Leblanc, Mathias; Berry, Kristina; Graciano, Sandy; Becker, Brandon; Reuter, Jon D
2014-11-01
Modern rodent colonies are housed in individually ventilated cages to protect the animals from contamination with adventitious pathogens. Standard health monitoring through soiled-bedding sentinels does not always detect infections, especially in the context of low pathogen prevalence. Recently proposed alternatives include analyzing environmental samples from the cages or rack exhaust by PCR to improve the detection of rodent pathogens but optimal sampling strategies have not yet been established for different microorganisms. Although generally very sensitive and specific, these molecular assays are not foolproof and subject to false-positive and -negative results and should always be interpreted cautiously with an overall understanding of the intrinsic controls and all the variables that may affect the results. Here, we report a limited Aspiculuris tetraptera outbreak in a mouse barrier facility that was detected by fecal PCR in sentinels and confirmed by fecal flotation and direct cecal examination of both sentinels and colony animals. The outbreak led to a widespread survey of all facilities for pinworms by using environmental PCR from ventilated rack exhaust plenums. Environmental PCR suggested an unexpected widespread contamination of all ventilated racks holding nonautoclaved cages, but results could not be confirmed in sentinel or colony animals by fecal flotation, cecal and colonic examination, or cage PCR testing. After additional investigation, the unexpected environmental PCR results were confirmed as false-positive findings due to the nonspecificity of the assay, leading to the amplification of rhabditid nematodes, which are not infectious in rodents but which contaminated the corncob bedding.
Retrospective Review of Treponema pallidum PCR and Serology Results: Are Both Tests Necessary?
Brischetto, Anna; Gassiep, Ian; Whiley, David; Norton, Robert
2018-05-01
There has been a resurgence of syphilis diagnoses in Australia. We investigated whether our Treponema pallidum PCR test provides any additional diagnostic information over syphilis serology (chemiluminescence immunoassay [CMIA], Treponema pallidum particle agglutination [TPPA] assay, and the rapid plasma reagin [RPR] flocculation test). A retrospective audit of all T. pallidum PCR requests that came through our laboratory from January 2010 to June 2017 was conducted; data collected included age, gender, site of swab, and results from T. pallidum PCR, syphilis serology, and herpes simplex virus 1 (HSV-1) and HSV-2 PCRs. A total of 441 T. pallidum PCR tests were performed; on average, 3 T. pallidum PCRs per month were requested in 2011, and this rate increased to 17.2 requests per month in 2017. A total of 323 patients had both T. pallidum PCR and syphilis serology performed, with 67% of swabs taken from the genitals. T. pallidum PCR gave positive results for 61/323 (19%) patients; of these 61 patients, 59 (97%) also had positive syphilis serology results ( T. pallidum PCR sensitivity, 68%; specificity, 99%; positive predictive value, 97%; negative predictive value, 89%). Syphilis serology was positive for 91/323 patients (28%); of these 91 patients, 61 (66%) were also T. pallidum PCR positive (syphilis serology sensitivity, 97%; specificity, 88%; positive predictive value, 60%; negative predictive value, 99%). The Cohen's kappa value was 0.74, indicating substantial agreement between the two tests. Our results show that most patients with positive T. pallidum PCR results also had positive syphilis serology. Therefore, T. pallidum PCR adds little clinical value over serology for the diagnosis of syphilis in certain clinical settings. Copyright © 2018 American Society for Microbiology.
Positive Streptobacillus moniliformis PCR in guinea pigs likely due to Leptotrichia spp.
Boot, Ron; Van de Berg, Lia; Reubsaet, Frans A G; Vlemminx, Maurice J
2008-04-30
Streptobacillus moniliformis is a zoonotic bacterium. We obtained positive S. moniliformis PCR results in oral swab samples from guinea pigs from an experimental colony and the breeding colony of origin. Comparison of the DNA sequence of an amplicon with deposited 16S rDNA sequences revealed that Leptotrichia sp. can be the source of a false positive S. moniliformis PCR outcome.
Rapid detection of Pseudomonas aeruginosa from positive blood cultures by quantitative PCR
Directory of Open Access Journals (Sweden)
Cattoir Vincent
2010-08-01
Full Text Available Abstract Background Pseudomonas aeruginosa is responsible for numerous bloodstream infections associated with severe adverse outcomes in case of inappropriate initial antimicrobial therapy. The present study was aimed to develop a novel quantitative PCR (qPCR assay, using ecfX as the specific target gene, for the rapid and accurate identification of P. aeruginosa from positive blood cultures (BCs. Methods Over the period August 2008 to June 2009, 100 BC bottles positive for gram-negative bacilli were tested in order to evaluate performances of the qPCR technique with conventional methods as gold standard (i.e. culture and phenotypic identification. Results Thirty-three strains of P. aeruginosa, 53 strains of Enterobactericaeae, nine strains of Stenotrophomonas maltophilia and two other gram-negative species were isolated while 3 BCs were polymicrobial including one mixture containing P. aeruginosa. All P. aeruginosa clinical isolates were detected by qPCR except a single strain in mixed culture. Performances of the qPCR technique were: specificity, 100%; positive predictive value, 100%; negative predictive value, 98.5%; and sensitivity, 97%. Conclusions This reliable technique may offer a rapid (
Jamshidi Makiani, Mahin; Davoodian, Parivash; Baghershiroodi, Mahnaz; Nejatizadeh, Abdol Azim; Fakkhar, Farideh; Zangeneh, Mehrangiz; Jahangiri, Nadia
2016-08-01
While tuberculosis (TB) can be diagnosed by microscopy and culture, the sensitivity of Ziehl-Neelsen staining is variable and culture results require 4 - 8 weeks to be determined. Polymerase chain reaction (PCR) and its modifications, including nested PCR, might be promising methods for the rapid diagnosis of TB. This study aimed to evaluate the performance of nested PCR on urine samples of human immunodeficiency virus (HIV)-positive and -negative patients with different manifestations of clinical TB. In a prospective study, three early-morning urine samples from 100 patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were evaluated using a molecular target with insertion element IS6110, specific to the Mycobacterium tuberculosis genome, and nested PCR was performed. The results were analyzed with SPSS version 22. A total of 100 patients, including 74 (74%) with PTB and 26 (26%) with EPTB, were enrolled. Positive smears were seen in 38 patients (38%). Lymph nodes were the most commonly involved organ in 14 of the 26 (53.8%) EPTB patients (13.5%). Seven (23.1%) of the EPTB patients were HIV-positive. Urine PCR was positive in only 28 patients (28%). Seven HIV-positive patients with PTB showed positive urine PCR results. Moreover, PCR results were positive in only one of the seven HIV-positive subjects with EPTB. Positive PCR results were found in 20 of the 73 HIV-negative patients (27.4%) and in 8 of the 27 HIV-positive patients (29.6%). Therefore, there was no significant difference between the HIV-negative and HIV-positive patients for urine PCR (sensitivity 29.6%, specificity 72.6%; positive and negative predictive values 28% and 72%, respectively; P = 0.138). Nested PCR showed the same sensitivity in HIV-positive and HIV-negative patients. It can be applied as a rapid technique for the diagnosis of TB.
Stachelska, Milena Alicja
2017-01-01
Yersiniosis is believed to be the third most common intestinal zoonosis in the European Union, after campylobacteriosis and salmonellosis. Yersinia enterocolitica is the most common species responsible for human infections. Pigs are regarded as the biggest reservoir of pathogenic Y. enterocolitica strains, which are mainly isolated from pig tonsils. The aim of this paper is to examine the prevalence of inv-positive and ail-positive Y. enterocolitica in pigs which were slaughtered in a Polish abattoir. Real-time PCR and culture methods were used to assess the prevalence of patho- genic Y. enterocolitica strains in pig tonsils. Real-time PCR was applied to detect inv-positive and ail-positive Y. enterocolitica. Y. enterocolitica was also isolated by applying direct plating, unselective (tryptic soy broth) and selective (irgasan-ticarcillin-potassium chlorate bouillon) enrichment. A total of 180 pigs were studied, of which 85% and 32% respectively were found to be infected with inv-positive and ail-positive Y. enterocolitica. The 92 inv-positive and ail-positive isolates, from 57 culture- positive tonsils, underwent bio- and serotyping. The most common was bioserotype 4/O:3, which was found in 53 (93%) out of 57 culture-positive tonsils. Strains of bioserotypes 2/O:5, 2/O:9 and 2/O:5.27 occurred in significantly lower numbers. The prevalence of inv-positive and ail-positive Y. enterocolitica was found to be high in the ton- sils of slaughtered pigs, using real-time PCR. The real-time PCR method for the detection and identification of pathogenic Y. enterocolitica is sensitive and specific, which has been verified by specificity and sensitivity tests using the pure cultures. Serotypes were distinguished from each other using PCR serotyping. The PCR method was essential in forming our conclusions.
Application of a PCR method for the diagnosis of ulcerative enteritis: preliminary results
Directory of Open Access Journals (Sweden)
Fabrizio Agnoletti
2010-01-01
Full Text Available Ulcerative enteritis or “quail disease” is an acute clostridial infection of young birds reported in many avian species, chicken and turkey included. Clostridium colinum is the causative agent of ulcerative enteritis and because of the difficulties bound to the isolation and identification of this bacterium by means of classic bacteriological techniques, its detection appears very hard and the prevalence of this disease could be underestimated. To investigate the diffusion of C. colinum in enteric disease of birds, a recently developed PCR protocol was applied to 42 cultural broths previously inoculated with organs and intestinal samples collected from diseased subjects. PCR-positive broths were cultivated to attempt the isolation of C. colinum. Samples collected from positive birds were subjected to histological examinations. 4 birds (3 broilers chickens and 1 pigeon resulted PCR-positive and, in one case, C. colinum was isolated. Gross and histological lesions of positive birds were compatible with those described in other ulcerative enteritis outbreaks. These preliminary results demonstrates that C. colinum is sporadically implicated in enteric diseases of broiler chickens (14.2%. In addition, the PCR assay proved to be an useful and reliable instrument to support the diagnosis of ulcerative enteritis and to facilitate the isolation of C. colinum.
Le Scanff, J; Gaultier, J B; Durand, D Vital; Durieu, I; Celard, M; Benito, Y; Vandenesch, F; Rousset, H
2008-11-01
PCR can be used to detect T. whipplei (Tw) in samples from variable tissue types and body fluids. We report clinical, evolutive characteristics and final diagnosis in patients with positive Tw PCR assay. Retrospective study of Tw PCR realized since 10years in a microbiology laboratory. Twenty-five Tw PCR assays were positive among 200 realized. Diagnosis was not confirmed in six cases. One patient was missing for follow up. Eighteen patients presented with Whipple's disease. Among these 18 patients, 14 had a classic Whipple's disease, three patients presented an endocarditis and one patient isolated neurological manifestations. Ten patients presented fever, seven a weight loss and 12 joint involvement. Four patients presented cutaneous manifestations, only six had gastrointestinal symptoms. Neurological involvement was reported in five cases, pulmonary symptoms in four cases, cardiac involvement in six cases and ocular signs in two cases. Anemia was reported in four patients and elevated levels of acute-phase reactants in 14 cases. Positive predictive value of Tw PCR for Whipple's disease diagnosis was 75%. Thirteen patients had a good evolution with antibiotics. Three patients presented recurrence and two cases with cardiovascular involvement died. Whipple's disease is rare but often mentioned in internist experience. The diagnosis should be every time confirmed. Tw PCR assay is an important diagnostic tool but is not sufficient to establish the diagnosis and must be interpreted with histopathology and immunohistochemical testing results.
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A. P.; Stentiford, Grant D.; Flegel, Timothy W.; Sritunyalucksana, Kallaya
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers. PMID:27832178
Jaroenlak, Pattana; Sanguanrut, Piyachat; Williams, Bryony A P; Stentiford, Grant D; Flegel, Timothy W; Sritunyalucksana, Kallaya; Itsathitphaisarn, Ornchuma
2016-01-01
Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP) is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth and unprofitable harvests. Existing PCR detection methods target the EHP small subunit ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give false positive test results due to cross reactivity of the SSU-PCR primers with DNA from closely related microsporidia that infect other aquatic organisms. This is problematic for investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive and specific nested PCR method was developed for detection of the spore wall protein (SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive results from closely related microsporidia. The first PCR step of the SWP-PCR method was 100 times (104 plasmid copies per reaction vial) more sensitive than that of the existing SSU-PCR method (106 copies) but sensitivity was equal for both in the nested step (10 copies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepatopancreatic samples despite the lower sensitivity than the SWP-PCR method. However, due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be used to screen for EHP in feces, feed and environmental samples for potential EHP carriers.
DEFF Research Database (Denmark)
Petersen, E.; Edvinsson, B.; Lundgren, Bettina
2006-01-01
. In positive samples, the genotype of the parasite was determined by sequence analysis of the GRA6 gene. Positive results were achieved for 2% (7/332) of the samples tested. Genotyping was possible in two samples and revealed GRA6 type II T. gondii. PCR for detecting T. gondii in BAL samples should...... be performed in all immunosuppressed HIV-positive patients with symptoms of a systemic infection of unknown etiology. Trimethoprim-sulfamethoxazole prophylaxis does not exclude concomitant infection with T. gondii....
Becker, Sören L; Müller, Ivan; Mertens, Pascal; Herrmann, Mathias; Zondie, Leyli; Beyleveld, Lindsey; Gerber, Markus; du Randt, Rosa; Pühse, Uwe; Walter, Cheryl; Utzinger, Jürg
2017-10-01
Stool-based rapid diagnostic tests (RDTs) for pathogenic intestinal protozoa (e.g. Cryptosporidium spp. and Giardia intestinalis) allow for prompt diagnosis and treatment in resource-constrained settings. Such RDTs can improve individual patient management and facilitate population-based screening programmes in areas without microbiological laboratories for confirmatory testing. However, RDTs are difficult to interpret in case of 'trace' results with faint test band intensities and little is known about whether such ambiguous results might indicate 'true' infections. In a longitudinal study conducted in poor neighbourhoods of Port Elizabeth, South Africa, a total of 1428 stool samples from two cohorts of schoolchildren were examined on the spot for Cryptosporidium spp. and G. intestinalis using an RDT (Crypto/Giardia DuoStrip; Coris BioConcept). Overall, 121 samples were positive for G. intestinalis and the RDT suggested presence of cryptosporidiosis in 22 samples. After a storage period of 9-10 months in cohort 1 and 2-3 months in cohort 2, samples were subjected to multiplex PCR (BD Max™ Enteric Parasite Panel, Becton Dickinson). Ninety-three percent (112/121) of RDT-positive samples for G. intestinalis were confirmed by PCR, with a correlation between RDT test band intensity and quantitative pathogen load present in the sample. For Cryptosporidium spp., all positive RDTs had faintly visible lines and these were negative on PCR. The performance of the BD Max™ PCR was nearly identical in both cohorts, despite the prolonged storage at disrupted cold chain conditions in cohort 1. The Crypto/Giardia DuoStrip warrants further validation in communities with a high incidence of diarrhoea. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Fox, J.C.; Ait-Khaled, Mounir; Webster, Alison; Emery, V.C.
1991-01-01
The sensitivity of polymerase chain reaction (PCR) can mean that even very low levels of contamination with the target DNA will result in a positive signal. At present this aspect is a major limitation in the use of PCR as a routine diagnostic method. By exposing PCR reagents to UV light, contaminating DNA can be inactivated, thus providing an opportunity to eradicate false positive reactions. UV irradiation was applied to PCR systems used for detection of human cytomegalovirus CMV and human immunodeficiency virus (HIV) and shown to be effective in eradicating both laboratory encountered contamination and plasmid DNA (below 100 pg) added to PCR systems prior to UV exposure. Sensitivity of a PCR system to amplify the long terminal repeat (LTR) sequence of HIV-1 was not affected by the irradiation procedure; however, ultimate sensitivity of a PCR system for the amplification of an early gene pro-motor sequence of the CMV genome was reduced 1000-fold. UV irradiation did not affect the size of the PCR product as determined by strand separating polyacrylamide gel electrophoresis of a 32 P-labelled amplimer. Thus, a simple pre-exposure to UV light would seem a worth-wile step to incorporate into PCR protocols provided that the effects on sensitivity have been determined empirically for each PCR system. (author). 11 refs.; 3 figs
Evaluation of PCR and multiplex PCR in relation to nested PCR for diagnosing Theileria equi
Directory of Open Access Journals (Sweden)
Danielle C. Leal
2011-07-01
Full Text Available Conventional PCR (PCRTeq for diagnosing Theileria equi and multiplex PCR (M/PCRTeq-Bc for diagnosing T. equi and Babesia caballi were comparatively evaluated with nested PCR (N/PCR-Teq for diagnosing equine piroplasmosis. In DNA sensitivity determinations, in multiple dilutions of equine blood that had tested positive for T. equi, PCR-Teq and N/PCR-Teq detected hemoparasite DNA in the larger dilutions (1:128, but did not differ significantly from the M/PCRTeq-Bc (1:64. In analyses on equine serum tested by ELISA, there was high agreement between this serological test and PCR-Teq (k = 0.780 and moderate agreement with N/PCR-Teq (k = 0.562 and M/PCRTeq-Bc (k = 0.488. PCR-Teq found a higher frequency of T. equi both in extensively and intensively reared horses, but this was not significant in relation to N/PCR-Teq (P>0.05, and both PCRs indicated that there was an endemic situation regarding T. equi in the population of horses of this sample. PCR-Teq was only significantly different from M/PCR-Teq-Bc (P<0.05. PCR-Teq presented high sensitivity and specificity, comparable to N/PCR-Teq, but with the advantage of higher speed in obtaining results and lower costs and risks of laboratory contamination. This accredits PCR-Teq for epidemiological studies and for determinations on affected horses.
Diagnosis of trichomonas vaginalis infection by PCR
International Nuclear Information System (INIS)
Issa, R.M.; Shalaby, M.A.
2007-01-01
To compare the sensitivity of PCR, wet preparation and culture in detecting Trichomonas vaginalis in urine and vaginal fluid. A PCR targeting the beta-tubulin genes of T. vaginalis was used for the detection of the organism in both vaginal swab and urine specimens from infected patients. Random urine samples were collected from 30 patients (23 females and 7 males), and tested for T. vaginalis by wet preparation and the Inpouch T. vaginalis culture systeme. Two vaginal swabs were collected by each woman. PCR detection. was carried out on samples negative by first methods. The positive result was found in 28.57% in male urine and 39.13% in female urine samples, 65.21% in 1st swab and 78.26 % in 2nd swab by wet preparation. By culture, the male urine samples showed 42.85% positive, female urine 69.56% while 1st swab showed 86.95% positive and 2nd swab 91.30% positive. All negative cases by culture in urine and vaginal samples were tested by PCR, which showed 2 cases to be positive in male urine samples and 5 cases positive in female urine sample. PCR assay was as good as or more sensitive than wet preparation and culture and resulted in practical advantage of providing results in shorter time. However, PCR test is still very expensive. (author)
Kotrova, M; van der Velden, V H J; van Dongen, J J M; Formankova, R; Sedlacek, P; Brüggemann, M; Zuna, J; Stary, J; Trka, J; Fronkova, E
2017-07-01
Minimal residual disease (MRD) monitoring via quantitative PCR (qPCR) detection of Ag receptor gene rearrangements has been the most sensitive method for predicting prognosis and making post-transplant treatment decisions for patients with ALL. Despite the broad clinical usefulness and standardization of this method, we and others have repeatedly reported the possibility of false-positive MRD results caused by massive B-lymphocyte regeneration after stem cell transplantation (SCT). Next-generation sequencing (NGS) enables precise and sensitive detection of multiple Ag receptor rearrangements, thus providing a more specific readout compared to qPCR. We investigated two cohorts of children with ALL who underwent SCT (30 patients and 228 samples). The first cohort consisted of 17 patients who remained in long-term CR after SCT despite having low MRD positivity (SCT monitoring using qPCR. Only one of 27 qPCR-positive samples was confirmed to be positive by NGS. Conversely, 10 of 15 samples with low qPCR-detected MRD positivity from 13 patients who subsequently relapsed were also confirmed to be positive by NGS (P=0.002). These data show that NGS has a better specificity in post-SCT ALL management and indicate that treatment interventions aimed at reverting impending relapse should not be based on qPCR only.
Bonelli, Francesca; Fratini, F; Turchi, B; Cantile, C; Ebani, V V; Colombani, G; Galiero, A; Sgorbini, M
2017-10-01
Johne's disease (JD) is an economically important infectious disease of ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP). This study evaluated the differences in various hematological and biochemical parameters between healthy goats and goats with JD. Forty goats were chosen randomly from a herd endemic for JD. A complete physical examination was performed. Blood and fresh fecal samples were collected from each goat. A complete blood cell (CBC) count and a protein electrophoresis were performed. Polymerase chain reaction (PCR) on fecal samples was performed in order to divide goats into two groups: group A "positive PCR on feces"; and group B "control (negative)." A Student's t test was performed for each parameter to verify differences between groups A vs B. Twenty goats were included in each group. Clinical signs likely related to JD were found in the history of 4/40 (10%) goats, while 36/40 (90%) goats were reported to be asymptomatic. CBC and electrophoresis values were within reference intervals in both groups. No differences were found for CBC parameters between the two groups. Values for alpha 1, beta, gamma globulins, and total protein (TP) were statistically higher in group A vs those in group B, while those for albumin and albumin/globulin (A/G) ratio were lower. An increase in TP, hypoalbuminemia, and hypergammaglobulinemia has been reported in group A, while no abnormalities were found concerning CBC. JD-positive goats seem to show earlier clinical pathological alternations than clinical signs. Protein electrophoresis may help the diagnosis of JD in asymptomatic goat herds, acting as an economical screening method.
Kumari, Sunita; Verma, Rajesh Kumar; Singh, Dharmendra Prasad; Yadav, Ramakant
2016-04-01
The cases of cryptococcal meningitis and other forms of cryptococcosis have increased in recent time and the present scenario of the condition with significant morbidity and mortality is actually posing a serious threat to the community, so an early and prompt diagnosis is necessary to prevent serious complications and thus improving the overall disease outcome. Comparison of diagnostic efficacy of nested Polymerase Chain Reaction (PCR) with Latex Agglutination Test (LAT) in the Cerebro Spinal Fluid (CSF) samples of the cases of meningitis in HIV positive and negative cases. We have compared the diagnostic efficacy of Latex Agglutination Test (LAT) with nested Polymerase Chain Reaction (PCR) in 200 Cerebrospinal Fluid (CSF) samples, including 14 HIV positive also, in the cases of suspected cryptococcal meningitis. Nested PCR was done in all cases reporting positive by LAT and results were then compared with that of India ink and culture on Sabouraud Dextrose Agar (SDA), and the isolates were further identified by urease, nitrate and sugar assimilation tests. Of the 200 cases, including 14 HIV positive, LAT was positive in 46 cases while 154 were negative. Out of these 46 LAT positive cases, nested PCR was positive in 40 cases only, while culture and India ink was positive in 38 and 33 cases respectively. Majority of the cases, 30 (65.2%) were between age group 21-50 years, while 2 (4.3%) in 0-20, and 14 (30.4%) in 51-80 years age group. Although negative staining like India ink and nigrosin are most widely used techniques, but these suffer with subjective error. Rapid method like LAT is available but it always has the scope of false positive and negative results. In such cases nested PCR can help in establishing final diagnosis.
Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh
2015-01-01
Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100
Result Variation and Efficiency Kinetics in Real-Time PCR
Directory of Open Access Journals (Sweden)
Reza Shahsiah
2010-10-01
Full Text Available Fluorescent monitoring of DNA amplification is the basis of real-time PCR. Absolute quantification can be achieved using a standard curve method. The standard curve is constructed by amplifying known amounts of standards under identical conditions to that of the samples.The objective of the current study is to propose a mathematical model to assess the acceptability of PCR resulys.Four commercial standards for HCV-RNA (hepatitis C virus RNA along with 6 patient samples were measured by real-time PCR, using two different RT-PCR reagents. The standard deviation of regression (Sy,x was calculated for each group of standard and compared by F-Test. The efficiency kinetics was computed by logistic regression, c2 goodness of fit test was preformed to assess the appropriateness of the efficiency curves.Calculated efficiencies were not significantly different from the value predicted by logistic regression model. Reactions with more variation showed less stable efficiency curves, with wider range of amplification efficiencies.Amplification efficiency kinetics can be computed by fitting a logistic regression curve to the gathered fluorescent data of each reaction. This model can be employed to assess the acceptability of PCR results calculated by standard curve method.
Potential for false positive HIV test results with the serial rapid HIV testing algorithm
Directory of Open Access Journals (Sweden)
Baveewo Steven
2012-03-01
Full Text Available Abstract Background Rapid HIV tests provide same-day results and are widely used in HIV testing programs in areas with limited personnel and laboratory infrastructure. The Uganda Ministry of Health currently recommends the serial rapid testing algorithm with Determine, STAT-PAK, and Uni-Gold for diagnosis of HIV infection. Using this algorithm, individuals who test positive on Determine, negative to STAT-PAK and positive to Uni-Gold are reported as HIV positive. We conducted further testing on this subgroup of samples using qualitative DNA PCR to assess the potential for false positive tests in this situation. Results Of the 3388 individuals who were tested, 984 were HIV positive on two consecutive tests, and 29 were considered positive by a tiebreaker (positive on Determine, negative on STAT-PAK, and positive on Uni-Gold. However, when the 29 samples were further tested using qualitative DNA PCR, 14 (48.2% were HIV negative. Conclusion Although this study was not primarily designed to assess the validity of rapid HIV tests and thus only a subset of the samples were retested, the findings show a potential for false positive HIV results in the subset of individuals who test positive when a tiebreaker test is used in serial testing. These findings highlight a need for confirmatory testing for this category of individuals.
Potential for false positive HIV test results with the serial rapid HIV testing algorithm.
Baveewo, Steven; Kamya, Moses R; Mayanja-Kizza, Harriet; Fatch, Robin; Bangsberg, David R; Coates, Thomas; Hahn, Judith A; Wanyenze, Rhoda K
2012-03-19
Rapid HIV tests provide same-day results and are widely used in HIV testing programs in areas with limited personnel and laboratory infrastructure. The Uganda Ministry of Health currently recommends the serial rapid testing algorithm with Determine, STAT-PAK, and Uni-Gold for diagnosis of HIV infection. Using this algorithm, individuals who test positive on Determine, negative to STAT-PAK and positive to Uni-Gold are reported as HIV positive. We conducted further testing on this subgroup of samples using qualitative DNA PCR to assess the potential for false positive tests in this situation. Of the 3388 individuals who were tested, 984 were HIV positive on two consecutive tests, and 29 were considered positive by a tiebreaker (positive on Determine, negative on STAT-PAK, and positive on Uni-Gold). However, when the 29 samples were further tested using qualitative DNA PCR, 14 (48.2%) were HIV negative. Although this study was not primarily designed to assess the validity of rapid HIV tests and thus only a subset of the samples were retested, the findings show a potential for false positive HIV results in the subset of individuals who test positive when a tiebreaker test is used in serial testing. These findings highlight a need for confirmatory testing for this category of individuals.
Clinical Assessment of a Nocardia PCR-Based Assay for Diagnosis of Nocardiosis.
Rouzaud, Claire; Rodriguez-Nava, Véronica; Catherinot, Emilie; Méchaï, Frédéric; Bergeron, Emmanuelle; Farfour, Eric; Scemla, Anne; Poirée, Sylvain; Delavaud, Christophe; Mathieu, Daniel; Durupt, Stéphane; Larosa, Fabrice; Lengelé, Jean-Philippe; Christophe, Jean-Louis; Suarez, Felipe; Lortholary, Olivier; Lebeaux, David
2018-06-01
The diagnosis of nocardiosis, a severe opportunistic infection, is challenging. We assessed the specificity and sensitivity of a 16S rRNA Nocardia PCR-based assay performed on clinical samples. In this multicenter study (January 2014 to April 2015), patients who were admitted to three hospitals and had an underlying condition favoring nocardiosis, clinical and radiological signs consistent with nocardiosis, and a Nocardia PCR assay result for a clinical sample were included. Patients were classified as negative control (NC) (negative Nocardia culture results and proven alternative diagnosis or improvement at 6 months without anti- Nocardia treatment), positive control (PC) (positive Nocardia culture results), or probable nocardiosis (positive Nocardia PCR results, negative Nocardia culture results, and no alternative diagnosis). Sixty-eight patients were included; 47 were classified as NC, 8 as PC, and 13 as probable nocardiosis. PCR results were negative for 35/47 NC patients (74%). For the 12 NC patients with positive PCR results, the PCR assay had been performed with respiratory samples. These NC patients had chronic bronchopulmonary disease more frequently than did the NC patients with negative PCR results (8/12 patients [67%] versus 11/35 patients [31%]; P = 0.044). PCR results were positive for 7/8 PC patients (88%). There were 13 cases of probable nocardiosis, diagnosed solely using the PCR results; 9 of those patients (69%) had lung involvement (consolidation or nodule). Nocardia PCR testing had a specificity of 74% and a sensitivity of 88% for the diagnosis of nocardiosis. Nocardia PCR testing may be helpful for the diagnosis of nocardiosis in immunocompromised patients but interpretation of PCR results from respiratory samples is difficult, because the PCR assay may also detect colonization. Copyright © 2018 American Society for Microbiology.
Directory of Open Access Journals (Sweden)
Rodrigo Staggemeier
2014-04-01
Full Text Available A novel SYBR® green-real time polymerase chain reaction (qPCR was developed to detect two Bartonella species, B. henselae and B. clarridgeiae, directly from blood samples. The test was used in blood samples obtained from cats living in animal shelters in Southern Brazil. Results were compared with those obtained by conventional PCR targeting Bartonella spp. Among the 47 samples analyzed, eight were positive using the conventional PCR and 12 were positive using qPCR. Importantly, the new qPCR detected the presence of both B. henselae and B. clarridgeiae in two samples. The results show that the qPCR described here may be a reliable tool for the screening and differentiation of two important Bartonella species.
Directory of Open Access Journals (Sweden)
Markus Spiliotis
Full Text Available Inverse fusion PCR cloning (IFPC is an easy, PCR based three-step cloning method that allows the seamless and directional insertion of PCR products into virtually all plasmids, this with a free choice of the insertion site. The PCR-derived inserts contain a vector-complementary 5'-end that allows a fusion with the vector by an overlap extension PCR, and the resulting amplified insert-vector fusions are then circularized by ligation prior transformation. A minimal amount of starting material is needed and experimental steps are reduced. Untreated circular plasmid, or alternatively bacteria containing the plasmid, can be used as templates for the insertion, and clean-up of the insert fragment is not urgently required. The whole cloning procedure can be performed within a minimal hands-on time and results in the generation of hundreds to ten-thousands of positive colonies, with a minimal background.
Directory of Open Access Journals (Sweden)
Lingxiang Zhu
Full Text Available Bacterial strains resistant to various antibiotic drugs are frequently encountered in clinical infections, and the rapid identification of drug-resistant strains is highly essential for clinical treatment. We developed a locked nucleic acid (LNA-based quantitative real-time PCR (LNA-qPCR method for the rapid detection of 13 antibiotic resistance genes and successfully used it to distinguish drug-resistant bacterial strains from positive blood culture samples. A sequence-specific primer-probe set was designed, and the specificity of the assays was assessed using 27 ATCC bacterial strains and 77 negative blood culture samples. No cross-reaction was identified among bacterial strains and in negative samples, indicating 100% specificity. The sensitivity of the assays was determined by spiking each bacterial strain into negative blood samples, and the detection limit was 1-10 colony forming units (CFU per reaction. The LNA-qPCR assays were first applied to 72 clinical bacterial isolates for the identification of known drug resistance genes, and the results were verified by the direct sequencing of PCR products. Finally, the LNA-qPCR assays were used for the detection in 47 positive blood culture samples, 19 of which (40.4% were positive for antibiotic resistance genes, showing 91.5% consistency with phenotypic susceptibility results. In conclusion, LNA-qPCR is a reliable method for the rapid detection of bacterial antibiotic resistance genes and can be used as a supplement to phenotypic susceptibility testing for the early detection of antimicrobial resistance to allow the selection of appropriate antimicrobial treatment and to prevent the spread of resistant isolates.
de Morais, Rayana Carla Silva; Gonçalves, Suênia da Cunha; Costa, Pietra Lemos; da Silva, Kamila Gaudêncio; da Silva, Fernando José; Silva, Rômulo Pessoa E; de Brito, Maria Edileuza Felinto; Brandão-Filho, Sinval Pinto; Dantas-Torres, Filipe; de Paiva-Cavalcanti, Milena
2013-04-01
Visceral leishmaniosis (VL) is a parasitic disease caused by Leishmania infantum, which is primarily transmitted by phlebotomine sandflies. However, there has been much speculation on the role of other arthropods in the transmission of VL. Thus, the aim of this study was to assess the presence of L. infantum in cats, dogs and their ectoparasites in a VL-endemic area in northeastern Brazil. DNA was extracted from blood samples and ectoparasites, tested by conventional PCR (cPCR) and quantitative real time PCR (qPCR) targeting the L. infantum kinetoplast DNA. A total of 280 blood samples (from five cats and 275 dogs) and 117 ectoparasites from dogs were collected. Animals were apparently healthy and not previously tested by serological or molecular diagnostic methods. Overall, 213 (76.1 %) animals and 51 (43.6 %) ectoparasites were positive to L. infantum, with mean parasite loads of 795.2, 31.9 and 9.1 fg in dogs, cats and ectoparasites, respectively. Concerning the positivity between dogs and their ectoparasites, 32 (15.3 %) positive dogs were parasitized by positive ectoparasites. The overall concordance between the PCR protocols used was 59.2 %, with qPCR being more efficient than cPCR; 34.1 % of all positive samples were exclusively positive by qPCR. The high number of positive animals and ectoparasites also indicates that they could serve as sentinels or indicators of the circulation of L. infantum in risk areas.
DEFF Research Database (Denmark)
Mahmmod, Yasser; Mweu, Marshal Mutinda; Nielsen, Søren Saxmose
2014-01-01
with Streptococcus agalactiae (S. agalactiae) in dairy herds with conventional milking parlours. Misclassification may result in unnecessary costs for treatment and culling. The objectives of this study were to (1) determine the effect of carryover on PCR-positivity for S. agalactiae at different PCR cycle threshold...... (Ct) cut-offs by estimating the between-cow correlation while accounting for the milking order, and (2) evaluate the effect of aseptic presampling procedures (PSP) on PCR-positivity at the different Ct-value cut-offs. The study was conducted in four herds with conventional milking parlours at routine...
Evaluation of PCR for diagnosis of visceral leishmaniasis
Osman, O. F.; Oskam, L.; Zijlstra, E. E.; Kroon, N. C.; Schoone, G. J.; Khalil, E. T.; El-Hassan, A. M.; Kager, P. A.
1997-01-01
An evaluation of Leishmania PCR was performed with bone marrow, lymph node, and blood samples from 492 patients, 60 positive controls, and 90 negative controls. Results were compared with microscopy results for Giemsa-stained smears. PCR and microscopy of lymph node and bone marrow aspirates from
Directory of Open Access Journals (Sweden)
Natanael Lamas Dias
2012-08-01
cases. The qPCR presented high specificity and sensitivity values. The observed qPCR negative and positive predictive values show that the qPCR has a high capacity to correctly classify positive and negative results. The qPCR was not able to detect three positive animals and has a lightly higher cost than the nPCR. However, the qPCR its faster, less prone to contamination, has a high sensitivity and does not use or generate carcinogenic residues. We conclude that the qPCR may be used to replace the OIE nPCR technique in routine diagnosis in areas where EBL is endemic, as is the case of Brazil.
Falchieri, Marco; Brown, Paul A; Catelli, Elena; Naylor, Clive J
2012-12-01
Using reverse genetics, an avian metapneumovirus (AMPV) was modified for use as a positive control for validating all stages of a popular established RT-nested PCR, used in the detection of the two major AMPV subtypes (A and B). Resultant amplicons were of increased size and clearly distinguishable from those arising from unmodified virus, thus allowing false positive bands, due to control virus contamination of test samples, to be identified readily. Absorption of the control virus onto filter paper and subsequent microwave irradiation removed all infectivity while its function as an efficient RT-nested-PCR template was unaffected. Identical amplicons were produced after storage for one year. The modified virus is likely to have application as an internal standard as well as in real time methods. Additions to AMPV of RNA from other RNA viruses, including hazardous examples such HIV and influenza, are likely to yield similar safe RT-PCR controls. Copyright © 2012 Elsevier B.V. All rights reserved.
Viability qPCR, a new tool for Legionella risk management.
Lizana, X; López, A; Benito, S; Agustí, G; Ríos, M; Piqué, N; Marqués, A M; Codony, F
2017-11-01
Viability quantitative Polymerase Chain Reaction (v-qPCR) is a recent analytical approach for only detecting live microorganisms by DNA amplification-based methods This approach is based on the use of a reagent that irreversibly fixes dead cells DNA. In this study, we evaluate the utility of v-qPCR versus culture method for Legionellosis risk management. The present study was performed using 116 real samples. Water samples were simultaneously analysed by culture, v-qPCR and qPCR methods. Results were compared by means of a non-parametric test. In 11.6% of samples using both methods (culture method and v-qPCR) results were positive, in 50.0% of samples both methods gave rise to negative results. As expected, equivalence between methods was not observed in all cases, as in 32.1% of samples positive results were obtained by v-qPCR and all of them gave rise to negative results by culture. Only in 6.3% of samples, with very low Legionella levels, was culture positive and v-qPCR negative. In 3.5% of samples, overgrowth of other bacteria did not allow performing the culture. When comparing both methods, significant differences between culture and v-qPCR were in the samples belonging to the cooling towers-evaporative condensers group. The v-qPCR method detected greater presence and obtained higher concentrations of Legionella spp. (p<0.001). Otherwise, no significant differences between methods were found in the rest of the groups. The v-qPCR method can be used as a quick tool to evaluate Legionellosis risk, especially in cooling towers-evaporative condensers, where this technique can detect higher levels than culture. The combined interpretation of PCR results along with the ratio of live cells is proposed as a tool for understanding the sample context and estimating the Legionellosis risk potential according to 4 levels of hierarchy. Copyright © 2017 Elsevier GmbH. All rights reserved.
Accurate quantification of supercoiled DNA by digital PCR
Dong, Lianhua; Yoo, Hee-Bong; Wang, Jing; Park, Sang-Ryoul
2016-01-01
Digital PCR (dPCR) as an enumeration-based quantification method is capable of quantifying the DNA copy number without the help of standards. However, it can generate false results when the PCR conditions are not optimized. A recent international comparison (CCQM P154) showed that most laboratories significantly underestimated the concentration of supercoiled plasmid DNA by dPCR. Mostly, supercoiled DNAs are linearized before dPCR to avoid such underestimations. The present study was conducted to overcome this problem. In the bilateral comparison, the National Institute of Metrology, China (NIM) optimized and applied dPCR for supercoiled DNA determination, whereas Korea Research Institute of Standards and Science (KRISS) prepared the unknown samples and quantified them by flow cytometry. In this study, several factors like selection of the PCR master mix, the fluorescent label, and the position of the primers were evaluated for quantifying supercoiled DNA by dPCR. This work confirmed that a 16S PCR master mix avoided poor amplification of the supercoiled DNA, whereas HEX labels on dPCR probe resulted in robust amplification curves. Optimizing the dPCR assay based on these two observations resulted in accurate quantification of supercoiled DNA without preanalytical linearization. This result was validated in close agreement (101~113%) with the result from flow cytometry. PMID:27063649
International Nuclear Information System (INIS)
Maria Lina R; Andi Yasmon
2011-01-01
There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)
Multiplex PCR-based assay for detection of Bordetella pertussis in nasopharyngeal swab specimens.
Wadowsky, R M; Michaels, R H; Libert, T; Kingsley, L A; Ehrlich, G D
1996-11-01
A multiplex PCR-based assay was developed for the detection of Bordetella pertussis in nasopharyngeal swab specimens. The assay simultaneously amplified two separate DNA targets (153 and 203 bp) within a B. pertussis repetitive element and a 438-bp target within the beta-actin gene of human DNA (PCR amplification control). PCR products were detected by a sensitive and specific liquid hybridization gel retardation assay. A total of 496 paired nasopharyngeal swab specimens were tested by both the PCR-based assay and culture. Although 30 (6%) of the specimens inhibited the amplification of the beta-actin target, in all 29 specimens studied, the inhibition disappeared on repeat testing or was easily overcome with a 1:8 dilution or less of specimen digest. Of the 495 specimen pairs yielding a final evaluable result by the PCR-based assay, 19.0% were positive by the PCR-based assay, whereas 13.9% were positive by culture (P < 0.0001). After resolving the PCR-positive, culture-negative results by testing an additional aliquot from these specimens by the multiplex PCR-based assay, the PCR-based assay had a sensitivity and specificity of 98.9 and 99.7%, respectively, compared with values of 73.4 and 100%, respectively, for culture. In comparison with patients with culture-confirmed pertussis, those with PCR-positive, culture-negative results were older and more likely to have had prolonged cough, immunization with pertussis vaccine, or treatment with erythromycin. This multiplex PCR-based assay is substantially more sensitive than culture and identifies specimens that contain inhibitors of PCR.
Pneumocystis PCR: It Is Time to Make PCR the Test of Choice.
Doyle, Laura; Vogel, Sherilynn; Procop, Gary W
2017-01-01
The testing strategy for Pneumocystis at the Cleveland Clinic changed from toluidine blue staining to polymerase chain reaction (PCR). We studied the differences in positivity rates for these assays and compared each with the detection of Pneumocystis in companion specimens by cytology and surgical pathology. We reviewed the results of all Pneumocystis test orders 1 year before and 1 year after the implementation of a Pneumocystis -specific PCR. We also reviewed the corresponding cytology and surgical pathology results, if performed. Finally, we reviewed the medical records of patients with rare Pneumocystis detected by PCR in an effort to differentiate colonization vs true disease. Toluidine blue staining and surgical pathology had similar sensitivities and negative predictive values, both of which were superior to cytology. There was a >4-fold increase in the annual detection of Pneumocystis by PCR compared with toluidine blue staining (toluidine blue staining: 11/1583 [0.69%] vs PCR: 44/1457 [3.0%]; chi-square P < .001). PCR detected 1 more case than surgical pathology and was far more sensitive than cytology. Chart review demonstrated that the vast majority of patients with rare Pneumocystis detected were immunosuppressed, had radiologic findings supportive of this infection, had no other pathogens detected, and were treated for pneumocystosis by the clinical team. PCR was the most sensitive method for the detection of Pneumocystis and should be considered the diagnostic test of choice. Correlation with clinical and radiologic findings affords discrimination of early true disease from the far rarer instances of colonization.
Utility of PCR, Culture, and Antigen Detection Methods for Diagnosis of Legionellosis.
Chen, Derrick J; Procop, Gary W; Vogel, Sherilynn; Yen-Lieberman, Belinda; Richter, Sandra S
2015-11-01
The goal of this retrospective study was to evaluate the performance of different diagnostic tests for Legionnaires' disease in a clinical setting where Legionella pneumophila PCR had been introduced. Electronic medical records at the Cleveland Clinic were searched for Legionella urinary antigen (UAG), culture, and PCR tests ordered from March 2010 through December 2013. For cases where two or more test methods were performed and at least one was positive, the medical record was reviewed for relevant clinical and epidemiologic factors. Excluding repeat testing on a given patient, 19,912 tests were ordered (12,569 UAG, 3,747 cultures, and 3,596 PCR) with 378 positive results. The positivity rate for each method was 0.4% for culture, 0.8% for PCR, and 2.7% for UAG. For 37 patients, at least two test methods were performed with at least one positive result: 10 (27%) cases were positive by all three methods, 16 (43%) were positive by two methods, and 11 (30%) were positive by one method only. For the 32 patients with medical records available, clinical presentation was consistent with proven or probable Legionella infection in 84% of the cases. For those cases, the sensitivities of culture, PCR, and UAG were 50%, 92%, and 96%, respectively. The specificities were 100% for culture and 99.9% for PCR and UAG. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan
2016-02-01
Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Zapparoli, Giada V; Jorissen, Robert N; Hewitt, Chelsee A; McBean, Michelle; Westerman, David A; Dobrovic, Alexander
2013-01-01
The JAK2 V617F mutation is the most frequent somatic change in myeloproliferative neoplasms, making it an important tumour-specific marker for diagnostic purposes and for the detection of minimal residual disease. Sensitive quantitative assays are required for both applications, particularly for the monitoring of minimal residual disease, which requires not only high sensitivity but also very high specificity. We developed a highly sensitive probe-free quantitative mutant-allele detection method, Quantitative Threefold Allele-Specific PCR (QuanTAS-PCR), that is performed in a closed-tube system, thus eliminating the manipulation of PCR products. QuantTAS-PCR uses a threefold approach to ensure allele-specific amplification of the mutant sequence: (i) a mutant allele-specific primer, (ii) a 3′dideoxy blocker to suppress false-positive amplification from the wild-type template and (iii) a PCR specificity enhancer, also to suppress false-positive amplification from the wild-type template. Mutant alleles were quantified relative to exon 9 of JAK2. We showed that the addition of the 3′dideoxy blocker suppressed but did not eliminate false-positive amplification from the wild-type template. However, the addition of the PCR specificity enhancer near eliminated false-positive amplification from the wild-type allele. Further discrimination between true and false positives was enabled by using the quantification cycle (Cq) value of a single mutant template as a cut-off point, thus enabling robust distinction between true and false positives. As 10,000 JAK2 templates were used per replicate, the assay had a sensitivity of 1/10 -4 per replicate. Greater sensitivity could be reached by increasing the number of replicates analysed. Variation in replicates when low mutant-allele templates were present necessitated the use of a statistics-based approach to estimate the load of mutant JAK2 copies. QuanTAS-PCR showed comparable quantitative results when validated against a
Correlation of HBV DNA PCR and HBeAg in hepatitis carriers
International Nuclear Information System (INIS)
Hussain, A.B.; Karamat, K.A.; Kazmi, S.Y.; Anwar, M.; Tariq, W.Z.
2004-01-01
Objective: To correlate hepatitis B HBV DNA polymerase chain reaction (PCR) results with HBeAg and serum ala- nine transferase (ALT) in carriers. Materials and Methods: Fifty hepatitis B carriers, with known HBsAg positive serostatus, raised serum ALT and detectable HBV DNA, were selected out of the patients reporting at AFIP for their blood test for HBV DNA. HBV DNA testing in these cases was carried out using PCR kit of Accugen-USA. After confirmation of their carrier status and raised serum ALT levels, the sera were tested for HBeAg and results of HBeAg testing were correlated with those of HBV DNA testing. Results: Out of the total 50 HBV DNA PCR positive hepatitis B carriers, 48 samples were positive for HBeAg. All the 50 HBV DNA positive cases had raised serum ALT levels. Conclusion: In case of non-availability of facility for HBV PCR, detectable HBeAg should be taken as a surrogate marker for HBV DNA in hepatitis B carriers with raised serum ALT. (author)
Patel, Divya A.; Shih, Yang-Jen; Newton, Duane W.; Michael, Claire W.; Oeth, Paul A.; Kane, Michael D.; Opipari, Anthony W.; Ruffin, Mack T.; Kalikin, Linda M.; Kurnit, David M.
2010-01-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay. PMID:19410602
Patel, Divya A; Shih, Yang-Jen; Newton, Duane W; Michael, Claire W; Oeth, Paul A; Kane, Michael D; Opipari, Anthony W; Ruffin, Mack T; Kalikin, Linda M; Kurnit, David M
2009-09-01
Knowledge of the central role of high-risk human papillomavirus (HPV) in cervical carcinogenesis, coupled with an emerging need to monitor the efficacy of newly introduced HPV vaccines, warrant development and evaluation of type-specific, quantitative HPV detection methods. In the present study, a prototype PCR and mass spectroscopy (PCR-MS)-based method to detect and quantitate 13 high-risk HPV types is compared to the Hybrid Capture 2 High-Risk HPV DNA test (HC2; Digene Corp., Gaithersburg, MD) in 199 cervical scraping samples and to DNA sequencing in 77 cervical tumor samples. High-risk HPV types were detected in 76/77 (98.7%) cervical tumor samples by PCR-MS. Degenerate and type-specific sequencing confirmed the types detected by PCR-MS. In 199 cervical scraping samples, all 13 HPV types were detected by PCR-MS. Eighteen (14.5%) of 124 cervical scraping samples that were positive for high-risk HPV by HC2 were negative by PCR-MS. In all these cases, degenerate DNA sequencing failed to detect any of the 13 high-risk HPV types. Nearly half (46.7%) of the 75 cervical scraping samples that were negative for high-risk HPV by the HC2 assay were positive by PCR-MS. Type-specific sequencing in a subset of these samples confirmed the HPV type detected by PCR-MS. Quantitative PCR-MS results demonstrated that 11/75 (14.7%) samples contained as much HPV copies/cell as HC2-positive samples. These findings suggest that this prototype PCR-MS assay performs at least as well as HC2 for HPV detection, while offering the additional, unique advantages of type-specific identification and quantitation. Further validation work is underway to define clinically meaningful HPV detection thresholds and to evaluate the potential clinical application of future generations of the PCR-MS assay.
Directory of Open Access Journals (Sweden)
Siwon Lee
2013-09-01
Full Text Available For quarantine purpose, we developed the RT- and nested PCR module of Tomato black ring virus (TBRV, Arabis mosaic virus (ArMV, Cherry leafroll virus (CLRV and Grapevine fanleaf virus (GFLV. The PCR modules, developed in this study make diagnosis more convenient and speedy because of same PCR condition. And also, the methods are more accurate because it can check whether the result is contamination or not using the mutation-positive control. We discard or return the 27 cases of Nepovirus infection seed by employing the module past 3 years. This study provides a rapid and useful method for detection of four quarantine plant viruses.
Energy Technology Data Exchange (ETDEWEB)
Pilatti, Marcia M.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)], e-mail: marciapilatti@yahoo.com.br, e-mail: antero@cdtn.br; Ferreira, Sidney A. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com
2009-07-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with {sup 32}P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
International Nuclear Information System (INIS)
Pilatti, Marcia M.; Andrade, Antero S.R.; Ferreira, Sidney A.
2009-01-01
The sensitivity of the kDNA PCR-Hybridization assay, which uses radioactive DNA probes (labeled with 32 P), was compared with three conventional PCR methods used for canine visceral leishmaniasis diagnosis. All PCR methods had two steps: a first amplification followed by hybridization or by a new amplification (nested or semi nested). Two methods (kDNA PCR-Hybridization and kDNA snPCR) used primers addressed to kinetoplast minicircles and the other two methods to the coding (LnPCR) and intergenic noncoding regions (ITS-1 nPCR) of the ribosomal rRNA genes. The comparison was accomplished in two groups of 23 infected dogs using samples collected by the conjunctival swab procedure. In the Group 1 the DNA was extracted from cotton swabs by phenol-chloroform and in Group 2 by boiling. The most efficient PCR methods in the Group 1 were those based on kDNA targets. The kDNA PCR-Hybridization was able to detect parasites in 22/23 dogs (95.6%) and in 40/46 samples (86.9%). The kDNA snPCR was positive for 21/23 dogs (91.3%) and for 40/46 samples (86.9%). The positivities of the kDNA based methods were significantly higher than the positivities verified for the methods based on ribosomal rRNA genes (p<0.05). In the Group 2 the kDNA PCR- Hybridization showed a better performance detecting parasites in 18/23 dogs (78.3%) and in 31/46 samples (67.4%), significantly higher than the other three methods (p<0.05). The higher sensitivity of the minicircle kDNA based assays reported by others was confirmed in this study and kDNA PCR-Hybridization showed the best sensitivity among the assays evaluated. (author)
Species-specific nested PCR as a diagnostic tool for Brucella ovis infection in rams
Directory of Open Access Journals (Sweden)
L.F. Costa
2013-02-01
Full Text Available The aim of the present study was to evaluate a species-specific nested PCR based on a previously described species-specific PCR for detection of B. ovis in semen and urine samples of experimentally infected rams. The performance of the species-specific nested PCR was compared with the results of a genus-specific PCR. Fourteen rams were experimentally infected with the Brucella ovis REO 198 strain and samples of semen and urine were collected every week up to 180 days post infection. Out of 83 semen samples collected, 42 (50.6% were positive for the species-specific nested PCR, and 23 (27.7% were positive for the genus-specific PCR. Out of 75 urine samples, 49 (65.3% were positive for the species-specific nested PCR, whereas 11 (14.6% were genus-specific PCR positive. Species-specific nested PCR was significantly more sensitive (P<0.001 than the genus-specific PCR in semen and urine from experimentally infected rams. In conclusion, the species-specific nested PCR developed in this study may be used as a diagnostic tool for the detection of B. ovis in semen and urine samples from suspected rams.
Galactomannan and Real-Time PCR in the diagnosis of invasive Aspergillosis: preliminary data
Directory of Open Access Journals (Sweden)
Cristina Pedrotti
2014-03-01
Full Text Available The diagnosis of invasive aspergillosis is notoriously difficult. The standard culture-based methods have shown considerable limitations in performance. For this reason, non-culture methods have been increasingly employed for the diagnosis of invasive aspergillosis, and, among them, the methods based on Real-Time polymerase chain reaction (RT-PCR. In this study we assess the contribution in lowering diagnosis errors provided by the RT-PCR method when run alongside other methods. We analyzed 23 biological samples, 14 serum samples, and 9 bronchoalveolar lavage samples (BAL from 10 immunocompromised patients who were selected according to EORTC/MSG criteria (European Organization for Research and Treatment of Cancer/Mycoses Study Group. On the serum sample we searched the galactomannan (GM (Platelia Aspergillus® and the fungal genome (MycAssayTMAspergillus; the BAL samples were subjected also to the culture tests. In 11 serum samples the results showed concordance between GM and RT–PCR tests, while in 3 samples we report discordance: 2 results were GM positive and RT-PCR negative, and 1 results GM negative and RT-PCR indeterminate. In 5 BAL samples the results showed concordance between the two methods, while 4 were GM positive and RT-PCR negative. The data, although still preliminary, suggest an increased accuracy in the diagnosis of suspected invasive aspergillosis when employing both RT-PCR and GM tests given that the RT-PCR test eliminates the false positive results of the GM test. The PCR methods require, however, further applications of this type of diagnostic because of the severe limit given by the lack of standardization.
Directory of Open Access Journals (Sweden)
Delogu Mauro
2006-05-01
Full Text Available Abstract Background Avian influenza viruses (AIVs are endemic in wild birds and their introduction and conversion to highly pathogenic avian influenza virus in domestic poultry is a cause of serious economic losses as well as a risk for potential transmission to humans. The ability to rapidly recognise AIVs in biological specimens is critical for limiting further spread of the disease in poultry. The advent of molecular methods such as real time polymerase chain reaction has allowed improvement of detection methods currently used in laboratories, although not all of these methods include an Internal Positive Control (IPC to monitor for false negative results. Therefore we developed a one-step reverse transcription real time PCR (RRT-PCR with a Minor Groove Binder (MGB probe for the detection of different subtypes of AIVs. This technique also includes an IPC. Methods RRT-PCR was developed using an improved TaqMan technology with a MGB probe to detect AI from reference viruses. Primers and probe were designed based on the matrix gene sequences from most animal and human A influenza virus subtypes. The specificity of RRT-PCR was assessed by detecting influenza A virus isolates belonging to subtypes from H1–H13 isolated in avian, human, swine and equine hosts. The analytical sensitivity of the RRT-PCR assay was determined using serial dilutions of in vitro transcribed matrix gene RNA. The use of a rodent RNA as an IPC in order not to reduce the efficiency of the assay was adopted. Results The RRT-PCR assay is capable to detect all tested influenza A viruses. The detection limit of the assay was shown to be between 5 and 50 RNA copies per reaction and the standard curve demonstrated a linear range from 5 to 5 × 108 copies as well as excellent reproducibility. The analytical sensitivity of the assay is 10–100 times higher than conventional RT-PCR. Conclusion The high sensitivity, rapidity, reproducibility and specificity of the AIV RRT-PCR with
Jacobson, Linda S; McIntyre, Lauren; Mykusz, Jenny
2018-02-01
Objectives Real-time PCR provides quantitative information, recorded as the cycle threshold (Ct) value, about the number of organisms detected in a diagnostic sample. The Ct value correlates with the number of copies of the target organism in an inversely proportional and exponential relationship. The aim of the study was to determine whether Ct values could be used to distinguish between culture-positive and culture-negative samples. Methods This was a retrospective analysis of Ct values from dermatophyte PCR results in cats with suspicious skin lesions or suspected exposure to dermatophytosis. Results One hundred and thirty-two samples were included. Using culture as the gold standard, 28 were true positives, 12 were false positives and 92 were true negatives. The area under the curve for the pretreatment time point was 96.8% (95% confidence interval [CI] 94.2-99.5) compared with 74.3% (95% CI 52.6-96.0) for pooled data during treatment. Before treatment, a Ct cut-off of value between culture-positive and culture-negative samples during treatment. Ct values prior to treatment differed significantly between the true-positive and false-positive groups ( P = 0.0056). There was a significant difference between the pretreatment and first and second negative culture time points ( P = 0.0002 and P values for true positives and true negatives, and for pre- and intra-treatment time points. Conclusions and relevance Ct values had limited usefulness for distinguishing between culture-positive and culture-negative cases when field study samples were analyzed. In addition, Ct values were less reliable than fungal culture for determining mycological cure.
Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein
2013-05-01
Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.
Fu, Wei; Zhu, Pengyu; Wei, Shuang; Zhixin, Du; Wang, Chenguang; Wu, Xiyang; Li, Feiwu; Zhu, Shuifang
2017-04-01
Among all of the high-throughput detection methods, PCR-based methodologies are regarded as the most cost-efficient and feasible methodologies compared with the next-generation sequencing or ChIP-based methods. However, the PCR-based methods can only achieve multiplex detection up to 15-plex due to limitations imposed by the multiplex primer interactions. The detection throughput cannot meet the demands of high-throughput detection, such as SNP or gene expression analysis. Therefore, in our study, we have developed a new high-throughput PCR-based detection method, multiplex enrichment quantitative PCR (ME-qPCR), which is a combination of qPCR and nested PCR. The GMO content detection results in our study showed that ME-qPCR could achieve high-throughput detection up to 26-plex. Compared to the original qPCR, the Ct values of ME-qPCR were lower for the same group, which showed that ME-qPCR sensitivity is higher than the original qPCR. The absolute limit of detection for ME-qPCR could achieve levels as low as a single copy of the plant genome. Moreover, the specificity results showed that no cross-amplification occurred for irrelevant GMO events. After evaluation of all of the parameters, a practical evaluation was performed with different foods. The more stable amplification results, compared to qPCR, showed that ME-qPCR was suitable for GMO detection in foods. In conclusion, ME-qPCR achieved sensitive, high-throughput GMO detection in complex substrates, such as crops or food samples. In the future, ME-qPCR-based GMO content identification may positively impact SNP analysis or multiplex gene expression of food or agricultural samples. Graphical abstract For the first-step amplification, four primers (A, B, C, and D) have been added into the reaction volume. In this manner, four kinds of amplicons have been generated. All of these four amplicons could be regarded as the target of second-step PCR. For the second-step amplification, three parallels have been taken for
Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear
Directory of Open Access Journals (Sweden)
Gholamreza HASSANPOUR
2016-12-01
Full Text Available Background: We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan-Plasmodium real-time PCR for accurate screening of individuals suspected of malaria.Methods: A single primer/probe set for pan-species Plasmodium-specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction.Results: The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum. All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR.Conclusion: By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.
Directory of Open Access Journals (Sweden)
Andi Yasmon
2010-11-01
Full Text Available Aim: Since culture method is time-consuming and has low sensitivity, we developed a duplex PCR (dPCR assay for the detection of Legionella sp. and L. pneumophila in cooling tower samples. We used culture method as a gold standard.Methods: Optimization of dPCR method was performed to obtain an assay with high sensitivity and specifi city. The optimized method was used to detect Legionella sp. dan L. pneumophila in 9 samples obtained from 9 buildings in Jakarta. For culture method, the bacteria were grown or isolated on selective growth factor supplemented-buffered charcoal yeast extract (BCYE media.Results: Of 9 samples tested by dPCR assay, 6 were positive for Legionella species,1 was positive for L. pneumophila, and 2 showed negative results. For the same samples, no Legionella sp. was detected by the culture method.Conclusion: dPCR assay was much more sensitive than the culture method and was potentially used as a rapid, specifi c and sensitive test for routine detection of Legionella sp. dan for L. pneumophila in water samples. (Med J Indones 2010; 19:223-7Keywords: BCYE media, mip gene, 16S-rRNA gene
Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.
Keane, O M; Budd, K E; Flynn, J; McCoy, F
2013-09-21
Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.
Directory of Open Access Journals (Sweden)
Giselle FMC Lima
2011-09-01
Full Text Available Malaria diagnoses has traditionally been made using thick blood smears, but more sensitive and faster techniques are required to process large numbers of samples in clinical and epidemiological studies and in blood donor screening. Here, we evaluated molecular and serological tools to build a screening platform for pooled samples aimed at reducing both the time and the cost of these diagnoses. Positive and negative samples were analysed in individual and pooled experiments using real-time polymerase chain reaction (PCR, nested PCR and an immunochromatographic test. For the individual tests, 46/49 samples were positive by real-time PCR, 46/49 were positive by nested PCR and 32/46 were positive by immunochromatographic test. For the assays performed using pooled samples, 13/15 samples were positive by real-time PCR and nested PCR and 11/15 were positive by immunochromatographic test. These molecular methods demonstrated sensitivity and specificity for both the individual and pooled samples. Due to the advantages of the real-time PCR, such as the fast processing and the closed system, this method should be indicated as the first choice for use in large-scale diagnosis and the nested PCR should be used for species differentiation. However, additional field isolates should be tested to confirm the results achieved using cultured parasites and the serological test should only be adopted as a complementary method for malaria diagnosis.
LENUS (Irish Health Repository)
Grogan, Juanita A
2011-06-01
Novel real-time PCR assays targeting the Bordetella pertussis insertion sequence IS481, the toxin promoter region and Bordetella parapertussis insertion sequence IS1001 were designed. PCR assays were capable of detecting ≤10 copies of target DNA per reaction, with an amplification efficiency of ≥90 %. From September 2003 to December 2009, per-nasal swabs and nasopharyngeal aspirates submitted for B. pertussis culture from patients ≤1 month to >15 years of age were examined by real-time PCR. Among 1324 patients, 76 (5.7 %) were B. pertussis culture positive and 145 (10.95 %) were B. pertussis PCR positive. Of the B. pertussis PCR-positive patients, 117 (81 %) were aged 6 months or less. A total of 1548 samples were examined, of which 87 (5.6 %) were culture positive for B. pertussis and 169 (10.92 %) were B. pertussis PCR positive. All culture-positive samples were PCR positive. Seven specimens (0.5 %) were B. parapertussis culture positive and 10 (0.8 %) were B. parapertussis PCR positive, with all culture-positive samples yielding PCR-positive results. A review of patient laboratory records showed that of the 1324 patients tested for pertussis 555 (42 %) had samples referred for respiratory syncytial virus (RSV) testing and 165 (30 %) were positive, as compared to 19.4 % of the total 5719 patients tested for RSV in this period. Analysis of the age distribution of RSV-positive patients identified that 129 (78 %) were aged 6 months or less, similar to the incidence observed for pertussis in that patient age group. In conclusion, the introduction of the real-time PCR assays for the routine detection of B. pertussis resulted in a 91 % increase in the detection of the organism as compared to microbiological culture. The incidence of infection with B. parapertussis is low while the incidence of RSV infection in infants suspected of having pertussis is high, with a similar age distribution to B. pertussis infection.
Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.
West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D
1995-01-01
A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625
Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.
Directory of Open Access Journals (Sweden)
Linda Hueston
Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.
Rigotto, C; Sincero, T C M; Simões, C M O; Barardi, C R M
2005-01-01
We tested three PCR based methodologies to detect adenoviruses associated with cultivated oysters. Conventional-PCR, nested-PCR, and integrated cell culture-PCR (ICC/PCR) were first optimized using oysters seeded with know amounts of Adenovirus serotype 5 (Ad5). The maximum sensitivity for Ad5 detection was determined for each method, and then used to detect natural adenovirus contamination in oysters from three aquiculture farms in Florianopolis, Santa Catarina State, Brazil, over a period of 6 months. The results showed that the nested-PCR was more sensitive (limit of detection: 1.2 PFU/g of tissue) than conventional-PCR and ICC-PCR (limit of detection for both: 1.2 x 10(2)PFU/g of tissue) for detection of Ad5 in oyster extracts. Nested-PCR was able to detect 90% of Ad5 contamination in harvested oyster samples, while conventional-PCR was unable to detect Ad5 in any of the samples. The present work suggests that detection of human adenoviruses can be used as a tool to monitor the presence of human viruses in marine environments where shellfish grow, and that nested-PCR is the method of choice.
A longitudinal evaluation of Treponema pallidum PCR testing in early syphilis
Directory of Open Access Journals (Sweden)
Shields Matt
2012-12-01
Full Text Available Abstract Background Syphilis is a growing public health problem among men who have sex with men (MSM globally. Rapid and accurate detection of syphilis is vital to ensure patients and their contacts receive timely treatment and reduce ongoing transmission. Methods We evaluated a PCR assay for the diagnosis of Treponema pallidum using swabs of suspected early syphilis lesions in longitudinally assessed MSM. Results We tested 260 MSM for T pallidum by PCR on 288 occasions: 77 (26.7% had early syphilis that was serologically confirmed at baseline or within six weeks, and 211 (73.3% remained seronegative for syphilis. Of 55 men with primary syphilis, 49 were PCR positive, giving a sensitivity of 89.1% (95% CI: 77.8%-95.9% and a specificity of 99.1% (95% CI: 96.5%-99.9%. Of 22 men with secondary syphilis, 11 were PCR positive, giving a sensitivity of 50% (95% CI: 28.2%-71.8% and a specificity of 100% (95% CI: 66.4%-71.8%. Of the 77 syphilis cases, 43 (56% were HIV positive and the sensitivity and specificity of the PCR test did not vary by HIV status. The PCR test was able to detect up to five (10% primary infections that were initially seronegative, including one HIV positive man with delayed seroconversion to syphilis (72 to 140 days and one HIV positive man who did not seroconvert to syphilis over 14 months follow-up. Both men had been treated for syphilis within a week of the PCR test. Conclusions T pallidum PCR is a potentially powerful tool for the early diagnosis of primary syphilis, particularly where a serological response has yet to develop.
Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange
2018-03-01
The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be
Luijt, DS; Bos, PAJ; van Zwet, AA; Vader, PCV; Schirm, J
A total of 3,023 clinical specimens were tested for Neisseria gonorrhoeae by using COBAS AMPLICOR (CA) PCR and confirmation of positives by N. gonorrhoeae-specific 16S rRNA PCR. The sensitivity of CA plus 16S rRNA PCR was 98.8%, compared to 68.2% for culture. Confirmation of CA positives increased
Comparison of Nested-PCR technique and culture method in ...
African Journals Online (AJOL)
USER
2010-04-05
Apr 5, 2010 ... Full Length Research Paper. Comparison of ... The aim of the present study was to evaluate the diagnostic value of nested PCR in genitourinary ... method. Based on obtained results, the positivity rate of urine samples in this study was 5.0% by using culture and PCR methods and 2.5% for acid fast staining.
PCR cycles above routine numbers do not compromise high-throughput DNA barcoding results.
Vierna, J; Doña, J; Vizcaíno, A; Serrano, D; Jovani, R
2017-10-01
High-throughput DNA barcoding has become essential in ecology and evolution, but some technical questions still remain. Increasing the number of PCR cycles above the routine 20-30 cycles is a common practice when working with old-type specimens, which provide little amounts of DNA, or when facing annealing issues with the primers. However, increasing the number of cycles can raise the number of artificial mutations due to polymerase errors. In this work, we sequenced 20 COI libraries in the Illumina MiSeq platform. Libraries were prepared with 40, 45, 50, 55, and 60 PCR cycles from four individuals belonging to four species of four genera of cephalopods. We found no relationship between the number of PCR cycles and the number of mutations despite using a nonproofreading polymerase. Moreover, even when using a high number of PCR cycles, the resulting number of mutations was low enough not to be an issue in the context of high-throughput DNA barcoding (but may still remain an issue in DNA metabarcoding due to chimera formation). We conclude that the common practice of increasing the number of PCR cycles should not negatively impact the outcome of a high-throughput DNA barcoding study in terms of the occurrence of point mutations.
Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam
2004-01-01
A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner. PMID:15071047
Sreenivas, Gannavaram; Ansari, N. A.; Kataria, Joginder; Salotra, Poonam
2004-01-01
A nested PCR assay to detect parasite DNA in slit aspirates from skin lesions of patients with post-kala-azar dermal lesihmaniasis (PKDL) is described. PCR results were positive in 27 of 29 (93%) samples by nested PCR assay, while only 20 of 29 (69%) were positive in a primary PCR assay. The nested PCR assay allowed reliable diagnosis of PKDL in a noninvasive manner.
Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.
Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N
2012-04-01
Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR
Directory of Open Access Journals (Sweden)
Sérgio Monteiro de Almeida
Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.
Chander, Vishal; Chakravarti, Soumendu; Gupta, Vikas; Nandi, Sukdeb; Singh, Mithilesh; Badasara, Surendra Kumar; Sharma, Chhavi; Mittal, Mitesh; Dandapat, S; Gupta, V K
2016-12-01
Canine parvovirus-2 antigenic variants (CPV-2a, CPV-2b and CPV-2c) ubiquitously distributed worldwide in canine population causes severe fatal gastroenteritis. Antigenic typing of CPV-2 remains a prime focus of research groups worldwide in understanding the disease epidemiology and virus evolution. The present study was thus envisioned to provide a simple sequencing independent, rapid, robust, specific, user-friendly technique for detecting and typing of presently circulating CPV-2 antigenic variants. ARMS-PCR strategy was employed using specific primers for CPV-2a, CPV-2b and CPV-2c to differentiate these antigenic types. ARMS-PCR was initially optimized with reference positive controls in two steps; where first reaction was used to differentiate CPV-2a from CPV-2b/CPV-2c. The second reaction was carried out with CPV-2c specific primers to confirm the presence of CPV-2c. Initial validation of the ARMS-PCR was carried out with 24 sequenced samples and the results were matched with the sequencing results. ARMS-PCR technique was further used to screen and type 90 suspected clinical samples. Randomly selected 15 suspected clinical samples that were typed with this technique were sequenced. The results of ARMS-PCR and the sequencing matched exactly with each other. The developed technique has a potential to become a sequencing independent method for simultaneous detection and typing of CPV-2 antigenic variants in veterinary disease diagnostic laboratories globally. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Fatemeh Dehghan
2014-11-01
Full Text Available Background: Detection of bacterial contamination in drinking water by culture method is a time and cost consuming method and spends a few days depending on contamination degree. However, the people use the tap water during that time. Molecular methods are rapid and sensitive. In this study a rapid Multiplex PCR method was used for rapid analysis both coliform bacteria and E.coli, and probable detection of VBNC bacteria in drinking water, the experiments were performed in bacteriological lab of water and Wastewater Corporation in Markazi province. Material and Methods:Amplification of a fragment from each of lacZ and uidA genes in a Multiplex PCR was used for detection of coliforms. Eight samples was taken from Arak drinking water system including 36 samples of wells, 41 samples of water distribution network and 3 samples from water storages were examined by amplification of lacZ and uidA genes in a Multiplex PCR. Equivalently, the MPN test was applied as a standard method for all samples for comparison of results. Standard bacteria, pure bacteria isolated from positive MPN and CRM were examined by PCR and MPN method. Results: The result of most samples water network, water storages, and water well were same in both MPN and PCR method .The results of standard bacteria and pure cultures of bacteria isolated from positive MPN and CRM confirmed the PCR method. Five samples were positive in PCR but negative in MPN method. Duration time of PCR was decreased about 105 min by changing the PCR program and electrophoreses factors. Conclusion: The Multiplex PCR can detect coliform bacteria and E.coli synchronous in drinking water.
International Nuclear Information System (INIS)
Lina, M.; Dadang, S.; Suhadi, F.
2002-01-01
Research for detecting the presence of HBV DNA in serum with PCR technique by using two pairs of oligonucleotide primers, has been carried out. Ten serum consisted of 5 HBsAg positive serum, I HBsAg weak positive serum, 3 HBsAg negative serum, and I sampel with negative HBV DNA as a previous PCR product trom another laboratory, were used to purify and to extract the DNA of virus, the sample pretreatment was done with Boom method. The two pairs of primers used for the- PCR process, were PC1 and PC2 and P1 and P2. The amplification process by means of PC1 and PC2 primer was carried out with two treatments, l.a. and l.b treatments of 5 HBsAg positive serum samples, 3 were positive for HBV DNA by PCR test with l.a. treatment. The PCR test by means of either the same primer but different treaunent (l.b treatment) or different pair of primer (pI and P2 pimer), revealed the presence of HBV DNA in all of HBsAg serum mentioned above of HBsAg negative Seruln, I serum was positive for HBV DNA and it was an amplification product of PCR test by using PI and P2 primer. The amplification products of PCR processwith either l.b treatment or PI and P2 primer, showed the positive results for I HBV positive serum as a previous PCR product trom another laboratory. All of the PCR test in this research provided the negative HBV DNA result in the HBsAg weak positive serum. The DNA amplification process by means of PI and P2 primer was more sensitive compared with PC I and PC2 primer
Arvia, Rosaria; Sollai, Mauro; Pierucci, Federica; Urso, Carmelo; Massi, Daniela; Zakrzewska, Krystyna
2017-08-01
Merkel cell polyomavirus (MCPyV) is associated with Merkel cell carcinoma and high viral load in the skin was proposed as a risk factor for the occurrence of this tumour. MCPyV DNA was detected, with lower frequency, in different skin cancers but since the viral load was usually low, the real prevalence of viral DNA could be underestimated. To evaluate the performance of two assays (qPCR and ddPCR) for MCPyV detection and quantification in formalin fixed paraffin embedded (FFPE) tissue samples. Both assays were designed to simultaneous detection and quantification of both MCPyV as well as house-keeping DNA in clinical samples. The performance of MCPyV quantification was investigated using serial dilutions of cloned target DNA. We also evaluated the applicability of both tests for the analysis of 76 FFPE cutaneous biopsies. The two approaches resulted equivalent with regard to the reproducibility and repeatability and showed a high degree of linearity in the dynamic range tested in the present study. Moreover, qPCR was able to quantify ≥10 5 copies per reaction, while the upper limit of ddPCR was 10 4 copies. There was not significant difference between viral load measured by the two methods The detection limit of both tests was 0,15 copies per reaction, however, the number of positive samples obtained by ddPCR was higher than that obtained by qPCR (45% and 37% respectively). The ddPCR represents a better method for detection of MCPyV in FFPE biopsies, mostly these containing low copies number of viral genome. Copyright © 2017 Elsevier B.V. All rights reserved.
Wells, Beth; Shaw, Hannah; Innocent, Giles; Guido, Stefano; Hotchkiss, Emily; Parigi, Maria; Opsteegh, Marieke; Green, James; Gillespie, Simon; Innes, Elisabeth A; Katzer, Frank
2015-12-15
Waterborne transmission of Toxoplasma gondii is a potential public health risk and there are currently no agreed optimised methods for the recovery, processing and detection of T. gondii oocysts in water samples. In this study modified methods of T. gondii oocyst recovery and DNA extraction were applied to 1427 samples collected from 147 public water supplies throughout Scotland. T. gondii DNA was detected, using real time PCR (qPCR) targeting the 529bp repeat element, in 8.79% of interpretable samples (124 out of 1411 samples). The samples which were positive for T. gondii DNA originated from a third of the sampled water sources. The samples which were positive by qPCR and some of the negative samples were reanalysed using ITS1 nested PCR (nPCR) and results compared. The 529bp qPCR was the more sensitive technique and a full analysis of assay performance, by Bayesian analysis using a Markov Chain Monte Carlo method, was completed which demonstrated the efficacy of this method for the detection of T. gondii in water samples. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Human papillomavirus detection using PCR and ATR-FTIR for cervical cancer screening
Rymsza, Taciana; Ribeiro, Eliane Aline; de Carvalho, Luis Felipe das Chagas e. Silva; Bhattacharjee, Tanmoy; de Azevedo Canevari, Renata
2018-05-01
The human papillomavirus (HPV) genital infection is considered one of the most common sexually transmitted diseases worldwide, and has been associated with cervical cancer. The objective of this study was to investigate the efficacy of the diagnostic methods: polymerase chain reaction (PCR) and Fourier transform infrared (FTIR) equipped with an ATR (Attenuated Total Reflectance) unit (Pike Tech) spectroscopy, to diagnose HPV infection in women undergoing gynecological examination. Seventeen patients (41.46%) of the 41 patients analyzed were diagnosed with exophytic/condyloma acuminate lesions by clinical analysis, 29 patients (70.7%) (G1 group) of the 41 patients, showed positive result for HPV cell injury by oncotic colpocitology and 12 patients (29.3%) (G2 group), presented negative result for cellular lesion and absence of clinical HPV lesion. Four samples were obtained per patient, which were submitted oncotic colpocitology analysis (Papanicolau staining, two samples), PCR (one sample) and ATR-FTIR analysis (one sample). L1 gene was amplified by PCR technique with specific GP5+/GP6+ and MY09/MY11 primers. PCR results were uniformly positive for presence of HPV in all analyzed samples. Multivariate analysis of ATR-FTIR spectra suggests no significant biochemical changes between groups and no clustering formed, concurring with results of PCR. This study suggests that PCR and ATR-FTIR are highly sensitive technique for HPV detection.
PCR for diagnosis of male Trichomonas vaginalis infection with chronic prostatitis and urethritis.
Lee, Jong Jin; Moon, Hong Sang; Lee, Tchun Yong; Hwang, Hwan Sik; Ahn, Myoung-Hee; Ryu, Jae-Sook
2012-06-01
The aim of this study was to assess the usefulness of PCR for diagnosis of Trichomonas vaginalis infection among male patients with chronic recurrent prostatitis and urethritis. Between June 2001 and December 2003, a total of 33 patients visited the Department of Urology, Hanyang University Guri Hospital and were examined for T. vaginalis infection by PCR and culture in TYM medium. For the PCR, we used primers based on a repetitive sequence cloned from T. vaginalis (TV-E650). Voided bladder urine (VB1 and VB3) was sampled from 33 men with symptoms of lower urinary tract infection (urethral charge, residual urine sensation, and frequency). Culture failed to detect any T. vaginalis infection whereas PCR identified 7 cases of trichomoniasis (21.2%). Five of the 7 cases had been diagnosed with prostatitis and 2 with urethritis. PCR for the 5 prostatitis cases yielded a positive 330 bp band from bothVB1 and VB3, whereas positive results were only obtained from VB1 for the 2 urethritis patients. We showed that the PCR method could detect T. vaginalis when there was only 1 T. vaginalis cell per PCR mixture. Our results strongly support the usefulness of PCR on urine samples for detecting T. vaginalis in chronic prostatitis and urethritis patients.
Directory of Open Access Journals (Sweden)
Maryam AlTamimi
2017-01-01
Full Text Available Dissemination of carbapenem resistance via Enterobacteriaceae, particularly among Klebsiella pneumoniae and Escherichia coli, is a major public health concern. Rapid methods for determining antimicrobial susceptibility are important to ensure adequate and appropriate use of antimicrobial agents and to limit the spread of these bacteria. In the current study, we compared the rapidity, sensitivity and specificity of traditional methods and molecular-based Xpert Carba-R PCR assay to identify sixty isolates, (26 E. coli and 34 K. pneumoniae. The specificity of MicroScan was 100% while sensitivity to ertapenem (ERT, imipenem (IMI, and meropenem (MER was 93%, 68.9%, and 55.17%, respectively. For the modified Hodge test, the specificity was 96.77% and sensitivity was 89.65%. Although some results of phenotypic assays matched with the definite PCR identification, some results were misleading. Out of the 29 positive PCR samples, three samples of K. pneumoniae were negative for the MHT and one E. coli sample was MHT positive but negative for the PCR. Nine samples were positive for the PCR but were determined as carbapenem sensitive by MicroScan. While MicroScan and MHT requires several hours and multi-steps to obtain results, Xpert Carba-R PCR assay takes less than an hour. Therefore, we recommend using Gene xpert Carba-R assay for the optimal carbapenemnase detection with reducing material, manpower and cost. Also it is important to know the type of carbapenemase is present.
Diagnosis of Hepatozoon canis in young dogs by cytology and PCR
Directory of Open Access Journals (Sweden)
Decaprariis Donato
2011-04-01
Full Text Available Abstract Background Hepatozoon canis is a widespread tick-borne protozoan affecting dogs. The diagnosis of H. canis infection is usually performed by cytology of blood or buffy coat smears, but this method may not be sensitive. Our study aimed to evaluate the best method to achieve a parasitological diagnosis of H. canis infection in a population of receptive young dogs, previously negative by cytology and exposed to tick infestation for one summer season. Results A total of 73 mongrel dogs and ten beagles younger than 18 months of age, living in an animal shelter in southern Italy where dogs are highly infested by Rhipicephalus sanguineus, were included in this study. In March-April 2009 and in October 2009, blood and bone marrow were sampled from each dog. Blood, buffy coat and bone marrow were examined by cytology only (at the first sampling and also by PCR for H. canis (second sampling. In March-April 2009, only one dog was positive for H. canis by cytological examination, whereas in October 2009 (after the summer season, the overall incidence of H. canis infection by cytological examinations was 43.9%. Molecular tests carried out on samples taken in October 2009 showed a considerably higher number of dogs positive by PCR (from 27.7% up to 51.2% on skin and buffy coat tissues, respectively, with an overall positivity of 57.8%. All animals, but one, which were positive by cytology were also PCR-positive. PCR on blood or buffy coat detected the highest number of H. canis-positive dogs displaying a sensitivity of 85.7% for both tissues that increased up to 98% when used in parallel. Twenty-six (74.8% out of the 28 H. canis-positive dogs presented hematological abnormalities, eosinophilia being the commonest alteration observed. Conclusions The results suggest that PCR on buffy coat and blood is the best diagnostic assay for detecting H. canis infection in dogs, although when PCR is not available, cytology on buffy coat should be preferred to
Diagnosis of Hepatozoon canis in young dogs by cytology and PCR
2011-01-01
Background Hepatozoon canis is a widespread tick-borne protozoan affecting dogs. The diagnosis of H. canis infection is usually performed by cytology of blood or buffy coat smears, but this method may not be sensitive. Our study aimed to evaluate the best method to achieve a parasitological diagnosis of H. canis infection in a population of receptive young dogs, previously negative by cytology and exposed to tick infestation for one summer season. Results A total of 73 mongrel dogs and ten beagles younger than 18 months of age, living in an animal shelter in southern Italy where dogs are highly infested by Rhipicephalus sanguineus, were included in this study. In March-April 2009 and in October 2009, blood and bone marrow were sampled from each dog. Blood, buffy coat and bone marrow were examined by cytology only (at the first sampling) and also by PCR for H. canis (second sampling). In March-April 2009, only one dog was positive for H. canis by cytological examination, whereas in October 2009 (after the summer season), the overall incidence of H. canis infection by cytological examinations was 43.9%. Molecular tests carried out on samples taken in October 2009 showed a considerably higher number of dogs positive by PCR (from 27.7% up to 51.2% on skin and buffy coat tissues, respectively), with an overall positivity of 57.8%. All animals, but one, which were positive by cytology were also PCR-positive. PCR on blood or buffy coat detected the highest number of H. canis-positive dogs displaying a sensitivity of 85.7% for both tissues that increased up to 98% when used in parallel. Twenty-six (74.8%) out of the 28 H. canis-positive dogs presented hematological abnormalities, eosinophilia being the commonest alteration observed. Conclusions The results suggest that PCR on buffy coat and blood is the best diagnostic assay for detecting H. canis infection in dogs, although when PCR is not available, cytology on buffy coat should be preferred to blood smear evaluation
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R.; Melo, Maria N.
2013-01-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using 32 P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83% (25
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Carregal, Virginia M.; Leite, Rodrigo S.; Ferreira, Sidney A.; Andrade, Antero Silva R., E-mail: alineleandra@hotmail.com, E-mail: streptos@hotmail.com, E-mail: rleite2005@gmail.com, E-mail: vidasnino@yahoo.com.br, E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia
2013-07-01
Visceral leishmaniasis (VL) in Brazil is caused by Leishmania infantum and dogs are considered the main domestic reservoirs of this parasite. The VL control program in Brazil emphasizes the use of serological surveys, followed by elimination of seropositive dogs. However, serologic tests have limitations in terms of sensitivity and specificity. Molecular methods such as PCR (Polymerase Chain Reaction) associated with hybridization using {sup 32}P radiolabeled DNA probes (kDNA PCR hybridization) are useful tools in this scenario, since they are more specific and sensitive than conventional methods. A variety of samples can be employed with PCR; however non-invasive procedures are the most adequate. One of main obstacles for implementation of PCR in the canine visceral leishmaniasis (CVL) diagnosis is the lack of standardization. Few studies up to the moment compared the effectiveness of the different PCR methods and clinical samples available. The objective of this study was to compare the kDNA PCR hybridization and the Internal Transcribed Spacer 1 nested PCR (ITS1 nPCR) methods and four types of clinical samples for the diagnosis of CVL in dogs with and without clinical signs of the disease. The methods were compared using samples of conjunctival swab (SC), bone marrow (BM), skin (S) and peripheral blood (PB). A group of 60 mongrel dogs, all positive in serological and parasitological tests, were equally divided in two groups: S (with clinical signs) and A (without clinical signs). The frequencies of positive results for the kDNA PCR hybridization in the S group were: CS 97% (29/30), BM 83 % (25/30), S 63% (19/30) and PB 4 7% (14/30). By the same method the following results were obtained in the A group: CS 70% (21/30), BM 63% (19/30), S 57% (17/30) and PB 17% (5/30). The ITS1 nPCR allowed the following positivities for the S group: CS 83% (25/30), BM 97% (29/30), S 83% (25/30) and PB 70% (21/30). For the A group the following results were obtained: CS and BM 83
Study the Three Extraction Methods for HBV DNA to Use in PCR
Directory of Open Access Journals (Sweden)
N. Sheikh
2004-07-01
Full Text Available Diagnosis of Hepatitis B is important because of the its high prevalence. Recently PCR method , has found greater interest among different diagnostic methods. Several reports emphasis on some false negative results in those laboratories using PCR. The aim of this study was to compare three different procedures for HBV DNA extraction. A total 30 serum samples received from Shariati hospital. Sera was taken from patients having chronic Hepatitis with HBs antigen positive and HBe antigen negative. The sensitivity of guanidium hydrochloride method for extracting the HBV DNA from serum were evaluated and compared with phenol–chloroform and boiling methods. Diagnostic PCR kit was obtained from Cynagene contained taq polymerase, reaction mixture, dNTP, and buffer for reaction. A 353 bp product were amplified by amplification program provided in used PCR protocol. The comparison of results indicated that procedure was successful for amplification of the designed products from Hepatitis B in sera. Number of positive results were 16,19,23 and number of negative result were 14,11,7 for the boiling, phenol-chloroform and guanidium-hydrochloride extraction methods respectively.PCR method is the fastest diagnosis method and the most accurate procedure to identify Hepatitis B. Guanidium hydrochloride method was the most successful procedure studied in this survey for viruses.
Walz, Paul H; Newcomer, Benjamin W; Riddell, Kay P; Scruggs, Daniel W; Cortese, Victor S
2017-09-01
We evaluated duration of PCR-positive results following administration of modified-live viral (MLV) vaccines to beef calves. Twenty beef calves were randomly assigned to either group 1 and vaccinated intranasally with a MLV vaccine containing bovine alphaherpesvirus 1 (BoHV-1), bovine respiratory syncytial virus (BRSV), and bovine parainfluenza virus 3 (BPIV-3), or to group 2 and vaccinated subcutaneously with a MLV vaccine containing bovine viral diarrhea virus 1 and 2 (BVDV-1, -2), BoHV-1, BRSV, and BPIV-3. Deep nasopharyngeal swabs (NPS) and transtracheal washes (TTW) were collected from all calves, and whole blood was collected from group 2 calves and tested by PCR. In group 1, the proportions of calves that tested PCR-positive to BVDV, BoHV-1, BRSV, and BPIV-3 on any sample at any time were 0%, 100%, 100%, and 10%, respectively. In group 1 calves, 100% of calves became PCR-positive for BoHV-1 by day 3 post-vaccination and 100% of calves became PCR-positive for BRSV by day 7 post-vaccination. In group 2, the proportions of calves that tested positive to BVDV, BoHV-1, BRSV, and BPIV-3 on any sample at any time were 50%, 40%, 10%, and 0%, respectively. All threshold cycle (Ct) values were >30 in group 2 calves, irrespective of virus; however, Ct values PCR-positive results for BoHV-1 and BRSV. All calves were PCR-negative for all viruses after day 28. Following intranasal MLV viral vaccination, PCR results and Ct values for BRSV and BoHV-1 suggest that attempts to differentiate vaccine virus from natural infection is unreliable.
Ala-Houhala, M; Koukila-Kähkölä, P; Antikainen, J; Valve, J; Kirveskari, J; Anttila, V-J
2018-03-01
To assess the clinical use of panfungal PCR for diagnosis of invasive fungal diseases (IFDs). We focused on the deep tissue samples. We first described the design of panfungal PCR, which is in clinical use at Helsinki University Hospital. Next we retrospectively evaluated the results of 307 fungal PCR tests performed from 2013 to 2015. Samples were taken from normally sterile tissues and fluids. The patient population was nonselected. We classified the likelihood of IFD according to the criteria of the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG), comparing the fungal PCR results to the likelihood of IFD along with culture and microscopy results. There were 48 positive (16%) and 259 negative (84%) PCR results. The sensitivity and specificity of PCR for diagnosing IFDs were 60.5% and 91.7%, respectively, while the negative predictive value and positive predictive value were 93.4% and 54.2%, respectively. The concordance between the PCR and the culture results was 86% and 87% between PCR and microscopy, respectively. Of the 48 patients with positive PCR results, 23 had a proven or probable IFD. Fungal PCR can be useful for diagnosing IFDs in deep tissue samples. It is beneficial to combine fungal PCR with culture and microscopy. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Real-Time PCR (qPCR) Primer Design Using Free Online Software
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and
Efficacy of a novel PCR- and microarray-based method in diagnosis of a prosthetic joint infection
2014-01-01
Background and purpose Polymerase chain reaction (PCR) methods enable detection and species identification of many pathogens. We assessed the efficacy of a new PCR and microarray-based platform for detection of bacteria in prosthetic joint infections (PJIs). Methods This prospective study involved 61 suspected PJIs in hip and knee prostheses and 20 negative controls. 142 samples were analyzed by Prove-it Bone and Joint assay. The laboratory staff conducting the Prove-it analysis were not aware of the results of microbiological culture and clinical findings. The results of the analysis were compared with diagnosis of PJIs defined according to the Musculoskeletal Infection Society (MSIS) criteria and with the results of microbiological culture. Results 38 of 61 suspected PJIs met the definition of PJI according to the MSIS criteria. Of the 38 patients, the PCR detected bacteria in 31 whereas bacterial culture was positive in 28 patients. 15 of the PJI patients were undergoing antimicrobial treatment as the samples for analysis were obtained. When antimicrobial treatment had lasted 4 days or more, PCR detected bacteria in 6 of the 9 patients, but positive cultures were noted in only 2 of the 9 patients. All PCR results for the controls were negative. Of the 61 suspected PJIs, there were false-positive PCR results in 6 cases. Interpretation The Prove-it assay was helpful in PJI diagnostics during ongoing antimicrobial treatment. Without preceding treatment with antimicrobials, PCR and microarray-based assay did not appear to give any additional information over culture. PMID:24564748
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection
Directory of Open Access Journals (Sweden)
Amanda de Faveri Pitz
2013-12-01
Full Text Available Introduction Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR assay for the detection of Paracoccidioides brasiliensis. Methods We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. Results The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. Conclusions The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.
International Nuclear Information System (INIS)
Ferreira, Sidney A.; Ituassu, Leonardo T.; Melo, Maria N.
2009-01-01
The canine visceral leishmaniasis (CVL) diagnosis still represents a challenge because of complexity of this disease. The aim of present study was to compare different clinical samples for diagnosis of CVL by Polymerase Chain Reaction (PCR) combined with hybridization of 32 P labeled probes. Bone marrow (BM), skin biopsy (SB), peripheral blood (PB) and conjunctival swab (CS) were used in this work. With this purpose 40 asymptomatic dogs, all positive by parasitological test, were obtained. From each animal were collected SB with sterile punches from ear internal surface, 1.0 mL of PB, BM aspirates from sternum and CS from both lower eyelid. Each clinical sample was submitted to suitable DNA purification process and PCR-hybridization assays. The positive results obtained with PCR were 55%, 25%, 30% and 22.5% for CS, BM, SB and PB respectively while the PCR followed by hybridization showed a positivity of 87.5%, 50%, 45% and 27.5% respectively. The hybridization assay was able to increase the PCR positivity in all kinds of clinical samples. The best performance was obtained using CS samples. We concluded that the PCR associated with DNA radioactive probes was a very sensitive tool for diagnosis of CVL in asymptomatic dogs and the CS has an important potential for regular screening of dogs. (author)
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].
Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan
2015-04-01
To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.
Joseph, Priya; Calderón, Maritza M.; Gilman, Robert H.; Quispe, Monica L.; Cok, Jaime; Ticona, Eduardo; Chavez, Victor; Jimenez, Juan A.; Chang, Maria C.; Lopez, Martín J.; Evans, Carlton A.
2002-01-01
Toxoplasma gondii is a common life-threatening opportunistic infection. We used experimental murine T. gondii infection to optimize the PCR for diagnostic use, define its sensitivity, and characterize the time course and tissue distribution of experimental toxoplasmosis. PCR conditions were adjusted until the assay reliably detected quantities of DNA derived from less than a single parasite. Forty-two mice were inoculated intraperitoneally with T. gondii tachyzoites and sacrificed from 6 to 72 h later. Examination of tissues with PCR and histology revealed progression of infection from blood to lung, heart, liver, and brain, with PCR consistently detecting parasites earlier than microscopy and with no false-positive results. We then evaluated the diagnostic value of this PCR assay in human patients. We studied cerebrospinal fluid and serum samples from 12 patients with AIDS and confirmed toxoplasmic encephalitis (defined as positive mouse inoculation and/or all of the Centers for Disease Control clinical diagnostic criteria), 12 human immunodeficiency virus-infected patients with suspected cerebral toxoplasmosis who had neither CDC diagnostic criteria nor positive mouse inoculation, 26 human immunodeficiency virus-infected patients with other opportunistic infections and no signs of cerebral toxoplasmosis, and 18 immunocompetent patients with neurocysticercosis. Eleven of the 12 patients with confirmed toxoplasmosis had positive PCR results in either blood or cerebrospinal fluid samples (6 of 9 blood samples and 8 of 12 cerebrospinal fluid samples). All samples from control patients were negative. This study demonstrates the high sensitivity, specificity, and clinical utility of PCR in the diagnosis of toxoplasmic encephalitis in a resource-poor setting. PMID:12454142
Detection by PCR of pathogenic protozoa in raw and drinkable water samples in Colombia.
Triviño-Valencia, Jessica; Lora, Fabiana; Zuluaga, Juan David; Gomez-Marin, Jorge E
2016-05-01
We evaluated the presence of DNA of Giardia, Toxoplasma, and Cryptosporidium by PCR, and of Giardia and Cryptosporidium genera by immunofluorescence antibody test (IFAT), in water samples, before, during, and after plant treatment for drinkable water. We applied this method in 38 samples of 10 l of water taken from each of the water treatment steps and in 8 samples taken at home (only for Toxoplasma PCR) in Quindio region in Colombia. There were 8 positive samples for Cryptosporidium parvum (21 %), 4 for Cryptosporidium hominis (10.5 %), 27 for Toxoplasma gondii (58.6 %), 2 for Giardia duodenalis assemblage A (5.2 %), and 5 for G. duodenalis assemblage B (13.1 %). By IFAT, 23 % were positive for Giardia and 21 % for Cryptosporidium. An almost perfect agreement was found between IFAT and combined results of PCR, by Kappa composite proportion analysis. PCR positive samples were significantly more frequent in untreated raw water for C. parvum (p = 0.02). High mean of fecal coliforms, high pH values, and low mean of chlorine residuals were strongly correlated with PCR positivity for G. duodenalis assemblage B. High pH value was correlated with PCR positivity for C. parvum. Phylogenetic analysis of DNA sequences was possible, showing water and human clinical sequences for Toxoplasma within the same phylogenetic group for B1 repeated sequence. PCR assay is complementary to IFAT assay for monitoring of protozoa in raw and drinkable water, enabling species identification and to look for phylogenetic analysis in protozoa from human and environmental sources.
Evaluation of nested PCR in diagnosis of fungal rhinosinusitis.
Badiee, Parisa; Gandomi, Behrooz; Sabz, Gholamabbass; Khodami, Bijan; Choopanizadeh, Maral; Jafarian, Hadis
2015-02-01
Given the importance of rapid diagnosis for fungal rhinosinusitis, this study aimed to evaluate the use of nested PCR to identify Aspergillus and Mucor species in clinical samples from patients with suspected fungal rhinosinusitis. Functional endoscopic sinus surgery specimens were collected from 98 patients with rhinosinusitis from 2012 to 2013. All samples were ground and cultured on sabouraud dextrose agar. The isolated fungi were identified based on their macroscopic and microscopic features. Fungal DNA was extracted from the tissue samples and nested PCR was performed with two sets of primers for Mucor and Aspergillus. Direct microscopic showed that 5.1% contained fungal components and 9.2% exhibited growth of fungi in culture. The most common agents isolated were Aspergillus fumigatus (n= 3), Aspergillus flavus (n=2), Penicillium sp (n=3) and Alternaria sp. (n=1). Mucor sp. was identified in the pathology smear from 1 patient. Positive results for fungal rhinosinusitis were obtained for a total of 10.2% by culture or pathology smear. Positive PCR results were obtained in 72 samples for Aspergillus and 31 samples for Mucor. Our results suggest that endoscopic sinus surgery specimens are not suitable for nested PCR, probably because of the accumulation of fungi that contaminate the environmental air. This drawback is a limiting factor for diagnosis with nasal cavity specimens. Therefore, molecular methods and conventional culture techniques are helpful complementary diagnostic methods to detect fungal rhinosinusitis and determine appropriate management for these patients.
Performance of Aspergillus PCR in cerebrospinal fluid for the diagnosis of cerebral aspergillosis.
Imbert, S; Brossas, J-Y; Palous, M; Joly, I; Meyer, I; Fekkar, A
2017-11-01
Cerebral aspergillosis is a rare but often fatal form of invasive aspergillosis that remains difficult to diagnose. The literature has shown the value of Aspergillus PCR in blood-derived samples for the diagnosis of invasive aspergillosis but provides far less information for cerebrospinal fluid (CSF) in cerebral aspergillosis. Here, we evaluated the usefulness of an Aspergillus PCR assay performed on CSF for the diagnosis of cerebral aspergillosis. This retrospective study involved 72 patients with suspected cerebral aspergillosis for a total of 88 CSF samples in whom CSF Aspergillus PCR was performed. Seventeen patients had proven/probable invasive aspergillosis according to the European Organization for Research and Treatment of Cancer/Mycoses Study Group criteria, including 12 cases of proven/probable cerebral aspergillosis. Aspergillus PCR in CSF was positive in nine of the twelve patients with cerebral aspergillosis, i.e. 75% sensitivity. In contrast, CSF culture was positive for Aspergillus in only two patients. In the non-cerebral aspergillosis group (60 patients), PCR was positive in one patient, i.e. 98.3% specificity. In this particular population of high-risk patients with suspicion of cerebral aspergillosis, the disease incidence was 16.7%. Therefore, the positive and negative predictive values of PCR were 90% and 95.2%, respectively. The results of this study indicate that Aspergillus PCR in CSF is an interesting tool that may eliminate the need for cerebral biopsy in patients with suspected cerebral aspergillosis. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Simplified Pan-species Real-time PCR-based Detection of Plasmodium Spp. in Blood Smear.
Hassanpour, Gholamreza; Mirhendi, Hossein; Mohebali, Mehdi; Raeisi, Ahmad; Zeraati, Hojjat; Keshavarz, Hossein
2016-01-01
We aimed to quicken and simplify the detection of Plasmodium in blood samples by developing and testing a pan- Plasmodium real-time PCR for accurate screening of individuals suspected of malaria. A single primer/probe set for pan-species Plasmodium -specific real time PCR targeting a conserved region of the small subunit 18S ribosomal DNA was designed and evaluated for rapid diagnosis and screening of malaria infections using dried blood smears. FTA cards were used for rapid and simple DNA extraction. The primers and probes showed a positive response with the DNA extracted from bloods infected with P. falciparum and P. vivax but not with DNA extracted from various smears from uninfected blood samples. Seven positive cases positive by both microscopy and nested PCR were found among 280 blood samples taken from in South and Southeast Iran. Five samples were identified as positive for P. vivax and two as positive for P. falciparum . All positive samples were positive by real-time PCR. Furthermore, all 38-blood samples positive by microscopy were positive by real-time PCR. No microscopy-negative samples were positive by real-time PCR. By using a simple FTA card for DNA extraction and by application of the real-time PCR developed in this study, sensitivity similar to nested-PCR and microscopy was achieved. This format simplifies the detection of Plasmodium in large numbers of samples.
Murdoch, David R.; Anderson, Trevor P.; Beynon, Kirsten A.; Chua, Alvin; Fleming, Angela M.; Laing, Richard T. R.; Town, G. Ian; Mills, Graham D.; Chambers, Stephen T.; Jennings, Lance C.
2003-01-01
Streptococcus pneumoniae is the most common cause of community-acquired pneumonia, but it is undoubtedly underdiagnosed. We used a nested PCR assay (targeting the pneumolysin gene) to detect S. pneumoniae DNA in multiple sample types from 474 adults with community-acquired pneumonia and 183 control patients who did not have pneumonia. Plasma or buffy coat samples were PCR positive in only 6 of the 21 patients with positive blood cultures for S. pneumoniae and in 12 other patients (4 of whom had no other laboratory evidence of S. pneumoniae infection). Buffy coat samples from two control patients (neither having evidence of S. pneumoniae infection), but no control plasma samples, were PCR positive. Although pneumococcal antigen was detected in the urine from 120 of 420 (29%) patients, only 4 of 227 (2%) urine samples tested were PCR positive. Overall, 256 of 318 (81%) patients had PCR-positive sputum samples, including 58 of 59 samples from which S. pneumoniae was cultured. Throat swab samples from 229 of 417 (55%) patients were PCR positive and, in those who produced sputum, 96% also had positive PCR results from sputum. Throat swabs from 73 of 126 (58%) control patients were also PCR positive. We conclude that the pneumolysin PCR assay adds little to existing diagnostic tests for S. pneumoniae and is unable to distinguish colonization from infection when respiratory samples are tested. PMID:12517826
Amplification of Mycoplasma haemofelis DNA by a PCR for point-of-care use.
Hawley, Jennifer; Yaaran, Tal; Maurice, Sarah; Lappin, Michael R
2018-01-01
We compared a qualitative in-clinic (IC)-PCR for the detection of Mycoplasma haemofelis DNA with the results of a commercial qualitative laboratory-based, conventional (c)PCR. In order to determine the specificity of both tests, Bartonella spp. samples were included. Forty-three previously tested blood samples with known PCR results for hemoplasmas and Bartonella spp. were selected. The samples were split between 2 laboratories. At the first laboratory, DNA was purified and run on 2 cPCR assays for the detection of hemoplasmas and Bartonella spp. At the second laboratory, DNA was purified using 2 purification protocols and both run in the IC-PCR assay. The cPCR results confirmed that 18 samples were positive for M. haemofelis, 5 for ' Candidatus M. haemominutum', 8 for Bartonella henselae, 2 for Bartonella clarridgeiae, and 10 were negative for both genera. No mixed infections were observed. The IC-PCR assay for the detection of M. haemofelis had a sensitivity of 94.4% and specificity of 96%, when using the same DNA purification method as the first laboratory. Using the second purification method, the sensitivity of the IC-PCR assay was 77.8% and specificity was 96%. Bartonella species were not detected by the IC-PCR M. haemofelis assay. The IC-PCR assay decreased the amount of time to final result compared to a cPCR assay.
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Sidney A.; Ituassu, Leonardo T.; Melo, Maria N. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Parasitologia], e-mail: saninoalmeida@gmail.com, e-mail: Itituassu@yahoo.com.br, e-mail: melo@icb.ufmg.br; Leite, Rodrigo S.; Andrade, Antero S.R. [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN-CNEN/MG), Belo Horizonte, MG (Brazil)], e-mail: rleite2005@gmail.com, e-mail: antero@cdtn.br
2009-07-01
The canine visceral leishmaniasis (CVL) diagnosis still represents a challenge because of complexity of this disease. The aim of present study was to compare different clinical samples for diagnosis of CVL by Polymerase Chain Reaction (PCR) combined with hybridization of {sup 32}P labeled probes. Bone marrow (BM), skin biopsy (SB), peripheral blood (PB) and conjunctival swab (CS) were used in this work. With this purpose 40 asymptomatic dogs, all positive by parasitological test, were obtained. From each animal were collected SB with sterile punches from ear internal surface, 1.0 mL of PB, BM aspirates from sternum and CS from both lower eyelid. Each clinical sample was submitted to suitable DNA purification process and PCR-hybridization assays. The positive results obtained with PCR were 55%, 25%, 30% and 22.5% for CS, BM, SB and PB respectively while the PCR followed by hybridization showed a positivity of 87.5%, 50%, 45% and 27.5% respectively. The hybridization assay was able to increase the PCR positivity in all kinds of clinical samples. The best performance was obtained using CS samples. We concluded that the PCR associated with DNA radioactive probes was a very sensitive tool for diagnosis of CVL in asymptomatic dogs and the CS has an important potential for regular screening of dogs. (author)
Comparison of real-time quantitative PCR and culture for the diagnosis of emerging Rickettsioses.
Directory of Open Access Journals (Sweden)
Emmanouil Angelakis
Full Text Available BACKGROUND: Isolation of Rickettsia species from skin biopsies may be replaced by PCR. We evaluated culture sensitivity compared to PCR based on sampling delay and previous antibiotic treatment. METHODOLOGY/PRINCIPAL FINDINGS: Skin biopsies and ticks from patients with suspected Rickettsia infection were screened for Rickettsia spp. using qPCR, and positive results were amplified and sequenced for the gltA and ompA genes. Immunofluorescence for spotted fever group rickettsial antigens was done for 79 patients. All skin biopsies and only ticks that tested positive using qPCR were cultured in human embryonic lung (HEL fibroblasts using the centrifugation-shell vial technique. Patients and ticks were classified as definitely having rickettsioses if there was direct evidence of infection with a Rickettsia sp. using culture or molecular assays or in patients if serology was positive. Data on previous antibiotic treatments were obtained for patients with rickettsiosis. Rickettsia spp. infection was diagnosed in 47 out of 145 patients (32%, 41 by PCR and 12 by culture, whereas 3 isolates were obtained from PCR negative biopsies. For 3 of the patients serology was positive although PCR and culture were negative. Rickettsia africae was the most common detected species (n = 25, [17.2%] and isolated bacterium (n = 5, [3.4%]. The probability of isolating Rickettsia spp. was 12 times higher in untreated patients and 5.4 times higher in patients from our hometown. Rickettsia spp. was amplified in 24 out of 95 ticks (25% and we isolated 7 R. slovaca and 1 R. raoultii from Dermacentor marginatus. CONCLUSIONS/SIGNIFICANCE: We found a positive correlation between the bacteria copies and the isolation success in skin biopsies and ticks. Culture remains critical for strain analysis but is less sensitive than serology and PCR for the diagnosis of a Rickettsia infection.
Energy Technology Data Exchange (ETDEWEB)
Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN), Belo Horizonte, MG (Brazil); Moreno, Elizabeth Castro [Fundacao Nacional de Saude, Belo Horizonte, MG (Brazil). Coordenacao Regional de Minas Gerais; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela [Minas Gerais Univ., Belo Horizonte, MG (Brazil). Dept. de Parasitologia; Fernandes, Octavio [Fundacao Inst. Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Medicina Tropical
2002-07-01
Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with {sup 32} P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with {sup 32} P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)
Directory of Open Access Journals (Sweden)
Strube Christina
2010-08-01
Full Text Available Abstract Background Borrelia burgdorferi sensu lato (sl, the causative agent of Lyme borreliosis, is transmitted by ticks of the genus Ixodes as vector. For identification of Borrelia infections in ticks a TaqMan™ minor groove binder (MGB probe-based quantitative real time PCR (qPCR was established targeting the 5S-23S intergenic spacer. Extension to a duplex qPCR included an Ixodes spp. positive control to verify successful DNA isolation. Besides qPCR, an ospA-specific conventional PCR for species-specific identification of B. spielmanii was established. Afterwards 1000 I. ricinus flagged in the city of Hanover, Germany, were investigated for B. burgdorferi sl infections followed by species identification. Furthermore, I. hexagonus ticks were investigated to proof applicability of the PCRs. Results Quantitative real time PCR (qPCR identifying B. burgdorferi sl in ticks was able to detect 1-10 copies per reaction. B. spielmanii ospA-specific conventional PCR was also highly specific and showed no cross reactions with the other tested Borrelia species. From 1000 hanoveranian ticks 24.3% were positive compared to only 7.4% positives by dark-field microscopy. Related to tick stage 1.7% larvae, 18.1% nymphs, and 34.6% adults were positive. The most frequent species was B. garinii, followed by B. afzelii, B. spielmanii, B. valaisiana and B. burgdorferi sensu stricto (ss. 70.6% of I. ricinus were mono-infected, whereas 28.0% and 1.4% were infected with two and three Borrelia species, respectively. From 232 I. hexagonus collected from hedgehogs in different sites of Germany, qPCR detected 5.7% to be infected with B. burgdorferi sl, which were identified as B. afzelii, B. garinii and B. spielmanii. Conclusions The evaluated qPCR to detect B. burgdorferi sl in Ixodes spp. is highly specific and sensitive. As a duplex qPCR including detection of Ixodes spp. DNA it is the first DNA based technique incorporating a control for successful DNA isolation from
Diagnostic value of nested-PCR for identification of Malassezia species in dandruff
Jusuf, N. K.; Nasution, T. A.; Ullyana, S.
2018-03-01
Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.
Demeke, Tigst; Dobnik, David
2018-07-01
The number of genetically modified organisms (GMOs) on the market is steadily increasing. Because of regulation of cultivation and trade of GMOs in several countries, there is pressure for their accurate detection and quantification. Today, DNA-based approaches are more popular for this purpose than protein-based methods, and real-time quantitative PCR (qPCR) is still the gold standard in GMO analytics. However, digital PCR (dPCR) offers several advantages over qPCR, making this new technique appealing also for GMO analysis. This critical review focuses on the use of dPCR for the purpose of GMO quantification and addresses parameters which are important for achieving accurate and reliable results, such as the quality and purity of DNA and reaction optimization. Three critical factors are explored and discussed in more depth: correct classification of partitions as positive, correctly determined partition volume, and dilution factor. This review could serve as a guide for all laboratories implementing dPCR. Most of the parameters discussed are applicable to fields other than purely GMO testing. Graphical abstract There are generally three different options for absolute quantification of genetically modified organisms (GMOs) using digital PCR: droplet- or chamber-based and droplets in chambers. All have in common the distribution of reaction mixture into several partitions, which are all subjected to PCR and scored at the end-point as positive or negative. Based on these results GMO content can be calculated.
[Application of Nested PCR in the Diagnosis of Imported Plasmodium Ovale Infection].
Huang, Bing-cheng; Xu, Chao; Li, Jin; Xiao, Ting; Yin, Kun; Liu, Gong-zhen; Wang, Wei-yan; Zhao, Gui-hua; Wei, Yan-bin; Wang, Yong-bin; Zhao, Chang-lei; Wei, Qing-kuan
2015-02-01
To identity Plasmodium ovale infection by 18S rRNA gene nested PCR. Whole blood and filter paper blood samples of malaria patients in Shandong Province were collected during 2012-2013. The parasites were observed under a microscope with Giemsa staining. The genome DNA of blood samples were extracted as PCR templates. Genus- and species-specific primers were designed according to the Plasmodium 18S rRNA gene sequences. Plasmodium ovale-positive specimens were identified by nested PCR as well as verified by sequencing. There were 7 imported cases of P. ovale infection in the province during 2012-2013. Nested PCR results showed that the P. ovale specific band (800 bp) was amplified in all the 7 specimens. Blast results indicated that the PCR products were consistent with the Plasmodium ovale reference sequence in GenBank. Seven imported cases of ovale malaria in Shandong Province in 2012-2013 are confirmed by nested PCR.
Detection of Mycoplasma hyopneumoniae in Bronchoalveolar Lavage Fluids of Pigs by PCR
Baumeister, A. Katrin; Runge, Martin; Ganter, Martin; Feenstra, Anne A.; Delbeck, Friedrich; Kirchhoff, Helga
1998-01-01
In the present investigation we developed a method for the detection of Mycoplasma hyopneumoniae in bronchoalveolar lavage fluid (BALF) of pigs by PCR with a primer pair flanking a DNA fragment of 853 bp specific for M. hyopneumoniae. Several methods were tested to eliminate the amplification inhibitors present in BALFs. The best results were obtained by the extraction of the DNA from the BALFs. By the PCR performed with the extracted DNA, 102 CFU of M. hyopneumoniae could be detected in 1 ml of BALF from specific-pathogen-free swine experimentally inoculated with M. hyopneumoniae. DNA from 11 other mycoplasma species and 17 cell-walled bacterial species colonizing the respiratory tracts of pigs was not amplified. In a field study BALFs from 40 pigs from farms with a history of chronic pneumonia were tested for M. hyopneumoniae by cultivation and by PCR (i) with BALFs incubated in Friis medium and (ii) with DNA extracted from the BALFs. In addition, PCR was performed with postmortem lung washings from 19 of the 40 pigs, and immunofluorescence tests were carried out with sections of lungs from 18 of the 40 pigs. M. hyopneumoniae could not be detected in 18 of the 40 pigs by any of the five methods tested. The remaining 22 pigs showed a positive reaction by the PCR with DNA extracted from the BALFs and variable positive reactions by the other tests. A complete correspondence could be observed between the immunofluorescence test result and the result of PCR with DNA. The investigation shows that the PCR with DNA extracted from BALFs is a suitable technique for the sensitive and specific in vivo detection of M. hyopneumoniae. PMID:9650949
Diagnosis of Hepatozoon canis in young dogs by cytology and PCR.
Otranto, Domenico; Dantas-Torres, Filipe; Weigl, Stefania; Latrofa, Maria Stefania; Stanneck, Dorothee; Decaprariis, Donato; Capelli, Gioia; Baneth, Gad
2011-04-13
Hepatozoon canis is a widespread tick-borne protozoan affecting dogs. The diagnosis of H. canis infection is usually performed by cytology of blood or buffy coat smears, but this method may not be sensitive. Our study aimed to evaluate the best method to achieve a parasitological diagnosis of H. canis infection in a population of receptive young dogs, previously negative by cytology and exposed to tick infestation for one summer season. A total of 73 mongrel dogs and ten beagles younger than 18 months of age, living in an animal shelter in southern Italy where dogs are highly infested by Rhipicephalus sanguineus, were included in this study. In March-April 2009 and in October 2009, blood and bone marrow were sampled from each dog. Blood, buffy coat and bone marrow were examined by cytology only (at the first sampling) and also by PCR for H. canis (second sampling). In March-April 2009, only one dog was positive for H. canis by cytological examination, whereas in October 2009 (after the summer season), the overall incidence of H. canis infection by cytological examinations was 43.9%. Molecular tests carried out on samples taken in October 2009 showed a considerably higher number of dogs positive by PCR (from 27.7% up to 51.2% on skin and buffy coat tissues, respectively), with an overall positivity of 57.8%. All animals, but one, which were positive by cytology were also PCR-positive. PCR on blood or buffy coat detected the highest number of H. canis-positive dogs displaying a sensitivity of 85.7% for both tissues that increased up to 98% when used in parallel. Twenty-six (74.8%) out of the 28 H. canis-positive dogs presented hematological abnormalities, eosinophilia being the commonest alteration observed. The results suggest that PCR on buffy coat and blood is the best diagnostic assay for detecting H. canis infection in dogs, although when PCR is not available, cytology on buffy coat should be preferred to blood smear evaluation. This study has also demonstrated
Botero, Jorge H; Montoya, Martha Nelly; Vanegas, Adriana Lucía; Díaz, Abel; Navarro-i-Martínez, Luis; Bornay, Fernando Jorge; Izquierdo, Fernando; del Aguila, Carmen; Agudelo, Sonia del Pilar
2004-12-01
Microsporidia are intracellular obligate parasites, today mainly associated with diarrhea in AIDS patients. Microsporidia prevalence ranges from 8% to 52% in different countries, as evaluated by several diagnostic methods, such as the stain test and PCR. In Medellín, Colombia, its frequency is unknown, and hence, a study was undertaken to determine the frequency of intestinal microsporidiosis in HIV patients, by means of the quick-hot Gram chromotrope test and the PCR. A prospective and descriptive study of an intentional population of all HIV-positive patients was sent to the Grupo Interdisciplinario para el Estudio de las Parasitosis Intestinales laboratory by institutions treating the HIV-positive patients of Medellín between August 2001 and September 2002. The clinical-epidemiological survey included a serial stool test with direct concentration and special stains for coccidiae and intestinal microsporidia. In addition, counts of lymphocytes TCD4+ and viral load were requested. One hundred and three patients with ages ranging from 2-74 years were evaluated. Seventy percent presented with diarrhea--mostly in men (83.5%). The overall frequency of intestinal microsporidiosis was 3.9% and that of other intestinal parasitic infections was 39.8%. Three of the four patients positive for microsporida were infected with Enterocytozoon bieneusi and one with Encephalitozoon intestinalis. The microsporidiosis frequency was relatively low with 3 of the 4 cases associated with protracted diarrhea, counts of LTCD4+ below 100 cel/microl and viral loads up to 100,000 copies.
Real-time PCR improves Helicobacter pylori detection in patients with peptic ulcer bleeding.
Directory of Open Access Journals (Sweden)
María José Ramírez-Lázaro
Full Text Available BACKGROUND AND AIMS: Histological and rapid urease tests to detect H. pylori in biopsy specimens obtained during peptic ulcer bleeding episodes (PUB often produce false-negative results. We aimed to examine whether immunohistochemistry and real-time PCR can improve the sensitivity of these biopsies. PATIENTS AND METHODS: We selected 52 histology-negative formalin-fixed paraffin-embedded biopsy specimens obtained during PUB episodes. Additional tests showed 10 were true negatives and 42 were false negatives. We also selected 17 histology-positive biopsy specimens obtained during PUB to use as controls. We performed immunohistochemistry staining and real-time PCR for 16S rRNA, ureA, and 23S rRNA for H. pylori genes on all specimens. RESULTS: All controls were positive for H. pylori on all PCR assays and immunohistochemical staining. Regarding the 52 initially negative biopsies, all PCR tests were significantly more sensitive than immunohistochemical staining (p<0.01. Sensitivity and specificity were 55% and 80% for 16S rRNA PCR, 43% and 90% for ureA PCR, 41% and 80% for 23S rRNA PCR, and 7% and 100% for immunohistochemical staining, respectively. Combined analysis of PCR assays for two genes were significantly more sensitive than ureA or 23S rRNA PCR tests alone (p<0.05 and marginally better than 16S rRNA PCR alone. The best combination was 16S rRNA+ureA, with a sensitivity of 64% and a specificity of 80%. CONCLUSIONS: Real-time PCR improves the detection of H. pylori infection in histology-negative formalin-fixed paraffin-embedded biopsy samples obtained during PUB episodes. The low reported prevalence of H. pylori in PUB may be due to the failure of conventional tests to detect infection.
Directory of Open Access Journals (Sweden)
Feng Q
2018-01-01
Full Text Available Qin Feng,1,* Fei Gai,2,* Yaxiong Sang,2 Jie Zhang,3 Ping Wang,1 Yue Wang,1 Bing Liu,2 Dongmei Lin,1 Yang Yu,2 Jian Fang3 1Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education, Department of Pathology, Peking University Cancer Hospital & Institute, 2Oncology Business Division, Beijing Novogene Bioinformatics Technology Co., Ltd, 3Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education, Department of Thoracic Oncology II, Peking University Cancer Hospital & Institute, Beijing, China *These authors contributed equally to this work Background: The AURA3 clinical trial has shown that advanced non-small cell lung cancer (NSCLC patients with EGFR T790M mutations in circulating tumor DNA (ctDNA could benefit from osimertinib.Purpose: The aim of this study was to assess the usefulness of QuantStudio™ 3D Digital PCR System platform for the detection of plasma EGFR T790M mutations in NSCLC patients, and compare the performances of 3D Digital PCR and ARMS-PCR.Patients and methods: A total of 119 Chinese patients were enrolled in this study. Mutant allele frequency of plasma EGFR T790M was detected by 3D Digital PCR, then 25 selected samples were verified by ARMS-PCR and four of them were verified by next generation sequencing (NGS.Results: In total, 52.94% (69/119 had EGFR T790M mutations detected by 3D Digital PCR. In 69 positive samples, the median mutant allele frequency (AF was 1.09% and three cases presented low concentration (AF <0.1%. Limited by the amount of plasma DNA, 17 samples (AF <2.5% and eight samples (T790M- were selected for verification by ARMS-PCR. Four of those samples were verified by NGS as a third verification method. Among the selected 17 positive cases, ten samples presented mutant allele frequency <0.5%, and seven samples presented intermediate mutant allele frequency (0.5%<AF<2.5%. However, only three samples (3/17 were identified as positive by ARMS-PCR, namely, P6
Directory of Open Access Journals (Sweden)
Gemma J. Robertson
2017-12-01
Full Text Available Strongyloidiasis, which is caused by infection with the nematode Strongyloides stercoralis, is endemic to areas of northern Australia. Diagnosis in this region remains difficult due to the distances between endemic communities and diagnostic laboratories, leading to lengthy delays in stool processing for microscopy and culture. PCR represents a viable solution to this difficulty, having potential for high sensitivity detection of S. stercoralis, even in older, unpreserved faecal samples. We prospectively collected 695 faecal specimens that were submitted to The Townsville Hospital Microbiology Laboratory from the North Queensland region for routine parasitological examination, and subjected them to a Strongyloides sp. real-time (qPCR. Results were confirmed with a novel nested conventional PCR assay targeting the 18S rRNA gene, followed by single-strand conformation polymorphism analysis (SSCP. Of the 695 specimens tested, S. stercoralis was detected in three specimens (0.4% by classical parasitological methods (direct microscopy and formyl-ether acetate concentration, whereas 42 positives were detected by qPCR (6.0%. Conventional PCR confirmed the real-time PCR results in 24 of the samples (3.5%. Several apparent false-positive results occurred at higher cycle times (Ct in the qPCR. Use of real-time PCR in these populations is promising for the enhanced detection of disease and to support eradication efforts.
de Almeida, Marcos E; Koru, Ozgur; Steurer, Francis; Herwaldt, Barbara L; da Silva, Alexandre J
2017-01-01
Leishmaniasis in humans is caused by Leishmania spp. in the subgenera Leishmania and Viannia Species identification often has clinical relevance. Until recently, our laboratory relied on conventional PCR amplification of the internal transcribed spacer 2 (ITS2) region (ITS2-PCR) followed by sequencing analysis of the PCR product to differentiate Leishmania spp. Here we describe a novel real-time quantitative PCR (qPCR) approach based on the SYBR green technology (LSG-qPCR), which uses genus-specific primers that target the ITS1 region and amplify DNA from at least 10 Leishmania spp., followed by analysis of the melting temperature (T m ) of the amplicons on qPCR platforms (the Mx3000P qPCR system [Stratagene-Agilent] and the 7500 real-time PCR system [ABI Life Technologies]). We initially evaluated the assay by testing reference Leishmania isolates and comparing the results with those from the conventional ITS2-PCR approach. Then we compared the results from the real-time and conventional molecular approaches for clinical specimens from 1,051 patients submitted to the reference laboratory of the Centers for Disease Control and Prevention for Leishmania diagnostic testing. Specimens from 477 patients tested positive for Leishmania spp. with the LSG-qPCR assay, specimens from 465 of these 477 patients also tested positive with the conventional ITS2-PCR approach, and specimens from 10 of these 465 patients had positive results because of retesting prompted by LSG-qPCR positivity. On the basis of the T m values of the LSG-qPCR amplicons from reference and clinical specimens, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate; the Leishmania (Leishmania) donovani complex in aggregate; the species L (L) tropica; and the species L (L) mexicana, L (L) amazonensis, L (L) major, and L (L) aethiopica in aggregate. Copyright © 2016 American Society for Microbiology.
Salgado, M; Steuer, P; Troncoso, E; Collins, M T
2013-12-27
Mycobacterium avium subsp. paratuberculosis (MAP) causes paratuberculosis, or Johne's disease, in animals. Diagnosis of MAP infection is challenging because of the pathogen's fastidious in vitro growth requirements and low-level intermittent shedding in feces during the preclinical phase of the infection. Detection of these "low-shedders" is important for effective control of paratuberculosis as these animals serve as sources of infection for susceptible calves. Magnetic separation technology, used in combination with culture or molecular methods for the isolation and detection of pathogenic bacteria, enhances the analytical sensitivity and specificity of detection methods. The aim of the present study was to evaluate peptide-mediated magnetic separation (PMS) capture technology coupled with IS900 PCR using the Roche real-time PCR system (PMS-PCR), in comparison with fecal culture using BACTEC-MGIT 960 system, for detection of MAP in bovine fecal samples. Among the 351 fecal samples 74.9% (263/351) were PMS-PCR positive while only 12.3% (43/351) were MGIT culture-positive (p=0.0001). All 43 MGIT culture-positive samples were also positive by PMS-PCR. Mean PMS-PCR crossing-point (Cp) values for the 13 fecal samples with the highest number of MAP, based on time to detection, (26.3) were significantly lower than for the 17 fecal samples with technology provided results in a shorter time and yielded a higher number of positive results than MGIT culture. Earlier and faster detection of animals shedding MAP by PMS-PCR should significantly strengthen control efforts for MAP-infected cattle herds by helping to limit infection transmission at earlier stages of the infection. Copyright © 2013 Elsevier B.V. All rights reserved.
A Ribeiroia spp. (Class: Trematoda) - Specific PCR-based diagnostic
Reinitz, David M.; Yoshino, T.P.; Cole, Rebecca A.
2007-01-01
Increased reporting of amphibian malformations in North America has been noted with concern in light of reports that amphibian numbers and species are declining worldwide. Ribeiroia ondatrae has been shown to cause a variety of types of malformations in amphibians. However, little is known about the prevalence of R. ondatrae in North America. To aid in conducting field studies of Ribeiroia spp., we have developed a polymerase chain reaction (PCR)-based diagnostic. Herein, we describe the development of an accurate, rapid, simple, and cost-effective diagnostic for detection of Ribeiroia spp. infection in snails (Planorbella trivolvis). Candidate oligonucleotide primers for PCR were designed via DNA sequence analyses of multiple ribosomal internal transcribed spacer-2 regions from Ribeiroia spp. and Echinostoma spp. Comparison of consensus sequences determined from both genera identified areas of sequence potentially unique to Ribeiroia spp. The PCR reliably produced a diagnostic 290-base pair (bp) product in the presence of a wide concentration range of snail or frog DNA. Sensitivity was examined with DNA extracted from single R. ondatrae cercaria. The single-tube PCR could routinely detect less than 1 cercariae equivalent, because DNA isolated from a single cercaria could be diluted at least 1:50 and still yield a positive result via gel electrophoresis. An even more sensitive nested PCR also was developed that routinely detected 100 fg of the 290-bp fragment. The assay did not detect furcocercous cercariae of certain Schistosomatidae, Echinostoma sp., or Sphaeridiotrema globulus nor adults of Clinostomum sp. or Cyathocotyle bushiensis. Field testing of 137 P. trivolvis identified 3 positives with no overt environmental cross-reactivity, and results concurred with microscopic examinations in all cases. ?? American Society of Parasitologists 2007.
PCR melting profile (PCR MP - a new tool for differentiation of Candida albicans strains
Directory of Open Access Journals (Sweden)
Nowak Magdalena
2009-11-01
Full Text Available Abstract Background We have previously reported the use of PCR Melting Profile (PCR MP technique based on using low denaturation temperatures during ligation mediated PCR (LM PCR for bacterial strain differentiation. The aim of the current study was to evaluate this method for intra-species differentiation of Candida albicans strains. Methods In total 123 Candida albicans strains (including 7 reference, 11 clinical unrelated, and 105 isolates from patients of two hospitals in Poland were examined using three genotyping methods: PCR MP, macrorestriction analysis of the chromosomal DNA by pulsed-field gel electrophoresis (REA-PFGE and RAPD techniques. Results The genotyping results of the PCR MP were compared with results from REA-PFGE and RAPD techniques giving 27, 26 and 25 unique types, respectively. The results showed that the PCR MP technique has at least the same discriminatory power as REA-PFGE and RAPD. Conclusion Data presented here show for the first time the evaluation of PCR MP technique for candidial strains differentiation and we propose that this can be used as a relatively simple and cheap technique for epidemiological studies in short period of time in hospital.
Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.
Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B
2010-03-20
This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.
Digital PCR as a tool to measure HIV persistence.
Rutsaert, Sofie; Bosman, Kobus; Trypsteen, Wim; Nijhuis, Monique; Vandekerckhove, Linos
2018-01-30
Although antiretroviral therapy is able to suppress HIV replication in infected patients, the virus persists and rebounds when treatment is stopped. In order to find a cure that can eradicate the latent reservoir, one must be able to quantify the persisting virus. Traditionally, HIV persistence studies have used real-time PCR (qPCR) to measure the viral reservoir represented by HIV DNA and RNA. Most recently, digital PCR is gaining popularity as a novel approach to nucleic acid quantification as it allows for absolute target quantification. Various commercial digital PCR platforms are nowadays available that implement the principle of digital PCR, of which Bio-Rad's QX200 ddPCR is currently the most used platform in HIV research. Quantification of HIV by digital PCR is proving to be a valuable improvement over qPCR as it is argued to have a higher robustness to mismatches between the primers-probe set and heterogeneous HIV, and forfeits the need for a standard curve, both of which are known to complicate reliable quantification. However, currently available digital PCR platforms occasionally struggle with unexplained false-positive partitions, and reliable segregation between positive and negative droplets remains disputed. Future developments and advancements of the digital PCR technology are promising to aid in the accurate quantification and characterization of the persistent HIV reservoir.
Directory of Open Access Journals (Sweden)
Hidenobu Yaku
2013-09-01
Full Text Available An assay for telomerase activity based on asymmetric polymerase chain reaction (A-PCR on magnetic beads (MBs and subsequent application of cycling probe technology (CPT is described. In this assay, the telomerase reaction products are immobilized on MBs, which are then washed to remove PCR inhibitors that are commonly found in clinical samples. The guanine-rich sequences (5'-(TTAGGGn-3' of the telomerase reaction products are then preferentially amplified by A-PCR, and the amplified products are subsequently detected via CPT, where a probe RNA with a fluorophore at the 5' end and a quencher at the 3' end is hydrolyzed by RNase H in the presence of the target DNA. The catalyst-mediated cleavage of the probe RNA enhances fluorescence from the 5' end of the probe. The assay allowed us to successfully detect HeLa cells selectively over normal human dermal fibroblast (NHDF cells. Importantly, this selectivity produced identical results with regard to detection of HeLa cells in the absence and presence of excess NHDF cells; therefore, this assay can be used for practical clinical applications. The lower limit of detection for HeLa cells was 50 cells, which is lower than that achieved with a conventional telomeric repeat amplification protocol assay. Our assay also eliminated false-negative results caused by PCR inhibitors. Furthermore, we show that this assay is appropriate for screening among G-quadruplex ligands to find those that inhibit telomerase activity.
Sensitivity of PCR IS6110 in relation to culture and staining in Pott′s disease
Directory of Open Access Journals (Sweden)
Manoj Kumar
2013-01-01
Full Text Available Background: Rapid diagnosis is essential to decrease the morbidity and mortality of Pott′s disease. The bacteriological methods are time-consuming or insensitive. Polymerase chain reaction (PCR provides a rapid diagnostic tool and hope for early diagnosis of this disease. The aim of this study was to compare and assess of a rapid and effective method among diagnostic battery (Ziehl-Neelsen (ZN microscopy, BACTEC culture and PCR of Pott′s disease. Materials and Methods: Sixty-five specimens from clinico-radiological suspected cases of Pott′s disease were included in this study. They were processed for ZN microscopy, BACTEC culture, and PCR IS6110. The tests tool′s efficiency, positive agreement Kc (Kappa coefficient, and significance level (P value were calculated for correlation between PCR and performed tests. Results: The PCR sensitivity reached to 96% and 46.3% among positive and negative specimens on ZN microscopy. Further, 94% and 36.4% sensitivity were found among positive and negative specimens by BACTEC culture. The total 38 (58.5% specimens were detected either ZN microscopy or by BACTEC culture. Thus, the overall sensitivity and specificity of PCR were 95% and 74.1%. The kappa coefficient and P value, calculated for PCR against BACTEC culture and combined results of performed bacteriological tests were (Kc=0.60, (P<0.001 and (Kc=0.70, (P<0.001, respectively. Above statistical relations showed a fair agreement with significant differences. Conclusion: The PCR IS6110 may be useful in rapid detection of clinico-radiological suspected cases of Pott′s disease and those that are negative with bacteriological methods.
One-stop polymerase chain reaction (PCR): An improved PCR ...
African Journals Online (AJOL)
Yomi
2011-12-21
Dec 21, 2011 ... membrane filtration was carried out with a commercial PCR product purification kit (Generay, Shanghai), according to the manufacture's instruction. In brief, 50 µl PCR product was mixed thoroughly with binding buffer, and the resultant mixture was loaded directly onto a silica membrane Gelclean column.
Automated 5 ' nuclease PCR assay for identification of Salmonella enterica
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Ahrens, Peter; Rådström, P.
2000-01-01
-point fluorescence (FAM) signals for the samples and positive control (TET) signals (relative sensitivity [Delta Rn], >0.6). The diagnostic specificity of the method was assessed using 120 non-Salmonella strains, which all resulted in negative FAM signals (Delta Rn, less than or equal to 0.5). All 100 rough...... Salmonella strains tested resulted in positive FAM and TET signals. In addition, it was found that the complete PCR mixture, predispensed in microwell plates, could be stored for up to 3 months at -20 degrees C, Thus, the diagnostic TaqMan assay developed can be a useful and simple alternative method......A simple and ready-to-go test based on a 5' nuclease (TaqMan) PCR technique was developed for identification of presumptive Salmonella enterica isolates. The results were compared with those of conventional methods. The TaqMan assay was evaluated for its ability to accurately detect 210 S. enterica...
Diagnosis of Cutaneous Leishmaniasis by Multiplex PCR
Directory of Open Access Journals (Sweden)
M Heiat
2010-07-01
Full Text Available Introduction: Annually, more than 14 million people are reported to be infected with Leishmaniasis all over the world. In Iran, this disease is seen in the form of cutaneous and visceral leishmaniasis, of which the cutaneous form is more wide spread. In recent years, cutaneous leishmaniaisis is diagnosed by PCR utilizing specific primers in order to amplify different parasite genes including ribosomal RNA genes, kinetoplast DNA or tandem repeating sequences. The aim of this research was to detect early stage cutaneous leishmaniasis using Multiplex-PCR technique. Methods: In this study, 67 samples were prepared from patients with cutaneous leishmaniasis. DNA was extracted with phenolchloroform. Each specimen was analyzed using two different pairs of PCR primers. The sensitivity of each PCR was optimized on pure Leishmania DNA prior to use for diagnosis. Two standard parasites L. major and L. tropica were used as positive control. Results: DNA amplification fragments were two 115 bp and 683 bp for AB and UL primers, respectively. The sensitivity of two primers was not equal for detection of L. major and L. tropica. The sensivity of PCR with AB primer was 35 cells, while that for UL primer was 40 cells. Conclusion: The results of this study indicate that PCR is a sensitive diagnostic assay for cutaneous leishmaniasis and could be employed as the new standard for routine diagnosis when species identification is not required. However, the ability to identify species is especially important in prognosis of the disease and in deciding appropriate therapy, especially in regions where more than one type of species and disease are seen by clinicians.
International Nuclear Information System (INIS)
Snellenberg, Suzanne; Strooper, Lise MA De; Hesselink, Albertus T; Meijer, Chris JLM; Snijders, Peter JF; Heideman, Daniëlle AM; Steenbergen, Renske DM
2012-01-01
Quantitative methylation-specific PCR (qMSP) analysis for determining the methylation status of (candidate) tumor suppressor genes has potential as objective and valuable test to triage high-risk human papillomavirus (hrHPV) positive women in cervical screening. Particularly combined methylation analysis of a panel of genes shows most promising clinical performance, with sensitivity levels that equal or exceed that of cytology. However, the wide application of such methylation marker panels is hampered by the lack of effective multiplex assays allowing simultaneous methylation detection of various targets in a single reaction. Here, we designed and analyzed a multiplex qMSP assay for three genes whose methylation was previously found to be informative for cervical (pre)cancer (i.e. CADM1, MAL and hsa-miR-124-2) as well as a reference gene β-actin. Based on our experience, we discuss the optimization of the parameters that provide a practical approach towards multiplex qMSP design. Primers and PCR reagents were optimized for multiplex qMSP purposes and the resulting assay was analytically validated on serial dilutions of methylated DNA in unmethylated DNA, and compared with singleplex counterparts on hrHPV-positive cervical scrapings. Upon optimization, including primer redesign and primer limiting assays, the multiplex qMSP showed the same analytical performance as the singleplex qMSPs. A strong correlation between the obtained normalized ratios of the singleplex and multiplex qMSPs on cervical scrapes was found for all three markers: CADM1 (R 2 =0.985), MAL (R 2 =0.986) and hsa-miR-124-2 (R 2 =0.944). Multiplex qMSP offers a promising approach for high-throughput diagnostic analysis of the methylation status of multiple genes, which after proper design and validation can be equally specific, sensitive and reproducible as its singleplex versions
Detection of Streptococcus pneumoniae in whole blood by PCR.
Zhang, Y; Isaacman, D J; Wadowsky, R M; Rydquist-White, J; Post, J C; Ehrlich, G D
1995-03-01
Streptococcus pneumoniae is a major cause of bacteremia in both children and adults. Currently, the diagnosis of pneumococcal bacteremia relies on the isolation and identification of the bacteria from blood cultures. We have developed a sensitive assay for the detection of S. pneumoniae in whole blood by the PCR. A specific primer-probe set (JM201 and JM202 primers with JM204 probe) designed from the penicillin-binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S. pneumoniae DNA. This assay system was shown to be inclusive for all strains of S. pneumoniae evaluated, including 15 different serotypes and a battery of penicillin-resistant and -sensitive strains. The specificity of this PCR-based assay was demonstrated by its inability to support amplification from a series of human, bacterial, and yeast genomic DNAs. A general specimen preparation method which should be suitable for the purification of DNA from any pathogens in whole blood was developed. With this protocol it was possible to detect S. pneumoniae-specific DNA from whole blood specimens inoculated with as little as 4 CFU/ml. Copurified human blood DNA, ranging from 0 to 4.5 micrograms per PCR, did not affect the sensitivity of S. pneumoniae detection by PCR. A blinded clinical trial was used to compare the PCR-based assay with standard microbiological blood culture for the detection of S. pneumoniae bacteremia in 36 specimens obtained from pediatric patients seen in the emergency room of Children's Hospital of Pittsburgh. With culture as the "gold standard," the PCR-based assay had a sensitivity of 80% (4 of 5 culture-positive specimens were PCR positive) and a specificity of 84% (26 of 31 culture-negative specimens were PCR negative). However, three patients whose specimens were PCR positive and culture negative had histories suggestive of bacteremia, including recent positive blood cultures, treatment with antibiotics, cellulitis, and multiple
Gilardoni, Liliana Rosa; Fernández, Bárbara; Morsella, Claudia; Mendez, Laura; Jar, Ana María; Paolicchi, Fernando Alberto; Mundo, Silvia Leonor
2016-01-01
The aim of this study was to standardize a diagnosis procedure to detect Mycobacterium avium subsp. paratuberculosis (Map) DNA in raw cow milk samples under field conditions. A procedure that combines both immunomagnetic separation and IS900-PCR detection (IMS-IS1 PCR) was employed on milk samples from 265 lactating Holstein cows from Map infected and uninfected herds in Argentina. IMS-IS1 PCR results were analyzed and compared with those obtained from milk and fecal culture and serum ELISA. The extent of agreement between both tests was determined by the Kappa test. IMS-IS1 PCR showed a detection limit of 10(1) CFU of Map/mL of milk, when 50:50 mix of monoclonal and polyclonal antibodies were used to coat magnetic beads. All of the 118 samples from the Map uninfected herds were negative for the set of the tests. In Map infected herds, 80 out of 147 cows tested positive by milk IMS-IS1 PCR (55%), of which 2 (1.4%) were also positive by milk culture, 15 (10%) by fecal culture, and 20 (14%) by serum ELISA. Kappa statistics (95% CI) showed a slight agreement between the different tests (<0.20), and the proportions of agreement were ≤0.55. The IMS-IS1 PCR method detected Map in milk of the cows that were not positive in other techniques. This is the first report dealing with the application of IMS-IS1 PCR in the detection of Map in raw milk samples under field conditions in Argentina. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1.
Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Kláudia S G; Ramos, Carlos Alberto N; Filho, Antonio Francisco S; Vidal, Carlos Eugênio S; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F; Júnior, Antônio A F; Silva, Marcio R; Neto, José Diomedes B; Cerqueira, Valíria D; Zumárraga, Martín J; Araújo, Flábio R
2014-01-01
In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.
International Nuclear Information System (INIS)
Andrade, Antero Silva Ribeiro de; Moreno, Elizabeth Castro; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela; Fernandes, Octavio
2002-01-01
Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with 32 P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with 32 P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)
International Nuclear Information System (INIS)
Denman, S.E.; McSweeney, C.S.
2005-01-01
Many nucleic acid-based probe and PCR assays have been developed for the detection tracking of specific microbes within the rumen ecosystem. Conventional PCR assays detect PCR products at the end stage of each PCR reaction, where exponential amplification is no longer being achieved. This approach can result in different end product (amplicon) quantities being generated. In contrast, using quantitative, or real-time PCR, quantification of the amplicon is performed not at the end of the reaction, but rather during exponential amplification, where theoretically each cycle will result in a doubling of product being created. For real-time PCR, the cycle at which fluorescence is deemed to be detectable above the background during the exponential phase is termed the cycle threshold (Ct). The Ct values obtained are then used for quantitation, which will be discussed later
Detection of Cutaneous Leishmaniasis by PCR in Fasa district in 2012
Directory of Open Access Journals (Sweden)
Mehdi Sharafi
2013-09-01
Material & Methods: Slit biopsies were collected from 138 suspected cases of cutaneous leishmaniasis who were presented, consecutively, in Fasa district from April 2011 to February 2012. After the microscopy, the entire smear was then scraped off the slide surface for DNA extraction and PCR assay. Results: All 138 investigated smears were reported positive by microscopy and nested PCR assay. In PCR, One of the smears had the 750-bp band, indicative of L. tropica and the rest had the 560-bp band indicative of L. major. Conclusion: In conclusion, the cutaneous leishmaniasis found in Fasa district is predominantly Rural Cutaneous Leishmaniasis. The PCR-based assay used in the present study appears to be a suitable and powerful tool for the characterization of Leishmanial species.
Detecting the presence of infectious hepatitis A virus in molluscs positive to RT-nested-PCR
Medici, de D.; Croci, L.; Pasquale, di S.; Fiore, A.; Toti, L.
2001-01-01
Aims: The objective of this study was to det. the presence of infectious hepatitis A virus (HAV) in molluscs naturally contaminated with viral HAV-RNA. Methods and Results: One hundred and forty-two mollusc samples were analyzed for the presence of viral HAV-RNA using RT-nested-PCR; pos. samples
Caviglia, Gian Paolo; Abate, Maria Lorena; Tandoi, Francesco; Ciancio, Alessia; Amoroso, Antonio; Salizzoni, Mauro; Saracco, Giorgio Maria; Rizzetto, Mario; Romagnoli, Renato; Smedile, Antonina
2018-04-02
The accurate diagnosis of occult HBV infection (OBI) requires the demonstration of HBV DNA in liver biopsies of HBsAg-negative subjects. However, in clinical practice a latent OBI is deduced by the finding of the antibody to the HB-core antigen (anti-HBc). We investigated the true prevalence of OBI and the molecular features of intrahepatic HBV in anti-HBc-positive subjects. The livers of 100 transplant donors (median age 68.2 years; 64 males, 36 females) positive for anti-HBc at standard serologic testing, were examined for total HBV DNA by nested-PCR and for the HBV covalently closed circular DNA (HBV cccDNA) with an in-house droplet digital PCR assay (ddPCR) (Linearity: R 2 = 0.9998; lower limit of quantitation and detection of 2.4 and 0.8 copies/10 5 cells, respectively). A true OBI status was found in 52% (52/100) of the subjects and cccDNA was found in 52% (27/52) of the OBI-positive, with a median 13 copies/10 5 cells (95% confidence interval 5-25). Using an assay specific for anti-HBc of IgG class, the median antibody level was significantly higher in HBV cccDNA-positive than negative donors (5.7 [3.6-9.7] vs. 17.0 [7.0-39.2] COI, p = 0.007). By multivariate analysis, an anti-HBc IgG value above a 4.4 cut-off index (COI) was associated with the finding of intrahepatic HBV cccDNA (OR = 8.516, p = 0.009); a lower value ruled out its presence with a negative predictive value of 94.6%. With a new in-house ddPCR-based method, intrahepatic HBV cccDNA was detectable in quantifiable levels in about half of the OBI cases examined. The titer of anti-HBc IgG may be a useful surrogate to predict the risk of OBI reactivation in immunosuppressed patients. The covalently closed circular DNA (cccDNA) form of the Hepatitis B virus (HBV) sustains the persistence of the virus even after decades of resolution of the florid infection (Occult HBV infection=OBI). In the present study we developed an highly sensitive method based on droplet digital PCR technology for the detection
Directory of Open Access Journals (Sweden)
Chung Hyun-Jae
2010-09-01
Full Text Available Abstract Background The aim of this study was to determine the prevalence of human papillomavirus (HPV and 15 species that cause sexually transmitted infections (STIs in negative cytology. In addition, we compared the diagnostic performance of multiplex polymerase chain reaction (PCR with widely available techniques used to detect HPV. Methods We recruited 235 women of reproductive age who had negative cytology findings in a liquid-based cervical smear. STIs were identified by multiplex PCR, and HPV genotypes by multiplex PCR, hybrid capture 2, and DNA microaray; discordant results were analyzed by direct sequencing. Results Approximately 96.6% of patients with negative cytology results were positive for pathogens that cause STIs. The pathogens most frequently detected were Gardnerella vaginalis, Ureaplasma urealyticum. The incidence of HPV in negative cytology was 23.3%. Low-risk HPV infection was significantly correlated with Chalmaydia trachomatis, and high-risk HPV infection was significantly correlated with Group β streptococcus. The analytical sensitivities of the multiplex PCR and DNA microarray were higher than 80%, and the analytical specificity was nearly 100% for all tests. Conclusions Multiplex PCR yielded results that most of patients with negative cytology were positive for pathogens that cause STIs, and were more similar to that of DNA microarray, than that of hybrid capture 2 in terms of analytical sensitivity and prediction value of HPV infection.
Meylan, Sylvain; Robert, Daniel; Estrade, Christine; Grimbuehler, Valérie; Péter, Olivier; Meylan, Pascal R; Sahli, Roland
2008-02-01
HSV-1 and HSV-2 cause CNS infections of dissimilar clinico-pathological characteristics with prognostic and therapeutic implications. To validate a type-specific real-time PCR that uses MGB/LNA Taqman probes and to review the virologico-clinical data of 25 eligible patients with non-neonatal CNS infections. This real-time PCR was evaluated against conventional PCR (26 CSF and 20 quality controls), and LightCycler assay (51 mucocutaneous, 8 CSF and 32 quality controls) and culture/immunofluorescence (75 mucocutaneous) to assess typing with independent methods. Taqman real-time PCR detected 240 HSV genomes per ml CSF, a level appropriate for the management of patients, and provided unambiguous typing for the 104 positive (62 HSV-1 and 42 HSV-2) out the 160 independent clinical samples tested. HSV type diagnosed by Taqman real-time PCR predicted final diagnosis (meningitis versus encephalitis/meningoencephalitis, p<0.001) in 24/25 patients at time of presentation, in contrast to clinical evaluation. Our real-time PCR, as a sensitive and specific means for type-specific HSV diagnosis, provided rapid prognostic information for patient management.
Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.
Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek
2013-12-01
Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Siska Irhamnawati Pulogu
2017-07-01
Full Text Available Witches‘ broom of peanut caused by phytoplasma is a common disease found in Indonesia. Phytoplasma is able to be detected using polymerase chain reaction (PCR technique. One of important factor which determine the successful of phytoplasma amplification is the DNA availability from fresh tissues. The research was aimed to evaluate some preservation methods of phytoplasma from infected plant samples. The aspects to be evaluated consisted of time (1, 2, 3, and 4 weeks, temperature (-20 °C, 4 °C, and 25 °C, and preservation medium (1X PGB buffer, 3 M NaCl, CTAB buffer, 70% ethanol, non medium, and FTA-card for storing the fresh phytoplasma infected samples. Good preservation method will optimize the phytoplasma DNA amplification using PCR standard technique followed by nested-PCR. The results showed that preservation of samples at -20 °C, 4 °C, and 25 °C in CTAB buffer was able to maintain the tissue freshness for 4 weeks and was able to provide the DNA of either quality or quantity sufficiently for PCR detection. PCR standard using a primer pair P1/P7 showed that not all of the preserved DNA of phytoplasma were amplified positively. However, standard PCR followed by nested-PCR using primer pair fU5/rU3 was able to increase the DNA detectability. Preserved samples derived from various medium and stored for 4 weeks gave positive results. This results were in contrary with previous same samples which were detected negatively by standard PCR technique.
Directory of Open Access Journals (Sweden)
Adriana Cortez
2015-12-01
Full Text Available The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS were collected from 68 dogs and tested by direct immunofluorescence test (RFID and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotein decoding. Fifty-nine samples were positive for RIFD, 40 for RT-PCR (Kappa = 0.358 and 54 for hnRT-PCR (Kappa = 0.740. All nine RIFD negative samples were also negative for RT-PCR and hnRT-PCR. In spite of the storage duration and proper sample conditions, the estimated accordance between hnRT-PCR and RIFD demonstrated that hnRT-PCR technique can be applied in retrospective studies.
Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi
2017-08-15
Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.
Murcia, L; Carrilero, B; Ferrer, F; Roig, M; Franco, F; Segovia, M
2016-11-01
Cure assessment in chronic Trypanosoma cruzi infection is controversial, mainly because of the lack of reliable tests to ensure parasite elimination. Here, we assess the impact of benznidazole therapy on the conventional serology and parasitaemia in chronic Chagas disease. A total of 455 patients with long-term Trypanosoma cruzi infection underwent specific chemotherapy with benznidazole. Their parasitological status was assessed by polymerase chain reaction (PCR) detection of T. cruzi DNA. Drops in the titres of antibody levels were serially measured by indirect immunofluorescence assay (IFI) and chemiluminescent microparticle immunoassay (CMIA). Patients were monitored during the treatment period and for a further 90, 150 and 240 days. Controls were repeated yearly during the 7-year follow-up. The PCR result was negative in all patients between 60-day (n = 22) and 90-day (n = 294) controls. Treatment failure was detected in 45 patients and was significantly more frequent in those who did not complete the therapy [12 out of 13 (92 %) vs. 33 out of 442 (7 %)] (p = 0.0001). A significant drop in serum titres was detected after the first follow-up year in patients with sustained negative PCR results: 2nd year (p = 0.029 by IFI; p = 0.002 by CMIA), 5th year (p = 0.036 by IFI; p = 0.039 by CMIA) and 6th year (p = 0.028 by IFI; p = 0.019 by CMIA). The results point to a beneficial effect of benznidazole and may be the cure of chronic patients who had a consistently negative PCR result throughout the follow-up period.
A PCR-based strategy for simple and rapid identification of rough presumptive Salmonella isolates
DEFF Research Database (Denmark)
Hoorfar, Jeffrey; Baggesen, Dorte Lau; Porting, P.H.
1999-01-01
The purpose of the present study was to investigate the application of ready-to-go Salmonella PCR tests, based on dry chemistry, for final identification of rough presumptive Salmonella isolates. The results were compared with two different biotyping methods performed at two different laboratories......, which did not result in any DNA band. A total of 32 out of the 36 rough presumptive isolates were positive in the PCR. All but one isolate were also identified as Salmonella by the two biochemical methods. All 80 Salmonella strains were also tested in the two multiplex serogroup tests based on PCR beads....... The sensitivity of the BAX Salmonella PCR test was assessed by testing a total of 80 Salmonella isolates, covering most serogroups, which correctly identified all the Salmonella strains by resulting in one 800-bp band in the sample tubes. The specificity of the PCR was assessed using 20 non-Salmonella strains...
RT-PCR Detection of HIV in Republic of Macedonia
Directory of Open Access Journals (Sweden)
Golubinka Bosevska
2008-11-01
Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is
van de Groep, Kirsten; Bos, Martine P; Savelkoul, Paul H M; Rubenjan, Anna; Gazenbeek, Christel; Melchers, Willem J G; van der Poll, Tom; Juffermans, Nicole P; Ong, David S Y; Bonten, Marc J M; Cremer, Olaf L
2018-04-26
Molecular tests may enable early adjustment of antimicrobial therapy and be complementary to blood culture (BC) which has imperfect sensitivity in critically ill patients. We evaluated a novel multiplex real-time PCR assay to diagnose bloodstream pathogens directly in whole blood samples (BSI-PCR). BSI-PCR included 11 species- and four genus-specific PCRs, a molecular Gram-stain PCR, and two antibiotic resistance markers. We collected 5 mL blood from critically ill patients simultaneously with clinically indicated BC. Microbial DNA was isolated using the Polaris method followed by automated DNA extraction. Sensitivity and specificity were calculated using BC as reference. BSI-PCR was evaluated in 347 BC-positive samples (representing up to 50 instances of each pathogen covered by the test) and 200 BC-negative samples. Bacterial species-specific PCR sensitivities ranged from 65 to 100%. Sensitivity was 26% for the Gram-positive PCR, 32% for the Gram-negative PCR, and ranged 0 to 7% for yeast PCRs. Yeast detection was improved to 40% in a smaller set-up. There was no overall association between BSI-PCR sensitivity and time-to-positivity of BC (which was highly variable), yet Ct-values were lower for true-positive versus false-positive PCR results. False-positive results were observed in 84 (4%) of the 2200 species-specific PCRs in 200 culture-negative samples, and ranged from 0 to 6% for generic PCRs. Sensitivity of BSI-PCR was promising for individual bacterial pathogens, but still insufficient for yeasts and generic PCRs. Further development of BSI-PCR will focus on improving sensitivity by increasing input volumes and on subsequent implementation as a bedside test.
Fikatas, A; Dimitriou, T G; Kyriakopoulou, Z; Moschonas, G D; Amoutzias, G D; Mossialos, D; Gartzonika, C; Levidiotou-Stefanou, S; Markoulatos, P
2017-09-01
In this report a strand specific RT-PCR was established for the detection of the replicative negative RNA strand of poliovirus sabin 1 (Sabin1) and Echovirus 19 (E19) strains. The key for the successful conduction of the assay was the use of a specific reverse transcription primer targeting the 5'-UTR of enteroviruses that consisted of a stem-loop structure at the 5'-end and an enteroviral-specific sequence at the 3'-end. The stem loop RT-PCR was found to be an accurate and sensitive method, detecting even 10 -2 CCID 50 of poliovirus sabin 1 (Sabin1) and E19 strains 6 h postinfection (p.i.), while CPE appeared 3 days later. This assay was also validated in SiHa and Caski cell lines that are not used for the detection of enteroviruses. The negative RNA strand was detected 6 h and 12 h p.i. in SiHa and Caski cells, when these cell lines were inoculated with 10 5 and 1 CCID 50 respectively, whereas CPE was observed 5 days p.i for SiHa cells and 8 days p.i for Caski cells and that only at 10 5 CCID 50 . The results show that this approach may be used for replacing the time-consuming cell cultures in order to detect the active replication of enteroviruses. Enteroviruses are positive stranded RNA viruses that may cause severe diseases. The conventional method for detection of active viral replication involves virus isolation in sensitive cell cultures followed by titration and seroneutralization. In this report, we describe the use of a stem-loop secondary structured oligonucleotide in RT-PCR assay for the detection of the replicative negative strand of the positive-stranded RNA of poliovirus sabin 1 and E19 strains. This approach proved to be a useful tool that may be used for replacing the time-consuming cell culture assays in order to detect the active replication of enteroviruses. © 2017 The Society for Applied Microbiology.
Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M
2014-05-01
A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.
Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio
2013-01-01
Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples' storage or conditions for handling and DNA preservation and extraction methods. We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patients urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used.
Elges, Sandra; Arnold, Renate; Liesenfeld, Oliver; Kofla, Grzegorz; Mikolajewska, Agata; Schwartz, Stefan; Uharek, Lutz; Ruhnke, Markus
2017-12-01
We prospectively evaluated a multiplex real-time PCR assay (SeptiFast, SF) in a cohort of patients undergoing allo-BMT in comparison to an in-house PCR method (IH-PCR). Overall 847 blood samples (mean 8 samples/patient) from 104 patients with haematological malignancies were analysed. The majority of patients had acute leukaemia (62%) with a mean age of 52 years (54% female). Pathogens could be detected in 91 of 847 (11%) samples by SF compared to 38 of 205 (18.5%) samples by BC, and 57 of 847 (6.7%) samples by IH-PCR. Coagulase-negative staphylococci (n=41 in SF, n=29 in BC) were the most frequently detected bacteria followed by Escherichia coli (n=9 in SF, n=6 in BC). Candida albicans (n=17 in SF, n=0 in BC, n=24 in IH-PCR) was the most frequently detected fungal pathogen. SF gave positive results in 5% of samples during surveillance vs in 26% of samples during fever episodes. Overall, the majority of blood samples gave negative results in both PCR methods resulting in 93% overall agreement resulting in a negative predictive value of 0.96 (95% CI: 0.95-0.97), and a positive predictive value of 0.10 (95% CI: -0.01 to 0.21). SeptiFast appeared to be superior over BC and the IH-PCR method. © 2017 Blackwell Verlag GmbH.
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.
De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda
2018-04-01
Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.
Piñero, A; Barandika, J F; Hurtado, A; García-Pérez, A L
2014-04-01
Bulk-tank milk (BTM) samples are frequently used to evaluate the health status of dairy livestock. A large-scale investigation carried out in BTM samples from dairy cattle herds from a Q fever-endemic region in Northern Spain revealed a high degree of exposure to Coxiella burnetii. This study was aimed at assessing the value of BTM samples analysis as an indicator of the C. burnetii status in dairy cattle herds. Three herds with BTM samples positive for C. burnetii by ELISA and PCR were selected, and blood, faeces and individual milk and BTM samples were analysed by serology and PCR. In spite of the high antibodies titres found in BTM samples, only one of the three farms presented an active infection by C. burnetii, as revealed by the presence of bacterial DNA in vaginal mucus and in environmental samples collected in the calving area, a seroprevalence around 40% in heifers and the seroconversion rate observed in cows. Results obtained indicated that the analysis of BTM samples is a good epidemiological tool at the population level that can be used to discriminate between seropositive and seronegative herds, but at the herd level, additional tests are necessary to evaluate whether Q fever is a potential problem in the farm. When Q fever is suspected in a cattle herd, sera from a small group of 1- to 3-year-old animals need to be analysed to investigate recent contact with C. burnetii. © 2012 Blackwell Verlag GmbH.
Directory of Open Access Journals (Sweden)
Isabel G. Fernández de Mera
2017-07-01
Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging tick-borne zoonotic disease caused by the CCHF virus (CCHFV. In this study, an experimental approach combining RT-PCR and proteomics was used for the identification and characterization of CCHFV in 106 ticks from 7 species that were collected from small ruminants in Greece. The methodological approach included an initial screening for CCHFV by RT-PCR followed by proteomics analysis of positive and control negative tick samples. This novel approach allowed the identification of CCHFV-positive ticks and provided additional information to corroborate the RT-PCR findings using a different approach. Two ticks, Dermacentor marginatus and Haemaphysalis parva collected from a goat and a sheep, respectively were positive for CCHFV. The sequences for CCHFV RNA segments S and L were characterized by RT-PCR and proteomics analysis of tick samples, respectively. These results showed the possibility of combining analyses at the RNA and protein levels using RT-PCR and proteomics for the characterization of CCHFV in ticks. The results supported that the CCHFV identified in ticks are genetic variants of the AP92 strain. Although the AP92-like strains probably do not represent a high risk of CCHF to the population, the circulation of genetically diverse CCHFV strains could potentially result in the appearance of novel viral genotypes with increased pathogenicity and fitness.
[Evaluation of cytomegalovirus quantification in blood by the R-gene real-time PCR test].
Marque-Juillet, S; Touzard, A; Monnier, S; Fernand-Laurent, C; Therby, A; Rigaudeau, S; Harzic, M
2010-04-01
Diagnosing the presence of cytomegalovirus (CMV) in the blood of immunodepressed patients is often done by quantitative polymerase chain reaction (Q-PCR) even though the reference method remains the antigenemia pp65 (Ag-pp65) test. To define the predictive value of the Q-PCR in the diagnosis of CMV disease and assess treatment efficacy using the CMV R-gene test. To compare the Q-PCR results and feasibility with those of the Ag-pp65 test. The Q-PCR was performed in 34 whole blood samples (frozen at -80 degrees C until use) from five patients diagnosed with CMV disease, defined as the presence of clinical signs and Ag-pp65 in the nuclei of more than two cells. After extraction, viral DNA was quantified in each sample using the Q-PCR CMV R-gene kit according to the manufacturer's instructions. Immediately after blood was drawn, the Ag-pp65 test had been performed in 32 samples using CINAkit (Argene). The 16 samples positive by the Ag-pp65 test were also positive by PCR; six samples negative by the Ag-pp65 test were positive by PCR; and the remaining 10 samples were negative by both techniques. During treatment, the two markers' kinetics were similar. The CMV R-gene test has a predictive value as good as that of the Ag-pp65 test but is fast and easier to use. A prospective study with a greater number of patients is needed to define the prediction threshold for CMV disease. Copyright 2009 Elsevier Masson SAS. All rights reserved.
Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim
2012-10-01
Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Helene Wahlström
2016-03-01
Full Text Available Introduction: A semi-automated magnetic capture probe-based DNA extraction and real-time PCR method (MC-PCR, allowing for a more efficient large-scale surveillance of Echinococcus multilocularis occurrence, has been developed. The test sensitivity has previously been evaluated using the sedimentation and counting technique (SCT as a gold standard. However, as the sensitivity of the SCT is not 1, test characteristics of the MC-PCR was also evaluated using latent class analysis, a methodology not requiring a gold standard. Materials and methods: Test results, MC-PCR and SCT, from a previous evaluation of the MC-PCR using 177 foxes shot in the spring (n=108 and autumn 2012 (n=69 in high prevalence areas in Switzerland were used. Latent class analysis was used to estimate the test characteristics of the MC-PCR. Although it is not the primary aim of this study, estimates of the test characteristics of the SCT were also obtained. Results and discussion: This study showed that the sensitivity of the MC-PCR was 0.88 [95% posterior credible interval (PCI 0.80–0.93], which was not significantly different than the SCT, 0.83 (95% PCI 0.76–0.88, which is currently considered as the gold standard. The specificity of both tests was high, 0.98 (95% PCI 0.94–0.99 for the MC-PCR and 0.99 (95% PCI 0.99–1 for the SCT. In a previous study, using fox scats from a low prevalence area, the specificity of the MC-PCR was higher, 0.999% (95% PCI 0.997–1. One reason for the lower estimate of the specificity in this study could be that the MC-PCR detects DNA from infected but non-infectious rodents eaten by foxes. When using MC-PCR in low prevalence areas or areas free from the parasite, a positive result in the MC-PCR should be regarded as a true positive. Conclusion: The sensitivity of the MC-PCR (0.88 was comparable to the sensitivity of SCT (0.83.
Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D
2018-06-01
We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.
Platts-Mills, James A.; Liu, Jie; Gratz, Jean; Mduma, Esto; Amour, Caroline; Swai, Ndealilia; Taniuchi, Mami; Begum, Sharmin; Peñataro Yori, Pablo; Tilley, Drake H.; Lee, Gwenyth; Shen, Zeli; Whary, Mark T.; Fox, James G.; McGrath, Monica; Kosek, Margaret; Haque, Rashidul
2014-01-01
Campylobacter is a common bacterial enteropathogen that can be detected in stool by culture, enzyme immunoassay (EIA), or PCR. We compared culture for C. jejuni/C. coli, EIA (ProSpecT), and duplex PCR to distinguish Campylobacter jejuni/C. coli and non-jejuni/coli Campylobacter on 432 diarrheal and matched control stool samples from infants in a multisite longitudinal study of enteric infections in Tanzania, Bangladesh, and Peru. The sensitivity and specificity of culture were 8.5% and 97.6%, respectively, compared with the results of EIA and 8.7% and 98.0%, respectively, compared with the results of PCR for C. jejuni/C. coli. Most (71.6%) EIA-positive samples were positive by PCR for C. jejuni/C. coli, but 27.6% were positive for non-jejuni/coli Campylobacter species. Sequencing of 16S rRNA from 53 of these non-jejuni/coli Campylobacter samples showed that it most closely matched the 16S rRNA of C. hyointestinalis subsp. lawsonii (56%), C. troglodytis (33%), C. upsaliensis (7.7%), and C. jejuni/C. coli (2.6%). Campylobacter-negative stool spiked with each of the above-mentioned Campylobacter species revealed reactivity with EIA. PCR detection of Campylobacter species was strongly associated with diarrhea in Peru (odds ratio [OR] = 3.66, P < 0.001) but not in Tanzania (OR = 1.56, P = 0.24) or Bangladesh (OR = 1.13, P = 0.75). According to PCR, Campylobacter jejuni/C. coli infections represented less than half of all infections with Campylobacter species. In sum, in infants in developing country settings, the ProSpecT EIA and PCR for Campylobacter reveal extremely high rates of positivity. We propose the use of PCR because it retains high sensitivity, can ascertain burden, and can distinguish between Campylobacter infections at the species level. PMID:24452175
Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S
Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.
Straub, Julia; Paula, Helga; Mayr, Michaela; Kasper, David; Assadian, Ojan; Berger, Angelika; Rittenschober-Böhm, Judith
2017-01-01
Diagnosis of neonatal sepsis remains a major challenge in neonatology. Most molecular-based methods are not customized for neonatal requirements. The aim of the present study was to assess the diagnostic accuracy of a modified multiplex PCR protocol for the detection of neonatal sepsis using small blood volumes. 212 episodes of suspected neonatal late onset sepsis were analyzed prospectively using the Roche SeptiFast® MGRADE PCR with a modified DNA extraction protocol and software-handling tool. Results were compared to blood culture, laboratory biomarkers and clinical signs of sepsis. Of 212 episodes, 85 (40.1%) were categorized as "not infected". Among these episodes, 1 was false positive by blood culture (1.2%) and 23 were false positive by PCR (27.1%). Of 51 (24.1%) episodes diagnosed as "culture proven sepsis", the same pathogen was detected by blood culture and PCR in 39 episodes (76.5%). In 8 episodes, more pathogens were detected by PCR compared to blood culture, and in 4 episodes the pathogen detected by blood culture was not found by PCR. One of these episodes was caused by Bacillus cereus, a pathogen not included in the PCR panel. In 76/212 (35.8%) episodes, clinical sepsis was diagnosed. Among these, PCR yielded positive results in 39.5% of episodes (30/76 episodes). For culture-positive sepsis, PCR showed a sensitivity of 90.2% (95%CI 86.2-94.2%) and a specificity of 72.9% (95%CI 67.0-79.0%). The Roche SeptiFast® MGRADE PCR using a modified DNA extraction protocol showed acceptable results for rapid detection of neonatal sepsis in addition to conventional blood culture. The benefit of rapid pathogen detection has to be balanced against the considerable risk of contamination, loss of information on antibiotic sensitivity pattern and increased costs.
Directory of Open Access Journals (Sweden)
Michelle de Campos Soriani Azevedo
2017-01-01
Full Text Available Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR, a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV and negative (NPV predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H, the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease.
Azevedo, Michelle de Campos Soriani; Ramuno, Natália Mortari; Fachin, Luciana Raquel Vincenzi; Tassa, Mônica; Rosa, Patrícia Sammarco; Belone, Andrea de Faria Fernandes; Diório, Suzana Madeira; Soares, Cleverson Teixeira; Garlet, Gustavo Pompermaier; Trombone, Ana Paula Favaro
Leprosy, whose etiological agent is Mycobacterium leprae, is a chronic infectious disease that mainly affects the skin and peripheral nervous system. The diagnosis of leprosy is based on clinical evaluation, whereas histopathological analysis and bacilloscopy are complementary diagnostic tools. Quantitative PCR (qPCR), a current useful tool for diagnosis of infectious diseases, has been used to detect several pathogens including Mycobacterium leprae. The validation of this technique in a robust set of samples comprising the different clinical forms of leprosy is still necessary. Thus, in this study samples from 126 skin biopsies (collected from patients on all clinical forms and reactional states of leprosy) and 25 slit skin smear of leprosy patients were comparatively analyzed by qPCR (performed with primers for the RLEP region of M. leprae DNA) and routine bacilloscopy performed in histological sections or in slit skin smear. Considering clinical diagnostic as the gold standard, 84.9% of the leprosy patients were qPCR positive in skin biopsies, resulting in 84.92% sensitivity, with 84.92 and 61.22% positive (PPV) and negative (NPV) predictive values, respectively. Concerning bacilloscopy of histological sections (BI/H), the sensitivity was 80.15% and the PPV and NPV were 80.15 and 44.44%, respectively. The concordance between qPCR and BI/H was 87.30%. Regarding the slit skin smear, 84% of the samples tested positive in the qPCR. Additionally, qPCR showed 100% specificity, since all samples from different mycobacteria, from healthy individuals, and from other granulomatous diseases presented negative results. In conclusion, the qPCR technique for detection of M. leprae using RLEP primers proved to be specific and sensitive, and qPCR can be used as a complementary test to diagnose leprosy irrespective of the clinical form of disease. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
[Quantitative fluorogenic real-time PCR assay for respiratory syncytial virus detection].
Zhang, Qi-wei; You, Shang-you; Sun, Ji-min; Wu, Qi; Yu, Chun-hua; Zhang, Chu-yu
2005-07-01
To Establish a rapid and objective quantitative fluorogenic real-time PCR assay for early detection of human respiratory syncytial virus (hRSV). Two pairs of primers and one TaqMan Fluorogenic probe that are specific for the recognition of the most conservative N gene of hRSV for virus detection with LighCycler PCR in 93 nasopharyngeal secretion specimens collected from infants and young children. The assay was compared with virus isolation, routine PCR, nested PCR, and enzyme-linked immunosorbent assay (ELISA). This TaqMan assay had a sensitivity of 1 x 10(2) cDNA copies/microl with a dynamic range between 1 x 10(2) and 1 x 10(7) cDNA copies/microl, which was the same as that of nested PCR, but 10 times more sensitive than routine PCR. The specificity of the assay was evaluated by comparing hRSV with polivirus type 1, coxsackie virus type 2, influenza A, influenza B and adenovirus type 7. A PCR product of the expected size (195 bp) was produced and fluorescence signal detected for hRSV, but not for any of the other viruses. The results in LightCycler and Rotor-Gene instrument were consistent. Forty-four specimens (43.9%) were hRSV-positive with this assay and 4 (4/93,4.3%) were hRSV-positive with ELISA, showing rather low correlation between the two methods. No visible relation was found between the concentration of hRSV RNA and severity of the disease. This assay is rapid, sensitive, specific and quantitative, and has the potential of wide application for early diagnosis of hRSV infection and evaluation of the therapeutic effect.
Standardization of the PCR technique for the detection of delta toxin in Staphylococcus spp.
Directory of Open Access Journals (Sweden)
C. Marconi
2005-06-01
Full Text Available Coagulase-negative staphylococci (CNS, components of the normal flora of neonates, have emerged as important opportunistic pathogens of nosocomial infections that occur in neonatal intensive care units. Some authors have reported the ability of some CNS strains, particularly Staphylococcus epidermidis, to produce a toxin similar to S. aureus delta toxin. This toxin is an exoprotein that has a detergent action on the membranes of various cell types resulting in rapid cell lysis. The objectives of the present study were to standardize the Polymerase Chain Reaction (PCR technique for the detection of the gene responsible for the production of delta toxin (hld gene in staphylococcal species isolated from catheters and blood cultures obtained from neonates, and to compare the results to those obtained with the phenotypic synergistic hemolysis method. Detection of delta toxin by the phenotypic and genotypic method yielded similar results for the S. aureus isolates. However, in S. epidermidis, a higher positivity was observed for PCR (97.4% compared to the synergistic hemolysis method (86.8%. Among CNS, S. epidermidis was the most frequent isolate and was a delta toxin producer. Staphylococcus simulans and S. warneri tested positive by the phenotypic method, but their positivity was not confirmed by PCR for the hld gene detection. These results indicate that different genes might be responsible for the production of this toxin in different CNS species, requiring highly specific primers for their detection. PCR was found to be a rapid and reliable method for the detection of the hld gene in S. aureus and S. epidermidis.
Stachelska, M A
2017-09-26
The aim of the present study was to establish a rapid and accurate real-time PCR method to detect pathogenic Yersinia enterocolitica in pork. Yersinia enterocolitica is considered to be a crucial zoonosis, which can provoke diseases both in humans and animals. The classical culture methods designated to detect Y. enterocolitica species in food matrices are often very time-consuming. The chromosomal locus _tag CH49_3099 gene, that appears in pathogenic Y. enterocolitica strains, was applied as DNA target for the 5' nuclease PCR protocol. The probe was labelled at the 5' end with the fluorescent reporter dye (FAM) and at the 3' end with the quencher dye (TAMRA). The real-time PCR cycling parameters included 41 cycles. A Ct value which reached a value higher than 40 constituted a negative result. The developed for the needs of this study qualitative real-time PCR method appeared to give very specific and reliable results. The detection rate of locus _tag CH49_3099 - positive Y. enterocolitica in 150 pig tonsils was 85 % and 32 % with PCR and culture methods, respectively. Both the Real-time PCR results and culture method results were obtained from material that was enriched during overnight incubation. The subject of the study were also raw pork meat samples. Among 80 samples examined, 7 ones were positive when real-time PCR was applied, and 6 ones were positive when classical culture method was applied. The application of molecular techniques based on the analysis of DNA sequences such as the Real-time PCR enables to detect this pathogenic bacteria very rapidly and with higher specificity, sensitivity and reliability in comparison to classical culture methods.
DEFF Research Database (Denmark)
Frosth, Sara; Slettemeås, Jannice S.; Jørgensen, Hannah J.
2012-01-01
BACKGROUND: Ovine footrot is a contagious disease with worldwide occurrence in sheep. The main causative agent is the fastidious bacterium Dichelobacter nodosus. In Scandinavia, footrot was first diagnosed in Sweden in 2004 and later also in Norway and Denmark. Clinical examination of sheep feet...... was tested using 55 bacterial and two fungal strains. To evaluate the sensitivity and harmonisation of results between different laboratories, aliquots of a single DNA preparation were analysed at three Scandinavian laboratories. The developed real-time PCR assay was compared to culturing by analysing 126...... laboratories and corresponds to approximately three copies of the D. nodosus genome per reaction. The assay showed 100% inclusivity and 100% exclusivity for the strains tested. The real-time PCR assay found 54.8% more positive samples than by culturing and 8% more than conventional PCR. CONCLUSIONS...
Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars
2015-01-01
Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (pnested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L
2013-01-01
Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.
Nigro, Mónica G; Figueroa, Carlos; Ledesma, Bibiana A
2014-01-01
Toxoplasmosis is an opportunistic infection caused by the parasite Toxoplasma gondii. The infection is severe and difficult to diagnose in patients receiving allogeneic hematopoietic stem cell transplantation (HSCT). Twelve patients receiving HSCT were monitored post-transplant, by qualitative PCR at the Children's Hospital S.A.M.I.C. "Prof. Dr. Juan P. Garrahan". The monitoring of these patients was defined by a history of positive serology for toxoplasmosis in the donor or recipient and because their hematologic condition did not allow the use of trimethoprim-sulfamethoxazole for prophylaxis. During the patients' monitoring, two of them with positive PCR results showed signs of illness by T. gondii and were treated with pyrimethamine-clindamycin. In two other patients, toxoplasmosis was the cause of death and an autopsy finding, showing negative PCR results. Four patients without clinical manifestations received treatment for toxoplasmosis because of positive PCR detection. In four patients there were no signs of toxoplasmosis disease and negative PCR results during follow-up. The qualitative PCR technique proved useful for the detection of toxoplasmosis reactivation in HSCT recipients, but has limitations in monitoring and making clinical decisions due to the persistence of positive PCR over time and manifestations of toxicity caused by the treatment. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.
FTA card utility for PCR detection of Mycobacterium leprae.
Aye, Khin Saw; Matsuoka, Masanori; Kai, Masanori; Kyaw, Kyaw; Win, Aye Aye; Shwe, Mu Mu; Thein, Min; Htoo, Maung Maung; Htoon, Myo Thet
2011-01-01
The suitability of the FTA® elute card for the collection of slit skin smear (SSS) samples for PCR detection of Mycobacterium leprae was evaluated. A total of 192 SSS leprosy samples, of bacillary index (BI) 1 to 5, were collected from patients attending two skin clinics in Myanmar and preserved using both FTA® elute cards and 70% ethanol tubes. To compare the efficacy of PCR detection of DNA from each BI class, PCR was performed to amplify an M. leprae-specific repetitive element. Of the 192 samples, 116 FTA® elute card and 112 70% ethanol samples were PCR positive for M. leprae DNA. When correlated with BI, area under the curve (AUC) values of the respective receiver-operating characteristic curves were similar for the FTA® elute card and ethanol collection methods (AUC=0.6). Taken together, our results indicate that the FTA® elute card, which enables the collection, transport, and archiving of clinical samples, is an attractive alternative to ethanol preservation for the detection of M. leprae DNA.
Use of Multiplex Real-Time PCR To Diagnose Scrub Typhus.
Tantibhedhyangkul, Wiwit; Wongsawat, Ekkarat; Silpasakorn, Saowaluk; Waywa, Duangdao; Saenyasiri, Nuttawut; Suesuay, Jintapa; Thipmontree, Wilawan; Suputtamongkol, Yupin
2017-05-01
Scrub typhus, caused by Orientia tsutsugamushi , is a common cause of acute undifferentiated febrile illness in the Asia-Pacific region. However, its nonspecific clinical manifestation often prevents early diagnosis. We propose the use of PCR and serologic tests as diagnostic tools. Here, we developed a multiplex real-time PCR assay using hydrolysis (TaqMan) probes targeting O. tsutsugamushi 47-kDa, groEL , and human interferon beta (IFN-β gene) genes to improve early diagnosis of scrub typhus. The amplification efficiency was higher than 94%, and the lower detection limit was 10 copies per reaction. We used a human gene as an internal DNA quality and quantity control. To determine the sensitivity of this PCR assay, we selected patients with confirmed scrub typhus who exhibited a clear 4-fold increase in the level of IgG and/or IgM. The PCR assay result was positive in 45 of 52 patients, indicating a sensitivity of 86.5% (95% confidence interval [CI]: 74.2 to 94.4). The PCR assessment was negative for all 136 non-scrub typhus patients, indicating a specificity of 100% (95% CI: 97.3 to 100). In addition, this test helped diagnose patients with inconclusive immunofluorescence assay (IFA) results and using single blood samples. In conclusion, the real-time PCR assay proposed here is sensitive and specific in diagnosing scrub typhus. Combining PCR and serologic tests will improve the diagnosis of scrub typhus among patients presenting with acute febrile illness. Copyright © 2017 American Society for Microbiology.
Early diagnosis of typhoid by pcr for flic-d gene of salmonella typhi in patients taking antibiotics
International Nuclear Information System (INIS)
Munir, T.; Razak, S.
2015-01-01
To compare PCR (Polymerase Chain Reaction) with blood culture, typhi-dot and Widal test for the diagnosis of typhoid in patients taking antibiotics. Study Design: Cross-sectional, comparative study. Place and Duration of Study: National University of Sciences and Technology, Islamabad, Pakistan, from April 2013 to August 2014. Methodology: One hundred and five patients were included in the study. Blood was collected and inoculated into tryptone soya broth for culture. Any growth obtained was identified by API 20 E and confirmed by Salmonellaanti-sera. Typhi-dot and Widal test were also done on all the samples. DNA extraction was done and PCR was carried out. Results: Among the 105 patients, 79 (75.2%) were males and 26 (24.8%) were females, with mean age of 20.64 ± 4 years. Typhi-dot was positive in 58 (55.2%) and negative in 47 (44.8%) patients. Blood widal test was positive in 27 (25.7%) and negative in 78 (74.3%) patients. Salmonella Typhi was positive on blood culture in only one (1%) patient. PCR for Salmonella Typhi was positive in 102 (97.1%) and negative in 3 (2.9%) patients. Positive cases detected by PCR were significantly higher as compared to Typhi-dot (p < 0.001), blood Widal test (p < 0.001) and blood culture (p < 0.001). Conclusion: Positivity rate of PCR was significantly higher as compared to blood culture, Typhi-dot or Widal test for diagnosing typhoid in patients who were already taking antibiotics. (author)
Directory of Open Access Journals (Sweden)
Elhamnia, F.
2010-07-01
Full Text Available Mycoplasma synoviae (MS is an important avian pathogen that can cause both respiratory disease and joint inflammation synovitis in poultry, inducing economic losses to the Iranian chicken industry especially breeder farms. The aim of this study was to use the MS specific PCR and culture methods in order to detect of M. synoviae from breeder farms where located in Tehran province. A total of 475 samples including choanal cleft, trachea, ovary and /or joint cavities from 23 broiler breeder farms of Tehran area were collected. Samples were cultured in PPLO broth media supplemented for MS isolation. The bacteria DNAs were extracted by phenol/chloroform method. Specific published primers amplify a 207 bp region of the 16S rRNA gene of MS were used for PCR method. Out of 475 samples, 146 cultures were shown positive and typical Mycoplasma colonies, 85 samples were also identified MS based on agglutination test with specific MS antiserum and the PCR method. A total of 122 samples, a band with 207 bp was shown as MS specific PCR product in electrophoresis. In addition to these 85 samples that were positives in both culture and PCR, 37 samples that had not grown in Mycoplasma media were positive in MS specific PCR. A total of 292 samples were negatives in both culture and PCR methods. 122 positive samples out of 475 samples (25.7% were belonged to 7 breeder farms (30.4%. On conclusions, the MS infection of broiler breeder farms of Tehran area was confirmed truly. From the results, as the PCR method reduces the time consuming, an effectiveness and efficient for detection of M. synoviae infection of chicken breeder. It is then suggested that the PCR method could be an alternative method for culturing.
Directory of Open Access Journals (Sweden)
Bugert Peter
2009-12-01
Full Text Available Abstract Background Interleukin-6 (IL-6 promoter polymorphisms at positions -597(G→A, -572(G→C and -174(G→C were shown to have a clinical impact on different major diseases. At present PCR-SSP protocols for IL-6 -597/-572/-174haplotyping are elaborate and require large amounts of genomic DNA. Findings We describe an improved typing technique requiring a decreased number of PCR-reactions and a reduced PCR-runtime due to optimized PCR-conditions. Conclusion This enables a fast and efficient determination of IL-6 -597/-572/-174haplotypes in clinical diagnosis and further evaluation of IL-6 promoter polymorphisms in larger patient cohorts.
Wang, Wen-Jun; Zheng, Chao-Feng; Liu, Zhuang; Tan, Yan-Hong; Chen, Xiu-Hua; Zhao, Bin-Liang; Li, Guo-Xia; Xu, Zhi-Fang; Ren, Fang-Gang; Zhang, Yao-Fang; Chang, Jian-Mei; Wang, Hong-Wei
2018-04-25
The present study intended to establish a droplet digital PCR (dd-PCR) for monitoring minimal residual disease (MRD) in patients with BCR/ABL (P210)-positive CML, thereby achieving deep-level monitoring of tumor load and determining the efficacy for guided clinically individualized treatment. Using dd-PCR and RT-qPCR, two cell suspensions were obtained from K562 cells and normal peripheral blood mononuclear cells by gradient dilution and were measured at the cellular level. At peripheral blood(PB) level, 61 cases with CML-chronic phase (CML-CP) were obtained after tyrosine kinase inhibitors (TKIs) treatment and regular follow-ups. By RT-qPCR, BCR/ABL (P210) fusion gene was undetectable in PB after three successive analyses, which were performed once every three months. At the same time, dd-PCR was performed simultaneously with the last equal amount of cDNA. Ten CML patients with MR4.5 were followed up by the two methods. At the cellular level, consistency of results of dd-PCR and RT-qPCR reached R 2 ≥0.99, with conversion equation of Y=33.148X 1.222 (Y: dd-PCR results; X: RT-qPCR results). In the dd-PCR test, 11 of the 61 CML patients (18.03%) tested positive and showed statistically significant difference (PPCR 3 months earlier than by RT-qPCR. In contrast with RT-qPCR, dd-PCR is more sensitive, thus enabling accurate conversion of dd-PCR results into internationally standard RT-qPCR results by conversion equation, to achieve a deeper molecular biology-based stratification of BCR/ABL(P210) MRD. It has some reference value to monitor disease progression in clinic. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Directory of Open Access Journals (Sweden)
Pedro Fernández-Soto
Full Text Available BACKGROUND: Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples' storage or conditions for handling and DNA preservation and extraction methods. METHODOLOGY/PRINCIPAL FINDINGS: We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patients urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. CONCLUSIONS/SIGNIFICANCE: Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA
International Nuclear Information System (INIS)
Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.
2004-01-01
The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV
Leach, L; Zhu, Y; Chaturvedi, S
2018-02-01
Candida auris is an emerging multidrug-resistant yeast causing invasive health care-associated infection with high mortality worldwide. Rapid identification of C. auris is of primary importance for the implementation of public health measures to control the spread of infection. To achieve these goals, we developed and validated a TaqMan-based real-time PCR assay targeting the internal transcribed spacer 2 ( ITS 2) region of the ribosomal gene. The assay was highly specific, reproducible, and sensitive, with the detection limit of 1 C. auris CFU/PCR. The performance of the C. auris real-time PCR assay was evaluated by using 623 surveillance samples, including 365 patient swabs and 258 environmental sponges. Real-time PCR yielded positive results from 49 swab and 58 sponge samples, with 89% and 100% clinical sensitivity with regard to their respective culture-positive results. The real-time PCR also detected C. auris DNA from 1% and 12% of swab and sponge samples with culture-negative results, indicating the presence of dead or culture-impaired C. auris The real-time PCR yielded results within 4 h of sample processing, compared to 4 to 14 days for culture, reducing turnaround time significantly. The new real-time PCR assay allows for accurate and rapid screening of C. auris and can increase effective control and prevention of this emerging multidrug-resistant fungal pathogen in health care facilities. Copyright © 2018 Leach et al.
Mekonnen, Solomon A; Beissner, Marcus; Saar, Malkin; Ali, Solomon; Zeynudin, Ahmed; Tesfaye, Kassahun; Adbaru, Mulatu G; Battke, Florian; Poppert, Sven; Hoelscher, Michael; Löscher, Thomas; Bretzel, Gisela; Herbinger, Karl-Heinz
2017-10-02
Onchocerciasis is a parasitic disease caused by the filarial nematode Onchocerca volvulus. In endemic areas, the diagnosis is commonly confirmed by microscopic examination of skin snip samples, though this technique is considered to have low sensitivity. The available melting-curve based quantitative real-time PCR (qPCR) using degenerated primers targeting the O-150 repeat of O. volvulus was considered insufficient for confirming the individual diagnosis, especially in elimination studies. This study aimed to improve detection of O. volvulus DNA in clinical samples through the development of a highly sensitive qPCR assay. A novel hydrolysis probe based qPCR assay was designed targeting the specific sequence of the O. volvulus O-5S rRNA gene. A total of 200 clinically suspected onchocerciasis cases were included from Goma district in South-west Ethiopia, from October 2012 through May 2013. Skin snip samples were collected and subjected to microscopy, O-150 qPCR, and the novel O-5S qPCR. Among the 200 individuals, 133 patients tested positive (positivity rate of 66.5%) and 67 negative by O-5S qPCR, 74 tested positive by microscopy (37.0%) and 78 tested positive by O-150 qPCR (39.0%). Among the 133 O-5S qPCR positive individuals, microscopy and O-150 qPCR detected 55.6 and 59.4% patients, respectively, implying a higher sensitivity of O-5S qPCR than microscopy and O-150 qPCR. None of the 67 individuals who tested negative by O-5S qPCR tested positive by microscopy or O-150 qPCR, implying 100% specificity of the newly designed O-5S qPCR assay. The novel O-5S qPCR assay is more sensitive than both microscopic examination and the existing O-150 qPCR for the detection of O. volvulus from skin snip samples. The newly designed assay is an important step towards appropriate individual diagnosis and control of onchocerciasis.
SASqPCR: robust and rapid analysis of RT-qPCR data in SAS.
Directory of Open Access Journals (Sweden)
Daijun Ling
Full Text Available Reverse transcription quantitative real-time PCR (RT-qPCR is a key method for measurement of relative gene expression. Analysis of RT-qPCR data requires many iterative computations for data normalization and analytical optimization. Currently no computer program for RT-qPCR data analysis is suitable for analytical optimization and user-controllable customization based on data quality, experimental design as well as specific research aims. Here I introduce an all-in-one computer program, SASqPCR, for robust and rapid analysis of RT-qPCR data in SAS. This program has multiple macros for assessment of PCR efficiencies, validation of reference genes, optimization of data normalizers, normalization of confounding variations across samples, and statistical comparison of target gene expression in parallel samples. Users can simply change the macro variables to test various analytical strategies, optimize results and customize the analytical processes. In addition, it is highly automatic and functionally extendable. Thus users are the actual decision-makers controlling RT-qPCR data analyses. SASqPCR and its tutorial are freely available at http://code.google.com/p/sasqpcr/downloads/list.
Directory of Open Access Journals (Sweden)
Dabirmanesh B
2011-03-01
Full Text Available Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR. Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5′untranslated region (5′ UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid detection of HPeV1 by RT-PCR can decrease both the unnecessary use of antibiotics and the costs in clinical practice
Rapid diagnosis of sepsis with TaqMan-Based multiplex real-time PCR.
Liu, Chang-Feng; Shi, Xin-Ping; Chen, Yun; Jin, Ye; Zhang, Bing
2018-02-01
The survival rate of septic patients mainly depends on a rapid and reliable diagnosis. A rapid, broad range, specific and sensitive quantitative diagnostic test is the urgent need. Thus, we developed a TaqMan-Based Multiplex real-time PCR assays to identify bloodstream pathogens within a few hours. Primers and TaqMan probes were designed to be complementary to conserved regions in the 16S rDNA gene of different kinds of bacteria. To evaluate accurately, sensitively, and specifically, the known bacteria samples (Standard strains, whole blood samples) are determined by TaqMan-Based Multiplex real-time PCR. In addition, 30 blood samples taken from patients with clinical symptoms of sepsis were tested by TaqMan-Based Multiplex real-time PCR and blood culture. The mean frequency of positive for Multiplex real-time PCR was 96% at a concentration of 100 CFU/mL, and it was 100% at a concentration greater than 1000 CFU/mL. All the known blood samples and Standard strains were detected positively by TaqMan-Based Multiplex PCR, no PCR products were detected when DNAs from other bacterium were used in the multiplex assay. Among the 30 patients with clinical symptoms of sepsis, 18 patients were confirmed positive by Multiplex real-time PCR and seven patients were confirmed positive by blood culture. TaqMan-Based Multiplex real-time PCR assay with highly sensitivity, specificity and broad detection range, is a rapid and accurate method in the detection of bacterial pathogens of sepsis and should have a promising usage in the diagnosis of sepsis. © 2017 Wiley Periodicals, Inc.
Development of a Real-time PCR test for porcine group A rotavirus diagnosis
Directory of Open Access Journals (Sweden)
Elizabeth C.M. Marconi
2015-01-01
Full Text Available Group A Rotavirus (RVA is one of the most common causes of diarrhea in humans and several animal species. A SYBR-Green Real-Time polymerase chain reaction (PCR was developed to diagnose RVA from porcine fecal samples, targeting amplification of a 137-bp fragment of nonstructural protein 5 (NSP5 gene using mRNA of bovine NADH-desidrogenase-5 as exogenous internal control. Sixty-five samples were tested (25 tested positive for conventional PCR and genetic sequencing. The overall agreement (kappa was 0.843, indicating 'very good' concordance between tests, presenting 100% of relative sensitivity (25+ Real Time PCR/25+ Conventional PCR and 87.5% of relative sensitivity (35- Real Time PCR/40- Conventional PCR. The results also demonstrated high intra- and inter-assay reproducibility (coefficient of variation ≤1.42%; thus, this method proved to be a fast and sensitive approach for the diagnosis of RVA in pigs.
de Almeida, Isabela Neves; Aleixo, Agdemir Valéria; Carvalho, Wânia da Silva; de Miranda, Silvana Spindola
2015-01-01
The possibility to obtain DNA from smears is a valuable alternative to remedy the lack of samples when they are totally used for bacilloscopy; this technique solves the biosafety problem related to a possible accident with the transportation of flasks containing potentially transmissible clinical samples. Hence, the purpose of this study was to utilize the insertion sequence IS6110 for amplification of DNA from a smear-positive sample for tuberculosis (TB) diagnosis. Among the 52 positive bacilloscopies, sensitivity, specificity, positive predictive value and negative predictive value were 52.3%, 100%, 100% and 89.7%, respectively whereas accuracy was 90.7%. The IS6110-based PCR for TB diagnosis developed in DNA extracted from a positive smear is a fast, simple, specific, and safe method. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.
McMahon, Tanis C; Blais, Burton W; Wong, Alex; Carrillo, Catherine D
2017-01-01
Foodborne illness attributed to enterohemorrhagic E. coli (EHEC), a highly pathogenic subset of Shiga toxin-producing E. coli (STEC), is increasingly recognized as a significant public health issue. Current microbiological methods for identification of EHEC in foods often use PCR-based approaches to screen enrichment broth cultures for characteristic gene markers [i.e., Shiga toxin ( stx ) and intimin ( eae )]. However, false positives arise when complex food matrices, such as beef, contain mixtures of eae -negative STEC and eae -positive E. coli , but no EHEC with both markers in a single cell. To reduce false-positive detection of EHEC in food enrichment samples, a Multiplexed, Single Intact Cell droplet digital PCR (MuSIC ddPCR) assay capable of detecting the co-occurrence of the stx and eae genes in a single bacterial cell was developed. This method requires: (1) dispersal of intact bacteria into droplets; (2) release of genomic DNA (gDNA) by heat lysis; and (3) amplification and detection of genetic targets ( stx and eae ) using standard TaqMan chemistries with ddPCR. Performance of the method was tested with panels of EHEC and non-target E. coli . By determining the linkage (i.e., the proportion of droplets in which stx and eae targets were both amplified), samples containing EHEC (typically greater than 20% linkage) could be distinguished from samples containing mixtures of eae -negative STEC and eae -positive E. coli (0-2% linkage). The use of intact cells was necessary as this linkage was not observed with gDNA extracts. EHEC could be accurately identified in enrichment broth cultures containing excess amounts of background E. coli and in enrichment cultures derived from ground beef/pork and leafy-green produce samples. To our knowledge, this is the first report of dual-target detection in single bacterial cells using ddPCR. The application of MuSIC ddPCR to enrichment-culture screening would reduce false-positives, thereby improving the cost, speed, and
Directory of Open Access Journals (Sweden)
Abtin, A.R.
2013-05-01
Full Text Available Contagious agalactia (C.A is an infectious syndrome of sheep that is characterized by mastitis andsubsequent failure of milk production, arthritis, abortion and keratoconjunctivitis. Mycoplasma agalactiae(M. agalactiae is the main cause of the disease in sheep. The aim of this study was isolation andidentification of M. agalactiae with culture and polymerase chain reaction (PCR assay from sheep of Qomprovince in Iran. A total of 102 samples were collected from milk secretion, eye, ear and joint exudates ofsheep. All samples were cultured in PPLO broth supplemented for M. agalaciae isolation. The bacteriaDNAs were extracted by phenol/chloroform method and the PCR assay was applied for detecting ofMycoplasma genus in 163bp fragment of 16S rRNA gene and M. agalactiae in 375bp fragment oflipoprotein gene from culture as same as in clinical samples. Out of the 102 samples, 19(18.63% cultureswere shown positive and typical Mycoplasma colonies in PPLO agar culture diagnostic method and59(57.8% were scored positive by Mycoplasma genus PCR, 19(18.62% of the samples were scoredpositive by using M. agalactiae PCR as diagnostic method. Out of the 102 samples, 19 samples wereshown both positive in the culture and PCR, 42 samples were shown both negative in the culture and PCR.40 samples were negative in the culture and positive in PCR whereas only one sample was positive inculture and negative in PCR. The results showed that the more isolations of M. agalactiae were taken from milk and less in joint samples. M. agalactiae was one of the main factors of contagious agalactia that was detected for the first time from sheep in Qom province.
Willi, Barbara; Meli, Marina L; Lüthy, Ruedi; Honegger, Hanspeter; Wengi, Nicole; Hoelzle, Ludwig E; Reusch, Claudia E; Lutz, Hans; Hofmann-Lehmann, Regina
2009-12-01
Hemotropic mycoplasmas (hemoplasmas) are the causative agents of infectious anemia in several mammalian species. Their zoonotic potential has recently been substantiated by the identification of a feline hemoplasma isolate in an immunocompromised human patient. Although species-specific diagnostic molecular methods have been developed, their application as screening tools is limited due to the species diversity of hemoplasmas. The goals of this study were to develop a universal hemoplasma screening assay with broad specificity based on the SYBR green PCR principle, to compare the assay with hemoplasma-specific TaqMan PCR, and to analyze potential tick vectors and human blood samples to address the zoonotic potential. The newly developed PCR assay based on the 16S rRNA gene amplified feline, canine, bovine, porcine, camelid, and murine hemoplasmas, as well as Mycoplasma penetrans and Mycoplasma pneumoniae. The lower detection limit for feline and canine hemoplasmas was 1 to 10 copies/PCR. The assay exhibited 98.2% diagnostic sensitivity and 92.1% diagnostic specificity for feline hemoplasmas. All 1,950 Ixodes ticks were PCR negative, suggesting that Ixodes ticks are not relevant vectors for the above-mentioned hemoplasma species in Switzerland. None of the 414 blood samples derived from anemic or immunocompromised human patients revealed a clear positive result. The SYBR green PCR assay described here is a suitable tool to screen for known and so-far-undiscovered hemoplasma species. Positive results should be confirmed by specific TaqMan PCR or sequencing.
Directory of Open Access Journals (Sweden)
Gilberto A Santiago
Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.
DEFF Research Database (Denmark)
Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja
2007-01-01
in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...
Cosnes-Lambe, Cecile; Raymond, Josette; Vallet, Christelle; Armengaud, Jean-Baptiste; Bosdure, Emmanuelle; Catalano-Pons, Charlotte; Chalumeau, Martin; El Hajje, Marie-Joelle; Moulin, Florence; de Suremain, Nathalie; Reglier-Poupet, Hélène; Poyart, Claire; Gendrel, Dominique
2008-10-01
False-negative findings of polymerase chain reaction (PCR) for genuine pertussis as well as the numerous atypical forms of whooping cough make it difficult to diagnose this disease in young babies. For two years, real-time PCR was performed to test for Bordetella pertussis in 86 infants younger than 6 months hospitalized for apnea or paroxysmal and/or vomiting cough and in 205 of their household contacts, whether or not they coughed. Group 1 included 30 infants for whom PCR detected B. pertussis (25 of whom were also RSV+). PCR was also positive for at least one household contact in 25/30 families. This group included 16 babies with apnea and 12 who developed a whooping cough during follow-up. Group 2 comprised 12 infants whose PCR was negative while at least one household contact had positive results. Five of these infants had severe apnea and 6 developed a whooping cough. Group 3 included 44 infants (28 RSV +) for whom PCR was negative in the index case and in the household contacts: none developed a whooping cough during follow-up. Only 3 of the 54 positive household contacts had a paroxysmal cough or a typical whooping cough and 12 had no cough at all. Positive PCR in a household contact, symptomatic or not, is helpful for the diagnosis of atypical whooping cough in young infants.
Directory of Open Access Journals (Sweden)
M.V. Resende
2011-06-01
Full Text Available The objective of the present study was to determine the sperm enrichment with X-bearing spermatozoa, after one centrifugation in a Percoll or OptiPrep continuous density gradient, using quantitative real-time polymerase chain reaction (qPCR of sperm DNA and resultant in vitro-produced bovine embryos by PCR. Frozen/thawed sperm was layered on density gradients and the tubes were centrifuged. Supernatants were gently aspirated and the sperm recovered from the bottom of the tubes. Cleavage and blastocyst rates were determined through in vitro production of embryos and PCR was performed to identify the embryos' genetic sex. A difference in blastocyst rate was found in the Percoll treatment compared to OptiPrep (P<0.05. The percentage of female embryos in the Percoll and OptiPrep groups was 62.0% and 47.1%, respectively. These results were confirmed by qPCR of spermatozoa DNA and underestimation was seen only in the Percoll group. It was possible to sexing sperm using simple approach.
Vinuesa, Víctor; Borrás, Rafael; Briones, María Luisa; Clari, María Ángeles; Cresencio, Vicenta; Giménez, Estela; Muñoz, Carmen; Oltra, Rosa; Servera, Emilio; Scheelje, Talia; Tornero, Carlos; Navarro, David
2018-05-01
The potential impact of routine real-time PCR testing of respiratory specimens from patients with presumptive tuberculosis in terms of diagnostic accuracy and time to tuberculosis treatment inception in low-prevalence settings remains largely unexplored. We conducted a prospective intervention cohort study. Respiratory specimens from 1,020 patients were examined by acid-fast bacillus smear microscopy, tested by a real-time Mycobacterium tuberculosis complex PCR assay (Abbott RealTi me MTB PCR), and cultured in mycobacterial media. Seventeen patients tested positive by PCR (5 were acid-fast bacillus smear positive and 12 acid-fast bacillus smear negative), and Mycobacterium tuberculosis was recovered from cultures for 12 of them. Patients testing positive by PCR and negative by culture ( n = 5) were treated and deemed to have responded to antituberculosis therapy. There were no PCR-negative/culture-positive cases, and none of the patients testing positive for nontuberculous mycobacteria ( n = 20) yielded a positive PCR result. The data indicated that routine testing of respiratory specimens from patients with presumptive tuberculosis by the RealTi me MTB PCR assay improves the tuberculosis diagnostic yield and may reduce the time to antituberculosis treatment initiation. On the basis of our data, we propose a novel mycobacterial laboratory algorithm for tuberculosis diagnosis. Copyright © 2018 American Society for Microbiology.
Maas, L; Dorigo-Zetsma, J W; de Groot, C J; Bouter, S; Plötz, F B; van Ewijk, B E
2014-06-01
The performance of a multiplex real-time PCR for the detection of Blastocystis, Dientamoeba fragilis, Giardia lamblia, Cryptosporidium species and Entamoeba species in faecal samples was evaluated in an observational prospective study. Paediatric patients (0-18 years) presenting with gastrointestinal symptoms and suspected of having enteroparasitic disease were included. A questionnaire on gastrointestinal symptoms and the chosen treatment was completed at the start of the study and after 6 weeks. Of 163 paediatric patients (mean age, 7.8 years), 114 (70%) had a PCR-positive faecal sample. D. fragilis was detected most frequently, in 101 patients, followed by Blastocystis in 49. In faecal samples of 47 patients, more than one protozoan was detected, mainly the combination of D. fragilis and Blastocystis. Reported gastrointestinal symptoms were abdominal pain (78%), nausea (30%), and altered bowel habits (28%). Eighty-nine of the PCR-positive patients were treated with antibiotics. A significant reduction in abdominal pain was observed both in treated and in untreated patients. This study demonstrated that multiplex real-time PCR detects a high percentage of intestinal protozoa in paediatric patients with gastrointestinal symptoms. However, interpretation and determination of the clinical relevance of a positive PCR result in this population are still difficult. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.
Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA
Energy Technology Data Exchange (ETDEWEB)
Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il [Korea Cancer Center Hospital, Seoul (Korea, Republic of)
1997-12-01
Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs.
Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA
International Nuclear Information System (INIS)
Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il
1997-12-01
Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs
A rapid method for screening arrayed plasmid cDNA library by PCR
International Nuclear Information System (INIS)
Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong
1999-01-01
Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency
Directory of Open Access Journals (Sweden)
Ram, S.
2012-01-01
Full Text Available Aim: Isolation, dark field detection and microscopic agglutination test (MAT are considered ―gold standard‖ tests for diagnosis of Leptospirosis. Several PCR assays are reported but very few have been evaluated for detection of Leptospirosis. Therefore, this study was undertaken. This study aims to design and standardize polymerase chain reaction (PCR - based DNA sequencing technique for the detection of pathogenic Leptospira from peripheral blood of patients clinically diagnosed with septicemia. Methodology and Results: Two hundred and seven (207 blood samples from patients were diagnosed with septicemia which includes 100 bacterial (other than Leptospira culture positive and 107 bacterial culture negative samples were studied. Primers for Nested PCR targeting LipL32 gene of Leptospira interrogans were designed and the specificity of primers was tested against serum samples positive/negative by either MAT or dark field microscopy. PCR amplified products were further confirmed by DNA sequencing. The standardized nPCR was sensitive and specific to Leptospira interrogans. Twenty-one (21% out of 100 culture positive blood samples, three (2.8% out of 107 culture negative samples showed nPCR positivity and were confirmed as Leptospira interrogans by DNA sequencing (p<0.001. A sensitive nPCR specific to Leptospira interrogans was developed. Conclusion, significance and impact of study: The p value (<0.001 signifies that Leptospira is commonly associated with other bacteria circulating in blood indicating that a decreased immune status is created primarily by a bacterium with enhanced possibility of development of Leptospiral infection probably be of an endogenous origin.
Taira, Cleison Ledesma; Okay, Thelma Suely; Delgado, Artur Figueiredo; Ceccon, Maria Esther Jurfest Rivero; de Almeida, Margarete Teresa Gottardo; Del Negro, Gilda Maria Barbaro
2014-07-21
Nosocomial candidaemia is associated with high mortality rates in critically ill paediatric patients; thus, the early detection and identification of the infectious agent is crucial for successful medical intervention. The PCR-based techniques have significantly increased the detection of Candida species in bloodstream infections. In this study, a multiplex nested PCR approach was developed for candidaemia detection in neonatal and paediatric intensive care patients. DNA samples from the blood of 54 neonates and children hospitalised in intensive care units with suspected candidaemia were evaluated by multiplex nested PCR with specific primers designed to identify seven Candida species, and the results were compared with those obtained from blood cultures. The multiplex nested PCR had a detection limit of four Candida genomes/mL of blood for all Candida species. Blood cultures were positive in 14.8% of patients, whereas the multiplex nested PCR was positive in 24.0% of patients, including all culture-positive patients. The results obtained with the molecular technique were available within 24 hours, and the assay was able to identify Candida species with 100% of concordance with blood cultures. Additionally, the multiplex nested PCR detected dual candidaemia in three patients. Our proposed PCR method may represent an effective tool for the detection and identification of Candida species in the context of candidaemia diagnosis in children, showing highly sensitive detection and the ability to identify the major species involved in this infection.
Jukes, Leanne; Mikhail, Jane; Bome-Mannathoko, Naledi; Hadfield, Stephen J; Harris, Llinos G; El-Bouri, Khalid; Davies, Angharad P; Mack, Dietrich
2010-12-01
This study evaluated a multiplex real-time PCR method specific for the mecA, femA-SA and femA-SE genes for rapid identification of Staphylococcus aureus, Staphylococcus epidermidis and non-S. epidermidis coagulase-negative staphylococci (CoNS), and meticillin susceptibility testing directly in positive blood cultures that grew Gram-positive cocci in clusters. A total of 100 positive blood cultures produced: 39 S. aureus [12 meticillin-resistant S. aureus (MRSA), 31% of all the S. aureus]; 30 S. epidermidis (56.6% of the CoNS), 8 Staphylococcus capitis (15.1%), 3 Staphylococcus saprophyticus (5.7%), 4 Staphylococcus hominis (7.5%), 3 Staphylococcus haemolyticus (5.7%), 2 Staphylococcus warneri (3.8%), 1 Staphylococcus cohnii (1.9%) and 2 unidentified Staphylococcus spp. (3.8%); and 1 Micrococcus luteus in pure culture. Two blood cultures had no growth on subculture and five blood cultures grew mixed CoNS. For the 95 blood cultures with pure growth or no growth on subculture, there was very good agreement between real-time PCR and the BD Phoenix identification system for staphylococcal species categorization in S. aureus, S. epidermidis and non-S. epidermidis CoNS and meticillin-resistance determination (Cohen's unweighted kappa coefficient κ=0.882). All MRSA and meticillin-susceptible S. aureus were correctly identified by mecA amplification. PCR amplification of mecA was more sensitive for direct detection of meticillin-resistant CoNS in positive blood cultures than testing with the BD Phoenix system. There were no major errors when identifying staphylococcal isolates and their meticillin susceptibility within 2.5 h. Further studies are needed to evaluate the clinical benefit of using such a rapid test on the consumption of glycopeptide antibiotics and the alteration of empiric therapy in the situation of positive blood cultures growing staphylococci, and the respective clinical outcomes.
Vázquez-Avila, Isidro; Vera-Peralta, Jorge Manuel; Alvarez-Nemegyei, José; Rodríguez-Carvajal, Otilia
2007-01-01
In order to decrease the burden of suffering and the costs derived from confirmatory molecular assays, a better strategy is badly needed to decrease the rate of false positive results of the enzyme-linked immunoassay (ELISA) for detection of hepatitis C virus (HCV) antibodies (Anti). To establish the best cutoff of the S/CO rate in subjects with a positive result of a microparticule, third generation ELISA assay for Anti-HCV, for predicting viremia as detected by polymerase chain reaction (PCR) assay. Using the result of the PCR assay as "gold standard", a ROC curve was build with the results of the S/CO rate values in subjects with a positive result for ELISA HCV assay. Fifty two subjects (30 male, 22 female, 40 +/- 12.5 years old) were included. Thirty four (65.3%) had a positive RNA HCV PCR assay. The area under the curve was 0.99 (95% CI: 0.98-1.0). The optimal cutoff for the S/CO rate was established in 29: sensitivity: 97%; specificity: 100%: PPV: 100%; NPV: 94%. Setting the cutoff of the S/CO in 29 results in a high predictive value for viremia as detected by PCR in subjects with a positive ELISA HVC assay. This knowledge may result in a better decision taking for the clinical follow up of those subjects with a positive result in the ELISA screening assay for HCV infection.
Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis
Directory of Open Access Journals (Sweden)
V Hallur
2015-01-01
Full Text Available Purpose: The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR inhibitors thus, undermining the confidence of a laboratory physician. Materials and Methods: We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Results: Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Conclusion: Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.
Directory of Open Access Journals (Sweden)
Zahra Gharibi
2017-10-01
Full Text Available Objective: To evaluate Entamoeba spp. diagnosis in patients with inflammatory diarrhea by staining, copro-antigen ELISA and multiplex PCR methods. Methods: In this descriptive cross-sectional survey, 200 stool samples were randomly collected during 2015–2016. The stool samples were evaluated microscopically for the presence of the parasite using direct and formalin-ether concentration and trichrome staining methods. Then, the stool samples were examined by copro-antigen ELISA (Biomerica Company and multiplex PCR methods. Results: Of 200 samples, 17, 29 and 23 cases were positive for Entamoeba species by the staining, copro-antigen ELISA and multiplex PCR methods, respectively. Of 23 positive samples in multiplex PCR test, 13 and 10 samples were positive for Entamoeba dispar (E. dispar and Entamoeba histolytica (E. histolytica, respectively. Conclusions: Our finding indicated a relatively high prevalence of Entamoeba species in patients with inflammatory diarrhea in Ahvaz city. Due to the complications of E. histolytica/ dispar infection, the health authorities of the city must pay more attention to control and prevent the transmission of E. histolytica/dispar to individuals.
DEFF Research Database (Denmark)
Petersen, E; Edvinsson, B; Lundgren, B
2006-01-01
The aim of the study presented here was to evaluate the use of PCR for improving the diagnosis of Toxoplasma gondii infection in immunocompromised hosts. Three hundred thirty-two bronchoalveolar lavage (BAL) fluid samples were analyzed by real-time PCR targeting a 529 bp element of T. gondii. In ...
Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt
Directory of Open Access Journals (Sweden)
Laila El-Shehawy
Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in
Development of a direct PCR assay to detect Taenia multiceps eggs isolated from dog feces.
Wang, Ning; Wang, Yu; Ye, Qinghua; Yang, Yingdong; Wan, Jie; Guo, Cheng; Zhan, Jiafei; Gu, Xiaobin; Lai, Weimin; Xie, Yue; Peng, Xuerong; Yang, Guangyou
2018-02-15
Taenia multiceps is a tapeworm that leads to the death of livestock, resulting in major economic losses worldwide. The adult stage of this parasite invades the small intestine of dogs and other canids. In the present study, we developed a direct PCR assay to detect T. multiceps eggs isolated from dog feces to help curb further outbreaks. The genomic DNA was rapidly released using a lysis buffer and the PCR reaction was developed to amplify a 433-bp fragment of the T. multiceps mitochondrial gene encoding NADH dehydrogenase subunit 5 (nad5) from eggs isolated from dog feces. The procedure could be completed within 3 h, including flotation. The sensitivity of the assay was determined by detecting DNA from defined numbers of eggs, and the specificity was determined by detecting DNA from other intestinal tapeworm and roundworm species that commonly infect dogs. In addition, 14 taeniid-positive fecal samples determined by the flotation technique were collected and further evaluated by the regular PCR and our direct PCR. The results showed that the direct PCR developed herein was sensitive enough to detect the DNA from as few as 10 T. multiceps eggs and that no cross-reactions with other tapeworm and roundworm were observed, suggesting its high sensitivity and specificity for T. multiceps detection. Moreover, 14 taeniid-positive samples were screened by the regular PCR and direct PCR, with detection rates of 78.6% and 85.7%, respectively. In conclusion, the direct PCR assay developed in the present study has high sensitivity and specificity to identify T. multiceps eggs isolated from dog feces and therefore could represent an invaluable tool to identify T. multiceps outbreaks and would contribute to future clinical applications. Copyright © 2017 Elsevier B.V. All rights reserved.
Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J
2017-12-01
RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.
Saavedra, Miguel; Zulantay, Inés; Apt, Werner; Martínez, Gabriela; Rojas, Antonio; Rodríguez, Jorge
2013-01-01
We evaluate the elimination of the microscopic stage of conventional xenodiagnosis (XD) to optimize the parasitological diagnosis of Trypanosoma cruzi in chronic Chagas disease. To this purpose we applied under informed consent two XD cages to 150 Chilean chronic chagasic patients. The fecal samples (FS) of the triatomines at 30, 60 and 90 days post feeding were divided into two parts: in one a microscopic search for mobile trypomastigote and/or epimastigote forms was performed. In the other part, DNA extraction-purification for PCR directed to the conserved region of kDNA minicircles of trypanosomes (PCR-XD), without previous microscopic observation was done. An XD was considered positive when at least one mobile T. cruzi parasite in any one of three periods of incubation was observed, whereas PCR-XD was considered positive when the 330 bp band specific for T. cruzi was detected. 25 of 26 cases with positive conventional XD were PCR-XD positive (concordance 96.2%), whereas 85 of 124 cases with negative conventional XD were positive by PCR-XD (68.5%). Human chromosome 12 detected by Real-time PCR used as exogenous internal control of PCR-XD reaction allowed to discounting of PCR inhibition and false negative in 40 cases with negative PCR-XD. PCR-XD performed without previous microscopic observation is a useful tool for detection of viable parasites with higher efficiency then conventional XD.
Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR
Directory of Open Access Journals (Sweden)
Neng Chen
2014-07-01
Full Text Available Cystic fibrosis transmembrane conductance regulator (CFTR gene mutation analysis has been implemented for Cystic Fibrosis (CF carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD. Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM curve analysis, allele-specific PCR (AS-PCR and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing.
Diagnosis of common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.
Jahan, F; Shamsuzzaman, S M; Akter, S
2014-12-01
Urethritis is one of the most important causes of morbidity and mortality in developing countries. The aim of this study was to detect common bacterial causes of urethritis in men by Gram stain, culture and multiplex PCR.185 male patients who presented at the Skin and venereal clinic of the Dhaka Medical College, Bangladesh with clinical symptoms suggestive of urethritis were enrolled in this study. Urethral discharges were tested for detection of Neisseria gonorrhoeae by Gram stain, culture and PCR. Multiplex PCR assay was done to detect DNA of Chlamydia trachomatis, Ureaplasma urealyticum and Mycoplasma genitalium. Out of 185 participants, 30.27% and 14.6% were infected by Neisseria gonorrhoeae and Chlamydia trachomatis respectively. None of the individuals was found positive for either Ureaplasma urealyticum or Mycoplasma genitalium. Among the Neisseria gonorrhoeae positive patients 27.57% were positive from Gram stain, 26.49% were culture positive, 30.27% were positive by PCR (p<0.001). 32.65% of the Neisseria gonorrhoeae isolates were penicillinase producers and 83.67% were susceptible to ceftriaxone. Considering culture as the gold standard, the sensitivity and specificity of PCR for the detection of Neisseria gonorrhoeae was 100%, and 94.85% respectively with an accuracy of 96.22%. 3.73% of the 134 smear negative and 5.15% of the 136 culture negative samples were positive by PCR. PCR was the most sensitive and rapid method for the diagnosis of urethritis. Multiplex PCR may be a useful approach to laboratory diagnosis of urethritis in men for its high sensitivity and specificity.
de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena
2016-06-01
Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing
Whatman Paper (FTA Cards for Storing and Transferring Leishmania DNA for PCR Examination
Directory of Open Access Journals (Sweden)
A Amin-Mohammadi
2009-12-01
Full Text Available "nBackground: Diagnosis of cutaneous leishmaniasis (CL is often made based on clinical manifestation. Correct diagnosis and identification of the parasite are crucial for choosing the effective treatment and for epidemiological studies. On the other hand, determination of Leishmania species is necessary for designing appropriate control programs. Diagnosis by PCR is becoming a 'gold standard'. For PCR preparation, storage and shipments of specimens are necessary. In this study, Whatman filter paper (FTA Card was used to store and transfer samples for Leishmania identification using PCR. "nMethods: Among the patients who had CL lesion and referred to Parasitology Laboratory of Emam Reza Hospital, Mashhad, Iran, 44 consented cases with positive results in their direct smear were selected. An informed consent form and a questionnaire were completed and three different types of samples (direct smear, NNN culture, and spot on FTA card were collected. DNA extraction and PCR were carried out on three different samples from each patient. "nResults: PCR results using Whatman paper samples revealed a significant difference (P<0.0001 compared to the culture method but no significant difference was seen between PCR results using samples stored on Whatman paper and direct smears. "nConclusion: The use of FTA cards is simple, rapid, and cost-effective, and can be readily employed for large-scale population screening, especially for regions where the specimens are to be transported from distant places to the laboratory.
Darton, Thomas C; Zhou, Liqing; Blohmke, Christoph J; Jones, Claire; Waddington, Claire S; Baker, Stephen; Pollard, Andrew J
2017-04-01
Improved diagnostics for typhoid are needed; a typhoid controlled human infection model may accelerate their development and translation. Here, we evaluated a blood culture-PCR assay for detecting infection after controlled human infection with S. Typhi and compared test performance with optimally performed blood cultures. Culture-PCR amplification of blood samples was performed alongside daily blood culture in 41 participants undergoing typhoid challenge. Study endpoints for typhoid diagnosis (TD) were fever and/or bacteraemia. Overall, 24/41 (59%) participants reached TD, of whom 21/24 (86%) had ≥1 positive blood culture (53/674, 7.9% of all cultures) or 18/24 (75%) had ≥1 positive culture-PCR assay result (57/684, 8.3%). A further five non-bacteraemic participants produced culture-PCR amplicons indicating infection; overall sensitivity/specificity of the assay compared to the study endpoints were 70%/65%. We found no significant difference between blood culture and culture-PCR methods in ability to identify cases (12 mismatching pairs, p = 0.77, binomial test). Clinical and stool culture metadata demonstrated that additional culture-PCR amplification positive individuals likely represented true cases missed by blood culture, suggesting the overall attack rate may be 30/41 (73%) rather than 24/41 (59%). Several participants had positive culture-PCR results soon after ingesting challenge providing new evidence for occurrence of an early primary bacteraemia. Overall the culture-PCR assay performed well, identifying extra typhoid cases compared with routine blood culture alone. Despite limitations to widespread field-use, the benefits of increased diagnostic yield, reduced blood volume and faster turn-around-time, suggest that this assay could enhance laboratory typhoid diagnostics in research applications and high-incidence settings. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Hamazaki, Toshihide; Kahler, Eryn; Borba, Bonnie M; Burton, Tamara
2013-07-09
We evaluated the comparability of culture and PCR tests for detecting Ichthyophonus in Yukon River Chinook salmon Oncorhynchus tshawytscha from field samples collected at 3 locations (Emmonak, Chena, and Salcha, Alaska, USA) in 2004, 2005, and 2006. Assuming diagnosis by culture as the 'true' infection status, we calculated the sensitivity (correctly identifying fish positive for Ichthyophonus), specificity (correctly identifying fish negative for Ichthyophonus), and accuracy (correctly identifying both positive and negative fish) of PCR. Regardless of sampling locations and years, sensitivity, specificity, and accuracy exceeded 90%. Estimates of infection prevalence by PCR were similar to those by culture, except for Salcha 2005, where prevalence by PCR was significantly higher than that by culture (p < 0.0001). These results show that the PCR test is comparable to the culture test for diagnosing Ichthyophonus infection.
Single-cell qPCR on dispersed primary pituitary cells -an optimized protocol
Directory of Open Access Journals (Sweden)
Haug Trude M
2010-11-01
Full Text Available Abstract Background The incidence of false positives is a potential problem in single-cell PCR experiments. This paper describes an optimized protocol for single-cell qPCR measurements in primary pituitary cell cultures following patch-clamp recordings. Two different cell harvesting methods were assessed using both the GH4 prolactin producing cell line from rat, and primary cell culture from fish pituitaries. Results Harvesting whole cells followed by cell lysis and qPCR performed satisfactory on the GH4 cell line. However, harvesting of whole cells from primary pituitary cultures regularly produced false positives, probably due to RNA leakage from cells ruptured during the dispersion of the pituitary cells. To reduce RNA contamination affecting the results, we optimized the conditions by harvesting only the cytosol through a patch pipette, subsequent to electrophysiological experiments. Two important factors proved crucial for reliable harvesting. First, silanizing the patch pipette glass prevented foreign extracellular RNA from attaching to charged residues on the glass surface. Second, substituting the commonly used perforating antibiotic amphotericin B with β-escin allowed efficient cytosol harvest without loosing the giga seal. Importantly, the two harvesting protocols revealed no difference in RNA isolation efficiency. Conclusion Depending on the cell type and preparation, validation of the harvesting technique is extremely important as contaminations may give false positives. Here we present an optimized protocol allowing secure harvesting of RNA from single cells in primary pituitary cell culture following perforated whole cell patch clamp experiments.
Lehmann, P; Ehrenstein, B; Hartung, W; Dragonas, C; Reischl, U; Fleck, M
2017-03-01
The diagnosis of Whipple's disease (WD) is commonly confirmed by histology demonstrating Periodic Acid Schiff (PAS)-positive macrophages in the duodenal mucosa. Analysis of intestinal tissue or other specimens using polymerase chain reaction (PCR) is a more sensitive method. However, the relevance of positive PCR findings is still controversial. Therefore, we evaluated the relevance of histology and PCR findings to establishing the diagnosis of WD in a series of WD patients initially presenting with suspected rheumatic diseases. Between 2006 and 2014, 20 patients with seronegative rheumatic diseases tested positive for Tropheryma whipplei (Tw) by PCR and/or histology and were enrolled in a retrospective analysis of the diagnostic value of both procedures. Seven of the 20 cases (35%) were diagnosed with 'classic' WD as indicated by PAS-positive macrophages. In the remaining 13 patients, the presence of Tw was detected by intestinal (n = 10) or synovial PCR analysis (n = 3). Two of the 20 patients (10%) with evidence of Tw did not respond to antibiotic therapy. They were not considered to suffer from WD. Therefore, relying only on histological findings of intestinal biopsies would have missed 11 (61%) of the 18 patients with WD in our cohort. In comparison, PCR of intestinal biopsies detected Tw-DNA in 14 (93%) of the 15 WD patients evaluated. Patients with a positive histology did not differ from PCR-positive patients with regard to sex, age, or duration of disease, but more often presented with gastrointestinal symptoms. A substantial number of WD patients present without typical intestinal histology findings. Additional PCR analysis of intestinal tissue or synovial fluid increased the sensitivity of the diagnostic evaluation and should be considered particularly in patients presenting with atypical seronegative rheumatic diseases and a high-risk profile for WD.
Targeted resequencing and variant validation using pxlence PCR assays
Directory of Open Access Journals (Sweden)
Frauke Coppieters
2016-01-01
Full Text Available The advent of next-generation sequencing technologies had a profound impact on molecular diagnostics. PCR is a popular method for target enrichment of disease gene panels. Using our proprietary primer-design pipeline, primerXL, we have created almost one million assays covering over 98% of the human exome. Here we describe the assay specification and both in silico and wet-lab validation of a selected set of 2294 assays using both next-generation sequencing and Sanger sequencing. Using a universal PCR protocol without optimization, these assays result in high coverage uniformity and limited non-specific coverage. In addition, data indicates a positive correlation between the predictive in silico specificity score and the amount of assay non-specific coverage.
Directory of Open Access Journals (Sweden)
Fabrícia Gimenes
Full Text Available Sexually transmitted diseases (STDs may impair sperm parameters and functions thereby promoting male infertility. To date limited molecular studies were conducted to evaluate the frequency and type of such infections in semen Thus, we aimed at conceiving and validating a multiplex PCR (M-PCR assay for the simultaneous detection of the following STD pathogens in semen: Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Trichomonas vaginalis, Herpes virus simplex (HSV -1 and -2, and Treponema pallidum; We also investigated the potential usefulness of this M-PCR assay in screening programs for semen pathogens. In addition, we aimed: to detect human Papillomavirus (HPV and genotypes by single PCR (sPCR in the same semen samples; to determine the prevalence of the seven STDs, HPV and co-infections; to assess the possibility that these infections affect semen parameters and thus fertility. The overall validation parameters of M-PCR were extremely high including agreement (99.2%, sensitivity (100.00%, specificity (99.70%, positive (96.40% and negative predictive values (100.00% and accuracy (99.80%. The prevalence of STDs was very high (55.3%. Furthermore, associations were observed between STDs and changes in semen parameters, highlighting the importance of STD detection in semen. Thus, this M-PCR assay has great potential for application in semen screening programs for pathogens in infertility and STD clinics and in sperm banks.
Combs, Laura Gaydosh; Warren, Joseph E; Huynh, Vivian; Castaneda, Joanna; Golden, Teresa D; Roby, Rhonda K
2015-11-01
targets human DNA in the Quantifiler(®) kit. Evidence of inhibition was observed for the human-specific assay at a lower metal concentration than detected by the IPC, for all metals examined except calcium. These results strongly suggest that determination of a "true negative" sample should not be based solely on the failure of the IPC to indicate the presence of a PCR inhibitor and indicate that amplification of all samples should be attempted, regardless of the quantification results. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Sampath, Asanga; Weerasekera, Manjula; Dilhari, Ayomi; Gunasekara, Chinthika; Bulugahapitiya, Uditha; Fernando, Neluka; Samaranayake, Lakshman
2017-12-01
Candida dubliniensis shares a wide range of phenotypic characteristics with Candida albicans including a common trait called germ tube positivity. Hence, laboratory differentiation of these two species is cumbersome. Duplex PCR analyses for C. albicans and C. dubliniensis was performed directly on DNA extracted from a total of 122 germ tube positive isolates derived from 100 concentrated oral rinse samples from a random cohort of diabetics attending a clinic in Sri Lanka. These results were confirmed by DNA sequencing of internal transcribed spacer (ITS) region of rDNA of the yeasts. Performance efficacy of duplex PCR was then compared with phenotypic identification using a standard battery of phenotypic tests. Of the 122 germ tube positive isolates three were identified by duplex PCR as C. dubliniensis and the remainder as C. albicans. On the contrary, when the standard phenotypic tests, sugar assimilation and chlamydospore formation, were used to differentiate the two species 13 germ tube positive isolates were erroneously identified as C. dubliniensis. Duplex PCR was found to be rapid, sensitive and more specific than phenotypic identification methods in discriminating C. dubliniensis from C. albicans. This is also the first report on the oral carriage of C. dubliniensis in a Sri Lankan population.
Hoferer, Marc; Braun, Anne; Skrypski, Julia; Bock, Sabine; Thalheim, Sabine; Sting, Reinhard
2017-09-01
Infectious pancreatic necrosis virus (IPNV) causes great losses in fish hatcheries world-wide. The detection of IPNV can be challenging in certain circumstances, particularly due to low viral load and the genetic variability of this RNA virus. For the first time, this project created a quantitative triplex real-time reverse transcription PCR (RT-qPCR), including an endogenous control system, for specific, sensitive and rapid detection of IPNV in routine diagnostics. Multiple sequence alignment of 46 nucleotide sequences of the segment A genome obtained from the NCBI database allowed the design of two RT-qPCR systems covering the IPNV genogroup 1 and genogroups 2-5, respectively. The completed triplex RT-qPCR including a salmonid-specific endogenous control showed high specificity and an analytical sensitivity of 20-40 oligonucleotide copies. Testing of dilution series of virus-loaded cell culture suspensions proved equality of the triplex RT-qPCR with virus detection in cell culture and a higher sensitivity than conventional RT-PCR in field samples. In comparative studies of a total of 77 field samples tested, 51 showed identical positive and 19 identical negative results in cell culture and the triplex RT-qPCR. However, seven other samples yielded positive results in the triplex RT-qPCR, but negative results in cell culture. Copyright © 2017 Elsevier B.V. All rights reserved.
LENUS (Irish Health Repository)
O'Callaghan, Isabelle
2010-05-01
To improve the detection of Neisseria gonorrhoeae by designing a multiplex PCR assay using two N gonorrhoeae-specific genes as targets, thereby providing detection and confirmation of a positive result simultaneously.
Sizikova, T E; Lebedev, V N; Pantyukhov, V B; Borisevich, S V; Merkulov, V A
2015-01-01
Experience of study and possible ways of elimination of false positive and false negative results during execution of polymerase chain reaction on an example of Junin virus RNA detection. MATERIALSS AND METHODS: Junin virus--causative agent of Argentine hemorrhagic fever (AHF) strain XJpR37/5787 was obtained from the State collection of pathogenicity group I causative agents of the 48th Central Research Institute. Reagent kit for detection of Junin virus RNA by RT-PCR was developed in the Institute and consists of 4 sets: for isolation of RNA, execution of reverse-transcription reaction, execution of PCR and electrophoretic detection of PCR products. RT-PCR was carried out by a standard technique. Continuous cell cultures of African green monkey Vero B, GMK-AH-1(D) were obtained from the museum of cell culture department of the Centre. An experimental study of the effect of various factors of impact on the sample under investigation ("thawing-freezing", presence of formaldehyde, heparin) on the obtaining of false negative results during Junin virus RNA detection by using RT-PCR was studied. Addition of 0.01% heparin to the samples was shown to completely inhibit PCR. Addition of 0.05% formaldehyde significantly reduces sensitivity of the method. A possibility of reduction of analysis timeframe from 15 to 5 days was shown during detection of the causative agent in samples with low concentration of the latter by growing the samples and subsequent analysis of the material obtained by using RT-PCR. During detection of causative agent by using RT-PCR false negative results could appear in the presence of formaldehyde and heparin in the sample. A possibility of elimination of false negative PCR results due to concentration of the causative agent in the sample under investigation at a level below sensitivity threshold was shown on the example of Junin virus RNA detection by using growing of the pathogen in appropriate accumulation system with subsequent analysis of the
Comparison of three mycobacterial DNA extraction methods from extrapulmonary samples for PCR assay
Directory of Open Access Journals (Sweden)
Khandaker Shadia
2012-01-01
Full Text Available Sensitivity of the molecular diagnostic tests of extrapulmonary tuberculosis largely depends upon the efficiency of DNA extraction methods. The objective of our study was to compare three methods of extracting DNA of Mycobacterium tuberculosis for testing by polymerase chain reaction. All three methods; heating, heating with sonication and addition of lysis buffer with heating and sonication were implicated on 20 extrapulmonary samples. PCR positivity was 2 (10%, 4 (20% and 7 (35% in the samples extracted by heating, heat+sonication and heat+sonication+lysis buffer method respectively. Of the extraction methods evaluated, maximum PCR positive results were achieved by combined heat, sonication and lysis buffer method which can be applied in routine clinical practice. Ibrahim Med. Coll. J. 2012; 6(1: 9-11
Directory of Open Access Journals (Sweden)
Miguel Saavedra
2013-01-01
Full Text Available We evaluate the elimination of the microscopic stage of conventional xenodiagnosis (XD to optimize the parasitological diagnosis of Trypanosoma cruzi in chronic Chagas disease. To this purpose we applied under informed consent two XD cages to 150 Chilean chronic chagasic patients. The fecal samples (FS of the triatomines at 30, 60 and 90 days post feeding were divided into two parts: in one a microscopic search for mobile trypomastigote and/or epimastigote forms was performed. In the other part, DNA extraction-purification for PCR directed to the conserved region of kDNA minicircles of trypanosomes (PCR-XD, without previous microscopic observation was done. An XD was considered positive when at least one mobile T. cruzi parasite in any one of three periods of incubation was observed, whereas PCR-XD was considered positive when the 330 bp band specific for T. cruzi was detected. 25 of 26 cases with positive conventional XD were PCR-XD positive (concordance 96.2%, whereas 85 of 124 cases with negative conventional XD were positive by PCR-XD (68.5%. Human chromosome 12 detected by Real-time PCR used as exogenous internal control of PCR-XD reaction allowed to discounting of PCR inhibition and false negative in 40 cases with negative PCR-XD. Conclusion: PCR-XD performed without previous microscopic observation is a useful tool for detection of viable parasites with higher efficiency then conventional XD.
Directory of Open Access Journals (Sweden)
AH Rasit
2011-03-01
Full Text Available OBJECTIVE: The aim of this study was to evaluate the role of polymerase chain reaction (PCR in the diagnosis of spinal tuberculosis after 2 weeks of preoperative anti-tuberculosis treatment and to compare PCR to the Löwenstein - Jensen Culture (LJC and histopathological examination (HPE methods. METHODS: Twenty-five patients were included in this study. Sixteen patients were diagnosed and treated for spinal tuberculosis based on clinical and radiological evidence. Nine patients were controls. The LJC method and HPE of the specimen were performed according to hospital protocol. PCR was performed using primer encoding insertion of sequences IS6110 for mycobacterium tuberculosis complex. Clinical findings and radiological features were the gold standard for comparison. RESULTS: PCR results were 15 positive and one negative. The sensitivity and specificity of PCR was 94% and 100% respectively (with 95% confidence interval [CI] 67% to 99% and 63% to 100%, respectively. HPE results showed 13 were positive and 3 negative in the spinal tuberculosis group; for the control group, all were negative. Sensitivity and specificity value of HPE was 82 % and 100% respectively (with 95% confidence interval [CI] 54% to 95% and 63% to 100%, respectively. Use of LJC showed only one was positive and 15 were negative in the spinal tuberculosis group whole all nine in the control group were negative. Sensitivity and specificity value of LJC was 6% and 100% respectively (with 95% confidence interval [CI] 0.3% to 32% and 63% to 100%, respectively. CONCLUSION: Our findings showed that the PCR for Mycobacterium tuberculosis is reliable as a method for diagnosis of spinal tuberculosis, even after of 2 weeks of anti-TB treatment, with an overall sensitivity of 94% and specificity of 100%.
Feasibility of shortening isolation of TB-suspects by first-sample PCR
DEFF Research Database (Denmark)
Fløe, Andreas; Wejse, Christian; Thomsen, Vibeke Østergaard
Rationale: Isolation of patients suspected for tuberculosis (TB) is usually guided by serial sputum smears. Many of patients initially isolated will turn out not to have TB, or will not be regarded as contagious. Current standards imply isolation for hours or days until contagiousness has been...... excluded. Objective: To evaluate the utility of single-specimen polymerase chain-reaction (PCR) for Mycobacterium tuberculosis complex (MTBC) as a parameter to cease isolation when negative. Methods: We evaluated all patients in Denmark who had sputa investigated for MTBC at the National Reference......-positive on the sample that produced the PCR-negative result. Conclusion: Though adequate sensitivity in diagnosing TB still requires serial samples for microbiological examination, the question of isolation can be determined by first-sample PCR in the majority of cases, when the test is negative. In our study, less...
Directory of Open Access Journals (Sweden)
Perkins James R
2012-07-01
Full Text Available Abstract Background Measuring gene transcription using real-time reverse transcription polymerase chain reaction (RT-qPCR technology is a mainstay of molecular biology. Technologies now exist to measure the abundance of many transcripts in parallel. The selection of the optimal reference gene for the normalisation of this data is a recurring problem, and several algorithms have been developed in order to solve it. So far nothing in R exists to unite these methods, together with other functions to read in and normalise the data using the chosen reference gene(s. Results We have developed two R/Bioconductor packages, ReadqPCR and NormqPCR, intended for a user with some experience with high-throughput data analysis using R, who wishes to use R to analyse RT-qPCR data. We illustrate their potential use in a workflow analysing a generic RT-qPCR experiment, and apply this to a real dataset. Packages are available from http://www.bioconductor.org/packages/release/bioc/html/ReadqPCR.htmland http://www.bioconductor.org/packages/release/bioc/html/NormqPCR.html Conclusions These packages increase the repetoire of RT-qPCR analysis tools available to the R user and allow them to (amongst other things read their data into R, hold it in an ExpressionSet compatible R object, choose appropriate reference genes, normalise the data and look for differential expression between samples.
A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.
Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth
2016-01-01
To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.
Miranda, A; Saldaña, A; González, K; Paz, H; Santamaría, G; Samudio, F; Calzada, J E
2012-09-01
Cutaneous leishmaniasis (CL) is a major vectorborne disease in Panama. In this study, the diagnostic performance and usefulness of two DNA extraction procedures from skin scraping samples collected on FTA filter paper for subsequent PCR diagnosis of CL was evaluated. A positive CL laboratory diagnosis was based on a positive parasitological test (Giemsa-stained smears or in vitro culture) and/or positive PCR test performed from skin scrapings collected in TE buffer (PCR-TE). Of 100 patients with skin lesions suggestive of CL, 82 (82%) were confirmed as CL positive. The sensitivity was calculated for each of the PCR approaches from samples collected on filter paper. The highest sensitivity was achieved by PCR-FTA processed by Chelex 100 (PCR-Chelex) (0.94). PCR-FTA extracted using the FTA purification reagent presented a lower sensitivity (0.60). Good concordance between routine PCR-TE and PCR-Chelex was observed (percent agreement=0.88, κ index=0.65). In conclusion, use of FTA filter paper for skin scraping collection combined with PCR is a reliable and convenient method for CL diagnosis in Panama, with comparable performance to the routine PCR method and with improved sensitivity compared with those of conventional parasitological methods. Copyright © 2012 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.
Floren, C; Wiedemann, I; Brenig, B; Schütz, E; Beck, J
2015-04-15
Species fraud and product mislabelling in processed food, albeit not being a direct health issue, often results in consumer distrust. Therefore methods for quantification of undeclared species are needed. Targeting mitochondrial DNA, e.g. CYTB gene, for species quantification is unsuitable, due to a fivefold inter-tissue variation in mtDNA content per cell resulting in either an under- (-70%) or overestimation (+160%) of species DNA contents. Here, we describe a reliable two-step droplet digital PCR (ddPCR) assay targeting the nuclear F2 gene for precise quantification of cattle, horse, and pig in processed meat products. The ddPCR assay is advantageous over qPCR showing a limit of quantification (LOQ) and detection (LOD) in different meat products of 0.01% and 0.001%, respectively. The specificity was verified in 14 different species. Hence, determining F2 in food by ddPCR can be recommended for quality assurance and control in production systems. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
An optimized one-tube, semi-nested PCR assay for Paracoccidioides brasiliensis detection.
Pitz, Amanda de Faveri; Koishi, Andrea Cristine; Tavares, Eliandro Reis; Andrade, Fábio Goulart de; Loth, Eduardo Alexandre; Gandra, Rinaldo Ferreira; Venancio, Emerson José
2013-01-01
Herein, we report a one-tube, semi-nested-polymerase chain reaction (OTsn-PCR) assay for the detection of Paracoccidioides brasiliensis. We developed the OTsn-PCR assay for the detection of P. brasiliensis in clinical specimens and compared it with other PCR methods. The OTsn-PCR assay was positive for all clinical samples, and the detection limit was better or equivalent to the other nested or semi-nested PCR methods for P. brasiliensis detection. The OTsn-PCR assay described in this paper has a detection limit similar to other reactions for the molecular detection of P. brasiliensis, but this approach is faster and less prone to contamination than other conventional nested or semi-nested PCR assays.
Dinoop, K P; Parija, Subhash Chandra; Mandal, Jharna; Swaminathan, R P; Narayanan, P
2016-01-01
Amoebiasis is a common parasitic infection caused by Entamoeba histolytica and amoebic liver abscess (ALA) is the most common extraintestinal manifestation of amoebiasis. The aim of this study was to standardise real-time PCR assays (Taqman and SYBR Green) to detect E. histolytica from liver abscess pus and stool samples and compare its results with nested-multiplex PCR. Liver abscess pus specimens were subjected to DNA extraction. The extracted DNA samples were subjected to amplification by nested-multiplex PCR, Taqman (18S rRNA) and SYBR Green real-time PCR (16S-like rRNA assays to detect E. histolytica/E. dispar/E. moshkovskii). The amplification products were further confirmed by DNA sequence analysis. Receiver operator characteristic (ROC) curve analysis was done for nested-multiplex and SYBR Green real-time PCR and the area under the curve was calculated for evaluating the accuracy of the tests to dignose ALA. In all, 17, 19 and 25 liver abscess samples were positive for E. histolytica by nested-multiplex PCR, SYBR Green and Taqman real-time PCR assays, respectively. Significant differences in detection of E. histolytica were noted in the real-time PCR assays evaluated ( Pnested-multiplex PCR, SYBR Green real-time PCR and Taqman real-time PCR evaluated showed a positivity rate of 34, 38 and 50 per cent, respectively. Based on ROC curve analysis (considering Taqman real-time PCR as the gold standard), it was observed that SYBR Green real-time PCR was better than conventional nested-multiplex PCR for the diagnosis of ALA. Taqman real-time PCR targeting the 18S rRNA had the highest positivity rate evaluated in this study. Both nested multiplex and SYBR Green real-time PCR assays utilized were evaluated to give accurate results. Real-time PCR assays can be used as the gold standard in rapid and reliable diagnosis, and appropriate management of amoebiasis, replacing the conventional molecular methods.
PCR-based techniques for leprosy diagnosis: from the laboratory to the clinic.
Directory of Open Access Journals (Sweden)
Alejandra Nóbrega Martinez
2014-04-01
Full Text Available In leprosy, classic diagnostic tools based on bacillary counts and histopathology have been facing hurdles, especially in distinguishing latent infection from active disease and diagnosing paucibacillary clinical forms. Serological tests and IFN-gamma releasing assays (IGRA that employ humoral and cellular immune parameters, respectively, are also being used, but recent results indicate that quantitative PCR (qPCR is a key technique due to its higher sensitivity and specificity. In fact, advances concerning the structure and function of the Mycobacterium leprae genome led to the development of specific PCR-based gene amplification assays for leprosy diagnosis and monitoring of household contacts. Also, based on the validation of point-of-care technologies for M. tuberculosis DNA detection, it is clear that the same advantages of rapid DNA detection could be observed in respect to leprosy. So far, PCR has proven useful in the determination of transmission routes, M. leprae viability, and drug resistance in leprosy. However, PCR has been ascertained to be especially valuable in diagnosing difficult cases like pure neural leprosy (PNL, paucibacillary (PB, and patients with atypical clinical presentation and histopathological features compatible with leprosy. Also, the detection of M. leprae DNA in different samples of the household contacts of leprosy patients is very promising. Although a positive PCR result is not sufficient to establish a causal relationship with disease outcome, quantitation provided by qPCR is clearly capable of indicating increased risk of developing the disease and could alert clinicians to follow these contacts more closely or even define rules for chemoprophylaxis.
Directory of Open Access Journals (Sweden)
Ariel Escobar
2013-03-01
Full Text Available Tuberculosis and brucellosis remain important causes of morbidity and mortality in many countries, for the detection of both diseases requires efficient and sensitive tool for effectuate the diagnosis. This study was aimed to evaluate and compare the duplex PCR versus the nested PCR, for detection of Brucella spp. (BR and Mycobacterium spp. (TB. A total of 100 samples of tissues from tracheo-bronchial lymph nodes, bovine lung and bacterial isolate as positive controls were used. Were evaluated ten combinations of primers which were designed to flank the segment of the 16S rRNA sequence (RB and antigen gen MPB70 (TB, the best result for the Duplex PCR was obtained with the primers Bru-2F/Bru-2R for BR and Tub-1F/Tub-N-R for TB. The amplification of the products was 225 and 230-bp respectively. In order to compare the results of the proposed technique, all samples were initially analyzed and compared between PCR and nested PCR (Kappa, k = 0.85 and the concordance between Duplex PCR and nested PCR (k = 0.88 for the two bacteria was very good.
Gupta, Vivek; Bhake, Arvind
2018-01-01
The diagnosis of tubercular lymphadenitis (TBLN) is challenging. This study assesses the role of diagnostic intervention with real-time PCR in clinically suspected tubercular lymphadenopathy in relation to cytology and microbiological methods. The cross-sectional study involved 214 patients, and PCR, cytology, and Ziehl-Neelsen (ZN) staining was performed on aspirates. The findings were compared with culture on Lowenstein-Jensen medium. The overall concordance of cytology and PCR, both individually and combined, was calculated. χ2 and Phi values were assessed between cytology, PCR, and culture. A cytological diagnosis of tuberculosis (TB), reactive lymphoid hyperplasia, and suppurative lymphadenitis was made in 71, 112, and 6 patients, respectively. PCR and culture were positive in 40% of the cases. Among the TBLN patients, PCR showed higher positivity in necrosis and culture showed higher positivity in necrotizing granuloma. Positive ZN staining was observed in 29.6% of the TBLN cases, with an overall positivity of 11%. PCR could additionally detect 82 cases missed by ZN staining. The overall concordance rate for either diagnostic modality, i.e., PCR or cytology, was highest (75%), and for PCR alone was 74%. Phi values were observed to be 0.47 between PCR and culture. Real-time PCR for Mycobacterium tuberculosis complex on aspirates offers a definitive and comparable diagnosis of TBLN. Including this approach as the primary investigation in the work-up of TBLN could reduce the burden of TB. © 2017 S. Karger AG, Basel.
Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis
2017-10-01
Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.
International Nuclear Information System (INIS)
R, Maria Lina; S, Dadang; Suhadi, F.
2000-01-01
To detect to DNA of 9 drug-resistant isolates of m. tuberculosis such as isoniazid, streptomycin, isoniazid + streptomycin and isoniazid + rifampisin- resistant isolates, the DNA amplification by using PCR assay was carried out after lysing the bacterial cells. Two primer pairs for amplification used were Pt8 and Pt9 and Pt3 and Pt6. The amplified DNA taeget of 8 drug-resistant isolates and 1 drug-resistant isolate by means Pt8 8 Pt9 primer, gave the positive and negative result, respectively. Presence of amplified DNA target fragmens/bands on agarose gel, showed the positive result and vice verse. PCR process by using Pt3 and Pt6 primer revealed the positive results on 2 drug-resistant islates, whereas there was no amplified DNA bands from the other 7 isolates. DNA amplification by using either Pt8 and Pt9 or Pt3 and Pt6 primers occurred on H sub.37Rv strain DNA. Size of the amplified DNA products with Pt8 and Pt9 and Pt3 and Pt6 primers were 541 bp and 188 bp, respectively
Directory of Open Access Journals (Sweden)
Kimble Matos
2007-02-01
Full Text Available PURPOSE: To study the applicability (sensitivity, specificity of polymerase chain reaction (PCR tests in the detection of cytomegalovirus (CMV, herpes virus (HSV and varicella zoster (VZV, Epstein-Barr virus (EBV, Mycobacterium sp and Toxoplasma gondii in the diagnosis of patients with or without AIDS, with presumably infectious uveitis, using serum, aqueous humor and vitreous humor samples. METHODS: Twenty individuals with uveitis of presumed infectious origin were evaluated. Sixteen of them had AIDS, four were immunocompetent individuals. We also evaluated 4 normal controls who underwent vitrectomy surgery. Clinical evaluation of the patients was performed together by three clinicians. PCR evaluations of the serum, aqueous, and vitreous humor were performed in a masked fashion by the laboratory staff. RESULTS: Twelve patients had a clinical diagnosis of CMV retinitis. Of these 6 (50% had a positive PCR for CMV in the vitreous, three (25% had a positive PCR for CMV in the serum, and none were positive in the aqueous. Five patients had a clinical diagnosis of acute retinal necrosis (ARN. Three (60% of these had positive PCR for HSV/VZV in the vitreous. One of these patients had a positive PCR reaction for both EBV and HSV/VZV in the vitreous samples. One patient with cutaneous herpes zoster had a positive PCR reaction for HSV/VZV in the serum. Four patients had a presumed diagnosis of ocular toxoplasmosis, one patient (25% had a positive PCR for Toxoplasma gondii in the serum, 3 (75% had positive results in the aqueous, and 2 (50% had positive results in the vitreous. One patient with presumed ocular tuberculosis had a positive PCR reaction both in the serum and in the vitreous samples. Finally, none of the four control individuals revealed any positive PCR reaction. CONCLUSION: PCR is an auxiliary diagnostic procedure that should be evaluated together with ophthalmological aspects of the patient.OBJETIVOS: Avaliar a aplicabilidade
RUCS: Rapid identification of PCR primers for unique core sequences
DEFF Research Database (Denmark)
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik
2017-01-01
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...
Markovich, Jessica E; Stucker, Karla M; Carr, Alaina H; Harbison, Carole E; Scarlett, Janet M; Parrish, Colin R
2012-07-01
To estimate the prevalence of canine parvovirus (CPV) strains among dogs with enteritis admitted to a referral hospital in the southwestern United States during an 11-month period and to compare diagnostic test results, disease severity, and patient outcome among CPV strains. Prospective observational study. 72 dogs with histories and clinical signs of parvoviral enteritis. For each dog, a fecal sample or rectal swab specimen was evaluated for CPV antigen via an ELISA. Subsequently, fecal samples (n = 42 dogs) and pharyngeal swab specimens (16) were obtained and tested for CPV antigen via an ELISA and CPV DNA via a PCR assay. For specimens with CPV-positive results via PCR assay, genetic sequencing was performed to identify the CPV strain. 56 dogs tested positive for CPV via ELISA or PCR assay. For 42 fecal samples tested via both ELISA and PCR assay, 27 had positive results via both assays, whereas 6 had positive PCR assay results only. Ten pharyngeal swab specimens yielded positive PCR assay results. Genetic sequencing was performed on 34 fecal or pharyngeal swab specimens that had CPV-positive PCR assay results; 25 (73.5%) were identified as containing CPV type-2c, and 9 (26.5%) were identified as containing CPV type-2b. No association was found between CPV strain and disease severity or clinical outcome. CPV type-2b and CPV type-2c posed similar health risks for dogs; therefore, genetic sequencing of CPV does not appear necessary for clinical management of infected patients. The diagnostic tests used could detect CPV type-2c.
Yağmur, Gülhan; Albayrak, Nurhan; Daş, Taner; Yıldırım, Muzaffer; Ozgün, Ayşe; Büyük, Yalçın
2014-10-01
Tuberculosis (TB) is one of those infections with high morbidity and mortality in all around the world. Hundreds of people died from this disease without diagnosed or due to resistant strains in Turkey. Therefore, it is important to identify postmortem cases who have died from tuberculosis. Molecular methods have been widely used as well as conventional methods in the diagnosis of tuberculosis. The aim of this study was to compare the two different real-time polymerase chain reaction (Rt-PCR) system in the postmortem diagnosis of Mycobacterium tuberculosis infections in paraffin-embedded tissues. A total of 40 paraffin-embedded tissue samples [lung (n= 35), brain (n= 2), heart (n= 2), lymph node (n= 1)] in which histopathologic findings consistent with TB (necrotizing granulomatous inflammation, gelatinous caseous pneumonia, necrotic fibrous nodul) obtained from 37 autopsy cases (31 male, 6 female; age range: 25-85 yrs) were included in the study. Paraffin-embedded tissues were deparafinized with xylene and ethyl alcohol and then DNA isolation was done with QIAsymphony DSP Virus/Pathogen Midi kit in the QIAsymphony device. DNA amplification process was performed by Rt-PCR using the kit Artus® M. tuberculosis RG-PCR in the Rotor-Gene® Q device (Qiagen, Germany). Likewise, after deparafinization process, samples placed in the cartridge and isolation and Rt-PCR was performed by Xpert® MTB/RIF (Cepheid, USA) system, simultaneosly. Seventeen and 20 out of the 40 paraffin-embedded tissues yielded positive results with Qiagen and Xpert system, respectively. M.tuberculosis DNA was found positive in 13 (32.5%) and negative in 16 (40%) of the samples by both of the systems, exhibiting 72.5% (29/40) of concordance. On the other hand, seven (17.5%) samples that were positive with Xpert system yielded negative result with the Qiagen, while four (10%) samples that were positive with Qiagen yielded negative result with the Xpert system. Of the 20 positive cases detected with
Directory of Open Access Journals (Sweden)
Zahra Derakhshani Nezhad
2012-09-01
Full Text Available Background & Objectives: Ethambutol is one of the four main drugs in treatment of tuberculosis. The most common mutation associated with this drug resistance usually occurs in codon 306 of embB. The aim of this study was to detect ethambutol resistance using Allele-Specific PCR and Spoligotyping in various subtypes of Mycobacterium tuberculosis. Methods : 140 sputum specimens were collected from suspected TB patients. They were digested and decontaminated using Pettrof method before culturing them on LJ medium. Drug susceptibility testing was performed on 106 culture positive specimens using proportional method. DNA was extracted from the isolated organisms and subsequently subjected to Allele-Specific PCR to detect any mutationin embB306. Spoligotyping was then used to determine the subtypes. Results: Out of 106 cultures positive samples, 36 samples (33.9% showed resistance to ethambutol using proportional method. Allele-Specific PCR assay identified 93 as sensitive and 13 (27.6% as resistant strains. The results of PCR were in agreement with result of proportional method. The PCR method revealed that 61.5% of mutation occurred in the first and 38.5% in third nucleotides. Spoligotyping differentiated Mycobacterium tuberculosis strains into Beijing (10 9.4%, Bovis (2 1.8%, CAS (24 22.6%, EAI (1 0.9%, Haarlem (27 25.4%, LAM (5 4.7%, Manu (5 4.7%, T (27 25.4% and U( 2 1,8% families. The high frequency of mutation in embB gene was belonged to Haarlem, CAS and T subfamilies. Conclusion: Based on results current study, mutations in the genes other than embB might have occurred in the resistant strains that gave negative result in Allele-Specific PCR assay. Therefore other mechanisms of resistance to this antibiotic should be investigated.
DEFF Research Database (Denmark)
Giese, Steen Bjørck; Ahrens, Peter
1999-01-01
Milk and faecal samples from cows with clinical symptoms of paratuberculosis were examined for the presence of Mycobacterium avium subsp.paratuberculosis (M. a. paratuberculosis) by culture and PCR. M. a. paratuberculosis was isolated in varied numbers from faeces or intestinal mucosa in 8 of 11...... animals. In milk from 5 cows (all faecal culture-positive) we cultivated a few colonies of M. a. paratuberculosis (less than 100 CFU per mi). Milk samples from 2 cows were PCR-positive (both animals were faecal culture-positive, and 1 cow was milk culture positive). One cow was culture......-negative on intestinal mucosa, but culture-positive in milk, and both faeces and milk were negative in culture and PCR from 2 cows. In conclusion the presence of M. a. paratuberculosis could be detected in raw milk by PCR but cultivation of milk was more sensitive in detecting the organism....
Feng, Qin; Gai, Fei; Sang, Yaxiong; Zhang, Jie; Wang, Ping; Wang, Yue; Liu, Bing; Lin, Dongmei; Yu, Yang; Fang, Jian
2018-01-01
The AURA3 clinical trial has shown that advanced non-small cell lung cancer (NSCLC) patients with EGFR T790M mutations in circulating tumor DNA (ctDNA) could benefit from osimertinib. The aim of this study was to assess the usefulness of QuantStudio™ 3D Digital PCR System platform for the detection of plasma EGFR T790M mutations in NSCLC patients, and compare the performances of 3D Digital PCR and ARMS-PCR. A total of 119 Chinese patients were enrolled in this study. Mutant allele frequency of plasma EGFR T790M was detected by 3D Digital PCR, then 25 selected samples were verified by ARMS-PCR and four of them were verified by next generation sequencing (NGS). In total, 52.94% (69/119) had EGFR T790M mutations detected by 3D Digital PCR. In 69 positive samples, the median mutant allele frequency (AF) was 1.09% and three cases presented low concentration (AF Digital PCR) was identified as T790M- by ARMS-PCR. Four samples were identified as T790M+ by both NGS and 3D Digital PCR, and typically three samples (3/4) presented at a low ratio (AF Digital PCR is a novel method with high sensitivity and specificity to detect EGFR T790M mutation in plasma.
Suryavanshi, Moushumi; Mehta, Anurag; Jaipuria, Jiten; Kumar, Dushyant; Vishwakarma, Gayatri; Panigrahi, Manoj Kumar; Verma, Haristuti; Saifi, Mumtaz; Sharma, Sanjeev; Tandon, Simran; Doval, D C; Das, Bhudev C
2018-02-09
IHC and FISH are used for categorizing HER 2 status in breast cancer at the protein and DNA level, respectively. HER 2 expression at the RNA level is quantitative, cheaper, easier to standardize and free from interobserver variation. 115 consecutive patients were tested by IHC, FISH and RT-PCR (test cohort). Assuming FISH result to be the response variable, ROC curves for RT-PCR ratio were analyzed to label HER 2 negative, equivocal and positive cases as RT-PCR score 1, 2 and 3, respectively. Inter-relationships between RT-PCR, IHC and FISH were defined. 'Clinical benefit' of a test was defined as proportion of patients labeled unequivocally as HER 2 positive or negative. Population for 1 year was simulated constraint to previous reports of HER 2 positivity and IHC category distribution by a meta-analysis of previous studies that evaluated concordance between IHC and FISH to determine HER 2 status (simulation cohort). Four diagnostic pathways in the simulation cohort were defined-(1) initial IHC, followed by FISH (conventional pathway); (2) initial RT-PCR, followed by FISH; (3) initial IHC, followed by RT-PCR and then by FISH; (4) initial RT-PCR, followed by IHC and then by FISH. The clinical benefit of IHC and RT-PCR in the four pathways was analyzed and sensitivity analysis for incremental cost-effectiveness ratio and cost-benefit comapring RT-PCR against IHC, both as first-line tests and among those with IHC score 2 as a reflex second-line test was performed by the Monte Carlo technique. 115 patients comprised the study population. While none with IHC score of 0 or 1 was FISH positive for HER 2, all cases with IHC score of 3 were FISH positive. 43 cases were assigned IHC score of 2. Thus, 72 patients benefited from the initial IHC testing [clinical benefit 62.6%], with the overall concordance between IHC and FISH being 100% for those with IHC score of 0, 1 and 3 (conclusive IHC categories). For RT-PCR with 100% concordance, 15.7% (115-97 = 18) patients
ABO Blood Group Genotyping by Real-time PCR in Kazakh Population
Directory of Open Access Journals (Sweden)
Pavel Tarlykov
2014-12-01
Full Text Available Introduction. ABO blood group genotyping is a new technology in hematology that helps prevent adverse transfusion reactions in patients. Identification of antigens on the surface of red blood cells is based on serology; however, genotyping employs a different strategy and is aimed directly at genes that determine the surface proteins. ABO blood group genotyping by real-time PCR has several crucial advantages over other PCR-based techniques, such as high rapidity and reliability of analysis. The purpose of this study was to examine nucleotide substitutions differences by blood types using a PCR-based method on Kazakh blood donors.Methods. The study was approved by the Ethics Committee of the National Center for Biotechnology. Venous blood samples from 369 healthy Kazakh blood donors, whose blood types had been determined by serological methods, were collected after obtaining informed consent. The phenotypes of the samples included blood group A (n = 99, B (n = 93, O (n = 132, and AB (n = 45. Genomic DNA was extracted using a salting-out method. PCR products of ABO gene were sequenced on an ABI 3730xl DNA analyzer (Applied Biosystems. The resulting nucleotide sequences were compared and aligned against reference sequence NM_020469.2. Real-time PCR analysis was performed on CFX96 Touch™ Real-Time PCR Detection System (BioRad.Results. Direct sequencing of ABO gene in 369 samples revealed that the vast majority of nucleotide substitutions that change the ABO phenotype were limited to exons 6 and 7 of the ABO gene at positions 261, 467, 657, 796, 803, 930 and 1,060. However, genotyping of only three of them (261, 796 and 803 resulted in identification of major ABO genotypes in the Kazakh population. As a result, TaqMan probe based real-time PCR assay for the specific detection of genotypes 261, 796 and 803 was developed. The assay did not take into account several other mutations that may affect the determination of blood group, because they have a
Knapp, Jenny; Millon, Laurence; Mouzon, Lorane; Umhang, Gérald; Raoul, Francis; Ali, Zeinaba Said; Combes, Benoît; Comte, Sébastien; Gbaguidi-Haore, Houssein; Grenouillet, Frédéric; Giraudoux, Patrick
2014-03-17
The oncosphere stage of Echinococcus multilocularis in red fox stools can lead, after ingestion, to the development of alveolar echinococcosis in the intermediate hosts, commonly small mammals and occasionally humans. Monitoring animal infection and environmental contamination is a key issue in public health surveillance. We developed a quantitative real-time PCR technique (qPCR) to detect and quantify E. multilocularis DNA released in fox faeces. A qPCR technique using a hydrolysis probe targeting part of the mitochondrial gene rrnL was assessed on (i) a reference collection of stools from 57 necropsied foxes simultaneously investigated using the segmental sedimentation and counting technique (SSCT) (29 positive for E. multilocularis worms and 28 negative animals for the parasite); (ii) a collection of 114 fox stools sampled in the field: two sets of 50 samples from contrasted endemic regions in France and 14 from an E. multilocularis-free area (Greenland). Of the negative SSCT controls, 26/28 were qPCR-negative and two were weakly positive. Of the positive SSCT foxes, 25/29 samples were found to be positive by qPCR. Of the field samples, qPCR was positive in 21/50 (42%) and 5/48 (10.4%) stools (2 samples inhibited), originating respectively from high and low endemic areas. In faeces, averages of 0.1 pg/μl of DNA in the Jura area and 0.7 pg/μl in the Saône-et-Loire area were detected. All qPCR-positive samples were confirmed by sequencing. The qPCR technique developed here allowed us to quantify environmental E. multilocularis contamination by fox faeces by studying the infectious agent directly. No previous study had performed this test in a one-step reaction. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuny Erwanto
2013-03-01
Full Text Available A polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP and species specific PCR methods had been applied for identifying pork in mixture of meat. Pork sample in various levels (1, 3, 5 and 10% was prepared in mixture with beef, chicken and mutton. The primary CYTb1 and CYTb2 were designed in the mitochondrial cytochrome b b (cytochrome b gene and PCR successfully amplified fragments of 359 bp. To distinguish pig species existence, the amplified PCR products of mitochondrial DNA were cut by BseDI restriction enzyme. The result showed that pig mitochondrial DNA was cut into 131 and 228 bp fragments. A polymerase chain reaction (PCR method based on the nucleotide sequence variation in the amelogenin gene has been chosen for the specific identification of pork DNAs in mixture meat. The primers designed generated specific fragments of 353 and 312 bp length for pork. The specificity of the primary designed was tested on 4 animal species including pig, cattle, chicken and goat species. Analysis of experimental mixture meat demonstrated that 1% of raw pork tissues could be detected using PCR-RFLP with BseDI restriction enzyme but detection using species-specific PCR showed the cross reactivity to beef, chicken and mutton. The cytochrome b PCR-RFLP species identification assay yielded excellent results for identification of pig species. PCR-RFLP is a potentially reliable technique for detection of the existence of pork in animal food product for Halal authentication. Keywords: Pork identification, cytochrome b, amelogenin, polymerase chain reaction ABSTRAK Penelitian ini dilakukan untuk mengaplikasikan metode deteksi daging babi dalam campuan daging dengan sapi, kambing dan ayam melalui PCR-RFLP dan PCR dengan primer spesifik untuk babi. Level kontaminasi daging babi dibuat sebesar 1, 3, 5 dan 10% dari total daging dalam campuran. Metode PCR-RFLP menggunakan sepasang primer yaitu gen cytochrome b dari mitokondria yang
Directory of Open Access Journals (Sweden)
Aline Diniz Cabral
2009-12-01
Full Text Available Neospora caninum, a cause of abortion and stillbirth in cattle, was studied by histology, immunohistochemistry, and nested-PCR, using primers from the Nc5 region of the genomic DNA (PCR PLUS and primers from the ITS1 region of the ribosomal DNA (PCR JB. A total of 105 fetal samples sent to the Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico from January 2006 to May 2008 were examined for evidence of N. caninum. Histological examination revealed 71.4% with non-suppurative inflammation in the heart, lung, liver, kidney, placenta, and brain. Immunohistochemistry detected infections in 8.6% of the samples, mainly in the brain, placenta, and heart. Nested-PCR JB revealed 6.7% with infections, while nested-PCR PLUS returned 20.9% positive results, mainly in brain and placenta, and in the pooled liver and heart. Kappa statistics demonstrated little agreement among the three techniques. The three methods are complementary, since they have distinct diagnostic characteristics and were combined to give a positivity rate of 24.8%.Pesquisou-se Neospora caninum como causador de abortamento e natimortalidade em bovinos, por meio de exame histopatológico (hematoxilina-eosina, imunoistoquímica (IHQ e nested-PCR, utilizando primers da região Nc5 do DNA genômico (PCR PLUS e primers da região ITS1 do DNA ribossomal (PCR JB. Foram avaliadas 105 amostras de abortamento bovino entre janeiro de 2006 a maio de 2008, encaminhadas ao Centro de Pesquisa e Desenvolvimento de Sanidade Animal do Instituto Biológico para diagnóstico diferencial de causas infecciosas. Observou-se em 71,4% das amostras lesões histológicas (HE caracterizadas pela presença de células inflamatórias mononucleares no coração, pulmão, fígado, rim, placenta e cérebro. A IHQ detectou 8,57% de positividade, sendo maior no cérebro, placenta e coração. A nested-PCR JB revelou 6,66% de casos positivos, enquanto que a nested-PCR PLUS apresentou maior taxa
Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan
2015-02-01
AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.
Jefferies, Ryan; Morgan, Eric R; Helm, Jenny; Robinson, Matthew; Shaw, Susan E
2011-12-01
This study reports the development of a real-time PCR assay and an indirect ELISA to improve on current detection of canine Angiostrongylus vasorum infection. A highly specific fluorescent probe-based, real-time PCR assay was developed to target the A. vasorum second internal transcribed spacer region and detected DNA in EDTA blood, lung tissue, broncho-alveolar larvage fluid, endotracheal mucus, pharyngeal swabs and faecal samples. PCR was fast (∼1 h), highly efficient when using EDTA blood samples, consistently detected a single molecule of parasite DNA and did not amplify DNA from other parasitic nematodes or definitive host species. An indirect ELISA was also developed using the soluble protein fraction from adult A. vasorum worms. Some cross-reactive antigen recognition was observed when tested against sera from dogs infected with Crenosoma vulpis (n = 8), Toxocara canis (n = 5) and Dirofilaria immitis (n = 5). This was largely overcome by setting the cut-off for a positive result at an appropriately high level. Field evaluation of the real-time PCR and ELISA was conducted by testing sera and EDTA blood from dogs with suspected A. vasorum infection (n = 148) and compared with the Baermann's larval migration test in faeces. Thirty-one dogs were positive by at least one test. Of these, 20 (65%) were detected by the Baermann method, 18 (58%) by blood PCR, 24 (77%) by ELISA and 28 (90%) by blood PCR and ELISA together. Combined testing using real-time PCR and ELISA therefore improved the detection rate of A. vasorum infection and holds promise for improved clinical diagnosis and epidemiological investigation.
The potential of TaqMan Array Cards for detection of multiple biological agents by real-time PCR.
Directory of Open Access Journals (Sweden)
Phillip A Rachwal
Full Text Available The TaqMan Array Card architecture, normally used for gene expression studies, was evaluated for its potential to detect multiple bacterial agents by real-time PCR. Ten PCR assays targeting five biological agents (Bacillus anthracis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, and Yersinia pestis were incorporated onto Array Cards. A comparison of PCR performance of each PCR in Array Card and singleplex format was conducted using DNA extracted from pure bacterial cultures. When 100 fg of agent DNA was added to Array Card channels the following levels of agent detection (where at least one agent PCR replicate returned a positive result were observed: Y. pestis 100%, B. mallei & F. tularensis 93%; B. anthracis 71%; B. pseudomallei 43%. For B. mallei & pseudomallei detection the BPM2 PCR, which detects both species, outperformed PCR assays specific to each organism indicating identification of the respective species would not be reproducible at the 100 fg level. Near 100% levels of detection were observed when 100 fg of DNA was added to each PCR in singleplex format with singleplex PCRs also returning sporadic positives at the 10 fg per PCR level. Before evaluating the use of Array Cards for the testing of environmental and clinical sample types, with potential levels of background DNA and PCR inhibitors, users would therefore have to accept a 10-fold reduction in sensitivity of PCR assays on the Array Card format, in order to benefit for the capacity to test multiple samples for multiple agents. A two PCR per agent strategy would allow the testing of 7 samples for the presence of 11 biological agents or 3 samples for 23 biological agents per card (with negative control channels.
DEFF Research Database (Denmark)
Iftner, Thomas; Germ, Liesje; Swoyer, Ryan
2009-01-01
methods has not been well characterized. Clinically, cytology is used to establish possible HPV infection. We evaluated the sensitivity and specificity of HPV multiplex PCR assays compared to those of the testing scheme of the Hybrid Capture II (HCII) assay followed by an HPV PCR/line hybridization assay...... (HCII-LiPA v2). SurePath residual samples were split into two aliquots. One aliquot was subjected to HCII testing followed by DNA extraction and LiPA v2 genotyping. The second aliquot was shipped to a second laboratory, where DNA was extracted and HPV multiplex PCR testing was performed. Comparisons...... were evaluated for 15 HPV types common in both assays. A slightly higher proportion of samples tested positive by the HPV multiplex PCR than by the HCII-LiPA v2 assay. The sensitivities of the multiplex PCR assay relative to those of the HCII-LiPA v2 assay for HPV types 6, 11, 16, and 18, for example...
Directory of Open Access Journals (Sweden)
Lidya Chaidir
Full Text Available BACKGROUND: Bacteriological confirmation of tuberculous (TB meningitis is difficult. Culture is slow and microscopy has insufficient sensitivity. We evaluated real time PCR targeting insertion sequence IS6110 among 230 consecutive adult patients with subacute meningitis in a referral hospital in Indonesia. METHODS: Cerebrospinal fluid (CSF samples were examined using microscopy, solid and liquid culture, and real time IS6110-PCR with a fluorescence-labeled probe using DNA extracted from CSF. CSF samples from 40 non-infectious neurology patients were used as negative controls. IS6110-PCR results were linked with clinical and CSF characteristics. RESULTS: Most patients presented with subacute meningitis, after a median of 14 days of symptoms (range 7-30. After exclusion of cryptococcal and bacterial meningitis, 207 patients were classified as definite or probable TB meningitis; 17.9% with HIV infection. Among this group IS6110-PCR gave the highest positivity rate (68%, 95% CI 62-74% compared with microscopy of ZN-stained slides (11%, 95% CI 7-15%, and mycobacterial culture using solid (36%, 95% CI 29-42% and liquid (44%, 95% CI 37-51% media. IS6110-PCR was positive in 92% of patients with culture-positive and 42% of patients with culture-negative probable TB meningitis. Among culture-negative patients, a positive PCR was associated with a history of TB treatment, a longer duration of illness, a higher CSF cell count and protein, and a lower CSF glucose. IS6110-PCR was negative in all CSF samples from non-meningitis control patients. CONCLUSIONS: Real time IS6110-PCR is a quick, sensitive, and specific test for diagnosing of TB meningitis in this setting. Its performance in other (less-developed settings needs further study.
Molecular diagnostic PCR handbook
International Nuclear Information System (INIS)
Viljoen, G.J.; Crowther, J.R.; Nel, L.H.
2005-01-01
The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology
Optimization of a 12-hour TaqMan PCR-based method for detection of Salmonella bacteria in meat
DEFF Research Database (Denmark)
Josefsen, Mathilde Hartmann; Krause, Michael; Hansen, F.
2007-01-01
no positive effects and resulted in decreased reproducibility. Increasing the amount of PCR template DNA from 5 to 20 mu l improved the threshold cycle value by approximately 2. The improved 12-h PCR method was successfully compared to a reference culture method with 100 minced meat and poultry samples...... the highest number of salmonellae. When analyzing minced meat samples, positive effects of increasing the initial sampling volume from 1 to 5 ml and increasing the amount of paramagnetic particles to 90 mu l were observed. However, washing the pellet and eluting the DNA in reduced volumes (25 and 50 mu l) had...
African Journals Online (AJOL)
Elham
2013-07-03
Jul 3, 2013 ... was constructed with competitive strategy by PCR-cloning technique and the limitation range was determined. The PCR products of MTB and IAC were 245 and 660 bp, respectively on .... products' differentiation was easy.
Landry, Marie L; Ferguson, David; Topal, Jeffrey
2014-01-01
Simplexa Clostridium difficile universal direct PCR, a real-time PCR assay for the detection of the C. difficile toxin B (tcdB) gene using the 3M integrated cycler, was compared with a two-step algorithm which includes the C. Diff Chek-60 glutamate dehydrogenase (GDH) antigen assay followed by cytotoxin neutralization. Three hundred forty-two liquid or semisolid stools submitted for diagnostic C. difficile testing, 171 GDH antigen positive and 171 GDH antigen negative, were selected for the study. All samples were tested by the C. Diff Chek-60 GDH antigen assay, cytotoxin neutralization, and Simplexa direct PCR. Of 171 GDH-positive samples, 4 were excluded (from patients on therapy or from whom duplicate samples were obtained) and 88 were determined to be true positives for toxigenic C. difficile. Of the 88, 67 (76.1%) were positive by the two-step method and 86 (97.7%) were positive by PCR. Seventy-nine were positive by the GDH antigen assay only. Of 171 GDH antigen-negative samples, none were positive by PCR. One antigen-negative sample positive by the cytotoxin assay only was deemed a false positive based on chart review. Simplexa C. difficile universal direct PCR was significantly more sensitive for detecting toxigenic C. difficile bacteria than cytotoxin neutralization (P = 0.0002). However, most PCR-positive/cytotoxin-negative patients did not have clear C. difficile disease. The estimated cost avoidance provided by a more rapid molecular diagnosis was outweighed by the cost of isolating and treating PCR-positive/cytotoxin-negative patients. The costs, clinical consequences, and impact on nosocomial transmission of treating and/or isolating patients positive for toxigenic C. difficile by PCR but negative for in vivo toxin production merit further study.
Directory of Open Access Journals (Sweden)
Azimi, Leila
2013-11-01
Full Text Available [english] Background: Resistance to carbapenems is developing around the world and can cause many problems for treatment of patients. Production of metallo-beta-lactamase (MBL is one of the main mechanism for this type of resistance. So, detection of MBL-producer microorganisms can prevent the spread of this type of resistance.Materials and methods: In this study 94 spp. were investigated. Resistance to imipenem was conducted after purification and identification. Combination disc (CD and Double Disc Synergy Test (DDST were performed for phenotypic detection of MBL and the molecular PCR method was done for vim-1, vim-2, imp-1 and OXA-23 genes.Results: According to TSI, SIM and oxidation-fermentation (OF test and PCR assay 93 and one strain were identified. 85% of them were resistant to imipenem. 34% of them have a positive combination disc test (CD while Double Disc Synergy Test (DDST was negative for all of them. The vim-1, vim-2 and imp-1 genes were not detected in PCR molecular method, however in 74% of strains with positive results in combination disc, were positive for the OXA-23 gene after PCR test. This study shows that the blaOXA-23 resistance determinant may become an emerging therapeutic problem.Discussion: According to the results, it seems that combination disc does not have enough specificity for detection of MBL-producer and using Double Disc Synergy Test (DDST can be more convenient.
Improved sensitivity of circulating tumor DNA measurement using short PCR amplicons
DEFF Research Database (Denmark)
Andersen, Rikke Fredslund; Spindler, Karen-Lise Garm; Brandslund, Ivan
2015-01-01
, however, presents a number of challenges that require attention. The amount of DNA is low and highly fragmented and analyses need to be optimized accordingly. KRAS ARMS-qPCR assays with amplicon lengths of 120 and 85 base pairs, respectively, were compared using positive control material (PCR fragments...
Maertens, J.; Bueselinck, K.; Lagrou, K.
2016-01-01
Infection is an important complication in patients with hematologic malignancies or solid tumors undergoing intensive cytotoxic chemotherapy. In only 20 to 30% of the febrile neutropenic episodes, an infectious agent is detected by conventional cultures. In this prospective study, the performance of broad-range PCR coupled with electrospray ionization time of flight mass spectrometry (PCR/ESI-MS) technology was compared to conventional blood cultures (BC) in a consecutive series of samples from high-risk hematology patients. In 74 patients, BC and a whole-blood sample for PCR/ESI-MS (Iridica BAC BSI; Abbott, Carlsbad, CA, USA) were collected at the start of each febrile neutropenic episode and, in case of persistent fever, also at day 5. During 100 different febrile episodes, 105 blood samples were collected and analyzed by PCR/ESI-MS. There was evidence of a bloodstream infection (BSI) in 36/105 cases (34%), based on 14 cases with both PCR/ESI-MS and BC positivity, 17 cases with BC positivity only, and 5 cases with PCR/ESI-MS positivity only. The sensitivity of PCR/ESI-MS was 45%, specificity was 93%, and the negative predictive value was 80% compared to blood culture. PCR/ESI-MS detected definite pathogens (Fusobacterium nucleatum and Streptococcus pneumoniae) missed by BC, whereas it missed both Gram-negative and Gram-positive organisms detected by BC. PCR/ESI-MS testing detected additional microorganisms but showed a low sensitivity (45%) compared to BC in neutropenic patients. Our results indicate a lower concordance between BC and PCR/ESI-MS in the neutropenic population than what has been previously reported in other patient groups with normal white blood cell distribution, and a lower sensitivity than other PCR-based methods. PMID:27440820
Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei
2015-01-01
Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...
Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo
2013-12-01
Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.
The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.
Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K
2003-01-01
An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT-PCR
Roberts, Megan C; Miller, Dave P; Shak, Steven; Petkov, Valentina I
2017-06-01
The Oncotype DX ® Breast Recurrence Score™ (RS) assay is validated to predict breast cancer (BC) recurrence and adjuvant chemotherapy benefit in select patients with lymph node-positive (LN+), hormone receptor-positive (HR+), HER2-negative BC. We assessed 5-year BC-specific survival (BCSS) in LN+ patients with RS results in SEER databases. In this population-based study, BC cases in SEER registries (diagnosed 2004-2013) were linked to RS results from assays performed by Genomic Health (2004-2014). The primary analysis included only patients (diagnosed 2004-2012) with LN+ (including micrometastases), HR+ (per SEER), and HER2-negative (per RT-PCR) primary invasive BC (N = 6768). BCSS, assessed by RS category and number of positive lymph nodes, was calculated using the actuarial method. The proportion of patients with RS results and LN+ disease (N = 8782) increased over time between 2004 and 2013, and decreased with increasing lymph node involvement from micrometastases to ≥4 lymph nodes. Five-year BCSS outcomes for those with RS < 18 ranged from 98.9% (95% CI 97.4-99.6) for those with micrometastases to 92.8% (95% CI 73.4-98.2) for those with ≥4 lymph nodes. Similar patterns were found for patients with RS 18-30 and RS ≥ 31. RS group was strongly predictive of BCSS among patients with micrometastases or up to three positive lymph nodes (p < 0.001). Overall, 5-year BCSS is excellent for patients with RS < 18 and micrometastases, one or two positive lymph nodes, and worsens with additionally involved lymph nodes. Further analyses should account for treatment variables, and longitudinal updates will be important to better characterize utilization of Oncotype DX testing and long-term survival outcomes.
Evaluation of two real time PCR assays for the detection of bacterial DNA in amniotic fluid.
Girón de Velasco-Sada, Patricia; Falces-Romero, Iker; Quiles-Melero, Inmaculada; García-Perea, Adela; Mingorance, Jesús
2018-01-01
The aim of this study was to evaluate two non-commercial Real-Time PCR assays for the detection of microorganisms in amniotic fluid followed by identification by pyrosequencing. We collected 126 amniotic fluids from 2010 to 2015 for the evaluation of two Real-Time PCR assays for detection of bacterial DNA in amniotic fluid (16S Universal PCR and Ureaplasma spp. specific PCR). The method was developed in the Department of Microbiology of the University Hospital La Paz. Thirty-seven samples (29.3%) were positive by PCR/pyrosequencing and/or culture, 4 of them were mixed cultures with Ureaplasma urealyticum. The Universal 16S Real-Time PCR was compared with the standard culture (81.8% sensitivity, 97.4% specificity, 75% positive predictive value, 98% negative predictive value). The Ureaplasma spp. specific Real-Time PCR was compared with the Ureaplasma/Mycoplasma specific culture (92.3% sensitivity, 89.4% specificity, 50% positive predictive value, 99% negative predictive value) with statistically significant difference (p=0.005). Ureaplasma spp. PCR shows a rapid response time (5h from DNA extraction until pyrosequencing) when comparing with culture (48h). So, the response time of bacteriological diagnosis in suspected chorioamnionitis is reduced. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Reza Faraji
2018-02-01
Full Text Available Broad-range bacterial rDNA polymerase chain reaction (PCR followed by sequencing may be identified as the etiology of infective endocarditis (IE from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery.
Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi
2018-02-01
Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.
Xu, Chun-Wei; Wang, Wen-Xian; Chen, Yan-Ping; Chen, Yu; Liu, Wei; Zhong, Li-Hua; Chen, Fang-Fang; Zhuang, Wu; Song, Zheng-Bo; Chen, Xiao-Hui; Huang, Yun-Jian; Guan, Yan-Fang; Yi, Xin; Lv, Tang-Feng; Zhu, Wei-Feng; Lu, Jian-Ping; Wang, Xiao-Jiang; Shi, Yi; Lin, Xian-Dong; Chen, Gang; Song, Yong
2018-04-11
ALK rearrangement-advanced NSCLC patients respond to crizotinib. ALK rearrangement is currently determined with RT-PCR. VENTANA IHC is a standard method to identify ALK protein overexpression in NSCLC; however, VENTANA IHC has rarely been used to determine the response to crizotinib in Chinese patients with NSCLC and ALK overexpression. To better clarify the clinical implication of VENTANA IHC to detect ALK rearrangements, we conducted this study to analyze VENTANA IHC and RT-PCR in a large cohort of Chinese patients with NSCLC undergoing screening for ALK rearrangements. A total of 1720 patients with NSCLC who had ALK rearrangements detected by VENTANA IHC and/or RT-PCR were included in this analysis. We compared the efficacy and survival of ALK-positive patients detected by VENTANA IHC and RT-PCR. We used NGS to identify patients in whom the two methods were inconsistent. Among 1720 patients, 187 (10.87%) were shown to be ALK-positive by VENTANA IHC and/or RT-PCR, and 66 received crizotinib treatment. We identified 10.27% (172/1674) of patients as ALK-positive by the VENTANA IHC method, and 12.73% (41/322) of patients had ALK rearrangements by the RT-PCR method. Twenty-nine of 276 (10.51%) ALK-positive patients were simultaneously analyzed using VENTANA IHC and RT-PCR. The overall response rates were 65.90% (29/44) by VENTANA IHC and 55.88% (19/34) by RT-PCR. The disease control rates were 86.36% (38/44) by VENTANA IHC and 76.47% (26/34) by RT-PCR. In contrast, the median progression-free survival for VENTANA IHC and RT-PCR was 8.5 and 9.2 months, respectively. The VENTANA IHC and RT-PCR results obtained for 6 of 17 ALK-positive patients were inconsistent based on NGS; specifically, 4 patients had EML4-ALK fusions, 2 patients had non EML4-ALK fusions, 1 patient had a KCL1-ALK fusion, and one patient had a FBXO36-ALK fusion. VENTANA IHC is a reliable and rapid screening tool used in routine pathologic laboratories for the identification of suitable candidates for
Directory of Open Access Journals (Sweden)
M Heydarnezhadi
2011-09-01
Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidiosis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neelsen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed primers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopically were positive. The described primary and nested PCR method could detect all Cryptosporidium positive samples from human and cattle. Regards to suspected negative samples in primary PCR examination, the Nested PCR could approve two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was negative in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.
Directory of Open Access Journals (Sweden)
F Ghazi
2012-05-01
Full Text Available
Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR.
Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5′untranslated region (5′ UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.
Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.
Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid
Saba Shirvan, Aylar; Mardani, Karim
2014-01-01
Infectious bronchitis (IB) and Newcastle disease (ND) are highly contagious and the most economically important diseases of the poultry affecting respiratory tract and causing economic losses in poultry industry throughout the world. In the present study, the simultaneous detection and differentiation of causative agents of these diseases were investigated using duplex-RT-PCR. RNA was extracted from vaccinal and reference strains of infectious bronchitis virus (IBV) and Newcastle disease virus (NDV) and then cDNA was synthesized. Using two universal primer sets for detection of IBV and NDV, the duplex-RT-PCR was developed. In order to assess the efficiency of the developed duplex RT-PCR, a number of 12 broiler farms with the symptoms of respiratory tract infection was sampled (trachea, lung and kidney were sampled from affected birds suspicious for IBV and NDV infections). After RNA extraction from tissues and cDNA synthesis, the presence of IBV and NDV genome were investigated using duplex-PCR. The results showed that three of twelve examined broiler farms were positive for IBV and two farms were positive for NDV and IBV. The results revealed that the duplex-RT-PCR is a quick and sensitive procedure for simultaneously detecting IBV and NDV in birds with respiratory infections.
A quantitative PCR (TaqMan assay for pathogenic Leptospira spp
Directory of Open Access Journals (Sweden)
Symonds Meegan L
2002-07-01
Full Text Available Abstract Background Leptospirosis is an emerging infectious disease. The differential diagnosis of leptospirosis is difficult due to the varied and often "flu like" symptoms which may result in a missed or delayed diagnosis. There are over 230 known serovars in the genus Leptospira. Confirmatory serological diagnosis of leptospirosis is usually made using the microscopic agglutination test (MAT which relies on the use of live cultures as the source of antigen, often performed using a panel of antigens representative of local serovars. Other techniques, such as the enzyme linked immunosorbent assay (ELISA and slide agglutination test (SAT, can detect different classes of antibody but may be subject to false positive reactions and require confirmation of these results by the MAT. Methods The polymerase chain reaction (PCR has been used to detect a large number of microorganisms, including those of clinical significance. The sensitivity of PCR often precludes the need for isolation and culture, thus making it ideal for the rapid detection of organisms involved in acute infections. We employed real-time (quantitative PCR using TaqMan chemistry to detect leptospires in clinical and environmental samples. Results and Conclusions The PCR assay can be applied to either blood or urine samples and does not rely on the isolation and culture of the organism. Capability exists for automation and high throughput testing in a clinical laboratory. It is specific for Leptospira and may discriminate pathogenic and non-pathogenic species. The limit of detection is as low as two cells.
Development of a PCR technique specific for Demodex injai in biological specimens.
Sastre, N; Ravera, I; Ferreira, D; Altet, L; Sánchez, A; Bardagí, M; Francino, O; Ferrer, L
2013-09-01
The identification of Demodex injai as a second Demodex species of dog opened new questions and challenges in the understanding on the Demodex-host relationships. In this paper, we describe the development of a conventional PCR technique based on published genome sequences of D. injai from GenBank that specifically detects DNA from D. injai. This technique amplifies a 238-bp fragment corresponding to a region of the mitochondrial 16S rDNA of D. injai. The PCR was positive in DNA samples obtained from mites identified morphologically as D. injai, which served as positive controls, as well as in samples from three cases of demodicosis associated with proliferation of mites identified as D. injai. Furthermore, the PCR was positive in 2 out of 19 healthy dogs. Samples of Demodex canis and Demodex folliculorum were consistently negative. Skin samples from seven dogs with generalized demodicosis caused by D. canis were all negative in the D. injai-specific PCR, demonstrating that in generalized canine demodicosis, mite proliferation is species-specific. This technique can be a useful tool in the diagnosis and in epidemiologic and pathogenic studies.
Absolute quantification by droplet digital PCR versus analog real-time PCR
Hindson, Christopher M; Chevillet, John R; Briggs, Hilary A; Gallichotte, Emily N; Ruf, Ingrid K; Hindson, Benjamin J; Vessella, Robert L; Tewari, Muneesh
2014-01-01
Nanoliter-sized droplet technology paired with digital PCR (ddPCR) holds promise for highly precise, absolute nucleic acid quantification. Our comparison of microRNA quantification by ddPCR and real-time PCR revealed greater precision (coefficients of variation decreased by 37–86%) and improved day-to-day reproducibility (by a factor of seven) of ddPCR but with comparable sensitivity. When we applied ddPCR to serum microRNA biomarker analysis, this translated to superior diagnostic performance for identifying individuals with cancer. PMID:23995387
RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK
Directory of Open Access Journals (Sweden)
Edith Burbano
2006-05-01
Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses
Directory of Open Access Journals (Sweden)
Peng Wang
Full Text Available Adequate detection of the production of carbapenemase in Enterobacteriaceae isolates is crucial for infection control measures and the appropriate choice of antimicrobial therapy. In this study, we investigated the frequency of false positive results for the detection of carbapenemases in carbapenemase-negative Escherichia coli and Klebsiella pneumoniae clinical isolates by the modified Hodge test (MHT. Three hundred and one E. coli and K. pneumoniae clinical isolates were investigated. All produced extended spectrum β-lactamases (ESBLs but were susceptible to carbapenems. Antimicrobial susceptibility testing was performed by the disk diffusion and agar dilution methods. The MHT was performed using the standard inoculum of test organisms recommended by the CLSI. Genes that encoded ESBLs and carbapenemases were identified by PCR and DNA sequencing. Among the 301 clinical isolates, none of the isolates conformed to the criteria for carbapenemase screening recommended by the CLSI. The susceptibility rates for imipenem, meropenem, and ertapenem all were 100.0%, 100.0%, and 100.0%, respectively. Of the 301 E. coli and K. pneumoniae isolates, none produced carbapenemase. The MHT gave a positive result for 3.3% (10/301 of the isolates. False positive results can occur when the MHT is used to detect carbapenemase in ESBL-producing isolates and clinical laboratories must be aware of this fact.
Diagnostic PCR tests for Microsporum audouinii, M. canis and Trichophyton infections
DEFF Research Database (Denmark)
Brillowska-Dabrowska, Anna; Swierkowska, Aleksandra; Lindhardt Saunte, Ditte Marie
2010-01-01
; 25 routine specimens from patients suspected of having dermatophytosis; 10 hair specimens from guinea pigs experimentally infected with M. canis; and two samples from un-infected control animals. DNA was prepared by a 10-min procedure from pure cultures as previously described. The 302 bp PCR product....... Finally, the Microsporum PCR was positive for 10/10 guinea pig specimens from infected animals but for 0/2 of the control animal samples. The evaluation of the two PCR tests indicated excellent sensitivity and specificity....
Modified DNA extraction for rapid PCR detection of methicillin-resistant staphylococci
International Nuclear Information System (INIS)
Japoni, A.; Alborzi, A.; Rasouli, M.; Pourabbas, B.
2004-01-01
Nosocomial infection caused by methicillin-resistant staphylococci poses a serious problem in many countries. The aim of this study was to rapidly and reliably detect methicillin-resistant-staphylococci in order to suggest appropriate therapy. The presence or absence of the methicillin-resistance gene in 115 clinical isolates of staphylococcus aureus and 50 isolates of coagulase negative staphylococci was examined by normal PCR. DNA extraction for PCR performance was then modified by omission of achromopeptadiase and proteinase K digestion, phenol/chloroform extraction and ethanol precipitation. All isolates with Mic>8 μ g/ml showed positive PCR. No differences in PCR detection have been observed when normal and modified DNA extractions have been performed. Our modified DNA extraction can quickly detect methicillin-resistant staphylococci by PCR. The advantage of rapid DNA extraction extends to both reduction of time and cost of PCR performance. This modified DNA extraction is suitable for different PCR detection, when staphylococci are the subject of DNA analysis
Directory of Open Access Journals (Sweden)
S Farnia
2009-05-01
Full Text Available "nBackground: The aim was to compare three different methods (direct examination, culture and PCR methods for the diagnosis of Acanthamoeba keratitis (AK in corneal scrapes."nMethods: Twenty eight corneal scrapes and contact lenses were collected from keratitis patients and referred to the Department of Medical Parasitology and Mycology, School of Public Health, Tehran University of Medical Sciences. Corneal scrapes were divided in three parts for direct examination, culture on non-nutrient agar and PCR analysis. PCR analysis was also performed using a 18S rRNA gene primer pair (DF3 region. DF3 (Diagnostic fragment 3 is a region of the nuclear small subunit ribosomal RNA gene which is specific for detecting Acanthamoeba strains."nResults: Acanthamoeba was the causative agent of keratitis in 50% of the patients. Direct smear of all prepared corneal scrapes in AK patients was negative and culture was positive in only 14.3% of the isolates. PCR analysis was positive in 71.4% of AK patients. These three methods were negative in corneal scrapes of non-AK patients. The sensitivity and specificity of PCR technique for the detection of Acanthamoeba sp. were calculated as 71.4% and 100%, respectively."nConclusion: According to high sensitivity and specificity of PCR-based method, this study confirmed that PCR using 18S rRNA gene primers (DF3 region is more useful for detecting AK cases compare to culture and direct microscopy methods.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design
Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G
2014-01-01
The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from
Collins, S; Stevenson, D; Walker, J; Bennett, A
2017-06-01
To evaluate the usefulness of Legionella qPCR alongside traditional culture for enumeration of Legionella from water samples as part of both routine and public health investigation testing. Routine water samples (n = 2002) and samples from public health investigations (n = 215) were analysed by culture and qPCR for Legionella spp., Legionella pneumophila and L. pneumophila sg-1. A negative qPCR result was highly predictive of a negative culture result for all water systems (negative predictive values, NPV from 97·4 to 100%). Positive predictive values (PPV) were lower (0-50%). Results for qPCR were generally larger than culture with average log 10 differences of 1·1 for Legionella spp. and 1·2 for L. pneumophila. Alert and action levels of 1000 and 10 000 GU per litre, respectively, are proposed for Legionella qPCR for hot and cold water systems (HCWS). The use of qPCR significantly reduced the time to results for public health investigations by rapidly identifying potential sources and ruling out others, thus enabling a more rapid and efficient response. The high NPV of qPCR supports its use to rapidly screen out negative samples without culture. Alert and action levels for Legionella qPCR for HCWS are proposed. Quantitative PCR will be a valuable tool for both routine and public health testing. This study generated comparative data of >2000 water samples by qPCR and culture. Action and alert levels have been recommended that could enable duty holders to interpret qPCR results to facilitate timely Legionella control and public health protection. © 2017 Crown copyright. Journal of Applied Microbiology © 2017 The Society for Applied Microbiology.
Friesen, J; Fuhrmann, J; Kietzmann, H; Tannich, E; Müller, M; Ignatius, R
2018-03-23
Multiplex PCR assays offer highly sensitive and specific tools for the detection of enteric pathogens. This prospective study aimed at comparing the novel Roche LightMix Modular Assay Gastro Parasites (LMAGP) detecting Giardia duodenalis, Entamoeba histolytica, Cryptosporidium spp., Blastocystishominis, and Dientamoebafragilis with routine laboratory procedures. Stool specimens (n = 1062 from 1009 patients) were consecutively examined by LMAGP, R-Biopharm Ridascreen enzyme immunoassays (EIAs) detecting G. duodenalis or E. histolytica/dispar, and microscopy of wet mounts. Discrepant results were analysed by in-house PCR. D. fragilis or B. hominis were detected by LMAGP in 131 (14.4%) and 179 (19.9%; 16 samples positive by microscopy; p PCR). G. duodenalis was detected by LMAGP, EIA, or microscopy in 20, 16, or 9 of 1039 stool samples, respectively; all four samples missed by EIA were confirmed by in-house PCR. In total, 938 stool samples were analysed for E. histolytica/dispar. Nine of ten EIA-positive samples were negative by LMAGP but positive by in-house PCR for E. dispar. One E. histolytica infection (positive by both LMAGP and in-house PCR) was missed by EIA and microscopy. Parasites only detected by microscopy included Enterobius vermicularis eggs (n = 3) and apathogenic amoebae (n = 27). The data call for routine use of multiplex PCR assays for the detection of enteric protozoan parasites in laboratory diagnostics. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung
2013-07-01
Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Faucher Jean-François
2010-08-01
Full Text Available Abstract Background A recent school-based study in Benin showed that applying a policy of anti-malarial prescriptions restricted to parasitologically-confirmed cases on the management of fever is safe and feasible. Additional PCR data were analysed in order to touch patho-physiological issues, such as the usefulness of PCR in the management of malaria in an endemic area or the triggering of a malaria attack in children with submicroscopic malaria. Methods PCR data were prospectively collected in the setting of an exposed (with fever/non exposed (without fever study design. All children had a negative malaria rapid diagnostic test (RDT at baseline, were followed up to day 14 and did not receive drugs with anti-malarial activity. The index group was defined by children with fever at baseline and the control group by children without fever at baseline. Children with submicroscopic malaria in these two groups were defined by a positive PCR at baseline. Results PCR was positive in 66 (27% children of the index group and in 104 (44% children of the control group respectively. The only significant factor positively related to PCR positivity at baseline was the clinical status (control group. When definition of malaria attacks included PCR results, no difference of malaria incidence was observed between the index and control groups, neither in the whole cohort, nor in children with submicroscopic malaria. The rate of undiagnosed malaria at baseline was estimated to 3.7% at baseline in the index group. Conclusions Treating all children with fever and a positive PCR would have led to a significant increase of anti-malarial consumption, with few benefits in terms of clinical events. Non malarial fevers do not or do not frequently trigger malaria attacks in children with submicroscopic malaria.
Detection of Shiga toxins genes by Multiplex PCR in clinical samples
Directory of Open Access Journals (Sweden)
2013-09-01
Full Text Available Background: Different methods have been used for detection of shiga toxins; such as, cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR. For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results: Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences. The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.
Directory of Open Access Journals (Sweden)
Qing Fan
Full Text Available Foot-and-mouth disease virus (FMDV, Bluetongue virus (BTV, Vesicular stomatitis Virus (VSV, Bovine viral diarrheal (BVDV, Bovine rotavirus (BRV, and Bovine herpesvirus 1 (IBRV are common cattle infectious viruses that cause a great economic loss every year in many parts of the world. A rapid and high-throughput GenomeLab Gene Expression Profiler (GeXP analyzer-based multiplex PCR assay was developed for the simultaneous detection and differentiation of these six cattle viruses. Six pairs of chimeric primers consisting of both the gene-specific primer and a universal primer were designed and used for amplification. Then capillary electrophoresis was used to separate the fluorescent labeled PCR products according to the amplicons size. The specificity of GeXP-multiplex PCR assay was examined with samples of the single template and mixed template of six viruses. The sensitivity was evaluated using the GeXP-multiplex PCR assay on serial 10-fold dilutions of ssRNAs obtained via in vitro transcription. To further evaluate the reliability, 305 clinical samples were tested by the GeXP-multiplex PCR assay. The results showed that the corresponding virus specific fragments of genes were amplified. The detection limit of the GeXP-multiplex PCR assay was 100 copies/μL in a mixed sample of ssRNAs containing target genes of six different cattle viruses, whereas the detection limit for the Gexp-mono PCR assay for a single target gene was 10 copies/μL. In detection of viruses in 305 clinical samples, the results of GeXP were consistent with simplex real-time PCR. Analysis of positive samples by sequencing demonstrated that the GeXP-multiplex PCR assay had no false positive samples of nonspecific amplification. In conclusion, this GeXP-multiplex PCR assay is a high throughput, specific, sensitive, rapid and simple method for the detection and differentiation of six cattle viruses. It is an effective tool that can be applied for the rapid differential diagnosis
Directory of Open Access Journals (Sweden)
C.D. Baldani
2008-06-01
Full Text Available This study compared the usefulness of in vitro culture, PCR, and nested PCR for the diagnosis of Theileria equi in horses submitted to stress during exercise. Blood samples from 15 apparently healthy horses, previously conditioned to a high-speed equine treadmill, were taken prior to and after exercise. The animals were divided into two experimental groups: 30-day training schedule (G1 and 90-day training schedule (G2. Statistical analysis was performed using a chi-square test and kappa statistic was used in order to assess agreement. No significant difference was observed between samples collected at resting or after exercise. In G1, merozoites of T. equi were detected in the blood smears of four horses before in vitro culture, whereas 14 samples were positive, confirmed by culture. In G2, five and 11 horses were positive before and after culture, respectively. No PCR amplified product was observed in any of the tested animals although the PCR system based on the 16S rRNA gene of T. equi detected DNA in blood with an equivalent 8x10-5% parasitaemia. The nested PCR based on the T. equi merozoite antigen gene (EMA-1 allowed the visualization of amplified products in all the horses. Therefore, nested PCR should be considered as a means of detection of sub-clinical T. equi infections and in vitro culture could be used as a complement to other methods of diagnosis.Comparou-se a utilização do cultivo in vitro, PCR e nested PCR no diagnóstico de Theileria equi em eqüinos submetidos ao estresse induzido por exercícios. Amostras de sangue foram obtidas de 15 eqüinos submetidos a treinamento em esteira rolante de alto desempenho, sendo as amostras colhidas antes e após os exercícios. Os animais foram divididos em dois grupos experimentais: 30 dias de treinamento (G1 e 90 dias de treinamento (G2. O teste do qui-quadrado foi empregado para as análises estatísticas e o índice kappa utilizado para avaliar a concordância. Não houve diferen
Ting, Tan Xue; Hashim, Rohaidah; Ahmad, Norazah; Abdullah, Khairul Hafizi
2013-01-01
Pertussis or whooping cough is a highly infectious respiratory disease caused by Bordetella pertussis. In vaccinating countries, infants, adolescents, and adults are relevant patients groups. A total of 707 clinical specimens were received from major hospitals in Malaysia in year 2011. These specimens were cultured on Regan-Lowe charcoal agar and subjected to end-point PCR, which amplified the repetitive insertion sequence IS481 and pertussis toxin promoter gene. Out of these specimens, 275 were positive: 4 by culture only, 6 by both end-point PCR and culture, and 265 by end-point PCR only. The majority of the positive cases were from ≤3 months old patients (77.1%) (P 0.05). Our study showed that the end-point PCR technique was able to pick up more positive cases compared to culture method.
Outcome of polymerase chain reaction (PCR) analysis in 100 suspected cases of infectious uveitis.
Kharel Sitaula, Ranju; Janani, M K; Madhavan, H N; Biswas, Jyotirmay
2018-01-10
Polymerase chain reaction (PCR) analysis is an important tool in the diagnosis of infectious uveitis. A retrospective, interventional study of PCR analysis of ocular fluid in suspected infectious uveitis cases between January 2014 to July 2016 was done. Nested, real-time and broad range PCR was performed for detection of the genome of Mycobacterium tuberculosis, herpes virus family, Chikungunya virus, Toxoplasma gondii, fungus, eubacterium and propionibacterium acne. Total of 100 cases included, mean age was 39.2 ± 15.4 years. Uveitis was unilateral in 82% and granulomatous in 40%. Mean visual acuity at the initial visit and final visit was 0.73 logMar and 0.63 logMar respectively. PCR analysis confirmed the clinical diagnosis in 70.1% patients. The sensitivity, specificity, positive predictive value and negative predictive value of PCR analysis was 90.2%, 93.9%, 93.9% and 90.2% respectively. The quantitative value of real-time M. tb. Positive PCR ranged from 32c/ml to 2722 c/ml. PCR assay is an accurate technique with high sensitivity and specificity to diagnose the DNA genome in infectious uveitis.
A real-time PCR antibiogram for drug-resistant sepsis.
Directory of Open Access Journals (Sweden)
John R Waldeisen
Full Text Available Current molecular diagnostic techniques for susceptibility testing of septicemia rely on genotyping for the presence of known resistance cassettes. This technique is intrinsically vulnerable due to the inability to detect newly emergent resistance genes. Traditional phenotypic susceptibility testing has always been a superior method to assay for resistance; however, relying on the multi-day growth period to determine which antimicrobial to administer jeopardizes patient survival. These factors have resulted in the widespread and deleterious use of broad-spectrum antimicrobials. The real-time PCR antibiogram, described herein, combines universal phenotypic susceptibility testing with the rapid diagnostic capabilities of PCR. We have developed a procedure that determines susceptibility by monitoring pathogenic load with the highly conserved 16S rRNA gene in blood samples exposed to different antimicrobial drugs. The optimized protocol removes heme and human background DNA from blood, which allows standard real-time PCR detection systems to be employed with high sensitivity (<100 CFU/mL. Three strains of E. coli, two of which were antimicrobial resistant, were spiked into whole blood and exposed to three different antibiotics. After real-time PCR-based determination of pathogenic load, a ΔC(t<3.0 between untreated and treated samples was found to indicate antimicrobial resistance (P<0.01. Minimum inhibitory concentration was determined for susceptible bacteria and pan-bacterial detection was demonstrated with 3 gram-negative and 2 gram-positive bacteria. Species identification was performed via analysis of the hypervariable amplicons. In summary, we have developed a universal diagnostic phenotyping technique that assays for the susceptibility of drug-resistant septicemia with the speed of PCR. The real-time PCR antibiogram achieves detection, susceptibility testing, minimum inhibitory concentration determination, and identification in less than 24
Polymerase Chain Reaction (Pcr) Assay to Detect Hepatitis C Virus
International Nuclear Information System (INIS)
Lina MR; Dadang S; Budiman Bela
2004-01-01
Research on the detection of hepatitis C virus in blood serum using PCR technique has been carried out. Amount of 50 blood serum from laboratory of Indonesia Red Cross (Palang Merah Indonesia = PMI) and RSCM hospital as samples, were used in this research. Lysis of virus cell and extraction of RNA virus as a preliminary treatment of the sample, was done with BOOM method using guanidine thiocyanate and diatomaceous earth, respectively. Synthesis of cDNA from RNA as an extraction product mentioned above, was carried out by means of reverse-transcriptase and RNA-se inhibitor. Amplification of cDNA was done with nested PCR technique that was performed with two times PCR processes using two pairs of oligonucleotide primers for each process. The amplified DNA was detected by agarose gel electrophoresis and ethidium bromide staining. Subsequently, the DNA was visualized with UV transilluminator. Result shows that of 50 blood serum samples, 13 serum were positive for RNA HCV that were performed with the present of specific DNA band on agarose gel. (author)
Rimério, Carla Aparecida Tavares; De Oliveira, Renato Souza; de Almeida Bonatelli, Murilo Queiroz; Nucci, Anamarli; Costa, Sandra Cecília Botelho; Bonon, Sandra Helena Alves
2015-04-01
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the "gold standard," and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture. © 2015 Wiley Periodicals, Inc.
Inoue, Hiroaki; Takama, Tomoko; Yoshizaki, Miwa; Agata, Kunio
2015-01-01
We detected Legionella species in 111 bath water samples and 95 cooling tower water samples by using a combination of conventional plate culture, quantitative polymerase chain reaction (qPCR) and qPCR combined with ethidium monoazide treatment (EMA-qPCR) methods. In the case of bath water samples, Legionella spp. were detected in 30 samples by plate culture, in 85 samples by qPCR, and in 49 samples by EMA-qPCR. Of 81 samples determined to be Legionella-negative by plate culture, 56 and 23 samples were positive by qPCR and EMA-qPCR, respectively. Therefore, EMA treatment decreased the number of Legionella-positive bath water samples detected by qPCR. In contrast, EMA treatment had no effect on cooling tower water samples. We therefore expect that EMA-qPCR is a useful method for the rapid detection of viable Legionella spp. from bath water samples.
Evaluation of conventional PCR for detection of Strongylus vulgaris on horse farms.
Bracken, M K; Wøhlk, C B M; Petersen, S L; Nielsen, M K
2012-03-23
Strongyle parasites are ubiquitous in grazing horses. Of these, the bloodworm Strongylus vulgaris is regarded as most pathogenic. Increasing levels of anthelmintic resistance in strongyle parasites has led to recommendations of decreased treatment intensities, and there is now a pronounced need for reliable tools for detection of parasite burdens in general and S. vulgaris in particular. The only method currently available for diagnosing S. vulgaris in practice is the larval culture, which is laborious and time-consuming, so veterinary practitioners most often pool samples from several horses together in one culture to save time. Recently, molecular tools have been developed to detect S. vulgaris in faecal samples. The aim of this study was to compare the performance of a conventional polymerase chain reaction (PCR) assay with the traditional larval culture and furthermore test the performance of pooled versus individual PCR for farm screening purposes. Faecal samples were obtained from 331 horses on 18 different farms. Farm size ranged from 6 to 56 horses, and horses aged between 2 months and 31 years. Larval cultures and PCR were performed individually on all horses. In addition, PCR was performed on 66 faecal pools consisting of 3-5 horses each. Species-specific PCR primers previously developed were used for the PCR. PCR and larval culture detected S. vulgaris in 12.1 and 4.5% of individual horses, respectively. On the farm level, eight farms tested positive with the larval culture, while 13 and 11 farms were positive with the individual and pooled PCRs, respectively. The individual PCR method was statistically superior to the larval culture, while no statistical difference could be detected between pooled and individual PCR for farm screening. In conclusion, pooled PCR appears to be a useful tool for farm screening for S. vulgaris. Copyright © 2011 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Andrea Cristine Koishi
2010-12-01
Full Text Available INTRODUCTION: Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. METHODS: In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. RESULTS: The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. CONCLUSIONS: The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.INTRODUÇÃO: A paracoccidioidomicose é uma infecção sistêmica causada pelo Paracoccidioides brasiliensis. MÉTODOS: Neste estudo, uma semi-nested PCR foi desenvolvida para o diagnóstico da paracoccidioidomicose. Os oligonucleotídeos iniciadores ITS1 e ITS4 foram usados na primeira reação, enquanto os oligonucleotídeos iniciadores MJ03 e ITS1 foram usados na segunda reação. A semi-nested PCR foi usada para investigar biopsias de cinco pacientes com lesões orais que se assemelhavam a paracoccidioidomicose. RESULTADOS: A semi-nested PCR foi positiva para quatro amostras e negativa para a amostra de um paciente, posteriormente diagnosticado com leishmaniose. CONCLUSÕES: A semi-nested PCR descrita aqui é útil para o diagnóstico da paracoccidioidomicose.
Droplet digital PCR technology promises new applications and research areas.
Manoj, P
2016-01-01
Digital Polymerase Chain Reaction (dPCR) is used to quantify nucleic acids and its applications are in the detection and precise quantification of low-level pathogens, rare genetic sequences, quantification of copy number variants, rare mutations and in relative gene expressions. Here the PCR is performed in large number of reaction chambers or partitions and the reaction is carried out in each partition individually. This separation allows a more reliable collection and sensitive measurement of nucleic acid. Results are calculated by counting amplified target sequence (positive droplets) and the number of partitions in which there is no amplification (negative droplets). The mean number of target sequences was calculated by Poisson Algorithm. Poisson correction compensates the presence of more than one copy of target gene in any droplets. The method provides information with accuracy and precision which is highly reproducible and less susceptible to inhibitors than qPCR. It has been demonstrated in studying variations in gene sequences, such as copy number variants and point mutations, distinguishing differences between expression of nearly identical alleles, assessment of clinically relevant genetic variations and it is routinely used for clonal amplification of samples for NGS methods. dPCR enables more reliable predictors of tumor status and patient prognosis by absolute quantitation using reference normalizations. Rare mitochondrial DNA deletions associated with a range of diseases and disorders as well as aging can be accurately detected with droplet digital PCR.
Directory of Open Access Journals (Sweden)
Arefeh Abdi
2016-05-01
Full Text Available Background: Campylobacter species are responsible for the majority of cases of food-borne gastroenteritis. The sources of the disease outbreaks are often contaminated water or milk, and consumption of undercooked poultry product is the main cause of sporadic campylobacteriosis cases. Objectives: The aims of this study were to determine the prevalence of Campylobacter gastroenteritis in children and to differentiate the interfering species using polymerase chain reaction (PCR and restriction fragment length polymorphism (RFLP methods at the Bahonar hospital in Karaj, Iran. Patients and Methods: A total of 150 stool samples were collected from children under 10 years old during the summer of 2014. PCR was performed using genus- and species-specific primers and RFLP was done using AluI and TasI enzymes. Results: The results showed the amplification of 400 and 491 bp segments and Campylobacter contamination in 30 (20% samples; 5 out of 30 Campylobacter positive samples (16.66% were identified as C. jejuni, 20 (66.66% as C. coli, 3 (10% as C. jejuni and C. coli (mixed infection, and 2 (6.66% were identified as non-jejuni, non-coli Campylobacter using the PCR method. Following the evaluation of RFLP results, 7 positive samples (23.33% showed the electrophoretic pattern of C. jejuni, 21 (70% showed the electrophoretic pattern of C. coli, and 2 (6.6% showed both of the patterns and mixed contamination with jejuni and coli species. The results of digestion with TasI did not show any C. lari or C. upsaliensis patterns. Conclusions: The results of this study showed high percentage of Campylobacter contamination in the tested stool samples. The other surprising finding was the high rate of Campylobacter coli positive samples; the difference between the results of PCR using species-specific primers (hipo and asp and the RFLP method (electrophoretic patterns in some of the positive samples confirms the hypothesis of variations in nucleotide sequences of the
Takamura, Y; Kubo, E; Tsuzuki, S; Akagi, Y
2008-11-01
To elucidate the putative role of human papillomavirus (HPV) infection in pterygium and conjunctival papilloma. Hybrid capture II (HC-II) and polymerase chain reaction (PCR) assays were performed to detect HPV in pterygium (42 samples obtained from 40 patients) and conjunctival papilloma (8 samples from 6 patients). The amount of HPV DNA was evaluated by measurement of relative light units (RLUs) on a luminometer. All papilloma samples were positive for HPV DNA by PCR and HC-II. The RLU values for specimens of recurrent and re-recurrent papilloma were markedly higher than those for specimens of primary lesions. HPV was detected by PCR in 2 of 42 (4.8%) beta-globin-positive pterygium specimens, whereas HC-II showed that HPV was negative in all pterygium samples. Our results support the hypothesis that HPV DNA is associated with the pathogenesis of conjunctival papilloma, but not pterygium. RLU measurement by HC-II may serve as a marker for evaluating the activity of HPV in conjunctival tumours.
Blaya, Josefa; Lloret, Eva; Santísima-Trinidad, Ana B; Ros, Margarita; Pascual, Jose A
2016-04-01
Currently, real-time polymerase chain reaction (qPCR) is the technique most often used to quantify pathogen presence. Digital PCR (dPCR) is a new technique with the potential to have a substantial impact on plant pathology research owing to its reproducibility, sensitivity and low susceptibility to inhibitors. In this study, we evaluated the feasibility of using dPCR and qPCR to quantify Phytophthora nicotianae in several background matrices, including host tissues (stems and roots) and soil samples. In spite of the low dynamic range of dPCR (3 logs compared with 7 logs for qPCR), this technique proved to have very high precision applicable at very low copy numbers. The dPCR was able to detect accurately the pathogen in all type of samples in a broad concentration range. Moreover, dPCR seems to be less susceptible to inhibitors than qPCR in plant samples. Linear regression analysis showed a high correlation between the results obtained with the two techniques in soil, stem and root samples, with R(2) = 0.873, 0.999 and 0.995 respectively. These results suggest that dPCR is a promising alternative for quantifying soil-borne pathogens in environmental samples, even in early stages of the disease. © 2015 Society of Chemical Industry.
Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.
Mo, Yiqun; Wan, Rong; Zhang, Qunwei
2012-01-01
Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.
Directory of Open Access Journals (Sweden)
Adriana Peci
2016-08-01
Full Text Available Legionella is a gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture and PCR test methods and to determine if sputum is an alternative to the use of more invasive bronchoalveolar lavage (BAL. Data for this study included specimens tested for Legionella at PHOL from January 1, 2010 to April 30, 2014, as part of routine clinical testing. We found sensitivity of UAT compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV 63.8% and negative predictive value (NPV 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7% and NPV 98.1%. Of 146 patients who had a Legionella positive result by PCR, only 66(45.2% also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%; sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results despite testing methods (Fisher Exact p-values=1.0, for each test. In summary, all test methods have inherent weaknesses in identifying Legionella; thereforemore than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection, and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical, from patients being tested for Legionella.
[A new method of processing quantitative PCR data].
Ke, Bing-Shen; Li, Guang-Yun; Chen, Shi-Min; Huang, Xiang-Yan; Chen, Ying-Jian; Xu, Jun
2003-05-01
Today standard PCR can't satisfy the need of biotechnique development and clinical research any more. After numerous dynamic research, PE company found there is a linear relation between initial template number and cycling time when the accumulating fluorescent product is detectable.Therefore,they developed a quantitative PCR technique to be used in PE7700 and PE5700. But the error of this technique is too great to satisfy the need of biotechnique development and clinical research. A better quantitative PCR technique is needed. The mathematical model submitted here is combined with the achievement of relative science,and based on the PCR principle and careful analysis of molecular relationship of main members in PCR reaction system. This model describes the function relation between product quantity or fluorescence intensity and initial template number and other reaction conditions, and can reflect the accumulating rule of PCR product molecule accurately. Accurate quantitative PCR analysis can be made use this function relation. Accumulated PCR product quantity can be obtained from initial template number. Using this model to do quantitative PCR analysis,result error is only related to the accuracy of fluorescence intensity or the instrument used. For an example, when the fluorescence intensity is accurate to 6 digits and the template size is between 100 to 1,000,000, the quantitative result accuracy will be more than 99%. The difference of result error is distinct using same condition,same instrument but different analysis method. Moreover,if the PCR quantitative analysis system is used to process data, it will get result 80 times of accuracy than using CT method.
Directory of Open Access Journals (Sweden)
Dil-Afroze
2008-06-01
Full Text Available Central nervous system (CNS tuberculosis is a serious clinical problem, the treatment of which is sometimes hampered by delayed diagnosis. Clearly, prompt laboratory diagnosis is of vital importance as the spectrum of disease is wideand abnormalities of the cerebrospinal fluid (CSF are incredibly variable. Since delayed hypersensitivity is the underlying immune response, bacterial load is very low. The conventional bacteriological methods rarely detect Mycobacterium tuberculosis in CSF and are of limited use in diagnosis of tuberculous meningitis (TBM. This double blind study was, therefore, directed to the molecular analysis of CNS tuberculosis by an in-house-developed PCR targeted for amplification of a 240bp nucleotidesequence coding for MPB64 protein specific for Mycobacterium tuberculosis. Based on the clinical criteria, 47 patients with CNS tuberculosis and a control group of 10 patients having non-tubercular lesions of the CNS were included in the study. Analyses were done in three groups; one group consisting of 27 patients of TBM, a second group of 20 patients with intracranial tuberculomas and a third group of 10 patients having non-tubercular lesions of the CNS acted as control. There were no false positive results by PCR and the specificity worked out to be 100%. In the three study groups, routine CSF analysis (cells and chemistry, CSF for AFB smear and culture were negative in all cases. PCR was positive for 21/27 patients (77.7% sensitivity of the first group of TBM patients, 6/20 patients (30% sensitivity of the second group with intracranial tuberculomas were positive by PCR and none was PCR-positive (100% specificity in the third group. Thus, PCR was found to be more sensitive than any other conventional method in the diagnosis of clinically suspected tubercular meningitis.A tuberculose do sistema nervoso central (CNS é um problema clínico sério, cujo tratamento é dificultado pelo diagnóstico tardio. O diagn
Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Klaudia S G; Ramos, Carlos A N; Souza Filho, Antonio F; Vidal, Carlos E S; Vargas, Agueda P C; Roxo, Eliana; Rocha, Adalgiza S; Suffys, Philip N; Fonseca, Antônio A; Silva, Marcio R; Barbosa Neto, José D; Cerqueira, Valíria D; Araújo, Flábio R
2014-01-01
Post-mortem bacterial culture and specific biochemical tests are currently performed to characterize the etiologic agent of bovine tuberculosis. Cultures take up to 90 days to develop. A diagnosis by molecular tests such as PCR can provide fast and reliable results while significantly decreasing the time of confirmation. In the present study, a nested-PCR system, targeting rv2807, with conventional PCR followed by real-time PCR, was developed to detect Mycobacterium tuberculosis complex (MTC) organisms directly from bovine and bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other Actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. Regarding the analytical sensitivity, DNA of the M. bovis AN5 strain was detected up to 1.5 pg by nested-PCR, whereas DNA of M. tuberculosis H37Rv strain was detected up to 6.1 pg. The nested-PCR system showed 100% analytical specificity for MTC when tested with DNA of reference strains of non-tuberculous mycobacteria and closely-related Actinomycetales. A clinical sensitivity level of 76.7% was detected with tissues samples positive for MTC by means of the culture and conventional PCR. A clinical specificity of 100% was detected with DNA from tissue samples of cattle with negative results in the comparative intradermal tuberculin test. These cattle exhibited no visible lesions and were negative in the culture for MTC. The use of the nested-PCR assay to detect M. tuberculosis complex in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)
2011-07-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
International Nuclear Information System (INIS)
Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.
2011-01-01
Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)
Internal quality control of PCR-based genotyping methods
DEFF Research Database (Denmark)
Bladbjerg, Else-Marie; Gram, Jørgen; Jespersen, Jørgen
2002-01-01
Internal quality control programmes for genetic analyses are needed. We have focused on quality control aspects of selected polymorphism analyses used in thrombosis research. DNA was isolated from EDTA-blood (n = 500) and analysed for 18 polymorphisms by polymerase chain reaction (PCR), i...... because of positive reagent blanks (controls (Control of data handling revealed 0.1% reading mistakes and 0.5% entry mistakes. Based on our experiences, we propose an internal quality control programme......, electrophoresis (analytical factors), result reading and entry into a database (post-analytical factors). Furthermore, we evaluated a procedure for result confirmation. Isolated DNA was of good quality (42 micrograms/ml blood, A260/A280 ratio > 1.75, negative DNAsis tests). Occasionally, results were reanalysed...
[Contribution of nested PCR in the diagnosis of imported malaria in southern Algeria].
Bouiba, L; Gassen, B; Gasmi, M; Hammadi, D; Harrat, Z
2016-12-01
The nested PCR was used to estimate its inputs in malaria diagnosis and in the performance of the microscope operators involved in the surveillance of malaria in remote areas of South Algeria. For the period 2010 to 2015, 112 patients (93 febrile and 19 asymptomatic) coming from sub-Saharan Africa were tested for malaria in the hospital of Tamanrasset. One part of the blood taken from fingertip was used for blood smears and the second part was absorbed in filter paper for molecular diagnosis. Overall, the infection was detected by nested PCR in 63 samples versus 53 by direct examination. In addition, 11 mixed infections and 6 positive asymptomatic cases not detected by microscopy were diagnosed by PCR. Moreover, two negative samples in nested PCR were tested positive by direct examination. The molecular tool is more sensitive than the direct examination in detecting infra-microscopic parasitaemia and mixed infections...
International Nuclear Information System (INIS)
2010-01-01
Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)
Advantages and limitations of quantitative PCR (Q-PCR)-based approaches in microbial ecology.
Smith, Cindy J; Osborn, A Mark
2009-01-01
Quantitative PCR (Q-PCR or real-time PCR) approaches are now widely applied in microbial ecology to quantify the abundance and expression of taxonomic and functional gene markers within the environment. Q-PCR-based analyses combine 'traditional' end-point detection PCR with fluorescent detection technologies to record the accumulation of amplicons in 'real time' during each cycle of the PCR amplification. By detection of amplicons during the early exponential phase of the PCR, this enables the quantification of gene (or transcript) numbers when these are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription reaction, it can be used to quantify gene expression (RT-Q-PCR). This review firstly addresses the theoretical and practical implementation of Q-PCR and RT-Q-PCR protocols in microbial ecology, highlighting key experimental considerations. Secondly, we review the applications of (RT)-Q-PCR analyses in environmental microbiology and evaluate the contribution and advances gained from such approaches. Finally, we conclude by offering future perspectives on the application of (RT)-Q-PCR in furthering understanding in microbial ecology, in particular, when coupled with other molecular approaches and more traditional investigations of environmental systems.
Beyhan, Yunus Emre; Taş Cengiz, Zeynep
2017-08-23
Background/aim: This study included patients who had digestive system complaints between August 2015 and October 2015. The research was designed to compare conventional microscopy with an antigen detection ELISA kit and the TaqMan-based real-time PCR (RT-PCR) technique for detection of Giardia intestinalis in human stool specimens. Materials and methods: Samples were concentrated by formalin-ether sedimentation technique and microscopic examinations were carried out on wet mount slides. A commercially available ELISA kit (Giardia CELISA, Cellabs, Brookvale, Australia) was used for immunoassay. DNA was extracted from fecal samples of about 200 mg using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) and the LightCycler Nano system (Roche Diagnostics, Mannheim, Germany) was used for the TaqMan-based RT-PCR assay. Results: A total of 94 stool samples, 38 of them diagnosed positive (40.4%) and 56 of them diagnosed negative by microscopy, were selected for evaluation by antigen detection and molecular assays. The prevalence of G. intestinalis infection was found as 46.8% (n: 44) and 79.8% (n: 75) by ELISA and RT-PCR, respectively. RT-PCR revealed by far the highest positivity rate compared to the other two methods. The difference between these methods was found to be statistically significant (P PCR, the sensitivity and specificity of microscopy and ELISA were 50.7% and 100% and 53.3% and 79%, respectively. Conclusion: RT-PCR seems to be much more sensitive and beneficial for rapid and accurate diagnosis of G. intestinalis in human stools.
Araj, G F; Talhouk, R S; Itani, L Y; Jaber, W; Jamaleddine, G W
2000-09-01
American University of Beirut Medical Center, Lebanon. To assess the performance of a polymerase chain reaction (PCR) using primers that flank 542 bp within IS6110 in Mycobacterium tuberculosis (TB) vs. microscopy and BACTEC culture, in the diagnosis of tuberculosis. A total of 82 clinical respiratory pulmonary specimens and 73 samples from BACTEC vials were tested by the three methods. Of 24 smear-positive culture-positive (SP-CP) and 11 smear-negative culture-positive (SN-CP) TB specimens, PCR detected 83% and 64%, respectively. Among 17 specimens yielding mycobacteria other than tuberculosis (MOTT), the PCR was positive in 33% SP-CP and 14% SN-CP specimens. Among the 73 BACTEC vials, PCR was positive in 36 of 38 (95%) yielding culture-positive TB, and in one of 20 (5%) yielding culture positive MOTT. None of the 30 smear-negative culture-negative (SN-CN) clinical specimens and 15 of the CN vials were positive by PCR. The overall sensitivity of PCR was 77% and 95% for TB detection in respiratory specimens and BACTEC vials, respectively, and the specificity was 94% in both. Because a substantial number of TB cases are missed, especially in SN-CP specimens, a PCR-based assay utilizing these primers cannot be used reliably, alone, in clinical laboratory diagnosis of mycobacterial respiratory infections.
Hopkins, Mark J; Smith, Godfrey; Hart, Ian J; Alloba, Fath
2012-11-01
To assess the clinical utility of supplementary PCRs following a positive cobas 4800 CT/NG PCR screening test result. Laboratory reports, for Chlamydia trachomatis or Neisseria gonorrhoeae, issued to genitourinary medicine patients between April 2010 and April 2011 were reviewed retrospectively. Positive reports were routinely confirmed by supplementary PCRs and N gonorrhoeae culture. Clinical records of patients with unconfirmed positive (equivocal) reports were retrieved to determine if the infection was confirmed by a second sample obtained at patient recall and the impact of this process on antibiotic management. Over 15 000 patients were tested during the study period. The prevalence of chlamydia and gonorrhoea was 972 (5.75%) and 76 (0.50%), respectively. A further 78 chlamydia and 2 gonorrhoea equivocal reports were issued. Only 56 (72%) patients with an equivocal chlamydia report returned to the clinic, and of these, only 41 (73%) gave a second sample to retest. Positive predictive value (PPV) of the PCR screening test was calculated at 98.0% and 97.5% for detection of chlamydia infection from urine and rectal swabs, respectively. Most patients accepted antibiotic treatment before their infection status had been confirmed. Prevalence of gonorrhoea infection was low but the PPV of the screening PCR in urine specimens remained high (98.75%). Equivocal reports introduce delays to patient management, while the risk of unnecessary antibiotic therapy appears acceptable to most patients. The cobas 4800 CT/NG PCR screening assay can achieve UK testing standards (PPV >90%) for chlamydia, and low prevalence gonorrhoea in urine without supplementary tests. A patient-led confirmation algorithm is proposed.
LENUS (Irish Health Repository)
O'Leary, James
2009-11-01
The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.
Zadoks, Ruth N; Tassi, Riccardo; Martin, Elena; Holopainen, Jani; McCallum, Sarah; Gibbons, James; Ballingall, Keith T
2014-10-01
Mastitis, inflammation of the mammary gland, is an important cause of disease, mortality, and production losses in dairy and meat sheep. Mastitis is commonly caused by intramammary infection with bacteria, which can be detected by bacterial culture or PCR. PathoProof (Thermo Fisher Scientific Ltd., Vantaa, Finland) is a commercially available real-time PCR system for the detection of bovine mastitis pathogens. Sheep differ from cattle in the bacterial species or bacterial strains that cause mastitis, as well as in the composition of their milk. The aim of this study was to evaluate whether the PathoProof system was suitable for detection of mastitis pathogens in sheep milk. Milk samples were collected aseptically from 219 udder halves of 113 clinically healthy ewes in a single flock. Aliquots were used for bacteriological culture and real-time PCR-based detection of bacteria. For species identified by culture, the diagnosis was confirmed by species-specific conventional PCR or by sequencing of a housekeeping gene. The majority of samples were negative by culture (74.4% of 219 samples) and real-time PCR (82.3% of 192 samples). Agreement was observed for 138 of 192 samples. Thirty-four samples were positive by culture only, mostly due to presence of species that are not covered by primers in the PCR system (e.g., Mannheimia spp.). Two samples were positive for Streptococcus uberis by culture but not by PCR directly from the milk samples. This was not due to inability of the PCR primers to amplify ovine Streptococcus uberis, as diluted DNA extracts from the same samples and DNA extracts from the bacterial isolates were positive by real-time PCR. For samples containing Staphylococcus spp., 11 samples were positive by culture and PCR, 9 by culture only, and 20 by PCR only. Samples that were negative by either method had lower bacterial load than samples that were positive for both methods, whereas no clear relation with species identity was observed. This study provides
Diagnosis of aerobic vaginitis by quantitative real-time PCR.
Rumyantseva, T A; Bellen, G; Savochkina, Y A; Guschin, A E; Donders, G G G
2016-07-01
To evaluate a real-time PCR-based technique to quantify bacteria associated with aerobic vaginitis (AV) as a potential test. Vaginal samples from 100 women were tested by wet-mount microscopy, gram stain and quantitative real-time PCR targeting Enterobacteriacea, Staphylococcus spp., Streptococcus spp., Enterococcus spp., Escherichia coli, Streptococcus agalactiae, S. aureus; Lactobacillus spp. AV diagnosis obtained by wet-mount microscopy was used as reference. Some level of AV was diagnosed in 23 (23.7 %) cases. Various concentrations of Enterobacteriacea, Staphylococcus spp., Streptococcus spp. were detected an all patients. Enterococcus spp. were detected in 76 (78.3 %) cases. Summarized concentrations of aerobes were tenfold higher in AV-positive compared to AV-negative cases [7.30lg vs 6.06lg (p = 0.02)]. Concentrations of aerobes in severe, moderate and light AV cases did not vary significantly (p = 0.14). Concentration of lactobacilli was 1000-fold lower in AV-positive cases compared to normal cases (5.3lg vs 8.3lg, p AV-positive cases [19/22 (86.4 %) samples]. The relation of high loads of aerobes to the low numbers of Lactobacilli are a reliable marker for the presence of AV and could substitute microscopy as a test. PCR may be a good standardized substitution for AV diagnosis in settings where well-trained microscopists are lacking.
[Detection of Cryptospordium spp. in environmental water samples by FTA-PCR].
Zhang, Xiao-Ping; Zhu, Qian; He, Yan-Yan; Jiang, Li; Jiang, Shou-Fu
2011-02-01
To establish a FTA-polymeras chain reaction (FTA-PCR) method in detection of Cryptospordium spp. in different sources of water. The semi automated immunomagnetic separation (IMS) of Cryptospordium oocysts in environmental water samples was performed firstly, and then genomic DNA of Cryptospordium oocysts was extracted by FTA filters disk. Oligonucleotide primers were designed based on the DNA fragment of the 18 S rRNA gene from C. parvum. Plate DNA was amplified with primers in PCR. The control DNA samples from Toxoplasma gondii,Sarcocystis suihominis, Echinococcus granulosus, and Clonorchis sinensis were amplified simultaneously. All PCR products were detected by agar electrophoresis dyed with ethidium bromide. The 446 bp fragment of DNA was detected in all samples of C. parvum, C. andersoni, and C. baileyi, while it was not detected in control groups in laboratory. No positive samples were found from 10 samples collected from tape water in 5 districts of Shanghai City by FTA-PCR. Nine positive samples were detected totally from 70 different environmental water samples, there were 0 out of 15 samples from the source of tape water, 2 out of 25 from the Huangpu River, 5 out of 15 from rivers around the animal farmers, 1 out of 9 from output water of contaminating water treatment factory, 1 out of 6 from the out gate of living contaminating water. The 446 bp fragment was detected from all the amplified positive water samples. FTA-PCR is an efficient method for gene detection of Cryptospordium oocysts, which could be used in detection of environmental water samples. The contamination degree of Cryptospordium oocysts in the river water around animal farms is high.
Directory of Open Access Journals (Sweden)
Parija Subhash C
2007-05-01
Full Text Available Abstract Background E. histolytica, a pathogenic amoeba, is indistinguishable in its cyst and trophozoite stages from those of non-pathogenic E. moshkovskii and E. dispar by light microscopy. We have developed a nested multiplex PCR targeting a 16S-like rRNA gene for differential detection of all the three morphologically similar forms of E. histolytica, E. moshkovskii and E. dispar simultaneously in stool samples. Results The species specific product size for E. histolytica, E. moshkovskii and E. dispar was 439, 553 and 174 bp respectively, which was clearly different for all the three Entamoeba species. The nested multiplex PCR showed a sensitivity of 94% and specificity of 100% for the demonstration of E. histolytica, E. moshkovskii and E. dispar DNA in stool samples. The PCR was positive for E. histolytica, E. moshkovskii and E. dispar in a total of 190 out of 202 stool specimens (94% sensitive that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture. All the 35 negative control stool samples that were negative for E. histolytica/E. dispar/E. moshkovskii by microscopy and culture were also found negative by the nested multiplex PCR (100% specific. The result from the study shows that only 34.6% of the patient stool samples that were positive for E. histolytica/E. dispar/E. moshkovskii by examination of stool by microscopy and/or culture, were actually positive for pathogenic E. histolytica and the remaining majority of the stool samples were positive for non-pathogenic E. dispar or E. moshkovskii as demonstrated by the use of nested multiplex PCR. Conclusion The present study reports a new nested multiplex PCR strategy for species specific detection and differentiation of E. histolytica, E. dispar and E. moshkovskii DNA in stool specimens. The test is highly specific, sensitive and also rapid, providing the results within 12 hours of receiving stool specimens.
Directory of Open Access Journals (Sweden)
Tian-Min Qiao
2016-10-01
Full Text Available Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP were developed for detection of C. scoparium based on factor 1-alpha (tef1 and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-01-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium, has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium. The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products. PMID:27721691
Qiao, Tian-Min; Zhang, Jing; Li, Shu-Jiang; Han, Shan; Zhu, Tian-Hui
2016-10-01
Eucalyptus dieback disease, caused by Cylindrocladium scoparium , has occurred in last few years in large Eucalyptus planting areas in China and other countries. Rapid, simple, and reliable diagnostic techniques are desired for the early detection of Eucalyptus dieback of C. scoparium prior to formulation of efficient control plan. For this purpose, three PCR-based methods of nested PCR, multiplex PCR, loop-mediated isothermal amplification (LAMP) were developed for detection of C. scoparium based on factor 1-alpha (tef1) and beta-tubulin gene in this study. All of the three methods showed highly specific to C. scoparium . The sensitivities of the nested PCR and LAMP were much higher than the multiplex PCR. The sensitivity of multiplex PCR was also higher than regular PCR. C. scoparium could be detected within 60 min from infected Eucalyptus plants by LAMP, while at least 2 h was needed by the rest two methods. Using different Eucalyptus tissues as samples for C. scoparium detection, all of the three PCR-based methods showed much better detection results than regular PCR. Base on the results from this study, we concluded that any of the three PCR-based methods could be used as diagnostic technology for the development of efficient strategies of Eucalyptus dieback disease control. Particularly, LAMP was the most practical method in field application because of its one-step and rapid reaction, simple operation, single-tube utilization, and simple visualization of amplification products.
Directory of Open Access Journals (Sweden)
Bárbara Angulo
Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.
Polymerase chain reaction methods (PCR in agrobiotechnology
Directory of Open Access Journals (Sweden)
Taški-Ajduković Ksenija
2006-01-01
Full Text Available The agricultural biotechnology applies polymerase chain reaction (PCR technology at numerous steps throughout product development. The major uses of PCR technology during product development include gene discovery and cloning, vector construction, transformant identification, screening and characterization as well as seed quality control. Commodity and food companies as well as testing laboratories rely on PCR technology to verify the presence or absence of genetically modification (GM in a product or to quantify the amount of GM material present in the product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains and highlights some of areas to which attention must be paid in order to produce reliable test results. The article also discuses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.
Canine distemper virus detection by different methods of One-Step RT-qPCR
Directory of Open Access Journals (Sweden)
Claudia de Camargo Tozato
2016-01-01
Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.
International Nuclear Information System (INIS)
Hoang Thi My Linh; Phan, D. T. Son; Nguyen Thi Vang; Nguyen, T. T. Hien; Le XuanTham
2007-01-01
The project was carried out in 2007 with the purpose of consideration for using the two simple and inexpensive molecular techniques to estimate changes in DNA of rice mutant after gamma irradiation. Three rice cultivars: Basmati370, Tam Thom (TT1), IR64 and three gamma irradiated mutants BDS, TDS and VND 95-20 respectively, were used. Suitable DNA extraction procedure was obtained. PCR optimization was conducted on three important factors including: amount of MgCl 2 , DNA concentration and annealing temperature. 2.5 mM of MgCl 2 for RAPD-PCR and 3.75 mM for RAMP-PCR were found the best. 40 ng DNA provided a good amplification for RAMP-PCR; this figure was 50 ng for RAPD-PCR. Annealing temperatures were determined at 36 o C for RAPD primer and at 55±3 o C for Microsatellite primer. Final results showed that, both RAPD-PCR and RAMP-PCR could detect changes in DNA of rice mutants after gamma irradiation compared to their parents. Percentage of DNA changes determined by RAPD-PCR and RAMP-PCR on Basmati370 and its mutant BDS were 11.49% and 21.2% respectively; These on TT1 and TDS were 8.98% and 15.4%; and on IR64 and VND 95-20 were 3.45% and 4.95%. (author)
Wagner, F; Streubel, A; Roth, A; Stephan-Falkenau, S; Mairinger, T
2014-05-01
We assessed the potential of a chromogenic in situ hybridisation (CISH) assay in comparison with quantitative reverse transcription (RT)-PCR (qPCR) to detect anaplastic lymphoma kinase (ALK) break apart-positive lung carcinomas. Dual-colour CISH using a break apart probe for the ALK gene on 2p23 was performed with 181 formalin-fixed, paraffin-embedded tissue and agar block sections from 175 cases of non-small cell lung carcinomas (NSCLC). Stained slides were analysed with a standard bright-field microscope at 1000× magnification by counting signals from 60 non-overlapping nuclei from three different tumour areas. Samples with ≥15% of positive nuclei were judged as ALK break apart-positive. All samples were simultaneously analysed by qPCR for EML4-ALK to validate CISH results, and positive samples were subject to Sanger sequencing. CISH was successful with 173 of 181 hybridised samples (96%), and seven ALK break apart-positive cases were detected. CISH signals were specific and distinct for both colours. All positive cases were confirmed by qPCR and Sanger sequencing, and concordance between CISH and qPCR was 100%. Nearly all samples (9/10) which failed by qPCR were accessible to CISH analysis. CISH is a very reliable, convenient and inexpensive method to detect ALK-positive NSCLC. CISH success rate is comparably high as with qPCR, and it detects all ALK break apart events in a single assay. It is of special value when RNA quality is poor, or when small biopsies with a very limited amount of tumour cells have to be analysed.
Directory of Open Access Journals (Sweden)
Rodolakis Annie
2009-07-01
Full Text Available Abstract Background Chlamydiosis and Q fever, two zoonosis, are important causes of ruminants' abortion around the world. They are caused respectively by strictly intracellular and Gram negative bacterium Chlamydophila abortus (Cp. abortus and Coxiella burnetii (C. burnetii. Chlamydophila pecorum (Cp. pecorum is commonly isolated from the digestive tract of clinically inconspicuous ruminants but the abortive and zoonotic impact of this bacterium is still unknown because Cp. pecorum is rarely suspected in abortion cases of small ruminants. We have developed a multiplex PCR (m-PCR for rapid simultaneous differential detection of Cp. abortus, Cp. pecorum and C. burnetii in clinical samples taken from infected animals. Results Specific PCR primers were designed and a sensitive and specific m-PCR was developed to detect simultaneously, in one tube reaction, three specific fragments of 821, 526 and 687-bp long for Cp. abortus, Cp. pecorum and C. burnetii respectively. This m-PCR assay was performed on 253 clinical samples taken from infected ruminant's flocks that have showed problems of abortion diseases. Thus, 67 samples were infected by either one of the three pathogens: 16 (13 vaginal swabs and 3 placentas were positive for Cp. abortus, 2 were positive for Cp. pecorum (1 vaginal swab and 1 placenta and 49 samples (33 vaginal swabs, 11 raw milks, 4 faeces and 1 placenta were positive for C. burnetii. Two vaginal swabs were m-PCR positive of both Cp. abortus and C. burnetii and none of the tested samples was shown to be infected simultaneously with the three pathogens. Conclusion We have successfully developed a rapid multiplex PCR that can detect and differentiate Cp. abortus, Cp. pecorum and C. burnetii; with a good sensitivity and specificity. The diagnosis of chlamydiosis and Q fever may be greatly simplified and performed at low cost. In addition, the improvement in diagnostic techniques will enhance our knowledge regarding the prevalence and
False-positive results in pharmacoepidemiology and pharmacovigilance.
Bezin, Julien; Bosco-Levy, Pauline; Pariente, Antoine
2017-09-01
False-positive constitute an important issue in scientific research. In the domain of drug evaluation, it affects all phases of drug development and assessment, from the very early preclinical studies to the late post-marketing evaluations. The core concern associated with this false-positive is the lack of replicability of the results. Aside from fraud or misconducts, false-positive is often envisioned from the statistical angle, which considers them as a price to pay for type I error in statistical testing, and its inflation in the context of multiple testing. If envisioning this problematic in the context of pharmacoepidemiology and pharmacovigilance however, that both evaluate drugs in an observational settings, information brought by statistical testing and the significance of such should only be considered as additional to the estimates provided and their confidence interval, in a context where differences have to be a clinically meaningful upon everything, and the results appear robust to the biases likely to have affected the studies. In the following article, we consequently illustrate these biases and their consequences in generating false-positive results, through studies and associations between drug use and health outcomes that have been widely disputed. Copyright © 2017 Société française de pharmacologie et de thérapeutique. Published by Elsevier Masson SAS. All rights reserved.
Validation of a PCR Assay for Chlamydophila abortus rRNA gene detection in a murine model
Directory of Open Access Journals (Sweden)
Francielle Gibson da Silva-Zacarias
2009-11-01
Full Text Available Chlamydophila abortus (C. abortus is associated with reproductive problems in cattle, sheep, and goats. Diagnosis of C. abortus using embryonated chicken eggs or immortalized cell lines has a very low sensitivity. Polymerase chain reaction (PCR assays have been used to detect C. abortus infection in clinical specimens and organ fragments, such as placenta, fetal organs, vaginal secretions, and semen. The aim of this study was to develop a PCR assay for the amplification of an 856-bp fragment of the rRNA gene of the Chlamydiaceae family. The PCR assay was evaluated using organs from 15 mice experimentally infected with the S26/3 reference strain of C. abortus. The results of the rRNA PCR were compared to the results from another PCR system (Omp2 PCR that has been previously described for the Omp2 (outer major protein gene from the Chlamydiaceae family. From the 15 C. abortus-inoculated mice, 13 (K=0.84, standard error =0.20 tested positive using the rRNA PCR assay and 9 (K=0.55, standard error=0.18 tested positive using the Omp2 PCR assay. The detection limit, measured using inclusion-forming units (IFU, for C. abortus with the rRNA PCR (1.05 IFU was 100-fold lower than for the Omp2 PCR (105 IFU. The higher sensitivity of the rRNA PCR, as compared to the previously described PCR assay, and the specificity of the assay, demonstrated using different pathogenic microorganisms of the bovine reproductive system, suggest that the new PCR assay developed in this study can be used for the molecular diagnosis of C. abortus in abortion and other reproductive failures in bovines, caprines, and ovines.Chlamydophila abortus (C. abortus é frequentemente associada a distúrbios reprodutivos em bovinos, ovinos e caprinos. Para o diagnóstico, os métodos de cultivo em ovo embrionado de galinha e em células de linhagem contínua apresentam baixa sensibilidade. A reação em cadeia da polimerase (PCR tem sido utilizada em placenta, órgãos fetais, secre
DEFF Research Database (Denmark)
Giese, Steen Bjørck; Ahrens, Peter
2000-01-01
Milk and faeces samples from cows with clinical symptoms of paratuberculosis were examined for the presence of Mycobacterium avium subsp. paratuberculosis (M. paratuberculosis) by culture and PCR. M. paratuberculosis was cultivated in variable numbers from faeces or intestinal mucosa in eight of 11...... animals. In milk from five cows (all faeces culture positive), we cultivated a few colonies of M. paratuberculosis (culture positive, and one cow was milk culture positive). One cow was culture negative on intestinal...... mucosa, but culture positive in milk, and two cows were negative in culture and PCR from both faeces and milk. In conclusion, the presence of M. paratuberculosis could be detected in raw milk by PCR, but cultivation of milk was more sensitive. (C) 2000 Elsevier Science B.V. All rights reserved....
Badiee, Parisa; Nejabat, Mahmood; Alborzi, Abdolvahab; Keshavarz, Fatemeh; Shakiba, Elaheh
2010-01-01
This study seeks to evaluate the efficacy and practicality of the molecular method, compared to the standard microbiological techniques for diagnosing fungal keratitis (FK). Patients with eye findings suspected of FK were enrolled for cornea sampling. Scrapings from the affected areas of the infected corneas were obtained and were divided into two parts: one for smears and cultures, and the other for nested PCR analysis. Of the 38 eyes, 28 were judged to have fungal infections based on clinical and positive findings in the culture, smear and responses to antifungal treatment. Potassium hydroxide, Gram staining, culture and nested PCR results (either positive or negative) matched in 76.3, 42.1, 68.4 and 81.6%, respectively. PCR is a sensitive method but due to the lack of sophisticated facilities in routine laboratory procedures, it can serve only complementarily and cannot replace conventional methods. Copyright © 2010 S. Karger AG, Basel.
Komparasi Metode Isolasi DNA Patogen Antraknosa dan Bulai untuk Deteksi PCR
Directory of Open Access Journals (Sweden)
Ade Syahputra
2016-11-01
Full Text Available Polymerase chain reaction (PCR is an important tool for detection, identification and monitoring of quarantine pests in Indonesia. DNA isolation method from target organism is an important step to provide adequate DNA template for performing PCR. Objective of the research was to compare conventional, commercial kit, FTA-card and its modification methods of DNA isolation to be used in PCR detection for Colletotrichum acutatum and Peronosclerospora sorghi from chili and maize, respectively. DNA obtained from various isolation methods were measured using UV-vis nanodrop-spectrophotometry. DNA amplification was performed using DNA concentration of 15 ng µL-1 from each isolation method with gradual primer concentrations of 0.4; 0.6; 0.8; and 1.0 mM. The highest concentration of DNA was achieved with conventional methods for C. acutatum from pure culture and P. sorghi from maize leaf. Best DNA purity was obtained from isolation method using commercial kit for C. acutatum from infected fruit (1.94 and from conventional method for C. acutatum from pure culture (1.91. The highest total yield of isolated DNA was achieved by modified FTA-card for C. acutatum from pure culture. In general DNA amplification using various primer concentration gave positive results although DNA bands intensity was varied from faint to very bright. Furthermore PCR optimization using the best primer concentration from previous reaction showed that all DNA templates resulted in thick and bright DNA bands.
RT-PCR for detection of all seven genotypes of Lyssavirus genus.
Vázquez-Morón, S; Avellón, A; Echevarría, J E
2006-08-01
The Lyssavirus genus includes seven species or genotypes named 1-7. Rabies genotypes correlate with geographical distribution and specific hosts. Co-circulation of different lyssaviruses, imported cases, and the presence of unknown viruses, such as Aravan, Khujand, Irkut and West Caucasian Bat Virus, make it necessary to use generic methods able to detect all lyssaviruses. Primer sequences were chosen from conserved regions in all genotypes in order to optimise a generic RT-PCR. Serial dilutions of 12 RNA extracts from all seven Lyssavirus genotypes were examined to compare the sensitivity of the RT-PCR standardised in this study with a published RT-PCR optimised for EBLV1 detection and capable of amplifying RNA from all seven lyssaviruses. All seven genotypes were detected by both RT-PCRs, however, the sensitivity was higher with the new version of the test. Twenty samples submitted for rabies diagnosis were tested by the new RT-PCR. Eight out of 20 samples from six dogs, one horse and one bat were found positive, in agreement with immunofluorescence results. Seven samples from terrestrial mammals were genotype 1 and one from a bat was genotype 5. In conclusion, this method can be used to complement immunofluorescence for the diagnosis of rabies, enabling the detection of unexpected lyssaviruses during rabies surveillance.
Consequences of a false-positive mammography result
DEFF Research Database (Denmark)
von Euler-Chelpin, My; Bæksted, Christina; Vejborg, Ilse
2016-01-01
group used anxiolytic and antidepressant drugs. There was no difference in use of beta blockers. Hormone therapy was used more frequently by the false-positive, 36.6% versus 28.7%. The proportion of women using anxiolytic and antidepressant drugs increased with 19% from the before to the after period...... in the false-positive group, and with 16% in the normal group, resulting in an RRR of 1.02 (95% CI 0.92-1.14). RRR was 1.03 for beta blockers, 0.97 for hormone therapy. Conclusion(s): Drugs used to mitigate mood disorders were used more frequently by women with false-positive than by women with normal......Background: Previous research showed women experiencing false-positive mammograms to have greater anxiety about breast cancer than women with normal mammograms. To elucidate psychological effects of false-positive mammograms, we studied impact on drug intake. Methods: We calculated the ratio...
Saingamsook, Jassada; Saeung, Atiporn; Yanola, Jintana; Lumjuan, Nongkran; Walton, Catherine; Somboon, Pradya
2017-10-10
Mutation of the voltage-gated sodium channel (VGSC) gene, or knockdown resistance (kdr) gene, is an important resistance mechanism of the dengue vector Aedes aegypti mosquitoes against pyrethroids. In many countries in Asia, a valine to glycine substitution (V1016G) and a phenylalanine to cysteine substitution (F1534C) are common in Ae. aegypti populations. The G1016 and C1534 allele frequencies have been increasing in recent years, and hence there is a need to have a simple and inexpensive tool to monitor the alleles in large scale. A multiplex PCR to detect V1016G and F1534C mutations has been developed in the current study. This study utilized primers from previous studies for detecting the mutation at position 1016 and newly designed primers to detect variants at position 1534. The PCR conditions were validated and compared with DNA sequencing using known kdr mutant laboratory strains and field collected mosquitoes. The efficacy of this method was also compared with allele-specific PCR (AS-PCR). The results of our multiplex PCR were in complete agreement with sequencing data and better than the AS-PCR. In addition, the efficiency of two non-toxic DNA staining dyes, Ultrapower™ and RedSafe™, were evaluated by comparing with ethidium bromide (EtBr) and the results were satisfactory. Our multiplex PCR method is highly reliable and useful for implementing vector surveillance in locations where the two alleles co-occur.
Directory of Open Access Journals (Sweden)
Fabio Felipe dos Santos
2015-12-01
Full Text Available ABSTRACT Purpose: To evaluate the ability of real-time quantitative PCR (qPCR for detectingToxoplasma gondii DNA in the peripheral blood and aqueous humor of patients with toxoplasmic active focal necrotizing retinochoroiditis. Methods: Fifty-five patients with infectious uveitis seen from 2009 to 2013 at the Department of Ophthalmology and Visual Sciences of the Federal University of São Paulo were enrolled in this study. Forty-three patients had toxoplasmic active focal necrotizing retinochoroiditis, and the remaining 12 had non-toxoplasmic infectious uveitis and served as controls. qPCR analysis forT. gondii DNA was performed on the patients' peripheral blood and aqueous humor samples. Results: The qPCR was positive for T. gondii DNA in 37.21% (16/43 of the aqueous humor samples and 2.33% (1/43 of the peripheral blood samples; further, 16.27% (7/43 of the patients had positive results in both their blood and aqueous humor samples. Conclusion: qPCR was able to detect T. gondii DNA in patients with toxoplasmic active focal necrotizing retinochoroiditis in the blood as well as the aqueous humor and can help with the diagnosis of the disease.
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.
Directory of Open Access Journals (Sweden)
Yong Huang
Full Text Available Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus and PCV2 (DNA virus from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29% and TGEV (11.7% preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay
Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.
Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.
Lucero, David E.; Ribera, Wilma; Pizarro, Juan Carlos; Plaza, Carlos; Gordon, Levi W.; Peña, Reynaldo; Morrissey, Leslie A.; Rizzo, Donna M.; Stevens, Lori
2014-01-01
Background In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps). Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia. Methodology/Principal Findings We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens), five for chicken (Gallus gallus) and unicolored blackbird (Agelasticus cyanopus), and one for opossum (Monodelphis domestica). Using the qPCR assay we detected chicken (13 vectors), and human (14 vectors) blood meals as well as an additional blood meal source, Canis sp. (4 vectors). Conclusions/Significance We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors. PMID:25474154
Directory of Open Access Journals (Sweden)
David E Lucero
2014-12-01
Full Text Available In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps. Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia.We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens, five for chicken (Gallus gallus and unicolored blackbird (Agelasticus cyanopus, and one for opossum (Monodelphis domestica. Using the qPCR assay we detected chicken (13 vectors, and human (14 vectors blood meals as well as an additional blood meal source, Canis sp. (4 vectors.We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors.
Schistosoma real-time PCR as diagnostic tool for international travellers and migrants.
Cnops, Lieselotte; Tannich, Egbert; Polman, Katja; Clerinx, Jan; Van Esbroeck, Marjan
2012-10-01
To evaluate the use of a genus-specific PCR that combines high sensitivity with the detection of different Schistosoma species for diagnosis in international travellers and migrants in comparison to standard microscopy. The genus-specific real-time PCR was developed to target the 28S ribosomal RNA gene of the major human Schistosoma species. It was validated for analytical specificity and reproducibility and demonstrated an analytical sensitivity of 0.2 eggs per gram of faeces. Its diagnostic performance was further evaluated on 152 faecal, 32 urine and 38 serum samples from patients presenting at the outpatient clinic of the Institute of Tropical Medicine in Antwerp (Belgium). We detected Schistosoma DNA in 76 faecal (50.0%) and five urine (15.6%) samples of which, respectively, nine and one were not detected by standard microscopy. Only two of the 38 serum samples of patients with confirmed schistosomiasis were positive with the presently developed PCR. Sequence analysis on positive faecal samples allowed identification of the Schistosoma species complex. The real-time PCR is highly sensitive and may offer added value in diagnosing imported schistosomiasis. The genus-specific PCR can detect all schistosome species that are infectious to humans and performs very well with faeces and urine, but not in serum. © 2012 Blackwell Publishing Ltd.
Peci, Adriana; Winter, Anne-Luise; Gubbay, Jonathan B.
2016-01-01
Legionella is a Gram-negative bacterium that can cause Pontiac fever, a mild upper respiratory infection and Legionnaire’s disease, a more severe illness. We aimed to compare the performance of urine antigen, culture, and polymerase chain reaction (PCR) test methods and to determine if sputum is an acceptable alternative to the use of more invasive bronchoalveolar lavage (BAL). Data for this study included specimens tested for Legionella at Public Health Ontario Laboratories from 1st January, 2010 to 30th April, 2014, as part of routine clinical testing. We found sensitivity of urinary antigen test (UAT) compared to culture to be 87%, specificity 94.7%, positive predictive value (PPV) 63.8%, and negative predictive value (NPV) 98.5%. Sensitivity of UAT compared to PCR was 74.7%, specificity 98.3%, PPV 77.7%, and NPV 98.1%. Out of 146 patients who had a Legionella-positive result by PCR, only 66 (45.2%) also had a positive result by culture. Sensitivity for culture was the same using either sputum or BAL (13.6%); sensitivity for PCR was 10.3% for sputum and 12.8% for BAL. Both sputum and BAL yield similar results regardless testing methods (Fisher Exact p-values = 1.0, for each test). In summary, all test methods have inherent weaknesses in identifying Legionella; therefore, more than one testing method should be used. Obtaining a single specimen type from patients with pneumonia limits the ability to diagnose Legionella, particularly when urine is the specimen type submitted. Given ease of collection and similar sensitivity to BAL, clinicians are encouraged to submit sputum in addition to urine when BAL submission is not practical from patients being tested for Legionella. PMID:27630979
Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan
2013-05-01
This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.
Taguchi, Hirokazu; Matsumoto, Tetsuya; Ishikawa, Hiroki; Ohta, Shoichi; Yukioka, Tetsuo
2012-10-01
We investigated active screening for colonization with methicillin-resistant Staphylococcus aureus (MRSA) on admission and weekly follow-up surveillance after admission to a tertiary care center (TCC) between June 2007 and 31 December 2007. Eleven percent (30/267) of patients were found to be positive for MRSA by polymerase chain reaction (PCR) and/or culture on admission; 5% (12/267) became positive during the TCC stay. The major primary diagnoses in MRSA-positive patients were pneumonia and cerebrovascular diseases. Twenty-two (52%) of 42 patients were found to be MRSA positive by both PCR and culture, compared with 19 (45%) of 42 who were PCR positive and culture negative. These findings suggest that active surveillance with PCR is highly sensitive and useful for the detection of MRSA colonization. To our knowledge, this is the first report of active surveillance of MRSA by PCR and bacterial culture in critically ill inpatients in Japan.
Fourour, Sarah; Fablet, Christelle; Tocqueville, Véronique; Dorenlor, Virginie; Eono, Florent; Eveno, Eric; Kempf, Isabelle; Marois-Créhan, Corinne
2018-03-30
A new multiplex qPCR targeting Mycoplasma (M.) hyopneumoniae, M. hyorhinis and M. flocculare was developed and the relationship between the detection of those mycoplasma species and the extent of gross pneumonia like lesions in slaughtered pigs lungs were investigated. The multiplex qPCR method targets the p102, p37 and fruA genes and has detection limits of 14, 146, and 16 genome equivalents μl -1 for M. hyopneumoniae, M. hyorhinis and M. flocculare, respectively. In all, 671 lungs were collected and analysed, among them 666 were scored for macroscopic pneumonia and categorized according to the extent of the lesions (no or minor lesions, moderate lesions, and extensive lesions). According to results of multiplex qPCR, 59.5% were positive for M. hyopneumoniae, 3.4% for M. hyorhinis and 34.7% for M. flocculare, with on average, 3.1x10 7 , 9.7x10 6 and 5.7x10 6 genome equivalents of mycoplasma ml -1 , respectively. More results showed that no or minor lesions were associated with multiplex qPCR-negative results or qPCR-positive results for M. flocculare. Moderate to extensive lesions were positively correlated with qPCR-positive results for M. hyopneumoniae. Extensive lesions were associated with qPCR-positive results for at least two mycoplasma species (M. hyopneumoniae and M. hyorhinis). The findings also indicated that M. hyopneumoniae and M. hyorhinis significantly increased the odds for a lung to have macroscopic pneumonia. No relationship was found between the extent of lesions and the mycoplasma genome load. This new multiplex qPCR appears to be specific, sufficiently sensitive and repeatable. The validation of this method with field samples guarantees its use for field epidemiological investigations, particularly to gain more insight into the etiology of the porcine respiratory disease complex. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.
Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G
2014-11-01
The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.
IDENTIFIKASI TIPE HLA KELAS II DENGAN TEKNIK PCR
Directory of Open Access Journals (Sweden)
Ervi Salwati
2012-09-01
Full Text Available HLA (Human Leukocyte Antigen contains a set of genes located together on the short arm of chromosome 6. These genes control immune responses, graft acceptance or rejection and tumor surveillance. These abilities have close relationship with genetic variation (occur in "many forms" or alleles that bind and present antigens to T lymphocytes. Using advanced technology and molecular biology approaches (PCR technique detection of genetic variation in the HLA region (or HLA typing has been performed based on DNA.. PCR is an in vitro technique to amplify the DNA sequence enzymatically. "Sequence Specific Primers" (SSP are designed for this PCR to obtain amplification of specific alleles or groups of alleles. The PCR products are visualized through agarose gel electrophoresis stained with ethidium bromide. The PCR technique requires small amount of whole blood (0.5 - 1 ml, gives rapid, accurate and complete result. This paper discuss identification of HLA class II typing using PCR-SSP technique and show the examples of the results. Key words: HLA (Human Leukocyte Antigen class II, PCR (Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Karla Valéria Batista Lima
2007-04-01
Full Text Available A reação em cadeia da polimerase usada para amplificação de uma seqüência interna de um fragmento previamente amplificado (nested-PCR foi investigada como uma alternativa complementar a pesquisa de bacilos álcool ácido resistentes e a cultura do Mycobacterium tuberculosis em meio de Lowenstein-Jensen. Foram investigadas 144 amostras de escarro de pacientes suspeitos de tuberculose encaminhados ao Laboratório de Tuberculose do Instituto Evandro Chagas em Belém, no período de junho de 2002 a dezembro de 2003. Das 144 amostras, 121 foram caracterizadas como tuberculose, 119 foram positivas na cultura, 95 na baciloscopia e 128 na nested-PCR. A sensibilidade da nested-PCR foi 96% (116/121, enquanto a especificidade foi 48% (11/23. A nested-PCR poderá ser uma ferramenta complementar para o diagnóstico da tuberculose, pois apresenta sensibilidade equivalente à cultura, no entanto, necessita de maiores avaliações visando minimizar o número de resultados falso-positivos.The polymerase chain reaction used for amplifying an internal sequence of a previously amplified fragment (nested-PCR was investigated as a complementary alternative for searching for alcohol-acid resistant bacilli and Mycobacterium tuberculosis cultures in Lowenstein-Jensen medium. 144 sputum samples were investigated from patients with suspected tuberculosis that were sent to the Tuberculosis Laboratory of the Evandro Chagas Institute in Belém, between June 2002 and December 2003. From the 144 samples, 121 were characterized as tuberculosis: 119 were positive in cultures, 95 under bacilloscopy and 128 using nested-PCR. The sensibility of the nested-PCR was 96% (116/121, while the specificity was 48% (11/23. Nested-PCR may be a complementary tool for diagnosing tuberculosis, since it presents sensitivity equivalent to that of cultures. However, further evaluations are needed with the aim of minimizing the number of false-positive results.
Implications of false-positive results for future cancer screenings.
Taksler, Glen B; Keating, Nancy L; Rothberg, Michael B
2018-06-01
False-positive cancer screening results may affect a patient's willingness to obtain future screening. The authors conducted logistic regression analysis of 450,484 person-years of electronic medical records (2006-2015) in 92,405 individuals aged 50 to 75 years. Exposures were false-positive breast, prostate, or colorectal cancer screening test results (repeat breast imaging or negative breast biopsy ≤3 months after screening mammography, repeat prostate-specific antigen [PSA] test ≤3 months after PSA test result ≥4.0 ng/mL or negative prostate biopsy ≤3 months after any PSA result, or negative colonoscopy [without biopsy/polypectomy] ≤6 months after a positive fecal occult blood test). Outcomes were up-to-date status with breast or colorectal cancer screening. Covariates included prior screening history, clinical information (eg, family history, obesity, and smoking status), comorbidity, and demographics. Women were more likely to be up to date with breast cancer screening if they previously had false-positive mammography findings (adjusted odds ratio [AOR], 1.43 [95% confidence interval, 1.34-1.51] without breast biopsy and AOR, 2.02 [95% confidence interval, 1.56-2.62] with breast biopsy; both Pfalse-positive PSA testing were more likely to be up to date with colorectal cancer screening (AOR, 1.22 [P = .039] without prostate imaging/biopsy and AOR, 1.60 [P = .028] with imaging/biopsy). Results were stronger for individuals with more false-positive results (all P≤.005). However, women with previous false-positive colorectal cancer fecal occult blood test screening results were found to be less likely to be up to date with breast cancer screening (AOR, 0.73; Pfalse-positive breast or prostate cancer screening test were more likely to engage in future screening. Cancer 2018;124:2390-8. © 2018 American Cancer Society. © 2018 American Cancer Society.
Opota, Onya; Jaton, Katia; Branley, James; Vanrompay, Daisy; Erard, Veronique; Borel, Nicole; Longbottom, David; Greub, Gilbert
2015-10-01
Chlamydia psittaci and Chlamydia abortus are closely related intracellular bacteria exhibiting different tissue tropism that may cause severe but distinct infection in humans. C. psittaci causes psittacosis, a respiratory zoonotic infection transmitted by birds. C. abortus is an abortigenic agent in small ruminants, which can also colonize the human placenta and lead to foetal death and miscarriage. Infections caused by C. psittaci and C. abortus are underestimated mainly due to diagnosis difficulties resulting from their strict intracellular growth. We developed a duplex real-time PCR to detect and distinguish these two bacteria in clinical samples. The first PCR (PCR1) targeted a sequence of the 16S-23S rRNA operon allowing the detection of both C. psittaci and C. abortus. The second PCR (PCR2) targeted the coding DNA sequence CPSIT_0607 unique to C. psittaci. The two PCRs showed 100 % detection for ≥ 10 DNA copies per reaction (1000 copies ml(- 1)). Using a set of 120 samples, including bacterial reference strains, clinical specimens and infected cell culture material, we monitored 100 % sensitivity and 100 % specificity for the detection of C. psittaci and C. abortus for PCR1. When PCR1 was positive, PCR2 could discriminate C. psittaci from C. abortus with a positive predictive value of 100 % and a negative predictive value of 88 %. In conclusion, this new duplex PCR represents a low-cost and time-saving method with high-throughput potential, expected to improve the routine diagnosis of psittacosis and pregnancy complication in large-scale screening programs and also during outbreaks.
Tuomi, Jari Michael; Voorbraak, Frans; Jones, Douglas L.; Ruijter, Jan M.
2010-01-01
For real-time monitoring of PCR amplification of DNA, quantitative PCR (qPCR) assays use various fluorescent reporters. DNA binding molecules and hybridization reporters (primers and probes) only fluoresce when bound to DNA and result in the non-cumulative increase in observed fluorescence.
Pitfalls in PCR troubleshooting: Expect the unexpected?
Directory of Open Access Journals (Sweden)
Livia Schrick
2016-01-01
Full Text Available PCR is a well-understood and established laboratory technique often used in molecular diagnostics. Huge experience has been accumulated over the last years regarding the design of PCR assays and their set-up, including in-depth troubleshooting to obtain the optimal PCR assay for each purpose. Here we report a PCR troubleshooting that came up with a surprising result never observed before. With this report we hope to sensitize the reader to this peculiar problem and to save troubleshooting efforts in similar situations, especially in time-critical and ambitious diagnostic settings.
Tran, Tuan M; Aghili, Amirali; Li, Shanping; Ongoiba, Aissata; Kayentao, Kassoum; Doumbo, Safiatou; Traore, Boubacar; Crompton, Peter D
2014-10-04
As public health efforts seek to eradicate malaria, there has been an emphasis on eliminating low-density parasite reservoirs in asymptomatic carriers. As such, diagnosing submicroscopic Plasmodium infections using PCR-based techniques has become important not only in clinical trials of malaria vaccines and therapeutics, but also in active malaria surveillance campaigns. However, PCR-based quantitative assays that rely on nucleic acid extracted from dried blood spots (DBS) have demonstrated lower sensitivity than assays that use cryopreserved whole blood as source material. The density of Plasmodium falciparum asexual parasites was quantified using genomic DNA extracted from dried blood spots (DBS) and the sensitivity of two approaches was compared: quantitative real-time PCR (qPCR) targeting the P. falciparum 18S ribosomal RNA gene, either with an initial conventional PCR amplification prior to qPCR (nested qPCR), or without an initial amplification (qPCR only). Parasite densities determined by nested qPCR, qPCR only, and light microscopy were compared. Nested qPCR results in 10-fold higher sensitivity (0.5 parasites/μl) when compared to qPCR only (five parasites/ul). Among microscopy-positive samples, parasite densities calculated by nested qPCR correlated strongly with microscopy for both asymptomatic (Pearson's r=0.58, PNested qPCR improves the sensitivity for the detection of P. falciparum blood-stage infection from clinical DBS samples. This approach may be useful for active malaria surveillance in areas where submicroscopic asymptomatic infections are prevalent.
Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.
Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto
2018-08-01
Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.
Aparecida de Oliveira, Maria; Abeid Ribeiro, Eliana Guimarães; Morato Bergamini, Alzira Maria; Pereira De Martinis, Elaine Cristina
2010-02-01
Modern lifestyle markedly changed eating habits worldwide, with an increasing demand for ready-to-eat foods, such as minimally processed fruits and leafy greens. Packaging and storage conditions of those products may favor the growth of psychrotrophic bacteria, including the pathogen Listeria monocytogenes. In this work, minimally processed leafy vegetables samples (n = 162) from retail market from Ribeirão Preto, São Paulo, Brazil, were tested for the presence or absence of Listeria spp. by the immunoassay Listeria Rapid Test, Oxoid. Two L. monocytogenes positive and six artificially contaminated samples of minimally processed leafy vegetables were evaluated by the Most Probable Number (MPN) with detection by classical culture method and also culture method combined with real-time PCR (RTi-PCR) for 16S rRNA genes of L. monocytogenes. Positive MPN enrichment tubes were analyzed by RTi-PCR with primers specific for L. monocytogenes using the commercial preparation ABSOLUTE QPCR SYBR Green Mix (ABgene, UK). Real-time PCR assay presented good exclusivity and inclusivity results and no statistical significant difference was found in comparison with the conventional culture method (p < 0.05). Moreover, RTi-PCR was fast and easy to perform, with MPN results obtained in ca. 48 h for RTi-PCR in comparison to 7 days for conventional method.
Identification of Tilletia species using rep-PCR fingerprinting technique
Directory of Open Access Journals (Sweden)
Župunski Vesna
2011-01-01
Full Text Available Analyzing 167 non-processed seed samples of wheat, it was found that 145 samples (86.8 % were contaminated with Tilletia species, while 22 (13.2 % samples were not contaminated. By using rep-PCR fingerprinting technique, it was found that DNA isolates of T. tritici originated from Serbian wheat samples had 80 % similarity with positive control for T. tritici. One isolate shared similarity of 60% with T. tritici, T. controversa and T. laevis. It was supposed that this isolate belongs to T. bromi. Isolate of T. laevis shared a similarity of 70 % with isolates of T. tritici and T. controversa, while T. walkeri was more than 10 % similar with T. tritici, T. controversa and T. laevis. Although T. controversa and T. tritici had high percent of genetic similarity, they were clustered separately. Our results suggest that rep-PCR fingerprinting could be a useful tool for monitoring presence of morphologically similar Tilletia species in wheat production areas.
Prevalence of Bartonella spp. by culture, PCR and serology, in veterinary personnel from Spain
Directory of Open Access Journals (Sweden)
José A. Oteo
2017-11-01
Full Text Available Abstract Background The genus Bartonella includes fastidious, facultative intracellular bacteria mainly transmitted by arthropods and distributed among mammalian reservoirs. Bartonella spp. implicated as etiological agents of zoonoses are increasing. Apart from the classical Bartonella henselae, B. bacilliformis or B. quintana, other species (B. elizabethae, B. rochalimae, B. vinsonii arupensis and B. v. berkhoffii, B. tamiae or B. koehlerae, among others have also been associated with human and/or animal diseases. Laboratory techniques for diagnosis (culture, PCR assays and serology usually show lack of sensitivity. Since 2005, a method based on a liquid enrichment Bartonella alphaproteobacteria growth medium (BAPGM followed by PCRs for the amplification of Bartonella spp. has been developed. We aimed to assess culture, molecular and serological prevalence of Bartonella infections in companion animal veterinary personnel from Spain. Methods Each of 89 participants completed a questionnaire. Immunofluorescence assays (IFA using B. vinsonii berkhoffii (genotypes I, II and III, B. henselae, B. quintana and B. koehlerae as antigens were performed. A cut-off of 1:64 was selected as a seroreactivity titer. Blood samples were inoculated into BAPGM and subcultured onto blood agar plates. Bartonella spp. was detected using conventional and quantitative real-time PCR assays and DNA sequencing. Results Among antigens corresponding to six Bartonella spp. or genotypes, the lowest seroreactivity was found against B. quintana (11.2% and the highest, against B. v. berkhoffii genotype III (56%. A total of 27% of 89 individuals were not seroreactive to any test antigen. Bartonella spp. IFA seroreactivity was not associated with any clinical sign or symptom. DNA from Bartonella spp., including B. henselae (n = 2, B. v. berkhoffii genotypes I (n = 1 and III (n = 2, and B. quintana (n = 2 was detected in 7/89 veterinary personnel. PCR and DNA sequencing
Real-time PCR evaluation of Strongylus vulgaris in horses on farms in Denmark and Central Kentucky.
Nielsen, M K; Olsen, S N; Lyons, E T; Monrad, J; Thamsborg, S M
2012-12-21
Strongyle parasites are ubiquitous in grazing horses, and the large strongyle Strongylus vulgaris is considered the most pathogenic helminth parasite of horses. Recent investigations have suggested an association between occurrence of this parasite and usage of selective therapy based on regular fecal egg counts. The established diagnostic method for S. vulgaris involves larval culture and subsequent morphological identification of third stage larvae under the microscope. Recently, a real-time PCR assay was developed and validated for the detection and semi-quantification of S. vulgaris eggs in equine fecal samples. The purposes of the present study were (a) to determine the presence of S. vulgaris by real-time PCR in Danish and American horses on farms using vastly different anthelmintic treatment regimens and (b) to evaluate the association between larval culture results and the PCR. A total of 991 horses representing 53 different horse farms in Denmark and Central Kentucky were studied. Fresh fecal samples were collected from all horses, and strongyle eggs retrieved for DNA extraction and subsequent real-time PCR analysis. Individual larval cultures were performed on the Danish part of the data set (663 horses on 42 farms). On the Danish farms, the S. vulgaris PCR prevalence was found to be 9.2% on farms not basing parasite control on fecal egg counts, and 14.1% on farms using selective therapy. No horses were PCR positive in the American part of the study (328 horses on 11 farms). Kappa-values indicated a moderate agreement between PCR and larval culture results, while McNemar tests revealed no statistical difference between the paired proportions. Significant associations were found between PCR cycle of threshold (Ct) value groups and larval culture counts. Results indicate that both diagnostic methods can be useful for determining the occurrence of S. vulgaris on horse farms, but that they both are affected by potential sources of error. The PCR results
Isaacman, D J; Zhang, Y; Rydquist-White, J; Wadowsky, R M; Post, J C; Ehrlich, G D
1995-06-01
A polymerase chain reaction (PCR) assay based on the penicillin-binding protein gene PBP2B identified the presence of DNA specific for Streptococcus pneumoniae in the serum and CSF of a patient with culture-proven bacteremia and meningitis. Positive signals were seen to dilutions of 1:125 and 1:390,625 for the blood and CSF specimens, respectively. Potential advantages of PCR over conventional culture include exquisite sensitivity, faster results and the ability to identify the organisms by the presence of species-specific DNA even in patients pretreated with antibiotics.
An investigation of false positive dosimetry results
International Nuclear Information System (INIS)
Lewandowski, M.A.; Davis, S.A.; Goff, T.E.; Wu, C.F.
1996-01-01
The Waste Isolation Pilot Plant (WIPP) is a facility designed for the demonstration of the safe disposal of transuranic waste. Currently, the radiation source term is confined to sealed calibration and check sources since WIPP has not received waste for disposal. For several years the WIPP Dosimetry Group has operated a Harshaw Model 8800C reader to analyze Harshaw 8801-7776 thermoluminescent cards (3 TLD-700 and 1 TLD-600) with 8805 holder. The frequency of false positive results for quarterly dosimeter exchanges is higher than desired by the Dosimetry Group management. Initial observations suggested that exposure to intense ambient sunlight may be responsible for the majority of the false positive readings for element 3. A study was designed to investigate the possibility of light leaking through the holder and inducing a signal in element 3. This paper discusses the methods and results obtained, with special emphasis placed on recommendations to reduce the frequency of light-induced false positive readings
Al-Harthi, Saeed A
2015-12-01
Molecular tools are increasingly accepted as the most sensitive and reliable techniques for malaria diagnosis and epidemiological surveys. Also, collection of finger prick blood spots onto filter papers is the most simple and affordable method for samples preservation and posterior molecular analysis, especially in rural endemic regions where malaria remains a major health problem. Two malaria molecular diagnostic tests, a Plasmodium genus-specific conventional PCR and a Plasmodium species-specific Nested PCR, were evaluated using DNA templates prepared from Whatman-FTA cards' dry blood spots using both, Methanol-fixation/Heat-extraction and FTA commercial purification kit. A total of 121 blood samples were collected from six Saudi south-western endemic districts both, as thick and thin films for routine microscopic screening and onto FTA cards for molecular studies. Out of the 121 samples, 75 were P. falciparum positive by at least one technique. No other species of Plasmodium were detected. P. falciparum parasites were identified in 69/75 (92%) samples by microscopic screening in health care centers. P. genus-specific PCR was able to amplify P. falciparum DNA in 41/75 (55%) and 59/75 (79%) samples using Methanol-fixation/Heat-extraction and FTA purification kit, respectively. P. species-specific Nested PCR revealed 68/75 (91%) and 75/75 (100%) positive samples using DNA templates were isolated by Methanol-fixation/Heat- extraction and FTA purification methods, respectively. The species-specific Nested PCR applied to Whatman-FTA preserved and processed blood samples represents the best alternative to classical microscopy for malaria diagnosis, particularly in epidemiological screening.
Liu, Yun-Xi; Zhao, Zhong-Tang; Cao, Wu-Chun; Xu, Xiao-Qun; Suo, Ji-Jiang; Xing, Yu-Bin; Jia, Ning; Du, Ming-Mei; Liu, Bo-Wei; Yao, Yuan
2013-01-01
The aim of the present study was to evaluate the clinical usefulness of applying RT-nested PCR along with RFLP as a method for diagnosis and genotypic differentiation of Hantavirus in the acute-stage sera of HFRS patients as compared to the ELISA technique. A prospective study of patients with suspected HFRS patients was carried out. Sera were collected for serological evaluation by ELISA and RT-nested PCR testing. Primers were selected from the published sequence of the S segment of HTNV strain 76-118 and SEOV strain SR-11, which made it possible to obtain an amplicon of 403 bp by RT-nested PCR. The genotypic differentiations of the RT-nested PCR amplicons were carried out by RFLP. Sequence analyses of the amplicons were used to confirm the accuracy of the results obtained by RFLP. Of the 48 acute-stage sera from suspected HFRS patients, 35 were ELISA-positive while 41 were positive by RT-nested PCR. With Hind III and Hinf I, RFLP profiles of the RT-nested PCR amplicons of the 41 positive sera exhibited two patterns. 33 had RFLP profiles similar to the reference strain R22, and thus belonged to the SEOV type. The other 8 samples which were collected during October-December had RFLP profiles similar to the reference strain 76-118, and thus belonged to the HTNV type. Sequence phylogenetic analysis of RT-nested PCR amplicons revealed sdp1, sdp2 YXL-2008, and sdp3 as close relatives of HTNV strain 76-118, while sdp22 and sdp37 as close relatives of SEOV strain Z37 and strain R22 located in two separate clusters in the phylogenetic tree. These results were identical to those acquired by RFLP. RT-nested PCR integrated with RFLP was a rapid, simple, accurate method for detecting and differentiating the genotypes of Hantavirus in the acute-stage sera of suspected HFRS patients. In Shandong province, the main genotypes of Hantavirus belonged to the SEOV types, while the HTNV types were observed during the autumn-winter season.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Full Text Available Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Directory of Open Access Journals (Sweden)
SR Naddaf
2011-06-01
Background: The mainstay of diagnosis of relapsing fever (RF is demonstration of the spirochetes in Giemsa-stained thick blood smears, but during non fever periods the bacteria are very scanty and rarely detected in blood smears by microscopy. This study is aimed to evaluate the sensitivity of different methods developed for detection of low-grade spirochetemia. Methods: Animal blood samples with low degrees of spirochetemia were tested with two PCRs and a nested PCR targeting flaB, GlpQ, and rrs genes. Also, a centrifuged-based enrichment method and Giemsa staining were performed on blood samples with various degrees of spirochetemia. Results: The flaB-PCR and nested rrs-PCR turned positive with various degrees of spirochetemia including the blood samples that turned negative with dark-field microscopy. The GlpQ-PCR was positive as far as at least one spirochete was seen in 5-10 microscopic fields. The sensitivity of GlpQ-PCR increased when DNA from Buffy Coat Layer (BCL was used as template. The centrifuged-based enrichment method turned positive with as low concentration as 50 bacteria/ml blood, while Giemsa thick staining detected bacteria with concentrations ≥ 25000 bacteria/ml. Conclusion: Centrifuged-based enrichment method appeared as much as 500-fold more sensitive than thick smears, which makes it even superior to some PCR assays. Due to simplicity and minimal laboratory requirements, this method can be considered a valuable tool for diagnosis of RF in rural health centers.
Beck, Rose C; Kohn, Debra J; Tuohy, Marion J; Prayson, Richard A; Yen-Lieberman, Belinda; Procop, Gary W
2004-03-01
We evaluated 2 methods, a LightCycler PCR assay and pyrosequencing for the detection of the JC polyoma virus (JCV) in fixed brain tissue of 10 patients with and 3 control patients without progressive multifocal leukoencephalopathy (PML). Nucleic acid extraction was performed after deparaffinization and proteinase K digestion. The LightCycler assay differentiates the BK virus (BKV), JCV, and SV40 using melt curve analysis. Conventional PCR was used with the same primers to generate products for pyrosequencing. Two sequencing primers were used that differentiate the polyoma viruses. Seven of 11 biopsies (1 patient had 2 biopsies) with PML were positive for JCV by real-time PCR and/or PCR/pyrosequencing. Three of 4 remaining biopsies were positive by real-time PCR but had melting points between JCV and SV40. The 4 specimens that were negative or atypical by LightCycler PCR were positive by traditional PCR, but 1 had an amplicon of lower molecular weight by gel electrophoresis. These were shown to represent JCV by at least 1 of the 2 pyrosequencing primers. The biopsies from patients without PML were PCR negative. Both the LightCycler and pyrosequencing assays are useful for confirming JCV in brain biopsies from patients with PML, but variant JCVs may require supplementary methods to confirm JCV infection.
Development and validation of a quantitative PCR assay for Ichthyophonus spp.
White, Vanessa C; Morado, J Frank; Crosson, Lisa M; Vadopalas, Brent; Friedman, Carolyn S
2013-04-29
Members of the genus Ichthyophonus are trophically transmitted, cosmopolitan parasites that affect numerous fish species worldwide. A quantitative PCR (qPCR) assay specific for genus Ichthyophonus 18S ribosomal DNA was developed for parasite detection and surveillance. The new assay was tested for precision, repeatability, reproducibility, and both analytical sensitivity and specificity. Diagnostic sensitivity and specificity were estimated using tissue samples from a wild population of walleye pollock Theragra chalcogramma. Ichthyophonus sp. presence in tissue samples was determined by qPCR, conventional PCR (cPCR), and histology. Parasite prevalence estimates varied depending upon the detection method employed and tissue type tested. qPCR identified the greatest number of Ichthyophonus sp.-positive cases when applied to walleye pollock skeletal muscle. The qPCR assay proved sensitive and specific for Ichthyophonus spp. DNA, but like cPCR, is only a proxy for infection. When compared to cPCR, qPCR possesses added benefits of parasite DNA quantification and a 100-fold increase in analytical sensitivity. Because this novel assay is specific for known members of the genus, it is likely appropriate for detecting Ichthyophonus spp. DNA in various hosts from multiple regions. However, species-level identification and isotype variability would require DNA sequencing. In addition to distribution and prevalence applications, this assay could be modified and adapted for use with zooplankton or environmental samples. Such applications could aid in investigating alternate routes of transmission and life history strategies typical to members of the genus Ichthyophonus.
Directory of Open Access Journals (Sweden)
BK Jha
2013-09-01
Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8
Lane, Courtney E; Benton, Michael G
2015-12-01
A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Sudrajat, Dadang; R, Maria Lina; Suhadi, F.
2000-01-01
A polymerase Chain Reaction (PCR) assay for detect presence of enterohemmoragic Eschericha coli O157:H7 was carried out. DNA was extracted from bacterial cells with CTBA-phenol-chloroform and precipitated with isopropanol. To test sensitivity of PCR amplifies reaction, serial dilutions of E. coli DNA solution were prepared bwtween 1 mu g-1 ng/mu l. A single pair oligonucleotide primer SLTI-F and SLTI-R derived from shiga-like-toxin genes was used in amplification method. The results shows that 1 ng/mu l of E. coli DNA could be detected using the primers SLTI-F and SLTI-R with the position of 140 bp DNA fragment
Mathematical analysis of the real time array PCR (RTA PCR) process
Dijksman, Johan Frederik; Pierik, A.
2012-01-01
Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the
Kelly, Patrick J; Stocking, Ruey; Gao, Dongya; Phillips, Nikol; Xu, Chuanling; Kaltenboeck, Bernhard; Wang, Chengming
2011-07-04
Although antibodies to the feline immunodeficiency virus (FIV) have been detected by SNAP assay in cats from St. Kitts, there have been no molecular studies to further confirm the infection and determine the FIV subtypes present. Total nucleic acids were extracted from EDTA whole blood specimens from 35 cats, followed by quantitative fluorescence resonance energy transfer (FRET) PCR under a six-channel LightCycler 2.0 Instrument with Software version 4.1. Four of 11 stray cats (36 %) but none of 24 owned cats were FIV positive by real-time PCR. High-resolution melting curve analysis indicated that all four positive cats were infected with FIV subtype-B. This is the first molecular characterization of FIV subtypes on St. Kitts and the results confirm the high prevalence of FIV infection in stray cats on the island.
Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares
2012-03-23
Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic
A robust internal control for high-precision DNA methylation analyses by droplet digital PCR.
Pharo, Heidi D; Andresen, Kim; Berg, Kaja C G; Lothe, Ragnhild A; Jeanmougin, Marine; Lind, Guro E
2018-01-01
Droplet digital PCR (ddPCR) allows absolute quantification of nucleic acids and has potential for improved non-invasive detection of DNA methylation. For increased precision of the methylation analysis, we aimed to develop a robust internal control for use in methylation-specific ddPCR. Two control design approaches were tested: (a) targeting a genomic region shared across members of a gene family and (b) combining multiple assays targeting different pericentromeric loci on different chromosomes. Through analyses of 34 colorectal cancer cell lines, the performance of the control assay candidates was optimized and evaluated, both individually and in various combinations, using the QX200™ droplet digital PCR platform (Bio-Rad). The best-performing control was tested in combination with assays targeting methylated CDO1 , SEPT9 , and VIM . A 4Plex panel consisting of EPHA3 , KBTBD4 , PLEKHF1 , and SYT10 was identified as the best-performing control. The use of the 4Plex for normalization reduced the variability in methylation values, corrected for differences in template amount, and diminished the effect of chromosomal aberrations. Positive Droplet Calling (PoDCall), an R-based algorithm for standardized threshold determination, was developed, ensuring consistency of the ddPCR results. Implementation of a robust internal control, i.e., the 4Plex, and an algorithm for automated threshold determination, PoDCall, in methylation-specific ddPCR increase the precision of DNA methylation analysis.
Dhiman, Sunil; Goswami, Diganta; Kumar, Dinesh; Rabha, Bipul; Sharma, Dhirendra Kumar; Bhola, Rakesh Kumar; Baruah, Indra; Veer, Vijay
2013-11-01
The present study evaluates the performance of OptiMAL-IT test and nested PCR assay in detection of malaria parasites. A total of 76 randomly selected blood samples collected from two malaria endemic areas were tested for malaria parasites using microscopy and OptiMAL-IT test in the field. PCR assays were performed in the laboratory using DNA extracted from blood spots of the same samples collected on the FTA classic cards. Of the total of 61 field confirmed malaria positive samples, only 58 (95%) were detected positive using microscopy in the laboratory. Sensitivity, specificity, positive predictive value, negative predictive value and false discovery rate of OptiMal-IT in comparison to the microscopy were 93%, 83%, 95%, 79% and 5%, respectively. On the other hand, the sensitivity and specificity of PCR assay were 97% and 100%, respectively, whereas positive predictive value, negative predictive value and false discovery rate were 100%, 90% and 0%, respectively. The overall performance of OptiMal-IT and PCR assays for malaria diagnosis was 76% and 97%, respectively. PCR assay enabled the identification of infection with Plasmodium malariae Laveran, 1881 in four samples misidentified by microscopy and Plasmodium-specific antigen (PAN) identified by the OptiMAL-IT test. In addition to the standard methods, such PCR assay could be useful to obtain the real incidence of each malaria parasite species for epidemiological perspectives.
Directory of Open Access Journals (Sweden)
Sibel Özdaş
2013-06-01
Full Text Available Objective: It is aimed to determine presence of HPV and HPV 16 by Real-Time PCR in cervical smears obtained from patients during colposcopic examination who had referred to outpatient clinic of Gynecology and Obstetrics Department due to various complaints and to examine interrelation between positive test results and clinical data. Method: Sixty patients were included in the study who were referred to outpatient clinic due to vary complaints and who had been decided to undergo to colposcopic examination. DNA was obtained from each smear sample by phenol-chloroform-isoamylalcohol method. L1 region was replicated in amplification process using MY09/MY11 primers. Products for Nested Real time PCR were studied in Ligth Cycler equipment by GP5+/GP6+ primers and Cyanine-5 labeled HPV 16 DNA specific probe. Real time PCR products were undergone melting curve analysis by LigthCycler software version 3.5.3. HPV DNA positivity and HPV 16 positivity were determined at 78-82°C and 68°C, respectively. Results: No statistically significant difference could be detected between HPV positivity, HPV 16 in and types other than HPV 16 control group and patients with positive test result as a consequence of colposcopic examination. Again, no statistically significant difference could be detected between HPV positivity and status of parity, result of PAP test, marital status and age of patient. Conclusion: No statistically significant difference could be detected between HPV positivity, HPV 16 in and types other than HPV 16 control group and patients with positive test result as a consequence of colposcopic examination. Again, no statistically difference could be detected between HPV positivity and result of PAP smear test, marital status, age of patient and smoking but statistically significant difference could be detected between types other than HPV 16 and status of parity (respectively; χ2=0.821, p=0.365; χ2=0.752, p=0.564; χ2=0.364, p=0.834; χ2= 6.835, p
Böttcher, S; Ritgen, M; Pott, C; Brüggemann, M; Raff, T; Stilgenbauer, S; Döhner, H; Dreger, P; Kneba, M
2004-10-01
The clinically most suitable method for minimal residual disease (MRD) detection in chronic lymphocytic leukemia is still controversial. We prospectively compared MRD assessment in 158 blood samples of 74 patients with CLL after stem cell transplantation (SCT) using four-color flow cytometry (MRD flow) in parallel with consensus IgH-PCR and ASO IgH real-time PCR (ASO IgH RQ-PCR). In 25 out of 106 samples (23.6%) with a polyclonal consensus IgH-PCR pattern, MRD flow still detected CLL cells, proving higher sensitivity of flow cytometry over PCR-genescanning with consensus IgH-primers. Of 92 samples, 14 (15.2%) analyzed in parallel by MRD flow and by ASO IgH RQ-PCR were negative by our flow cytometric assay but positive by PCR, thus demonstrating superior sensitivity of RQ-PCR with ASO primers. Quantitative MRD levels measured by both methods correlated well (r=0.93). MRD detection by flow and ASO IgH RQ-PCR were equally suitable to monitor MRD kinetics after allogeneic SCT, but the PCR method detected impending relapses after autologous SCT earlier. An analysis of factors that influence sensitivity and specificity of flow cytometry for MRD detection allowed to devise further improvements of this technique.
Lobanov, Vladislav A; Peckle, Maristela; Massard, Carlos L; Brad Scandrett, W; Gajadhar, Alvin A
2018-03-02
Equine piroplasmosis (EP) is an economically significant infection of horses and other equine species caused by the tick-borne protozoa Theileria equi and Babesia caballi. The long-term carrier state in infected animals makes importation of such subclinical cases a major risk factor for the introduction of EP into non-enzootic areas. Regulatory testing for EP relies on screening of equines by serological methods. The definitive diagnosis of EP infection in individual animals will benefit from the availability of sensitive direct detection methods, for example, when used as confirmatory assays for non-negative serological test results. The objectives of this study were to develop a real-time quantitative polymerase chain reaction (qPCR) assay for simultaneous detection of both agents of EP, perform comprehensive evaluation of its performance and assess the assay's utility for regulatory testing. We developed a duplex qPCR targeting the ema-1 gene of T. equi and the 18S rRNA gene of B. caballi and demonstrated that the assay has high analytical sensitivities for both piroplasm species. Validation of the duplex qPCR on samples from 362 competitive enzyme-linked immunosorbent assay (cELISA)-negative horses from Canada and the United States yielded no false-positive reactions. The assay's performance was further evaluated using samples collected from 430 horses of unknown EP status from a highly endemic area in Brazil. This set of samples was also tested by a single-target 18S rRNA qPCR for T. equi developed at the OIE reference laboratory for EP in Japan, and a previously published single-target 18S rRNA qPCR for B. caballi whose oligonucleotides we adopted for use in the duplex qPCR. Matching serum samples were tested for antibodies to these parasites using cELISA. By the duplex qPCR, T. equi-specific 18S rRNA qPCR and cELISA, infections with T. equi were detected in 87.9% (95% confidence interval, CI: 84.5-90.7%), 90.5% (95% CI: 87.3-92.3%) and 87.4% (95% CI: 84
Directory of Open Access Journals (Sweden)
Mojtaba Tahmoorespur
2016-04-01
Full Text Available Introduction Butyrivibrio fibrisolvens strains are presently recognized as the major butyrate-producing bacteria found in the rumen and digestive track of many animals and also in the human gut. In this study we reported the development of two DNA based techniques, quantitative competitive (QC PCR and absolute based Real-Time PCR, for enumerating Butyrivibrio fibrisolvens strains. Despite the recent introduction of real-time PCR method for the rapid quantification of the target DNA sequences, use of quantitative competitive PCR (QC-PCR technique continues to play an important role in nucleic acid quantification since it is more cost effective. The procedure relies on the co-amplification of the sequence of interest with a serially diluted synthetic DNA fragment of the known concentration (competitor, using the single set primers. A real-time polymerase chain reaction is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR. It monitors the amplification of a targeted DNA molecule during the PCR. Materials and Methods At first reported species-specific primers targeting the 16S rDNA region of the bacterium Butyrivibrio fibrisolvens were used for amplifying a 213 bp fragment. A DNA competitor differing by 50 bp in length from the 213 bp fragment was constructed and cloned into pTZ57R/T vector. The competitor was quantified by NanoDrop spectrophotometer and serially diluted and co-amplified by PCR with total extracted DNA from rumen fluid samples. PCR products were quantified by photographing agarose gels and analyzed with Image J software and the amount of amplified target DNA was log plotted against the amount of amplified competitor. Coefficient of determination (R2 was used as a criterion of methodology precision. For developing the Real-time PCR technique, the 213 bp fragment was amplified and cloned into pTZ57R/T was used to draw a standard curve. Results and Discussion The specific primers of Butyrivibrio
Development and evaluation of a nested-PCR assay for Senecavirus A diagnosis.
Feronato, Cesar; Leme, Raquel A; Diniz, Jaqueline A; Agnol, Alais Maria Dall; Alfieri, Alice F; Alfieri, Amauri A
2018-02-01
Senecavirus A (SVA) has been associated with vesicular disease in weaned and adult pigs and with high mortality of newborn piglets. This study aimed to establish a nested-PCR assay for the routine diagnosis of SVA infection. Tissue samples (n = 177) were collected from 37 piglets of 18 pig farms located in four different Brazilian states. For the nested-PCR, a primer set was defined to amplify an internal VP1 fragment of 316 bp of SVA genome. Of the 37 piglets, 15 (40.5%) and 23 (62.2%) were positive for the SVA in the RT-PCR and nested-PCR assays, respectively. The SVA RNA was detected in 61/177 (34.5%) samples with the RT-PCR, while the nested-PCR assay showed 84/177 (47.5%) samples with the virus (p PCR and nested-PCR assays, respectively. Nucleotide sequencing analysis revealed similarities of 98.7-100% among SVA Brazilian strains and of 86.6-98% with SVA strains from other countries. The nested-PCR assay in this study was suitable to recover the SVA RNA in biological specimens, piglets, and/or herds that were considered as negative in the RT-PCR assay, and is proposed for the routine investigation of the SVA infection in piglets, especially when other techniques are not available or when a great number of samples has to be examined.
Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan
2017-06-01
Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.
Energy Technology Data Exchange (ETDEWEB)
Ferreira, Sidney de Almeida; Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)]. E-mail: vidasnino@yahoo.com.br; antero@cdtn.br; Ituassu, Leonardo Trindade; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)]. E-mail: melo@mono.icb.ufmg.br; ltituassu@yahoo.com.br
2007-07-01
The dogs are the main reservoir of the visceral leishmaniasis etiological agent Leishmania chagasi and these animals have to be systematically monitored. The aim of present work was to standardize a method for canine leishmaniasis diagnosis using DNA samples obtained by a noninvasive ways. Two kind of samples were compared: conjunctival swab and blood. The samples were analyzed by the Polymerase Chain Reaction (PCR) associated with the hybridization of {sup 32}P labeled DNA probes. An in vitro test was carried out using cotton swabs seeded with L. chagasi parasites at different cell numbers. After that, the PCR and hybridization sensitivity was evaluated in two groups of 23 seropositive dogs. Conjunctival swabs and 1,0 mL of blood were collected from each animal. 90 {mu}L of these blood were spotted onto filter paper and the remaining used to prepare the buffy coat. The DNA purification from cotton swabs was carried out through the phenol-chloroform (group 1) or boiling (group 2). The Wizard kit was used to DNA extraction from buffy coat. The filters were treated according to Dialab protocol. The analysis of the seeded samples showed that the PCR was able to identify until ten parasites while the following hybridization of the PCR products allows the detection of until one parasite. The PCR positivity for the conjunctival swabs were 73.9% and 52.2% respectively to the groups 1 and 2. For buffy coat the positivities were 43.5% and 56.5% respectively. The filters presented the lowest positivity. The hybridization step was not accomplished yet for these samples. (author)
Li, Dan; Tong, Tiezheng; Zeng, Siyu; Lin, Yiwen; Wu, Shuxu; He, Miao
2014-02-01
The detection of viable bacteria in wastewater treatment plants (WWTPs) is very important for public health, as WWTPs are a medium with a high potential for waterborne disease transmission. The aim of this study was to use propidium monoazide (PMA) combined with the quantitative polymerase chain reaction (PMA-qPCR) to selectively detect and quantify viable bacteria cells in full-scale WWTPs in China. PMA was added to the concentrated WWTP samples at a final concentration of 100 micromol/L and the samples were incubated in the dark for 5 min, and then lighted for 4 min prior to DNA extraction and qPCR with specific primers for Escherichia coli and Enterococci, respectively. The results showed that PMA treatment removed more than 99% of DNA from non-viable cells in all the WWTP samples, while matrices in sludge samples markedly reduced the effectiveness of PMA treatment. Compared to qPCR, PMA-qPCR results were similar and highly linearly correlated to those obtained by culture assay, indicating that DNA from non-viable cells present in WWTP samples can be eliminated by PMA treatment, and that PMA-qPCR is a reliable method for detection of viable bacteria in environmental samples. This study demonstrated that PMA-qPCR is a rapid and selective detection method for viable bacteria in WWTP samples, and that WWTPs have an obvious function in removing both viable and non-viable bacteria. The results proved that PMA-qPCR is a promising detection method that has a high potential for application as a complementary method to the standard culture-based method in the future.
Bernal-Martínez, Leticia; Gago, Sara; Buitrago, María J; Gomez-Lopez, Alicia; Rodríguez-Tudela, Juan L; Cuenca-Estrella, Manuel
2011-10-01
The performance of a real-time PCR-based assay was retrospectively analyzed (according to European Organization for Research and Treatment of Cancer/Mycosis Study Group criteria) in the samples of patients with invasive aspergillosis. A total of 711 serial samples (356 whole-blood and 355 serum samples) from 38 adult patients were analyzed. The Aspergillus fumigatus PCR assay results were positive for 89 of 356 (25%) whole-blood samples and 90 of 355 (25.35%) serum samples. Positive PCR results were seen in 29 of 31 (93.5%) patients for which serum was analyzed and in 31 of 33 (93.9%) cases with whole-blood specimens. Both blood and serum samples were available in 26 cases, and significant differences were not observed in this subgroup of cases. The average number of threshold cycles (C(T)) for positive blood samples was 37.6, and the average C(T) for serum was 37.4. The DNA concentration ranged between 2 and 50 fg per μl of sample, with average DNA concentrations of 10.2 and 11.7 fg in positive blood and serum samples, respectively (P > 0.01). The performance of this PCR-based quantitative assay was similar for both serum and blood samples. We recommend serum samples as the most convenient hematological sample to use for Aspergillus DNA quantification when serial determinations are done.
RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza
DEFF Research Database (Denmark)
Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen
2003-01-01
A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....
Development and application of a real-time quantitative PCR assay ...
African Journals Online (AJOL)
PRECIOUS
2009-12-01
Dec 1, 2009 ... and a gel band purification kit (GE Health Care, UK), the PCR products obtained were ... amino acid sequences from various species, sequence alignment ..... sequence weighting, positions-specific gap penalties and weight.
Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R
2018-04-10
Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.
Detection of Pneumocystis jirovecii by nested PCR in HIV-negative patients with pulmonary disease.
Santos, Cristina Rodrigues; de Assis, Ângela M; Luz, Edson A; Lyra, Luzia; Toro, Ivan F; Seabra, José Claudio C; Daldin, Dira H; Marcalto, Tathiane U; Galasso, Marcos T; Macedo, Ronaldo F; Schreiber, Angélica Z; Aoki, Francisco H
Nested PCR can be used to determine the status of Pneumocystis jirovecii infection in other lung diseases. This study sought to detect a target DNA fragment (mitochondrial large subunit rRNA or mtL SUrRNA) of P. jirovecii in patients with lung disease who underwent bronchoscopy with collection of bronchoalveolar lavage (BAL). The results from toluidine blue staining were compared with those obtained using molecular methods that included an "in house" DNA extraction procedure, PCR and nested PCR. Fifty-five BAL samples from patients with atypical chest X-rays were screened for P. jirovecii. None of the samples was positive for P. jirovecii using toluidine blue staining. In contrast, P. jirovecii DNA was detected by nested PCR in BAL samples from 36 of 55 patients (65.5%). The lung diseases in the patients included cancer, pneumonia, tuberculosis, and chronic obstructive pulmonary disease (COPD). Other chronic problems in the patients included hypertension, diabetes, smoking, and alcoholism. Nested PCR showed high sensitivity for detecting P. jirovecii, especially when compared with toluidine blue staining. Using this method, P. jirovecii infection was detected in HIV-negative patients with lung disease. Copyright © 2016 Asociación Española de Micología. Publicado por Elsevier España, S.L.U. All rights reserved.
Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin
2015-01-01
To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (pnested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.
Assessment of the real-time PCR and different digital PCR platforms for DNA quantification.
Pavšič, Jernej; Žel, Jana; Milavec, Mojca
2016-01-01
Digital PCR (dPCR) is beginning to supersede real-time PCR (qPCR) for quantification of nucleic acids in many different applications. Several analytical properties of the two most commonly used dPCR platforms, namely the QX100 system (Bio-Rad) and the 12.765 array of the Biomark system (Fluidigm), have already been evaluated and compared with those of qPCR. However, to the best of our knowledge, direct comparison between the three of these platforms using the same DNA material has not been done, and the 37 K array on the Biomark system has also not been evaluated in terms of linearity, analytical sensitivity and limit of quantification. Here, a first assessment of qPCR, the QX100 system and both arrays of the Biomark system was performed with plasmid and genomic DNA from human cytomegalovirus. With use of PCR components that alter the efficiency of qPCR, each dPCR platform demonstrated consistent copy-number estimations, which indicates the high resilience of dPCR. Two approaches, one considering the total reaction volume and the other considering the effective reaction size, were used to assess linearity, analytical sensitivity and variability. When the total reaction volume was considered, the best performance was observed with qPCR, followed by the QX100 system and the Biomark system. In contrast, when the effective reaction size was considered, all three platforms showed almost equal limits of detection and variability. Although dPCR might not always be more appropriate than qPCR for quantification of low copy numbers, dPCR is a suitable method for robust and reproducible quantification of viral DNA, and a promising technology for the higher-order reference measurement method.
Some factors determining the PCr recovery overshoot in skeletal muscle.
Korzeniewski, Bernard; Zoladz, Jerzy A
2005-07-01
It has been proposed recently that the phosphocreatine (PCr) overshoot (increase above the resting level) during muscle recovery after exercise is caused by a slow decay during this recovery of the direct activation of oxidative phosphorylation taking place during muscle work. In the present article the factors determining the appearance and size of the PCr overshoot are studied using the computer model of oxidative phosphorylation in intact skeletal muscle developed previously. It is demonstrated that the appearance and duration of this overshoot is positively correlated with the value of the characteristic decay time of the direct activation of oxidative phosphorylation. It is also shown that the size of PCr overshoot is increased by low resting PCr/Cr ratio (what is confirmed by our unpublished experimental data), by high intensity of the direct activation of oxidative phosphorylation, by high muscle work intensity and by low rate of the return of cytosolic pH to the resting value during muscle recovery.
PCR detection of Helicobacter pylori in string-absorbed gastric juice.
Domínguez-Bello, M G; Cienfuentes, C; Romero, R; García, P; Gómez, I; Mago, V; Reyes, N; Gueneau de Novoa, P
2001-04-20
Molecular methods for detection of Helicobacter pylori infection have been shown to be highly sensitive in gastric biopsies and cultures. The objective of this work was to compare PCR detection of H. pylori DNA in string-absorbed gastric juice and in gastric biopsies. The study was performed in 47 dyspeptic adult patients undergoing endoscopy, and infection was detected by amplification of a segment of H. pylori ureA gene. Of the 29 patients positive in biopsy analysis, 23 (79%) were also positive in the gastric string. PCR analysis of gastric strings is a sensitive and safe procedure to detect H. pylori when endoscopy is not indicated, and may be of great clinical and epidemiological usefulness in determining effectiveness of eradication therapies, typing virulence genes and detecting antibiotic resistance mutations.
Virology: The Next Generation from Digital PCR to Single Virion Genomics
Energy Technology Data Exchange (ETDEWEB)
White, Richard A.; Brazelton De Cardenas, Jessica N.; Hayden, Randall T.
2015-10-01
In the past 25 years, virology has had major technology breakthroughs stemming first from the introduction of nucleic acid amplification testing, but more recently from the use of next-generation sequencing, digital PCR, and the possibility of single virion genomics. These technologies have and will improve diagnosis and disease state monitoring in clinical settings, aid in environmental monitoring, and reveal the vast genetic potential of viruses. Using the principle of limiting dilution, digital PCR amplifies single molecules of DNA in highly partitioned endpoint reactions and reads each of those reactions as either positive or negative based on the presence or absence of target fluorophore. In this review, digital PCR will be highlighted along with current studies, advantages/disadvantages, and future perspectives with regard to digital PCR, viral load testing, and the possibility of single virion genomics.
Malm, Magdalena; Kronqvist, Nina; Lindberg, Hanna; Gudmundsdotter, Lindvi; Bass, Tarek; Frejd, Fredrik Y; Höidén-Guthenberg, Ingmarie; Varasteh, Zohreh; Orlova, Anna; Tolmachev, Vladimir; Ståhl, Stefan; Löfblom, John
2013-01-01
The HER3 receptor is implicated in the progression of various cancers as well as in resistance to several currently used drugs, and is hence a potential target for development of new therapies. We have previously generated Affibody molecules that inhibit heregulin-induced signaling of the HER3 pathways. The aim of this study was to improve the affinity of the binders to hopefully increase receptor inhibition efficacy and enable a high receptor-mediated uptake in tumors. We explored a novel strategy for affinity maturation of Affibody molecules that is based on alanine scanning followed by design of library diversification to mimic the result from an error-prone PCR reaction, but with full control over mutated positions and thus less biases. Using bacterial surface display and flow-cytometric sorting of the maturation library, the affinity for HER3 was improved more than 30-fold down to 21 pM. The affinity is among the higher that has been reported for Affibody molecules and we believe that the maturation strategy should be generally applicable for improvement of affinity proteins. The new binders also demonstrated an improved thermal stability as well as complete refolding after denaturation. Moreover, inhibition of ligand-induced proliferation of HER3-positive breast cancer cells was improved more than two orders of magnitude compared to the previously best-performing clone. Radiolabeled Affibody molecules showed specific targeting of a number of HER3-positive cell lines in vitro as well as targeting of HER3 in in vivo mouse models and represent promising candidates for future development of targeted therapies and diagnostics.
Detection of bacterial species involved in perimplantitis concerned with cultural and RT-PCR
Directory of Open Access Journals (Sweden)
Marcello Gatti
2010-06-01
Full Text Available Dental implants offer new treatment options for edentulous either partially or completely, now represent a viable alternative to conventional fixed protheses. Dental implants are colonized by a flora dominated by Gram-positive facultative aerobic, while in patients with bone loss and formation of pockets peri-implant diseases was found a significant difference in the composition of microflora, bacteria, Gram-negative anaerobes in particular Fusobacterium spp., Treponema denticola (Spirochetes, Tannerella forsythensis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia as interim black-pigmented bacteria, Porphyromonas gingivalis, often in high concentrations. Aims. The purpose of this study was to identify those at risk of perimplantitis using 2 techniques: RT-PCR examination of trade and culture. The results were compared taking into consideration the advantages and disadvantages of both methods. Materials and methods.We studied 24 patients (14 women and 10 men, aged, women between 43 and 76 years, with an average of 63.8 + / - 10.9 years, men between 45 and 88 years with a average of 64.3 years + / - 12.5 years. Was performed a double levy of sub-gingival plaque at multiple sites that had an implant CAL (clinical attachment level> 4mm in order to assess the microbiological identification with the two techniques: Examining culture and Real-Time PCR of Commerce ( Gum-Sunstar that identifies 4 bacterial species: A. actinomycetemcomitans (A.a., P.gingivalis (P.g., T.forsythensis (T.f., and T.denticola (T.d.. Results. All patients studied were positive to both tests with charger high: the consideration of tenure, with CFU / ml > 105, was positive in 66.6% of samples by:T.f., and P.g., in 12.5% for A.a., while T.d. not been sought by examining culture, the RT-PCR was positive, with high loads, in 95.8% of samples for T.f., in 79.1% for P.g., in 12.5% for A.a. and 20.8% for T.d.The test crop showed the presence of even P.intermedia in 91
Scollo, Francesco; Egea, Leticia A; Gentile, Alessandra; La Malfa, Stefano; Dorado, Gabriel; Hernandez, Pilar
2016-12-15
Olive oil is considered a premium product for its nutritional value and health benefits, and the ability to define its origin and varietal composition is a key step towards ensuring the traceability of the product. However, isolating the DNA from such a matrix is a difficult task. In this study, the quality and quantity of olive oil DNA, isolated using four different DNA isolation protocols, was evaluated using the qRT-PCR and ddPCR techniques. The results indicate that CTAB-based extraction methods were the best for unfiltered oil, while Nucleo Spin-based extraction protocols showed greater overall reproducibility. The use of both qRT-PCR and ddPCR led to the absolute quantification of the DNA copy number. The results clearly demonstrate the importance of the choice of DNA-isolation protocol, which should take into consideration the qualitative aspects of DNA and the evaluation of the amplified DNA copy number. Copyright © 2016 Elsevier Ltd. All rights reserved.
Detection of 12 respiratory viruses by duplex real time PCR assays in respiratory samples.
Arvia, Rosaria; Corcioli, Fabiana; Ciccone, Nunziata; Della Malva, Nunzia; Azzi, Alberta
2015-12-01
Different viruses can be responsible for similar clinical manifestations of respiratory infections. Thus, the etiological diagnosis of respiratory viral diseases requires the detection of a large number of viruses. In this study, 6 duplex real-time PCR assays, using EvaGreen intercalating dye, were developed to detect 12 major viruses responsible for respiratory diseases: influenza A and B viruses, enteroviruses (including enterovirus spp, and rhinovirus spp), respiratory syncytial virus, human metapneumovirus, coronaviruses group I (of which CoV 229E and CoV NL63 are part) and II (including CoV OC43 and CoV HKU1), parainfluenza viruses type 1, 2, 3 and 4, human adenoviruses and human bocaviruses. The 2 target viruses of each duplex reaction were distinguishable by the melting temperatures of their amplicons. The 6 duplex real time PCR assays were applied for diagnostic purpose on 202 respiratory samples from 157 patients. One hundred fifty-seven samples were throat swabs and 45 were bronchoalveolar lavages. The results of the duplex PCR assays were confirmed by comparison with a commercial, validated, assay; in addition, the positive results were confirmed by sequencing. The analytical sensitivity of the duplex PCR assays varied from 10(3) copies/ml to 10(4) copies/ml. For parainfluenza virus 2 only it was 10(5) copies/ml. Seventy clinical samples (35%) from 55 patients (30 children and 25 adults) were positive for 1 or more viruses. In adult patients, influenza A virus was the most frequently detected respiratory virus followed by rhinoviruses. In contrast, respiratory syncytial virus was the most common virus in children, followed by enteroviruses, influenza A virus and coronavirus NL63. The small number of samples/patients does not allow us to draw any epidemiological conclusion. Altogether, the results of this study indicate that the 6 duplex PCR assays described in this study are sensitive, specific and cost-effective. Thus, this assay could be
Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita
2017-06-01
Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Abildgaard, Lotte; Ommen, Hans Beier; Lausen, Birgitte Frederiksen
2013-01-01
OBJECTIVES: Patients with acute myeloid leukaemia (AML) of the monocytic lineage often lack molecular markers for minimal residual disease (MRD) monitoring. The MLL-MLLT3 fusion transcript found in patients with AML harbouring t(9;11) is amenable to RT-qPCR quantification but because...... of the heterogeneity of translocation break points, the MLL-MLLT3 fusion gene is a challenging target. We hypothesised that MRD monitoring using MLL-MLLT3 as a RT-qPCR marker is feasible in the majority of patients with t(9;11)-positive AML. METHODS: Using a locked nucleic acid probe, we developed a sensitive RT......-qPCR assay for quantification of the most common break point region of the MLL-MLLT3 fusion gene. Five paediatric patients with t(9;11)-positive AML were monitored using the MLL-MLLT3 assay. RESULTS: A total of 43 bone marrow (BM) and 52 Peripheral blood (PB) samples were collected from diagnosis until...
International Nuclear Information System (INIS)
Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Li Yanping; Yang Hong; Cui Yufang
2000-01-01
Objective: To study the significance of endogenous interleukin 3(IL-3) gene expression in repair of irradiated mouse bone marrow. Methods: Seventy-eight LACA mice were subjected to total body irradiation with 60 Co γ-rays and were sacrificed within 4 weeks after irradiation. The bone marrow histopathological sections were stained with HE, and the expression of endogenous IL-3 gene was detected by means of immunocytochemistry,in situ hybridization(ISH) and in situ reverse transcription PCR(IS RT-PCR). Results: Obvious injury of bone marrow occurred after irradiation and then recovered within 4 weeks. IL-3 protein was obviously increased in the cytoplasm of recovering hematopoietic cells(HCs), especially on day 21 after irradiation, while its mRNA was poorly positive by ISH on days 10-21, especially day 15.IS RT-PCR showed that IL-3 mRNA was strongly positive in recovering HCs cytoplasm, especially on days 10 to 15. Conclusion: In situ RT-PCR can objectively reflect the regulation of IL-3 gene expression in bone marrow after irradiation, and the expression of endogenous IL-3 gene may play an important role in hematopoietic reconstruction of irradiated bone marrow
Directory of Open Access Journals (Sweden)
Amir Aliramezani
2012-01-01
Full Text Available Background and Aims: Periodontitis is one of the most common oral diseases with the various incidence rates in different populations. A number of bacteria are considered as the major etiologic agents of periodontitis. The aim of the present study was to determine the prevalence of periodontopathogen bacteria in patients using both PCR and culture techniques.Materials and Methods: In this study, one-hundred patients (including 62 females and 38 males with an average age of 49±11.5 years with adult periodontitis referred to periodontics department of School of Dentistry/Tehran University of Medical Sciences were investigated. The samples were taken and sent immediately to the laboratory for culture and molecular evaluation. The PCR was performed using specific primers and the statistical analysis of data was performed using SPSS statistic software and McNemar test.Results: The results demonstrated that the total detection rate in culture method was 64%. The rate of Aggregatibacter actinomycetemcomitans (Aa was 28% which was significantly higher than that of Porphyromonas gingivalis (Pg (6% and Prevotella intermedia (Pi (3%. 27% of cases showed mixed bacterial growth. 65% of patients were positive using molecular method. The rate of Aa (30% was significantly higher than that of Pg (7% and Pi (5%. The mixed PCR positive rate containing of Aa, Pg and Pi was (23%.Conclusion: In this study, it was found that most of the bacteria isolated using culture and molecular methods were Aa, Pg and Pi, respectively. Although the detection frequencies of both techniques were similar, the specificity, sensitivity and bacterial detection speed of the PCR technique is obviously higher. Therefore, the use of molecular techniques is strongly recommended. However, both techniques seem to be suitable for microbiological diagnostics.
Collins, S; Jorgensen, F; Willis, C; Walker, J
2015-10-01
Culture remains the gold-standard for the enumeration of environmental Legionella. However, it has several drawbacks including long incubation and poor sensitivity, causing delays in response times to outbreaks of Legionnaires' disease. This study aimed to validate real-time PCR assays to quantify Legionella species (ssrA gene), Legionella pneumophila (mip gene) and Leg. pneumophila serogroup-1 (wzm gene) to support culture-based detection in a frontline public health laboratory. Each qPCR assay had 100% specificity, excellent sensitivity (5 GU/reaction) and reproducibility. Comparison of the assays to culture-based enumeration of Legionella from 200 environmental samples showed that they had a negative predictive value of 100%. Thirty eight samples were positive for Legionella species by culture and qPCR. One hundred samples were negative by both methods, whereas 62 samples were negative by culture but positive by qPCR. The average log10 increase between culture and qPCR for Legionella spp. and Leg. pneumophila was 0·72 (P = 0·0002) and 0·51 (P = 0·006), respectively. The qPCR assays can be conducted on the same 1 l water sample as culture thus can be used as a supplementary technique to screen out negative samples and allow more rapid indication of positive samples. The assay could prove informative in public health investigations to identify or rule out sources of Legionella as well as to specifically identify Leg. pneumophila serogroup 1 in a timely manner not possible with culture. © 2015 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Baraa Abdalaziz Ahmed
2016-09-01
Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277
Khosravi, Azar D; Alami, Ameneh; Meghdadi, Hossein; Hosseini, Atta A
2017-01-01
Definitive and rapid diagnosis of extrapulmonary tuberculosis (EPTB) is challenging since conventional techniques have limitations due to the paucibacillary nature of the disease. To increase the sensitivity of detection of Mycobacterium tuberculosis (MTB) in EPTB specimens, we performed a nested PCR assay targeting several genes of MTB on EPTB specimens. A total of 100 clinical specimens from suspected cases of EPTB were processed. Standard staining for acid fast bacilli (AFB) was performed as the preliminary screening test. Extracted DNAs from specimens were subjected to Nested PCR technique for the detection of five different MTB target genes of IS6110, IS1081, hsp65kd, mbp64 , and mtp40 . On performing AFB staining, only 13% of specimens were positive, of which ascites fluid (33.3%), followed by pleural effusion (30.8%) showed the greatest AFB positivity rate. We demonstrated slight improvement in yields in lymph node which comprised the majority of specimens in this study, by employing PCR targeted to IS6110 - and hsp65-genes in comparison to AFB staining. However, the yields in ascites fluid and pleural effusion were not substantially improved by PCR, but those from bone and wound were, as in nested PCR employing either gene, the same positivity rate were obtained for ascites fluid (33.3%), while for pleural effusion specimens only IS1081 based PCR showed identical positivity rate with AFB stain (30.8%). The results for bone and wound specimens, however, demonstrated an improved yield mainly by employing IS1081 gene. Here, we report higher detection rate of EPTB in clinical specimens using five different targeted MTB genes. This nested PCR approach facilitates the comparison and the selection of the most frequently detected genes. Of course this study demonstrated the priority of IS1081 followed by mtp40 and IS6110 , among the five tested genes and indicates the effectiveness of any of the three genes in the design of an efficient nested-PCR test that
Directory of Open Access Journals (Sweden)
Benu Dhawan
2014-01-01
Full Text Available Background & objectives: Little is known about the prevalence of Chlamydia trachomatis infection in Indian women with infertility. To improve the diagnosis of C. trachomatis infection in developing countries, there is an urgent need to establish cost-effective molecular test with high sensitivity and specificity. This study was conducted to determine the diagnostic utility of a real time-PCR assay for detention of C. trachomatis infection in infertile women attending an infertility clinic in north India. The in house real time-PCR assay was also compared with a commercial real-time PCR based detection system. Methods: Endocervical swabs, collected from 200 infertile women were tested for C. trachomatis by three different PCR assays viz. in-house real time-PCR targeting the cryptic plasmid using published primers, along with omp1 gene and cryptic plasmid based conventional PCR assays. Specimens were also subjected to direct fluorescence assay (DFA and enzyme immunoassay (EIA Performance of in-house real time-PCR was compared with that of COBAS Taqman C. trachomatis Test, version 2.0 on all in-house real time-PCR positive sample and 30 consecutive negative samples. Results: C. trachomatis infection was found in 13.5 per cent (27/200 infertile women by in-house real time-PCR, 11.5 per cent (23/200 by cryptic plasmid and/or omp1 gene based conventional PCR, 9 per cent (18/200 by DFA and 6.5 per cent (7/200 by EIA. The in-house real time-PCR exhibited a sensitivity and specificity of 100 per cent, considering COBAS Taqman CT Test as the gold standard. The negative and positive predictive values of the in-house real time-PCR were 100 per cent. The in-house real time-PCR could detect as low as 10 copies of C. trachomatis DNA per reaction. Interpretation & conclusions: In-house real time-PCR targeting the cryptic plasmid of C. trachomatis exhibited an excellent sensitivity and specificity similar to that of COBAS Taqman CT Test, v2.0 for detection of C
Fallahi, Shirzad; Seyyed Tabaei, Seyyed Javad; Pournia, Yadollah; Zebardast, Nozhat; Kazemi, Bahram
2014-07-01
Toxoplasmosis diagnosis constitutes an important measure for disease prevention and control. In this paper, a newly described DNA amplification technique, loop-mediated isothermal amplification (LAMP), and nested-PCR targeting the repeated element (RE) and B1 gene, were compared to each other for the detection of Toxoplasma gondii DNA in blood samples of children with leukaemia. One hundred ten blood samples from these patients were analyzed by LAMP and nested-PCR. Out of 50 seropositive samples (IgM+, IgG+), positive results were obtained with 92% and 86% on RE, B1-LAMP and 82% and 68% on RE, B1-nested PCR analyses, respectively. Of the 50 seronegative samples, three, two and one samples were detected positive by RE-LAMP, B1-LAMP and RE-nested PCR assays, respectively, while none were detected positive by B1-nested PCR. None of the 10 IgM-, IgG+ samples was detected positive after testing LAMP and nested-PCR assays in duplicate. This is the first report of a study in which the LAMP method was applied with high sensitivity and efficacy for the diagnosis of T. gonii in blood samples of children with leukaemia. Copyright © 2014 Elsevier Inc. All rights reserved.
Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella
2009-01-01
Background One of the major sources of human Salmonella infections is meat. Therefore, efficient and rapid monitoring of Salmonella in the meat production chain is necessary. Validation of alternative methods is needed to prove that the performance is equal to established methods. Very few of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non-commercial real-time PCR method for detection of Salmonella in meat and carcass swabs. Results The comparative trial was performed against a reference method (NMKL-71:5, 1999) using artificially and naturally contaminated samples (60 minced veal and pork meat samples, 60 poultry neck-skins, and 120 pig carcass swabs). The relative accuracy was 99%, relative detection level 100%, relative sensitivity 103% and relative specificity 100%. The collaborative trial included six laboratories testing minced meat, poultry neck-skins, and carcass swabs as un-inoculated samples and samples artificially contaminated with 1–10 CFU/25 g, and 10–100 CFU/25 g. Valid results were obtained from five of the laboratories and used for the statistical analysis. Apart from one of the non-inoculated samples being false positive with PCR for one of the laboratories, no false positive or false negative results were reported. Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion The real-time PCR method for detection of Salmonella in meat
Sanz, Juan Carlos; Ríos, Esther; Rodríguez-Avial, Iciar; Ramos, Belén; Marín, Mercedes; Cercenado, Emilia
2017-08-14
The aim was to evaluate the utility of a multiplex real-time PCR to detect Streptococcus pneumoniae lytA, plyA and psaA genes in pleural fluid (PF). A collection of 81 PF samples was used. Sixty were considered positive for S. pneumoniae according to previous results (54 by an in-house lytA gene PCR and eight by universal rRNA PCR). The sensitivity for detection of the lytA, plyA and psaA genes by multiplex PCR was 100% (60/60), 98.3% (59/60) and 91.7% (55/60), respectively. The detection of all three genes was negative in 21 samples formerly confirmed as negative for S. pneumoniae (100% specificity) by the other procedures (9 by in-house lytA PCR and 12 by rRNA PCR). The use of this multiplex PCR may be a useful option to identify S. pneumoniae directly in PF samples. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.
Gayet-Ageron, Angèle; Lautenschlager, Stephan; Ninet, Béatrice; Perneger, Thomas V; Combescure, Christophe
2013-05-01
To systematically review and estimate pooled sensitivity and specificity of the polymerase chain reaction (PCR) technique compared to recommended reference tests in the diagnosis of suspected syphilis at various stages and in various biological materials. Systematic review and meta-analysis. Search of three electronic bibliographic databases from January 1990 to January 2012 and the abstract books of five congresses specialized in the infectious diseases' field (1999-2011). Search key terms included syphilis, Treponema pallidum or neurosyphilis and molecular amplification, polymerase chain reaction or PCR. We included studies that used both reference tests to diagnose syphilis plus PCR and we presented pooled estimates of PCR sensitivity, specificity, and positive and negative likelihood ratios (LR) per syphilis stages and biological materials. Of 1160 identified abstracts, 69 were selected and 46 studies used adequate reference tests to diagnose syphilis. Sensitivity was highest in the swabs from primary genital or anal chancres (78.4%; 95% CI: 68.2-86.0) and in blood from neonates with congenital syphilis (83.0%; 55.0-95.2). Most pooled specificities were ∼95%, except those in blood. A positive PCR is highly informative with a positive LR around 20 in ulcers or skin lesions. In the blood, the positive LR was syphilis diagnosis in lesions. PCR is a useful diagnostic tool in ulcers, especially when serology is still negative and in medical settings with a high prevalence of syphilis.
Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab
2016-07-01
The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.
Directory of Open Access Journals (Sweden)
Murat Karahan, Mehmet Nuri Acik1* and Burhan Cetinkaya
2011-06-01
Full Text Available The aim of the present study was to characterize coagulase (coa positive Staphylococcus aureus strains (n=92 isolated from bovine subclinical mastitis in Turkey by PCR amplification of clumping factor A (clfA and protein A (spa genes. All the coa-positive S. aureus isolates were determined to harbor the genes encoding the IgG binding region (spa-IgG and the X region (spa-X of spa. On the other hand, 84 (91.3% isolates were positive for clfA gene. These three genes displayed size polymorphisms. It was concluded that spa gene polymorphisms for S. aureus, when used together with coa-PCR, can be proposed as good alternatives to conventional methods in typing S. aureus isolates of bovine origin which may provide valuable data for the development of effective control strategies against staphylococcal mastitis. The results of the present study showed that S. aureus isolates responsible for the mastitis cases in Turkey were genetically diverse.
Simultaneous Detection of Ricin and Abrin DNA by Real-Time PCR (qPCR
Directory of Open Access Journals (Sweden)
Roman Wölfel
2012-08-01
Full Text Available Ricin and abrin are two of the most potent plant toxins known and may be easily obtained in high yield from the seeds using rather simple technology. As a result, both toxins are potent and available toxins for criminal or terrorist acts. However, as the production of highly purified ricin or abrin requires sophisticated equipment and knowledge, it may be more likely that crude extracts would be used by non-governmental perpetrators. Remaining plant-specific nucleic acids in these extracts allow the application of a real-time PCR (qPCR assay for the detection and identification of abrin or ricin genomic material. Therefore, we have developed a duplex real-time PCR assays for simultaneous detection of ricin and abrin DNA based on the OmniMix HS bead PCR reagent mixture. Novel primers and hybridization probes were designed for detection on a SmartCycler instrument by using 5′-nuclease technology. The assay was thoroughly optimized and validated in terms of analytical sensitivity. Evaluation of the assay sensitivity by probit analysis demonstrated a 95% probability of detection at 3 genomes per reaction for ricin DNA and 1.2 genomes per reaction for abrin DNA. The suitability of the assays was exemplified by detection of ricin and abrin contaminations in a food matrix.
Hahm, J E; Kim, C W; Kim, S S
2018-04-06
A widespread scabies infestation, associated to long-term residence in nursing homes, is becoming a serious issue in developed countries. Mineral oil examination is regarded as the gold standard in diagnosing scabies, but the sensitivity of this method is generally low-approximately 50%. Molecular tests may contribute to enhance the sensitivity of current tests for laboratory diagnosis of human scabies. In this study, we developed new primers for a nested PCR for the cytochrome c oxidase subunit 1 (cox1) gene of Sarcoptes scabiei var. hominis to increase the sensitivity of a previously developed conventional PCR. Clinically suspected scabies patients underwent dermoscopy-guided skin scraping with microscopic examination. The diagnosis was positive for scabies when mites or eggs were found under the microscope, and patients were then designated as 'microscopy-positive'. Patients in the 'microscopy-negative' group presented with negative microscopic results. Skin scrapings were collected from both groups for PCR. Of the total 63 samples, 28 were microscopy-positive and 35 were negative with no differences in sex and age between the two groups. All microscopically proven scabies cases were positive with the cox1 nested PCR. Among microscopy-negative ones, S. scabiei DNA was detected in 9 samples. If sensitivity of the cox1 nested PCR is considered 100% (95% CI, 90.51-100), then sensitivity of microscopy is 75.68% (95% CI, 58.80-88.23; P = 0.004). Nested PCR can be successfully used as an alternative method for diagnosing suspected scabies patient. Therefore, infection control measures and treatments can be initiated before significant transmission occurs, minimizing the risk of outbreaks. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Development of an improved species specific PCR test for detection of Haemophilus parasuis
DEFF Research Database (Denmark)
Angen, Øystein; Oliveira, Simone; Ahrens, Peter
2007-01-01
, the present PCR test was found to be 100% species specific for H. parasuis, in contrast to the PCR test of Oliveira et al., which also tested positive for strains belonging to A. indolicus, A. porcinus, and A. minor, species commonly occurring in the upper respiratory tract. However, when the PCR test...... with representatives of H. parasuis. The test was further evaluated on 55 clinical samples from 16 Danish pigs suspected for being infected with H. parasuis, showing polyserositis or septicemia at autopsy as well as on 492 nasal swabs. The test was compared with the performance of a PCR test earlier published...... by Oliveira et al. [Oliveira, S., Galina, L., Pijoan, C., 2001. Development of a PCR test to diagnose Haemophilus parasuis infections. J. Vet. Diagn. Invest. 13, 495-501]. The sensitivity of the present PCR test was found to be slightly lower when applied on clinical samples from diseased pigs and 10-fold...
Comparison between digital PCR and real-time PCR in detection of Salmonella typhimurium in milk.
Wang, Meng; Yang, Junjie; Gai, Zhongtao; Huo, Shengnan; Zhu, Jianhua; Li, Jun; Wang, Ranran; Xing, Sheng; Shi, Guosheng; Shi, Feng; Zhang, Lei
2018-02-02
As a kind of zero-tolerance foodborne pathogens, Salmonella typhimurium poses a great threat to quality of food products and public health. Hence, rapid and efficient approaches to identify Salmonella typhimurium are urgently needed. Combined with PCR and fluorescence technique, real-time PCR (qPCR) and digital PCR (ddPCR) are regarded as suitable tools for detecting foodborne pathogens. To compare the effect between qPCR and ddPCR in detecting Salmonella typhimurium, a series of nucleic acid, pure strain culture and spiking milk samples were applied and the resistance to inhibitors referred in this article as well. Compared with qPCR, ddPCR exhibited more sensitive (10 -4 ng/μl or 10 2 cfu/ml) and less pre-culturing time (saving 2h). Moreover, ddPCR had stronger resistance to inhibitors than qPCR, yet absolute quantification hardly performed when target's concentration over 1ng/μl or 10 6 cfu/ml. This study provides an alternative strategy in detecting foodborne Salmonella typhimurium. Copyright © 2018 Elsevier B.V. All rights reserved.
Khan, S; Harish, B N; Menezes, G A; Acharya, N S; Parija, S C
2012-11-01
Typhoid fever caused by Salmonella Typhi continues to be a major health problem in spite of the use of antibiotics and the development of newer antibacterial drugs. Inability to make an early laboratory diagnosis and resort to empirical therapy, often lead to increased morbidity and mortality in cases of typhoid fever. This study was aimed to optimize a nested PCR for early diagnosis of typhoid fever and using it as a diagnostic tool in culture negative cases of suspected typhoid fever. Eighty patients with clinical diagnosis of typhoid fever and 40 controls were included in the study. The blood samples collected were subjected to culture, Widal and nested PCR targeting the flagellin gene of S. Typhi. The sensitivity of PCR on blood was found to be 100 per cent whereas the specificity was 76.9 per cent. The positive predictive value (PPV) of PCR was calculated to be 76.9 per cent with an accuracy of 86 per cent. None of the 40 control samples gave a positive PCR. Due to its high sensitivity and specificity nested PCR can be used as a useful tool to diagnose clinically suspected, culture negative cases of typhoid fever.
Cassinat, Bruno; de Botton, Stéphane; Kelaidi, Charikleia; Ades, Lionel; Zassadowski, Fabien; Guillemot, Isabelle; Schlageter, Marie-Helene; Raffoux, Emmanuel; Harousseau, Jean-Luc; Legrand, Olivier; Escoffre-Barbe, Martine; Reman, Oumedaly; Gardembas, Martine; Himberlin, Chantal; Cahn, Jean Yves; Guyotat, Denis; Bouscary, Didier; Parry, Anne; Rousselot, Philippe; Baruchel, Andre; Dombret, Hervé; Chevret, Sylvie; Fenaux, Pierre; Chomienne, Christine
2009-09-01
10-20% of APL patients relapse and the challenge remains to early identify these patients to improve survival rate. We report PML-RARalpha transcript detection by RQ-PCR in 260 consecutive APL patients (n = 970 samples). 223 patients with samples of sufficient RNA quality to demonstrate they reached molecular remission were monitored for MRD. During follow-up, 38 of these patients were tested positive for PML-RARalpha mRNA. 13 out of the 38 patients (34%) effectively developed hematological relapse. In the first positive sample, specific PML-RARalpha NCN thresholds over which, or under which, patients could effectively be predicted to relapse or not, were identified and subsequently validated in a second cohort.
Rapid qualitative urinary tract infection pathogen identification by SeptiFast real-time PCR.
Directory of Open Access Journals (Sweden)
Lutz E Lehmann
2011-02-01
Full Text Available Urinary tract infections (UTI are frequent in outpatients. Fast pathogen identification is mandatory for shortening the time of discomfort and preventing serious complications. Urine culture needs up to 48 hours until pathogen identification. Consequently, the initial antibiotic regimen is empirical.To evaluate the feasibility of qualitative urine pathogen identification by a commercially available real-time PCR blood pathogen test (SeptiFast® and to compare the results with dipslide and microbiological culture.Pilot study with prospectively collected urine samples.University hospital.82 prospectively collected urine samples from 81 patients with suspected UTI were included. Dipslide urine culture was followed by microbiological pathogen identification in dipslide positive samples. In parallel, qualitative DNA based pathogen identification (SeptiFast® was performed in all samples.61 samples were SeptiFast® positive, whereas 67 samples were dipslide culture positive. The inter-methodological concordance of positive and negative findings in the gram+, gram- and fungi sector was 371/410 (90%, 477/492 (97% and 238/246 (97%, respectively. Sensitivity and specificity of the SeptiFast® test for the detection of an infection was 0.82 and 0.60, respectively. SeptiFast® pathogen identifications were available at least 43 hours prior to culture results.The SeptiFast® platform identified bacterial DNA in urine specimens considerably faster compared to conventional culture. For UTI diagnosis sensitivity and specificity is limited by its present qualitative setup which does not allow pathogen quantification. Future quantitative assays may hold promise for PCR based UTI pathogen identification as a supplementation of conventional culture methods.
Directory of Open Access Journals (Sweden)
Mohammad Khalili
2015-02-01
Full Text Available Objective: To use PCR for the detection of Coxiella burnetii (C. burnetii in bulk tank milk samples collected from dairy caprine herds in southeast Iran. Methods: In the present study, 31 goat bulk milk from 31 dairy goat herds were tested for C. burnetii using trans-PCR assay. The animals which their milk samples collected for this study were clinically healthy. Results: In total, 5 of 31 (16.12% goat milk samples were positive. Conclusions: The results of this study indicate clinically healthy dairy goats are important sources of C. burnetii infection in this area.
Two-temperature LATE-PCR endpoint genotyping
Directory of Open Access Journals (Sweden)
Reis Arthur H
2006-12-01
Full Text Available Abstract Background In conventional PCR, total amplicon yield becomes independent of starting template number as amplification reaches plateau and varies significantly among replicate reactions. This paper describes a strategy for reconfiguring PCR so that the signal intensity of a single fluorescent detection probe after PCR thermal cycling reflects genomic composition. The resulting method corrects for product yield variations among replicate amplification reactions, permits resolution of homozygous and heterozygous genotypes based on endpoint fluorescence signal intensities, and readily identifies imbalanced allele ratios equivalent to those arising from gene/chromosomal duplications. Furthermore, the use of only a single colored probe for genotyping enhances the multiplex detection capacity of the assay. Results Two-Temperature LATE-PCR endpoint genotyping combines Linear-After-The-Exponential (LATE-PCR (an advanced form of asymmetric PCR that efficiently generates single-stranded DNA and mismatch-tolerant probes capable of detecting allele-specific targets at high temperature and total single-stranded amplicons at a lower temperature in the same reaction. The method is demonstrated here for genotyping single-nucleotide alleles of the human HEXA gene responsible for Tay-Sachs disease and for genotyping SNP alleles near the human p53 tumor suppressor gene. In each case, the final probe signals were normalized against total single-stranded DNA generated in the same reaction. Normalization reduces the coefficient of variation among replicates from 17.22% to as little as 2.78% and permits endpoint genotyping with >99.7% accuracy. These assays are robust because they are consistent over a wide range of input DNA concentrations and give the same results regardless of how many cycles of linear amplification have elapsed. The method is also sufficiently powerful to distinguish between samples with a 1:1 ratio of two alleles from samples comprised of
Molecular diagnosis of strongyloidiasis in a population of an endemic area through nested-PCR.
Sharifdini, Meysam; Keyhani, Amir; Eshraghian, Mohammad Reza; Beigom Kia, Eshrat
2018-01-01
This study is aimed to diagnose and analyze strongyloidiasis in a population of an endemic area of Iran using nested-PCR, coupled with parasitological methods. Screening of strongyloidiasis infected people using reliable diagnostic techniques are essential to decrease the mortality and morbidity associated with this infection. Molecular methods have been proved to be highly sensitive and specific for detection of Strongyloides stercoralis in stool samples. A total of 155 fresh single stool samples were randomly collected from residents of north and northwest of Khouzestan Province, Iran. All samples were examined by parasitological methods including formalin-ether concentration and nutrient agar plate culture, and molecular method of nested-PCR. Infections with S. stercoralis were analyzed according to demographic criteria. Based on the results of nested-PCR method 15 cases (9.7%) were strongyloidiasis positive. Nested-PCR was more sensitive than parasitological techniques on single stool sampling. Elderly was the most important population index for higher infectivity with S. stercoralis . In endemic areas of S. stercoralis , old age should be considered as one of the most important risk factors of infection, especially among the immunosuppressed individuals.
Lee, S; Kim, C S; Shin, Y G; Kim, J H; Kim, Y S; Jheong, W H
2016-03-01
The Peach rosette mosaic virus (PRMV) is a plant pathogen of the genus Nepovirus, and has been designated as a controlled quarantine virus in Korea. In this study, a specific reverse transcription (RT)-PCR marker set, nested PCR marker set, and modified-plasmid positive control were developed to promptly and accurately diagnose PRMV at plant-quarantine sites. The final selected PRMV-specific RT-PCR marker was PRMV-N10/C70 (967 bp), and the nested PCR product of 419 bp was finally amplified. The modified-plasmid positive control, in which the SalI restriction-enzyme region (GTCGAC) was inserted, verified PRMV contamination in a comparison with the control, enabling a more accurate diagnosis. It is expected that the developed method will continuously contribute to the plant-quarantine process in Korea.
Directory of Open Access Journals (Sweden)
Kröncke, Klaus-Dietrich
2008-08-01
Full Text Available [english] Background: The polymerase chain reaction (PCR is an example of a technology that for many medical students is not easy to understand. We investigated whether a tutor-supported e-learning teaching unit is suitable to teach undergraduate medical students the PCR. Methods: We developed a computer-based practical course (attendance is compulsory that uses an open source-based system as a learning platform. The students learned to search in scientific medical databases to find PCR-relevant data. In addition, they learned the essential features of the PCR with the aid of embedded textual information and audiovisual animations. To check that the learning objectives were fulfilled, the students had to solve medical-related PCR tasks on the computer. Results: In total, 311 students went through the course. They were satisfied with the e-learning teaching unit and evaluated it very positively, independently of their prior knowledge concerning the PCR. Students with low levels of computer skills did not feel over-challenged. Conclusion: Our results show that a computer-based practical training course is an excellent option for teaching undergraduate medical students complex technologies that could otherwise only be taught in a laboratory at great expense of time and effort. [german] Zielsetzung: Es sollte untersucht werden, ob ein E-Learning Praktikumsversuch geeignet ist, Medizin-Studierenden der Vorklinik die Polymerase-Kettenreaktion (PCR begreiflich zu machen. Methodik: Ein Computer-basierter Praktikumsversuch wurde entwickelt, der sowohl das Recherchieren in wissenschaftlich-medizinischen Datenbanken zum Auffinden von PCR-relevanten Informationen beinhaltet als auch Selbstlerneinheiten über die PCR. Als Lernzielkontrollen dienten Aufgaben aus der medizinischen PCR-Diagnostik. Die Akzeptanz der Lehrveranstaltung bei den Studierenden wurde mit einem Fragebogen ermittelt, der 19 Items enthielt. Ergebnisse: 311 Studierende absolvierten den
Diagnosis of Neisseria gonorrhoeae among pregnant women by culture method and PCR on cppB gene
Directory of Open Access Journals (Sweden)
Jalal Mardaneh
2013-11-01
Full Text Available Background: Neisseria gonorrhoeae is a human obligate pathogen and the etiological agent of gonorrhea. Health irreparable complications resulting from gonorrhea disease occur mainly in pregnant women and neonates. Aim of this study was diagnosis of Neisseria gonorrhoeae among pregnant women with using culture and molecular method by amplification of cppB gene with PCR. Material and Methods: In this cross-sectional study, two endocervical swab specimens were obtained from 1100 pregnant women who referred to Shiraz Hospitals. Culture on nonselective and selective media and nucleic acid amplification test (NAAT were performed for detection of Neisseria gonorrhoeae cppB gene. Results: All endocervical swabs cultures on selective and nonselective media were negative for Neisseria gonorrhoeae. Among examined endocervical swabs, 13samples (1.18% were positive by nucleic acid amplification of Neisseria gonorrgoeae cppB gene. Conclusion: Negative results of culture and positive results of PCR in this study indicate that however culture is gold standard method for detection of Neisseria gonorrhoeae but due to bacterial autolysis, poor sampling techniques and improper specimen storage and transport, its value decline as compared with Nucleic acid amplification test (NAAT.
Heytens, S; De Sutter, A; Coorevits, L; Cools, P; Boelens, J; Van Simaey, L; Christiaens, T; Vaneechoutte, M; Claeys, G
2017-09-01
Our objective was to examine whether or not women with symptoms of a urinary tract infection but with a negative culture (20%-30%) do have an infection. We performed quantitative PCR (qPCR) for Escherichia coli and Staphylococcus saprophyticus, on top of a standard culture, in urine samples from 220 women with dysuria and/or frequency and/or urgency and from 86 women without symptoms. For symptomatic women, qPCR was also carried out for four sexually transmitted agents. In the symptomatic group, 80.9% (178/220) of the urine cultures were positive for any uropathogen and 95.9% (211/220) were E. coli qPCR-positive. For the control group, cultures for E. coli and E. coli qPCR were positive in, respectively, 10.5% (9/86) and 11.6% (10/86). In the symptomatic group, qPCR yielded 19 positive samples for S. saprophyticus qPCR, one positive sample for Mycoplasma genitalium and one for Trichomonas vaginalis. These findings suggest that almost all women with typical urinary complaints and a negative culture still have an infection with E. coli. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Yamada, Kazuhiro; Ibata, Ami; Suzuki, Masahiro; Matsumoto, Masakado; Yamashita, Teruo; Minagawa, Hiroko; Kurane, Ryuichiro
2015-01-01
Campylobacter jejuni is responsible for the majority of Campylobacter infections. As the molecular epidemiological study of outbreaks, pulsed-field gel electrophoresis (PFGE) is performed in general. But PFGE has several problems. PCR binary typing (P-BIT) method is a typing method for Campylobacter spp. that was recently developed, and was reported to have a similar discriminatory power and stability to those of PFGE. We modified the P-BIT method from 18 monoplex PCRs to two multiplex PCR systems (mP-BIT). The same results were obtained from monoplex PCRs using original primers and multiplex PCR in the representative isolates. The mP-BIT can analyze 48 strains at a time by using 96-well PCR systems and can identify C. jejuni because mP-BIT includes C. jejuni marker. The typing of the isolates by the mP-BIT and PFGE demonstrated generally concordant results and the mP-BIT method (D = 0.980) has a similar discriminatory power to that of PFGE with SmaI digest (D = 0.975) or KpnI digest (D = 0.987) as with original article. The mP-BIT method is quick, simple and easy, and comes to be able to perform it at low cost by having become a multiplex PCR system. Therefore, the mP-BIT method with two multiplex PCR systems has high potential for a rapid first-line surveillance typing assay of C. jejuni and can be used for routine surveillance and outbreak investigations of C. jejuni in the future. Copyright © 2014 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Kapoor, Pratibha; Hayes, Yumiko O; Jarrell, Leslie T; Bellinger, Dwight A; Thomas, Rhiannon D; Lawson, Gregory W; Arkema, Jaclyn D; Fletcher, Craig A; Nielsen, Judith N
2017-01-01
The entry of infectious agents in rodent colonies occurs despite robust sentinel monitoring programs, strict quarantine measures, and stringent biosecurity practices. In light of several outbreaks with Aspiculuris tetraptera in our facilities, we investigated the presence of anthelmintic resistance and the use of exhaust air dust (EAD) PCR for early detection of A. tetraptera infection. To determine anthelmintic resistance, C57BL/6, DBA/2, and NCr nude mice were experimentally inoculated with embryonated A. tetraptera ova harvested from enzootically infected mice, followed by treatment with 150 ppm fenbendazole in feed, 150 ppm fenbendazole plus 5 ppm piperazine in feed, or 2.1 mg/mL piperazine in water for 4 or 8 wk. Regardless of the mouse strain or treatment, no A. tetraptera were recovered at necropsy, indicating the lack of resistance in the worms to anthelmintic treatment. In addition, 10 of 12 DBA/2 positive-control mice cleared the A. tetraptera infection without treatment. To evaluate the feasibility of EAD PCR for A. tetraptera, 69 cages of breeder mice enzootically infected with A. tetraptera were housed on a Tecniplast IVC rack as a field study. On day 0, 56% to 58% of the cages on this rack tested positive for A. tetraptera by PCR and fecal centrifugation flotation (FCF). PCR from EAD swabs became positive for A. tetraptera DNA within 1 wk of placing the above cages on the rack. When these mice were treated with 150 ppm fenbendazole in feed, EAD PCR reverted to pinworm-negative after 1 mo of treatment and remained negative for an additional 8 wk. The ability of EAD PCR to detect few A. tetraptera positive mice was investigated by housing only 6 infected mice on another IVC rack as a field study. The EAD PCR from this rack was positive for A. tetraptera DNA within 1 wk of placing the positive mice on it. These findings demonstrate that fenbendazole is still an effective anthelmintic and that EAD PCR is a rapid, noninvasive assay that may be a useful
Gwida, Mayada M; Al-Ashmawy, Maha A M
2014-01-01
A total of 200 samples of milk and dairy products as well as 120 samples of dairy handlers were randomly collected from different dairy farms and supermarkets in Dakahlia Governorate, Egypt. The conventional cultural and serotyping methods for detection of Salmonella in dairy products were applied and the results were compared with those obtained by molecular screening assay using (ttr sequence). The obtained results revealed that 21% of milk and dairy products (42/200) were positive for Salmonella species using enrichment culture-based PCR method, while 12% of different dairy samples (24/200) were found to be positive for Salmonella species by using the conventional culture methods. Two stool specimens out of 40 apparently healthy dairy handlers were positive by the PCR method. Serotyping of Salmonella isolates revealed that 58.3% (14/24) from different dairy products were contaminated with Salmonella Typhimurium. We conclude that the enrichment culture-based PCR assay has high sensitivity and specificity for detection of Salmonella species in dairy products and handlers. High incidence of Salmonella Typhimurium in the examined dairy samples highlights the important role played by milk and dairy products as a vehicle in disease prevalence. Great effort should be applied for reducing foodborne risk for consumers.
Frosth, Sara; König, Ulrika; Nyman, Ann-Kristin; Aspán, Anna
2017-09-01
Dichelobacter nodosus is the principal cause of ovine footrot and strain virulence is an important factor in disease severity. Therefore, detection and virulence determination of D. nodosus is important for proper diagnosis of the disease. Today this is possible by real-time PCR analysis. Analysis of large numbers of samples is costly and laborious; therefore, pooling of individual samples is common in surveillance programs. However, pooling can reduce the sensitivity of the method. The aim of this study was to develop a pooling method for real-time PCR analysis that would allow sensitive detection and simultaneous virulence determination of D. nodosus. A total of 225 sheep from 17 flocks were sampled using ESwabs within the Swedish Footrot Control Program in 2014. Samples were first analysed individually and then in pools of five by real-time PCR assays targeting the 16S rRNA and aprV2/B2 genes of D. nodosus. Each pool consisted of four negative and one positive D. nodosus samples with varying amounts of the bacterium. In the individual analysis, 61 (27.1%) samples were positive in the 16S rRNA and the aprV2/B2 PCR assays and 164 (72.9%) samples were negative. All samples positive in the aprV2/B2 PCR-assay were of aprB2 variant. The pooled analysis showed that all 41 pools were also positive for D. nodosus 16S rRNA and the aprB2 variant. The diagnostic sensitivity for pooled and individual samples was therefore similar. Our method includes concentration of the bacteria before DNA-extraction. This may account for the maintenance of diagnostic sensitivity. Diagnostic sensitivity in the real-time PCR assays of the pooled samples were comparable to the sensitivity obtained for individually analysed samples. Even sub-clinical infections were able to be detected in the pooled PCR samples which is important for control of the disease. This method may therefore be implemented in footrot control programs where it can replace analysis of individual samples.
Kobayashi, Naomi; Bauer, Thomas W; Togawa, Daisuke; Lieberman, Isador H; Sakai, Hiroshige; Fujishiro, Takaaki; Tuohy, Marion J; Procop, Gary W
2005-06-01
The bacteria associated with orthopaedic infections are usually common gram-positive and gram-negative bacteria. This fundamental grouping of bacteria is a necessary first step in the selection of appropriate antibiotics. Since polymerase chain reaction (PCR) is more rapid and may be more sensitive than culture, we developed a postamplification pyrosequencing method to subcategorize bacteria based on a few nucleotide polymorphisms in the 16S rRNA gene. We validated this method using well-characterized strains of bacteria and applied it to specimens from spinal surgery cases with suspected infections. Lysates of 114 bacteria including 75 species were created following standard cultivation to obtain DNA. The DNA was amplified by a broad-range real-time PCR. The amplicons were evaluated by pyrosequencing and were classified as gram-positive, gram-negative, or acid-fast bacilli based on the first three to five nucleotides sequenced. In addition, clinical cases of suspected infection were obtained from spinal surgery. The results of the "molecular Gram stain" were compared with the results of traditional Gram stain and culture. The lysates of 107 (93.9%) of the bacteria extracts tested were appropriately categorized as gram-positive and gram-negative or as acid-fast bacilli on the basis of this assay. The sensitivity and specificity of this assay were 100% and 97.4% for gram-positive and 88.3% and 100% for gram-negative isolates. All of the five clinical samples were appropriately categorized as containing gram-positive or gram-negative bacteria with this assay. This study demonstrates that high sensitivity and specificity of a molecular gram stain may be achieved using broad-range real-time PCR and pyrosequencing.
COMPARISON OF 16S rRNA-PCR-RFLP, LipL32-PCR AND OmpL1-PCR METHODS IN THE DIAGNOSIS OF LEPTOSPIROSIS
Directory of Open Access Journals (Sweden)
Tülin GÜVEN GÖKMEN
Full Text Available SUMMARY Leptospirosis is still one of the most important health problems in developing countries located in humid tropical and subtropical regions. Human infections are generally caused by exposure to water, soil or food contaminated with the urine of infected wild and domestic animals such as rodents and dogs. The clinical course of leptospirosis is variable and may be difficult to distinguish from many other infectious diseases. The dark-field microscopy (DFM, serology and nucleic acid amplification techniques are used to diagnose leptospirosis, however, a distinctive standard reference method is still lacking. Therefore, in this study, we aimed to determine the presence of Leptospira spp., to differentiate the pathogenic L. interrogans and the non-pathogenic L. biflexa, and also to determine the sensitivity and specificity values of molecular methods as an alternative to conventional ones. A total of 133 serum samples, from 47 humans and 86 cattle were evaluated by two conventional tests: the Microagglutination Test (MAT and the DFM, as well as three molecular methods, the 16S rRNA-PCR followed by Restriction Fragment Lenght Polymorphism (RFLP of the amplification products 16S rRNA-PCR-RFLP, LipL32-PCR and OmpL1-PCR. In this study, for L. interrogans, the specificity and sensitivity rates of the 16S rRNA-PCR and the LipL32-PCR were considered similar (100% versus 98.25% and 100% versus 98.68%, respectively. The OmpL1-PCR was able to classify L. interrogans into two intergroups, but this PCR was less sensitive (87.01% than the other two PCR methods. The 16S rRNA-PCR-RFLP could detect L. biflexa DNA, but LipL32-PCR and OmpL1-PCR could not. The 16S rRNA-PCR-RFLP provided an early and accurate diagnosis and was able to distinguish pathogenic and non-pathogenic Leptospira species, hence it may be used as an alternative method to the conventional gold standard techniques for the rapid disgnosis of leptospirosis.
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
Real-time PCR for Strongyloides stercoralis-associated meningitis.
Nadir, Eyal; Grossman, Tamar; Ciobotaro, Pnina; Attali, Malka; Barkan, Daniel; Bardenstein, Rita; Zimhony, Oren
2016-03-01
Four immunocompromised patients, immigrants from Ethiopia, presented with diverse clinical manifestations of meningitis associated with Strongyloides stercoralis dissemination as determined by identification of intestinal larvae. The cerebrospinal fluid of 3 patients was tested by a validated (for stool) real-time PCR for S. stercoralis and was found positive, establishing this association. Copyright © 2016 Elsevier Inc. All rights reserved.
van den Brand, Marre; van den Dungen, Frank A M; Bos, Martine P; van Weissenbruch, Mirjam M; van Furth, A Marceline; de Lange, Annemieke; Rubenjan, Anna; Peters, Remco P H; Savelkoul, Paul H M
2018-04-22
Rapid and accurate diagnosis of neonatal sepsis is highly warranted because of high associated morbidity and mortality. The aim of this study was to evaluate the performance of a novel multiplex PCR assay for diagnosis of late-onset sepsis and to investigate the value of bacterial DNA load (BDL) determination as a measure of infection severity. This cross-sectional study was conducted in a neonatal intensive care unit. Preterm and/or very low birth weight infants suspected for late-onset sepsis were included. Upon suspicion of sepsis, a whole blood sample was drawn for multiplex PCR to detect the eight most common bacteria causing neonatal sepsis, as well as for blood culture. BDL was determined in episodes with a positive multiplex PCR. In total, 91 episodes of suspected sepsis were investigated, and PCR was positive in 53 (58%) and blood culture in 60 (66%) episodes, yielding no significant difference in detection rate (p = 0.17). Multiplex PCR showed a sensitivity of 77%, specificity of 81%, positive predictive value of 87%, and negative predictive value of 68% compared with blood culture. Episodes with discordant results of PCR and blood culture included mainly detection of coagulase-negative staphylococci (CoNS). C-reactive protein (CRP) level and immature to total neutrophil (I/T) ratio were lower in these episodes, indicating less severe disease or even contamination. Median BDL was high (4.1 log 10 cfu Eq/ml) with a wide range, and was it higher in episodes with a positive blood culture than in those with a negative blood culture (4.5 versus 2.5 log 10 cfu Eq/ml; p PCR provides a powerful assay to enhance rapid identification of the causative pathogen in late-onset sepsis. BDL measurement may be a useful indicator of severity of infection.
From the 'PCR' function to the 'PCR' profession; de la fonction 'PCR' au metier 'PCR'
Energy Technology Data Exchange (ETDEWEB)
Perrin, L. [CERAP, 91 - Gif sur Yvette (France)
2008-07-01
After having recalled the legal context concerning the appointment and training of a radiation protection expert (PCR for 'personne competente en radioprotection'), the author outlines that the PCR's role has notably evolved: his function is now of primary importance in the company and his activity does not correspond to the legal framework any longer. Moreover, with the application of a European directive, some small establishments possessing ionizing radiation sources are disadvantaged, and the PCR is now facing an increasing number of missions and tasks. The author gives a list of them and assesses a needed time of 146 days per year: this means PCRs cannot have an other activity within their company
Hiitiö, Heidi; Riva, Rauna; Autio, Tiina; Pohjanvirta, Tarja; Holopainen, Jani; Pyörälä, Satu; Pelkonen, Sinikka
2015-05-01
Reliable identification of the aetiological agent is crucial in mastitis diagnostics. Real-time PCR is a fast, automated tool for detecting the most common udder pathogens directly from milk. In this study aseptically taken quarter milk samples were analysed with a real-time PCR assay (Thermo Scientific PathoProof Mastitis Complete-12 Kit, Thermo Fisher Scientific Ltd.) and by semi-quantitative, in-depth bacteriological culture (BC). The aim of the study was to evaluate the diagnostic performance of the real-time PCR assay in routine use. A total of 294 quarter milk samples from routine mastitis cases were cultured in the national reference laboratory of Finland and examined with real-time PCR. With BC, 251 out of 294 (85.7%) of the milk samples had at least one colony on the plate and 38 samples were considered contaminated. In the PCR mastitis assay, DNA of target species was amplified in 244 samples out of 294 (83.0%). The most common bacterial species detected in the samples, irrespective of the diagnostic method, was the coagulase negative staphylococci (CNS) group (later referred as Staphylococcus spp.) followed by Staphylococcus aureus. Sensitivity (Se) and specificity (Sp) for the PCR assay to provide a positive Staph. aureus result was 97.0 and 95.8% compared with BC. For Staphylococcus spp., the corresponding figures were 86.7 and 75.4%. Our results imply that PCR performed well as a diagnostic tool to detect Staph. aureus but may be too nonspecific for Staphylococcus spp. in routine use with the current cut-off Ct value (37.0). Using PCR as the only microbiological method for mastitis diagnostics, clinical relevance of the results should be carefully considered before further decisions, for instance antimicrobial treatment, especially when minor pathogens with low amount of DNA have been detected. Introducing the concept of contaminated samples should also be considered.
Bliem, Rupert; Reischer, Georg; Linke, Rita; Farnleitner, Andreas; Kirschner, Alexander
2018-06-01
In recent years, global warming has led to a growing number of Vibrio cholerae infections in bathing water users in regions formerly unaffected by this pathogen. It is therefore of high importance to monitor V. cholerae in aquatic environments and to elucidate the main factors governing its prevalence and abundance. For this purpose, rapid and standardizable methods that can be performed by routine water laboratories are prerequisite. In this study, we applied a recently developed multiplex quantitative PCR (qPCR) strategy (i) to monitor the spatiotemporal variability of V. cholerae abundance in two small soda pools and a large lake that is intensively used for recreation and (ii) to elucidate the main factors driving V. cholerae dynamics in these environments. V. cholerae was detected with qPCR at high concentrations of up to 970,000 genomic units 100 ml -1 during the warm season, up to 2 orders of magnitude higher than values obtained by cultivation. An independent cytometric approach led to results comparable to qPCR data but with significantly more positive samples due to problems with DNA recovery for qPCR. Not a single sample was positive for toxigenic V. cholerae , indicating that only nontoxigenic V. cholerae (NTVC) was present. Temperature was the main predictor of NTVC abundance, but the quality and quantity of dissolved organic matter were also important environmental correlates. Based on this study, we recommend using the developed qPCR strategy for quantification of toxigenic and nontoxigenic V. cholerae in bathing waters with the need for improvements in DNA recovery. IMPORTANCE There is a definitive need for rapid and standardizable methods to quantify waterborne bacterial pathogens. Such methods have to be thoroughly tested for their applicability to environmental samples. In this study, we critically tested a recently developed multiplex qPCR strategy for its applicability to determine the spatiotemporal variability of V. cholerae abundance in
Qin, T; Zhou, H; Ren, H; Shi, W; Jin, H; Jiang, X; Xu, Y; Zhou, M; Li, J; Wang, J; Shao, Z; Xu, X
2016-07-01
Legionnaires' disease (LD) is a globally distributed systemic infectious disease. The burden of LD in many regions is still unclear, especially in Asian countries including China. A survey of Legionella infection using real-time PCR and nested sequence-based typing (SBT) was performed in two hospitals in Shanghai, China. A total of 265 bronchoalveolar lavage fluid (BALF) specimens were collected from hospital A between January 2012 and December 2013, and 359 sputum specimens were collected from hospital B throughout 2012. A total of 71 specimens were positive for Legionella according to real-time PCR focusing on the 5S rRNA gene. Seventy of these specimens were identified as Legionella pneumophila as a result of real-time PCR amplification of the dotA gene. Results of nested SBT revealed high genetic polymorphism in these L. pneumophila and ST1 was the predominant sequence type. These data revealed that the burden of LD in China is much greater than that recognized previously, and real-time PCR may be a suitable monitoring technology for LD in large sample surveys in regions lacking the economic and technical resources to perform other methods, such as urinary antigen tests and culture methods.
Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi
2017-10-01
Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.
Risk of breast cancer after false-positive results in mammographic screening
DEFF Research Database (Denmark)
Roman, Marta; Castells, Xavier; Hofvind, Solveig
2016-01-01
risk (RR) of screen-detected cancer for women with false-positive versus negative results. We analyzed information from 1,935,093 women 50–69 years who underwent 6,094,515 screening exams. During an average 5.8 years of follow-up, 230,609 (11.9%) women received a false-positive result and 27,849 (1......Women with false-positive results are commonly referred back to routine screening. Questions remain regarding their long-term outcome of breast cancer. We assessed the risk of screen-detected breast cancer in women with false-positive results. We conducted a joint analysis using individual level.......4%) were diagnosed with screen-detected cancer. The adjusted RR of screen-detected cancer after a false-positive result was 2.01 (95% CI: 1.93–2.09). Women who tested false-positive at first screen had a RR of 1.86 (95% CI: 1.77–1.96), whereas those who tested false-positive at third screening had a RR...
Kistler, Whitney M; Parlos, Julie A; Peper, Steven T; Dunham, Nicholas R; Kendall, Ronald J
2016-01-01
Oxyspirura petrowi is a parasitic nematode that infects wild birds. This parasite has a broad host range, but has recently been reported in high prevalences from native Galliformes species in the United States. In order to better understand the impact O. petrowi has on wild bird populations, we developed a quantitative PCR protocol to detect infections in wild northern bobwhites (Colinus virginianus). We used paired fecal and cloacal swab samples from wild caught and experimentally infected northern bobwhites and matching fecal float data from experimentally infected birds to validate our assay. Overall we detected more positive birds from fecal samples than the paired cloacal swabs and there was strong agreement between the qPCR results from fecal samples and from fecal flotation (84%; κ = 0.69 [0.53-0.84 95% CI]). We also detected O. petrowi DNA in ten replicates of samples spiked with one O. petrowi egg. This qPCR assay is an effective assay to detect O. petrowi infections in wild birds. Our results suggest that fecal samples are the most appropriate sample for detecting infections; although, cloacal swabs can be useful for determining if O. petrowi is circulating in a population.
Inhibitory effect of common microfluidic materials on PCR outcome
Kodzius, Rimantas; Xiao, Kang; Wu, Jinbo; Yi, Xin; Gong, Xiuqing; Foulds, Ian G.; Wen, Weijia
2013-01-01
In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.
Inhibitory effect of common microfluidic materials on PCR outcome
Kodzius, Rimantas
2013-10-10
In this study, we established a simple method for evaluating the PCR compatibility of various common materials employed when fabricating microfluidic chips, including silicon, several kinds of silicon oxide, glasses, plastics, wax, and adhesives. Two-temperature PCR was performed with these materials to determine their PCR-inhibitory effect. In most cases, adding bovine serum albumin effectively improved the reaction yield. We also studied the individual PCR components from the standpoint of adsorption. Most of the materials did not inhibit the DNA, although they noticeably interacted with the polymerase. We provide a simple method of performing PCR-compatibility testing of materials using inexpensive instrumentation that is common in molecular biology laboratories. Furthermore, our method is direct, being performed under actual PCR conditions with high temperature. Our results provide an overview of materials that are PCR-friendly for fabricating microfluidic devices. The PCR reaction, without any additives, performed best with pyrex glass, and it performed worst with PMMA or acrylic glue materials.
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
PCR detection of Burkholderia multivorans in water and soil samples.
Peeters, Charlotte; Daenekindt, Stijn; Vandamme, Peter
2016-08-12
Although semi-selective growth media have been developed for the isolation of Burkholderia cepacia complex bacteria from the environment, thus far Burkholderia multivorans has rarely been isolated from such samples. Because environmental B. multivorans isolates mainly originate from water samples, we hypothesized that water rather than soil is its most likely environmental niche. The aim of the present study was to assess the occurrence of B. multivorans in water samples from Flanders (Belgium) using a fast, culture-independent PCR assay. A nested PCR approach was used to achieve high sensitivity, and specificity was confirmed by sequencing the resulting amplicons. B. multivorans was detected in 11 % of the water samples (n = 112) and 92 % of the soil samples (n = 25) tested. The percentage of false positives was higher for water samples compared to soil samples, showing that the presently available B. multivorans recA primers lack specificity when applied to the analysis of water samples. The results of the present study demonstrate that B. multivorans DNA is commonly present in soil samples and to a lesser extent in water samples in Flanders (Belgium).
Directory of Open Access Journals (Sweden)
Marize Quinhones Pires
2014-04-01
Full Text Available Introduction During a diagnostic evaluation of canine visceral leishmaniasis (VL, two of seventeen dogs were found to be co-infected by Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi. Methods Specific polymerase chain reaction (PCR and restriction fragment length polymorphism-PCR (RFLP-PCR assays were performed. Results PCR assays for Leishmania subgenus identification followed by RFLP-PCR analysis in biopsies from cutaneous lesions and the spleen confirmed the presence of Leishmania (Viannia braziliensis and Leishmania (Leishmania chagasi in those fragments. Conclusions This report reinforces the importance of using serological and molecular techniques in the epidemiological surveillance of canine populations in endemic areas in which both diseases are known to co-exist. In such cases, a reassessment of the control measures is required.
Luo, Jun; Li, Junhua; Yang, Hang; Yu, Junping; Wei, Hongping
2017-10-01
Accurate and rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) is needed to screen MRSA carriers and improve treatment. The current widely used duplex PCR methods are not able to differentiate MRSA from coexisting methicillin-susceptible S. aureus (MSSA) or other methicillin-resistant staphylococci. In this study, we aimed to develop a direct method for accurate and rapid detection of MRSA in clinical samples from open environments, such as nasal swabs. The new molecular assay is based on detecting the cooccurrence of nuc and mecA markers in a single bacterial cell by utilizing droplet digital PCR (ddPCR) with the chimeric lysin ClyH for cell lysis. The method consists of (i) dispersion of an intact single bacterium into nanoliter droplets, (ii) temperature-controlled release of genomic DNA (gDNA) by ClyH at 37°C, and (iii) amplification and detection of the markers ( nuc and mecA ) using standard TaqMan chemistries with ddPCR. Results were analyzed based on MRSA index ratios used for indicating the presence of the duplex-positive markers in droplets. The method was able to achieve an absolute limit of detection (LOD) of 2,900 CFU/ml for MRSA in nasal swabs spiked with excess amounts of Escherichia coli , MSSA, and other mecA -positive bacteria within 4 h. Initial testing of 104 nasal swabs showed that the method had 100% agreement with the standard culture method, while the normal duplex qPCR method had only about 87.5% agreement. The single-bacterium duplex ddPCR assay is rapid and powerful for more accurate detection of MRSA directly from clinical specimens. Copyright © 2017 American Society for Microbiology.
Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.
Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S
2016-02-01
Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.
A ready-to-use duplex qPCR to detect Leishmania infantum DNA in naturally infected dogs.
Rampazzo, Rita de Cássia Pontello; Solcà, Manuela da Silva; Santos, Liliane Celestino Sales; Pereira, Lais de Novaes; Guedes, José Carlos Oliveira; Veras, Patrícia Sampaio Tavares; Fraga, Deborah Bittencourt Mothé; Krieger, Marco Aurélio; Costa, Alexandre Dias Tavares
2017-11-15
Canine visceral leishmaniasis (CVL) is a systemic disease caused by Leishmania infantum. A precise CVL diagnosis would allow for a faster and more specific treatment. Quantitative PCR (qPCR) is a sensitive and specific technique that can diagnose CVL and also monitor parasite load in the animal during the course of the infection or treatment. The aim of this study was to develop a ready-to-use (gelified and freezer-free) duplex qPCR for the identification of infected animals. We combined a new qPCR protocol that detects the canine 18S rRNA gene with an existing protocol for L. infantum kDNA detection, creating a duplex qPCR. This duplex method was then developed into a ready-to-use format. The performance of the duplex and singleplex reactions were compared in the traditional format (liquid and freezer-stored). Furthermore, the duplex qPCR performance was compared between the ready-to-use and traditional formats. The singleplex and new duplex qPCR exhibited the same detection limit in the traditional format (0.1 parasites/reaction). The ready-to-use format showed a detection limit of 1 parasite/reaction without affecting the reaction efficiency. The performance of the new qPCR protocol in the two formats was assessed using canine tissue samples from 82 dogs in an endemic CVL area that were previously characterized by standard serological and parasitological protocols. Splenic aspirates provided a higher rate of positivity (92.9%) followed by skin (50%) and blood (35.7%). The reported detection limits were observed for all tissues studied. Our results show that the amplification of L. infantum kDNA and canine DNA in a single tube, using either the traditional or ready-to-use format, exhibited the same diagnostic performance as amplification of the parasite kDNA alone. The detection of the host gene strengthens the qPCR results by confirming the presence and quality of DNA in the samples and the absence of polymerase inhibitors. The ready-to-use duplex qPCR format
Institute of Scientific and Technical Information of China (English)
李先枢; 徐家进; 高燕球
1990-01-01
Based on the first part of this paper (Science in China, 33(1990), 982—995), further research has been done on quasi-equivalence relation and asymmetrical character of axisymmetrical phase-conjugatlon resonator(PCR). A series of calculations for axisymmetrical PCR(hundreds of transverse modes in 66 axisymmetrical PCRs) have been carried out, and the results are compared with those of corresponding conventional laser resonators. Fundamental properties of the transverse modes (TEMs) in PCR are summarized. This makes possible a rough estimation of the properties of various TEMs in these simple PCR, including different geometrical structures.
Tsai, Jih-Jin; Liu, Li-Teh; Lin, Ping-Chang; Tsai, Ching-Yi; Chou, Pin-Hsing; Tsai, Yun-Long; Chang, Hsiao-Fen Grace; Lee, Pei-Yu Alison
2018-05-01
Dengue virus (DENV) infection, a mosquito-borne disease, is a major public health problem in tropical countries. Point-of-care DENV detection with good sensitivity and specificity enables timely early diagnosis of DENV infection, facilitating effective disease management and control, particularly in regions of low resources. The Pockit dengue virus reagent set (GeneReach Biotech), a reverse transcription insulated isothermal PCR (RT-iiPCR), is available to detect all four serotypes of DENV on the field-deployable Pockit system, which is ready for on-site applications. In this study, analytical and clinical performances of the assay were evaluated. The index assay did not react with 14 non-DENV human viruses, indicating good specificity. Compared to the U.S. CDC DENV-1-4 real-time quantitative RT-PCR (qRT-PCR) assay, testing with serial dilutions of virus-spiked human sera demonstrated that the index assay had detection endpoints that were separately comparable with the 4 serotypes. Excellent reproducibility was observed among repeat tests done by six operators at three sites. In clinical performance, 195 clinical sera collected around Kaohsiung city in 2012 and 21 DENV-4-spiked sera were tested with the RT-iiPCR and qRT-PCR assays in parallel. The 121 (11 DENV-1, 78 DENV-2, 11 DENV-3, and 21 DENV-4) qRT-PCR-positive and 95 qRT-PCR-negative samples were all positive and negative by the RT-iiPCR reagent results, respectively, demonstrating high (100%) interrater agreement (95% confidence interval [CI 95% ], ∼98.81% to 100%; κ = 1). With analytical and clinical performance equivalent to those of the reference qRT-PCR assay, the index PCR assay on the field-deployable system can serve as a highly sensitive and specific on-site tool for DENV detection. Copyright © 2018 American Society for Microbiology.
DEFF Research Database (Denmark)
Fløe, Andreas
2018-01-01
: Study I: As a single sputum-sample analyzed with PCR for MTB identifies >97% of smear-positive TB patients, and as the majority of missed smear-positive TB patients have only one low-grade smear, de-isolation of patients with a single negative sputum PCR-result is safe. Study II: Six HLA A*0201......-restricted antigen-specific CD8+ T-cells. Study III: The CD8+ T-cell response to MTB is highly variable and unpredictable, targeting a wide panel of differently expressed antigens. However, the novel epitopes described here could play a role in future immunodiagnostic tools as well as in vaccine development...
Mycobacterium bovis in milk samples: a preliminary investigation using PCR
International Nuclear Information System (INIS)
Achel, D.G.; Gyamfi, O.K.; Broni, F.; Gomda, Y.; Brown, C.A.
2007-01-01
PCR was used to screen milk samples (n=41) for Mycobacterium bovis. DNA samples were obtained through concentration by 50% sucrose addition and centrifugation. Sixteen (16) samples (or 39%) were positive for M. Bovis DNA and the rest 25 (or 61%) were negative. All four kraals had some samples testing positive for M. bovis; the highest being 50% (5/10) and the lowest being 13% (2/15). (au)
Morton, C Oliver; White, P Lewis; Barnes, Rosemary A; Klingspor, Lena; Cuenca-Estrella, Manuel; Lagrou, Katrien; Bretagne, Stéphane; Melchers, Willem; Mengoli, Carlo; Caliendo, Angela M; Cogliati, Massimo; Debets-Ossenkopp, Yvette; Gorton, Rebecca; Hagen, Ferry; Halliday, Catriona; Hamal, Petr; Harvey-Wood, Kathleen; Jaton, Katia; Johnson, Gemma; Kidd, Sarah; Lengerova, Martina; Lass-Florl, Cornelia; Linton, Chris; Millon, Laurence; Morrissey, C Orla; Paholcsek, Melinda; Talento, Alida Fe; Ruhnke, Markus; Willinger, Birgit; Donnelly, J Peter; Loeffler, Juergen
2017-06-01
A wide array of PCR tests has been developed to aid the diagnosis of invasive aspergillosis (IA), providing technical diversity but limiting standardisation and acceptance. Methodological recommendations for testing blood samples using PCR exist, based on achieving optimal assay sensitivity to help exclude IA. Conversely, when testing more invasive samples (BAL, biopsy, CSF) emphasis is placed on confirming disease, so analytical specificity is paramount. This multicenter study examined the analytical specificity of PCR methods for detecting IA by blind testing a panel of DNA extracted from a various fungal species to explore the range of Aspergillus species that could be detected, but also potential cross reactivity with other fungal species. Positivity rates were calculated and regression analysis was performed to determine any associations between technical specifications and performance. The accuracy of Aspergillus genus specific assays was 71.8%, significantly greater (P Aspergillus species (47.2%). For genus specific assays the most often missed species were A. lentulus (25.0%), A. versicolor (24.1%), A. terreus (16.1%), A. flavus (15.2%), A. niger (13.4%), and A. fumigatus (6.2%). There was a significant positive association between accuracy and using an Aspergillus genus PCR assay targeting the rRNA genes (P = .0011). Conversely, there was a significant association between rRNA PCR targets and false positivity (P = .0032). To conclude current Aspergillus PCR assays are better suited for detecting A. fumigatus, with inferior detection of most other Aspergillus species. The use of an Aspergillus genus specific PCR assay targeting the rRNA genes is preferential. © The Author 2016. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Kim, Cheol-Hong; Woo, Heungjeong; Hyun, In Gyu; Kim, Changhwan; Choi, Jeong-Hee; Jang, Seung-Hun; Park, Sang Myeon; Kim, Dong-Gyu; Lee, Myung Goo; Jung, Ki-Suck; Hyun, Jeongwon; Kim, Hyun Soo
2014-06-01
Polymerase chain reaction (PCR) for the detection of Mycobacterium tuberculosis (MTB) is more sensitive, specific, and rapid than the conventional methods of acid-fast bacilli (AFB) smear and culture. The aim of this study was to determine if the Xpert MTB/rifampicin (RIF) assay had additional advantages over nested PCR for the detection of MTB in a geographical area with intermediate tuberculosis (TB) incidence. Between February and December 2013, the Xpert MTB/RIF assay and MTB nested PCR, as well as AFB smear and culture, were simultaneously performed on 198 clinical samples (160 pulmonary and 38 non-pulmonary specimens) collected from 171 patients hospitalized at Hallym University Medical Center for possible TB. The accuracy of the diagnosis of MTB culture-positive TB and the turnaround time of reporting laboratory results were calculated and compared. Rifampin resistance by the Xpert MTB/RIF assay was reviewed with that of conventional drug susceptibility testing (DST). The sensitivity, specificity, and positive and negative predictive values of the Xpert MTB/RIF assay and MTB nested PCR for diagnosis of MTB culture-positive pulmonary TB were 86.1% vs. 69.4% (P=0.1563), 97.8% vs. 94.1% (P=0.2173), 91.2% vs. 75.8% (P=0.1695), and 96.4% vs. 92.0% (P=0.2032), respectively. The median turnaround times of the Xpert MTB/RIF assay and MTB nested PCR were 0 [0-4] days and 4 [1-11] days, respectively (Pnested PCR for identifying MTB among clinically suspected TB patients, and the assay can be valuable in giving a timely identification of resistance to rifampin.
International Nuclear Information System (INIS)
Silvennoinen, R; Lundan, T; Kairisto, V; Pelliniemi, T-T; Putkonen, M; Anttila, P; Huotari, V; Mäntymaa, P; Siitonen, S; Uotila, L; Penttilä, T-L; Juvonen, V; Selander, T; Remes, K
2014-01-01
Multiparameter flow cytometry (MFC) and allele-specific oligonucleotide real-time quantitative PCR (ASO RQ-PCR) are the two most sensitive methods to detect minimal residual disease (MRD) in multiple myeloma (MM). We compared these methods in 129 paired post-therapy samples from 22 unselected, consecutive MM patients in complete/near complete remission. Appropriate immunophenotypic and ASO RQ-PCR-MRD targets could be detected and MRD analyses constructed for all patients. The high PCR coverage could be achieved by gradual widening of the primer sets used for clonality detection. In addition, for 13 (55%) of the patients, reverse orientation of the ASO primer and individual design of the TaqMan probe improved the sensitivity and specificity of ASO RQ-PCR analysis. A significant nonlinear correlation prevailed between MFC-MRD and PCR-MRD when both were positive. Discordance between the methods was found in 32 (35%) paired samples, which were negative by MFC-MRD, but positive by ASO RQ-PCR. The findings suggest that with the described technique, ASO RQ-PCR can be constructed for all patients with MM. ASO RQ-PCR is slightly more sensitive in MRD detection than 6−10-color flow cytometry. Owing to technical demands ASO RQ-PCR could be reserved for patients in immunophenotypic remission, especially in efficacy comparisons between different drugs and treatment modalities
Fahimzad, Alireza; Afgeh, Seyyed Abolfazl; Eghbali, Elham; Abdinia, Babak; Shiva, Farideh; Rahbar, Mohammad
2013-01-01
Cytomegalovirus (CMV) is a leading cause of congenital infection in neonates. Most infants with congenital CMV infection are asymptomatic at birth and not diagnosed on routine clinical examination. To identify these at-risk infants early in life, polymerase chain reaction (PCR) assays are done to screen large populations of newborn infants. We carried out a pilot study to estimate the prevalence of CMV in saliva from newborns by DNA PCR assay. This study was performed from January 2012 to March 2012 at a maternity hospital in the south of Tehran. All newborns aged between 1 to 14 days born at this hospital were enrolled. Saliva specimens from newborns were collected by swabbing the inside of the baby's mouth and stored at -70 degrees C until PCR processing for virus detection. Six-hundred and twenty infants between 1 to 14 days of age were enrolled during the study period of two months. The PCR assay was positive for CMV in 2 newborns [0.3%]. Both of these infants were asymptomatic for congenital CMV at birth and also when followed up at three months and six months of age. Our findings reveal that because of a low yield of positive results, screening for congenital CMV infection would not be cost-effective in Iranian neonates.
BLV-CoCoMo-qPCR: a useful tool for evaluating bovine leukemia virus infection status
Directory of Open Access Journals (Sweden)
Jimba Mayuko
2012-09-01
Full Text Available Abstract Background Bovine leukemia virus (BLV is associated with enzootic bovine leukosis, which is the most common neoplastic disease of cattle. BLV infects cattle worldwide, imposing a severe economic impact on the dairy cattle industry. Recently, we developed a new quantitative real-time polymerase chain reaction (PCR method using Coordination of Common Motifs (CoCoMo primers to measure the proviral load of known and novel BLV variants in BLV-infected animals. Indeed, the assay was highly effective in detecting BLV in cattle from a range of international locations. This assay enabled us to demonstrate that proviral load correlates not only with BLV infection capacity as assessed by syncytium formation, but also with BLV disease progression. In this study, we compared the sensitivity of our BLV-CoCoMo-qPCR method for detecting BLV proviruses with the sensitivities of two real-time PCR systems, and also determined the differences of proviral load with serotests. Results BLV-CoCoMo-qPCR was found to be highly sensitive when compared with the real-time PCR-based TaqMan MGB assay developed by Lew et al. and the commercial TaKaRa cycleave PCR system. The BLV copy number determined by BLV-CoCoMo-qPCR was only partially correlated with the positive rate for anti-BLV antibody as determined by the enzyme-linked immunosorbent assay, passive hemagglutination reaction, or agar gel immunodiffusion. This result indicates that, although serotests are widely used for the diagnosis of BLV infection, it is difficult to detect BLV infection with confidence by using serological tests alone. Two cattle were experimentally infected with BLV. The kinetics of the provirus did not precisely correlate with the change in anti-BLV antibody production. Moreover, both reactions were different in cattle that carried different bovine leukocyte antigen (BoLA-DRB3 genotypes. Conclusions Our results suggest that the quantitative measurement of proviral load by BLV-CoCoMo-qPCR
Directory of Open Access Journals (Sweden)
Iveta Svobodová
Full Text Available Detection and characterization of circulating cell-free fetal DNA (cffDNA from maternal circulation requires an extremely sensitive and precise method due to very low cffDNA concentration. In our study, droplet digital PCR (ddPCR was implemented for fetal RHD genotyping from maternal plasma to compare this new quantification alternative with real-time PCR (qPCR as a golden standard for quantitative analysis of cffDNA. In the first stage of study, a DNA quantification standard was used. Clinical samples, including 10 non-pregnant and 35 pregnant women, were analyzed as a next step. Both methods' performance parameters-standard curve linearity, detection limit and measurement precision-were evaluated. ddPCR in comparison with qPCR has demonstrated sufficient sensitivity for analysing of cffDNA and determination of fetal RhD status from maternal circulation, results of both methods strongly correlated. Despite the more demanding workflow, ddPCR was found to be slightly more precise technology, as evaluated using quantitative standard. Regarding the clinical samples, the precision of both methods equalized with decreasing concentrations of tested DNA samples. In case of cffDNA with very low concentrations, variance parameters of both techniques were comparable. Detected levels of fetal cfDNA in maternal plasma were slightly higher than expected and correlated significantly with gestational age as measured by both methods (ddPCR r = 0.459; qPCR r = 0.438.
Alpha toxin specific PCR for detection of toxigenic strains of Clostridium perfringens in Poultry
Directory of Open Access Journals (Sweden)
Malmarugan Shanmugasamy
2012-12-01
Full Text Available Aim : Isolation of clostridium perfirngens from necrotic enteritis cases in poultry and confirmation by alpha toxin specific PCR Materials and methods: Robertson cooked meat medium with Brain Heart Infusion broth was used for isolation of C. perfringens from intestinal contents of necrotic enteritis suspected birds. Positive cultures from perfringens agar were further confirmed by biochemical tests and subjected to alpha toxin specific PCR. Results: Twenty Clostridium perfringens isolates were isolated from intestinal contents of thirty five NE suspected birds. Out of the twenty isolates, fourteen were isolated from commercial broilers of 2 to 6 wk of age and six from commercial layers of 9 to 15 wk of age. Frequency of isolation of C. perfringens was more with Robertson cooked meat medium with BHI broth than thioglycollate broth alone. When positive cultures were streaked on to clostridial agar appreciable luxuriant growths were obtained and the selective streaking of these colonies on perfringens agar with supplements revealed rough and black colonies with sulphate reduction. The isolates produced rough and black colonies with sulphate reduction on perfringens agar, double zone haemolysis on sheep blood agar, stormy clot fermentation on milk medium and opalescence on egg yolk medium. The isolates were found negative for oxidase, catalase, liquefied gelatin, fermented glucose, maltose, lactose and sucrose except mannitol. All the fourteen isolates obtained from commercial broilers proved the alpha toxin producing strains of C. perfringens when they were subjected to alpha toxin specific PCR. Conclusion : This study revealed alpha toxin specific PCR is highly useful for detection of toxigenic strains of Clostridium perfringens in poultry [Vet. World 2012; 5(6.000: 365-368
International Nuclear Information System (INIS)
Anon.
2012-01-01
The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)
Risk of breast cancer after false-positive results in mammographic screening.
Román, Marta; Castells, Xavier; Hofvind, Solveig; von Euler-Chelpin, My
2016-06-01
Women with false-positive results are commonly referred back to routine screening. Questions remain regarding their long-term outcome of breast cancer. We assessed the risk of screen-detected breast cancer in women with false-positive results. We conducted a joint analysis using individual level data from the population-based screening programs in Copenhagen and Funen in Denmark, Norway, and Spain. Overall, 150,383 screened women from Denmark (1991-2008), 612,138 from Norway (1996-2010), and 1,172,572 from Spain (1990-2006) were included. Poisson regression was used to estimate the relative risk (RR) of screen-detected cancer for women with false-positive versus negative results. We analyzed information from 1,935,093 women 50-69 years who underwent 6,094,515 screening exams. During an average 5.8 years of follow-up, 230,609 (11.9%) women received a false-positive result and 27,849 (1.4%) were diagnosed with screen-detected cancer. The adjusted RR of screen-detected cancer after a false-positive result was 2.01 (95% CI: 1.93-2.09). Women who tested false-positive at first screen had a RR of 1.86 (95% CI: 1.77-1.96), whereas those who tested false-positive at third screening had a RR of 2.42 (95% CI: 2.21-2.64). The RR of breast cancer at the screening test after the false-positive result was 3.95 (95% CI: 3.71-4.21), whereas it decreased to 1.25 (95% CI: 1.17-1.34) three or more screens after the false-positive result. Women with false-positive results had a twofold risk of screen-detected breast cancer compared to women with negative tests. The risk remained significantly higher three or more screens after the false-positive result. The increased risk should be considered when discussing stratified screening strategies. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Costa Elena
2011-05-01
Full Text Available Abstract Background 22q11.2 microdeletion is responsible for the DiGeorge Syndrome, characterized by heart defects, psychiatric disorders, endocrine and immune alterations and a 1 in 4000 live birth prevalence. Real-time quantitative PCR (qPCR approaches for allelic copy number determination have recently been investigated in 22q11.2 microdeletions detection. The qPCR method was performed for 22q11.2 microdeletions detection as a first-level screening approach in a genetically unknown series of patients with congenital heart defects. A technical issue related to the VPREB1 qPCR marker was pointed out. Methods A set of 100 unrelated Italian patients with congenital heart defects were tested for 22q11.2 microdeletions by a qPCR method using six different markers. Fluorescence In Situ Hybridization technique (FISH was used for confirmation. Results qPCR identified six patients harbouring the 22q11.2 microdeletion, confirmed by FISH. The VPREB1 gene marker presented with a pattern consistent with hemideletion in one 3 Mb deleted patient, suggestive for a long distal deletion, and in additional five non-deleted patients. The long distal 22q11.2 deletion was not confirmed by Comparative Genomic Hybridization. Indeed, the VPREB1 gene marker generated false positive results in association with the rs1320 G/A SNP, a polymorphism localized within the VPREB1 marker reverse primer sequence. Patients heterozygous for rs1320 SNP, showed a qPCR profile consistent with the presence of a hemideletion. Conclusions Though the qPCR technique showed advantages as a screening approach in terms of cost and time, the VPREB1 marker case revealed that single nucleotide polymorphisms can interfere with qPCR data generating erroneous allelic copy number interpretations.
Identification of Candida Species Associated with Vulvovaginal Candidiasis by Multiplex PCR
Directory of Open Access Journals (Sweden)
Mahnaz Mahmoudi Rad
2012-01-01
Full Text Available Background. Vulvovaginal candidiasis is a common infection. The aim of this study was to identify the species of vaginal Candida isolates by using multiplex PCR technique. Methods. 191 isolates from patients admitted to Mahdieh hospital were identified. The vaginal swab specimens were cultured on Sabouraud Dextrose Agar. The ITS1 region between the 18S and 5.8S rRNA genes and a specific DNA fragment within the ITS2 region were amplified. The multiplex PCR products were separated by electrophoresis in 2% agarose gel, visualized by staining with ethidium bromide, and photographed. Descriptive statistics, Chi-square test, and Spearman correlation were used to summarize the findings. Results. C. albicans and C. glabrata were the most common species isolated from the specimens. A mix of C. glabrata and C. albicans was the most common mixed infection isolated from the samples. The analysis revealed a significant positive association between older age and infection with C. glabrata isolates (Spearman’s rho = 0.89, P=0.015. Conclusion. Multiplex PCR is a fast, yet reliable method to identify Candida species. C. albicans and then C. glabrata are the two most common causes of vulvovaginal candidiasis. The number of mixed fungal infections is higher among Iranian population compared to international reports.
Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen
2017-05-01
Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3 ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.
Legionella detection by culture and qPCR: Comparing apples and oranges.
Whiley, Harriet; Taylor, Michael
2016-01-01
Legionella spp. are the causative agent of Legionnaire's disease and an opportunistic pathogen of significant public health concern. Identification and quantification from environmental sources is crucial for identifying outbreak origins and providing sufficient information for risk assessment and disease prevention. Currently there are a range of methods for Legionella spp. quantification from environmental sources, but the two most widely used and accepted are culture and real-time polymerase chain reaction (qPCR). This paper provides a review of these two methods and outlines their advantages and limitations. Studies from the last 10 years which have concurrently used culture and qPCR to quantify Legionella spp. from environmental sources have been compiled. 26/28 studies detected Legionella at a higher rate using qPCR compared to culture, whilst only one study detected equivalent levels of Legionella spp. using both qPCR and culture. Aggregating the environmental samples from all 28 studies, 2856/3967 (72%) tested positive for the presence of Legionella spp. using qPCR and 1331/3967 (34%) using culture. The lack of correlation between methods highlights the need to develop an acceptable standardized method for quantification that is sufficient for risk assessment and management of this human pathogen.
Menting, Sandra; Thai, Khoa T. D.; Nga, Tran T. T.; Phuong, Hoang L.; Klatser, Paul; Wolthers, Katja C.; Binh, Tran Q.; de Vries, Peter J.; Beld, Marcel
2011-01-01
Dengue has become a global public health problem and a sensitive diagnostic test for early phase detection can be life saving. An internally controlled, generic real-time PCR was developed and validated by testing serial dilutions of a DENV positive control RNA in the presence of a fixed amount of
Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2015-07-01
Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).
Directory of Open Access Journals (Sweden)
Yogita Maheshwari
Full Text Available Droplet digital polymerase chain reaction (ddPCR is a method for performing digital PCR that is based on water-oil emulsion droplet technology. It is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. This study evaluated the applicability of ddPCR as a quantitative detection tool for the Spiroplasma citri, causal agent of citrus stubborn disease (CSD in citrus. Two sets of primers, SP1, based on the spiral in housekeeping gene, and a multicopy prophage gene, SpV1 ORF1, were used to evaluate ddPCR in comparison with real time (quantitative PCR (qPCR for S. citri detection in citrus tissues. Standard curve analyses on tenfold dilution series showed that both ddPCR and qPCR exhibited good linearity and efficiency. However, ddPCR had a tenfold greater sensitivity than qPCR and accurately quantified up to one copy of spiralin gene. Receiver operating characteristic analysis indicated that the ddPCR methodology was more robust for diagnosis of CSD and the area under the curve was significantly broader compared to qPCR. Field samples were used to validate ddPCR efficacy and demonstrated that it was equal or better than qPCR to detect S. citri infection in fruit columella due to a higher pathogen titer. The ddPCR assay detected both the S. citri spiralin and the SpV1 ORF1 targets quantitatively with high precision and accuracy compared to qPCR assay. The ddPCR was highly reproducible and repeatable for both the targets and showed higher resilience to PCR inhibitors in citrus tissue extract for the quantification of S. citri compare to qPCR.
Izadi, Morteza; Jonaidi Jafari, Nematollah; Sadraei, Javid; Mahmoodzadeh Poornaki, Abbas; Rezavand, Babak; Zarrinfar, Hossein; Abdi, Jahangir; Mohammadi, Younes
2014-12-01
The use of immune suppressive drugs for organ transplant recipients predisposes them to opportunistic infections, especially by fungal agents. Pneumocystis jiroveci, as an opportunistic pathogen, endangers the patients' life in those with immune system disorders. Early detection of latent Pneumocystis infection in susceptible patients may help choose the optimal treatment for these patients. The aim of this study was to identify and determine the colonization of latent P. jiroveci infection among lung transplant recipients. This cross-sectional descriptive study was conducted on lung transplant recipients. Bronchoalveolar lavage (BAL) specimens were collected from 32 patients undergoing bronchoscopy. The samples were aseptically homogenized by 10 mM dithiothreitol, and their DNA was extracted. The mtLSUrRNA gene of P. jiroveci was amplified using nested PCR in two stages. Nested PCR was performed using external primers of pAZ-102-E and pAZ102-H followed by using the PCR product of the first stage and internal primers of pAZ-102-E and pAZ102-L2. The genome of P. jiroveci was revealed by a 346 bp PCR product in the initial amplification and a 120 bp product in the nested PCR. The results showed that seven BAL specimens (21.9%) from lung transplant recipients were positive for P. jiroveci. In molecular epidemiology studies, nested PCR has higher sensitivity than PCR. Results of this study support the colonization of P. jiroveci in patients receiving lung transplantation. Patients who are carriers of P. jiroveci are at a higher risk of P. jiroveci pneumonia.
Kletzel, Morris; Huang, Wei; Olszewski, Marie; Khan, Sana
2013-01-01
Post-hematopoietic stem cell transplantation (HSCT) chimerism monitoring is important to assess relapse and therapeutic intervention. The purpose of our study is to compare two methods variable number tandem repeats (VNTR) vs. quantitative real- time polymerase chain reaction (qPCR) in terms of determining chimerism. 127 (peripheral blood n=112, bone marrow n=15) samples were simultaneously tested by VNTR using APO-B, D1S80, D1S111, D17S30, gene loci SRY and ZP3 and qPCR using 34 assays (CA001-CA034) that are designed to a bi-allelic insertion/deletion (indel) polymorphism in the human genome. Samples were separated in three subsets: total WBC, T-cell and Myeloid cells. Extraction of DNA was performed then quantified. We analyzed column statistics, paired t-test and regression analysis for both methods. There was complete correlation between the two methods. The simplicity and rapidity of the test results from the qPCR method is more efficient and accurate to assess chimerism.
Directory of Open Access Journals (Sweden)
Marsh Robyn L
2012-10-01
Full Text Available Abstract Background Otitis media is endemic in remote Indigenous communities of Australia’s Northern Territory. Alloiococcus otitidis is an outer ear commensal and putative middle ear pathogen that has not previously been described in acute otitis media (AOM in this population. The aims of this study were to determine the presence, antibiotic susceptibility and bacterial load of A. otitidis in nasopharyngeal and ear discharge swabs collected from Indigenous Australian children with AOM with perforation. Methods Paired nasopharyngeal and ear discharge swabs from 27 children with AOM with perforation were tested by A. otitidis quantitative PCR (qPCR. Positive swabs were cultured for 21 days. Total and respiratory pathogen bacterial loads in A. otitidis-positive swabs were determined by qPCR. Results A. otitidis was detected by qPCR in 11 ear discharge swabs from 10 of 27 (37% children, but was not detected in paired nasopharyngeal swabs. A. otitidis was cultured from 5 of 11 qPCR-positive swabs from four children. All A. otitidis isolates had minimum inhibitory concentrations consistent with macrolide resistance. All A. otitidis qPCR-positive swabs were culture-positive for other bacteria. A. otitidis bacterial load ranged from 2.2 × 104-1.1 × 108 cells/swab (median 1.8 × 105 cells/swab. The relative abundance of A. otitidis ranged from 0.01% to 34% of the total bacterial load (median 0.7%. In 6 of 11 qPCR-positive swabs the A. otitidis relative abundance was A. otitidis bacterial load and relative abundance measures were comparable to that of Haemophilus influenzae. Conclusions A. otitidis can be a dominant species in the bacterial communities present in the ear discharge of Indigenous children with AOM with perforation. The absence of A. otitidis in nasopharyngeal swabs suggests the ear canal as the likely primary reservoir. The significance of A. otitidis at low relative abundance is unclear; however, at higher relative
Directory of Open Access Journals (Sweden)
Andreas Garcia-Bardon
Full Text Available Real-time reverse transcription polymerase chain reaction (PCR is the gold standard for expression analysis. Designed to improve reproducibility and sensitivity, commercial kits are commonly used for the critical step of cDNA synthesis. The present study was designed to determine the impact of these kits. mRNA from mouse brains were pooled to create serial dilutions ranging from 0.0625 μg to 2 μg, which were transcribed into cDNA using four different commercial reverse-transcription kits. Next, we transcribed mRNA from brain tissue after acute brain injury and naïve mice into cDNA for qPCR. Depending on tested genes, some kits failed to show linear results in dilution series and revealed strong variations in cDNA yield. Absolute expression data in naïve and trauma settings varied substantially between these kits. Normalization with a housekeeping gene failed to reduce kit-dependent variations, whereas normalization eliminated differences when naïve samples from the same region were used. The study shows strong evidence that choice of commercial cDNA synthesis kit has a major impact on PCR results and, consequently, on comparability between studies. Additionally, it provides a solution to overcome this limitation by normalization with data from naïve samples. This simple step helps to compare mRNA expression data between different studies and groups.
Detection of Mycoplasma synoviae in clinical samples by VlhA-PCR method
Directory of Open Access Journals (Sweden)
H Ansari
2010-02-01
Full Text Available As one of the major pathogens of avian species, Mycoplasma Synoviae causes significant economic losses to the poultry industry. The main purpose of this study was to detect Mycoplasma Synoviae in clinical samples using the VlhA-PCR method. For serological screening test, 373 serum samples were collected from 25 breeder farms and rapid serum agglutination test conducted which revealed that 143 samples equivalent to 19 breeder farms were positive. For VlhA-PCR assay, 20 of the previously mentioned breeder farms were selected and sterile swab were collected from the palatine cleft, trachea, air sacs and lungs. Three swabs from 3 birds were placed in a test tube containing 1 ml of PBS and transferred to the laboratory for PCR test. Specific primers for VIhA gene were employed in this study. The PCR product from specific primers showed 350-400 bp for all field isolated on electrophoresis gel in 8 farms. VlhA-PCR with high sensitivity could be employed in definitive diagnosis of Mycoplasma Synoviae infection in the laboratory.
Randazzo, W; López-Gálvez, Francisco; Allende, A; Aznar, R; Sánchez, G
2016-07-16
Norovirus (NoV) detection in food and water is mainly carried out by quantitative RT-PCR (RT-qPCR). The inability to differentiate between infectious and inactivated viruses and the resulting overestimation of viral targets is considered a major disadvantage of RT-qPCR. Initially, conventional photoactivatable dyes (i.e. propidium monoazide, PMA and ethidium monoazide, EMA) and newly developed ones (i.e. PMAxx and PEMAX) were evaluated for the discrimination between infectious and thermally inactivated NoV genogroup I (GI) and II (GII) suspensions. Results showed that PMAxx was the best photoactivatable dye to assess NoV infectivity. This procedure was further optimized in artificially inoculated lettuce. Pretreatment with 50μM PMAxx and 0.5% Triton X-100 (Triton) for 10min reduced the signal of thermally inactivated NoV by ca. 1.8 logs for both genogroups in lettuce concentrates. Additionally, this pretreatment reduced the signal of thermally inactivated NoV GI between 1.4 and 1.9 logs in spinach and romaine and lamb's lettuces and by >2 logs for NoV GII in romaine and lamb's lettuce samples. Moreover this pretreatment was satisfactorily applied to naturally-contaminated water samples with NoV GI and GII. Based on the obtained results this pretreatment has the potential to be integrated in routine diagnoses to improve the interpretation of positive NoV results obtained by RT-qPCR. Copyright © 2016 Elsevier B.V. All rights reserved.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Directory of Open Access Journals (Sweden)
Gleison Ricardo de Biazio
2008-09-01
Full Text Available The main objective of this work was to develop a PCR protocol for the identification of Fusarium graminearum, based on a pair of primers targeted to a segment of the 3' coding region of the gaoA gene that codes for the enzyme galactose oxidase (GO. This region has low homology with the same region of GO genes from other fungi. Genomic DNA from 17 strains of Fusarium spp. isolated from diseased cereals, from several other Fusarium species, and from other fungi genera was analyzed in a PCR assay using this primer set. The 17 strains of Fusarium spp. were also analyzed for the GO enzyme production in submerse fermentation in a new formulated liquid medium. All strains that were morphologically and molecularly identified as F. graminearum were able to secrete the enzyme and had a positive result in the used PCR protocol. No DNA fragment was amplified using genomic DNA from other Fusarium species and species of other fungi genera. The results suggest that the proposed PCR protocol is specific and can be considered as a new molecular tool for the identification of F. graminearum. In addition, the new formulated medium is a cheap alternative for screening for GO screening production by F. graminearum.O principal objetivo deste trabalho foi desenvolver um novo protocolo de PCR para identificação de isolados de Fusarium graminearum, baseado no uso de um par de iniciadores direcionado para um segmento da região 3' codificadora do gene gaoA que codifica a enzima galactose oxidase (GO. Esta região possui baixa homologia com a mesma região de genes da GO de outros fungos. O DNA genômico de 17 cepas de Fusarium spp. isoladas de cereais infectados com sintomas, de vários outras espécies de Fusarium e de outros gêneros de fungos foi analisado em um protocolo de PCR utilizando os iniciadores desenhados. Os 17 isolados de Fusarium spp. também foram analisados para a produção da enzima GO em fermentação submersa em um novo meio líquido. Todas as
Comparison of PCR and common clinical tests for the diagnosis of H. pylori in dyspeptic patients.
Pacheco, N; Mago, V; Gómez, I; Gueneau, P; Guelrud, M; Reyes, N; Pericchi, L R; Domínguez-Bello, M G
2001-04-01
Helicobacter pylori has been recognized as a major gastric pathogen. The objective of this study was to assess the diagnostic value of common clinical tests to detect H. pylori infection, by comparison with PCR. Serum and gastric biopsy specimens from 106 dyspeptic patients were examined. Serology was performed with Pyloriset Dry test, and biopsies were examined histologically, for rapid urease activity and PCR amplification of an ureA gene segment of H. pylori. PCR primers were specific for H. pylori and required at least 1.47 pg of H. pylori DNA, corresponding to about 800 bacterial cells. According to serology, histology, rapid urease, and PCR, positive results were respectively found in 56%, 86%, 64%, and 85% of dyspeptic patients, primarily with gastritis. Relative to PCR, the sensitivity (and specificity) was 55% (38%) for serology, 86% (13%) for histology, 70% (69%) for urease. When combining histology and urease, Bayesian analysis of data indicated no advantage of using combined methods over rapid urease test alone. Histology should not any longer be considered a gold standard test for Helicobacter pylori. Urea breath test still seems the first option for non invasive diagnostic. If an invasive diagnostic is justified, highly specific and sensitive molecular methods should be used to examine specimens.
Directory of Open Access Journals (Sweden)
Moore John E
2004-10-01
Full Text Available Abstract Background Pseudomonas aeruginosa (PA is the most important bacterial pathogen in patients with cystic fibrosis (CF patients. Currently, routine bacteriological culture on selective/non- selective culture media is the cornerstone of microbiological detection. The aim of this study was to compare isolation rates of PA by conventional culture and molecular (PCR detection directly from sputum. Methods Adult patients (n = 57 attending the regional adult CF centre in Northern Ireland, provided fresh sputum following airways clearance exercise. Following processing of the specimen with sputasol (1:1 vol, the specimen was examined for the presence of PA by plating onto a combination of culture media (Pseudomonas isolation agar, Blood agar & McConkey agar. In addition, from the same specimen, genomic bacterial DNA was extracted (1 ml and was amplified employing two sequence-specific targets, namely (i the outer membrane protein (oprL gene locus and (ii the exotoxin A (ETA gene locus. Results By sputum culture, there were 30 patients positive for PA, whereas by molecular techniques, there were 35 positive patients. In 39 patients (22 PA +ve & 17 PA -ve, there was complete agreement between molecular and conventional detection and with both PCR gene loci. The oprL locus was more sensitive than the ETA locus, as the former was positive in 10 more patients and there were no patients where the ETA was positive and the oprL target negative. Where a PCR +ve/culture -ve result was recorded (10 patients, we followed these patients and recorded that 5 of these patients converted to being culture-positive at times ranging from 4–17 months later, with a mean lag time of 4.5 months. Conclusions This study indicates that molecular detection of PA in sputum employing the oprL gene target, is a useful technique in the early detection of PA, gaining on average 4.5 months over conventional culture. It now remains to be established whether aggressive antibiotic
Neurotoxoplasmosis diagnosis for HIV-1 patients by real-time PCR of cerebrospinal fluid
Directory of Open Access Journals (Sweden)
Fábio Luís Nascimento Nogui
Full Text Available Encephalitis caused by Toxoplasma gondii is the most common cause of central nervous system damage in patients with acquired immunodeficiency syndrome (AIDS. Toxoplasma may infect any of the brain cells, thus leading to non-specific neurotoxoplasmosis clinical manifestations including focused or non-focused signs and symptoms of central nervous system malfunction. Clinical development ranges from insidious display during weeks to experiencing acute general confusion or ultimately fatal onset. Cerebral toxoplasmosis occurs in advanced stages of immunodeficiency, and the absence of anti-toxoplasmosis antibodies by the immunofluorescence method does not allow us to rule out its diagnosis. As specific therapy begins, diagnosis confirmation is sought through clinical and radiological response. There are few accurate diagnosis methods to confirm such cases. We present a method for T. gondii DNA detection by real time PCR-Multiplex. Fifty-one patients were evaluated; 16 patients had AIDS and a presumptive diagnosis for toxoplasmosis, 23 patients were HIV-positive with further morbidities except neurotoxoplasmosis, and 12 subjects were HIV-negative control patients. Real time PCR-Multiplex was applied to these patients' cephalorachidian liquid with a specific T. gondii genome sequence from the 529bp fragment. This test is usually carried out within four hours. Test sensitivity, specificity, positive predictive value, and negative predictive value were calculated according to applicable tables. Toxoplasma gondii assay by real time Multiplex of cephalorachidian fluid was positive for 11 out of 16 patients with AIDS and a presumptive diagnosis for cerebral toxoplasmosis, while none of the 35 control patients displayed such a result. Therefore, this method allowed us to achieve 68.8% sensitivity, 100% specificity, 100% positive predictive value, and 87.8% negative predictive value. Real time PCR on CSF allowed high specificity and good sensitivity among
PCR+ In Diesel Fuels and Emissions Research
Energy Technology Data Exchange (ETDEWEB)
McAdams, H.T.
2002-04-15
In past work for the U.S. Department of Energy (DOE) and Oak Ridge National Laboratory (ORNL), PCR+ was developed as an alternative methodology for building statistical models. PCR+ is an extension of Principal Components Regression (PCR), in which the eigenvectors resulting from Principal Components Analysis (PCA) are used as predictor variables in regression analysis. The work was motivated by the observation that most heavy-duty diesel (HDD) engine research was conducted with test fuels that had been ''concocted'' in the laboratory to vary selected fuel properties in isolation from each other. This approach departs markedly from the real world, where the reformulation of diesel fuels for almost any purpose leads to changes in a number of interrelated properties. In this work, we present new information regarding the problems encountered in the conventional approach to model-building and how the PCR+ method can be used to improve research on the relationship between fuel characteristics and engine emissions. We also discuss how PCR+ can be applied to a variety of other research problems related to diesel fuels.
Zhu, Yu; Liang, Lin; Luo, Yakun; Wang, Guihua; Wang, Chunren; Cui, Yudong; Ai, Xia; Cui, Shangjin
2017-02-01
In this study, a novel duplex nanoparticle-assisted polymerase chain reaction (nanoPCR) assay was developed to detect porcine epidemic diarrhea virus (PEDV) and porcine transmissible gastroenteritis virus (TGEV). Two pairs of primers were designed based on the conserved region within the N gene of PEDV and TGEV. In a screening of 114 clinical samples from four provinces in China for PEDV and TGEV, 48.2 and 3.5 % of the samples, respectively, tested positive. Under optimized conditions, the duplex nanoPCR assay had a detection limit of 7.6 × 10 1 and 8.5 × 10 1 copies μL -1 for PEDV and TGEV, respectively. The sensitivity of the duplex nanoPCR assay was ten times higher than that of a conventional PCR assay. Moreover, no fragments were amplified when the duplex nanoPCR assay was used to test samples containing other porcine viruses. Our results indicate that the duplex nanoPCR assay described here is useful for the rapid detection of PEDV and TGEV and can be applied in clinical diagnosis.
Directory of Open Access Journals (Sweden)
Cielo M. León
2017-10-01
Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.
León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.
2017-01-01
Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670
Martinez-Lopez, Joaquin; Fernández-Redondo, Elena; García-Sánz, Ramón; Montalbán, María Angeles; Martínez-Sánchez, Pilar; Pavia, Bruno; Mateos, María Victoria; Rosiñol, Laura; Martín, Marisa; Ayala, Rosa; Martínez, Rafael; Blanchard, María Jesus; Alegre, Adrian; Besalduch, Joan; Bargay, Joan; Hernandez, Miguel T; Sarasquete, María Eugenia; Sanchez-Godoy, Pedro; Fernández, Manuela; Blade, Joan; San Miguel, Jesús F; Lahuerta, Juan Jose
2013-12-01
Minimal residual disease monitoring is becoming increasingly important in multiple myeloma (MM), but multiparameter flow cytometry (MFC) and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR) techniques are not routinely available. This study investigated the prognostic influence of achieving molecular response assessed by fluorescent-PCR (F-PCR) in 130 newly diagnosed MM patients from Grupo Español Multidisciplinar de Melanoma (GEM)2000/GEM05 trials (NCT00560053, NCT00443235, NCT00464217) who achieved almost very good partial response after induction therapy. As a reference, we used the results observed with simultaneous MFC. F-PCR at diagnosis was performed on DNA using three different multiplex PCRs: IGH D-J, IGK V-J and KDE rearrangements. The applicability of F-PCR was 91·5%. After induction therapy, 64 patients achieved molecular response and 66 non-molecular response; median progression-free survival (PFS) was 61 versus 36 months, respectively (P = 0·001). Median overall survival (OS) was not reached (NR) in molecular response patients (5-year survival: 75%) versus 66 months in the non-molecular response group (P = 0·03). The corresponding PFS and OS values for patients with immunophenotypic versus non-immunophenotypic response were 67 versus 42 months (P = 0·005) and NR (5-year survival: 95%) versus 69 months (P = 0·004), respectively. F-PCR analysis is a rapid, affordable, and easily performable technique that, in some circumstances, may be a valid approach for minimal residual disease investigations in MM. © 2013 John Wiley & Sons Ltd.
Comparison of polymerase chain reaction (PCR) and loop-mediated ...
African Journals Online (AJOL)
Comparison of polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) for diagnosis of Fusarium solani in human immunodeficiency virus (HIV) positive patients. ... The test was carried out in 1 h reaction at 65°C in a heater block. The specificity of the test was 100% and its sensitivity was a ...
Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju
2016-10-01
Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.
HPV-16 viral load in oropharyngeal squamous cell carcinoma using digital PCR.
Antonsson, Annika; Knight, Lani; Panizza, Benedict J; Porceddu, Sandro V; Emmett, Sarah; Whiteman, David C
2018-05-09
We did not identify any strong associations between HPV-16 viral load and any of the clinical or lifestyle factors. The epidemiology of oropharyngeal SCC is changing, with an increasing proportion of HPV-positive cases seen in the last decade. It is known that a high viral load is linked to the development of cervical cancer, the relation between viral load and oropharyngeal SCC is less clear. We sought to determine HPV-16 viral load in HPV-positive oropharyngeal SCCs using highly sensitive digital PCR and to identify clinical and lifestyle factors associated with viral load. We analysed 45 HPV-16 positive oropharyngeal SCCs diagnosed between 2013 and 2015. All patients completed a lifestyle questionnaire and clinical data were extracted from medical charts. Viral load was determined using digital PCR assays for HPV-L1 and RNAseP. We found large variations in HPV-16 viral load from 1 to 930 copies per cell (median 34 copies per cell).
Wilson, D A; Yen-Lieberman, B; Schindler, S; Asamoto, K; Schold, J D; Procop, G W
2012-12-01
A comparison of direct fluorescent-antibody assay (DFA), culture, and two PCR assays disclosed sensitivities of 87.8%, 46.3%, and 97.6% and 100%, respectively. We reviewed 1,150 results for clinical specimens submitted for DFA and culture and found that only 17 were culture positive/DFA negative. The incremental cost to detect these 17 positives was $3,078/specimen.
Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang
2018-05-01
Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Frickmann, Hagen; Tenner-Racz, Klara; Eggert, Petra; Schwarz, Norbert G; Poppert, Sven; Tannich, Egbert; Hagen, Ralf M
2013-12-01
We report on the reliability of polymerase chain reaction (PCR) for the detection of Entamoeba histolytica from formalin-fixed, paraffin-embedded tissue in comparison with microscopy and have determined predictors that may influence PCR results. E. histolytica-specific and Entamoeba dispar-specific real-time PCR and microscopy from adjacent histologic sections were performed using a collection of formalin-fixed, paraffin-embedded tissue specimens obtained from patients with invasive amebiasis. Specimens had been collected during the previous 4 decades. Association of sample age, parasite density, and reliability of PCR was analyzed. E. histolytica PCR was positive in 20 of 34 biopsies (58.8%); 2 of these 20 were microscopically negative for amebae in neighboring tissue sections. PCR was negative in 9 samples with visible amebae in neighboring sections and in 5 samples without visible parasites in neighboring sections. PCR was negative in all specimens that were older than 3 decades. Low parasite counts and sample ages older than 20 years were predictors for false-negative PCR results. All samples were negative for E. dispar DNA. PCR is suitable for the detection of E. histolytica in formalin-fixed, paraffin-embedded tissue samples that are younger than 2 decades and that contain intermediate to high parasite numbers. Negative results in older samples were due to progressive degradation of DNA over time as indicated by control PCRs targeting the human 18S rRNA gene. Moreover, our findings support previous suggestions that only E. histolytica but not E. dispar is responsible for invasive amebiasis.
Detection of Mycoplasma genitalium in female cervical samples by Multitarget Real-Time PCR
Directory of Open Access Journals (Sweden)
Sabina Mahmutović-Vranić
2007-05-01
Full Text Available Mycoplasma genitalum (MG is associated with variety of urogenital infections such as non-gonococcal urethritis (NGU, endometritis and cervicitis. The objective of this study was to demonstrate and evaluate a research polymerase chain reaction (PCR assay, for the detection of MG in cervical samples of a tested population of women attending gynecology clinics in Bosnia and Herzegovina. The Multitarget Real-Time (MTRT PCR, utilizing the ABI 7900HT, the sequence detection system, was performed for the detection of MG. Cervical samples (N=97 from females were divided into three types of patient groups: Group 1: patients who had known abnormal clinical cytology reports (N=34; Group 2: patients who reported a history of genitourinary infections (N=22; and Group 3: patients not in either groups 1 or 2 (N=41. Overall, 14,43% (14/97 of those tested were positive for MG. A positive sample was defined as having a cycle threshold cross point (Ct < 40,0 with a fluorescent detection comparable to the low positive control utilized during the run. This study validated the use of MTRT PCR as a reliable method for the detection of MG in clinical specimens and should facilitate large-scale screening for this organism.
Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW
2009-01-01
Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...
De Spiegelaere, Ward; Malatinkova, Eva; Lynch, Lindsay; Van Nieuwerburgh, Filip; Messiaen, Peter; O'Doherty, Una; Vandekerckhove, Linos
2014-06-01
Quantification of integrated proviral HIV DNA by repetitive-sampling Alu-HIV PCR is a candidate virological tool to monitor the HIV reservoir in patients. However, the experimental procedures and data analysis of the assay are complex and hinder its widespread use. Here, we provide an improved and simplified data analysis method by adopting binomial and Poisson statistics. A modified analysis method on the basis of Poisson statistics was used to analyze the binomial data of positive and negative reactions from a 42-replicate Alu-HIV PCR by use of dilutions of an integration standard and on samples of 57 HIV-infected patients. Results were compared with the quantitative output of the previously described Alu-HIV PCR method. Poisson-based quantification of the Alu-HIV PCR was linearly correlated with the standard dilution series, indicating that absolute quantification with the Poisson method is a valid alternative for data analysis of repetitive-sampling Alu-HIV PCR data. Quantitative outputs of patient samples assessed by the Poisson method correlated with the previously described Alu-HIV PCR analysis, indicating that this method is a valid alternative for quantifying integrated HIV DNA. Poisson-based analysis of the Alu-HIV PCR data enables absolute quantification without the need of a standard dilution curve. Implementation of the CI estimation permits improved qualitative analysis of the data and provides a statistical basis for the required minimal number of technical replicates. © 2014 The American Association for Clinical Chemistry.
Review: Diagnostic accuracy of PCR-based detection tests for Helicobacter Pylori in stool samples.
Khadangi, Fatemeh; Yassi, Maryam; Kerachian, Mohammad Amin
2017-12-01
Although different methods have been established to detect Helicobacter pylori (H. pylori) infection, identifying infected patients is an ongoing challenge. The aim of this meta-analysis was to provide pooled diagnostic accuracy measures for stool PCR test in the diagnosis of H. pylori infection. In this study, a systematic review and meta-analysis were carried out on various sources, including MEDLINE, Web of Sciences, and the Cochrane Library from April 1, 1999, to May 1, 2016. This meta-analysis adheres to the guidelines provided by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses report (PRISMA Statement). The clinical value of DNA stool PCR test was based on the pooled false positive, false negative, true positive, and true negative of different genes. Twenty-six of 328 studies identified met the eligibility criteria. Stool PCR test had a performance of 71% (95% CI: 68-73) sensitivity, 96% (95% CI: 94-97) specificity, and 65.6 (95% CI: 30.2-142.5) diagnostic odds ratio (DOR) in diagnosis of H. pylori. The DOR of genes which showed the highest performance of stool PCR tests was as follows: 23S rRNA 152.5 (95% CI: 55.5-418.9), 16S rRNA 67.9 (95%CI: 6.4-714.3), and glmM 68.1 (95%CI: 20.1-231.7). The sensitivity and specificity of stool PCR test are relatively in the same spectrum of other diagnostic methods for the detection of H. pylori infection. In descending order of significance, the most diagnostic candidate genes using PCR detection were 23S rRNA, 16S rRNA, and glmM. PCR for 23S rRNA gene which has the highest performance could be applicable to detect H. pylori infection. © 2017 John Wiley & Sons Ltd.
Mackay, Ian M; Arden, Katherine E; Nitsche, Andreas
2002-03-15
The use of the polymerase chain reaction (PCR) in molecular diagnostics has increased to the point where it is now accepted as the gold standard for detecting nucleic acids from a number of origins and it has become an essential tool in the research laboratory. Real-time PCR has engendered wider acceptance of the PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination. There are currently five main chemistries used for the detection of PCR product during real-time PCR. These are the DNA binding fluorophores, the 5' endonuclease, adjacent linear and hairpin oligoprobes and the self-fluorescing amplicons, which are described in detail. We also discuss factors that have restricted the development of multiplex real-time PCR as well as the role of real-time PCR in quantitating nucleic acids. Both amplification hardware and the fluorogenic detection chemistries have evolved rapidly as the understanding of real-time PCR has developed and this review aims to update the scientist on the current state of the art. We describe the background, advantages and limitations of real-time PCR and we review the literature as it applies to virus detection in the routine and research laboratory in order to focus on one of the many areas in which the application of real-time PCR has provided significant methodological benefits and improved patient outcomes. However, the technology discussed has been applied to other areas of microbiology as well as studies of gene expression and genetic disease.
Sandes, V S; Silva, S G C; Motta, I J F; Velarde, L G C; de Castilho, S R
2017-06-01
We propose to analyse the positive and false-positive results of treponemal and nontreponemal tests in blood donors from Brazil and to evaluate possible factors associated with the results of treponemal tests. Treponemal tests have been used widely for syphilis screening in blood banks. The introduction of these tests in donor screening has caused an impact and a loss of donors who need to be assessed. This was a retrospective cross-sectional study of syphilis screening and confirmatory test results of blood donors that were obtained before and after adopting a chemiluminescent immunoassay (CLIA). A comparative analysis was performed using a second sample drawn from positive donors. The possible factors associated with CLIA-positive or CLIA-false-positive results were investigated in a subgroup. Statistical tests were used to compare the proportions and adjusted estimates of association. The reactivity rate increased from 1·01% (N = 28 158) to 2·66% (N = 25 577) after introducing the new test. Among Venereal Disease Research Laboratory (VDRL)- and CLIA-confirmed results, the false-positive rates were 40·5% (N = 180) and 37·4% (N = 359), respectively (P = 0·5266). Older donors (OR = 1·04; P = 0·0010) and donors with lower education levels (OR = 6·59; P = 0·0029) were associated with a higher risk of positivity for syphilis. CLIA represents an improvement in blood bank serological screening. However, its use in a healthy population appears to result in high rates of false positives. Identifying which characteristics can predict false positives, however, remains a challenge. © 2017 British Blood Transfusion Society.
Abd Alla, Mohamed Darwish Ahmed; Elibiary, Saleh Ahmed; Wu, George Y; El-Awady, Mostafa Kamel
2017-12-28
Background and Aims: Occult HCV infections (OCIs) include IgG antibody seronegative cryptogenic (COCIs), as well as seropositive secondary naïve (SNOCIs) and experienced (SEOCIs) cases. We used peripheral-blood-mononuclear-cell (PBMC)-PCR to evaluate COCIs and SNOCIs prevalence, serum HCV spontaneous disappearance (SCSD) in naïve cirrhotics and non-cirrhotics, intra-PBMC HCV-RNA strands in relation to cirrhosis density in naïve non-viremia cases, and HCV-RNA seroconversion after 1 year of solitary naïve intra-PBMC infection. Methods: The anti-HCV IgG antibody-positive naïve-patients ( n = 785) were classified into viremic ( n = 673) and non-viremic [ n = 112, including non-cirrhotics ( n = 55) and cirrhotics ( n = 57)], and 62 controls without evidence of HCV-infection. Controls and post-HCV non-viremia cases ( n = 62+112 = 174) were submitted to hepatic Fibroscan-Elastography evaluation. All subjects ( n = 847) were screened for intra-PBMC HCV-RNA sense and antisense strands by nested-PCR. Results: Naïve-OCI cases (4.84%) that were diagnosed by PBMC-PCR significantly raised the total numbers of HCV-infection to 714 ( p = 0.01). The percent positivity of SNOCIs (34.82%) was significantly higher than for asymptomatic-COCIs (3.125%, p = 0.0001). Comparing PBMC-PCR with single-step-reverse-transcription (SRT)-PCR for identification of SCSD in naïve IgG antibody-positive non-viremia patients ( n = 112) revealed a decline in SCSD prevalence by PBMC-PCR (from 14.27% to 9.3%), regardless of presence of hepatic cirrhosis ( p = 0.03). SCSD was found to be higher by PBMC-PCR in non-cirrhotics compared to cirrhotics ( p = 0.0001), with an insignificant difference when using SRT-PCR ( p = 0.45). Intra-PBMC HCV-RNA infection was significantly more frequent in cirrhotics compared to both non-cirrhotics and controls ( p < 0.0005). An increased hepatic fibrosis density was recognized in intra-PBMC HCV-RNA infection with sense ( p = 0.0001) or antisense strand ( p = 0
Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A
2014-01-01
Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.
Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun
2016-11-01
Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.
Principal component reconstruction (PCR) for cine CBCT with motion learning from 2D fluoroscopy.
Gao, Hao; Zhang, Yawei; Ren, Lei; Yin, Fang-Fang
2018-01-01
This work aims to generate cine CT images (i.e., 4D images with high-temporal resolution) based on a novel principal component reconstruction (PCR) technique with motion learning from 2D fluoroscopic training images. In the proposed PCR method, the matrix factorization is utilized as an explicit low-rank regularization of 4D images that are represented as a product of spatial principal components and temporal motion coefficients. The key hypothesis of PCR is that temporal coefficients from 4D images can be reasonably approximated by temporal coefficients learned from 2D fluoroscopic training projections. For this purpose, we can acquire fluoroscopic training projections for a few breathing periods at fixed gantry angles that are free from geometric distortion due to gantry rotation, that is, fluoroscopy-based motion learning. Such training projections can provide an effective characterization of the breathing motion. The temporal coefficients can be extracted from these training projections and used as priors for PCR, even though principal components from training projections are certainly not the same for these 4D images to be reconstructed. For this purpose, training data are synchronized with reconstruction data using identical real-time breathing position intervals for projection binning. In terms of image reconstruction, with a priori temporal coefficients, the data fidelity for PCR changes from nonlinear to linear, and consequently, the PCR method is robust and can be solved efficiently. PCR is formulated as a convex optimization problem with the sum of linear data fidelity with respect to spatial principal components and spatiotemporal total variation regularization imposed on 4D image phases. The solution algorithm of PCR is developed based on alternating direction method of multipliers. The implementation is fully parallelized on GPU with NVIDIA CUDA toolbox and each reconstruction takes about a few minutes. The proposed PCR method is validated and