large lake that is intensively used for recreation and (ii) to elucidate the main factors driving V. cholerae dynamics in these environments. V. cholerae was detected with qPCR at high concentrations of up to 970,000 genomic units 100 ml -1 during the warm season, up to 2 orders of magnitude higher than values obtained by cultivation. An independent cytometric approach led to results comparable to qPCR data but with significantly more positive samples due to problems with DNA recovery for qPCR. Not a single sample was positive for toxigenic V. cholerae , indicating that only nontoxigenic V. cholerae (NTVC) was present. Temperature was the main predictor of NTVC abundance, but the quality and quantity of dissolved organic matter were also important environmental correlates. Based on this study, we recommend using the developed qPCR strategy for quantification of toxigenic and nontoxigenic V. cholerae in bathing waters with the need for improvements in DNA recovery. IMPORTANCE There is a definitive need for rapid and standardizable methods to quantify waterborne bacterial pathogens. Such methods have to be thoroughly tested for their applicability to environmental samples. In this study, we critically tested a recently developed multiplex qPCR strategy for its applicability to determine the spatiotemporal variability of V. cholerae abundance in

  13. [Efficacy of absorbance ratio of ELISA antibodies [corrected] for hepatitis C virus of 3th generation in the prediction of viremia evaluated by PCR].

    Science.gov (United States)

    Vázquez-Avila, Isidro; Vera-Peralta, Jorge Manuel; Alvarez-Nemegyei, José; Rodríguez-Carvajal, Otilia

    2007-01-01

    In order to decrease the burden of suffering and the costs derived from confirmatory molecular assays, a better strategy is badly needed to decrease the rate of false positive results of the enzyme-linked immunoassay (ELISA) for detection of hepatitis C virus (HCV) antibodies (Anti). To establish the best cutoff of the S/CO rate in subjects with a positive result of a microparticule, third generation ELISA assay for Anti-HCV, for predicting viremia as detected by polymerase chain reaction (PCR) assay. Using the result of the PCR assay as "gold standard", a ROC curve was build with the results of the S/CO rate values in subjects with a positive result for ELISA HCV assay. Fifty two subjects (30 male, 22 female, 40 +/- 12.5 years old) were included. Thirty four (65.3%) had a positive RNA HCV PCR assay. The area under the curve was 0.99 (95% CI: 0.98-1.0). The optimal cutoff for the S/CO rate was established in 29: sensitivity: 97%; specificity: 100%: PPV: 100%; NPV: 94%. Setting the cutoff of the S/CO in 29 results in a high predictive value for viremia as detected by PCR in subjects with a positive ELISA HVC assay. This knowledge may result in a better decision taking for the clinical follow up of those subjects with a positive result in the ELISA screening assay for HCV infection.

  14. A multiplex PCR for detection of knockdown resistance mutations, V1016G and F1534C, in pyrethroid-resistant Aedes aegypti.

    Science.gov (United States)

    Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya

    2017-10-10

    Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.

  15. Whatman Paper (FTA Cards for Storing and Transferring Leishmania DNA for PCR Examination

    Directory of Open Access Journals (Sweden)

    A Amin-Mohammadi

    2009-12-01

    Full Text Available "nBackground: Diagnosis of cutaneous leishmaniasis (CL is often made based on clinical manifesta­tion. Correct diagnosis and identification of the parasite are crucial for choosing the effective treat­ment and for epidemiological studies. On the other hand, determination of Leishmania species is nec­essary for designing appropriate control programs. Diagnosis by PCR is becoming a 'gold standard'. For PCR preparation, storage and shipments of specimens are necessary. In this study, Whatman filter paper (FTA Card was used to store and transfer samples for Leishmania identification using PCR. "nMethods: Among the patients who had CL lesion and referred to Parasitology Laboratory of Emam Reza Hospital, Mashhad, Iran, 44 consented cases with positive results in their direct smear were se­lected. An informed consent form and a questionnaire were completed and three different types of samples (direct smear, NNN culture, and spot on FTA card were collected. DNA extraction and PCR were carried out on three different samples from each patient. "nResults: PCR results using Whatman paper samples revealed a significant difference (P<0.0001 compared to the culture method but no significant difference was seen between PCR results using samples stored on Whatman paper and direct smears. "nConclusion: The use of FTA cards is simple, rapid, and cost-effective, and can be readily employed for large-scale population screening, especially for regions where the specimens are to be transported from distant places to the laboratory.

  16. ReadqPCR and NormqPCR: R packages for the reading, quality checking and normalisation of RT-qPCR quantification cycle (Cq data

    Directory of Open Access Journals (Sweden)

    Perkins James R

    2012-07-01

    Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.

  17. Diagnosis of Hepatozoon canis in young dogs by cytology and PCR.

    Science.gov (United States)

    Otranto, Domenico; Dantas-Torres, Filipe; Weigl, Stefania; Latrofa, Maria Stefania; Stanneck, Dorothee; Decaprariis, Donato; Capelli, Gioia; Baneth, Gad

    2011-04-13

    Hepatozoon canis is a widespread tick-borne protozoan affecting dogs. The diagnosis of H. canis infection is usually performed by cytology of blood or buffy coat smears, but this method may not be sensitive. Our study aimed to evaluate the best method to achieve a parasitological diagnosis of H. canis infection in a population of receptive young dogs, previously negative by cytology and exposed to tick infestation for one summer season. A total of 73 mongrel dogs and ten beagles younger than 18 months of age, living in an animal shelter in southern Italy where dogs are highly infested by Rhipicephalus sanguineus, were included in this study. In March-April 2009 and in October 2009, blood and bone marrow were sampled from each dog. Blood, buffy coat and bone marrow were examined by cytology only (at the first sampling) and also by PCR for H. canis (second sampling). In March-April 2009, only one dog was positive for H. canis by cytological examination, whereas in October 2009 (after the summer season), the overall incidence of H. canis infection by cytological examinations was 43.9%. Molecular tests carried out on samples taken in October 2009 showed a considerably higher number of dogs positive by PCR (from 27.7% up to 51.2% on skin and buffy coat tissues, respectively), with an overall positivity of 57.8%. All animals, but one, which were positive by cytology were also PCR-positive. PCR on blood or buffy coat detected the highest number of H. canis-positive dogs displaying a sensitivity of 85.7% for both tissues that increased up to 98% when used in parallel. Twenty-six (74.8%) out of the 28 H. canis-positive dogs presented hematological abnormalities, eosinophilia being the commonest alteration observed. The results suggest that PCR on buffy coat and blood is the best diagnostic assay for detecting H. canis infection in dogs, although when PCR is not available, cytology on buffy coat should be preferred to blood smear evaluation. This study has also demonstrated

  18. Prospective evaluation of the SeptiFAST multiplex real-time PCR assay for surveillance and diagnosis of infections in haematological patients after allogeneic stem cell transplantation compared to routine microbiological assays and an in-house real-time PCR method.

    Science.gov (United States)

    Elges, Sandra; Arnold, Renate; Liesenfeld, Oliver; Kofla, Grzegorz; Mikolajewska, Agata; Schwartz, Stefan; Uharek, Lutz; Ruhnke, Markus

    2017-12-01

    We prospectively evaluated a multiplex real-time PCR assay (SeptiFast, SF) in a cohort of patients undergoing allo-BMT in comparison to an in-house PCR method (IH-PCR). Overall 847 blood samples (mean 8 samples/patient) from 104 patients with haematological malignancies were analysed. The majority of patients had acute leukaemia (62%) with a mean age of 52 years (54% female). Pathogens could be detected in 91 of 847 (11%) samples by SF compared to 38 of 205 (18.5%) samples by BC, and 57 of 847 (6.7%) samples by IH-PCR. Coagulase-negative staphylococci (n=41 in SF, n=29 in BC) were the most frequently detected bacteria followed by Escherichia coli (n=9 in SF, n=6 in BC). Candida albicans (n=17 in SF, n=0 in BC, n=24 in IH-PCR) was the most frequently detected fungal pathogen. SF gave positive results in 5% of samples during surveillance vs in 26% of samples during fever episodes. Overall, the majority of blood samples gave negative results in both PCR methods resulting in 93% overall agreement resulting in a negative predictive value of 0.96 (95% CI: 0.95-0.97), and a positive predictive value of 0.10 (95% CI: -0.01 to 0.21). SeptiFast appeared to be superior over BC and the IH-PCR method. © 2017 Blackwell Verlag GmbH.

  19. Internal quality control of PCR-based genotyping methods

    DEFF Research Database (Denmark)

    Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen

    2002-01-01

    Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...

  20. Implementierung und Evaluierung eines tutoriell betreuten elektronischen Biochemie-Praktikumsversuchs "Polymerase-Kettenreaktion (PCR" im vorklinischen Studienabschnitt [Implementation and Evaluation of a Tutor-Supported Computer-Based Practical Biochemistry Course "Polymerase Chain Reaction (PCR" in Preclinical Education

    Directory of Open Access Journals (Sweden)

    Kröncke, Klaus-Dietrich

    2008-08-01

    Full Text Available [english] Background: The polymerase chain reaction (PCR is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-relevant data. In addition, they learned the essential features of the PCR with the aid of embedded textual information and audiovisual animations. To check that the learning objectives were fulfilled, the students had to solve medical-related PCR tasks on the computer. Results: In total, 311 students went through the course. They were satisfied with the e-learning teaching unit and evaluated it very positively, independently of their prior knowledge concerning the PCR. Students with low levels of computer skills did not feel over-challenged. Conclusion: Our results show that a computer-based practical training course is an excellent option for teaching undergraduate medical students complex technologies that could otherwise only be taught in a laboratory at great expense of time and effort. [german] Zielsetzung: Es sollte untersucht werden, ob ein E-Learning Praktikumsversuch geeignet ist, Medizin-Studierenden der Vorklinik die Polymerase-Kettenreaktion (PCR begreiflich zu machen. Methodik: Ein Computer-basierter Praktikumsversuch wurde entwickelt, der sowohl das Recherchieren in wissenschaftlich-medizinischen Datenbanken zum Auffinden von PCR-relevanten Informationen beinhaltet als auch Selbstlerneinheiten über die PCR. Als Lernzielkontrollen dienten Aufgaben aus der medizinischen PCR-Diagnostik. Die Akzeptanz der Lehrveranstaltung bei den Studierenden wurde mit einem Fragebogen ermittelt, der 19 Items enthielt. Ergebnisse: 311 Studierende absolvierten den

  1. Comparative study of Gram stain, potassium hydroxide smear, culture and nested PCR in the diagnosis of fungal keratitis.

    Science.gov (United States)

    Badiee, Parisa; Nejabat, Mahmood; Alborzi, Abdolvahab; Keshavarz, Fatemeh; Shakiba, Elaheh

    2010-01-01

    This study seeks to evaluate the efficacy and practicality of the molecular method, compared to the standard microbiological techniques for diagnosing fungal keratitis (FK). Patients with eye findings suspected of FK were enrolled for cornea sampling. Scrapings from the affected areas of the infected corneas were obtained and were divided into two parts: one for smears and cultures, and the other for nested PCR analysis. Of the 38 eyes, 28 were judged to have fungal infections based on clinical and positive findings in the culture, smear and responses to antifungal treatment. Potassium hydroxide, Gram staining, culture and nested PCR results (either positive or negative) matched in 76.3, 42.1, 68.4 and 81.6%, respectively. PCR is a sensitive method but due to the lack of sophisticated facilities in routine laboratory procedures, it can serve only complementarily and cannot replace conventional methods. Copyright © 2010 S. Karger AG, Basel.

  2. Droplet digital PCR for detection and quantification of circulating tumor DNA in plasma of head and neck cancer patients.

    Science.gov (United States)

    van Ginkel, Joost H; Huibers, Manon M H; van Es, Robert J J; de Bree, Remco; Willems, Stefan M

    2017-06-19

    During posttreatment surveillance of head and neck cancer patients, imaging is insufficiently accurate for the early detection of relapsing disease. Free circulating tumor DNA (ctDNA) may serve as a novel biomarker for monitoring tumor burden during posttreatment surveillance of these patients. In this exploratory study, we investigated whether low level ctDNA in plasma of head and neck cancer patients can be detected using Droplet Digital PCR (ddPCR). TP53 mutations were determined in surgically resected primary tumor samples from six patients with high stage (II-IV), moderate to poorly differentiated head and neck squamous cell carcinoma (HNSCC). Subsequently, mutation specific ddPCR assays were designed. Pretreatment plasma samples from these patients were examined on the presence of ctDNA by ddPCR using the mutation-specific assays. The ddPCR results were evaluated alongside clinicopathological data. In all cases, plasma samples were found positive for targeted TP53 mutations in varying degrees (absolute quantification of 2.2-422 mutational copies/ml plasma). Mutations were detected in wild-type TP53 background templates of 7667-156,667 copies/ml plasma, yielding fractional abundances of down to 0.01%. Our results show that detection of tumor specific TP53 mutations in low level ctDNA from HNSCC patients using ddPCR is technically feasible and provide ground for future research on ctDNA quantification for the use of diagnostic biomarkers in the posttreatment surveillance of HNSCC patients.

  3. Detection of Coxiella burnetii by PCR in bulk tank milk samples from dairy caprine herds in southeast of Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Khalili

    2015-02-01

    Full Text Available Objective: To use PCR for the detection of Coxiella burnetii (C. burnetii in bulk tank milk samples collected from dairy caprine herds in southeast Iran. Methods: In the present study, 31 goat bulk milk from 31 dairy goat herds were tested for C. burnetii using trans-PCR assay. The animals which their milk samples collected for this study were clinically healthy. Results: In total, 5 of 31 (16.12% goat milk samples were positive. Conclusions: The results of this study indicate clinically healthy dairy goats are important sources of C. burnetii infection in this area.

  4. Performance of a real-time PCR assay in routine bovine mastitis diagnostics compared with in-depth conventional culture.

    Science.gov (United States)

    Hiitiö, Heidi; Riva, Rauna; Autio, Tiina; Pohjanvirta, Tarja; Holopainen, Jani; Pyörälä, Satu; Pelkonen, Sinikka

    2015-05-01

    Reliable identification of the aetiological agent is crucial in mastitis diagnostics. Real-time PCR is a fast, automated tool for detecting the most common udder pathogens directly from milk. In this study aseptically taken quarter milk samples were analysed with a real-time PCR assay (Thermo Scientific PathoProof Mastitis Complete-12 Kit, Thermo Fisher Scientific Ltd.) and by semi-quantitative, in-depth bacteriological culture (BC). The aim of the study was to evaluate the diagnostic performance of the real-time PCR assay in routine use. A total of 294 quarter milk samples from routine mastitis cases were cultured in the national reference laboratory of Finland and examined with real-time PCR. With BC, 251 out of 294 (85.7%) of the milk samples had at least one colony on the plate and 38 samples were considered contaminated. In the PCR mastitis assay, DNA of target species was amplified in 244 samples out of 294 (83.0%). The most common bacterial species detected in the samples, irrespective of the diagnostic method, was the coagulase negative staphylococci (CNS) group (later referred as Staphylococcus spp.) followed by Staphylococcus aureus. Sensitivity (Se) and specificity (Sp) for the PCR assay to provide a positive Staph. aureus result was 97.0 and 95.8% compared with BC. For Staphylococcus spp., the corresponding figures were 86.7 and 75.4%. Our results imply that PCR performed well as a diagnostic tool to detect Staph. aureus but may be too nonspecific for Staphylococcus spp. in routine use with the current cut-off Ct value (37.0). Using PCR as the only microbiological method for mastitis diagnostics, clinical relevance of the results should be carefully considered before further decisions, for instance antimicrobial treatment, especially when minor pathogens with low amount of DNA have been detected. Introducing the concept of contaminated samples should also be considered.

  5. Species identification and quantification in meat and meat products using droplet digital PCR (ddPCR).

    Science.gov (United States)

    Floren, C; Wiedemann, I; Brenig, B; Schütz, E; Beck, J

    2015-04-15

    Species fraud and product mislabelling in processed food, albeit not being a direct health issue, often results in consumer distrust. Therefore methods for quantification of undeclared species are needed. Targeting mitochondrial DNA, e.g. CYTB gene, for species quantification is unsuitable, due to a fivefold inter-tissue variation in mtDNA content per cell resulting in either an under- (-70%) or overestimation (+160%) of species DNA contents. Here, we describe a reliable two-step droplet digital PCR (ddPCR) assay targeting the nuclear F2 gene for precise quantification of cattle, horse, and pig in processed meat products. The ddPCR assay is advantageous over qPCR showing a limit of quantification (LOQ) and detection (LOD) in different meat products of 0.01% and 0.001%, respectively. The specificity was verified in 14 different species. Hence, determining F2 in food by ddPCR can be recommended for quality assurance and control in production systems. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. A mode of error: Immunoglobulin binding protein (a subset of anti-citrullinated proteins can cause false positive tuberculosis test results in rheumatoid arthritis

    Directory of Open Access Journals (Sweden)

    Maria Greenwald

    2017-12-01

    Full Text Available Citrullinated Immunoglobulin Binding Protein (BiP is a newly described autoimmune target in rheumatoid arthritis (RA, one of many cyclic citrullinated peptides(CCP or ACPA. BiP is over-expressed in RA patients causing T cell expansion and increased interferon levels during incubation for the QuantiFERON-Gold tuberculosis test (QFT-G TB. The QFT-G TB has never been validated where interferon is increased by underlying disease, as for example RA.Of ACPA-positive RA patients (n = 126, we found a 13% false-positive TB test rate by QFT-G TB. Despite subsequent biologic therapy for 3 years of all 126 RA patients, none showed evidence of TB without INH. Most of the false-positive RA patients after treatment with biologic therapy reverted to a negative QFT-G test. False TB tests correlated with ACPA level (p < 0.02.Three healthy women without arthritis or TB exposure had negative QFT-G TB. In vitro, all three tested positive every time for TB correlating to the dose of BiP or anti-BiP added, at 2 ug/ml, 5 ug/ml, 10 ug/ml, and 20 ug/ml.BiP naturally found in the majority of ACPA-positive RA patients can result in a false positive QFT-G TB. Subsequent undertreatment of RA, if biologic therapy is withheld, and overtreatment of presumed latent TB may harm patients. Keywords: Tuberculosis, IGRA, Rheumatoid arthritis, Interferon, Anti-citrullinated peptide antibody (ACPA, Immunoglobulin binding protein (BiP

  7. Blood culture-PCR to optimise typhoid fever diagnosis after controlled human infection identifies frequent asymptomatic cases and evidence of primary bacteraemia.

    Science.gov (United States)

    Darton, Thomas C; Zhou, Liqing; Blohmke, Christoph J; Jones, Claire; Waddington, Claire S; Baker, Stephen; Pollard, Andrew J

    2017-04-01

    Improved diagnostics for typhoid are needed; a typhoid controlled human infection model may accelerate their development and translation. Here, we evaluated a blood culture-PCR assay for detecting infection after controlled human infection with S. Typhi and compared test performance with optimally performed blood cultures. Culture-PCR amplification of blood samples was performed alongside daily blood culture in 41 participants undergoing typhoid challenge. Study endpoints for typhoid diagnosis (TD) were fever and/or bacteraemia. Overall, 24/41 (59%) participants reached TD, of whom 21/24 (86%) had ≥1 positive blood culture (53/674, 7.9% of all cultures) or 18/24 (75%) had ≥1 positive culture-PCR assay result (57/684, 8.3%). A further five non-bacteraemic participants produced culture-PCR amplicons indicating infection; overall sensitivity/specificity of the assay compared to the study endpoints were 70%/65%. We found no significant difference between blood culture and culture-PCR methods in ability to identify cases (12 mismatching pairs, p = 0.77, binomial test). Clinical and stool culture metadata demonstrated that additional culture-PCR amplification positive individuals likely represented true cases missed by blood culture, suggesting the overall attack rate may be 30/41 (73%) rather than 24/41 (59%). Several participants had positive culture-PCR results soon after ingesting challenge providing new evidence for occurrence of an early primary bacteraemia. Overall the culture-PCR assay performed well, identifying extra typhoid cases compared with routine blood culture alone. Despite limitations to widespread field-use, the benefits of increased diagnostic yield, reduced blood volume and faster turn-around-time, suggest that this assay could enhance laboratory typhoid diagnostics in research applications and high-incidence settings. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  8. Comparison of real time IS6110-PCR, microscopy, and culture for diagnosis of tuberculous meningitis in a cohort of adult patients in Indonesia.

    Directory of Open Access Journals (Sweden)

    Lidya Chaidir

    Full Text Available BACKGROUND: Bacteriological confirmation of tuberculous (TB meningitis is difficult. Culture is slow and microscopy has insufficient sensitivity. We evaluated real time PCR targeting insertion sequence IS6110 among 230 consecutive adult patients with subacute meningitis in a referral hospital in Indonesia. METHODS: Cerebrospinal fluid (CSF samples were examined using microscopy, solid and liquid culture, and real time IS6110-PCR with a fluorescence-labeled probe using DNA extracted from CSF. CSF samples from 40 non-infectious neurology patients were used as negative controls. IS6110-PCR results were linked with clinical and CSF characteristics. RESULTS: Most patients presented with subacute meningitis, after a median of 14 days of symptoms (range 7-30. After exclusion of cryptococcal and bacterial meningitis, 207 patients were classified as definite or probable TB meningitis; 17.9% with HIV infection. Among this group IS6110-PCR gave the highest positivity rate (68%, 95% CI 62-74% compared with microscopy of ZN-stained slides (11%, 95% CI 7-15%, and mycobacterial culture using solid (36%, 95% CI 29-42% and liquid (44%, 95% CI 37-51% media. IS6110-PCR was positive in 92% of patients with culture-positive and 42% of patients with culture-negative probable TB meningitis. Among culture-negative patients, a positive PCR was associated with a history of TB treatment, a longer duration of illness, a higher CSF cell count and protein, and a lower CSF glucose. IS6110-PCR was negative in all CSF samples from non-meningitis control patients. CONCLUSIONS: Real time IS6110-PCR is a quick, sensitive, and specific test for diagnosing of TB meningitis in this setting. Its performance in other (less-developed settings needs further study.

  9. Study On Application Of Molecular Techniques (RAPD-PCR And RAMP-PCR) To Detect Mutation In Rice Breeding

    International Nuclear Information System (INIS)

    Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham

    2007-01-01

    The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)

  10. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  11. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  12. ASSOCIATION BETWEEN POSITIVE CANINE HEARTWORM (DIROFILARIA IMMITIS) ANTIGEN RESULTS AND PRESENCE OF ACANTHOCHEILONEMA ODENDHALI MICROFILARIA IN CALIFORNIA SEA LIONS (ZALOPHUS CALIFORNIANUS).

    Science.gov (United States)

    Krucik, David D R; Van Bonn, William; Johnson, Shawn P

    2016-03-01

    This study establishes a relationship between positive canine heartworm (Dirofilaria immitis) test results frequently observed in California sea lions (Zalophus californianus) and infection with the filarid nematode Acanthocheilonema odendhali. Four commercially available canine heartworm antigen tests were evaluated for cross-reaction with A. odendhali in California sea lions. Sera were tested from fifteen California sea lions with A. odendhali-associated microfilaremia, confirmed by blood smear, and with no evidence of D. immitis infection at necropsy. Ninety-five percent of tests were falsely positive for D. immitis. This study also determined that the prevalence of A. odendhali infection in stranded California sea lions from central California is approximately 23% by comparing the number of findings of mircofilaremia to the total number of California sea lions sampled at The Marine Mammal Center between 2005 and 2011, inclusive. Acanthocheilonema odenhali microfilaremia in California sea lions is likely to cross-react with canine heartworm antigen tests, and clinicians should interpret results with caution.

  13. Self-Reported HIV-Positive Status But Subsequent HIV-Negative Test Result Using Rapid Diagnostic Testing Algorithms Among Seven Sub-Saharan African Military Populations

    Science.gov (United States)

    2017-07-07

    analysis, data interpretation, or writing of the report. Leidos provided support in the form of salaries for JH, BRT, AGT, MBJ and JM but did not have any...have data on a QA process. The survey used for all seven partner mili- taries was based on a standardized modular survey, which assessed HIV risk... Technical considerations Technical limitations have been shown to increase false-positive HIV test results in voluntary counseling and testing centers

  14. Detection of Yersinia Enterocolitica Species in Pig Tonsils and Raw Pork Meat by the Real-Time Pcr and Culture Methods.

    Science.gov (United States)

    Stachelska, M A

    2017-09-26

    The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.

  15. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Science.gov (United States)

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  16. Molecular detection of infectious bronchitis and Newcastle disease viruses in broiler chickens with respiratory signs using Duplex RT-PCR.

    Science.gov (United States)

    Saba Shirvan, Aylar; Mardani, Karim

    2014-01-01

    Infectious bronchitis (IB) and Newcastle disease (ND) are highly contagious and the most economically important diseases of the poultry affecting respiratory tract and causing economic losses in poultry industry throughout the world. In the present study, the simultaneous detection and differentiation of causative agents of these diseases were investigated using duplex-RT-PCR. RNA wa