Polyphenol Oxidases in Crops: Biochemical, Physiological and Genetic Aspects

Directory of Open Access Journals (Sweden)

Francesca Taranto

2017-02-01

Full Text Available Enzymatic browning is a colour reaction occurring in plants, including cereals, fruit and horticultural crops, due to oxidation during postharvest processing and storage. This has a negative impact on the colour, flavour, nutritional properties and shelf life of food products. Browning is usually caused by polyphenol oxidases (PPOs, following cell damage caused by senescence, wounding and the attack of pests and pathogens. Several studies indicated that PPOs play a role in plant immunity, and emerging evidence suggested that PPOs might also be involved in other physiological processes. Genomic investigations ultimately led to the isolation of PPO homologs in several crops, which will be possibly characterized at the functional level in the near future. Here, focusing on the botanic families of Poaceae and Solanaceae, we provide an overview on available scientific literature on PPOs, resulting in useful information on biochemical, physiological and genetic aspects.

Comparison of content in phenolic compounds, polyphenol oxidase and peroxidase in grains of fifty sorghum cultivars from Burkina Faso.

NARCIS (Netherlands)

Dicko, M.H.; Hilhorst, M.H.; Gruppen, H.; Traore, A.S.; Laane, N.C.M.; Berkel, van W.J.H.; Voragen, A.G.J.

2002-01-01

Analysis of fifty sorghum [Sorghum bicolor (L.) Moench] varieties used in Burkina Faso showed that they have different contents of phenolic compounds, peroxidase (POX), and polyphenol oxidase (PPO). Most of the varieties (82%) had a tannin content less than 0.25% (w/w). POX specific activity was

Immobilization of the enzyme polyphenol oxidase on dendrispheres: In partial fulfilment of the degree Magister Scientiae

CSIR Research Space (South Africa)

Bannister, M

2011-04-01

Full Text Available OF THE ENZYME POLYPHENOL OXIDASE ON DENDRISPHERES IN PARTIAL FULFILMENT OF THE DEGREE MAGISTER SCIENTIAE Magdalien Bannister 26112664 April 2011 TEA (Camellia sinensis plant) ? CSIR 2011 Slide 2 Second most consumed beverage in the world Grouped into...: ?Green tea Non-fermented ?Oolong tea Partially fermented ?Black tea Fermented Catechins: ?Major component present in green tea leaves ?(-)-Epigallocatechin gallate (EGCG), (-)-epigallocatechin (EGC), (-)-epicatechin gallate (ECG) and (-)-epicatechin...

Purification and characterization of polyphenol oxidase from cauliflower (Brassica oleracea L.).

Science.gov (United States)

Rahman, Andi Nur Faidah; Ohta, Mayumi; Nakatani, Kazuya; Hayashi, Nobuyuki; Fujita, Shuji

2012-04-11

Polyphenol oxidase (PPO) of cauliflower was purified to 282-fold with a recovery rate of 8.1%, using phloroglucinol as a substrate. The enzyme appeared as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The estimated molecular weight of the enzyme was 60 and 54 kDa by SDS-PAGE and gel filtration, respectively. The purified enzyme, called phloroglucinol oxidase (PhO), oxidized phloroglucinol (K(m) = 3.3 mM) and phloroglucinolcarboxylic acid. The enzyme also had peroxidase (POD) activity. At the final step, the activity of purified cauliflower POD was 110-fold with a recovery rate of 3.2%. The PhO and POD showed the highest activity at pH 8.0 and 4.0 and were stable in the pH range of 3.0-11.0 and 5.0-8.0 at 5 °C for 20 h, respectively. The optimum temperature was 55 °C for PhO and 20 °C for POD. The most effective inhibitor for PhO was sodium diethyldithiocarbamate at 10 mM (IC(50) = 0.64 and K(i) = 0.15 mM), and the most effective inhibitor for POD was potassium cyanide at 1.0 mM (IC(50) = 0.03 and K(i) = 29 μM).

Characterization of polyphenol oxidase from blueberry (Vaccinium corymbosum L.).

Science.gov (United States)

Siddiq, M; Dolan, K D

2017-03-01

Polyphenol oxidase (PPO) was extracted and characterized from high-bush blueberries. PPO showed an optimum activity at pH 6.1-6.3 and 35°C, with the enzyme showing significant activity over a wide temperature range (25-60°C). Catechol was the most readily oxidized substrate followed by 4-methylcatechol, DL-DOPA, and dopamine. Blueberry PPO showed a K m of 15mM and V max of 2.57 ΔA 420 nm/min×10 -1 , determined with catechol. PPO was completely inactivated in 20min at 85°C, however, after 30minat 75°C it showed about 10% residual activity. Thermal treatment at 55 and 65°C for 30min resulted in the partial inactivation of PPO. Ascorbic acid, sodium diethyldithiocarbamic acid, L-cysteine, and sodium metabisulfite were effective inhibitors of PPO at 1.0mM. Benzoic acid and cinnamic acid series inhibitors showed relatively weak inhibition of PPO (21.8-27.6%), even at as high as 2.0mM concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.

Preparation of biosensors by immobilization of polyphenol oxidase in conducting copolymers and their use in determination of phenolic compounds in red wine.

Science.gov (United States)

Böyükbayram, A Elif; Kiralp, Senem; Toppare, Levent; Yağci, Yusuf

2006-10-01

Electrochemically produced graft copolymers of thiophene capped polytetrahydofuran (TPTHF1 and TPTHF2) and pyrrole were achieved by constant potential electrolysis using sodium dodecylsulfate (SDS) as the supporting electrolyte. Characterizations were based on Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). Electrical conductivities were measured by the four-probe technique. Novel biosensors for phenolic compounds were constructed by immobilizing polyphenol oxidase (PPO) into conducting copolymers prepared by electropolymerization of pyrrole with thiophene capped polytetrahydrofuran. Kinetic parameters, maximum reaction rate (V(max)) and Michaelis-Menten constant (K(m)) and optimum conditions regarding temperature and pH were determined for the immobilized enzyme. Operational stability and shelf-life of the enzyme electrodes were investigated. Enzyme electrodes of polyphenol oxidase were used to determine the amount of phenolic compounds in two brands of Turkish red wines and found very useful owing to their high kinetic parameters and wide pH working range.

Polyphenol Oxidase as a Biochemical Seed Defense Mechanism

Directory of Open Access Journals (Sweden)

E. Patrick Fuerst

2014-12-01

Full Text Available Seed dormancy and resistance to decay are fundamental survival strategies, which allow a population of seeds to germinate over long periods of time. Seeds have physical, chemical, and biological defense mechanisms that protect their food reserves from decay-inducing organisms and herbivores. Here, we hypothesize that seeds also possess enzyme-based biochemical defenses, based on induction of the plant defense enzyme, polyphenol oxidase (PPO, when wild oat (Avena fatua L. caryopses and seeds were challenged with seed-decaying Fusarium fungi. These studies suggest that dormant seeds are capable of mounting a defense response to pathogens. The pathogen-induced PPO activity from wild oat was attributed to a soluble isoform of the enzyme that appeared to result, at least in part, from proteolytic activation of a latent PPO isoform. PPO activity was also induced in wild oat hulls (lemma and palea, non-living tissues that cover and protect the caryopsis. These results are consistent with the hypothesis that seeds possess inducible enzyme-based biochemical defenses arrayed on the exterior of seeds and these defenses represent a fundamental mechanism of seed survival and longevity in the soil. Enzyme-based biochemical defenses may have broader implications since they may apply to other defense enzymes as well as to a diversity of plant species and ecosystems.

Purification and characterization of polyphenol oxidase from jackfruit ( Artocarpus heterophyllus ) bulbs.

Science.gov (United States)

Tao, Yi-Ming; Yao, Le-Yi; Qin, Qiu-Yan; Shen, Wang

2013-12-26

Polyphenol oxidase (PPO) from jackfruit bulb was purified through acetone precipitation, ion-exchange column, and gel filtration column. PPO was a dimer with the molecular weight of 130 kDa determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and gel filtration. The Km was 8.3 and 18.2 mM using catechol and 4-methylcatechol as substrates, respectively. The optimum pH was 7.0 (catechol as the substrate) or 6.5 (4-methylcatechol as the substrate). The optimum temperature was 8 °C. The enzyme was stable below 40 °C. The activation energy (Ea) of heat inactivation was estimated to be 103.30 kJ/mol. The PPO activity was activated by Mn(2+), SDS, Tween-20, Triton X-100, citric acid, and malic acid but inhibited by K(+), Zn(2+), Mg(2+), Ca(2+), Ba(2+), cetyl trimethyl ammonium bromide (CTAB), kojic acid, tropolone, glutathione (GSH), cysteine (Cys), and ascorbic acid (AA). Cys and AA were effective to reduce browning of jackfruit bulbs during the storage at 8 °C for 15 days.

Characterization of polyphenol oxidase from Cape gooseberry (Physalis peruviana L.) fruit.

Science.gov (United States)

Bravo, Karent; Osorio, Edison

2016-04-15

Cape gooseberry (Physalis peruviana) is an exotic fruit highly valued, however it is a very rich source of polyphenol oxidase (PPO). In this study, Cape gooseberry PPO was isolated and biochemically characterized. The enzyme was extracted and purified using acetone and aqueous two-phase systems. The data indicated that PPO had the highest substrate affinity for chlorogenic acid, 4-methylcatechol and catechol. Chlorogenic acid was the most suitable substrate (Km=0.56±0.07 mM and Vmax=53.15±2.03 UPPO mL(-1) min(-1)). The optimal pH values were 5.5 for catechol and 4-methylcatechol and 5.0 for chlorogenic acid. Optimal temperatures were 40°C for catechol, 25°C for 4-methylcatechol and 20°C for chlorogenic acid. In inhibition tests, the most potent inhibitor was found to be ascorbic acid followed by L-cysteine and quercetin. This study shows possible treatments that can be implemented during the processing of Cape gooseberry fruits to prevent browning. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation and properties of polyphenol oxidase from basidiocarps of Lactarius pergamenus Fr. (Fr. fungi

Directory of Open Access Journals (Sweden)

M. V. Tsivinska

2015-04-01

Full Text Available Fresh juice of basidiocarps of Lactarius pergamenus Fr. (Fr. fungi was subjected to ion exchange chromatography with used DEAE-toyopearl and CM-cellulose columns, as well as preparative electrophoresis in 7.5% polyacrylamide gels (pH 8.6. Three isoforms of polyphenol oxidase (PPO were discovered and two isoforms (1-1 and 1-2 were purified with a release of protein 0.42 mg/kg and 0.15 mg/kg of basidiocarps, respectively. These isoforms differ in the mobility at disc-electrophoresis in 7.5% PAGE in alkaline buffer system (pH 8.6. Specific activity of isoform 1-2 is 4.8 times higher than that of the isoforms 1-1. The molecular weight determination by gel chromatography on the Toyopearl HW-55 demonstrated that both isoforms 1-1 and 1-2 have the same 64 ± 2 kDa molecular mass. Electrophoresis in 15% PAGE in the presence of sodium dodecylsulphate and β-mercaptoethanol revealed one band with molecular mass of 64 ± 1 kDa which suggests the presence of one polypeptide chain in the molecule of the enzyme. The enzyme has demonstrated the highest activity at pH 6.0 and temperature +10 ºC, and at +70 ºC the enzyme was inactivated. The PPO activity was the highest in young mushrooms and it decreased with their age and positively correlated with the content of the milky juice. Ortho-aminophenol was most effective among all the tested substrates to determine the activity of PPO (o-, m– and p-aminophenol, catechol, tyrosine, resorcinol, phloroglucinol and its relative activity was 129% of the activity of catechol. Ascorbic acid was the most effective inhibitor of the polyphenol oxidase activity which was completely blocked at 1 mM concentration, whereas the same concentration of thiourea and sodium sulphite decreased the enzymatic activity by 40-45%. The PPO in L. pergamenus fungi basidiocarps was mainly localized in the mushroom milky juice where its high activity may be associated with protection of basidiocarps against various pathogens.

Effects of water blanching on polyphenol reaction kinetics and quality of cocoa beans

Science.gov (United States)

Menon, A. S.; Hii, C. L.; Law, C. L.; Suzannah, S.; Djaeni, M.

2015-12-01

Several studies have been reported on the potential health benefits of cocoa polyphenols. However, drying has an inhibitory effect on the substantial recovery of cocoa polyphenols. This is majorly because of the high degradation of polyphenol compounds as well as the enhanced activity of polyphenol oxidases; a pre-cursor for browning of polyphenols during drying. Pre-treatment technique such as water blanching (80° and 90°C for 5 min, 10 min and 15 min exposure times respectively) can inactivate the polyphenol oxidases enzyme and promote high percent of the polyphenol recovery in dried cocoa bean. The degradation kinetics of cocoa polyphenols during hot water blanching are analyzed; The rate constant for the polyphenol degradation after blanching was found to be ranging from 0.0208 to 0.0340 /min. The results for dried fresh cocoa beans showed an optimal level of polyphenol recovery (118 mg GAE/g) when blanched at 90°C for 5 minutes duration. The antioxidant activity is also analyzed using DPPH scavenging assay.

Purification and characterization of polyphenol oxidase from banana (Musa sapientum L.) pulp.

Science.gov (United States)

Yang, C P; Fujita, S; Ashrafuzzaman, M; Nakamura, N; Hayashi, N

2000-07-01

Polyphenol oxidase (EC 1.10.3.1, PPO) in the pulp of banana (Musa sapientum L.) was purified to 636-fold with a recovery of 3.0%, using dopamine as substrate. The purified enzyme exhibited a clear single band on polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS)-PAGE. The molecular weight of the enzyme was estimated to be about 41000 and 42000 by gel filtration and SDS-PAGE, respectively. The enzyme quickly oxidized dopamine, and its K(m) value for dopamine was 2.8 mM. The optimum pH was at 6.5, and the enzyme activity was stable in the range of pH 5-11 at 5 degrees C for 48 h. The enzyme had an optimum temperature of 30 degrees C and was stable even after a heat treatment at 70 degrees C for 30 min. The enzyme activity was completely inhibited by L-ascorbic acid, cysteine, sodium diethyldithiocarbamate, and potassium cyanide. Under a low buffer capacity, the enzyme was also strongly inhibited by citric acid and acetic acid at 10 mM.

Genetic Variation of Isozyme Polyphenol Oxidase (PPO Profiles in Different Varieties of Capsicum annuum L.

Directory of Open Access Journals (Sweden)

Owk ANIEL KUMAR

2013-12-01

Full Text Available The genus Capsicum commonly known as chilli pepper is a major spice crop and is of cosmopolitan in distribution. Native polyacrylamide gel electrophoresis (Native PAGE was used to study the polyphenol oxidase (PPO isozyme variation in 21 varieties of Capsicum annuum L. A maximum of 4 PPO bands were scored in five varieties i.e., Ca14, Ca15, Ca16, Ca19 & Ca20, while the minimum (2 bands was observed in four varieties (Ca3, Ca10, Ca13 & Ca17. 15 pair wise combinations showed highest average per cent similarity (100% and the UPGMA dendrogram represented low genetic diversity. The present study revealed that considerable intraspecific differences were found in the varieties. Thus the results obtained could be used in fingerprinting the genotypes.

Forage Polyphenol Oxidase and Ruminant Livestock Nutrition

Directory of Open Access Journals (Sweden)

Michael Richard F. Lee

2014-12-01

Full Text Available Polyphenol oxidase (PPO is associated with the detrimental effect of browning fruit and vegetables, however interest within PPO containing forage crops has grown since the brownng reaction was associated with reduced nitrogen (N losses in silo and the rumen. The reduction in protein breakdown in silo of red clover (high PPO forage increased the quality of protein, improving N-use efficiency (NUE when fed to ruminants. A further benefit of red clover silage feeding is a significant reduction in lipolysis in silo and an increase in the deposition of beneficial C18 polyunsaturated fatty acid (PUFA in animal products, which has also been linked to PPO activity. PPOs protection of plant protein and glycerol based-PUFA in silo is related to the deactivation of plant proteases and lipases. This deactivation occurs through PPO catalysing the conversion of diphenols to quinones which bind with cellular nucleophiles such as protein reforming a protein-bound phenol (PBP. If the protein is an enzyme the complexing denatures the enzyme. However, PPO is inactive in the anaerobic rumen and therefore any subsequent protection of plant protein and glycerol based-PUFA in the rumen must be as a result of events that occurred to the forage pre-ingestion. Reduced activity of plant proteases and lipases would have little effect on NUE and glycerol based-PUFA in the rumen due to the greater concentration of rumen microbial proteases and lipases. The mechanism for PPOs protection of plant protein in the rumen is a consequence of complexing plant protein, rather than protease deactivation per se. These complexed proteins reduce protein digestibility in the rumen and subsequently increase un-degraded dietary protein flow to the small intestine. The mechanism for protecting glycerol-based PUFA has yet to be fully elucidated but may be associated with entrapment within PBP reducing access to microbial lipases or differences in rumen digestion kinetics of red clover.

Comparative investigation to see the efficacy of polyphenol oxidase inhibitors parallel to sulphite for control of enzymatic browning in guava juice

International Nuclear Information System (INIS)

Zai, M.N.K.A.

2008-01-01

Comparative study was conducted to determine the efficacy of polyphenol oxidase inhibitors to control browning in guava juice/concentrates parallel to sulfite. Although sulfites are highly effective to control the browning but these have shown adverse effect on health particularly to those who have pulmonary disorder like asthma. Filtration with useful filter aid and juicing agents are found to be helpful in removing browning residue particulates fractions to extend the shelf life of the juice. Non-enzymatic browning can be prevented by cold blanching. (author)

Browning in Annona cherimola fruit: role of polyphenol oxidase and characterization of a coding sequence of the enzyme.

Science.gov (United States)

Prieto, Humberto; Utz, Daniella; Castro, Alvaro; Aguirre, Carlos; González-Agüero, Mauricio; Valdés, Héctor; Cifuentes, Nicolas; Defilippi, Bruno G; Zamora, Pablo; Zúñiga, Gustavo; Campos-Vargas, Reinaldo

2007-10-31

Cherimoya (Annona cherimola Mill.) fruit is an attractive candidate for food processing applications as fresh cut. However, along with its desirable delicate taste, cherimoya shows a marked susceptibility to browning. This condition is mainly attributed to polyphenol oxidase activity (PPO). A general lack of knowledge regarding PPO and its role in the oxidative loss of quality in processed cherimoya fruit requires a better understanding of the mechanisms involved. The work carried out included the cloning of a full-length cDNA, an analysis of its properties in the deduced amino sequence, and linkage of its mRNA levels with enzyme activity in mature and ripe fruits after wounding. The results showed one gene different at the nucleotide level when compared with previously reported genes, but a well-conserved protein, either in functional and in structural terms. Cherimoya PPO gene (Ac-ppo, GenBank DQ990911) showed to be present apparently in one copy of the genome, and its transcripts could be significantly detected in leaves and less abundantly in flowers and fruits. Analysis of wounded matured and ripened fruits revealed an inductive behavior for mRNA levels in the flesh of mature cherimoya after 16 h. Although the highest enzymatic activity was observed on rind, a consistent PPO activity was detected on flesh samples. A lack of correlation between PPO mRNA level and PPO activity was observed, especially in flesh tissue. This is probably due to the presence of monophenolic substrates inducing a lag period, enzyme inhibitors and/or diphenolic substrates causing suicide inactivation, and proenzyme or latent isoforms of PPO. To our knowledge this is the first report of a complete PPO sequence in cherimoya. Furthermore, the gene is highly divergent from known nucleotide sequences but shows a well conserved protein in terms of its function, deduced structure, and physiological role.

Polyphenol oxidase activity and antioxidant properties of Yomra apple (Malus communis L.) from Turkey.

Science.gov (United States)

Can, Zehra; Dincer, Barbaros; Sahin, Huseyin; Baltas, Nimet; Yildiz, Oktay; Kolayli, Sevgi

2014-12-01

In this study, firstly, antioxidant and polyphenol oxidase (PPO) properties of Yomra apple were investigated. Seventeen phenolic constituents were measured by reverse phase-high-performance liquid chromatography (RP-HPLC). Total phenolic compounds (TPCs), ferric reducing antioxidant power (FRAP) and 2, 2-diphenyl-1-picrylhydrazyl radical (DPPH) scavenging activities were performed to measure antioxidant capacity. Some kinetic parameters (Km, Vmax), and inhibition behaviors against five different substrates were measured in the crude extract. Catechin and chlorogenic acid were found as the major components in the methanolic extract, while ferulic acid, caffeic acid, p-hydroxybenzoic acid, quercetin and p-coumaric acid were small quantities. Km values ranged from 0.70 to 10.10 mM in the substrates, and also 3-(4-hydroxyphenyl) propanoic acid (HPPA) and L-DOPA showed the highest affinity. The inhibition constant of Ki were ranged from 0.05 to 14.90 mM against sodium metabisulphite, ascorbic acid, sodium azide and benzoic acid, while ascorbic acid and sodium metabisulphite were the best inhibitors.

Purification and partial biochemical characterization of polyphenol oxidase from mango (Mangifera indica cv. Manila).

Science.gov (United States)

Palma-Orozco, Gisela; Marrufo-Hernández, Norma A; Sampedro, José G; Nájera, Hugo

2014-10-08

Polyphenol oxidase (PPO) is an enzyme widely distributed in the plant kingdom that has been detected in most fruits and vegetables. PPO was extracted and purified from Manila mango (Mangifera indica), and its biochemical properties were studied. PPO was purified 216-fold by hydrophobic interaction and ion exchange chromatography. PPO was purified to homogeneity, and the estimated PPO molecular weight (MW) by SDS-PAGE was ≈31.5 kDa. However, a MW of 65 kDa was determined by gel filtration, indicating a dimeric structure for the native PPO. The isolated PPO showed the highest affinity to pyrogallol (Km = 2.77 mM) followed by 4-methylcatechol (Km = 3.14 mM) and catechol (Km = 15.14 mM). The optimum pH for activity was 6.0. PPO was stable in the temperature range of 20-70 °C. PPO activity was completely inhibited by tropolone, ascorbic acid, sodium metabisulfite, and kojic acid at 0.1 mM.

In silico analysis, mapping of regulatory elements and corresponding dna-protein interaction in polyphenol oxidase gene promoter from different rice varieties

International Nuclear Information System (INIS)

Mahmood, T.; Rehman, M.; Aziz, E.

2015-01-01

Polyphenol oxidase (PPO) is an important enzyme that has positive impact regarding plant resistance against different biotic and abiotic stresses. In the present study PPO promoter from six different rice varieties was amplified and then analyzed for cis- and trans-acting elements. The study revealed a total of 79 different cis-acting regulatory elements including 11 elements restricted to only one or other variety. Among six varieties Pakhal-Basmati had highest number (5) of these elements, whereas C-622 and Rachna-Basmati have no such sequences. Rachna-Basmati, IR-36-Basmati and Kashmir- Basmati had 1, 2 and 3 unique elements, respectively. Different elementsrelated to pathogen, salt and water stresses were found, which may be helpful in controlling PPO activity according to changing environment. Moreover, HADDOCK was used to understand molecular mechanism of PPO regulation and it was found that DNA-protein interactions are stabilized by many potential hydrogen bonds. Adenine and arginine were the most reactive residues in DNA and proteins respectively.Structural comparison of different protein-DNA complexes show that even a highly conserved transcriptional factor can adopt different conformations when they contact a different DNA binding sequence, however their stable interactions depend on the number of hydrogen bonds formed and distance. (author)

Immunogold Labelling to Localize Polyphenol Oxidase (PPO) During Wilting of Red Clover Leaf Tissue and the Effect of Removing Cellular Matrices on PPO Protection of Glycerol-Based Lipid in the Rumen

Science.gov (United States)

The enzyme polyphenol oxidase (PPO) reduces the extent of proteolysis and lipolysis within red clover fed to ruminants. PPO catalyses the conversion of phenols to quinones which can react with nucleophilic cellular constituents (e.g. proteins), forming protein-phenol complexes that may reduce protei...

Potential Use of Apple Polyphenol Oxidase for Bioremediation of Phenolic Contaminants

Directory of Open Access Journals (Sweden)

Anita Šalić

2018-04-01

Full Text Available Phenolic compounds, such as catechol, are released into the environment from a variety of industrial sources and they present a serious ecosystem burden. This work examined the possibility of using partially purified apple polyphenol oxidase (PPO for bioremediation of phenolic contaminants. In order to optimize process conditions, the optimal pH and temperature for PPO activity were determined, while PPO affinity toward various phenols, as well as the effect of some salts and organic solvents which can be found in wastewaters, was used to confirm applicability of PPO in wastewater treatment. It was found that partially purified apple PPO shows maximal activity at pH 6.8 and 25 °C, but exhibits more than 85 % of its maximal activity in pH range from 5 to 8, and more than 90 % of activity in temperature range from 10 to 50 °C. PPO showed high affinity for various diphenols, but lack of affinity toward monophenols. Sodium tetraborate decahydrate moderately inhibited PPO activity, while exposure of PPO to the presence of organic solvents (φ = 5 % caused 40 % loss in its activity. Catechol oxidation by PPO performed for just 5 min in a batch reactor at optimal process conditions resulted in 25 % conversion. Based on obtained data, it seems that partially purified apple PPO has reasonable potential in wastewater treatment.

Gene cloning and heterologous expression of pyranose 2-oxidase from the brown-rot fungus, Gloeophyllum trabeum

Science.gov (United States)

Diane Dietrich; Casey Crooks

2009-01-01

A pyranose 2-oxidase gene from the brown-rot basidiomycete Gloeophyllum trabeum was isolated using homology-based degenerate PCR. The gene structure was determined and compared to that of several pyranose 2-oxidases cloned from white-rot fungi. The G. trabeum pyranose 2-oxidase gene consists of 16 coding exons with canonical promoter CAAT and TATA elements in the 5’UTR...

Egg white hybrid nanoflower (EW-hNF) with biomimetic polyphenol oxidase reactivity: Synthesis, characterization and potential use in decolorization of synthetic dyes.

Science.gov (United States)

Altinkaynak, Cevahir; Kocazorbaz, Ebru; Özdemir, Nalan; Zihnioglu, Figen

2018-04-01

In this study, for the first time, we described organic-inorganic hybrid nanoflowers using crude egg white as the organic component and copper (II) ions as the inorganic component under the mild conditions. The synthesized egg white-inorganic hybrid nanoflowers (EW-hNFs) were characterized using SEM, EDX, XRD and FTIR analysis. The biomimetic Polyphenol/Peroxidase like activities of synthesized egg white-inorganic hybrid nanoflowers (EW-hNFs) were determined by using various phenolics with or without H 2 O 2 . Optimum pH and temperature, kinetic parameters, reusability, pH and thermal stability of EW-hNFs were also studied. The most noteworthy aspect of our study is that synthesized EW-hNFs which consist of only egg white proteins, showed polyphenol oxidase activity. Furthermore, potential use of the EW-hNFs in the discoloration of the some synthetic dyes was also evaluated. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

International Nuclear Information System (INIS)

Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

2005-01-01

Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

Partial purification and characterization of polyphenol oxidase from banana (Musa sapientum L.) peel.

Science.gov (United States)

Yang, C P; Fujita, S; Kohno, K; Kusubayashi, A; Ashrafuzzaman, M; Hayashi, N

2001-03-01

Polyphenol oxidase (EC 1.10.3.1, o-diphenol: oxygen oxidoreductase, PPO) of banana (Musa sapientum L.) peel was partially purified about 460-fold with a recovery of 2.2% using dopamine as substrate. The enzyme showed a single peak on Toyopearl HW55-S chromatography. However, two bands were detected by staining with Coomassie brilliant blue on PAGE: one was very clear, and the other was faint. Molecular weight for purified PPO was estimated to be about 41 000 by gel filtration. The enzyme quickly oxidized dopamine, and its Km value (Michaelis constant) for dopamine was 3.9 mM. Optimum pH was 6.5 and the PPO activity was quite stable in the range of pH 5-11 for 48 h. The enzyme had an optimum temperature at 30 degrees C and was stable up to 60 degrees C after heat treatment for 30 min. The enzyme activity was strongly inhibited by sodium diethyldithiocarbamate, potassium cyanide, L-ascorbic acid, and cysteine at 1 mM. Under a low buffer capacity, the enzyme was also strongly inhibited by citric acid and acetic acid at 10 mM.

Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

Directory of Open Access Journals (Sweden)

Coppée Jean-Yves

2010-02-01

Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.

Characterization of a Highly Thermostable and Organic Solvent-Tolerant Copper-Containing Polyphenol Oxidase with Dye-Decolorizing Ability from Kurthia huakuii LAM0618T.

Directory of Open Access Journals (Sweden)

Xiang Guo

Full Text Available Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM and Ethyl Violet (25 μM, respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions.

Molecular evolution of the polyamine oxidase gene family in Metazoa

Directory of Open Access Journals (Sweden)

Polticelli Fabio

2012-06-01

Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

Polyphenol oxidase and peroxidase expression in four pineapple varieties (Ananas comosus L.) after a chilling injury.

Science.gov (United States)

Raimbault, Astrid-Kim; Marie-Alphonsine, Paul-Alex; Horry, Jean-Pierre; Francois-Haugrin, Madlyn; Romuald, Karell; Soler, Alain

2011-01-12

Pineapple internal browning (IB) is a chilling injury that produces enzymatic browning associated with flesh translucency. Pineapple biodiversity allowed the investigation of how polyphenol oxidase (PPO) and peroxidase (POD) activities with their different isoforms are involved in the IB mechanism. Fruits of four varieties that expressed IB symptoms differently, Smooth Cayenne (SCay) and the hybrids MD2, Flhoran 41 (Flh 41), and Flhoran 53 (Flh 53), were stressed by cold. The susceptible varieties showed classical brown spots but different patterns of IB, whereas MD2 and controls showed no IB. Enzymatic activities were measured on fruit protein extracts and PPO and POD isoforms separated on mini-gels (PhastSystem). Only PPO activity was significantly enhanced in the presence of IB. Up to six PPO isoforms were identified in the susceptible varieties. PPO was barely detectable in the nonsusceptible variety MD2 and in controls. The number of PPO isoforms and the total PPO activity after chilling are varietal characteristics.

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron

Science.gov (United States)

Hiesel, Rudolf; Brennicke, Axel

1983-01-01

The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484

Promising perspectives for ruminal protection of polyunsaturated fatty acids through polyphenol-oxidase-mediated crosslinking of interfacial protein in emulsions.

Science.gov (United States)

De Neve, N; Vlaeminck, B; Gadeyne, F; Claeys, E; Van der Meeren, P; Fievez, V

2018-03-16

Previously, polyunsaturated fatty acids (PUFA) from linseed oil were effectively protected (>80%) against biohydrogenation through polyphenol-oxidase-mediated protein crosslinking of an emulsion, prepared with polyphenol oxidase (PPO) extract from potato tuber peelings. However, until now, emulsions of only 2 wt% oil have been successfully protected, which implies serious limitations both from a research perspective (e.g. in vivo trials) as well as for further upscaling toward practical applications. Therefore, the aim of this study was to increase the oil/PPO ratio. In the original protocol, the PPO extract served both an emulsifying function as well as a crosslinking function. Here, it was first evaluated whether alternative protein sources could replace the emulsifying function of the PPO extract, with addition of PPO extract and 4-methylcatechol (4MC) to induce crosslinking after emulsion preparation. This approach was then further used to evaluate protection of emulsions with higher oil content. Five candidate emulsifiers (soy glycinin, gelatin, whey protein isolate (WPI), bovine serum albumin and sodium caseinate) were used to prepare 10 wt% oil emulsions, which were diluted five times (w/w) with PPO extract (experiment 1). As a positive control, 2 wt% oil emulsions were prepared directly with PPO extract according to the original protocol. Further, emulsions of 2, 4, 6, 8 and 10 wt% oil were prepared, with 80 wt% PPO extract (experiment 2), or with 90, 80, 70, 60 and 50 wt% PPO extract, respectively (experiment 3) starting from WPI-stabilized emulsions. Enzymatic crosslinking was induced by 24-h incubation with 4MC. Ruminal protection efficiency was evaluated by 24-h in vitro batch simulation of the rumen metabolism. In experiment 1, protection efficiencies were equal or higher than the control (85.5% to 92.5% v. 81.3%). In both experiments 2 and 3, high protection efficiencies (>80%) were achieved, except for emulsions containing 10 wt% oil emulsions

Expression analysis of polyphenol oxidase isozymes by active staining method and tissue browning of head lettuce (Lactuca sativa L.).

Science.gov (United States)

Noda, Takahiro; Iimure, Kazuhiko; Okamoto, Shunsuke; Saito, Akira

2017-08-01

Browning of plant tissue is generally considered attributable to enzymatic oxidation by polyphenol oxidase (PPO). Electrophoresis followed by activity staining has been used as an effective procedure to visually detect and isolate isozymes; however, it has not been applied for examination of various PPO isozymes in lettuce. Our study demonstrated that different lettuce PPO isozymes could be detected at different pH in active staining, and multiple isozymes were detected only under alkaline conditions. As a result, we concluded that activity staining with approximately pH 8 enabled to detect various PPO isozymes in lettuce. By expression analysis of the PPO isozymes after wounding, PPO isozymes that correlated with time-course of tissue browning were detected. The wound-induced PPO may play a key role in enzymatic browning.

Cloning and sequencing of phenol oxidase 1 (pox1) gene from ...

African Journals Online (AJOL)

The gene (pox1) encoding a phenol oxidase 1 from Pleurotus ostreatus was sequenced and the corresponding pox1-cDNA was also synthesized, cloned and sequenced. The isolated gene is flanked by an upstream region called the promoter (399 bp) prior to the start codon (ATG). The putative metalresponsive elements ...

Tea polyphenols alleviate high fat and high glucose-induced endothelial hyperpermeability by attenuating ROS production via NADPH oxidase pathway.

Science.gov (United States)

Zuo, Xuezhi; Tian, Chong; Zhao, Nana; Ren, Weiye; Meng, Yi; Jin, Xin; Zhang, Ying; Ding, Shibin; Ying, Chenjiang; Ye, Xiaolei

2014-03-02

Hyperglycemia-induced endothelial hyperpermeability is crucial to cardiovascular disorders and macro-vascular complications in diabetes mellitus. The objective of this study is to investigate the effects of green tea polyphenols (GTPs) on endothelial hyperpermeability and the role of nicotinamide adenine dinucleotide phosphate (NADPH) pathway. Male Wistar rats fed on a high fat diet (HF) were treated with GTPs (0, 0.8, 1.6, 3.2 g/L in drinking water) for 26 weeks. Bovine aortic endothelial cells (BAECs) were treated with high glucose (HG, 33 mmol/L) and GTPs (0.0, 0.4, or 4 μg/mL) for 24 hours in vitro. The endothelial permeabilities in rat aorta and monolayer BAECs were measured by Evans blue injection method and efflux of fluorescein isothiocyanate (FITC)-dextran, respectively. The reactive oxygen species (ROS) levels in rat aorta and monolayer BAECs were measured by dihydroethidium (DHE) and 2', 7'-dichloro-fluorescein diacetate (DCFH-DA) fluorescent probe, respectively. Protein levels of NADPH oxidase subunits were determined by Western-blot. HF diet-fed increased the endothelial permeability and ROS levels in rat aorta while HG treatments increased the endothelial permeability and ROS levels in cultured BAECs. Co-treatment with GTPs alleviated those changes both in vivo and in vitro. In in vitro studies, GTPs treatments protected against the HG-induced over-expressions of p22phox and p67phox. Diphenylene iodonium chloride (DPI), an inhibitor of NADPH oxidase, alleviated the hyperpermeability induced by HG. GTPs could alleviate endothelial hyperpermeabilities in HF diet-fed rat aorta and in HG treated BAECs. The decrease of ROS production resulting from down-regulation of NADPH oxidase contributed to the alleviation of endothelial hyperpermeability.

Polyphenol Oxidase Induction in Lulo Fruits (Solanum quitoense Infected by Colletotrichum acutatum

Directory of Open Access Journals (Sweden)

Obradith Caicedo O.

2007-08-01

Full Text Available Polyphenol oxidase (PFO activity induction was evaluated in lulo fruits to determine the role of this enzyme in resistance responses towards the pathogen Colletotrichum acutatum which causes anthracnose disease. We studied the experimental conditions to obtain the enzyme, using lulo peel, and found that extraction with phosphates buffer 100 mM pH 7, 1% SDS y 1% PVPP showed higher activities. The adequate parameters for activity measurement was also evaluated and established as cathecol 40 mM, pH 7,0, 23 °C and 30 µL of extract. Then, we performed an in vivo assay using lulo fruits in three maturity stages, green, semimature and mature, which were inoculated with the fungus or with sterile water. Enzymatic induction of this protein was studied at nine postinoculation times, and it was found that the induction was differential according to the time, the maturity stage, and as consequence of pathogen presence. The PFO activity increased in green fruits at 48, 96 y 144 (hours postinoculation (hpi, and in mature lulos for the majority of times studied, with the most significant induction response at this stage. In semimature lulo, the induction was observed only at 72 and 144 hpi. The highest nominal value of activity was found in green fruits. Fruits responded to incision with enzyme activation. The increase in the activity of the enzyme was faster in the fruits with the minor anthracnose symptoms than the ones that were more affected. Therefore, it is possible to postulate a positive relation between PFO induction and tolerance to anthracnose symptoms.

Cloning and sequencing of the peroxisomal amine oxidase gene from Hansenula polymorpha

NARCIS (Netherlands)

Bruinenberg, P. G.; Evers, M.; Waterham, H. R.; Kuipers, J.; Arnberg, A. C.; AB, G.

1989-01-01

We have cloned the AMO gene, encoding the microbody matrix enzyme amine oxidase (EC 1.4.3.6) from the yeast Hansenula polymorpha. The gene was isolated by differential screening of a cDNA library, immunoselection, and subsequent screening of a H. polymorpha genomic library. The nucleotide sequence

Purification and Characterization of Polyphenol Oxidase, Peroxidase and Lipoxygenase from Freshly Cut Lettuce (L. sativa

Directory of Open Access Journals (Sweden)

Vural Gökmen

2011-01-01

Full Text Available Enzymatic reactions taking place in minimally processed vegetables are considered as a major problem, because they adversely affect sensorial and nutritional quality. Polyphenol oxidase (PPO, peroxidase (POD and lipoxygenase (LOX from lettuce were purified on a column packed with positively charged diethylaminoethyl (DEAE cellulose by applying pH gradient elution from pH=4.0 to 9.0. The main purified fractions (PPO1 and PPO4, POD1 and POD2, LOX1 and LOX2 were characterized for enzyme concentration-reaction rate relationship, thermal stability, pH activity and kinetic parameters. Kinetic properties of each isoform were considerably different. Cysteine was found as the most effective inhibitor of both fractions of PPO. Kinetic parameters of lettuce POD were presented using guaiacol at various H2O2 concentrations. β-carotene directly influences lettuce LOX in the reaction medium available for the catalytic conversion of linoleic acid into hydroperoxides. Ascorbic and oxalic acids appear as effective PPO inhibitors, protecting phenolic compounds against oxidation in lettuce. Understanding the characteristics of deteriorative enzymes becomes important to maintain suitable conditions for fresh-like quality of lettuce. The results can be useful to keep the nutritional quality of minimally processed lettuce during shelf-life.

Polyphenols in preventing endothelial dysfunction

Directory of Open Access Journals (Sweden)

Sylwia Biegańska-Hensoldt

2017-03-01

Full Text Available One of the main causes of mortality in developed countries is atherosclerosis. The pathogenesis of atherosclerosis is associated with endothelial dysfunction. Consumption of food rich in natural antioxidants including polyphenols significantly improves endothelial cells functions.Polyphenols have a beneficial effect on the human body and play an important part in protecting the cardiovascular system. Polyphenols present in food have antioxidant, anti-inflammatory, antihypertensive, antithrombotic and antiproliferative properties. Catechins cause an increase in the activity of endothelial nitric oxide synthase (eNOS and increased production of nitric oxide (NO and decrease in blood pressure. Catechins also reduce platelet adhesion, lower the concentration of C-reactive protein and tumor necrosis factor alpha and interleukin-6. Resveratrol inhibits NADPH oxidase expression, increases the expression of eNOS and NO production as well as decreases the expression of proinflammatory cytokines, and also lowers the concentration of the soluble forms of adhesion molecules – sICAM-1 and sVCAM-1 in blood. Quercetin reduces the blood level of low density lipoprotein cholesterol, lowers blood pressure, reduces the concentration of C-reactive protein and F2-isoprostane level. Curcumin has antagonistic activity to homocysteine. Curcumin increases the expression of eNOS and reduces oxidative DNA damage in rat cardiomyocytes. Numerous attempts are taken for improving the bioavailability of polyphenols in order to increase their use in the body.

Divergence and adaptive evolution of the gibberellin oxidase genes in plants.

Science.gov (United States)

Huang, Yuan; Wang, Xi; Ge, Song; Rao, Guang-Yuan

2015-09-29

The important phytohormone gibberellins (GAs) play key roles in various developmental processes. GA oxidases (GAoxs) are critical enzymes in GA synthesis pathway, but their classification, evolutionary history and the forces driving the evolution of plant GAox genes remain poorly understood. This study provides the first large-scale evolutionary analysis of GAox genes in plants by using an extensive whole-genome dataset of 41 species, representing green algae, bryophytes, pteridophyte, and seed plants. We defined eight subfamilies under the GAox family, namely C19-GA2ox, C20-GA2ox, GA20ox,GA3ox, GAox-A, GAox-B, GAox-C and GAox-D. Of these, subfamilies GAox-A, GAox-B, GAox-C and GAox-D are described for the first time. On the basis of phylogenetic analyses and characteristic motifs of GAox genes, we demonstrated a rapid expansion and functional divergence of the GAox genes during the diversification of land plants. We also detected the subfamily-specific motifs and potential sites of some GAox genes, which might have evolved under positive selection. GAox genes originated very early-before the divergence of bryophytes and the vascular plants and the diversification of GAox genes is associated with the functional divergence and could be driven by positive selection. Our study not only provides information on the classification of GAox genes, but also facilitates the further functional characterization and analysis of GA oxidases.

Biodegradation of phenolic compounds with oxidases from sorghum and non-defined mixed bacterium media

International Nuclear Information System (INIS)

Obame, C. E. L.; Savadogo, P. W.; Mamoudou, D. H.; Dembele, R. H.; Traore, A. S.

2009-01-01

The biodegradation of the phenolic compounds is performed using oxidative enzymes, e. g. polyphenol oxidases (PPOs) and peroxidases (POXs). These oxidases displaying a wide spectrum for the oxidation of phenolic compounds were isolated either from sorghum or mixed bacteria. Spectrophotometric methods were used to assess the monophenolase and diphenolase activities of PPOs as well as the hydrogen-dependant oxidation of POXs. (Author)

Biodegradation of phenolic compounds with oxidases from sorghum and non-defined mixed bacterium media

Energy Technology Data Exchange (ETDEWEB)

Obame, C. E. L.; Savadogo, P. W.; Mamoudou, D. H.; Dembele, R. H.; Traore, A. S.

2009-07-01

The biodegradation of the phenolic compounds is performed using oxidative enzymes, e. g. polyphenol oxidases (PPOs) and peroxidases (POXs). These oxidases displaying a wide spectrum for the oxidation of phenolic compounds were isolated either from sorghum or mixed bacteria. Spectrophotometric methods were used to assess the monophenolase and diphenolase activities of PPOs as well as the hydrogen-dependant oxidation of POXs. (Author)

A New Laccase Biosensor For Polyphenols Determination

Directory of Open Access Journals (Sweden)

M. J.F. Rebelo

2003-06-01

Full Text Available The relevance of polyphenols in human health is a well known fact. Prompted by that, a very intensive research has been directed to get a method to detect them, wich will improve the current ones. Laccase (p-diphenol:dioxygen oxidoreductase EC 1.10.3.2 is a multi-copper oxidase, wich couples catalytic oxidation of phenolic substrates with four electron reduction of dioxygen to water [1]. A maximum catalytic response in oxigenated electrolyte was observed between 4.5 and 5.5 [2], while for pH > 6.9 the laccase was found to be inactive [3]. We prepared a biosensor with laccase immobilised on a polyether sulphone membrane, at pH 4.5, wich was applied at Universal Sensors base electrode. Reduction of the product of oxidation of several polyphenols, catalysed by laccase, was done at a potential for wich the polyphenol of interest was found to respond. Reduction of catechol was found to occur at a potential of -200mV, wich is often referred to in the literature for polyphenolic biosensors. However other polyphenols did not respond at that potential. It was observed that (+- catechin produced a very large cathodic current when +100mV were applied to the laccase biosensor, both in aqueous acetate and 12% ethanol acetate buffer, whereas caffeic acid responded at -50mV. Other polyphenols tested were gallic acid, malvidin, quercetin, rutin, trans-resveratrol

Polyphenol oxidase activity from three sicilian artichoke [ Cynara cardunculus L. Var. scolymus L. (Fiori)] cultivars: studies and technological application on minimally processed production.

Science.gov (United States)

Todaro, Aldo; Peluso, Orazio; Catalano, Anna Eghle; Mauromicale, Giovanni; Spagna, Giovanni

2010-02-10

Several papers helped with the development of more methods to control browning, or study thermal polyphenol oxidase (PPO) inactivation, but did not provide any solutions to technological process problems and food process improvement. Artichokes [ Cynara cardunculus L. var. scolymus L. (Fiori)] are susceptible to browning; this alteration could affect and reduce the suitability for its use, fresh or processed. Within this study, the catecholase and cresolase activities of PPO from three different Sicilian artichokes cultivar were characterized with regard to substrate specificity and enzyme kinetics, optimum pH and temperature, temperature and pH stability, and inhibitor test; all of the results were used for technological purposes, particularly to optimize minimally processed productions (ready-to-eat and cook-chilled artichokes).

Functional Analysis of Polyphenol Oxidases by Antisense/Sense Technology

Directory of Open Access Journals (Sweden)

Jutharat Attajarusit

2007-07-01

Full Text Available Polyphenol oxidases (PPOs catalyze the oxidation of phenolics to quinones, the secondary reactions of which lead to oxidative browning and postharvest losses of many fruits and vegetables. PPOs are ubiquitous in angiosperms, are inducible by both biotic and abiotic stresses, and have been implicated in several physiological processes including plant defense against pathogens and insects, the Mehler reaction, photoreduction of molecular oxygen by PSI, regulation of plastidic oxygen levels, aurone biosynthesis and the phenylpropanoid pathway. Here we review experiments in which the roles of PPO in disease and insect resistance as well as in the Mehler reaction were investigated using transgenic tomato (Lycopersicon esculentum plants with modified PPO expression levels (suppressed PPO and overexpressing PPO. These transgenic plants showed normal growth, development and reproduction under laboratory, growth chamber and greenhouse conditions. Antisense PPO expression dramatically increased susceptibility while PPO overexpression increased resistance of tomato plants to Pseudomonas syringae. Similarly, PPO-overexpressing transgenic plants showed an increase in resistance to various insects, including common cutworm (Spodoptera litura (F., cotton bollworm (Helicoverpa armigera (Hübner and beet army worm (Spodoptera exigua (Hübner, whereas larvae feeding on plants with suppressed PPO activity had higher larval growth rates and consumed more foliage. Similar increases in weight gain, foliage consumption, and survival were also observed with Colorado potato beetles (Leptinotarsa decemlineata (Say feeding on antisense PPO transgenic tomatoes. The putative defensive mechanisms conferred by PPO and its interaction with other defense proteins are discussed. In addition, transgenic plants with suppressed PPO exhibited more favorable water relations and decreased photoinhibition compared to nontransformed controls and transgenic plants

An intron capture strategy used to identify and map a lysyl oxidase-like gene on chromosome 9 in the mouse

Energy Technology Data Exchange (ETDEWEB)

Wydner, K.S.; Passmore, H.C. [Rutgers Univ., Piscataway, NJ (United States); Kim, Houngho; Csiszar, K.; Boyd, C.D. [UMDNJ, New Brunswick, NJ (United States)

1997-03-01

An intron capture strategy involving use of polymerase chain reaction was used to identify and map the mouse homologue of a human lysyl oxidase-like gene (LOXL). Oligonucleotides complementary to conserved domains within exons 4 and 5 of the human lysyl oxidase-like gene were used to amplify the corresponding segment from mouse genomic DNA. Sequencing of the resulting mouse DNA fragment of approximately 1 kb revealed that the exon sequences at the ends of the amplified fragment are highly homologous (90% nucleotide identity) to exons 4 and 5 of the human lysyl oxidase-like gene. An AluI restriction site polymorphism within intron 4 was used to map the mouse lysyl oxidase-like gene (Loxl) to mouse Chromosome 9 in a region that shares linkage conservation with human chromosome 15q24, to which the LOXL was recently mapped. 22 refs., 3 figs.

Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.

Science.gov (United States)

Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R

2010-01-27

The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

Purification and biochemical characterization of ionically unbound polyphenol oxidase from Musa paradisiaca leaf.

Science.gov (United States)

Diwakar, Sanjeev Kumar; Mishra, Sarad Kumar

2011-01-01

An ionically unbound and thermostable polyphenol oxidase (PPO) was extracted from the leaf of Musa paradisiaca. The enzyme was purified 2.54-fold with a total yield of 9.5% by ammonium sulfate precipitation followed by Sephadex G-100 gel filtration chromatography. The purified enzyme exhibited a clear single band on native polyacrylamide gel electrophoresis (PAGE) and sodium dodecyl sulfate (SDS) PAGE. It was found to be monomeric protein with molecular mass of about 40 kD. The zymographic study using crude extract as enzyme source showed a very clear band around 40 kD and a faint band at around 15 kD, which might be isozymes. The enzyme was optimally active at pH 7.0 and 50°C temperature. The enzyme was active in wide range of pH (4.0-9.0) and temperature (30-90°C). From the thermal inactivation studies in the range 60-75°C, the half-life (t(1/2)) values of the enzyme ranged from 17 to 77 min. The inactivation energy (Ea) value of PPO was estimated to be 91.3 kJ mol(-1). It showed higher specificity with catechol (K(m) = 8 mM) as compared to 4-methylcatechol (K(m) = 10 mM). Among metal ions and reagents tested, Cu(2+), Fe(2+), Hg(2+), Mn(2+), Ni(2+), protocatechuic acid, and ferrulic acid enhanced the enzyme activity, while K(+), Na(+), Co(2+), kojic acid, ascorbic acid, ethylenediamine tetraacetic acid (EDTA), sodium azide, β-mercaptoethanol, and L-cysteine inhibited the activity of the enzyme.

Biological Effects of Potato Plants Transformation with Glucose Oxidase Gene and their Resistance to Hyperthermia

Directory of Open Access Journals (Sweden)

O.I. Grabelnych

2017-02-01

Full Text Available It is known that regulation of plant tolerance to adverse environmental factors is connected with short term increase of the concentration of endogenous reactive oxygen species (ROS, which are signalling molecules for the induction of protective mechanisms. Introduction and expression of heterologous gox gene, which encodes glucose oxidase enzyme in plant genome, induce constantly higher content of hydrogen peroxide in plant tissues. It is not known how the introduction of native or modified gox gene affects the plant resistance to high-temperature stress, one of the most commonly used model for the study of stress response and thermal tolerance. In this study, we investigated biological effects of transformation and evaluated the resistance to temperature stress of potato plants with altered levels of glucose oxidase expression. Transformation of potato plants by gox gene led to the more early coming out from tuber dormancy of transformed plants and slower growth rate. Transformants containing the glucose oxidase gene were more sensitive to lethal thermal shock (50 °C, 90 min than the transformant with the empty vector (pBI or untransformed plants (CK. Pre-heating of plants at 37 °C significantly weakened the damaging effect of lethal thermal shock. This attenuation was more significant in the non-transformed plants.

Dietary polyphenols and chromatin remodeling.

Science.gov (United States)

Russo, Gian Luigi; Vastolo, Viviana; Ciccarelli, Marco; Albano, Luigi; Macchia, Paolo Emidio; Ungaro, Paola

2017-08-13

Polyphenols are the most abundant phytochemicals in fruits, vegetables, and plant-derived beverages. Recent findings suggest that polyphenols display the ability to reverse adverse epigenetic regulation involved in pathological conditions, such as obesity, metabolic disorder, cardiovascular and neurodegenerative diseases, and various forms of cancer. Epigenetics, defined as heritable changes to the transcriptome, independent from those occurring in the genome, includes DNA methylation, histone modifications, and posttranscriptional gene regulation by noncoding RNAs. Sinergistically and cooperatively, these processes regulate gene expression by changing chromatin organization and DNA accessibility. Such induced epigenetic changes can be inherited during cell division, resulting in permanent maintenance of the acquired phenotype, but they may also occur throughout an individual life-course and may ultimately influence phenotypic outcomes (health and disease risk). In the last decade, a number of studies have shown that nutrients can affect metabolic traits by altering the structure of chromatin and directly regulate both transcription and translational processes. In this context, dietary polyphenol-targeted epigenetics becomes an attractive approach for disease prevention and intervention. Here, we will review how polyphenols, including flavonoids, curcuminoids, and stilbenes, modulate the establishment and maintenance of key epigenetic marks, thereby influencing gene expression and, hence, disease risk and health.

Polyphenols and Oxidative Stress in Atherosclerosis-Related Ischemic Heart Disease and Stroke

Directory of Open Access Journals (Sweden)

Yu-Chen Cheng

2017-01-01

Full Text Available Good nutrition could maintain health and life. Polyphenols are common nutrient mainly derived from fruits, vegetables, tea, coffee, cocoa, mushrooms, beverages, and traditional medicinal herbs. They are potential substances against oxidative-related diseases, for example, cardiovascular disease, specifically, atherosclerosis-related ischemic heart disease and stroke, which are health and economic problems recognized worldwide. In this study, we reviewed the risk factors for atherosclerosis, including hypertension, diabetes mellitus, hyperlipidemia, obesity, and cigarette smoking as well as the antioxidative activity of polyphenols, which could prevent the pathology of atherosclerosis, including endothelial dysfunction, low-density lipoprotein oxidation, vascular smooth muscle cell proliferation, inflammatory process by monocytes, macrophages or T lymphocytes, and platelet aggregation. The strong radical-scavenging properties of polyphenols would exhibit antioxidative and anti-inflammation effects. Polyphenols reduce ROS production by inhibiting oxidases, reducing the production of superoxide, inhibiting OxLDL formation, suppressing VSMC proliferation and migration, reducing platelet aggregation, and improving mitochondrial oxidative stress. Polyphenol consumption also inhibits the development of hypertension, diabetes mellitus, hyperlipidemia, and obesity. Despite the numerous in vivo and in vitro studies, more advanced clinical trials are necessary to confirm the efficacy of polyphenols in the treatment of atherosclerosis-related vascular diseases.

Effect of phenol on germination capacity and polyphenol oxidase, peroxidase and catalase activities in lettuce

Directory of Open Access Journals (Sweden)

Tadić Vojin

2014-01-01

Full Text Available In this study we examined the activities of polyphenol oxidase (PPO and antioxidant enzymes, peroxidase (POX and catalase (CAT during lettuce seed germination at different concentrations of phenol. Out of eleven varieties of lettuce, four were chosen according to their germination tolerance to phenol as follows: plants exhibiting high (Ljubljanska ledenka - LJL and Nansen - N and low toleranace (Little Gem - LG and Majska kraljica - MK. A decrease in germination efficiency after exposure to LD50 of phenol was determined for these four varieties. The effects of phenol treatment on POX, CAT and PPO activities were determined after 4, 5, 6, 7 and 8 days of growth at LD50 concentrations. A trend of increased peroxidase activity was observed in seeds grown on LD50 of phenol compared to control seeds. A significant increase in CAT activity was observed at the beginning of treatment for MK, LG and N in seeds grown on phenol as well as in control seeds. A trend of increased PPO activity was observed in all control seeds. We also investigated the affinity of PPO for two different substrates that were used for the determination of enzyme activity. Our results show that LJL and N are the varieties most tolerant to growth on phenol. Here we report on the activities of their antioxidant enzymes and PPO during seed germination. [Projekat Ministarstva nauke Republike Srbije, br. ON173017

The effect of ultrasound on particle size, color, viscosity and polyphenol oxidase activity of diluted avocado puree.

Science.gov (United States)

Bi, Xiufang; Hemar, Yacine; Balaban, Murat O; Liao, Xiaojun

2015-11-01

The effect of ultrasound treatment on particle size, color, viscosity, polyphenol oxidase (PPO) activity and microstructure in diluted avocado puree was investigated. The treatments were carried out at 20 kHz (375 W/cm(2)) for 0-10 min. The surface mean diameter (D[3,2]) was reduced to 13.44 μm from an original value of 52.31 μm by ultrasound after 1 min. A higher L(∗) value, ΔE value and lower a(∗) value was observed in ultrasound treated samples. The avocado puree dilution followed pseudoplastic flow behavior, and the viscosity of diluted avocado puree (at 100 s(-1)) after ultrasound treatment for 1 min was 6.0 and 74.4 times higher than the control samples for dilution levels of 1:2 and 1:9, respectively. PPO activity greatly increased under all treatment conditions. A maximum increase of 25.1%, 36.9% and 187.8% in PPO activity was found in samples with dilution ratios of 1:2, 1:5 and 1:9, respectively. The increase in viscosity and measured PPO activity might be related to the decrease in particle size. The microscopy images further confirmed that ultrasound treatment induced disruption of avocado puree structure. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of gamma irradiation on the radiation-resistant bacteria and polyphenol oxidase activity in fresh kale juice

International Nuclear Information System (INIS)

Kim, Dongho; Song, Hyunpa; Lim, Sangyong; Yun, Hyejeong; Chung, Jinwoo

2007-01-01

Gamma radiation was performed to prolong the shelf life of natural kale juice. The total aerobic bacteria in fresh kale juice, prepared by a general kitchen process, was detected in the range of 10 6 cfu/ml, and about 10 2 cfu/ml of the bacteria survived in the juice in spite of gamma irradiation treatment with a dose of 5 kGy. Two typical radiation-resistant bacteria, Bacillus megaterium and Exiguobacterium acetylicum were isolated and identified from the 5 kGy-irradiated kale juices. The D 10 values of the vegetative cell and endospore of the B. megaterium in peptone water were 0.63±0.05 and 1.52±0.05 kGy, respectively. The D 10 value of the E. acetylicum was calculated as 0.65±0.06 kGy. In the inoculation test, the growth of the surviving B. megaterium and E. acetylicum in the 3-5 kGy-irradiated kale juice retarded and/or decreased significantly during a 3 d post-irradiation storage period. However, there were no significant differences in the residual polyphenol oxidase activity and browning index between the nonirradiated control and the gamma irradiated kale juice during a post-irradiation period

Effects of gamma irradiation on the radiation-resistant bacteria and polyphenol oxidase activity in fresh kale juice

Science.gov (United States)

Kim, Dongho; Song, Hyunpa; Lim, Sangyong; Yun, Hyejeong; Chung, Jinwoo

2007-07-01

Gamma radiation was performed to prolong the shelf life of natural kale juice. The total aerobic bacteria in fresh kale juice, prepared by a general kitchen process, was detected in the range of 10 6 cfu/ml, and about 10 2 cfu/ml of the bacteria survived in the juice in spite of gamma irradiation treatment with a dose of 5 kGy. Two typical radiation-resistant bacteria, Bacillus megaterium and Exiguobacterium acetylicum were isolated and identified from the 5 kGy-irradiated kale juices. The D10 values of the vegetative cell and endospore of the B. megaterium in peptone water were 0.63±0.05 and 1.52±0.05 kGy, respectively. The D10 value of the E. acetylicum was calculated as 0.65±0.06 kGy. In the inoculation test, the growth of the surviving B. megaterium and E. acetylicum in the 3-5 kGy-irradiated kale juice retarded and/or decreased significantly during a 3 d post-irradiation storage period. However, there were no significant differences in the residual polyphenol oxidase activity and browning index between the nonirradiated control and the gamma irradiated kale juice during a post-irradiation period.

Thermal and pH stabilities of partially purified polyphenol oxidase ...

African Journals Online (AJOL)

Dr. Paul Chidoka Chikezie

2012-07-30

Jul 30, 2012 ... indices of the two PPO extracts is summarized in Table. 1. At the end of the .... activity near neutral pH values (Jime´nez-Atie´nzar et al.,. 2004; Dogan and Dogan, 2004). ..... oxidase from white cherry fruit (Starks gold). GIDA.

Impact of high pressure processing on color, bioactive compounds, polyphenol oxidase activity, and microbiological attributes of pumpkin purée.

Science.gov (United States)

González-Cebrino, Francisco; Durán, Rocío; Delgado-Adámez, Jonathan; Contador, Rebeca; Bernabé, Rosario Ramírez

2016-04-01

Physicochemical parameters, bioactive compounds' content (carotenoids and total phenols), total antioxidant activity, and enzymatic activity of polyphenol oxidase (PPO) were evaluated after high pressure processing (HPP) on a pumpkin purée (cv. 'Butternut'). Three pressure levels (400, 500, and 600 MPa) were combined with three holding times (200, 400, and 600 s). The applied treatments reduced the levels of total aerobic mesophilic (TAM), total psychrophilic and psychrotrophic bacteria (TPP), and molds and yeasts (M&Y). All applied treatments did not affect enzymatic activity of PPO. Pressure level increased CIE L* values, which could enhance the lightness perception of high pressure (HP)-treated purées. No differences were found between the untreated and HP-treated purées regarding total phenols and carotenoids content (lutein, α-carotene, and β-carotene) and total antioxidant activity. HPP did not affect most quality parameters and maintained the levels of bioactive compounds. However, it did not achieve the complete inhibition of PPO, which could reduce the shelf-life of the pumpkin purée. © The Author(s) 2015.

Development of a Polyphenol Oxidase Biosensor from Jenipapo Fruit Extract (Genipa americana L. and Determination of Phenolic Compounds in Textile Industrial Effluents

Directory of Open Access Journals (Sweden)

Rafael Souza Antunes

2018-05-01

Full Text Available In this work, an innovative polyphenol oxidase biosensor was developed from Jenipapo (Genipa americana L. fruit and used to assess phenolic compounds in industrial effluent samples obtained from a textile industry located in Jaraguá-GO, Brasil. The biosensor was prepared and optimized according to: the proportion of crude vegetal extract, pH and overall voltammetric parameters for differential pulse voltammetry. The calibration curve presented a linear interval from 10 to 310 µM (r2 = 0.9982 and a limit of detection of 7 µM. Biosensor stability was evaluated throughout 15 days, and it exhibited 88.22% of the initial response. The amount of catechol standard recovered post analysis varied between 87.50% and 96.00%. Moreover, the biosensor was able to detect phenolic compounds in a real sample, and the results were in accordance with standard spectrophotometric assays. Therefore, the innovatively-designed biosensor hereby proposed is a promising tool for phenolic compound detection and quantification when environmental contaminants are concerned.

The terminal oxidases of Paracoccus denitrificans

NARCIS (Netherlands)

de Gier, J.-W.; Lübben, M; Reijnders, W N; Tipker, C A; Slotboom, D.J.; van Spanning, R J; Stouthamer, A.H.; van der Oost, J.

Three distinct types of terminal oxidases participate in the aerobic respiratory pathways of Paracoccus denitrificans. Two alternative genes encoding subunit I of the aa3-type cytochrome c oxidase have been isolated before, namely ctaDI and ctaDII. Each of these genes can be expressed separately to

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum

OpenAIRE

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibite...

Molecular characterisation and expression analysis of acc oxidase gene from guzmania ruiz and pav

International Nuclear Information System (INIS)

Jianxin, L.; Huaqiao, D.; Weiyong, W.; Danqing, T.

2017-01-01

ACC oxidase is the last key enzyme of ethylene synthesis pathway, while ethylene is a key factor affecting flowering in ornamental bromeliad. To understand ACC oxidase gene's characteristics and its effect on ornamental bromeliad flowering, we cloned 1504bp full-length cDNA sequence (GenBank: JX972145) and 2546bp corresponding genomic sequence (GenBank: JX972146)of GoACO1 (ACC oxidase gene) from Guzmania variety: Ostara. Prokaryotic expression study showed that expression of GoACO1 can produced a 41 KD protein precipitation in Escherichia coli DE3(BL-21); Real-time quantitative analysis showed that GoACO1 can express in all tested tissues including floral organ, bract, leaf and scape, and expression quantity in bract was the highest. Through constructing plant overexpression vector, transforming into Arabidopsis thaliana, and investigating blossom character of T2 generation seeds, we found that first flowering time of the goal Arabidopsis thaliana was 1.5 days earlier, and their peak flowering time(the number of flowering more than 50%) was 1.8 days earlier, compared with wild type one. Taken together, our results suggested that GoACO1can express in all kinds of tissues and seems to promote Arabidopsis thaliana flowering earlier. (author)

In vitro antioxidant, lipoxygenase and xanthine oxidase inhibitory activities of fractions from Cienfuegosia digitata Cav., Sida alba L. and Sida acuta Burn f. (Malvaceae).

Science.gov (United States)

Konaté, K; Souza, A; Coulibaly, A Y; Meda, N T R; Kiendrebeogo, M; Lamien-Meda, A; Millogo-Rasolodimby, J; Lamidi, M; Nacoulma, O G

2010-11-15

In this study polyphenol content, antioxidant activity, lipoxygenase (LOX) and Xanthine Oxidase (XO) inhibitory effects of n-hexane, dichloromethane, ethyl acetate and n-butanol fractions of aqueous acetone extracts from S. alba L., S. acuta Burn f and Cienfuegosia digitata Cav. were investigated. The total phenolics, flavonoids, flavonols and total tannins were determined by spectrophotometric methods using Folin-ciocalteu, AlCl3 reagents and tannic acid, respectively. The antioxidant potential was evaluated using three methods: inhibition of free radical 2,2-diphenyl-1-picrylhydramzyl (DPPH), ABTS radical cation decolorization assay and Iron (III) to iron (II) reduction activity (FRAP). For enzymatic activity, lipoxygenase and xanthine oxidase inhibitory activities were used. This study shows a relationship between polyphenol contents, antioxidant and enzymatic activities. Present results showed that ethyl acetate and dichloromethane fractions elicit the highest polyphenol content, antioxidant and enzymatic activities.

Removal of bisphenol derivatives through quinone oxidation by polyphenol oxidase and subsequent quinone adsorption on chitosan in the heterogeneous system.

Science.gov (United States)

Kimura, Yuji; Takahashi, Ayumi; Kashiwada, Ayumi; Yamada, Kazunori

2015-01-01

In this study, the combined use of a biopolymer chitosan and an oxidoreductase polyphenol oxidase (PPO) was systematically investigated for the removal of bisphenol derivatives from aqueous medium. The process parameters, such as the pH value, temperature, and PPO concentration, were estimated to conduct the enzymatic quinone oxidation of bisphenol derivatives by as little enzyme as possible. Bisphenol derivatives effectively underwent PPO-catalysed quinone oxidation without H2O2 unlike other oxidoreductases, such as peroxidase and tyrosinase, and the optimum conditions were determined to be pH 7.0 and 40°C for bisphenol B, bisphenol E, bisphenol O, and bisphenol Z; pH 7.0 and 30°C for bisphenol C and bisphenol F; and pH 8.0 and 40°C for bisphenol T. They were completely removed through adsorption of enzymatically generated quinone derivatives on chitosan beads or chitosan powders. Quinone adsorption on chitosan beads or chitosan powders in the heterogeneous system was found to be a more effective procedure than generation of aggregates in the homogeneous system with chitosan solution. The removal time was shortened by increasing the amount of chitosan beads or decreasing the size of the chitosan powders.

[THE INFLUENCE OF SEROTONIN TRANSPORTER AND MONOAMINE OXIDASE A GENES POLYMORPHISM ON PSYCHO-EMOTION AND KARYOLOGICAL STABILITY OF ATHLETES].

Science.gov (United States)

Kalaev, V N; Nechaeva, M S; Korneeva, O S; Cherenkov, D A

2015-11-01

The influence of polymorphism of the serotonin transporter and monoamine oxidase A genes, associated with man's aggressiveness on the psycho-emotional state and karyological status of single combat athletes. It was revealed that the carriers of less active ("short"), monoamine oxidase A gene variant have a high motivation to succeed and less rigidity and frustrated, compared to the carriers of more active ("long") version of the gene. Heterozygote carriers of less active ("short") variant of the serotonin transporter gene 5-HTTL had more physical aggression, guilt and were less frustrated compared with carriers of two long alleles. It has been revealed the association of studied genes with the karyological status of athletes. So fighters who are carriers of the short and long alleles of the serotonin transporter gene had more cells with nuclear abnormalities in the buccal epithelium than single combat athletes which both alleles were long.

Multiple origins of the phenol reaction negative phenotype in foxtail millet, Setaria italica (L.) P. Beauv., were caused by independent loss-of-function mutations of the polyphenol oxidase (Si7PPO) gene during domestication.

Science.gov (United States)

Inoue, Takahiko; Yuo, Takahisa; Ohta, Takeshi; Hitomi, Eriko; Ichitani, Katsuyuki; Kawase, Makoto; Taketa, Shin; Fukunaga, Kenji

2015-08-01

Foxtail millet shows variation in positive phenol color reaction (Phr) and negative Phr in grains, but predominant accessions of this crop are negative reaction type, and the molecular genetic basis of the Phr reaction remains unresolved. In this article, we isolated polyphenol oxidase (PPO) gene responsible for Phr using genome sequence information and investigated molecular genetic basis of negative Phr and crop evolution of foxtail millet. First of all, we searched for PPO gene homologs in a foxtail millet genome database using a rice PPO gene as a query and successfully found three copies of the PPO gene. One of the PPO gene homologs on chromosome 7 showed the highest similarity with PPO genes expressed in hulls (grains) of other cereal species including rice, wheat, and barley and was designated as Si7PPO. Phr phenotypes and Si7PPO genotypes completely co-segregated in a segregating population. We also analyzed the genetic variation conferring negative Phr reaction. Of 480 accessions of the landraces investigated, 87 (18.1 %) showed positive Phr and 393 (81.9 %) showed negative Phr. In the 393 Phr negative accessions, three types of loss-of-function Si7PPO gene were predominant and independently found in various locations. One of them has an SNP in exon 1 resulting in a premature stop codon and was designated as stop codon type, another has an insertion of a transposon (Si7PPO-TE1) in intron 2 and was designated as TE1-insertion type, and the other has a 6-bp duplication in exon 3 resulting in the duplication of 2 amino acids and was designated as 6-bp duplication type. As a rare variant of the stop codon type, one accession additionally has an insertion of a transposon, Si7PPO-TE2, in intron 2 and was designated as "stop codon +TE2 insertion type". The geographical distribution of accessions with positive Phr and those with three major types of negative Phr was also investigated. Accessions with positive Phr were found in subtropical and tropical regions at

Perennial peanut (Arachis glabrata Benth.) contains polyphenol oxidase (PPO) and PPO substrates that can reduce post-harvest proteolysis.

Science.gov (United States)

Sullivan, Michael L; Foster, Jamie L

2013-08-15

Studies of perennial peanut (Arachis glabrata Benth.) suggest its hay and haylage have greater levels of rumen undegraded protein (RUP) than other legume forages such as alfalfa (Medicago sativa L.). Greater RUP can result in more efficient nitrogen utilization by ruminant animals with positive economic and environmental effects. We sought to determine whether, like red clover (Trifolium pretense L.), perennial peanut contains polyphenol oxidase (PPO) and PPO substrates that might be responsible for increased RUP. Perennial peanut extracts contain immunologically detectible PPO protein and high levels of PPO activity (>100 nkatal mg(-1) protein). Addition of caffeic acid (PPO substrate) to perennial peanut extracts depleted of endogenous substrates reduced proteolysis by 90%. Addition of phenolics prepared from perennial peanut leaves to extracts of either transgenic PPO-expressing or control (non-expressing) alfalfa showed peanut phenolics could reduce proteolysis >70% in a PPO-dependent manner. Two abundant likely PPO substrates are present in perennial peanut leaves including caftaric acid. Perennial peanut contains PPO and PPO substrates that together are capable of inhibiting post-harvest proteolysis, suggesting a possible mechanism for increased RUP in this forage. Research related to optimizing the PPO system in other forage crops will likely be applicable to perennial peanut. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

NADPH oxidase AtrbohD and AtrbohF genes function in ROS-dependent ABA signaling in Arabidopsis

Science.gov (United States)

Kwak, June M.; Mori, Izumi C.; Pei, Zhen-Ming; Leonhardt, Nathalie; Torres, Miguel Angel; Dangl, Jeffery L.; Bloom, Rachel E.; Bodde, Sara; Jones, Jonathan D.G.; Schroeder, Julian I.

2003-01-01

Reactive oxygen species (ROS) have been proposed to function as second messengers in abscisic acid (ABA) signaling in guard cells. However, the question whether ROS production is indeed required for ABA signal transduction in vivo has not yet been addressed, and the molecular mechanisms mediating ROS production during ABA signaling remain unknown. Here, we report identification of two partially redundant Arabidopsis guard cell-expressed NADPH oxidase catalytic subunit genes, AtrbohD and AtrbohF, in which gene disruption impairs ABA signaling. atrbohD/F double mutations impair ABA-induced stomatal closing, ABA promotion of ROS production, ABA-induced cytosolic Ca2+ increases and ABA- activation of plasma membrane Ca2+-permeable channels in guard cells. Exogenous H2O2 rescues both Ca2+ channel activation and stomatal closing in atrbohD/F. ABA inhibition of seed germination and root elongation are impaired in atrbohD/F, suggesting more general roles for ROS and NADPH oxidases in ABA signaling. These data provide direct molecular genetic and cell biological evidence that ROS are rate-limiting second messengers in ABA signaling, and that the AtrbohD and AtrbohF NADPH oxidases function in guard cell ABA signal transduction. PMID:12773379

Generation of Resistance to the Diphenyl Ether Herbicide, Oxyfluorfen, via Expression of the Bacillus subtilis Protoporphyrinogen Oxidase Gene in Transgenic Tobacco Plants.

Science.gov (United States)

Choi, K W; Han, O; Lee, H J; Yun, Y C; Moon, Y H; Kim, M; Kuk, Y I; Han, S U; Guh, J O

1998-01-01

In an effort to develop transgenic plants resistant to diphenyl ether herbicides, we introduced the protoporphyrinogen oxidase (EC 1.3.3.4) gene of Bacillus subtilis into tobacco plants. The results from a Northern analysis and leaf disc assay indicate that the expression of the B. subtilis protoporphyrinogen oxidase gene under the cauliflower mosaic virus 35S promoter generated resistance to the diphenyl ether herbicide, oxyfluorfen, in transgenic tobacco plants.

Role of Lysyl oxidase-like 1 gene polymorphisms in Pakistani patients with pseudoexfoliative glaucoma

NARCIS (Netherlands)

Micheal, S.; Khan, M.I.; Akhtar, F.; Ali, M.; Ahmed, A.; Hollander, A.I. den; Qamar, R.

2012-01-01

PURPOSE: Single nucleotide polymorphisms (SNPs) rs1048661 (p.R141L) and rs3825942 (p.G153D) in the lysyl oxidase-like 1 (LOXL1) gene have been previously reported to be associated with pseudoexfoliation glaucoma (PEXG) in various Asian and European populations, but these SNPs have not yet been

Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5'-phosphate oxidase genes in Bombyx mori.

Science.gov (United States)

Huang, ShuoHao; Yao, LiLi; Zhang, JianYun; Huang, LongQuan

2016-08-01

Vitamin B6 comprises six interconvertible pyridine compounds (vitamers), among which pyridoxal 5'-phosphate is a coenzyme involved in a high diversity of biochemical reactions. Humans and animals obtain B6 vitamers from diet, and synthesize pyridoxal 5'-phosphate by pyridoxal kinase and pyridoxine 5'-phosphate oxidase. Currently, little is known on how pyridoxal 5'-phosphate biosynthesis is regulated, and pyridoxal 5'-phosphate is supplied to meet their requirement in terms of cofactor. Bombyx mori is a large silk-secreting insect, in which protein metabolism is most active, and the vitamin B6 demand is high. In this study, we successfully down-regulated the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase by body cavity injection of synthesized double-stranded small interfering RNA to 5th instar larvae of Bombyx mori, and analyzed the gene transcription levels of pyridoxal 5'-phosphate dependent enzymes, phosphoserine aminotransferase and glutamic-oxaloacetic transaminase. Results show that the gene expression of pyridoxal kinase and pyridoxine 5'-phosphate oxidase has a greater impact on the gene transcription of enzymes using pyridoxal 5'-phosphate as a cofactor in Bombyx mori. Our study suggests that pyridoxal 5'-phosphate biosynthesis and dynamic balance may be regulated by genetic networks. Copyright © 2016 Elsevier B.V. All rights reserved.

Composition, physicochemical properties and thermal inactivation kinetics of polyphenol oxidase and peroxidase from coconut (Cocos nucifera) water obtained from immature, mature and overly-mature coconut.

Science.gov (United States)

Tan, Thuan-Chew; Cheng, Lai-Hoong; Bhat, Rajeev; Rusul, Gulam; Easa, Azhar Mat

2014-01-01

Composition, physicochemical properties and enzyme inactivation kinetics of coconut water were compared between immature (IMC), mature (MC) and overly-mature coconuts (OMC). Among the samples studied, pH, turbidity and mineral contents for OMC water was the highest, whereas water volume, titratable acidity, total soluble solids and total phenolics content for OMC water were the lowest. Maturity was found to affect sugar contents. Sucrose content was found to increase with maturity, and the reverse trend was observed for fructose and glucose. Enzyme activity assessment showed that polyphenol oxidase (PPO) in all samples was more heat resistant than peroxidase (POD). Compared to IMC and MC, PPO and POD from OMC water showed the lowest thermal resistance, with D83.3°C=243.9s (z=27.9°C), and D83.3°C=129.9s (z=19.5°C), respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.

Cloning and molecular analyses of a gibberellin 20-oxidase gene expressed specifically in developing seeds of watermelon.

Science.gov (United States)

Kang, H G; Jun, S H; Kim, J; Kawaide, H; Kamiya, Y; An, G

1999-10-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA(12) at C-20 to the C(19) compound GA(9), a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the beta-glucuronidase (GUS) gene. In a transient expression system, beta-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds.

[Spectral analysis of polyphenol oxidase (PPO) and lipoxygenase (LOX) treated by pulsed electric field].

Science.gov (United States)

Luo, Wei; Zhang, Ruo-Bing; Chen, Jie; Wang, Li-Ming; Guan, Zhi-Cheng; Jia, Zhi-Dong

2009-08-01

Inactivation effect of pulsed electric field (PEF) on polyphenol oxidase (PPO) and lipoxygenase (LOX) was investigated using a laboratory PEF system with a coaxial treatment chamber. Circular dichroism (CD) and fluorescence analysis were used to study the conformation change of the protein. The experimental results show that PPO and LOX can be effectively inactivated by the PEF treatment. Inactivation effect of PPO and LOX increases with the increase in the applied electric strength and the treatment time. Activity of PPO and LOX can be reduced by 60.3% and 21.7% at 20 kV x cm(-1) after being treated for 320 micros respectively. The decrease of the negative peaks (208 and 215 nm in PPO spectra, 208 nm and 218 nm in LOX spectra) in CD spectra of PPO and LOX shows that PEF treatment caused a loss of alpha-helix and increase in beta-sheet content, indicating that conformation changes occur in the secondary structure of PPO and LOX enzyme. This effect was strengthened as the applied electric field increased: alpha-helical content of PPO and LOX was 56% and 29% after being treated at 8 kV x cm(-1), however, when the electric field was increased up to 20 kV x cm(-1), alpha-helical content of PPO and LOX decreased to 21% and 16% respectively. The decrease rate of alpha-helix and increase rate of beta-sheet in PPO are higher than LOX, indicating that the second conformation of PPO is less resistant to PEF treatment than LOX. The fluorescence intensity of LOX increases after PEF treatment. At the same time, increasing the applied pulsed electric field increases the fluorescence intensity emitted. Fluorescence measurements confirm that tertiary conformation changes occur in the local structure of LOX. However the possible mechanism of the conformation change induced by the PEF treatment is beyond the scope of the present investigation.

Impact of Dietary Polyphenols on Carbohydrate Metabolism

Directory of Open Access Journals (Sweden)

Kati Hanhineva

2010-03-01

Full Text Available Polyphenols, including flavonoids, phenolic acids, proanthocyanidins and resveratrol, are a large and heterogeneous group of phytochemicals in plant-based foods, such as tea, coffee, wine, cocoa, cereal grains, soy, fruits and berries. Growing evidence indicates that various dietary polyphenols may influence carbohydrate metabolism at many levels. In animal models and a limited number of human studies carried out so far, polyphenols and foods or beverages rich in polyphenols have attenuated postprandial glycemic responses and fasting hyperglycemia, and improved acute insulin secretion and insulin sensitivity. The possible mechanisms include inhibition of carbohydrate digestion and glucose absorption in the intestine, stimulation of insulin secretion from the pancreatic b-cells, modulation of glucose release from the liver, activation of insulin receptors and glucose uptake in the insulin-sensitive tissues, and modulation of intracellular signalling pathways and gene expression. The positive effects of polyphenols on glucose homeostasis observed in a large number of in vitro and animal models are supported by epidemiological evidence on polyphenol-rich diets. To confirm the implications of polyphenol consumption for prevention of insulin resistance, metabolic syndrome and eventually type 2 diabetes, human trials with well-defined diets, controlled study designs and clinically relevant end-points together with holistic approaches e.g., systems biology profiling technologies are needed.

Adaptation of respiratory chain biogenesis to cytochrome c oxidase deficiency caused by SURF1 gene mutations

Czech Academy of Sciences Publication Activity Database

Kovářová, Nikola; Vrbacká-Čížková, Alena; Pecina, Petr; Stránecký, V.; Pronicka, E.; Kmoch, S.; Houštěk, Josef

2012-01-01

Roč. 1822, č. 7 (2012), s. 1114-1124 ISSN 0925-4439 R&D Projects: GA MZd(CZ) NS9759; GA MZd(CZ) NT12370; GA ČR(CZ) GD305/08/H037 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial disorder * SURF1 gene * Leigh syndrome * gene expression * oxidative phosphorylation * cytochrome c oxidase Subject RIV: FG - Pediatrics Impact factor: 4.910, year: 2012

NADPH oxidase is involved in regulation of gene expression and ROS overproduction in soybean (Glycine max L. seedlings exposed to cadmium

Directory of Open Access Journals (Sweden)

Jagna Chmielowska-Bąk

2017-06-01

Full Text Available Cadmium-induced oxidative burst is partially mediated by NADPH oxidase. The aim of the present research was to evaluate the role of NADPH oxidase in soybeans’ response to short-term cadmium stress. The application of an NADPH oxidase inhibitor, diphenyleneiodonium chloride (DPI, affected expression of two Cd-inducible genes, encoding DOF1 and MYBZ2 transcription factors. This effect was observed after 3 h of treatment. Interestingly, Cd-dependent increases in NADPH oxidase activity occurred only after a period of time ranging from 6 and 24 h of stress. Stimulation of the enzyme correlated in time with a significant accumulation of reactive oxygen species (ROS. Further analysis revealed that pharmacological inhibition of NADPH oxidase activity during 24 h of Cd stress does not affect Cd uptake, seedling growth, or the level of lipid peroxidation. The role of NADPH oxidase in the response of soybean seedlings to short-term Cd exposure is discussed.

Contribution of Polyphenol Oxidation, Chlorophyll and Vitamin C Degradation to the Blackening of Piper nigrum L.

Science.gov (United States)

Gu, Fenglin; Huang, Feifei; Wu, Guiping; Zhu, Hongying

2018-02-09

Black pepper ( Piper nigrum L.) is the most widely used spice in the world. Blackening is considered to be beneficial and important in the processing of black pepper because it contributes to its color and flavor. The purpose of this paper is to investigate polyphenol oxidation as well as the chlorophyll and vitamin C (VC) degradation in the blackening of Piper nigrum L. Black pepper was produced by four methods, and changes in polyphenols, chlorophyll and VC were studied by high performance liquid chromatography (HPLC) and ultraviolet-visible and visible (UV-Vis) spectrophotometry. The results show that polyphenol oxidase activity significantly decreased during the preparation of black pepper, and the concentrations of phenolic compounds, VC, and chlorophyll a and b also significantly decreased. Polyphenol oxidation and chlorophyll and VC degradation contribute to the blackening. A crude extract of phenolic compounds from black pepper was prepared by the system solvent method. The greater the polarity of the extraction solvent, the higher the extraction rates of the phenolic compounds and the total phenol content. Pepper phenolic compounds were analyzed by HPLC analysis.

Contribution of Polyphenol Oxidation, Chlorophyll and Vitamin C Degradation to the Blackening of Piper nigrum L.

Directory of Open Access Journals (Sweden)

Fenglin Gu

2018-02-01

Full Text Available Black pepper (Piper nigrum L. is the most widely used spice in the world. Blackening is considered to be beneficial and important in the processing of black pepper because it contributes to its color and flavor. The purpose of this paper is to investigate polyphenol oxidation as well as the chlorophyll and vitamin C (VC degradation in the blackening of Piper nigrum L. Black pepper was produced by four methods, and changes in polyphenols, chlorophyll and VC were studied by high performance liquid chromatography (HPLC and ultraviolet-visible and visible (UV-Vis spectrophotometry. The results show that polyphenol oxidase activity significantly decreased during the preparation of black pepper, and the concentrations of phenolic compounds, VC, and chlorophyll a and b also significantly decreased. Polyphenol oxidation and chlorophyll and VC degradation contribute to the blackening. A crude extract of phenolic compounds from black pepper was prepared by the system solvent method. The greater the polarity of the extraction solvent, the higher the extraction rates of the phenolic compounds and the total phenol content. Pepper phenolic compounds were analyzed by HPLC analysis.

Diversity of Two-Domain Laccase-Like Multicopper Oxidase Genes in Streptomyces spp.: Identification of Genes Potentially Involved in Extracellular Activities and Lignocellulose Degradation during Composting of Agricultural Waste

Science.gov (United States)

Lu, Lunhui; Zhang, Jiachao; Chen, Anwei; Chen, Ming; Jiang, Min; Yuan, Yujie; Wu, Haipeng; Lai, Mingyong; He, Yibin

2014-01-01

Traditional three-domain fungal and bacterial laccases have been extensively studied for their significance in various biotechnological applications. Growing molecular evidence points to a wide occurrence of more recently recognized two-domain laccase-like multicopper oxidase (LMCO) genes in Streptomyces spp. However, the current knowledge about their ecological role and distribution in natural or artificial ecosystems is insufficient. The aim of this study was to investigate the diversity and composition of Streptomyces two-domain LMCO genes in agricultural waste composting, which will contribute to the understanding of the ecological function of Streptomyces two-domain LMCOs with potential extracellular activity and ligninolytic capacity. A new specific PCR primer pair was designed to target the two conserved copper binding regions of Streptomyces two-domain LMCO genes. The obtained sequences mainly clustered with Streptomyces coelicolor, Streptomyces violaceusniger, and Streptomyces griseus. Gene libraries retrieved from six composting samples revealed high diversity and a rapid succession of Streptomyces two-domain LMCO genes during composting. The obtained sequence types cluster in 8 distinct clades, most of which are homologous with Streptomyces two-domain LMCO genes, but the sequences of clades III and VIII do not match with any reference sequence of known streptomycetes. Both lignocellulose degradation rates and phenol oxidase activity at pH 8.0 in the composting process were found to be positively associated with the abundance of Streptomyces two-domain LMCO genes. These observations provide important clues that Streptomyces two-domain LMCOs are potentially involved in bacterial extracellular phenol oxidase activities and lignocellulose breakdown during agricultural waste composting. PMID:24657870

Cloning and Molecular Analyses of a Gibberellin 20-Oxidase Gene Expressed Specifically in Developing Seeds of Watermelon1

Science.gov (United States)

Kang, Hong-Gyu; Jun, Sung-Hoon; Kim, Junyul; Kawaide, Hiroshi; Kamiya, Yuji; An, Gynheung

1999-01-01

To understand the biosynthesis and functional role of gibberellins (GAs) in developing seeds, we isolated Cv20ox, a cDNA clone from watermelon (Citrullus lanatus) that shows significant amino acid homology with GA 20-oxidases. The complementary DNA clone was expressed in Escherichia coli as a fusion protein, which oxidized GA12 at C-20 to the C19 compound GA9, a precursor of bioactive GAs. RNA-blot analysis showed that the Cv20ox gene was expressed specifically in developing seeds. The gene was strongly expressed in the integument tissues, and it was also expressed weakly in inner seed tissues. In parthenocarpic fruits induced by 1-(2-chloro-4-pyridyl)-3-phenylurea treatment, the expression pattern of Cv20ox did not change, indicating that the GA 20-oxidase gene is expressed primarily in the maternal cells of developing seeds. The promoter of Cv20ox was isolated and fused to the β-glucuronidase (GUS) gene. In a transient expression system, β-glucuronidase staining was detectable only in the integument tissues of developing watermelon seeds. PMID:10517828

Inhibition of rat mammary microsomal oxidation of ethanol to acetaldehyde by plant polyphenols.

Science.gov (United States)

Maciel, María Eugenia; Castro, José Alberto; Castro, Gerardo Daniel

2011-07-01

We previously reported that the microsomal fraction from rat mammary tissue is able to oxidize ethanol to acetaldehyde, a mutagenic-carcinogenic metabolite, depending on the presence of NADPH and oxygen but not inhibited by carbon monoxide or other cytochrome P450 inhibitors. The process was strongly inhibited by diphenyleneiodonium, a known inhibitor of NADPH oxidase, and by nordihydroguaiaretic acid, an inhibitor of lipoxygenases. This led us to suggest that both enzymes could be involved. With the purpose of identifying natural compounds present in food with the ability to decrease the production of acetaldehyde in mammary tissue, in the present studies, several plant polyphenols having inhibitory effects on lipoxygenases and of antioxidant nature were tested as potential inhibitors of the rat mammary tissue microsomal pathway of ethanol oxidation. We included in the present screening study 32 polyphenols having ready availability and that were also tested against the rat mammary tissue cytosolic metabolism of ethanol to acetaldehyde. Several polyphenols were also able to inhibit the microsomal ethanol oxidation at concentrations as low was 10-50 μM. The results of these screening experiments suggest the potential of several plant polyphenols to prevent in vivo production and accumulation of acetaldehyde in mammary tissue.

Enzyme characterisation, isolation and cDNA cloning of polyphenol oxidase in the hearts of palm of three commercially important species.

Science.gov (United States)

Shimizu, Milton Massao; Melo, Geraldo Aclécio; Brombini Dos Santos, Adriana; Bottcher, Alexandra; Cesarino, Igor; Araújo, Pedro; Magalhães Silva Moura, Jullyana Cristina; Mazzafera, Paulo

2011-09-01

Heart of palm (palmito) is the edible part of the apical meristem of palms and is considered a gourmet vegetable. Palmitos from the palms Euterpe edulis (Juçara) and Euterpe oleracea (Açaí) oxidise after harvesting, whereas almost no oxidation is observed in palmitos from Bactris gasipaes (Pupunha). Previous investigations showed that oxidation in Juçara and Açaí was mainly attributable to polyphenol oxidase (PPO; EC 1.14.18.1) activity. In this study, we partially purified PPOs from these three palmitos and analysed them for SDS activation, substrate specificity, inhibition by specific inhibitors, thermal stability, optimum pH and temperature conditions, Km and Ki. In addition, the total phenolic content and chlorogenic acid content were determined. Two partial cDNA sequences were isolated and sequenced from Açaí (EoPPO1) and Juçara (EePPO1). Semi-quantitative RT-PCR expression assays showed that Açaí and Juçara PPOs were strongly expressed in palmitos and weakly expressed in leaves. No amplification was observed for Pupunha samples. The lack of oxidation in the palmito Pupunha might be explained by the low PPO expression, low enzyme activity or the phenolic profile, particularly the low content of chlorogenic acid. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Cocoa polyphenols and fiber modify colonic gene expression in rats.

Science.gov (United States)

Massot-Cladera, Malen; Franch, Àngels; Castell, Margarida; Pérez-Cano, Francisco J

2017-08-01

Cocoa intake has been associated with health benefits, improving cardiovascular function and metabolism, as well as modulating intestinal immune function. The aim of this study was to take an in-depth look into the mechanisms affected by the cocoa intake by evaluating the colonic gene expression after nutritional intervention, and to ascertain the role of the fiber of cocoa in these effects. To achieve this, Wistar rats were fed for 3 weeks with either a reference diet, a diet containing 10 % cocoa (C10), a diet based on cocoa fiber (CF) or a diet containing inulin (I). At the end of the study, colon was excised to obtain the RNA to evaluate the differential gene expression by microarray. Results were validated by RT-PCR. The C10 group was the group with most changes in colonic gene expression, most of them down-regulated but a few in common with the CF diet. The C10 diet significantly up-regulated the expression of Scgb1a1 and Scnn1 g and down-regulated Tac4, Mcpt2, Fcer1a and Fabp1 by twofold, most of them related to lipid metabolism and immune function. The CF and I diets down-regulated the expression of Serpina10 and Apoa4 by twofold. Similar patterns of expression were found by PCR. Most of the effects attributed to cocoa consumption on genes related to the immune system (B cell and mast cell functionality) and lipid metabolism in the colon tissue were due not only to its fiber content, but also to the possible contribution of polyphenols and other compounds.

Changes in polyphenol profile of dried apricots containing SO2 at various concentrations during storage.

Science.gov (United States)

Altındağ, Melek; Türkyılmaz, Meltem; Özkan, Mehmet

2018-05-01

Changes in polyphenols have important effects on the quality (especially color) and health benefits of dried apricots. SO 2 concentration, storage and the activities of polyphenol oxidase (PPO) and phenylalanine ammonia lyase (PAL) were factors which had significant effects on polyphenols. Polyphenol profile and activities of PPO and PAL in sulfured dried apricots (SDAs, 0, 451, 832, 2112 and 3241 mg SO 2 kg -1 ) were monitored during storage at 4, 20 and 30 °C for 379 days for the first time. Even the lowest SO 2 concentration (451 mg kg -1 ) was sufficient to inactivate PPO during the entire storage period. However, while SO 2 led to the increase in PAL activity of the samples (r = 0.767) before storage, PAL activities of SDAs decreased during storage. After 90 days of storage, PAL activity was determined in only non-sulfured dried apricots (NSDAs) and dried apricots containing 451 mg SO 2 kg -1 . Although the major polyphenol in NSDAs was epicatechin (611.4 mg kg -1 ), that in SDAs was chlorogenic acid (455-1508 mg kg -1 ), followed by epicatechin (0-426.8 mg kg -1 ), rutin (148.9-477.3 mg kg -1 ), ferulic acid (23.3-55.3 mg kg -1 ) and gallic acid (2.4-43.6 mg kg -1 ). After storage at 30 °C for 379 days, the major polyphenol in SDAs was gallic acid (706-2324 mg kg -1 ). However, the major polyphenol in NSDAs did not change after storage. The highest total polyphenol content was detected in SDAs containing 2112 mg SO 2 kg -1 and stored at 30 °C. To produce dried apricots having high polyphenol content, ∼2000 mg SO 2 kg -1 should be used. Low storage temperature (<30 °C) was not necessary for the protection of polyphenols. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Polyphenols and Sunburn

Directory of Open Access Journals (Sweden)

Suzana Saric

2016-09-01

Full Text Available Polyphenols are antioxidant molecules found in many foods such as green tea, chocolate, grape seeds, and wine. Polyphenols have antioxidant, anti-inflammatory, and antineoplastic properties. Growing evidence suggests that polyphenols may be used for the prevention of sunburns as polyphenols decrease the damaging effects of ultraviolet A (UVA and ultraviolet B (UVB radiation on the skin. This review was conducted to examine the evidence for use of topically and orally ingested polyphenols in prevention of sunburns. The PubMed database was searched for studies that examined polyphenols and its effects on sunburns. Of the 27 studies found, 15 met the inclusion criteria. Seven studies were conducted on human subjects and eight on animals (mice and rats. Eleven studies evaluated the effects of topical polyphenols, two studies examined ingested polyphenols, and two studies examined both topical and ingested polyphenols. Polyphenol sources included the following plant origins: green tea, white tea, cocoa, Romanian propolis (RP, Calluna vulgaris (Cv, grape seeds, honeybush, and Lepidium meyenii (maca. Eight studies examined green tea. Overall, based on the studies, there is evidence that polyphenols in both oral and topical form may provide protection from UV damage and sunburn, and thus are beneficial to skin health. However, current studies are limited and further research is necessary to evaluate the efficacy, mechanism of action, and potential side effects of various forms and concentrations of polyphenols.

Polyphenols and Sunburn.

Science.gov (United States)

Saric, Suzana; Sivamani, Raja K

2016-09-09

Polyphenols are antioxidant molecules found in many foods such as green tea, chocolate, grape seeds, and wine. Polyphenols have antioxidant, anti-inflammatory, and antineoplastic properties. Growing evidence suggests that polyphenols may be used for the prevention of sunburns as polyphenols decrease the damaging effects of ultraviolet A (UVA) and ultraviolet B (UVB) radiation on the skin. This review was conducted to examine the evidence for use of topically and orally ingested polyphenols in prevention of sunburns. The PubMed database was searched for studies that examined polyphenols and its effects on sunburns. Of the 27 studies found, 15 met the inclusion criteria. Seven studies were conducted on human subjects and eight on animals (mice and rats). Eleven studies evaluated the effects of topical polyphenols, two studies examined ingested polyphenols, and two studies examined both topical and ingested polyphenols. Polyphenol sources included the following plant origins: green tea, white tea, cocoa, Romanian propolis (RP), Calluna vulgaris (Cv), grape seeds, honeybush, and Lepidium meyenii (maca). Eight studies examined green tea. Overall, based on the studies, there is evidence that polyphenols in both oral and topical form may provide protection from UV damage and sunburn, and thus are beneficial to skin health. However, current studies are limited and further research is necessary to evaluate the efficacy, mechanism of action, and potential side effects of various forms and concentrations of polyphenols.

Effects of dietary polyphenol-rich plant products from grape or hop on pro-inflammatory gene expression in the intestine, nutrient digestibility and faecal microbiota of weaned pigs.

Science.gov (United States)

Fiesel, Anja; Gessner, Denise K; Most, Erika; Eder, Klaus

2014-09-04

Feeding polyphenol-rich plant products has been shown to increase the gain:feed ratio in growing pigs. The reason for this finding has not yet been elucidated. In order to find the reasons for an increase of the gain:feed ratio, this study investigated the effect of two polyphenol-rich dietary supplements, grape seed and grape marc meal extract (GSGME) or spent hops (SH), on gut morphology, apparent digestibility of nutrients, microbial composition in faeces and the expression of pro-inflammatory genes in the intestine of pigs. Pigs fed GSGME or SH showed an improved gain:feed ratio in comparison to the control group (P value, lower levels of volatile fatty acids and lower counts of Streptococcus spp. and Clostridium Cluster XIVa in the faecal microbiota (P pro-inflammatory genes in duodenum, ileum and colon than the control group (P present study suggests that dietary plant products rich in polyphenols are able to improve the gain:feed ratio in growing pigs. It is assumed that an alteration in the microbial composition and anti-inflammatory effects of the polyphenol-rich plant products in the intestine might contribute to this effect.

Crystallization and preliminary crystallographic analysis of latent, active and recombinantly expressed aurone synthase, a polyphenol oxidase, from Coreopsis grandiflora

Energy Technology Data Exchange (ETDEWEB)

Molitor, Christian; Mauracher, Stephan Gerhard; Rompel, Annette, E-mail: annette.rompel@univie.ac.at [Universität Wien, Althanstrasse 14, 1090 Wien (Austria)

2015-05-22

Latent and active aurone synthase purified from petals of C. grandiflora (cgAUS1) were crystallized. The crystal quality of recombinantly expressed latent cgAUS1 was significantly improved by co-crystallization with the polyoxotungstate Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase-separation zone. Aurone synthase (AUS), a member of a novel group of plant polyphenol oxidases (PPOs), catalyzes the oxidative conversion of chalcones to aurones. Two active cgAUS1 (41.6 kDa) forms that differed in the level of phosphorylation or sulfation as well as the latent precursor form (58.9 kDa) were purified from the petals of Coreopsis grandiflora. The differing active cgAUS1 forms and the latent cgAUS1 as well as recombinantly expressed latent cgAUS1 were crystallized, resulting in six different crystal forms. The active forms crystallized in space groups P2{sub 1}2{sub 1}2{sub 1} and P12{sub 1}1 and diffracted to ∼1.65 Å resolution. Co-crystallization of active cgAUS1 with 1,4-resorcinol led to crystals belonging to space group P3{sub 1}21. The crystals of latent cgAUS1 belonged to space group P12{sub 1}1 and diffracted to 2.50 Å resolution. Co-crystallization of recombinantly expressed pro-AUS with the hexatungstotellurate(VI) salt Na{sub 6}[TeW{sub 6}O{sub 24}] within the liquid–liquid phase separation zone significantly improved the quality of the crystals compared with crystals obtained without hexatungstotellurate(VI)

Isolated sulfite oxidase deficiency.

Science.gov (United States)

Rupar, C A; Gillett, J; Gordon, B A; Ramsay, D A; Johnson, J L; Garrett, R M; Rajagopalan, K V; Jung, J H; Bacheyie, G S; Sellers, A R

1996-12-01

Isolated sulfite oxidase (SO) deficiency is an autosomal recessively inherited inborn error of sulfur metabolism. In this report of a ninth patient the clinical history, laboratory results, neuropathological findings and a mutation in the sulfite oxidase gene are described. The data from this patient and previously published patients with isolated sulfite oxidase deficiency and molybdenum cofactor deficiency are summarized to characterize this rare disorder. The patient presented neonatally with intractable seizures and did not progress developmentally beyond the neonatal stage. Dislocated lenses were apparent at 2 months. There was increased urine excretion of sulfite and S-sulfocysteine and a decreased concentration of plasma cystine. A lactic acidemia was present for 6 months. Liver sulfite oxidase activity was not detectable but xanthine dehydrogenase activity was normal. The boy died of respiratory failure at 32 months. Neuropathological findings of cortical necrosis and extensive cavitating leukoencephalopathy were reminiscent of those seen in severe perinatal asphyxia suggesting an etiology of energy deficiency. A point mutation that resulted in a truncated protein missing the molybdenum-binding site has been identified.

Cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp.

Directory of Open Access Journals (Sweden)

Hamed Esmaeil Lashgarian

2016-10-01

Full Text Available Cholesterol oxidase (CHO is one of the valuable enzymes that play an important role in: measurement of serum cholesterol, food industry as a biocatalyst and agriculture as a biological larvicide. This enzyme was produced by several bacterial strains. Wild type enzyme produced by Rhodococcus sp. secret two forms of CHO enzyme: extra cellular and membrane bound type which its amount is low and unstable. The goal of the study was cloning, expression, and enzymatic activity evaluation of cholesterol oxidase gene isolated from a native Rhodococcus sp. CHO gene was isolated from native bacteria and cloned into pET23a. In the next step, the construct was expressed in E.coli BL21 and induced by different concentration of IPTG ranges from 0.1 - 0.9 mM. This gene contains 1642 bp and encodes a protein consists of 533 amino acids. It has about 96 % homology with CHO gene isolated from Rhodococcus equi. The high expression was obtained in 0.5 mM concentration of IPTG after 4 hour induction. This recombinant enzyme had a molecular weight of 55 kDa, that secretion of intra cellular type is much more than extracellular form. The optimum pH and temperature conditions for the recombinant enzyme were 7.5 and 45°C, respectively. CHO enzyme obtained from Rhodococcus sp. is a cheap enzyme with medical and industrial applications that can be produced easily and purified in large scale with simple methods.

Resveratrol protects vascular endothelial cells from high glucose-induced apoptosis through inhibition of NADPH oxidase activation-driven oxidative stress.

Science.gov (United States)

Chen, Feng; Qian, Li-Hua; Deng, Bo; Liu, Zhi-Min; Zhao, Ying; Le, Ying-Ying

2013-09-01

Hyperglycemia-induced oxidative stress has been implicated in diabetic vascular complications in which NADPH oxidase is a major source of reactive oxygen species (ROS) generation. Resveratrol is a naturally occurring polyphenol, which has vasoprotective effects in diabetic animal models and inhibits high glucose (HG)-induced oxidative stress in endothelial cells. We aimed to examine whether HG-induced NADPH oxidase activation and ROS production contribute to glucotoxicity to endothelial cells and the effect of resveratrol on glucotoxicity. Using a murine brain microvascular endothelial cell line bEnd3, we found that NADPH oxidase inhibitor (apocynin) and resveratrol both inhibited HG-induced endothelial cell apoptosis. HG-induced elevation of NADPH oxidase activity and production of ROS were inhibited by apocynin, suggesting that HG induces endothelial cell apoptosis through NADPH oxidase-mediated ROS production. Mechanistic studies revealed that HG upregulated NADPH oxidase subunit Nox1 but not Nox2, Nox4, and p22(phox) expression through NF-κB activation, which resulted in elevation of NADPH oxidase activity and consequent ROS production. Resveratrol prevented HG-induced endothelial cell apoptosis through inhibiting HG-induced NF-κB activation, NADPH oxidase activity elevation, and ROS production. HG induces endothelial cell apoptosis through NF-κB/NADPH oxidase/ROS pathway, which was inhibited by resveratrol. Our findings provide new potential therapeutic targets against brain vascular complications of diabetes. © 2013 John Wiley & Sons Ltd.

Antioxidant and signal modulation properties of plant polyphenols in controlling vascular inflammation.

Science.gov (United States)

Kostyuk, Vladimir A; Potapovich, Alla I; Suhan, Tatyana O; de Luca, Chiara; Korkina, Liudmila G

2011-05-11

Oxidized low-density lipoproteins (oxLDL) play a critical role in the initiation of atherosclerosis through activation of inflammatory signaling. In the present work we investigated the role of antioxidant and signal modulation properties of plant polyphenols in controlling vascular inflammation. Significant decrease in intracellular NO level and superoxide overproduction was found in human umbilical vein endothelial cells (HUVEC) treated with oxLDL, but not with LDL. The redox imbalance was prevented by the addition of quercetin or resveratrol. Expression analysis of 14 genes associated with oxidative stress and inflammation revealed oxLDL-mediated up-regulation of genes specifically involved in leukocyte recruitment and adhesion. This up-regulation could be partially avoided by the addition of verbascoside or resveratrol, while treatment with quercetin resulted in a further increase in the expression of these genes. Lipopolysaccharide (LPS)-treated HUVEC were also used for the evaluation of anti-inflammatory potency of plant polyphenols. Significant differences between HUVEC treaded with oxLDL and LPS were found in both the expression pattern of inflammation-related genes and the effects of plant polyphenols on cellular responses. The present data indicate that plant polyphenols may affect vascular inflammation not only as antioxidants but also as modulators of inflammatory redox signaling pathways. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

Expressional studies of the aldehyde oxidase (AOX1) gene during myogenic differentiation in C2C12 cells

Energy Technology Data Exchange (ETDEWEB)

Kamli, Majid Rasool; Kim, Jihoe; Pokharel, Smritee; Jan, Arif Tasleem [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Lee, Eun Ju [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Choi, Inho, E-mail: inhochoi@ynu.ac.kr [School of Biotechnology, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of); Bovine Genome Resources Bank, Yeungnam University, Gyeongsan 712-749 (Korea, Republic of)

2014-08-08

Highlights: • AOX1 contributes to the formation of myotube. • Silencing of AOX1 reduces myotube formation. • AOX1 regulates MyoG gene expression. • AOX1 contributes to myogenesis via H{sub 2}O{sub 2}. - Abstract: Aldehyde oxidases (AOXs), which catalyze the hydroxylation of heterocycles and oxidation of a wide variety of aldehydic compounds, have been present throughout evolution from bacteria to humans. While humans have only a single functional aldehyde oxidase (AOX1) gene, rodents are endowed with four AOXs; AOX1 and three aldehyde oxidase homologs (AOH1, AOH2 and AOH3). In continuation of our previous study conducted to identify genes differentially expressed during myogenesis using a microarray approach, we investigated AOX1 with respect to its role in myogenesis to conceptualize how it is regulated in C2C12 cells. The results obtained were validated by silencing of the AOX1 gene. Analysis of their fusion index revealed that formation of myotubes showed a marked reduction of up to 40% in AOX1{sub kd} cells. Expression of myogenin (MYOG), one of the marker genes used to study myogenesis, was also found to be reduced in AOX1{sub kd} cells. AOX1 is an enzyme of pharmacological and toxicological importance that metabolizes numerous xenobiotics to their respective carboxylic acids. Hydrogen peroxide (H{sub 2}O{sub 2}) produced as a by-product in this reaction is considered to be involved as a part of the signaling mechanism during differentiation. An observed reduction in the level of H{sub 2}O{sub 2} among AOX1{sub kd} cells confirmed production of H{sub 2}O{sub 2} in the reaction catalyzed by AOX1. Taken together, these findings suggest that AOX1 acts as a contributor to the process of myogenesis by influencing the level of H{sub 2}O{sub 2}.

Flavonoid glycosides isolated from unique legume plant extracts as novel inhibitors of xanthine oxidase.

Directory of Open Access Journals (Sweden)

Chrysoula Spanou

Full Text Available Legumes and the polyphenolic compounds present in them have gained a lot of interest due to their beneficial health implications. Dietary polyphenolic compounds, especially flavonoids, exert antioxidant properties and are potent inhibitors of xanthine oxidase (XO activity. XO is the main contributor of free radicals during exercise but it is also involved in pathogenesis of several diseases such as vascular disorders, cancer and gout. In order to discover new natural, dietary XO inhibitors, some polyphenolic fractions and pure compounds isolated from two legume plant extracts were tested for their effects on XO activity. The fractions isolated from both Vicia faba and Lotus edulis plant extracts were potent inhibitors of XO with IC(50 values range from 40-135 µg/mL and 55-260 µg/mL, respectively. All the pure polyphenolic compounds inhibited XO and their K(i values ranged from 13-767 µM. Ten of the compounds followed the non competitive inhibitory model whereas one of them was a competitive inhibitor. These findings indicate that flavonoid isolates from legume plant extracts are novel, natural XO inhibitors. Their mode of action is under investigation in order to examine their potential in drug design for diseases related to overwhelming XO action.

A role for NADPH oxidase in antigen presentation

Directory of Open Access Journals (Sweden)

Gail J Gardiner

2013-09-01

Full Text Available The nicotinamide adenine dinucleotide phosphate (NADPH oxidase expressed in phagocytes is a multi-subunit enzyme complex that generates superoxide (O2.-. This radical is an important precursor of hydrogen peroxide (H2O2 and other reactive oxygen species (ROS needed for microbicidal activity during innate immune responses. Inherited defects in NADPH oxidase give rise to chronic granulomatous disease (CGD, a primary immunodeficiency characterized by recurrent infections and granulomatous inflammation. Interestingly, CGD, CGD carrier status, and oxidase gene polymorphisms have all been associated with autoinflammatory and autoimmune disorders, suggesting a potential role for NADPH oxidase in regulating adaptive immune responses. Here, NADPH oxidase function in antigen processing and presentation is reviewed. NADPH oxidase influences dendritic cell (DC crosspresentation by major histocompatibility complex class I molecules (MHC-I through regulation of the phagosomal microenvironment, while in B lymphocytes, NADPH oxidase alters epitope selection by major histocompatibility complex class II molecules (MHC-II.

Improvement of exopolysaccharide production in Lactobacillus casei LC2W by overexpression of NADH oxidase gene.

Science.gov (United States)

Li, Nan; Wang, Yuanlong; Zhu, Ping; Liu, Zhenmin; Guo, Benheng; Ren, Jing

2015-02-01

Lactobacillus casei LC2W is an exopolysaccharide (EPS)-producing strain with probiotic effects. To investigate the regulation mechanism of EPS biosynthesis and to improve EPS production through cofactor engineering, a H₂O-forming NADH oxidase gene was cloned from Streptococcus mutans and overexpressed in L. casei LC2W under the control of constitutive promoter P₂₃. The recombinant strain LC-nox exhibited 0.854 U/mL of NADH oxidase activity, which was elevated by almost 20-fold in comparison with that of wild-type strain. As a result, overexpression of NADH oxidase resulted in a reduction in growth rate. In addition, lactate production was decreased by 22% in recombinant strain. It was proposed that more carbon source was saved and used for the biosynthesis of EPS, the production of which was reached at 219.4 mg/L, increased by 46% compared to that of wild-type strain. This work provided a novel and convenient genetic approach to manipulate metabolic flux and to increase EPS production. To the best of our knowledge, this is the first report which correlates cofactor engineering with EPS production. Copyright © 2015 Elsevier GmbH. All rights reserved.

Characterization and purification of polyphenol oxidase from artichoke (Cynara scolymus L.).

Science.gov (United States)

Dogan, Serap; Turan, Yusuf; Ertürk, Hatibe; Arslan, Oktay

2005-02-09

In this study, the polyphenol oxidase (PPO) of artichoke (Cynara scolymus L.) was first purified by a combination of (NH(4))(2)SO(4) precipitation, dialysis, and a Sepharose 4B-L-tyrosine-p-aminobenzoic acid affinity column. At the end of purification, 43-fold purification was achieved. The purified enzyme migrated as a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Polyacrylamide gel electrophoresis indicated that PPO had a 57 kDa molecular mass. Second, the contents of total phenolic and protein of artichoke head extracts were determined. The total phenolic content of artichoke head was determined spectrophotometrically according to the Folin-Ciocalteu procedure and was found to be 425 mg 100 g(-1) on a fresh weight basis. Protein content was determined according to Bradford method. Third, the effects of substrate specificity, pH, temperature, and heat inactivation were investigated on the activity of PPO purified from artichoke. The enzyme showed activity to 4-methylcatechol, pyrogallol, catechol, and L-dopa. No activity was detected toward L-tyrosine, resorsinol, and p-cresol. According to V(max)/K(m) values, 4-methylcatechol (1393 EU min(-1) mM(-1)) was the best substrate, followed by pyrogallol (1220 EU min(-1) mM(-1)), catechol (697 EU min(-1) mM(-1)), and L-dopa (102 EU min(-1) mM(-1)). The optimum pH values for PPO were 5.0, 8.0, and 7.0 using 4-methylcatechol, pyrogallol, and catechol as substrate, respectively. It was found that optimum temperatures were dependent on the substrates studied. The enzyme activity decreased due to heat denaturation of the enzyme with increasing temperature and inactivation time for 4-methylcatechol and pyrogallol substrates. However, all inactivation experiments for catechol showed that the activity of artichoke PPO increased with mild heating, reached a maximum, and then decreased with time. Finally, inhibition of artichoke PPO was investigated with inhibitors such as L-cysteine, EDTA, ascorbic

Monoamine Oxidase A Gene Methylation and Its Role in Posttraumatic Stress Disorder: First Evidence from the South Eastern Europe (SEE)-PTSD Study.

Science.gov (United States)

Ziegler, Christiane; Wolf, Christiane; Schiele, Miriam A; Feric Bojic, Elma; Kucukalic, Sabina; Sabic Dzananovic, Emina; Goci Uka, Aferdita; Hoxha, Blerina; Haxhibeqiri, Valdete; Haxhibeqiri, Shpend; Kravic, Nermina; Muminovic Umihanic, Mirnesa; Cima Franc, Ana; Jaksic, Nenad; Babic, Romana; Pavlovic, Marko; Warrings, Bodo; Bravo Mehmedbasic, Alma; Rudan, Dusko; Aukst-Margetic, Branka; Kucukalic, Abdulah; Marjanovic, Damir; Babic, Dragan; Bozina, Nada; Jakovljevic, Miro; Sinanovic, Osman; Avdibegovic, Esmina; Agani, Ferid; Dzubur-Kulenovic, Alma; Deckert, Jürgen; Domschke, Katharina

2018-05-01

Posttraumatic stress disorder is characterized by an overactive noradrenergic system conferring core posttraumatic stress disorder symptoms such as hyperarousal and reexperiencing. Monoamine oxidase A is one of the key enzymes mediating the turnover of noradrenaline. Here, DNA methylation of the monoamine oxidase A gene exonI/intronI region was investigated for the first time regarding its role in posttraumatic stress disorder risk and severity. Monoamine oxidase A methylation was analyzed via direct sequencing of sodium bisulfite-treated DNA extracted from blood cells in a total sample of N=652 (441 male) patients with current posttraumatic stress disorder, patients with remitted posttraumatic stress disorder, and healthy probands (comparison group) recruited at 5 centers in Bosnia-Herzegovina, Croatia, and the Republic of Kosovo. Posttraumatic stress disorder severity was measured by means of the Clinician-Administered Posttraumatic Stress Disorder Scale and its respective subscores representing distinct symptom clusters. In the male, but not the female sample, patients with current posttraumatic stress disorder displayed hypermethylation of 3 CpGs (CpG3=43656362; CpG12=43656514; CpG13=43656553, GRCh38.p2 Assembly) as compared with remitted Posttraumatic Stress Disorder patients and healthy probands. Symptom severity (Clinician-Administered Posttraumatic Stress Disorder Scale scores) in male patients with current posttraumatic stress disorder significantly correlated with monoamine oxidase A methylation. This applied particularly to symptom clusters related to reexperiencing of trauma (cluster B) and hyperarousal (cluster D). The present findings suggest monoamine oxidase A gene hypermethylation, potentially resulting in enhanced noradrenergic signalling, as a disease status and severity marker of current posttraumatic stress disorder in males. If replicated, monoamine oxidase A hypermethylation might serve as a surrogate marker of a hyperadrenergic subtype of

Characterization of a multicopper oxidase gene cluster in Phanerochaete chrysosporium and evidence of altered splicing of the mco transcripts

Science.gov (United States)

Luis F. Larrondo; Bernardo Gonzalez; Dan Cullen; Rafael Vicuna

2004-01-01

A cluster of multicopper oxidase genes (mco1, mco2, mco3, mco4) from the lignin-degrading basidiomycete Phanerochaete chrysosporium is described. The four genes share the same transcriptional orientation within a 25 kb region. mco1, mco2 and mco3 are tightly grouped, with intergenic regions of 2.3 and 0.8 kb, respectively, whereas mco4 is located 11 kb upstream of mco1...

Expression of novel rice gibberellin 2-oxidase gene is under homeostatic regulation by biologically active gibberellins.

Science.gov (United States)

Sakai, Miho; Sakamoto, Tomoaki; Saito, Tamio; Matsuoka, Makoto; Tanaka, Hiroshi; Kobayashi, Masatomo

2003-04-01

We have cloned two genes for gibberellin (GA) 2-oxidase from rice ( Oryza sativa L.). Expression of OsGA2ox2 was not observed. The other gene, OsGA2ox3, was expressed in every tissue examined and was enhanced by the application of biologically active GA. Recombinant OsGA2ox3 protein catalyzed the metabolism of GA(1) to GA(8) and GA(20) to GA(29)-catabolite. These results indicate that OsGA2ox3 is involved in the homeostatic regulation of the endogenous level of biologically active GA in rice.

Genomic sequencing of uric acid metabolizing and clearing genes in relationship to xanthine oxidase inhibitor dose.

Science.gov (United States)

Carroll, Matthew B; Smith, Derek M; Shaak, Thomas L

2017-03-01

It remains unclear why the dose of xanthine oxidase inhibitors (XOI) allopurinol or febuxostat varies among patients though they reach similar serum uric acid (SUA) goal. We pursued genomic sequencing of XOI metabolism and clearance genes to identify single-nucleotide polymorphisms (SNPs) relate to differences in XOI dose. Subjects with a diagnosis of Gout based on the 1977 American College of Rheumatology Classification Criteria for the disorder, who were on stable doses of a XOI, and who were at their goal SUA level, were enrolled. The primary outcome was relationship between SNPs in any of these genes to XOI dose. The secondary outcome was relationship between SNPs and change in pre- and post-treatment SUA. We enrolled 100 subjects. The average patient age was 68.6 ± 10.6 years old. Over 80% were men and 77% were Caucasian. One SNP was associated with a higher XOI dose: rs75995567 (p = 0.031). Two SNPs were associated with 300 mg daily of allopurinol: rs11678615 (p = 0.022) and rs3731722 on Aldehyde Oxidase (AO) (His1297Arg) (p = 0.001). Two SNPs were associated with a lower dose of allopurinol: rs1884725 (p = 0.033) and rs34650714 (p = 0.006). For the secondary outcome, rs13415401 was the only SNP related to a smaller mean SUA change. Ten SNPs were identified with a larger change in SUA. Though multiple SNPs were identified in the primary and secondary outcomes of this study, rs3731722 is known to alter catalytic function for some aldehyde oxidase substrates.

Functional expression of amine oxidase from Aspergillus niger (AO-I) in Saccharomyces cerevisiae.

Science.gov (United States)

Kolaríková, Katerina; Galuszka, Petr; Sedlárová, Iva; Sebela, Marek; Frébort, Ivo

2009-01-01

The aim of this work was to prepare recombinant amine oxidase from Aspergillus niger after overexpressing in yeast. The yeast expression vector pDR197 that includes a constitutive PMA1 promoter was used for the expression in Saccharomyces cerevisiae. Recombinant amine oxidase was extracted from the growth medium of the yeast, purified to homogeneity and identified by activity assay and MALDI-TOF peptide mass fingerprinting. Similarity search in the newly published A. niger genome identified six genes coding for copper amine oxidase, two of them corresponding to the previously described enzymes AO-I a methylamine oxidase and three other genes coding for FAD amine oxidases. Thus, A. niger possesses an enormous metabolic gear to grow on amine compounds and thus support its saprophytic lifestyle.

Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

Science.gov (United States)

Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

2015-12-01

Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

Associations Between Genetic Variants of NADPH Oxidase-Related Genes and Blood Pressure Responses to Dietary Sodium Intervention: The GenSalt Study.

Science.gov (United States)

Han, Xikun; Hu, Zunsong; Chen, Jing; Huang, Jianfeng; Huang, Chen; Liu, Fangchao; Gu, Charles; Yang, Xueli; Hixson, James E; Lu, Xiangfeng; Wang, Laiyuan; Liu, De-Pei; He, Jiang; Chen, Shufeng; Gu, Dongfeng

2017-04-01

The aim of this study was to comprehensively test the associations of genetic variants of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase-related genes with blood pressure (BP) responses to dietary sodium intervention in a Chinese population. We conducted a 7-day low-sodium intervention followed by a 7-day high-sodium intervention among 1,906 participants in rural China. BP measurements were obtained at baseline and each dietary intervention using a random-zero sphygmomanometer. Linear mixed-effect models were used to assess the additive associations of 63 tag single-nucleotide polymorphisms in 11 NADPH oxidase-related genes with BP responses to dietary sodium intervention. Gene-based analyses were conducted using the truncated product method. The Bonferroni method was used to adjust for multiple testing in all analyses. Systolic BP (SBP) response to high-sodium intervention significantly decreased with the number of minor T allele of marker rs6967221 in RAC1 (P = 4.51 × 10-4). SBP responses (95% confidence interval) for genotypes CC, CT, and TT were 5.03 (4.71, 5.36), 4.20 (3.54, 4.85), and 0.56 (-1.08, 2.20) mm Hg, respectively, during the high-sodium intervention. Gene-based analyses revealed that RAC1 was significantly associated with SBP response to high-sodium intervention (P = 1.00 × 10-6) and diastolic BP response to low-sodium intervention (P = 9.80 × 10-4). These findings suggested that genetic variants of NADPH oxidase-related genes may contribute to the variation of BP responses to sodium intervention in Chinese population. Further replication of these findings is warranted. © American Journal of Hypertension, Ltd 2017. All rights reserved. For Permissions, please email: journals.permissions@oup.com

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora).

Science.gov (United States)

Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng

2013-01-01

The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover using a large insert BAC library

Directory of Open Access Journals (Sweden)

Thomas Ann

2009-07-01

Full Text Available Abstract Background Polyphenol oxidase (PPO activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover, a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3. Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate

Gene cloning and characterization of NADH oxidase from ...

African Journals Online (AJOL)

use

2011-12-07

Dec 7, 2011 ... potent inhibitors of NADH oxidases, silver nitrate and potassium cyanide did not show any significant ... anaerobes, a class of organisms that have not been ... DNA and amino acid sequence analyses were performed using.

Identification of a p53-response element in the promoter of the proline oxidase gene

International Nuclear Information System (INIS)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-01-01

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site

Season-controlled changes in biochemical constituents and oxidase enzyme activities in tomato (Lycopersicon esculentum Mill.).

Science.gov (United States)

Sen, Supatra; Mukherji, S

2009-07-01

Season-controlled changes in biochemical constituents viz. carotenoids (carotene and xanthophyll) and pectic substances along with IAA-oxidase and polyphenol oxidase (PPO) enzyme activities were estimated/assayed in leaves of Lycopersicon esculentum Mill. (tomato) in two developmental stages--pre-flowering (35 days after sowing) and post-flowering (75 days after sowing) in three different seasons--summer rainy and winter Carotenoid content along with pectic substances were highest in winter and declined significantly in summer followed by rainy i.e. winter > summer > rainy. Carotenoid content was significantly higher in the pre-flowering as compared to post-flowering in all three seasons while pectic substances increased in the post-flowering as compared to pre-flowering throughout the annual cycle. IAA oxidase and PPO enzyme activities were enhanced in rainy and decreased sharply in summer and winter i.e. rainy > summer > winter. Both the enzymes exhibited higher activity in the post-flowering stage as compared to pre-flowering in all three seasons. These results indicate winter to be the most favourable season for tomato plants while rainy season environmental conditions prove to be unfavourable (stressful) with diminished content of carotenoid and pectic substances and low activities of IAA oxidase and PPO, ultimately leading to poor growth and productivity.

Comparative study of the banana pulp browning process of 'Giant Dwarf' and FHIA-23 during fruit ripening based on image analysis and the polyphenol oxidase and peroxidase biochemical properties.

Science.gov (United States)

Escalante-Minakata, Pilar; Ibarra-Junquera, Vrani; Ornelas-Paz, José de Jesús; García-Ibáñez, Victoria; Virgen-Ortíz, José J; González-Potes, Apolinar; Pérez-Martínez, Jaime D; Orozco-Santos, Mario

2018-01-01

This work presents a novel method to associate the polyphenol oxidase (PPO) and the peroxidase (POD) activities with the ripening-mediated color changes in banana peel and pulp by computational image analysis. The method was used to follow up the de-greening of peel and browning of homogenized pulp from 'Giant Dwarf' (GD: Musa AAA, subgroup Cavendish) and FHIA-23 (tetraploid hybrid, AAAA) banana cultivars. In both cultivars, the color changes of peel during the ripening process clearly showed four stages, which were used to group the fruit into ripening stages. The PPO and POD were extracted from pulp of fruit at these ripening stages, precipitated, and partially purified by gel filtration chromatography. Moreover, the pulp browning was digitally monitored after homogenization for a span time of up to 120 min. The browning level was higher for GD than FHIA-23 tissues. This fact correlated with an 11.7-fold higher PPO activity in the GD cultivar, as compared with that of FHIA-23. POD activity was 8.1 times higher for GD as compared that that of FHIA-23.

Preexposure to Olive Oil Polyphenols Extract Increases Oxidative Load and Improves Liver Mass Restoration after Hepatectomy in Mice via Stress-Sensitive Genes

Directory of Open Access Journals (Sweden)

Jelena Marinić

2016-01-01

Full Text Available Polyphenols can act as oxidants in some conditions, inducing redox-sensitive genes. We investigated the effect of preexposure to the olive oil polyphenols extract (PFE on time-dependent changes in the hepatic oxidative state in a model of liver regeneration—a process in which oxidative stress associated with the metabolic overload accounts for the early events that contribute to the onset of liver self-repair. Liver regeneration was induced by one-third hepatectomy in mice. Prior to hepatectomy, mice were intraperitoneally given either PFE (50 mg/kg body weight or saline for seven consecutive days, while respective controls received vehicle alone. Redox state-regulating enzymes and thiol proteins along with the mRNA levels of Nrf2 gene and its targets γ-glutamylcysteine synthetase and heme oxygenase-1 were determined at different time intervals after hepatectomy. The liver mass restoration was calculated to assess hepatic regeneration. The resulting data demonstrate the effectiveness of preexposure to PFE in stimulating liver regeneration in a model of a small tissue loss which may be ascribed to the transient increase in oxidant load during the first hours after hepatectomy and associated induction of stress response gene-profiles under the control of Nrf2.

Genetics Home Reference: isolated sulfite oxidase deficiency

Science.gov (United States)

... and Management Resources (1 link) GeneReview: Isolated Sulfite Oxidase Deficiency General Information from MedlinePlus (5 links) Diagnostic Tests Drug Therapy Genetic Counseling Palliative Care Surgery and ...

Genetic differentiation of the mitochondrial cytochrome oxidase C subunit I gene in genus Paramecium (Protista, Ciliophora.

Directory of Open Access Journals (Sweden)

Yan Zhao

Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.

Evolution of multicopper oxidase genes in coprophilous and non-coprophilous members of the order sordariales.

Science.gov (United States)

Pöggeler, Stefanie

2011-04-01

Multicopper oxidases (MCO) catalyze the biological oxidation of various aromatic substrates and have been identified in plants, insects, bacteria, and wood rotting fungi. In nature, they are involved in biodegradation of biopolymers such as lignin and humic compounds, but have also been tested for various industrial applications. In fungi, MCOs have been shown to play important roles during their life cycles, such as in fruiting body formation, pigment formation and pathogenicity. Coprophilous fungi, which grow on the dung of herbivores, appear to encode an unexpectedly high number of enzymes capable of at least partly degrading lignin. This study compared the MCO-coding capacity of the coprophilous filamentous ascomycetes Podospora anserina and Sordaria macrospora with closely related non-coprophilous members of the order Sordariales. An increase of MCO genes in coprophilic members of the Sordariales most probably occurred by gene duplication and horizontal gene transfer events.

Multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts: differential role of hydroxycinnamic acids, flavonols and stilbenes on endothelial inflammatory gene expression.

Science.gov (United States)

Calabriso, Nadia; Scoditti, Egeria; Massaro, Marika; Pellegrino, Mariangela; Storelli, Carlo; Ingrosso, Ilaria; Giovinazzo, Giovanna; Carluccio, Maria Annunziata

2016-03-01

The aim of the study was to evaluate the vascular anti-inflammatory effects of polyphenolic extracts from two typical South Italy red wines, the specific contribution of individual polyphenols and the underlying mechanisms of action. Human endothelial cells were incubated with increasing concentrations (1-50 μg/mL) of Primitivo and Negroamaro polyphenolic extracts (PWPE and NWPE, respectively) or pure polyphenols (1-25 μmol/L), including hydroxycinnamic acids (p-coumaric, caffeic and caftaric acids), flavonols (kaempferol, quercetin, myricetin) or stilbenes (trans-resveratrol, trans-piceid) before stimulation with lipopolysaccharide. Through multiple assays, we analyzed the endothelial-monocyte adhesion, the endothelial expression of adhesion molecules (ICAM-1, VCAM-1 and E-Selectin), monocyte chemoattractant protein-1 (MCP-1) and macrophage colony-stimulating factor (M-CSF), as well as ROS intracellular levels and the activation of NF-κB and AP-1. Both PWPE and NWPE, already at 1 μg/mL, inhibited monocyte adhesion to stimulated endothelial cells, a key event in triggering vascular inflammation. They down-regulated the expression of adhesion molecules, ICAM-1, VCAM-1, E-Selectin, as well as MCP-1 and M-CSF, at mRNA and protein levels. All polyphenols reduced intracellular ROS, and everything, except caftaric acid, inhibited the endothelial expression of adhesion molecules and MCP-1, although with different potency. Flavonols and resveratrol significantly reduced also the endothelial expression and release of M-CSF. The decrease in endothelial inflammatory gene expression was related to the inhibition of NF-κB and AP-1 activation but not to intracellular oxidative stress. This study showed multiple anti-inflammatory and anti-atherosclerotic properties of red wine polyphenolic extracts and indentified specific bioactive polyphenols which could counteract inflammatory diseases including atherosclerosis.

Polyphenols and Glycemic Control

Directory of Open Access Journals (Sweden)

Yoona Kim

2016-01-01

Full Text Available Growing evidence from animal studies supports the anti-diabetic properties of some dietary polyphenols, suggesting that dietary polyphenols could be one dietary therapy for the prevention and management of Type 2 diabetes. This review aims to address the potential mechanisms of action of dietary polyphenols in the regulation of glucose homeostasis and insulin sensitivity based on in vitro and in vivo studies, and to provide a comprehensive overview of the anti-diabetic effects of commonly consumed dietary polyphenols including polyphenol-rich mixed diets, tea and coffee, chocolate and cocoa, cinnamon, grape, pomegranate, red wine, berries and olive oil, with a focus on human clinical trials. Dietary polyphenols may inhibit α-amylase and α-glucosidase, inhibit glucose absorption in the intestine by sodium-dependent glucose transporter 1 (SGLT1, stimulate insulin secretion and reduce hepatic glucose output. Polyphenols may also enhance insulin-dependent glucose uptake, activate 5′ adenosine monophosphate-activated protein kinase (AMPK, modify the microbiome and have anti-inflammatory effects. However, human epidemiological and intervention studies have shown inconsistent results. Further intervention studies are essential to clarify the conflicting findings and confirm or refute the anti-diabetic effects of dietary polyphenols.

A Plastid Terminal Oxidase Associated with Carotenoid Desaturation during Chromoplast Differentiation1

Science.gov (United States)

Josse, Eve-Marie; Simkin, Andrew J.; Gaffé, Joël; Labouré, Anne-Marie; Kuntz, Marcel; Carol, Pierre

2000-01-01

The Arabidopsis IMMUTANS gene encodes a plastid homolog of the mitochondrial alternative oxidase, which is associated with phytoene desaturation. Upon expression in Escherichia coli, this protein confers a detectable cyanide-resistant electron transport to isolated membranes. In this assay this activity is sensitive to n-propyl-gallate, an inhibitor of the alternative oxidase. This protein appears to be a plastid terminal oxidase (PTOX) that is functionally equivalent to a quinol:oxygen oxidoreductase. This protein was immunodetected in achlorophyllous pepper (Capsicum annuum) chromoplast membranes, and a corresponding cDNA was cloned from pepper and tomato (Lycopersicum esculentum) fruits. Genomic analysis suggests the presence of a single gene in these organisms, the expression of which parallels phytoene desaturase and ζ-carotene desaturase gene expression during fruit ripening. Furthermore, this PTOX gene is impaired in the tomato ghost mutant, which accumulates phytoene in leaves and fruits. These data show that PTOX also participates in carotenoid desaturation in chromoplasts in addition to its role during early chloroplast development. PMID:10938359

Plasma amine oxidase activities in Norrie disease patients with an X-chromosomal deletion affecting monoamine oxidase.

Science.gov (United States)

Murphy, D L; Sims, K B; Karoum, F; Garrick, N A; de la Chapelle, A; Sankila, E M; Norio, R; Breakefield, X O

1991-01-01

Two individuals with an X-chromosomal deletion were recently found to lack the genes encoding monoamine oxidase type A (MAO-A) and MAO-B. This abnormality was associated with almost total (90%) reductions in the oxidatively deaminated urinary metabolites of the MAO-A substrate, norepinephrine, and with marked (100-fold) increases in an MAO-B substrate, phenylethylamine, confirming systemic functional consequences of the genetic enzyme deficiency. However, urinary concentrations of the deaminated metabolites of dopamine and serotonin (5-HT) were essentially normal. To investigate other deaminating systems besides MAO-A and MAO-B that might produce these metabolites of dopamine and 5-HT, we examined plasma amine oxidase (AO) activity in these two patients and two additional patients with the same X-chromosomal deletion. Normal plasma AO activity was found in all four Norrie disease-deletion patients, in four patients with classic Norrie disease without a chromosomal deletion, and in family members of patients from both groups. Marked plasma amine metabolite abnormalities and essentially absent platelet MAO-B activity were found in all four Norrie disease-deletion patients, but in none of the other subjects in the two comparison groups. These results indicate that plasma AO is encoded by gene(s) independent of those for MAO-A and MAO-B, and raise the possibility that plasma AO, and perhaps the closely related tissue AO, benzylamine oxidase, as well as other atypical AOs or MAOs encoded independently from MAO-A and MAO-B may contribute to the oxidative deamination of dopamine and 5-HT in humans.

A multidisciplinary approach providing new insight into fruit flesh browning physiology in apple (Malus x domestica Borkh.).

Science.gov (United States)

Di Guardo, Mario; Tadiello, Alice; Farneti, Brian; Lorenz, Giorgia; Masuero, Domenico; Vrhovsek, Urska; Costa, Guglielmo; Velasco, Riccardo; Costa, Fabrizio

2013-01-01

In terms of the quality of minimally processed fruit, flesh browning is fundamentally important in the development of an aesthetically unpleasant appearance, with consequent off-flavours. The development of browning depends on the enzymatic action of the polyphenol oxidase (PPO). In the 'Golden Delicious' apple genome ten PPO genes were initially identified and located on three main chromosomes (2, 5 and 10). Of these genes, one element in particular, here called Md-PPO, located on chromosome 10, was further investigated and genetically mapped in two apple progenies ('Fuji x Pink Lady' and 'Golden Delicious x Braeburn'). Both linkage maps, made up of 481 and 608 markers respectively, were then employed to find QTL regions associated with fruit flesh browning, allowing the detection of 25 QTLs related to several browning parameters. These were distributed over six linkage groups with LOD values spanning from 3.08 to 4.99 and showed a rate of phenotypic variance from 26.1 to 38.6%. Anchoring of these intervals to the apple genome led to the identification of several genes involved in polyphenol synthesis and cell wall metabolism. Finally, the expression profile of two specific candidate genes, up and downstream of the polyphenolic pathway, namely phenylalanine ammonia lyase (PAL) and polyphenol oxidase (PPO), provided insight into flesh browning physiology. Md-PPO was further analyzed and two haplotypes were characterised and associated with fruit flesh browning in apple.

A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)

Science.gov (United States)

Farneti, Brian; Lorenz, Giorgia; Masuero, Domenico; Vrhovsek, Urska; Costa, Guglielmo; Velasco, Riccardo; Costa, Fabrizio

2013-01-01

In terms of the quality of minimally processed fruit, flesh browning is fundamentally important in the development of an aesthetically unpleasant appearance, with consequent off-flavours. The development of browning depends on the enzymatic action of the polyphenol oxidase (PPO). In the ‘Golden Delicious’ apple genome ten PPO genes were initially identified and located on three main chromosomes (2, 5 and 10). Of these genes, one element in particular, here called Md-PPO, located on chromosome 10, was further investigated and genetically mapped in two apple progenies (‘Fuji x Pink Lady’ and ‘Golden Delicious x Braeburn’). Both linkage maps, made up of 481 and 608 markers respectively, were then employed to find QTL regions associated with fruit flesh browning, allowing the detection of 25 QTLs related to several browning parameters. These were distributed over six linkage groups with LOD values spanning from 3.08 to 4.99 and showed a rate of phenotypic variance from 26.1 to 38.6%. Anchoring of these intervals to the apple genome led to the identification of several genes involved in polyphenol synthesis and cell wall metabolism. Finally, the expression profile of two specific candidate genes, up and downstream of the polyphenolic pathway, namely phenylalanine ammonia lyase (PAL) and polyphenol oxidase (PPO), provided insight into flesh browning physiology. Md-PPO was further analyzed and two haplotypes were characterised and associated with fruit flesh browning in apple. PMID:24205065

Modulation of endogenous antioxidant system by wine polyphenols in human disease.

Science.gov (United States)

Rodrigo, Ramón; Miranda, Andrés; Vergara, Leonardo

2011-02-20

Numerous studies indicate that moderate red wine consumption is associated with a protective effect against all-cause mortality. Since oxidative stress constitutes a unifying mechanism of injury of many types of disease processes, it should be expected that polyphenolic antioxidants account for this beneficial effect. Nevertheless, beyond the well-known antioxidant properties of these compounds, they may exert several other protective mechanisms. Indeed, the overall protective effect of polyphenols is due to their large array of biological actions, such as free radical-scavenging, metal chelation, enzyme modulation, cell signalling pathways modulation and gene expression effects, among others. Wine possesses a variety of polyphenols, being resveratrol its most outstanding representative, due to its pleiotropic biological properties. The presence of ethanol in wine aids to polyphenol absorption, thereby contributing to their bioavailability. Before absorption, polyphenols must be hydrolyzed by intestinal enzymes or by colonic microflora. Then, they undergo intestinal and liver metabolism. There have been no reported polyphenol adverse effects derived from intakes currently associated with the normal diet. However, supplements for health-protection should be cautiously used as no level definition has been given to make sure the dose is safe. The role of oxidative stress and the beneficial effects of wine polyphenols against cardiovascular, cancer, diabetes, microbial, inflammatory, neurodegenerative and kidney diseases and ageing are reviewed. Future large scale randomized clinical trials should be conducted to fully establish the therapeutic use of each individual wine polyphenol against human disease. Copyright © 2010 Elsevier B.V. All rights reserved.

Functionally undefined gene, yggE, alleviates oxidative stress generated by monoamine oxidase in recombinant Escherichia coli.

Science.gov (United States)

Ojima, Yoshihiro; Kawase, Daisuke; Nishioka, Motomu; Taya, Masahito

2009-01-01

Real-time PCR analysis showed that yggE gene was about two and three times up-regulated in Escherichia coli cells exposed to UVA irradiation and thermal elevation, respectively, suggesting that this gene is responsive to physiological stress. The yggE gene was introduced into E. coli BL21 cells, together with a monoamine oxidase (MAO) gene as a model source for oxidative stress generation. The distribution of independently isolated transformants (two dozen isolates) was examined in terms of MAO activity and cell vitality. In the case of control strain expressing MAO alone, the largest number of transformants existed in the low range of MAO activity less than 2 units mg(-1) and the number significantly decreased at increased MAO activity. On the other hand, the distribution of MAO/YggE-coexpressing transformants shifted to higher MAO activity with frequent appearance in the activity range of 4-8 units mg(-1). The yggE gene product therefore has a possible function for alleviating the stress generated in the cells.

The acute impact of polyphenols from Hibiscus sabdariffa in metabolic homeostasis: an approach combining metabolomics and gene-expression analyses.

Science.gov (United States)

Beltrán-Debón, Raúl; Rodríguez-Gallego, Esther; Fernández-Arroyo, Salvador; Senan-Campos, Oriol; Massucci, Francesco A; Hernández-Aguilera, Anna; Sales-Pardo, Marta; Guimerà, Roger; Camps, Jordi; Menendez, Javier A; Joven, Jorge

2015-09-01

We explored the acute multifunctional effects of polyphenols from Hibiscus sabdariffa in humans to assess possible consequences on the host's health. The expected dynamic response was studied using a combination of transcriptomics and metabolomics to integrate specific functional pathways through network-based methods and to generate hypotheses established by acute metabolic effects and/or modifications in the expression of relevant genes. Data were obtained from healthy male volunteers after 3 hours of ingestion of an aqueous Hibiscus sabdariffa extract. The data were compared with data obtained prior to the ingestion, and the overall findings suggest that these particular polyphenols had a simultaneous role in mitochondrial function, energy homeostasis and protection of the cardiovascular system. These findings suggest beneficial actions in inflammation, endothelial dysfunction, and oxidation, which are interrelated mechanisms. Among other effects, the activation of the heme oxygenase-biliverdin reductase axis, the systemic inhibition of the renin-angiotensin system, the inhibition of the angiotensin-converting enzyme, and several actions mirroring those of the peroxisome proliferator-activated receptor agonists further support this notion. We also found concordant findings in the serum of the participants, which include a decrease in cortisol levels and a significant increase in the active vasodilator metabolite of bradykinin (des-Arg(9)-bradykinin). Therefore, our data support the view that polyphenols from Hibiscus sabdariffa play a regulatory role in metabolic health and in the maintenance of blood pressure, thus implying a multi-faceted impact in metabolic and cardiovascular diseases.

Cloning and expression analysis of the Ccrboh gene encoding respiratory burst oxidase in Citrullus colocynthis and grafting onto Citrullus lanatus (watermelon).

Science.gov (United States)

Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K

2010-06-01

A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.

Expression and Chloroplast Targeting of Cholesterol Oxidase in Transgenic Tobacco Plants

Science.gov (United States)

Corbin, David R.; Grebenok, Robert J.; Ohnmeiss, Thomas E.; Greenplate, John T.; Purcell, John P.

2001-01-01

Cholesterol oxidase represents a novel type of insecticidal protein with potent activity against the cotton boll weevil (Anthonomus grandis grandis Boheman). We transformed tobacco (Nicotiana tabacum) plants with the cholesterol oxidase choM gene and expressed cytosolic and chloroplast-targeted versions of the ChoM protein. Transgenic leaf tissues expressing cholesterol oxidase exerted insecticidal activity against boll weevil larvae. Our results indicate that cholesterol oxidase can metabolize phytosterols in vivo when produced cytosolically or when targeted to chloroplasts. The transgenic plants exhibiting cytosolic expression accumulated low levels of saturated sterols known as stanols, and displayed severe developmental aberrations. In contrast, the transgenic plants expressing chloroplast-targeted cholesterol oxidase maintained a greater accumulation of stanols, and appeared phenotypically and developmentally normal. These results are discussed within the context of plant sterol distribution and metabolism. PMID:11457962

Tet1 oxidase regulates neuronal gene transcription, active DNA hydroxymethylation, object location memory, and threat recognition memory

Directory of Open Access Journals (Sweden)

Dinesh Kumar

2015-10-01

Full Text Available A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the central nervous system. In this study, we used Tet1 gene knockout (Tet1KO mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

Global Transcriptomic Analysis of Targeted Silencing of Two Paralogous ACC Oxidase Genes in Banana

Science.gov (United States)

Xia, Yan; Kuan, Chi; Chiu, Chien-Hsiang; Chen, Xiao-Jing; Do, Yi-Yin; Huang, Pung-Ling

2016-01-01

Among 18 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase homologous genes existing in the banana genome there are two genes, Mh-ACO1 and Mh-ACO2, that participate in banana fruit ripening. To better understand the physiological functions of Mh-ACO1 and Mh-ACO2, two hairpin-type siRNA expression vectors targeting both the Mh-ACO1 and Mh-ACO2 were constructed and incorporated into the banana genome by Agrobacterium-mediated transformation. The generation of Mh-ACO1 and Mh-ACO2 RNAi transgenic banana plants was confirmed by Southern blot analysis. To gain insights into the functional diversity and complexity between Mh-ACO1 and Mh-ACO2, transcriptome sequencing of banana fruits using the Illumina next-generation sequencer was performed. A total of 32,093,976 reads, assembled into 88,031 unigenes for 123,617 transcripts were obtained. Significantly enriched Gene Oncology (GO) terms and the number of differentially expressed genes (DEGs) with GO annotation were ‘catalytic activity’ (1327, 56.4%), ‘heme binding’ (65, 2.76%), ‘tetrapyrrole binding’ (66, 2.81%), and ‘oxidoreductase activity’ (287, 12.21%). Real-time RT-PCR was further performed with mRNAs from both peel and pulp of banana fruits in Mh-ACO1 and Mh-ACO2 RNAi transgenic plants. The results showed that expression levels of genes related to ethylene signaling in ripening banana fruits were strongly influenced by the expression of genes associated with ethylene biosynthesis. PMID:27681726

Symbiotic Burkholderia Species Show Diverse Arrangements of nif/fix and nod Genes and Lack Typical High-Affinity Cytochrome cbb3 Oxidase Genes.

Science.gov (United States)

De Meyer, Sofie E; Briscoe, Leah; Martínez-Hidalgo, Pilar; Agapakis, Christina M; de-Los Santos, Paulina Estrada; Seshadri, Rekha; Reeve, Wayne; Weinstock, George; O'Hara, Graham; Howieson, John G; Hirsch, Ann M

2016-08-01

Genome analysis of fourteen mimosoid and four papilionoid beta-rhizobia together with fourteen reference alpha-rhizobia for both nodulation (nod) and nitrogen-fixing (nif/fix) genes has shown phylogenetic congruence between 16S rRNA/MLSA (combined 16S rRNA gene sequencing and multilocus sequence analysis) and nif/fix genes, indicating a free-living diazotrophic ancestry of the beta-rhizobia. However, deeper genomic analysis revealed a complex symbiosis acquisition history in the beta-rhizobia that clearly separates the mimosoid and papilionoid nodulating groups. Mimosoid-nodulating beta-rhizobia have nod genes tightly clustered in the nodBCIJHASU operon, whereas papilionoid-nodulating Burkholderia have nodUSDABC and nodIJ genes, although their arrangement is not canonical because the nod genes are subdivided by the insertion of nif and other genes. Furthermore, the papilionoid Burkholderia spp. contain duplications of several nod and nif genes. The Burkholderia nifHDKEN and fixABC genes are very closely related to those found in free-living diazotrophs. In contrast, nifA is highly divergent between both groups, but the papilionoid species nifA is more similar to alpha-rhizobia nifA than to other groups. Surprisingly, for all Burkholderia, the fixNOQP and fixGHIS genes required for cbb3 cytochrome oxidase production and assembly are missing. In contrast, symbiotic Cupriavidus strains have fixNOQPGHIS genes, revealing a divergence in the evolution of two distinct electron transport chains required for nitrogen fixation within the beta-rhizobia.

Effects of de-alcoholised wines with different polyphenol content on DNA oxidative damage, gene expression of peripheral lymphocytes, and haemorheology: an intervention study in post-menopausal women.

Science.gov (United States)

Giovannelli, Lisa; Pitozzi, Vanessa; Luceri, Cristina; Giannini, Lucia; Toti, Simona; Salvini, Simonetta; Sera, Francesco; Souquet, Jean-Marc; Cheynier, Veronique; Sofi, Francesco; Mannini, Lucia; Gori, Anna Maria; Abbate, Rosanna; Palli, Domenico; Dolara, Piero

2011-02-01

Epidemiological studies suggest that a moderate consumption of wine is associated with a reduced risk of cardiovascular diseases and with a reduced mortality for all causes, possibly due to increased antioxidant defences. The present intervention study was undertaken to evaluate the in vivo effects of wine polyphenols on gene expression in humans, along with their supposed antioxidant activity. Blood haemorheology and platelet function were also evaluated. In order to avoid interferences from alcohol, we used de-alcoholised wine (DAW) with different polyphenol content. A randomised cross-over trial of high-proanthocyanidin (PA) red DAW (500 mL/die, PA dose = 7 mg/kg b.w.) vs. low-PA rosé DAW (500 mL/die, PA dose = 0.45 mg/kg) was conducted in 21 post-menopausal women in Florence, Italy. Oxidative DNA damage by the comet assay and gene expression by microarray was measured in peripheral blood lymphocytes, collected during the study period. Blood samples were also collected for the evaluation of haematological, haemostatic, haemorheological, and inflammatory parameters. The results of the present study provide evidence that consumption of substantial amounts of de-alcoholised wine for 1 month does not exert a protective activity towards oxidative DNA damage, nor modifies significantly the gene expression profile of peripheral lymphocytes, whereas it shows blood-fluidifying actions, expressed as a significant decrease in blood viscosity. However, this effect does not correlate with the dosage of polyphenols of the de-alcoholised wine. More intervention studies are needed to provide further evidence of the health-protective effects of wine proanthocyanidins.

Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

NARCIS (Netherlands)

Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

2006-01-01

Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

Discovery, characterization, and kinetic analysis of an alditol oxidase from streptomyces coelicolor

NARCIS (Netherlands)

Heuts, Dominic P. H. M.; van Hellemond, Erik W.; Janssen, Dick B.; Fraaije, Marco W.

2007-01-01

A gene encoding an alditol oxidase was found in the genome of Streptomyces coelicolor A3(2). This newly identified oxidase, AldO, was expressed at extremely high levels in Escherichia coli when fused to maltose-binding protein. AldO is a soluble monomeric flavoprotein with subunits of 45.1 kDa, each

A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

Science.gov (United States)

Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

2013-05-01

A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

Neonatal epileptic encephalopathy caused by mutations in the PNPO gene encoding pyridox(am)ine 5'-phosphate oxidase.

Science.gov (United States)

Mills, Philippa B; Surtees, Robert A H; Champion, Michael P; Beesley, Clare E; Dalton, Neil; Scambler, Peter J; Heales, Simon J R; Briddon, Anthony; Scheimberg, Irene; Hoffmann, Georg F; Zschocke, Johannes; Clayton, Peter T

2005-04-15

In the mouse, neurotransmitter metabolism can be regulated by modulation of the synthesis of pyridoxal 5'-phosphate and failure to maintain pyridoxal phosphate (PLP) levels results in epilepsy. This study of five patients with neonatal epileptic encephalopathy suggests that the same is true in man. Cerebrospinal fluid and urine analyses indicated reduced activity of aromatic L-amino acid decarboxylase and other PLP-dependent enzymes. Seizures ceased with the administration of PLP, having been resistant to treatment with pyridoxine, suggesting a defect of pyridox(am)ine 5'-phosphate oxidase (PNPO). Sequencing of the PNPO gene identified homozygous missense, splice site and stop codon mutations. Expression studies in Chinese hamster ovary cells showed that the splice site (IVS3-1g>a) and stop codon (X262Q) mutations were null activity mutations and that the missense mutation (R229W) markedly reduced pyridox(am)ine phosphate oxidase activity. Maintenance of optimal PLP levels in the brain may be important in many neurological disorders in which neurotransmitter metabolism is disturbed (either as a primary or as a secondary phenomenon).

The role of the embryo and ethylene in avocado fruit mesocarp discoloration

Science.gov (United States)

Hershkovitz, Vera; Friedman, Haya; Goldschmidt, Eliezer E.; Pesis, Edna

2009-01-01

Chilling injury (CI) symptoms in avocado (Persea americana Mill.) fruit, expressed as mesocarp discoloration, were found to be associated with embryo growth and ethylene production during cold storage. In cvs Ettinger and Arad most mesocarp discoloration was located close to the base of the seed and was induced by ethylene treatment in seeded avocado fruit. However, ethylene did not increase mesocarp discoloration in seedless fruit stored at 5 °C. Application of ethylene to whole fruit induced embryo development inside the seed. It also induced seedling elongation when seeds were imbibed separately. Persea americana ethylene receptor (PaETR) gene expression and polyphenol oxidase activity were highest close to the base of the seed and decreased gradually toward the blossom end. By contrast, expressions of PaETR transcript and polyphenol oxidase activity in seedless avocado fruit were similar throughout the pulp at the base of the fruit. Application of the ethylene inhibitor, 1-methylcyclopropene, decreased mesocarp browning, embryo development, seedling growth, and ion leakage, and down-regulated polyphenol oxidase activity. The results demonstrate that ethylene-mediated embryo growth in whole fruit is involved in the mesocarp response to ethylene perception and the development of CI disorders. PMID:19196750

Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory.

Science.gov (United States)

Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David

2015-10-01

A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

Science.gov (United States)

Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

2017-01-23

The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

Polyphenol-Rich Extract from Propolis Reduces the Expression and Activity of Streptococcus mutans Glucosyltransferases at Subinhibitory Concentrations

Directory of Open Access Journals (Sweden)

Jorge Jesús Veloz

2016-01-01

Full Text Available Tooth decay is an infectious disease, whose main causative agent identified is Streptococcus mutans (S. mutans. Diverse treatments have been used to eradicate this microorganism, including propolis. To date, it has been shown that polyphenols from Chilean propolis inhibit S. mutans growth and biofilm formation. However, the molecular mechanisms underlying this process are unclear. In the present study, we assessed the effect of Chilean propolis on the expression and activity of the glycosyltransferases enzymes and their related genes. Polyphenol-rich extract from propolis inhibited gene expression of glycosyltransferases (GtfB, GtfC, and GtfD and their related regulatory genes, for example, VicK, VicR, and CcpA. Moreover, the treatment inhibited glucosyltransferases activity measured by the formation of sucrose-derived glucans. Additionally, an inhibitory effect was observed in the expression of SpaP involved in sucrose-independent virulence of S. mutans. In summary, our results suggest that Chilean propolis has a dose-dependent effect on the inhibition of genes involved in S. mutans virulence and adherence through the inhibition of glucosyltransferases, showing an anticariogenic potential of polyphenols from propolis beyond S. mutans growth inhibition.

Overexpressing key component genes of the secretion pathway for enhanced secretion of an Aspergillus niger glucose oxidase in Trichoderma reesei.

Science.gov (United States)

Wu, Yilan; Sun, Xianhua; Xue, Xianli; Luo, Huiying; Yao, Bin; Xie, Xiangming; Su, Xiaoyun

2017-11-01

Vast interest exists in developing T. reesei for production of heterologous proteins. Although rich genomic and transcriptomic information has been uncovered for the T. reesei secretion pathway, little is known about whether engineering its key components could enhance expression of a heterologous gene. In this study, snc1, a v-SNARE gene, was first selected for overexpression in T. reesei. In engineered T. reesei with additional copies of snc1, the Aspergillus niger glucose oxidase (AnGOD) was produced to a significantly higher level (2.2-fold of the parental strain). hac1 and bip1, two more component genes in the secretion pathway, were further tested for overexpression and found to be also beneficial for AnGOD secretion. The overexpression of one component gene more or less affected the expression of the other two genes, suggesting a complex regulating mechanism. Our study demonstrates the potential of engineering the secretion pathway for enhancing heterologous gene production in T. reesei. Copyright © 2017 Elsevier Inc. All rights reserved.

The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

Science.gov (United States)

Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

1987-01-01

Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

Polyphenol levels in human urine after intake of six different polyphenol-rich beverages.

Science.gov (United States)

Ito, Hideyuki; Gonthier, Marie-Paule; Manach, Claudine; Morand, Christine; Mennen, Louise; Rémésy, Christian; Scalbert, Augustin

2005-10-01

Dietary polyphenols are suggested to participate in the prevention of CVD and cancer. It is essential for epidemiological studies to be able to compare intake of the main dietary polyphenols in populations. The present paper describes a fast method suitable for the analysis of polyphenols in urine, selected as potential biomarkers of intake. This method is applied to the estimation of polyphenol recovery after ingestion of six different polyphenol-rich beverages. Fifteen polyphenols including mammalian lignans (enterodiol and enterolactone), several phenolic acids (chlorogenic, caffeic, m-coumaric, gallic, and 4-O-methylgallic acids), phloretin and various flavonoids (catechin, epicatechin, quercetin, isorhamnetin, kaempferol, hesperetin, and naringenin) were simultaneously quantified in human urine by HPLC coupled with electrospray ionisation mass-MS (HPLC-electrospray-tandem mass spectrometry) with a run time of 6 min per sample. The method has been validated with regard to linearity, precision, and accuracy in intra- and inter-day assays. It was applied to urine samples collected from nine volunteers in the 24 h following consumption of either green tea, a grape-skin extract, cocoa beverage, coffee, grapefruit juice or orange juice. Levels of urinary excretion suggest that chlorogenic acid, gallic acid, epicatechin, naringenin or hesperetin could be used as specific biomarkers to evaluate the consumption of coffee, wine, tea or cocoa, and citrus juices respectively.

Preharvest Ultraviolet C Irradiation Increased the Level of Polyphenol Accumulation and Flavonoid Pathway Gene Expression in Strawberry Fruit.

Science.gov (United States)

Xu, Yanqun; Charles, Marie Thérèse; Luo, Zisheng; Mimee, Benjamin; Veronneau, Pierre-Yves; Rolland, Daniel; Roussel, Dominique

2017-11-22

Preharvest ultraviolet C (UV-C) irradiation is an innovative approach for increasing the bioactive phytochemical content of strawberries to increase the disease resistance and nutritional value. This study investigated the changes in individual flavonoids in strawberry developed with three different cumulative doses of preharvest UV-C treatment (low, 9.6 kJ m -2 ; middle, 15 kJ m -2 ; and high , 29.4 kJ m -2 ). Significant accumulation (p radiation. The expression of the flavonoid pathway structural genes, i.e., FaCHS1, FaCHI, FaFHT, FaDFR, FaFLS, and FaFGT, was upregulated in the low- and middle-dose groups, while the early stage genes were not affected by the high dose. FaMYB1 was also relatively enhanced in the low- and middle-dose groups, while FaASR was upregulated in only the low-dose group. Hormetic preharvest UV-C dose ranges for enhancing the polyphenol content of strawberries were established for the first time.

Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis.

Directory of Open Access Journals (Sweden)

Xiuchun Ge

Full Text Available Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation.

Peroxisomal Polyamine Oxidase and NADPH-Oxidase cross-talk for ROS homeostasis which affects respiration rate in Arabidopsis thaliana

Directory of Open Access Journals (Sweden)

Efthimios A. Andronis

2014-04-01

Full Text Available Homeostasis of reactive oxygen species (ROS in the intracellular compartments is of critical importance as ROS have been linked with nearly all cellular processes and more importantly with diseases and aging. PAs are nitrogenous molecules with an evolutionary conserved role in the regulation of metabolic and energetic status of cells. Recent evidence also suggests that polyamines (PA are major regulators of ROS homeostasis. In Arabidopsis the backconversion of the PAs spermidine (Spd and spermine (Spm to putrescine (Put and Spd, respectively is catalyzed by two peroxisomal PA oxidases (AtPAO. However, the physiological role of this pathway remains largely elusive. Here we explore the role of peroxisomal PA backconversion and in particular that catalyzed by the highly expressed AtPAO3 in the regulation of ROS homeostasis and mitochondrial respiratory burst. Exogenous PAs exert an NADPH-oxidase dependent stimulation of oxygen consumption, with Spd exerting the strongest effect. This increase is attenuated by treatment with the NADPH-oxidase blocker diphenyleneiodonium iodide (DPI. Loss-of-function of AtPAO3 gene results to increased NADPH-oxidase-dependent production of superoxide anions (O2.-, but not H2O2, which activate the mitochondrial alternative oxidase pathway (AOX. On the contrary, overexpression of AtPAO3 results to an increased but balanced production of both H2O2 and O2.-. These results suggest that the ratio of O2.-/H2O2 regulates respiratory chain in mitochondria, with PA-dependent production of O2.- by NADPH-oxidase tilting the balance of electron transfer chain in favor of the AOX pathway. In addition, AtPAO3 seems to be an important component in the regulating module of ROS homeostasis, while a conserved role for PA backconversion and ROS across kingdoms is discussed.

Targeting miRNAs by polyphenols: Novel therapeutic strategy for cancer.

Science.gov (United States)

Pandima Devi, Kasi; Rajavel, Tamilselvam; Daglia, Maria; Nabavi, Seyed Fazel; Bishayee, Anupam; Nabavi, Seyed Mohammad

2017-10-01

In the recent years, polyphenols have gained significant attention in scientific community owing to their potential anticancer effects against a wide range of human malignancies. Epidemiological, clinical and preclinical studies have supported that daily intake of polyphenol-rich dietary fruits have a strong co-relationship in the prevention of different types of cancer. In addition to direct antioxidant mechanisms, they also regulate several therapeutically important oncogenic signaling and transcription factors. However, after the discovery of microRNA (miRNA), numerous studies have identified that polyphenols, including epigallocatechin-3-gallate, genistein, resveratrol and curcumin exert their anticancer effects by regulating different miRNAs which are implicated in all the stages of cancer. MiRNAs are short, non-coding endogenous RNA, which silence the gene functions by targeting messenger RNA (mRNA) through degradation or translation repression. However, cancer associated miRNAs has emerged only in recent years to support its applications in cancer therapy. Preclinical experiments have suggested that deregulation of single miRNA is sufficient for neoplastic transformation of cells. Indeed, the widespread deregulation of several miRNA profiles of tumor and healthy tissue samples revealed the involvement of many types of miRNA in the development of numerous cancers. Hence, targeting the miRNAs using polyphenols will be a novel and promising strategy in anticancer chemotherapy. Herein, we have critically reviewed the potential applications of polyphenols on various human miRNAs, especially which are involved in oncogenic and tumor suppressor pathways. Copyright © 2017 Elsevier Ltd. All rights reserved.

Dietary polyphenol intake in Europe

DEFF Research Database (Denmark)

Zamora-Ros, Raul; Knaze, Viktoria; Rothwell, Joseph A

2016-01-01

were collected using a standardized 24-h dietary recall software administered to 36,037 adult subjects. Dietary data were linked with Phenol-Explorer, a database with data on 502 individual polyphenols in 452 foods and data on polyphenol losses due to cooking and food processing. RESULTS: Mean total....... The current cross-sectional analysis aimed at estimating dietary intakes of all currently known individual polyphenols and total intake per class and subclass, and to identify their main food sources in the European Prospective Investigation into Cancer and Nutrition cohort. METHODS: Dietary data at baseline...... polyphenol intake was the highest in Aarhus-Denmark (1786 mg/day in men and 1626 mg/day in women) and the lowest in Greece (744 mg/day in men and 584 mg/day in women). When dividing the subjects into three regions, the highest intake of total polyphenols was observed in the UK health-conscious group...

Effects of Long-Term Feeding of the Polyphenols Resveratrol and Kaempferol in Obese Mice

Science.gov (United States)

Montero, Mayte; de la Fuente, Sergio; Fonteriz, Rosalba I.; Moreno, Alfredo; Alvarez, Javier

2014-01-01

The effect of the intake of antioxidant polyphenols such as resveratrol and others on survival and different parameters of life quality has been a matter of debate in the last years. We have studied here the effects of the polyphenols resveratrol and kaempferol added to the diet in a murine model undergoing long-term hypercaloric diet. Using 50 mice for each condition, we have monitored weight, survival, biochemical parameters such as blood glucose, insulin, cholesterol, triglycerides and aspartate aminotransferase, neuromuscular coordination measured with the rotarod test and morphological aspect of stained sections of liver and heart histological samples. Our data show that mice fed since they are 3-months-old with hypercaloric diet supplemented with any of these polyphenols reduced their weight by about 5–7% with respect to the controls fed only with hypercaloric diet. We also observed that mice fed with any of the polyphenols had reduced levels of glucose, insulin and cholesterol, and better marks in the rotarod test, but only after 1 year of treatment, that is, during senescence. No effect was observed in the rest of the parameters studied. Furthermore, although treatment with hypercaloric diets induced large changes in the pattern of gene expression in liver, we found no significant changes in gene expression induced by the presence of any of the polyphenols. Thus, our data indicate that addition of resveratrol or kaempferol to mice food produces an initial decrease in weight in mice subjected to hypercaloric diet, but beneficial effects in other parameters such as blood glucose, insulin and cholesterol, and neuromuscular coordination, only appear after prolonged treatments. PMID:25386805

Metabolism of 2,4-dichlorophenol in tobacco engineered with bacterial degradative genes

International Nuclear Information System (INIS)

Perkins, E.J.; Sekine, M.; Gordon, M.P.

1990-01-01

The potential use of plants in toxic waste remediation has been overlooked. While chlorophenols are relatively slowly metabolized in Nicotiana tabacum var. Xanthi leaf extracts, chlorocatechols are rapidly metabolized, presumably by polyphenol oxidases. Our initial focus has been the fate of 2,4-dichlorophenol (2,4DCP) in var. Xanthi plants which express a bacterial 2,4DCP hydroxylase, which converts 2,4DCP to 3,5-dichlorocatechol. The roots of wild type and 2,4DCP hydroxylase transgenic plants growing in hydroponics were exposed to 14 C-2,4DCP. Approximately 95% of 14 C-2,4DCP metabolites remained in the roots when exposed to 2,4DCP. Upon extraction of root tissue, three major metabolites were found in untransformed plants and four major metabolites in transformed plants. Upon digestion with beta-D-glucosidase, these metabolites disappeared concomitant with the appearance of free 2,4DCP in wild type plants and 2,4DCP and 3,5-dichlorocatechol in transgenic plants. It is apparent that the chlorophenols are not readily available substrates for polyphenol oxidases in whole plants

Polyphenols as enzyme inhibitors in different degraded peat soils: Implication for microbial metabolism in rewetted peatlands

Science.gov (United States)

Zak, Dominik; Roth, Cyril; Gelbrecht, Jörg; Fenner, Nathalie; Reuter, Hendrik

2015-04-01

Recently, more than 30,000 ha of drained minerotrophic peatlands (= fens) in NE Germany were rewetted to restore their ecological functions. Due to an extended drainage history, a re-establishment of their original state is not expected in the short-term. Elevated concentrations of dissolved organic carbon, ammonium and phosphate have been measured in the soil porewater of the upper degraded peat layers of rewetted fens at levels of one to three orders higher than the values in pristine systems; an indicator of increased microbial activity in the upper degraded soil layers. On the other hand there is evidence that the substrate availability within the degraded peat layer is lowered since the organic matter has formerly been subject to intense decomposition over the decades of drainage and intense agricultural use of the areas. Previously however, it was suggested that inhibition of hydrolytic enzymes by polyphenolic substances is suspended during aeration of peat soils mainly due to the decomposition of the inhibiting polyphenols by oxidising enzymes such as phenol oxidase. Accordingly we hypothesised a lack of enzyme inhibiting polyphenols in degraded peat soils of rewetted fens compared to less decomposed peat of more natural fens. We collected both peat samples at the soil surface (0-20 cm) and fresh roots of dominating vascular plants and mosses (as peat parent material) from five formerly drained rewetted sites and five more natural sites of NE Germany and NW Poland. Less decomposed peat and living roots were used to obtain an internal standard for polyphenol analysis and to run enzyme inhibition tests. For all samples we determined the total phenolic contents and in addition we distinguished between the contents of hydrolysable and condensed tannic substances. From a methodical perspective the advantage of internal standards compared to the commercially available standards cyanidin chloride and tannic acid became apparent. Quantification with cyanidin or

Characterization of the cydAB-Encoded Cytochrome bd Oxidase from Mycobacterium smegmatis

Science.gov (United States)

Kana, Bavesh D.; Weinstein, Edward A.; Avarbock, David; Dawes, Stephanie S.; Rubin, Harvey; Mizrahi, Valerie

2001-01-01

The cydAB genes from Mycobacterium smegmatis have been cloned and characterized. The cydA and cydB genes encode the two subunits of a cytochrome bd oxidase belonging to the widely distributed family of quinol oxidases found in prokaryotes. The cydD and cydC genes located immediately downstream of cydB encode a putative ATP-binding cassette-type transporter. At room temperature, reduced minus oxidized difference spectra of membranes purified from wild-type M. smegmatis displayed spectral features that are characteristic of the γ-proteobacterial type cytochrome bd oxidase. Inactivation of cydA or cydB by insertion of a kanamycin resistance marker resulted in loss of d-heme absorbance at 631 nm. The d-heme could be restored by transformation of the M. smegmatis cyd mutants with a replicating plasmid carrying the highly homologous cydABDC gene cluster from Mycobacterium tuberculosis. Inactivation of cydA had no effect on the ability of M. smegmatis to exit from stationary phase at 37 or 42°C. The growth rate of the cydA mutant was tested under oxystatic conditions. Although no discernible growth defect was observed under moderately aerobic conditions (9.2 to 37.5 × 102 Pa of pO2 or 5 to 21% air saturation), the mutant displayed a significant growth disadvantage when cocultured with the wild type under extreme microaerophilia (0.8 to 1.7 × 102 Pa of pO2 or 0.5 to 1% air saturation). These observations were in accordance with the two- to threefold increase in cydAB gene expression observed upon reduction of the pO2 of the growth medium from 21 to 0.5% air saturation and with the concomitant increase in d-heme absorbance in spectra of membranes isolated from wild-type M. smegmatis cultured at 1% air saturation. Finally, the cydA mutant displayed a competitive growth disadvantage in the presence of the terminal oxidase inhibitor, cyanide, when cocultured with wild type at 21% air saturation in an oxystat. In conjunction with these findings, our results suggest that

Laccase gene expression as a possible key adaptation for herbivorous niche expansion in the attine fungus-growing ants

DEFF Research Database (Denmark)

de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan

generalist functional herbivores. Laccases are polyphenol oxidase enzymes (PPOs) that are best known for their ability to degrade lignin in saprophytic and wood-pathogenic fungi. We found that laccase activity was primarily expressed in newly constructed garden sections where secondary leaf compounds...

Association study of monoamine oxidase A/B genes and schizophrenia in Han Chinese

Directory of Open Access Journals (Sweden)

Li Sheng-Bin

2011-10-01

Full Text Available Abstract Background Monoamine oxidases (MAOs catalyze the metabolism of dopaminergic neurotransmitters. Polymorphisms of isoforms MAOA and MAOB have been implicated in the etiology of mental disorders such as schizophrenia. Association studies detected these polymorphisms in several populations, however the data have not been conclusive to date. Here, we investigated the association of MAOA and MAOB polymorphisms with schizophrenia in a Han Chinese population. Methods Two functional single nucleotide polymorphisms (SNPs, rs6323 of MAOA and rs1799836 of MAOB, were selected for association analysis in 537 unrelated schizophrenia patients and 536 healthy controls. Single-locus and Haplotype associations were calculated. Results No differences were found in the allelic distribution of rs6323. The G allele of rs1799836 was identified as a risk factor in the development of schizophrenia (P = 0.00001. The risk haplotype rs6323T-rs1799836G was associated with schizophrenia in female patients (P = 0.0002, but the frequency difference was not significant among male groups. Conclusions Our results suggest that MAOB is a susceptibility gene for schizophrenia. In contrast, no significant associations were observed for the MAOA functional polymorphism with schizophrenia in Han Chinese. These data support further investigation of the role of MAO genes in schizophrenia.

Genome-wide analysis and identification of cytokinin oxidase/dehydrogenase (CKX gene family in foxtail millet (Setaria italica

Directory of Open Access Journals (Sweden)

Yuange Wang

2014-08-01

Full Text Available Cytokinin oxidase/dehydrogenase (CKX; EC.1.5.99.12 regulates cytokinin (CK level in plants and plays an essential role in CK regulatory processes. CKX proteins are encoded by a small gene family with a varying number of members in different plants. In spite of their physiological importance, systematic analyses of SiCKX genes in foxtail millet have not yet been examined. In this paper, we report the genome wide isolation and characterization of SiCKXs using bioinformatic methods. A total of 11 members of the family were identified in the foxtail millet genome. SiCKX genes were distributed in seven chromosomes (chromosome 1, 3, 4, 5, 6, 7, and 11. The coding sequences of all the SiCKX genes were disrupted by introns, with numbers varying from one to four. These genes expanded in the genome mainly due to segmental duplication events. Multiple alignment and motif display results showed that all SiCKX proteins share FAD- and CK-binding domains. Putative cis-elements involved in Ca2 +-response, abiotic stress response, light and circadian rhythm regulation, disease resistance and seed development were present in the promoters of SiCKX genes. Expression data mining suggested that SiCKX genes have diverse expression patterns. Real-time PCR analysis indicated that all 11 SiCKX genes were up-regulated in embryos under 6-BA treatment, and some were NaCl or PEG inducible. Collectively, these results provide molecular insights into CKX research in plants.

The role of the monoamine oxidase A gene in moderating the response to adversity and associated antisocial behavior: a review

Directory of Open Access Journals (Sweden)

Buades-Rotger M

2014-07-01

Full Text Available Macià Buades-Rotger,1,2 David Gallardo-Pujol1,3 1Department of Personality, Faculty of Psychology, University of Barcelona, Barcelona, Spain; 2Department of Neurology, University of Lübeck, Lübeck, Germany; 3Institute for Brain, Cognition and Behavior (IR3C, University of Barcelona, Barcelona, Spain Abstract: Hereditary factors are increasingly attracting the interest of behavioral scientists and practitioners. Our aim in the present article is to introduce some state-of-the-art topics in behavioral genetics, as well as selected findings in the field, in order to illustrate how genetic makeup can modulate the impact of environmental factors. We focus on the most-studied polymorphism to date for antisocial responses to adversity: the monoamine oxidase A gene. Advances, caveats, and promises of current research are reviewed. We also discuss implications for the use of genetic information in applied settings. Keywords: behavioral genetics, antisocial behaviors, monoamine oxidase A

Allelic variations of functional markers for polyphenol oxidase (PPO)

Indian Academy of Sciences (India)

genes in Indian bread wheat (Triticum aestivum L.) cultivars. Rajender Singh, Umesh Goutam, R. K. Gupta, G. C. Pandey, Jag Shoran and Ratan Tiwari. J. Genet. 88, 325–329. Figure 1. Phenol colour reaction of kernels. Kernels without treatment by phenol solution are shown as controls. Phenol colour reaction of kernels; ...

Hot or not? Discovery and characterization of a thermostable alditol oxidase from Acidothermus cellulolyticus 11B

NARCIS (Netherlands)

Winter, Remko T.; Heuts, Dominic P. H. M.; Rijpkema, Egon M. A.; van Bloois, Edwin; Wijma, Hein J.; Fraaije, Marco W.

We describe the discovery, isolation and characterization of a highly thermostable alditol oxidase from Acidothermus cellulolyticus 11B. This protein was identified by searching the genomes of known thermophiles for enzymes homologous to Streptomyces coelicolor A3(2) alditol oxidase (AldO). A gene

High isostatic pressure and thermal processing of açaí fruit (Euterpe oleracea Martius): Effect on pulp color and inactivation of peroxidase and polyphenol oxidase.

Science.gov (United States)

Jesus, Ana Laura Tibério de; Leite, Thiago Soares; Cristianini, Marcelo

2018-03-01

The present study evaluated the effect of high isostatic pressure (HIP) on the activity of peroxidase (POD) and polyphenol oxidase (PPO) from açaí. Açaí pulp was submitted to several combinations of pressure (400, 500, 600MPa), temperature (25 and 65°C) for 5 and 15min. The combined effect of HIP technology and high temperatures (690MPa by 2 and 5min at 80°C) was also investigated and compared to the conventional thermal treatment (85°C/1min). POD and PPO enzyme activity and instrumental color were examined after processing and after 24h of refrigerated storage. Results showed stability of POD for all pressures at 25°C, which proved to be heat-resistant and baro-resistant at 65°C. For PPO, the inactivation at 65°C was 71.7% for 600MPa after 15min. In general, the increase in temperature from 25°C to 65°C reduced the PPO relative activity with no changes in color. Although the thermal treatment and the HIP (690MPa) along with high temperature (80°C) reduced the PPO relative activity, and relevant darkening was observed in the processed samples. Thus, it can be concluded that POD is more baro-resistant than PPO in açaí pulp subjected to the same HIP processing conditions and processing at 600MPa/65°C for 5min may be an effective alternative for thermal pasteurization treatments. Copyright © 2017 Elsevier Ltd. All rights reserved.

Expression Studies of Gibberellin Oxidases in Developing Pumpkin Seeds1

Science.gov (United States)

Frisse, Andrea; Pimenta, Maria João; Lange, Theo

2003-01-01

Two cDNA clones, 3-ox and 2-ox, have been isolated from developing pumpkin (Cucurbita maxima) embryos that show significant amino acid homology to gibberellin (GA) 3-oxidases and 2-oxidases, respectively. Recombinant fusion protein of clone 3-ox converted GA12-aldehyde, GA12, GA15, GA24, GA25, and GA9 to GA14-aldehyde, GA14, GA37, GA36, GA13, and GA4, respectively. Recombinant 2-ox protein oxidized GA9, GA4, and GA1 to GA51, GA34, and GA8, respectively. Previously cloned GA 7-oxidase revealed additional 3β-hydroxylation activity of GA12. Transcripts of this gene were identified in endosperm and embryo of the developing seed by quantitative reverse transcriptase-polymerase chain reaction and localized in protoderm, root apical meristem, and quiescent center by in situ hybridization. mRNA of the previously cloned GA 20-oxidase from pumpkin seeds was localized in endosperm and in tissues of protoderm, ground meristem, and cotyledons of the embryo. However, transcripts of the recently cloned GA 20-oxidase from pumpkin seedlings were found all over the embryo, and in tissues of the inner seed coat at the micropylar end. Previously cloned GA 2β,3β-hydroxylase mRNA molecules were specifically identified in endosperm tissue. Finally, mRNA molecules of the 3-ox and 2-ox genes were found in the embryo only. 3-ox transcripts were localized in tissues of cotyledons, protoderm, and inner cell layers of the root apical meristem, and 2-ox transcripts were found in all tissues of the embryo except the root tips. These results indicate tissue-specific GA-biosynthetic pathways operating within the developing seed. PMID:12644672

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Directory of Open Access Journals (Sweden)

Shan Xin

Full Text Available Apoplastic ascorbate oxidase (AO plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1 gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA. Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome, Gossypium raimondii (Gr, diploid cotton with a DD genome and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence

Cloning and Functional Analysis of the Promoter of an Ascorbate Oxidase Gene from Gossypium hirsutum.

Science.gov (United States)

Xin, Shan; Tao, Chengcheng; Li, Hongbin

2016-01-01

Apoplastic ascorbate oxidase (AO) plays significant roles in plant cell growth. However, the mechanism of underlying the transcriptional regulation of AO in Gossypium hirsutum remains unclear. Here, we obtained a 1,920-bp promoter sequence from the Gossypium hirsutum ascorbate oxidase (GhAO1) gene, and this GhAO1 promoter included a number of known cis-elements. Promoter activity analysis in overexpressing pGhAO1::GFP-GUS tobacco (Nicotiana benthamiana) showed that the GhAO1 promoter exhibited high activity, driving strong reporter gene expression in tobacco trichomes, leaves and roots. Promoter 5'-deletion analysis demonstrated that truncated GhAO1 promoters with serial 5'-end deletions had different GUS activities. A 360-bp fragment was sufficient to activate GUS expression. The P-1040 region had less GUS activity than the P-720 region, suggesting that the 320-bp region from nucleotide -720 to -1040 might include a cis-element acting as a silencer. Interestingly, an auxin-responsive cis-acting element (TGA-element) was uncovered in the promoter. To analyze the function of the TGA-element, tobacco leaves transformed with promoters with different 5' truncations were treated with indole-3-acetic acid (IAA). Tobacco leaves transformed with the promoter regions containing the TGA-element showed significantly increased GUS activity after IAA treatment, implying that the fragment spanning nucleotides -1760 to -1600 (which includes the TGA-element) might be a key component for IAA responsiveness. Analyses of the AO promoter region and AO expression pattern in Gossypium arboreum (Ga, diploid cotton with an AA genome), Gossypium raimondii (Gr, diploid cotton with a DD genome) and Gossypium hirsutum (Gh, tetraploid cotton with an AADD genome) indicated that AO promoter activation and AO transcription were detected together only in D genome/sub-genome (Gr and Gh) cotton. Taken together, these results suggest that the 1,920-bp GhAO1 promoter is a functional sequence with a

Effect of a heme oxygenase-1 inducer on NADPH oxidase ...

African Journals Online (AJOL)

Effect of a heme oxygenase-1 inducer on NADPH oxidase expression in ... and immunohistochemistry of hepatic NOX1 and NOX4 were investigated in week 4. ... (HO-1 inhibitor) administration caused upregulation of NOX gene expression ...

Cocoa Polyphenols: Evidence from Epidemiological Studies.

Science.gov (United States)

Matsumoto, Chisa

2018-01-01

Accumulating evidence suggests potential preventive effects of chocolate/cocoa on the risk of cardio vascular disease (CVD). However, cocoa products also contain high levels of sugar and fat, which increase CVD risk factors. Even, the identity of the substance in chocolate/cocoa that has a favorable effect on CVD and CVD risk factors remains unclear, growing evidence from experimental studies suggests that cocoa polyphenols might be a major contributor to cardiovascular-protective effects. However, epidemiological studies, which are necessary to evaluate an association between the risk of CVD and cocoa polyphenol, remain sparse. We will discuss recent evidence regarding the association between cocoa polyphenol consumption and the risks of CVD and its risk factors by reviewing recent epidemiological studies. We shall also provide some guidance for patient counseling and will discuss the public health implications for recommending cocoa polyphenol consumption to prevent CVD. Epidemiological studies evaluating the association between cocoa polyphenol itself and the risk of CVD are sparse. However, evidence from limited epidemiological studies suggests that cocoa polyphenol consumption may lower the risk of CVD. Given the potential adverse effects of the consumption of cocoa products with high fat and sugar and the fact that the most appropriate dose of cocoa polyphenol for cardio-protective effects has not yet been established, health care providers should remain cautious about recommending cocoa/cocoa polyphenol consumption to their patients to reduce the risk of CVD, taking the characteristics of individual patients into careful consideration. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Multi-Targeted Molecular Effects of Hibiscus sabdariffa Polyphenols: An Opportunity for a Global Approach to Obesity.

Science.gov (United States)

Herranz-López, María; Olivares-Vicente, Mariló; Encinar, José Antonio; Barrajón-Catalán, Enrique; Segura-Carretero, Antonio; Joven, Jorge; Micol, Vicente

2017-08-20

Improper diet can alter gene expression by breaking the energy balance equation and changing metabolic and oxidative stress biomarkers, which can result in the development of obesity-related metabolic disorders. The pleiotropic effects of dietary plant polyphenols are capable of counteracting by modulating different key molecular targets at the cell, as well as through epigenetic modifications. Hibiscus sabdariffa (HS)-derived polyphenols are known to ameliorate various obesity-related conditions. Recent evidence leads to propose the complex nature of the underlying mechanism of action. This multi-targeted mechanism includes the regulation of energy metabolism, oxidative stress and inflammatory pathways, transcription factors, hormones and peptides, digestive enzymes, as well as epigenetic modifications. This article reviews the accumulated evidence on the multiple anti-obesity effects of HS polyphenols in cell and animal models, as well as in humans, and its putative molecular targets. In silico studies reveal the capacity of several HS polyphenols to act as putative ligands for different digestive and metabolic enzymes, which may also deserve further attention. Therefore, a global approach including integrated and networked omics techniques, virtual screening and epigenetic analysis is necessary to fully understand the molecular mechanisms of HS polyphenols and metabolites involved, as well as their possible implications in the design of safe and effective polyphenolic formulations for obesity.

Multi-Targeted Molecular Effects of Hibiscus sabdariffa Polyphenols: An Opportunity for a Global Approach to Obesity

Science.gov (United States)

Herranz-López, María; Olivares-Vicente, Mariló; Barrajón-Catalán, Enrique; Segura-Carretero, Antonio; Joven, Jorge; Micol, Vicente

2017-01-01

Improper diet can alter gene expression by breaking the energy balance equation and changing metabolic and oxidative stress biomarkers, which can result in the development of obesity-related metabolic disorders. The pleiotropic effects of dietary plant polyphenols are capable of counteracting by modulating different key molecular targets at the cell, as well as through epigenetic modifications. Hibiscus sabdariffa (HS)-derived polyphenols are known to ameliorate various obesity-related conditions. Recent evidence leads to propose the complex nature of the underlying mechanism of action. This multi-targeted mechanism includes the regulation of energy metabolism, oxidative stress and inflammatory pathways, transcription factors, hormones and peptides, digestive enzymes, as well as epigenetic modifications. This article reviews the accumulated evidence on the multiple anti-obesity effects of HS polyphenols in cell and animal models, as well as in humans, and its putative molecular targets. In silico studies reveal the capacity of several HS polyphenols to act as putative ligands for different digestive and metabolic enzymes, which may also deserve further attention. Therefore, a global approach including integrated and networked omics techniques, virtual screening and epigenetic analysis is necessary to fully understand the molecular mechanisms of HS polyphenols and metabolites involved, as well as their possible implications in the design of safe and effective polyphenolic formulations for obesity. PMID:28825642

RNA Interference of 1-Aminocyclopropane-1-carboxylic Acid Oxidase (ACO1 and ACO2 Genes Expression Prolongs the Shelf Life of Eksotika (Carica papaya L. Papaya Fruit

Directory of Open Access Journals (Sweden)

Rogayah Sekeli

2014-06-01

Full Text Available The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6. Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

Combined effect of ultrasound, heat, and pressure on Escherichia coli O157:H7, polyphenol oxidase activity, and anthocyanins in blueberry (Vaccinium corymbosum) juice.

Science.gov (United States)

Zhu, Jinyan; Wang, Yuehua; Li, Xinghe; Li, Bin; Liu, Suwen; Chang, Nan; Jie, Ding; Ning, Chong; Gao, Haiyan; Meng, Xianjun

2017-07-01

The objective of this study was to evaluate the effect of different treatments-heat treatment (HT), sonication (SC), thermosonication (TS), manosonication (MS), manothermal (MT), and manothermosonication (MTS) on Escherichia coli O157:H7, polyphenol oxidase (PPO), and anthocyanin content in blueberry juice. First, samples were treated at different temperatures (30, 40, 50, 60, 70, and 80°C) and power intensities (280, 420, 560, and 700W) for 10min. Subsequently, samples were treated using combinations of power intensity and mild temperature for 10min. For further study, samples were treated using HT (80°C), TS (40°C, 560W), MT (350MPa, 40°C), MS (560W, 5min/350MPa), or MTS (560W, 5min, 40°C/350MPa, 40°C) for 5, 10, 15, 20min for each treatment, and the results compared between treatments. HT significantly reduced PPO activation (2.05% residual activity after only 5min), and resulted in a 2.00-log reduction in E. coli O157:H7 and an 85.25% retention of anthocyanin. Escherichia coli O157:H7 was slightly inactivated by TS after 5min (0.17-log reduction), while residual PPO activity was 23.36% and anthocyanin retention was 98.48%. However, Escherichia coli O157:H7 was rapidly inactivated by MTS (5.85-log reduction) after 5min, while anthocyanin retention was 97.49% and residual PPO activity dropped to 10.91%. The destruction of E. coli cells as a result of these treatments were confirmed using SEM and TEM. Therefore, a combination of sonication, high pressure, and mild heat allows the safety of blueberry juice to be maintained without compromising the retention of desirable antioxidant compounds. Copyright © 2017 Elsevier B.V. All rights reserved.

Managing hypertension by polyphenols.

Science.gov (United States)

Fernández-Arroyo, Salvador; Camps, Jordi; Menendez, Javier A; Joven, Jorge

2015-06-01

Some polyphenols, obtained from plants of broad use, induce a favorable endothelial response in hypertension and beneficial effects in the management of other metabolic cardiovascular risks. Previous studies in our laboratories using the calyces of Hibiscus sabdariffa as a source of polyphenols show that significant effects on hypertension are noticeable in humans only when provided in high amounts. Available data are suggestive in animal models and ex vivo experiments, but data in humans are difficult to acquire. Additionally, and despite the low bioavailability of polyphenols, intervention studies provide evidence for the protective effects of secondary plant metabolites. Assumptions on public health benefits are limited by the lack of scientific knowledge, robust data derived from large randomized clinical trials, and an accurate assessment of the bioactive components provided by common foodstuff. Because it is likely that clinical effects are the result of multiple interactions among different polyphenols rather than the isolated action of unique compounds, to provide polyphenol-rich botanical extracts as dietary supplements is a suggestive option. Unfortunately, the lack of patent perspectives for the pharmaceutical industries and the high cost of production and release for alimentary industries will hamper the performance of the necessary clinical trials. Here we briefly discuss whether and how such limitations may complicate the extensive use of plant-derived products in the management of hypertension and which steps are the necessary to deal with the predictable complexity in a possible clinical practice. Georg Thieme Verlag KG Stuttgart · New York.

Select polyphenolic fractions from dried plum enhance osteoblast activity through BMP-2 signaling.

Science.gov (United States)

Graef, Jennifer L; Rendina-Ruedy, Elizabeth; Crockett, Erica K; Ouyang, Ping; King, Jarrod B; Cichewicz, Robert H; Lucas, Edralin A; Smith, Brenda J

2018-05-01

Dried plum supplementation has been shown to enhance bone formation while suppressing bone resorption. Evidence from previous studies has demonstrated that these responses can be attributed in part to the fruit's polyphenolic compounds. The purpose of this study was to identify the most bioactive polyphenolic fractions of dried plum with a focus on their osteogenic activity and to investigate their mechanisms of action under normal and inflammatory conditions. Utilizing chromatographic techniques, six fractions of polyphenolic compounds were prepared from a crude extract of dried plum. Initial screening assays revealed that two fractions (DP-FrA and DP-FrB) had the greatest osteogenic potential. Subsequent experiments using primary bone-marrow-derived osteoblast cultures demonstrated these two fractions enhanced extracellular alkaline phosphatase (ALP), an indicator of osteoblast activity, and mineralized nodule formation under normal conditions. Both fractions enhanced bone morphogenetic protein (BMP) signaling, as indicated by increased Bmp2 and Runx2 gene expression and protein levels of phosphorylated Smad1/5. DP-FrB was most effective at up-regulating Tak1 and Smad1, as well as protein levels of phospho-p38. Under inflammatory conditions, TNF-α suppressed ALP and tended to decrease nodule formation (P=.0674). This response coincided with suppressed gene expression of Bmp2 and the up-regulation of Smad6, an inhibitor of BMP signaling. DP-FrA and DP-FrB partially normalized these responses. Our results show that certain fractions of polyphenolic compounds in dried plum up-regulate osteoblast activity by enhancing BMP signaling, and when this pathway is inhibited by TNF-α, the osteogenic response is attenuated. Copyright © 2017 Elsevier Inc. All rights reserved.

Biochemical Conservation and Evolution of Germacrene A Oxidase in Asteraceae*

Science.gov (United States)

Nguyen, Don Trinh; Göpfert, Jens Christian; Ikezawa, Nobuhiro; MacNevin, Gillian; Kathiresan, Meena; Conrad, Jürgen; Spring, Otmar; Ro, Dae-Kyun

2010-01-01

Sesquiterpene lactones are characteristic natural products in Asteraceae, which constitutes ∼8% of all plant species. Despite their physiological and pharmaceutical importance, the biochemistry and evolution of sesquiterpene lactones remain unexplored. Here we show that germacrene A oxidase (GAO), evolutionarily conserved in all major subfamilies of Asteraceae, catalyzes three consecutive oxidations of germacrene A to yield germacrene A acid. Furthermore, it is also capable of oxidizing non-natural substrate amorphadiene. Co-expression of lettuce GAO with germacrene synthase in engineered yeast synthesized aberrant products, costic acids and ilicic acid, in an acidic condition. However, cultivation in a neutral condition allowed the de novo synthesis of a single novel compound that was identified as germacrene A acid by gas and liquid chromatography and NMR analyses. To trace the evolutionary lineage of GAO in Asteraceae, homologous genes were further isolated from the representative species of three major subfamilies of Asteraceae (sunflower, chicory, and costus from Asteroideae, Cichorioideae, and Carduoideae, respectively) and also from the phylogenetically basal species, Barnadesia spinosa, from Barnadesioideae. The recombinant GAOs from these genes clearly showed germacrene A oxidase activities, suggesting that GAO activity is widely conserved in Asteraceae including the basal lineage. All GAOs could catalyze the three-step oxidation of non-natural substrate amorphadiene to artemisinic acid, whereas amorphadiene oxidase diverged from GAO displayed negligible activity for germacrene A oxidation. The observed amorphadiene oxidase activity in GAOs suggests that the catalytic plasticity is embedded in ancestral GAO enzymes that may contribute to the chemical and catalytic diversity in nature. PMID:20351109

[Investigation into the relationship between mitochondrial 12 S rRNA gene, tRNA gene and cytochrome oxidase Ⅱ gene variations and the risk of noise-induced hearing loss].

Science.gov (United States)

Jiao, J; Gu, G Z; Chen, G S; Li, Y H; Zhang, H L; Yang, Q Y; Xu, X R; Zhou, W H; Wu, H; He, L H; Zheng, Y X; Yu, S F

2017-01-06

Objective: To explore the relationship between mitochondrial 12 S rRNA gene variation, tRNA gene variation and cytochrome oxidase Ⅱ gene point mutations and the risk of noise-induced hearing loss (NIHL). Methods: A nested case-control study was performed that followed a cohort of 7 445 noise-exposed workers in a steel factory in Henan province, China, from January 1, 2006 to December 31, 2015. Subjects whose average hearing threshold was more than 40 dB(A) in high frequency were defined as the case group, and subjects whose average hearing threshold was less than 35 dB(A) in high frequency and less than 25 dB (A) in speech frequency were defined as the control group. Subjects was recruited into the case group ( n =286) and the control group ( n= 286) according to gender, age, job category and time of exposure to noise, and a 1∶1 case-control study was carried out. We genotyped eight single nucleotide polymorphisms in the mitochondrial 12 S rRNA gene, the mitochondrial tRNA gene and the mitochondrial cytochrome oxidase Ⅱ gene using SNPscan high-throughput genotyping technology from the recruited subjects. The relationship between polymorphic sites and NIHL, adjusted for covariates, was analyzed using conditional logistic regression analysis, as were the subgroup data. Results: The average age of the recruited subjects was (40.3±8.1) years and the length of service exposure to noise was (18.6±8.9) years. The range of noise exposed levels and cumulative noise exposure (CNE) was 80.1- 93.4 dB (A) and 86.8- 107.9 dB (A) · year, respectively. For workers exposed to noise at a CNE level<98 dB (A) · year, smokers showed an increased risk of NIHL of 1.88 (1.16-3.05) compared with non-smokers; for workers exposed to noise at a CNE level ≥98 dB(A) · year, smokers showed an increased risk of NIHL of 2.53 (1.49- 4.30) compared with non-smokers. For workers exposed to noise at a CNE level<98 dB (A) · year, the results of univariate analysis and multifactor analysis

Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

Science.gov (United States)

Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

2015-03-01

Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

Green tea polyphenols rescue of brain defects induced by overexpression of DYRK1A.

Directory of Open Access Journals (Sweden)

Fayçal Guedj

Full Text Available Individuals with partial HSA21 trisomies and mice with partial MMU16 trisomies containing an extra copy of the DYRK1A gene present various alterations in brain morphogenesis. They present also learning impairments modeling those encountered in Down syndrome. Previous MRI and histological analyses of a transgenic mice generated using a human YAC construct that contains five genes including DYRK1A reveal that DYRK1A is involved, during development, in the control of brain volume and cell density of specific brain regions. Gene dosage correction induces a rescue of the brain volume alterations. DYRK1A is also involved in the control of synaptic plasticity and memory consolidation. Increased gene dosage results in brain morphogenesis defects, low BDNF levels and mnemonic deficits in these mice. Epigallocatechin gallate (EGCG - a member of a natural polyphenols family, found in great amount in green tea leaves - is a specific and safe DYRK1A inhibitor. We maintained control and transgenic mice overexpressing DYRK1A on two different polyphenol-based diets, from gestation to adulthood. The major features of the transgenic phenotype were rescued in these mice.

Genetic effect of monoamine oxidase B (MAOB gene on ASD associated behavior phenotypes

Directory of Open Access Journals (Sweden)

Deepak Verma

2017-10-01

Full Text Available Autism spectrum disorder (ASD is a male predominance, behaviorally defined neurodevelopmental disorder which is characterized by impairment in social communication and restricted and repetitive activities. Abnormalities in serotoninergic function play a major role in ASD pathophysiology. Monoamine oxidases, encoded by two X-chromosomal genes MAOA and MAOB regulate the serotonergic function by the degradation of serotonin and other biological amines. Therefore, the objective of present study is to investigate genetic correlation of MAOB markers with the severity of specific behavioral traits as scored by Childhood Autism Rating Scale (CARS has been examined as quantitative trait (QT analysis using IBM-SPSS program. A total of 225 ASD patients (190 male and 35 female were recruited after psychometric evaluation done by DSM-IV-TR/DSM-5 criteria and assessment by CARS. Genotyping carried by PCR/RFLP/sequencing methods, and population were found in Hardy-Weinberg equilibrium. The outcome of the QT analysis indicating the increased score in overall CARS were associated with G and C allele of MAOB marker rs3027449 (p-value: 0.03 and rs1040399 (p-value: 0.01, respectively in male ASD children. In addition to this, major alleles of studied polymorphisms of gene were found to be statistically associated with the higher impairment in social communication domain only in male ASD children. Overall outcome of the study suggests likely involvement of MAOB with ASD in a gender-specific manner with the severity in behavior phenotypes. Considering the cumulative impact of these markers in regulating the severity of the behavioral symptoms of ASD, it is likely that MAOB gene is associated with the disorder.

Target metabolite and gene transcription profiling during the development of superficial scald in apple (Malus x domestica Borkh).

Science.gov (United States)

Busatto, Nicola; Farneti, Brian; Tadiello, Alice; Vrhovsek, Urska; Cappellin, Luca; Biasioli, Franco; Velasco, Riccardo; Costa, Guglielmo; Costa, Fabrizio

2014-07-20

Fruit quality features resulting from ripening processes need to be preserved throughout storage for economical reasons. However, during this period several physiological disorders can occur, of which superficial scald is one of the most important, due to the development of large brown areas on the fruit skin surface. This study examined the variation in polyphenolic content with the progress of superficial scald in apple, also with respect to 1-MCP, an ethylene competitor interacting with the hormone receptors and known to interfere with this etiology. The change in the accumulation of these metabolites was further correlated with the gene set involved in this pathway, together with two specific VOCs (Volatile Organic Compounds), α-farnesene and its oxidative form, 6-methyl-5-hepten-2-one. Metabolite profiling and qRT-PCR assay showed these volatiles are more heavily involved in the signalling system, while the browning coloration would seem to be due more to a specific accumulation of chlorogenic acid (as a consequence of the activation of MdPAL and MdC3H), and its further oxidation carried out by a polyphenol oxidase gene (MdPPO). In this physiological scenario, new evidence regarding the involvement of an anti-apoptotic regulatory mechanism for the compartmentation of this phenomenon in the skin alone was also hypothesized, as suggested by the expression profile of the MdDAD1, MdDND1 and MdLSD1 genes. The results presented in this work represent a step forward in understanding the physiological mechanisms of superficial scald in apple, shedding light on the regulation of the specific physiological cascade.

Polyphenols as dietary supplements: A double-edged sword

Directory of Open Access Journals (Sweden)

Keith R Martin

2009-12-01

Full Text Available Keith R Martin, Christy L AppelNutrition Program, Healthy Lifestyles Research Center, College of Nursing and Health Innovation, Arizona State University, Mesa, AZ, USAAbstract: Increased consumption of fruits and vegetables is associated with a lower risk of chronic disease such as cardiovascular disease, some forms of cancer, and neurodegeneration. Pro-oxidant-induced oxidative stress contributes to the pathogenesis of numerous chronic diseases and, as such, dietary antioxidants can quench and/or retard such processes. Dietary polyphenols, ie, phenolic acids and flavonoids, are a primary source of antioxidants for humans and are derived from plants including fruits, vegetables, spices, and herbs. Based on compelling evidence regarding the health effects of polyphenol-rich foods, new dietary supplements and polyphenol-rich foods are being developed for public use. Consumption of such products can increase dietary polyphenol intake and subsequently plasma concentrations beyond expected levels associated with dietary consumption and potentially confer additional health benefits. Furthermore, bioavailability can be modified to further increase absorption and ultimately plasma concentrations of polyphenols. However, the upper limit for plasma concentrations of polyphenols before the elaboration of adverse effects is unknown for many polyphenols. Moreover, a considerable amount of evidence is accumulating which supports the hypothesis that high-dose polyphenols can mechanistically cause adverse effects through pro-oxidative action. Thus, polyphenol-rich dietary supplements can potentially confer additional benefits but high-doses may elicit toxicity thereby establishing a double-edge sword in supplement use.Keywords: antioxidant, bioavailability, flavonoids, polyphenols, supplement

A Review of Polyphenolics in Oak Woods

Directory of Open Access Journals (Sweden)

Bo Zhang

2015-03-01

Full Text Available Polyphenolics, which are ubiquitous in plants, currently are among the most studied phytochemicals because of their perceptible chemical properties and antioxidant activity. Oak barrels and their alternatives, which are widely used in winemaking nowadays, contribute polyphenolics to wines and are thought to play crucial roles in the development of wines during aging. This study summarizes the detailed information of polyphenolics in oak woods and their products by examining their structures and discussing their chemical reactions during wine aging. This paper evaluates the most recent developments in polyphenolic chemistry by summarizing their extraction, separation, and their identification by the use of chromatographic and spectral techniques. In addition, this paper also introduces polyphenol bioactive ingredients in other plant foods.

Application of randomly amplified polymorphic DNA (RAPD ...

African Journals Online (AJOL)

Jane

2011-10-10

Oct 10, 2011 ... and T7-010 based on functional markers according to He et al. (2007). These primers were constructed by Invitrogen GmbH,. Karlsruhe, Germany, and used to amplify the polyphenol oxidases genes. The sequences of these primers were as follows: T3-001: 5`-CCA TTA ACC CTC ACT AAA GGG ACC GTA ...

Dysbindin and d-amino-acid-oxidase gene polymorphisms associated with positive and negative symptoms in schizophrenia

DEFF Research Database (Denmark)

Wirgenes, Katrine V; Djurovic, Srdjan; Agartz, Ingrid

2009-01-01

-amino-acid-oxidase (DAO) gene, both involved in glutamate receptor function, reported associations with negative symptoms and with anxiety and depression, respectively, when measured with the Positive and Negative Syndrome Scale (PANSS). METHODS: In the present study, the suggested association between dysbindin and DAO...... single nucleotide polymorphisms (SNPs) and PANSS scores was analyzed in 155 Norwegian schizophrenia patients. RESULTS: There was a significant association between the dysbindin SNP rs3213207 and severity of both negative symptoms and total symptom load, as well as between the DAO SNP rs2070587 and total...... symptom score and severity of anxiety and depression. CONCLUSION: The present association of dysbindin SNPs with negative symptoms and DAO SNPs with anxiety and depression is a replication of earlier findings and strengthens the hypothesis of a genetic association. It further indicates involvement...

Analysis of the cytochrome c oxidase subunit 1 (COX1) gene reveals the unique evolution of the giant panda.

Science.gov (United States)

Hu, Yao-Dong; Pang, Hui-Zhong; Li, De-Sheng; Ling, Shan-Shan; Lan, Dan; Wang, Ye; Zhu, Yun; Li, Di-Yan; Wei, Rong-Ping; Zhang, He-Min; Wang, Cheng-Dong

2016-11-05

As the rate-limiting enzyme of the mitochondrial respiratory chain, cytochrome c oxidase (COX) plays a crucial role in biological metabolism. "Living fossil" giant panda (Ailuropoda melanoleuca) is well-known for its special bamboo diet. In an effort to explore functional variation of COX1 in the energy metabolism behind giant panda's low-energy bamboo diet, we looked at genetic variation of COX1 gene in giant panda, and tested for its selection effect. In 1545 base pairs of the gene from 15 samples, 9 positions were variable and 1 mutation leaded to an amino acid sequence change. COX1 gene produces six haplotypes, nucleotide (pi), haplotype diversity (Hd). In addition, the average number of nucleotide differences (k) is 0.001629±0.001036, 0.8083±0.0694 and 2.517, respectively. Also, dN/dS ratio is significantly below 1. These results indicated that giant panda had a low population genetic diversity, and an obvious purifying selection of the COX1 gene which reduces synthesis of ATP determines giant panda's low-energy bamboo diet. Phylogenetic trees based on the COX1 gene were constructed to demonstrate that giant panda is the sister group of other Ursidae. Copyright © 2016 Elsevier B.V. All rights reserved.

Natural polyphenols: Influence on membrane transporters

Directory of Open Access Journals (Sweden)

Saad Abdulrahman Hussain

2016-03-01

Full Text Available Accumulated evidences have focused on the use of natural polyphenolic compounds as nutraceuticals, since they showed a wide range of bioactivities and exhibited protection against variety of age related disorders. Polyphenols have variable potencies to interact, and hence alter the activities of various transporter proteins, many of them classified as ATP-Binding Cassette transporters, like multidrug resistance protein (MDRP, and p-glycoprotein (P-gp. Some of the efflux transporters are generally linked with anticancer and antiviral drug resistance; in this context, polyphenols may be beneficial in modulating drug resistance by increasing the efficacy of anticancer and antiviral drugs. Additionally, these effects were implicated to explain the influence of dietary polyphenols on drug efficacy as result of food-drug interactions. However, limited data are available about the influence of these components on uptake transporters. Therefore, the objective of this article is to review the potential efficacies of polyphenols in modulating the functional integrity of uptake transporter proteins, including those terminated the effect of neurotransmitters, and their possible influence in neuropharmacology. [J Complement Med Res 2016; 5(1.000: 97-104

Polyphenols: skin photoprotection and inhibition of photocarcinogenesis.

Science.gov (United States)

Afaq, F; Katiyar, S K

2011-12-01

Polyphenols are a large family of naturally occurring plant products and are widely distributed in plant foods, such as, fruits, vegetables, nuts, flowers, bark and seeds, etc. These polyphenols contribute to the beneficial health effects of dietary products. Clinical and epidemiological studies suggest that exposure of the skin to environmental factors/pollutants, such as solar ultraviolet (UV) radiation induce harmful effects and leads to various skin diseases including the risk of melanoma and non-melanoma skin cancers. The incidence of non-melanoma skin cancer, comprising of squamous cell carcinoma and basal cell carcinoma, is a significant public health concern world-wide. Exposure of the skin to solar UV radiation results in inflammation, oxidative stress, DNA damage, dysregulation of cellular signaling pathways and immunosuppression thereby resulting in skin cancer. The regular intake of natural plant products, especially polyphenols, which are widely present in fruits, vegetables, dry legumes and beverages have gained considerable attention as protective agents against the adverse effects of UV radiation. In this article, we first discussed the impact of polyphenols on human health based on their structure-activity relationship and bioavailability. We then discussed in detail the photoprotective effects of some selected polyphenols on UV-induced skin inflammation, proliferation, immunosuppression, DNA damage and dysregulation of important cellular signaling pathways and their implications in skin cancer management. The selected polyphenols include: green tea polyphenols, pomegranate fruit extract, grape seed proanthocyanidins, resveratrol, silymarin, genistein and delphinidin. The new information on the mechanisms of action of these polyphenols supports their potential use in skin photoprotection and prevention of photocarcinogenesis in humans.

Influence of diabetes on the pharmacokinetic behavior of natural polyphenols.

Science.gov (United States)

Xiao, Jianbo; Högger, Petra

2014-01-01

The development of food fortified with polyphenols and polyphenol-rich foods represents a novel approach to prevent or attenuate type 2 diabetes. It has been reported that type 2 diabetes may affect the pharmacokinetics of various drugs in several animal models. There is powerful evidence linking dietary polyphenols consumption with the risk factors defining type 2 diabetes, even if some opposite results occurred. This mini-review summarizes important advances on diabetes-associated changes in pharmacokinetics of natural polyphenols. The pharmacokinetic behavior between drugs and dietary polyphenols probably may be different due to (i) Ingested dose/amount per day. The dietary polyphenol intake per day is much higher than that of clinical drugs; (ii) Complexity of the components. Clinical drugs are well-characterized and typically small molecules. However, the polyphenols in diet are unimaginably complex; (iii) Interaction with food proteins. Although the effects of food proteins on the bioavailability of polyphenols are still not examined in much detail, direct binding interactions of polyphenols to proteins always occur; (iv) The most common polyphenols in the human diet have a low intrinsic activity and are poorly absorbed from the intestine, highly metabolized, or rapidly eliminated. Although there is very limited information available so far, it is proposed that type 2 diabetes influences the pharmacokinetic behavior of dietary polyphenols including: i) competition of glucose with polyphenols regarding binding to plasma proteins; ii) weakened non-covalent interaction affinities of plasma proteins for natural polyphenols due to protein glycation in type II diabetes; iii) the enhanced clearance of polyphenols in type 2 diabetes. An understanding of diabetes-associated changes in absorption, distribution, metabolism, elimination and bioactivities of natural polyphenols as well as the mechanism of the variability should lead to the improvement of the benefits of

Galactose Oxidase from Fusarium oxysporum - Expression in E. coli and P. pastoris and Biochemical Characterization

Czech Academy of Sciences Publication Activity Database

Paukner, R.; Staudigl, P.; Choosri, W.; Sygmund, Ch.; Halada, Petr; Haltrich, D.; Leitner, CH.

2014-01-01

Roč. 9, č. 6 (2014) E-ISSN 1932-6203 Grant - others:Austrian Science Foundation(AT) L 504-B11 Institutional support: RVO:61388971 Keywords : galactose oxidase * gene * Fusarium * gene expression Subject RIV: CE - Biochemistry Impact factor: 3.234, year: 2014

Polyphenols from cocoa and vascular health-a critical review.

Science.gov (United States)

Rimbach, Gerald; Melchin, Mona; Moehring, Jennifer; Wagner, Anika E

2009-11-20

Cocoa is a rich source of dietary polyphenols. In vitro as well as cell culture data indicate that cocoa polyphenols may exhibit antioxidant and anti-inflammatory, as well as anti-atherogenic activity. Several molecular targets (e.g., nuclear factor kappa B, endothelial nitric oxide synthase, angiotensin converting enzyme) have been recently identified which may partly explain potential beneficial cardiovascular effects of cocoa polyphenols. However cocoa polyphenol concentrations, as used in many cell culture studies, are not physiologically achievable. Bioavailability studies indicate that plasma concentrations of cocoa polyphenols following dietary intake are low and in the nanomolar range. Human studies regarding the effect of cocoa polyphenols on vascular health are often underpowered and lack a rigorous study design. If dietary cocoa polyphenol intake is due to chocolate its high energy content needs to be taken into account. In order to determine potential health benefits of cocoa polyphenols large scale, long term, randomized, placebo controlled studies, (ideally with a cross-over design) as well as prospective studies are warranted.

Expression and Characterization of Glucose Oxidase from Aspergillus niger in Yarrowia lipolytica.

Science.gov (United States)

Khadivi Derakshan, Fatemeh; Darvishi, Farshad; Dezfulian, Mehrouz; Madzak, Catherine

2017-08-01

Glucose oxidase (GOX) is currently used in clinical, pharmaceutical, food and chemical industries. The aim of this study was expression and characterization of Aspergillus niger glucose oxidase gene in the yeast Yarrowia lipolytica. For the first time, the GOX gene of A. niger was successfully expressed in Y. lipolytica using a mono-integrative vector containing strong hybrid promoter and secretion signal. The highest total glucose oxidase activity was 370 U/L after 7 days of cultivation. An innovative method was used to cell wall disruption in current study, and it could be recommended to use for efficiently cell wall disruption of Y. lipolytica. Optimum pH and temperature for recombinant GOX activity were 5.5 and 37 °C, respectively. A single band with a molecular weight of 80 kDa similar to the native and pure form of A. niger GOX was observed for the recombinant GOX in SDS-PAGE analysis. Y. lipolytica is a suitable and efficient eukaryotic expression system to production of recombinant GOX in compered with other yeast expression systems and could be used to production of pure form of GOX for industrial applications.

Variation of the Phytochemical Constituents and Antioxidant Activities of Zingiber officinale var. rubrum Theilade Associated with Different Drying Methods and Polyphenol Oxidase Activity.

Science.gov (United States)

Ghasemzadeh, Ali; Jaafar, Hawa Z E; Rahmat, Asmah

2016-06-17

The effects of different drying methods (freeze drying, vacuum oven drying, and shade drying) on the phytochemical constituents associated with the antioxidant activities of Z. officinale var. rubrum Theilade were evaluated to determine the optimal drying process for these rhizomes. Total flavonoid content (TFC), total phenolic content (TPC), and polyphenol oxidase (PPO) activity were measured using the spectrophotometric method. Individual phenolic acids and flavonoids, 6- and 8-gingerol and shogaol were identified by ultra-high performance liquid chromatography method. Ferric reducing antioxidant potential (FRAP) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) assays were used for the evaluation of antioxidant activities. The highest reduction in moisture content was observed after freeze drying (82.97%), followed by vacuum oven drying (80.43%) and shade drying (72.65%). The highest TPC, TFC, and 6- and 8-shogaol contents were observed in samples dried by the vacuum oven drying method compared to other drying methods. The highest content of 6- and 8-gingerol was observed after freeze drying, followed by vacuum oven drying and shade drying methods. Fresh samples had the highest PPO activity and lowest content of flavonoid and phenolic acid compounds compared to dried samples. Rhizomes dried by the vacuum oven drying method represent the highest DPPH (52.9%) and FRAP activities (566.5 μM of Fe (II)/g DM), followed by freeze drying (48.3% and 527.1 μM of Fe (II)/g DM, respectively) and shade drying methods (37.64% and 471.8 μM of Fe (II)/g DM, respectively) with IC50 values of 27.2, 29.1, and 34.8 μg/mL, respectively. Negative and significant correlations were observed between PPO and antioxidant activity of rhizomes. Vacuum oven dried rhizomes can be utilized as an ingredient for the development of value-added food products as they contain high contents of phytochemicals with valuable antioxidant potential.

Effect of fermentation and drying on cocoa polyphenols.

Science.gov (United States)

Albertini, Barbara; Schoubben, Aurélie; Guarnaccia, Davide; Pinelli, Filippo; Della Vecchia, Mirco; Ricci, Maurizio; Di Renzo, Gian Carlo; Blasi, Paolo

2015-11-18

Cocoa seed polyphenols have demonstrated interesting beneficial effects in humans. Most polyphenols contained in fresh seeds are chemically modified during fermentation, drying, and cocoa powder or chocolate production. The improvement of these procedures to obtain a high-polyphenol-content cocoa is highly desirable. To this aim, a field investigation on the effect of fermentation and natural drying on fine flavor National cocoa (cacao Nacional) was performed. Cocoa seeds were fermented for 6 days and, every day, samples were sun-dried and analyzed for polyphenol content and antioxidant power. During the first 2 days of fermentation, Folin-Ciocalteu and FRAP tests evidenced a significant reduction of polyphenol content and antioxidant capacity, respectively. Changes during the following days of fermentation were less significant. Epicatechin, the most studied member of the catechin family, followed a similar pathway of degradation. Data confirmed the high impact of fermentation and drying on cocoa seed polyphenols. Fermentation and drying are, on the one hand, necessary to obtain cocoa flavor and palatability but, on the other hand, are responsible for greatly compromising polyphenol content. To obtain high-polyphenol-content cocoa, the existing fermentation, drying, and manufacturing protocols should be scientifically reviewed to understand and modify the critical steps.

Cytokinin oxidase/dehydrogenase genes in barley and wheat. Cloning and heterologous expression

Czech Academy of Sciences Publication Activity Database

Galuszka, P.; Frébortová, Jitka; Werner, T.; Yamada, M.; Strnad, Miroslav; Schmülling, T.; Frébort, I.

2004-01-01

Roč. 271, č. 20 (2004), s. 3990-4002 ISSN 0014-2956 Institutional research plan: CEZ:AV0Z5038910 Keywords : cereals * cloning * cytokinin oxidase/dehydrogenase Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.260, year: 2004

Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

Science.gov (United States)

Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

2012-01-01

The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

Ultraviolet Irradiation Effect on Apple Juice Bioactive Compounds during Shelf Storage

Science.gov (United States)

Juarez-Enriquez, Edmundo; Salmerón, Ivan; Gutierrez-Mendez, Nestor; Ortega-Rivas, Enrique

2016-01-01

Clarified and standardized apple juice was ultraviolet-irradiated to inactivate polyphenol oxidase enzyme and microbiota, and its effect on bioactive compounds and stability during storage was also evaluated. Apple juice was irradiated with 345.6 J/cm2 and treatment effect was evaluated in terms of color, antioxidant capacity, polyphenol content, pH, titratable acidity and total soluble solids. Using a linear regression design, inactivation kinetic of polyphenol oxidase enzyme was also described. In addition, a repeated measures design was carried out to evaluate apple juice during 24 days of storage at 4 °C and 20 °C. After irradiation, reduction of antioxidant capacity was observed while during storage, ascorbic acid content decreased up to 40% and total polyphenol content remain stable. Ultraviolet irradiation achieved a complete inactivation of polyphenol oxidase enzyme and microbiota, keeping apple juice antioxidants during ultraviolet treatment and storage available until juice consumption. UV-treated apple juice can be used as a regular beverage, ensuring antioxidant intake. PMID:28231106

Ultraviolet Irradiation Effect on Apple Juice Bioactive Compounds during Shelf Storage

Directory of Open Access Journals (Sweden)

Edmundo Juarez-Enriquez

2016-02-01

Full Text Available Clarified and standardized apple juice was ultraviolet-irradiated to inactivate polyphenol oxidase enzyme and microbiota, and its effect on bioactive compounds and stability during storage was also evaluated. Apple juice was irradiated with 345.6 J/cm2 and treatment effect was evaluated in terms of color, antioxidant capacity, polyphenol content, pH, titratable acidity and total soluble solids. Using a linear regression design, inactivation kinetic of polyphenol oxidase enzyme was also described. In addition, a repeated measures design was carried out to evaluate apple juice during 24 days of storage at 4 °C and 20 °C. After irradiation, reduction of antioxidant capacity was observed while during storage, ascorbic acid content decreased up to 40% and total polyphenol content remain stable. Ultraviolet irradiation achieved a complete inactivation of polyphenol oxidase enzyme and microbiota, keeping apple juice antioxidants during ultraviolet treatment and storage available until juice consumption. UV-treated apple juice can be used as a regular beverage, ensuring antioxidant intake.

Allelic variations in the CYBA gene of NADPH oxidase and risk of kidney complications in patients with type 1 diabetes.

Science.gov (United States)

Patente, Thiago A; Mohammedi, Kamel; Bellili-Muñoz, Naïma; Driss, Fathi; Sanchez, Manuel; Fumeron, Frédéric; Roussel, Ronan; Hadjadj, Samy; Corrêa-Giannella, Maria Lúcia; Marre, Michel; Velho, Gilberto

2015-09-01

Oxidative stress plays a pivotal role in the pathophysiology of diabetic nephropathy, and the nicotinamide adenine dinucleotide phosphate (NADPH) oxidase system is an important source of reactive oxygen species in hyperglycemic conditions in the kidney. Plasma concentration of advanced oxidation protein products (AOPP), a marker of oxidative stress, is increased in patients with diabetic nephropathy. We investigated associations of variants in the CYBA gene, encoding the regulatory subunit p22(phox) of NADPH oxidase, with diabetic nephropathy and plasma AOPP and myeloperoxidase (MPO) concentrations in type 1 diabetic patients. Seven SNPs in the CYBA region were analyzed in 1357 Caucasian subjects with type 1 diabetes from the SURGENE (n=340), GENEDIAB (n=444), and GENESIS (n=573) cohorts. Duration of follow-up was 10, 9, and 6 years, respectively. Cox proportional hazards and logistic regression analyses were used to estimate hazard ratios (HR) or odds ratios (OR) for incidence and prevalence of diabetic nephropathy. The major G-allele of rs9932581 was associated with the incidence of renal events defined as new cases of microalbuminuria or the progression to a more severe stage of nephropathy during follow-up (HR 1.59, 95% CI 1.17-2.18, P=0.003) in SURGENE. The same allele was associated with established/advanced nephropathy (OR 1.52, 95% CI 1.22-1.92, P=0.0001) and with the incidence of end-stage renal disease (ESRD) (HR 2.01, 95% CI 1.30-3.24, P=0.001) in GENEDIAB/GENESIS pooled studies. The risk allele was also associated with higher plasma AOPP concentration in subsets of SURGENE and GENEDIAB, with higher plasma MPO concentration in a subset of GENEDIAB, and with lower estimated glomerular filtration rate (eGFR) in the three cohorts. In conclusion, a functional variant in the promoter of the CYBA gene was associated with lower eGFR and with prevalence and incidence of diabetic nephropathy and ESRD in type 1 diabetic patients. These results are consistent with

Plant Polyphenol Antioxidants and Oxidative Stress

Directory of Open Access Journals (Sweden)

INES URQUIAGA

2000-01-01

Full Text Available In recent years there has been a remarkable increment in scientific articles dealing with oxidative stress. Several reasons justify this trend: knowledge about reactive oxygen and nitrogen species metabolism; definition of markers for oxidative damage; evidence linking chronic diseases and oxidative stress; identification of flavonoids and other dietary polyphenol antioxidants present in plant foods as bioactive molecules; and data supporting the idea that health benefits associated with fruits, vegetables and red wine in the diet are probably linked to the polyphenol antioxidants they contain.In this review we examine some of the evidence linking chronic diseases and oxidative stress, the distribution and basic structure of plant polyphenol antioxidants, some biological effects of polyphenols, and data related to their bioavailability and the metabolic changes they undergo in the intestinal lumen and after absorption into the organism.Finally, we consider some of the challenges that research in this area currently faces, with particular emphasis on the contributions made at the International Symposium "Biology and Pathology of Free Radicals: Plant and Wine Polyphenol Antioxidants" held July 29-30, 1999, at the Catholic University, Santiago, Chile and collected in this special issue of Biological Research

Polyphenols from Cocoa and Vascular Health—A Critical Review

Directory of Open Access Journals (Sweden)

Anika E. Wagner

2009-09-01

Full Text Available Cocoa is a rich source of dietary polyphenols. In vitro as well as cell culture data indicate that cocoa polyphenols may exhibit antioxidant and anti-inflammatory, as well as anti-atherogenic activity. Several molecular targets (e.g., nuclear factor kappa B, endothelial nitric oxide synthase, angiotensin converting enzyme have been recently identified which may partly explain potential beneficial cardiovascular effects of cocoa polyphenols. However cocoa polyphenol concentrations, as used in many cell culture studies, are not physiologically achievable. Bioavailability studies indicate that plasma concentrations of cocoa polyphenols following dietary intake are low and in the nanomolar range. Human studies regarding the effect of cocoa polyphenols on vascular health are often underpowered and lack a rigorous study design. If dietary cocoa polyphenol intake is due to chocolate its high energy content needs to be taken into account. In order to determine potential health benefits of cocoa polyphenols large scale, long term, randomized, placebo controlled studies, (ideally with a cross-over design as well as prospective studies are warranted.

Identification of Urinary Polyphenol Metabolite Patterns Associated with Polyphenol-Rich Food Intake in Adults from Four European Countries

Directory of Open Access Journals (Sweden)

Hwayoung Noh

2017-07-01

Full Text Available We identified urinary polyphenol metabolite patterns by a novel algorithm that combines dimension reduction and variable selection methods to explain polyphenol-rich food intake, and compared their respective performance with that of single biomarkers in the European Prospective Investigation into Cancer and Nutrition (EPIC study. The study included 475 adults from four European countries (Germany, France, Italy, and Greece. Dietary intakes were assessed with 24-h dietary recalls (24-HDR and dietary questionnaires (DQ. Thirty-four polyphenols were measured by ultra-performance liquid chromatography–electrospray ionization-tandem mass spectrometry (UPLC-ESI-MS-MS in 24-h urine. Reduced rank regression-based variable importance in projection (RRR-VIP and least absolute shrinkage and selection operator (LASSO methods were used to select polyphenol metabolites. Reduced rank regression (RRR was then used to identify patterns in these metabolites, maximizing the explained variability in intake of pre-selected polyphenol-rich foods. The performance of RRR models was evaluated using internal cross-validation to control for over-optimistic findings from over-fitting. High performance was observed for explaining recent intake (24-HDR of red wine (r = 0.65; AUC = 89.1%, coffee (r = 0.51; AUC = 89.1%, and olives (r = 0.35; AUC = 82.2%. These metabolite patterns performed better or equally well compared to single polyphenol biomarkers. Neither metabolite patterns nor single biomarkers performed well in explaining habitual intake (as reported in the DQ of polyphenol-rich foods. This proposed strategy of biomarker pattern identification has the potential of expanding the currently still limited list of available dietary intake biomarkers.

Characterization of Two VAO-Type Flavoprotein Oxidases from Myceliophthora thermophila

Directory of Open Access Journals (Sweden)

Alessandro R. Ferrari

2018-01-01

Full Text Available The VAO flavoprotein family consists mostly of oxidoreductases harboring a covalently linked flavin cofactor. The linkage can be either monocovalent at position 8 with a histidine or tyrosine or bicovalent at position 8 with a histidine and at position 6 with a cysteine. Bicovalently bound flavoproteins show a preference for bulkier substrates such as oligosaccharides or secondary metabolites. The genome of the thermophilic fungus Myceliophthora thermophila C1 was found to be rich in genes encoding putative covalent VAO-type flavoproteins. Enzymes from this fungus have the advantage of being rather thermostable and homologous overexpression in M. thermophila C1 is feasible. Recently we discovered a new and VAO-type carbohydrate oxidase from this fungus: xylooligosaccharide oxidase. In this study, two other putative VAO-type oxidases, protein sequence XP_003663615 (MtVAO615 and XP_003665713 (MtVAO713, were expressed in M. thermophila C1, purified and characterized. Enzyme MtVAO615 was found to contain a bicovalently bound FAD, while enzyme MtVAO713 contained a monocovalent histidyl-bound FAD. The crystal structures of both proteins were obtained which revealed atypical active site architectures. It could be experimentally verified that both proteins, when reduced, rapidly react with molecular oxygen, a hallmark of flavoprotein oxidases. A large panel of alcohols, including carbohydrates, steroids and secondary alcohols were tested as potential substrates. For enzyme MtVAO713 low oxidase activity was discovered towards ricinoleic acid.

Glucose oxidase variants with improved properities

OpenAIRE

Fischer, Rainer; Ostafe, Raluca; Prodanovic, Radivoje

2014-01-01

Source: WO14173822A3 [EN] The technology provided herein relates to novel variants of microbial glucose oxidase with improved properties, more specifically to polypeptides having glucose oxidase activity as their major enzymatic activity; to nucleic acid molecules encoding said glucose oxidases; vectors and host cells containing the nucleic acids and methods for producing the glucose oxidase; compositions comprising said glucose oxidase; methods for the preparation and production of such enzy...

Immunochemical detection of food-derived polyphenols in the aorta: macrophages as a major target underlying the anti-atherosclerotic activity of polyphenols.

Science.gov (United States)

Kawai, Yoshichika

2011-01-01

It has been suggested that polyphenol-rich diets decrease the risk of cardiovascular diseases. Although studies of the bioavailability of polyphenols, particularly their absorption and metabolism, have been reported recently, the tissue and cellular distributions underlying their biological mechanisms remain unknown. It is difficult to evaluate the specific localization of tissue and/or cellular polyphenols, because the method is limited to chromatography. To overcome these difficulties, we have developed anti-polyphenol antibodies to characterize immunohistochemically the localization of polyphenols and their metabolites in vivo. Two novel monoclonal antibodies were raised against quercetin and tea catechins, which represent flavonoid-type polyphenols distributed in foods and beverages, and are expected to exhibit anti-oxidative and anti-inflammatory activities in vivo. Using these antibodies, we identified activated macrophages as a specific target of these flavonoids during the development of atherosclerotic lesions. This review describes recent findings on the molecular actions of flavonoids that underly their anti-atherosclerotic activity in vivo.

Red Wine Polyphenols for Cancer Prevention

Science.gov (United States)

He, Shan; Sun, Cuirong; Pan, Yuanjiang

2008-01-01

Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been implicated in cancer prevention and that promote human health without recognizable side effects. Since resveratrol, a major component of red wine polyphenols, has been studied and reviewed extensively for its chemopreventive activity to interfere with the multi-stage carcinogenesis, this review focuses on recent progress in studies on cancer chemopreventive activities of red wine polyphenol extracts and fractions as well as other red wine polyphenols, like procyanidin B5 analogues and myricetin. PMID:19325788

Red Wine Polyphenols for Cancer Prevention

Directory of Open Access Journals (Sweden)

Yuanjiang Pan

2008-05-01

Full Text Available Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been implicated in cancer prevention and that promote human health without recognizable side effects. Since resveratrol, a major component of red wine polyphenols, has been studied and reviewed extensively for its chemopreventive activity to interfere with the multi-stage carcinogenesis, this review focuses on recent progress in studies on cancer chemopreventive activities of red wine polyphenol extracts and fractions as well as other red wine polyphenols, like procyanidin B5 analogues and myricetin.

Isolation and purification of pyranose 2-oxidase from Phanerochaete chrysosporium and characterization of gene structure and regulation

Science.gov (United States)

Theodorus H. de Koker; Michael D. Mozuch; Daniel Cullen; Jill Gaskell; Philip J. Kersten

2004-01-01

Pyranose 2-oxidase (POX) was recovered from Phanerochaete chrysosporium BKM-F-1767 solid substrate culture using mild extraction conditions and was purified. 13C-nuclear magnetic resonance confirmed production of D- arabino -hexos-2-ulose (glucosone) from D-glucose with the oxidase. Peptide fingerprints generated by liquid chromatography-tandem mass spectrometry of...

Polyphenols in Food: Cancer Prevention and Apoptosis Induction.

Science.gov (United States)

Sharma, Ashita; Kaur, Mandeep; Katnoria, Jatinder Kaur; Nagpal, Avinash Kaur

2017-10-06

Polyphenols are group of water-soluble organic compounds, mainly of natural origin. The compounds having about 5-7 aromatic rings and more than 12 phenolic hydroxyl groups are classified as polyphenols. These are the antioxidants which protect the body from oxidative damage. In plants, they are the secondary metabolites produced as a defense mechanism against stress factors. Antioxidant property of polyphenols is suggested to provide protection against many diseases associated with reactive oxygen species (ROS), including cancer. Various studies carried out across the world have suggested that polyphenols can inhibit the tumor generation, induce apoptosis in cancer cells and interfere in progression of tumors. This group of wonder compounds is present in surplus in natural plants and food products. Intake of polyphenols through diet can scavenge ROS and thus can help in cancer prevention. The plant derived products can also be used along with conventional chemotherapy to enhance the chemopreventive effects. The present review focuses on various in vitro and in vivo studies carried out to assess the anti-carcinogenic potential of polyphenols present in our food. Also, the pathways involved in cancer chemopreventive effects of various subclasses (flavonoids, lignans, stilbenes and phenolic acids) of polyphenols are discussed. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Evolutionary origin and function of NOX4-art, an arthropod specific NADPH oxidase

OpenAIRE

Gandara, Ana Caroline Paiva; Torres, Andr?; Bahia, Ana Cristina; Oliveira, Pedro L.; Schama, Renata

2017-01-01

Background NADPH oxidases (NOX) are ROS producing enzymes that perform essential roles in cell physiology, including cell signaling and antimicrobial defense. This gene family is present in most eukaryotes, suggesting a common ancestor. To date, only a limited number of phylogenetic studies of metazoan NOXes have been performed, with few arthropod genes. In arthropods, only NOX5 and DUOX genes have been found and a gene called NOXm was found in mosquitoes but its origin and function has not b...

The Relevance of Dietary Polyphenols in Cardiovascular Protection.

Science.gov (United States)

Murillo, Ana G; Fernandez, Maria L

2017-01-01

The chemical structure of polyphenols consisting of aromatic rings, capable of quenching free radicals, makes them ideal candidates to protect against oxidation. Polyphenols are present in a variety of foods including grapes, berries, dark chocolate, coffee and tea to mention a few. A number of studies have shown that dietary polyphenols exert a protective effect against hypertension, dyslipidemias, inflammation, endothelial function and atherosclerosis, conditions associated with increased risk for cardiovascular disease. Studies indicate that by decreasing cholesterol absorption, polyphenols alter hepatic cholesterol homeostasis resulting in decreases in plasma lipids and reduction in atherogenic lipoproteins thus having a protective effect against atherosclerosis; polyphenols have also been shown to decrease the activity of enzymes involved in the renin-angiotensinaldosterone system and improve blood pressure. Further, they have been recognized to increase nitric oxide production and to improve endothelial function. In this review we will present some of the evidence derived from epidemiological studies, clinical interventions as well as animal and cell studies supporting the cardioprotective effects of dietary polyphenols. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Study of a possible role of the monoamine oxidase A (MAOA) gene in paranoid schizophrenia among a Chinese population.

Science.gov (United States)

Sun, Yuhui; Zhang, Jiexu; Yuan, Yanbo; Yu, Xin; Shen, Yan; Xu, Qi

2012-01-01

Monoamine oxidase A (MAOA) is the enzyme responsible for degradation of several monoamines, such as dopamine and serotonin that are considered as being two of the most important neurotransmitters involved in the pathophysiology of schizophrenia. To study a possible role of the MAOA gene in conferring susceptibility to schizophrenia, the present study genotyped the variable number of tandem repeat (VNTR) polymorphism and 41 SNPs across this gene among 555 unrelated patients with paranoid schizophrenia and 567 unrelated healthy controls. Quantitative real-time PCR analysis was employed to quantify expression of MAOA mRNA in 73 drug-free patients. While none of these genotyped DNA markers showed allelic association with paranoid schizophrenia, haplotypic association was found for the VNTR-rs6323, VNTR-rs1137070, and VNTR-rs6323-rs1137070 haplotypes in female subjects. Nevertheless, no significant change of the expression of MAOA mRNA was detected in either female or male patients with paranoid schizophrenia. Our study suggests that the interaction between genetic variants within the MAOA gene may contribute to an increased risk of paranoid schizophrenia, but the precise mechanism needs further investigation. Copyright © 2011 Wiley Periodicals, Inc.

Systemic Manifestations in Pyridox(am)ine 5'-Phosphate Oxidase Deficiency.

Science.gov (United States)

Guerriero, Réjean M; Patel, Archana A; Walsh, Brian; Baumer, Fiona M; Shah, Ankoor S; Peters, Jurriaan M; Rodan, Lance H; Agrawal, Pankaj B; Pearl, Phillip L; Takeoka, Masanori

2017-11-01

Pyridoxine is converted to its biologically active form pyridoxal-5-phosphate (P5P) by the enzyme pyridox(am)ine 5'-phosphate oxidase and serves as a cofactor in nearly 200 reactions in the central nervous system. Pyridox(am)ine 5'-phosphate oxidase deficiency leads to P5P dependent epilepsy, typically a neonatal- or infantile-onset epileptic encephalopathy treatable with P5P or in some cases, pyridoxine. Following identification of retinopathy in a patient with pyridox(am)ine 5'-phosphate oxidase deficiency that was reversible with P5P therapy, we describe the systemic manifestations of pyridox(am)ine 5'-phosphate oxidase deficiency. A series of six patients with homozygous mutations of PNPO, the gene coding pyridox(am)ine 5'-phosphate oxidase, were evaluated in our center over the course of two years for phenotyping of neurological and systemic manifestations. Five of six were born prematurely, three had anemia and failure to thrive, and two had elevated alkaline phosphatase. A movement disorder was observed in two children, and a reversible retinopathy was observed in the most severely affected infant. All patients had neonatal-onset epilepsy and were on a continuum of developmental delay to profound encephalopathy. Electroencephalographic features included background slowing and disorganization, absent sleep features, and multifocal and generalized epileptiform discharges. All the affected probands carried a homozygous PNPO mutation (c.674 G>T, c.686 G>A and c.352G>A). In addition to the well-described epileptic encephalopathy, pyridox(am)ine 5'-phosphate oxidase deficiency causes a range of neurological and systemic manifestations. A movement disorder, developmental delay, and encephalopathy, as well as retinopathy, anemia, and failure to thrive add to the broadening clinical spectrum of P5P dependent epilepsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Bioavailability and activity of phytosome complexes from botanical polyphenols: the silymarin, curcumin, green tea, and grape seed extracts.

Science.gov (United States)

Kidd, Parris M

2009-09-01

Plant-derived polyphenols are increasingly receiving attention as dietary supplements for the homeostatic management of inflammation, to support detoxication, and for anticancer, weight loss, and other benefits. Their pro-homeostatic effects on genes, transcription factors, enzymes, and cell signaling pathways are being intensively explored, but the poor bioavailability of some polyphenols likely contributes to poor clinical trial outcomes. This review covers four polyphenol preparations with poor bioavailability and their complexation into phytosomes to bypass this problem. Silybin and the other silymarin flavonolignans from milk thistle conserve tissue glutathione, are liver-protective, and have anticancer potential. Curcumin and its related diphenolic curcuminoids have potent antioxidant, anti-inflammatory, and anti-carcinogenic properties. The green tea flavan-3-ol catechins have antioxidant, anti-inflammatory, cardio- and neuro-protective effects, and anti-carcinogenic benefits, with fat oxidation effects coupled to weight loss. The complex grape seed proanthocyanidin mix (including catechin and epicatechin monomers and oligomers) counters oxidative stress and protects the circulatory system. For each of these preparations, conversion into phytosomes has improved efficacy without compromising safety. The phytosome technology creates intermolecular bonding between individual polyphenol molecules and one or more molecules of the phospholipid, phosphatidylcholine (PC). Molecular imaging suggests that PC molecule(s) enwrap each polyphenol; upon oral intake the amphipathic PC molecules likely usher the polyphenol through the intestinal epithelial cell outer membrane, subsequently accessing the bloodstream. PC itself has proven clinical efficacy that contributes to phytosome in vivo actions. As a molecular delivery vehicle, phytosome technology substantially improves the clinical applicabilities of polyphenols and other poorly absorbed plant medicinals.

Role of ascorbic acid in the inhibition of polyphenol oxidase and the prevention of browning in different browning-sensitive Lactuca sativa var. capitata (L.) and Eruca sativa (Mill.) stored as fresh-cut produce.

Science.gov (United States)

Landi, Marco; Degl'Innocenti, Elena; Guglielminetti, Lorenzo; Guidi, Lucia

2013-06-01

Polyphenol oxidase (PPO) and, to a minor extent, peroxidase (POD) represent the key enzymes involved in enzymatic browning, a negative process induced by cutting fresh-cut produce such as lettuce (Lactuca sativa) and rocket salad (Eruca sativa). Although ascorbic acid is frequently utilised as an anti-browning agent, its mechanism in the prevention of the browning phenomenon is not clearly understood. The activity of PPO and POD and their isoforms in lettuce (a high-browning and low-ascorbic acid species) and rocket salad (a low-browning and high-ascorbic species) was characterised. The kinetic parameters of PPO and in vitro ascorbic acid-PPO inhibition were also investigated. In rocket salad, PPO activity was much lower than that in lettuce and cutting induced an increase in PPO activity only in lettuce. Exogenous ascorbic acid (5 mmol L(-1)) reduced PPO activity by about 90% in lettuce. POD did not appear to be closely related to browning in lettuce. PPO is the main enzyme involved in the browning phenomenon; POD appears to play a minor role. The concentration of endogenous ascorbic acid in rocket salad was related to its low-browning sensitivity after cutting. In lettuce, the addition of ascorbic acid directly inhibited PPO activity. The results suggest that the high ascorbic acid content found in rocket salad plays an effective role in reducing PPO activity. © 2012 Society of Chemical Industry.

Recent advances on tea polyphenols

Science.gov (United States)

Kanwar, Jyoti; Taskeen, Mujtaba; Mohammad, Imthiyaz; Huo, Congde; Chan, Tak Hang; Dou, Qing Ping

2012-01-01

Over the past decade many scientific and medical studies have focused on green tea for its long-purported health benefits. There is convincing evidence that tea is a cup of life. It has multiple preventive and therapeutic effects. This review thus focuses on the recent advances of tea polyphenols and their applications in the prevention and treatment of human cancers. Of the various polyphenols in tea, (−)-Epigallocatechin-3-gallate (EGCG) is the most abundant, and active compound studied in tea research. EGCG inhibits several molecular targets to inhibit cancer initiation and modulates several essential survival pathways to block cancer progression. Herein, we describe the various mechanisms of action of EGCG and also discuss previous and current ongoing clinical trials of EGCG and green tea polyphenols in different cancer types. PMID:22201858

Norrie disease gene is distinct from the monoamine oxidase genes

OpenAIRE

Sims, Katherine B.; Ozelius, Laurie; Corey, Timothy; Rinehart, William B.; Liberfarb, Ruth; Haines, Jonathan; Chen, Wei Jane; Norio, Reijo; Sankila, Eeva; de la Chapelle, Albert; Murphy, Dennis L.; Gusella, James; Breakefield, Xandra O.

1989-01-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and /or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in “classic” Norrie disease patients. Genomic DNA from these “nondelet...

Reducing Breast Cancer Recurrence: The Role of Dietary Polyphenolics

Directory of Open Access Journals (Sweden)

Andrea J. Braakhuis

2016-09-01

Full Text Available Evidence from numerous observational and clinical studies suggest that polyphenolic phytochemicals such as phenolic acids in olive oil, flavonols in tea, chocolate and grapes, and isoflavones in soy products reduce the risk of breast cancer. A dietary food pattern naturally rich in polyphenols is the Mediterranean diet and evidence suggests those of Mediterranean descent have a lower breast cancer incidence. Whilst dietary polyphenols have been the subject of breast cancer risk-reduction, this review will focus on the clinical effects of polyphenols on reducing recurrence. Overall, we recommend breast cancer patients consume a diet naturally high in flavonol polyphenols including tea, vegetables (onion, broccoli, and fruit (apples, citrus. At least five servings of vegetables and fruit daily appear protective. Moderate soy protein consumption (5–10 g daily and the Mediterranean dietary pattern show the most promise for breast cancer patients. In this review, we present an overview of clinical trials on supplementary polyphenols of dietary patterns rich in polyphenols on breast cancer recurrence, mechanistic data, and novel delivery systems currently being researched.

Transgenic rice plants expressing a Bacillus subtilis protoporphyrinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluorfen.

Science.gov (United States)

Lee, H J; Lee, S B; Chung, J S; Han, S U; Han, O; Guh, J O; Jeon, J S; An, G; Back, K

2000-06-01

Protoporphyrinogen oxidase (Protox), the penultimate step enzyme of the branch point for the biosynthetic pathway of Chl and hemes, is the target site of action of diphenyl ether (DPE) herbicides. However, Bacillus subtilis Protox is known to be resistant to the herbicides. In order to develop the herbicide-resistant plants, the transgenic rice plants were generated via expression of B. subtilis Protox gene under ubiquitin promoter targeted to the cytoplasm or to the plastid using Agrobacterium-mediated gene transformation. The integration and expression of the transgene were investigated at T0 generation by DNA and RNA blots. Most transgenic rice plants revealed one copy transgene insertion into the rice genome, but some with 3 copies. The expression levels of B. subtilis Protox mRNA appeared to correlate with the copy number. Furthermore, the plastidal transgenic lines exhibited much higher expression of the Protox mRNA than the cytoplasmic transgenic lines. The transgenic plants expressing the B. subtilis Protox gene at T0 generation were found to be resistant to oxyfluorfen when judged by cellular damage with respect to cellular leakage, Chl loss, and lipid peroxidation. The transgenic rice plants targeted to the plastid exhibited higher resistance to the herbicide than the transgenic plants targeted to the cytoplasm. In addition, possible resistance mechanisms in the transgenic plants to DPE herbicides are discussed.

Mapping of a Cellulose-Deficient Mutant Named dwarf1-1 in Sorghum bicolor to the Green Revolution Gene gibberellin20-oxidase Reveals a Positive Regulatory Association between Gibberellin and Cellulose Biosynthesis.

Science.gov (United States)

Petti, Carloalberto; Hirano, Ko; Stork, Jozsef; DeBolt, Seth

2015-09-01

Here, we show a mechanism for expansion regulation through mutations in the green revolution gene gibberellin20 (GA20)-oxidase and show that GAs control biosynthesis of the plants main structural polymer cellulose. Within a 12,000 mutagenized Sorghum bicolor plant population, we identified a single cellulose-deficient and male gametophyte-dysfunctional mutant named dwarf1-1 (dwf1-1). Through the Sorghum propinquum male/dwf1-1 female F2 population, we mapped dwf1-1 to a frameshift in GA20-oxidase. Assessment of GAs in dwf1-1 revealed ablation of GA. GA ablation was antagonistic to the expression of three specific cellulose synthase genes resulting in cellulose deficiency and growth dwarfism, which were complemented by exogenous bioactive gibberellic acid application. Using quantitative polymerase chain reaction, we found that GA was positively regulating the expression of a subset of specific cellulose synthase genes. To cross reference data from our mapped Sorghum sp. allele with another monocotyledonous plant, a series of rice (Oryza sativa) mutants involved in GA biosynthesis and signaling were isolated, and these too displayed cellulose deficit. Taken together, data support a model whereby suppressed expansion in green revolution GA genes involves regulation of cellulose biosynthesis. © 2015 American Society of Plant Biologists. All Rights Reserved.

Wine polyphenols: potential agents in neuroprotection.

Science.gov (United States)

Basli, Abdelkader; Soulet, Stéphanie; Chaher, Nassima; Mérillon, Jean-Michel; Chibane, Mohamed; Monti, Jean-Pierre; Richard, Tristan

2012-01-01

There are numerous studies indicating that a moderate consumption of red wine provides certain health benefits, such as the protection against neurodegenerative diseases. This protective effect is most likely due to the presence of phenolic compounds in wine. Wine polyphenolic compounds are well known for the antioxidant properties. Oxidative stress is involved in many forms of cellular and molecular deterioration. This damage can lead to cell death and various neurodegenerative disorders, such as Parkinson's or Alzheimer's diseases. Extensive investigations have been undertaken to determine the neuroprotective effects of wine-related polyphenols. In this review we present the neuroprotective abilities of the major classes of wine-related polyphenols.

Wine Polyphenols: Potential Agents in Neuroprotection

Science.gov (United States)

Basli, Abdelkader; Soulet, Stéphanie; Chaher, Nassima; Mérillon, Jean-Michel; Chibane, Mohamed; Monti, Jean-Pierre; Richard, Tristan

2012-01-01

There are numerous studies indicating that a moderate consumption of red wine provides certain health benefits, such as the protection against neurodegenerative diseases. This protective effect is most likely due to the presence of phenolic compounds in wine. Wine polyphenolic compounds are well known for the antioxidant properties. Oxidative stress is involved in many forms of cellular and molecular deterioration. This damage can lead to cell death and various neurodegenerative disorders, such as Parkinson's or Alzheimer's diseases. Extensive investigations have been undertaken to determine the neuroprotective effects of wine-related polyphenols. In this review we present the neuroprotective abilities of the major classes of wine-related polyphenols. PMID:22829964

Effects of hydrogen fluoride and wounding on respiratory enzymes in soybean leaves

Energy Technology Data Exchange (ETDEWEB)

Lee, C J; Miller, G W; Welkie, G W

1966-01-01

Soybeans (Glycine max, merr, Var. Hawkeye) were cultured in Hoagland's solution and fumigated with hydrogen fluoride (ca. 100 ppb). After 24, 96 and 144 hr of fumigation, the enzyme activities of cytochrome oxidase, peroxidase, catalase, polyphenol oxidase, ascorbic acid oxidase and glucose-6-phosphate dehydrogenase were assayed in leaves from fumigated and control plants. The total oxygen uptake after each time of treatment was measured. The effect of mechanically wounding the tissue on the above enzymes was determined by rubbing with carborundum. Glucose-6-phosphate dehydrogenase activity from fumigated leaves showed an average increase of 5 to 22 times that of the control. Cytochrome oxidase, peroxidase and catalase activities were markedly stimulated by fluoride fumigation. Polyphenol oxidase activity was suppressed throughout the fumigation period. Ascorbic acid oxidase was stimulated at the initial state, then showed a steady decrease in activity. In vitro tests revealed that ascorbic acid oxidase and peroxidase were very sensitive to fluoride ions. Polyphenol oxidase was only slightly inhibited by 10/sup -2/M KF solution. Cytochrome oxidase and catalase were not affected by KF up to 10/sup -2/M. Total respiration throughout the treatment period showed an accelerated rate. All enzymes studied were stimulated by wounding. The effect of HF on respiration and specific enzymes is discussed in terms of direct effects and injury. 48 references, 8 tables.

Polyphenol Concentrate from Kazakhstan Cabernet Sauvignon Collection of Grapes

Directory of Open Access Journals (Sweden)

Zarina Shulgau

2014-12-01

Full Text Available Introduction. Nowadays, most of the research in the field of gerontology is focused on the effects of the grape polyphenols. In particular, resveratrol has been shown to increase life expectancy of various living organisms, including mammals. Resveratrol also plays an important role in cancer prevention and decreases the risk of developing cardiovascular disease. In our research, we proposed the development of the therapeutic product from Cabernet Sauvignon grapes that would exhibit the beneficial properties of polyphenols. Standard operating procedures were developed in our laboratories to collect alcohol free concentrate of polyphenols from the Kazakhstan Cabernet Sauvignon collection of grapes. The purpose of the study was to investigate the composition, biological safety, and potential therapeutic effects of the polyphenol concentrate.Methods. The total polyphenol amount was determined using the Enology Analyzer Y15 (BioSystems, Spain. HPLC analysis of the polyphenol composition was performed using Agilent 1290 chromatograph. The polyphenol concentrate was analyzed for the microbiological purity and the presence of the toxic elements. The cytoprotective effect of the polyphenol concentrate was studied in experimental models of diabetes, toxic hepatitis, doxorubicin cardiomyopathy, and acute radiation sickness.Results. The total polyphenol amount in one sample was 12,819 mg/l. Polyphenol composition analysis showed presence of the following polyphenols: catechin, epicatechin, gallic acid, quercetin, miricetin, 3-glucosylkaempferol, epicatechin gallate, 3-(3,4-Dihydroxyphenyl-2-propenoic acid, catechin gallate, pitseid, kaempferol, n-hydroxy-cinnamic acid, resveratrol and chlorogenic acid. The concentrate was proven to be biologically safe and acceptable for use as a dietary supplement. The polyphenol concentrate demonstrated high antioxidant activity against ABTS and DPPH radicals in vitro. It also showed the following impacts on the various

Antioxidant and antimicrobial activities of polyphenols from ...

African Journals Online (AJOL)

USER

2010-05-17

May 17, 2010 ... population depend on them as primary health care. (Akinyemi ... The mechanism of polyphenols toxicity against microbes may be related to ... and incubated at room temperature for 3 min. ..... polyphenols in copper foliage.

Polyphenol-Rich Lentils and Their Health Promoting Effects.

Science.gov (United States)

Ganesan, Kumar; Xu, Baojun

2017-11-10

Polyphenols are a group of plant metabolites with potent antioxidant properties, which protect against various chronic diseases induced by oxidative stress. Evidence showed that dietary polyphenols have emerged as one of the prominent scientific interests due to their role in the prevention of degenerative diseases in humans. Possible health beneficial effects of polyphenols are measured based on the human consumption and their bioavailability. Lentil ( Lens culinaris ; Family: Fabaceae) is a great source of polyphenol compounds with various health-promoting properties. Polyphenol-rich lentils have a potential effect on human health, possessing properties such as antioxidant, antidiabetic, anti-obesity, anti-hyperlipidemic, anti-inflammatory and anticancer. Based on the explorative study, the current comprehensive review aims to give up-to-date information on nutritive compositions, bioactive compounds and the health-promoting effect of polyphenol-rich lentils, which explores their therapeutic values for future clinical studies. All data of in vitro , in vivo and clinical studies of lentils and their impact on human health were collected from a library database and electronic search (Science Direct, PubMed and Google Scholar). Health-promoting information was gathered and orchestrated in the suitable place in the review.

Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

Directory of Open Access Journals (Sweden)

Verónica Loera-Castañeda

2014-01-01

Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

Diversity and abundance of the arsenite oxidase gene aioA in geothermal areas of Tengchong, Yunnan, China.

Science.gov (United States)

Jiang, Zhou; Li, Ping; Jiang, Dawei; Wu, Geng; Dong, Hailiang; Wang, Yanhong; Li, Bing; Wang, Yanxin; Guo, Qinghai

2014-01-01

A total of 12 samples were collected from the Tengchong geothermal areas of Yunnan, China, with the goal to assess the arsenite (AsIII) oxidation potential of the extant microbial communities as inferred by the abundance and diversity of the AsIII oxidase large subunit gene aioA relative to geochemical context. Arsenic concentrations were higher (on average 251.68 μg/L) in neutral or alkaline springs than in acidic springs (on average 30.88 μg/L). aioA abundance ranged from 1.63 × 10(1) to 7.08 × 10(3) per ng of DNA and positively correlated with sulfide and the ratios of arsenate (AsV):total dissolved arsenic (AsTot). Based on qPCR estimates of bacterial and archaeal 16S rRNA gene abundance, aioA-harboring organisms comprised as much as ~15% of the total community. Phylogenetically, the major aioA sequences (270 total) in the acidic hot springs (pH 3.3-4.4) were affiliated with Aquificales and Rhizobiales, while those in neutral or alkaline springs (pH 6.6-9.1) were inferred to be primarily bacteria related to Thermales and Burkholderiales. Interestingly, aioA abundance at one site greatly exceeded bacterial 16S rRNA gene abundance, suggesting these aioA genes were archaeal even though phylogenetically these aioA sequences were most similar to the Aquificales. In summary, this study described novel aioA sequences in geothermal features geographically far removed from those in the heavily studied Yellowstone geothermal complex.

Cocoa Polyphenols and Inflammatory Markers of Cardiovascular Disease

Science.gov (United States)

Khan, Nasiruddin; Khymenets, Olha; Urpí-Sardà, Mireia; Tulipani, Sara; Garcia-Aloy, Mar; Monagas, María; Mora-Cubillos, Ximena; Llorach, Rafael; Andres-Lacueva, Cristina

2014-01-01

Epidemiological studies have demonstrated the beneficial effect of plant-derived food intake in reducing the risk of cardiovascular disease (CVD). The potential bioactivity of cocoa and its polyphenolic components in modulating cardiovascular health is now being studied worldwide and continues to grow at a rapid pace. In fact, the high polyphenol content of cocoa is of particular interest from the nutritional and pharmacological viewpoints. Cocoa polyphenols are shown to possess a range of cardiovascular-protective properties, and can play a meaningful role through modulating different inflammatory markers involved in atherosclerosis. Accumulated evidence on related anti-inflammatory effects of cocoa polyphenols is summarized in the present review. PMID:24566441

Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

Science.gov (United States)

Phil Kersten; Dan Cullen

2014-01-01

Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

Potential Health Benefits of Olive Oil and Plant Polyphenols.

Science.gov (United States)

Gorzynik-Debicka, Monika; Przychodzen, Paulina; Cappello, Francesco; Kuban-Jankowska, Alicja; Marino Gammazza, Antonella; Knap, Narcyz; Wozniak, Michal; Gorska-Ponikowska, Magdalena

2018-02-28

Beneficial effects of natural plant polyphenols on the human body have been evaluated in a number of scientific research projects. Bioactive polyphenols are natural compounds of various chemical structures. Their sources are mostly fruits, vegetables, nuts and seeds, roots, bark, leaves of different plants, herbs, whole grain products, processed foods (dark chocolate), as well as tea, coffee, and red wine. Polyphenols are believed to reduce morbidity and/or slow down the development of cardiovascular and neurodegenerative diseases as well as cancer. Biological activity of polyphenols is strongly related to their antioxidant properties. They tend to reduce the pool of reactive oxygen species as well as to neutralize potentially carcinogenic metabolites. A broad spectrum of health-promoting properties of plant polyphenols comprises antioxidant, anti-inflammatory, anti-allergic, anti-atherogenic, anti-thrombotic, and anti-mutagenic effects. Scientific studies present the ability of polyphenols to modulate the human immune system by affecting the proliferation of white blood cells, and also the production of cytokines or other factors that participate in the immunological defense. The aim of the review is to focus on polyphenols of olive oil in context of their biological activities.

Potential Health Benefits of Olive Oil and Plant Polyphenols

Directory of Open Access Journals (Sweden)

Monika Gorzynik-Debicka

2018-02-01

Full Text Available Beneficial effects of natural plant polyphenols on the human body have been evaluated in a number of scientific research projects. Bioactive polyphenols are natural compounds of various chemical structures. Their sources are mostly fruits, vegetables, nuts and seeds, roots, bark, leaves of different plants, herbs, whole grain products, processed foods (dark chocolate, as well as tea, coffee, and red wine. Polyphenols are believed to reduce morbidity and/or slow down the development of cardiovascular and neurodegenerative diseases as well as cancer. Biological activity of polyphenols is strongly related to their antioxidant properties. They tend to reduce the pool of reactive oxygen species as well as to neutralize potentially carcinogenic metabolites. A broad spectrum of health-promoting properties of plant polyphenols comprises antioxidant, anti-inflammatory, anti-allergic, anti-atherogenic, anti-thrombotic, and anti-mutagenic effects. Scientific studies present the ability of polyphenols to modulate the human immune system by affecting the proliferation of white blood cells, and also the production of cytokines or other factors that participate in the immunological defense. The aim of the review is to focus on polyphenols of olive oil in context of their biological activities.

Clinical, biochemical, and neuropsychiatric evaluation of a patient with a contiguous gene syndrome due to a microdeletion Xp11.3 including the Norrie disease locus and monoamine oxidase (MAOA and MAOB) genes.

Science.gov (United States)

Collins, F A; Murphy, D L; Reiss, A L; Sims, K B; Lewis, J G; Freund, L; Karoum, F; Zhu, D; Maumenee, I H; Antonarakis, S E

1992-01-01

Norrie disease is a rare X-linked recessive disorder characterized by blindness from infancy. The gene for Norrie disease has been localized to Xp11.3. More recently, the genes for monoamine oxidase (MAOA, MAOB) have been mapped to the same region. This study evaluates the clinical, biochemical, and neuropsychiatric data in an affected male and 2 obligate heterozygote females from a single family with a submicroscopic deletion involving Norrie disease and MAO genes. The propositus was a profoundly retarded, blind male; he also had neurologic abnormalities including myoclonus and stereotopy-habit disorder. Both obligate carrier females had a normal IQ. The propositus' mother met diagnostic criteria for "chronic hypomania and schizotypal features." The propositus' MAO activity was undetectable and the female heterozygotes had reduced levels comparable to patients receiving MAO inhibiting antidepressants. MAO substrate and metabolite abnormalities were found in the propositus' plasma and CSF. This study indicates that subtle biochemical and possibly neuropsychiatric abnormalities may be detected in some heterozygotes with the microdeletion in Xp11.3 due to loss of the gene product for the MAO genes; this deletion can also explain some of the complex phenotype of this contiguous gene syndrome in the propositus.

Dynamic 1-aminocyclopropane-1-carboxylate-synthase and -oxidase transcript accumulation patterns during pollen tube growth in tobacco styles.

Science.gov (United States)

Weterings, Koen; Pezzotti, Mario; Cornelissen, Marc; Mariani, Celestina

2002-11-01

In flowering plants, pollination of the stigma sets off a cascade of responses in the distal flower organs. Ethylene and its biosynthetic precursor 1-aminocyclopropane-1-carboxylate (ACC) play an important role in regulating these responses. Because exogenous application of ethylene or ACC does not invoke the full postpollination syndrome, the pollination signal probably consists of a more complex set of stimuli. We set out to study how and when the pollination signal moves through the style of tobacco (Nicotiana tabacum) by analyzing the expression patterns of pistil-expressed ACC-synthase and -oxidase genes. Results from this analysis showed that pollination induces high ACC-oxidase transcript levels in all cells of the transmitting tissue. ACC-synthase mRNA accumulated only in a subset of transmitting tract cells and to lower levels as compared with ACC-oxidase. More significantly, we found that although ACC-oxidase transcripts accumulate to uniform high levels, the ACC-synthase transcripts accumulate in a wave-like pattern in which the peak coincides with the front of the ingrowing pollen tube tips. This wave of ACC-synthase expression can also be induced by incongruous pollination and (partially) by wounding. This indicates that wounding-like features of pollen tube invasion might be part of the stimuli evoking the postpollination response and that these stimuli are interpreted differently by the regulatory mechanisms of the ACC-synthase and -oxidase genes.

Anti-inflammatory effects of polyphenols in arthritis.

Science.gov (United States)

Oliviero, Francesca; Scanu, Anna; Zamudio-Cuevas, Yessica; Punzi, Leonardo; Spinella, Paolo

2018-03-01

Polyphenols have been extensively investigated with regard to their antioxidant, anti-inflammatory, and immunomodulant properties in many inflammatory chronic conditions. The aim of this review is to summarise how these compounds can modulate the inflammatory pathways which characterise the most prevalent arthropathies including osteoarthritis, rheumatoid arthritis and crystal-induced arthritis. Among polyphenols, epigallocatechin gallate, carnosol, hydroxytyrosol, curcumin, resveratrol, kaempferol and genistein have been the most widely investigated in arthritis. The most important results of the studies outlined in this article show how polyphenolic compounds are able to inhibit the expression and the release of a number of pro-inflammatory mediators and proteolytic enzymes, the activity of different transcriptional factors and the production of reactive oxygen species in vitro. Studies on animal models of rheumatoid arthritis, osteoarthritis and gout show interesting results in terms of reduced tissue damage, restored cartilage homeostasis, and decreased levels of uric acid, respectively. Despite the multiple protective effects of polyphenols, there are no dietary recommendations for patients affected by rheumatic diseases. Future studies, including intervention trials, should be conducted to determine the relevance of polyphenols consumption or supplementation in arthritis. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Wine Polyphenols: Potential Agents in Neuroprotection

Directory of Open Access Journals (Sweden)

Abdelkader Basli

2012-01-01

Full Text Available There are numerous studies indicating that a moderate consumption of red wine provides certain health benefits, such as the protection against neurodegenerative diseases. This protective effect is most likely due to the presence of phenolic compounds in wine. Wine polyphenolic compounds are well known for the antioxidant properties. Oxidative stress is involved in many forms of cellular and molecular deterioration. This damage can lead to cell death and various neurodegenerative disorders, such as Parkinson’s or Alzheimer’s diseases. Extensive investigations have been undertaken to determine the neuroprotective effects of wine-related polyphenols. In this review we present the neuroprotective abilities of the major classes of wine-related polyphenols.

A broad distribution of the alternative oxidase in microsporidian parasites.

Directory of Open Access Journals (Sweden)

Bryony A P Williams

2010-02-01

Full Text Available Microsporidia are a group of obligate intracellular parasitic eukaryotes that were considered to be amitochondriate until the recent discovery of highly reduced mitochondrial organelles called mitosomes. Analysis of the complete genome of Encephalitozoon cuniculi revealed a highly reduced set of proteins in the organelle, mostly related to the assembly of iron-sulphur clusters. Oxidative phosphorylation and the Krebs cycle proteins were absent, in keeping with the notion that the microsporidia and their mitosomes are anaerobic, as is the case for other mitosome bearing eukaryotes, such as Giardia. Here we provide evidence opening the possibility that mitosomes in a number of microsporidian lineages are not completely anaerobic. Specifically, we have identified and characterized a gene encoding the alternative oxidase (AOX, a typically mitochondrial terminal oxidase in eukaryotes, in the genomes of several distantly related microsporidian species, even though this gene is absent from the complete genome of E. cuniculi. In order to confirm that these genes encode functional proteins, AOX genes from both A. locustae and T. hominis were over-expressed in E. coli and AOX activity measured spectrophotometrically using ubiquinol-1 (UQ-1 as substrate. Both A. locustae and T. hominis AOX proteins reduced UQ-1 in a cyanide and antimycin-resistant manner that was sensitive to ascofuranone, a potent inhibitor of the trypanosomal AOX. The physiological role of AOX microsporidia may be to reoxidise reducing equivalents produced by glycolysis, in a manner comparable to that observed in trypanosomes.

Predictive relationship between polyphenol and nonfat cocoa solids content of chocolate.

Science.gov (United States)

Cooper, Karen A; Campos-Giménez, Esther; Jiménez Alvarez, Diego; Rytz, Andreas; Nagy, Kornél; Williamson, Gary

2008-01-09

Chocolate is often labeled with percent cocoa solids content. It is assumed that higher cocoa solids contents are indicative of higher polyphenol concentrations, which have potential health benefits. However, cocoa solids include polyphenol-free cocoa butter and polyphenol-rich nonfat cocoa solids (NFCS). In this study the strength of the relationship between NFCS content (estimated by theobromine as a proxy) and polyphenol content was tested in chocolate samples with labeled cocoa solids contents in the range of 20-100%, grouped as dark (n = 46), milk (n = 8), and those chocolates containing inclusions such as wafers or nuts (n = 15). The relationship was calculated with regard to both total polyphenol content and individual polyphenols. In dark chocolates, NFCS is linearly related to total polyphenols (r2 = 0.73). Total polyphenol content appears to be systematically slightly higher for milk chocolates than estimated by the dark chocolate model, whereas for chocolates containing other ingredients, the estimates fall close to or slightly below the model results. This shows that extra components such as milk, wafers, or nuts might influence the measurements of both theobromine and polyphenol contents. For each of the six main polyphenols (as well as their sum), the relationship with the estimated NFCS was much lower than for total polyphenols (r2 chocolate type, indicating that they might still have some predictive capabilities.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae) and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Science.gov (United States)

Yong, Hoi-Sen; Song, Sze-Looi; Lim, Phaik-Eem; Eamsobhana, Praphathip

2017-01-01

The tephritid fruit fly Zeugodacus tau (Walker) is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1) the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2) the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3) and 15835 bp for the China specimen (ZT1), with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes) and a non-coding A + T-rich control region (D-loop). Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China) and Z. tau ZT1 (China) formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia). Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes) instead of partial sequence is more appropriate for determining phylogenetic relationship.

Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia.

Science.gov (United States)

Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain

2009-08-01

The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.

Polyphenol Content, Physicochemical Properties, Enzymatic Activity, Anthocyanin Profiles, and Antioxidant Capacity of Cerasus humilis (Bge. Sok. Genotypes

Directory of Open Access Journals (Sweden)

Suwen Liu

2018-01-01

Full Text Available Seven varieties of Chinese dwarf cherries were evaluated and compared with respect to their weight, diameter, titratable acidity, total soluble solids, color, polyphenol contents, ascorbic acid levels, anthocyanin profiles, enzymatic activity, and antioxidant capacity. The fruits are rich in phenolic content (339.07–770.30 mg/100 g fresh weight. Nine anthocyanins were obtained from fruits after chromatographic separation and their structures analyzed using HPLC-ESI-MS/MS. Cyanidin-3-glucoside was the major anthocyanin with 50.36–78.39% concentration. Three anthocyanins were reported for the first time in these cherries. They exhibit low polyphenol oxidase and peroxidase activities, but their superoxide dismutase activity is high (572.75–800.17 U/g FW. The highest amounts of soluble solid content (15.67 Brix %, total titratable acid (1.90%, ascorbic acid (18.47 mg/100 g FW, and total anthocyanin (152.66 mg/100 g FW were observed. Three methods (DPPH-scavenging ability, oxygen radical absorbance capacity assay, and cellular antioxidant activity assay were employed to evaluate the antioxidant capacity of the phenolic extracts of these cherries. Number 5 has the highest values of ORAC and CAA of 205.68 μmol TE/g DM and 99.67 μmol QE/100 g FW, respectively.

State of polyphenols in the drying process of fruits and vegetables.

Science.gov (United States)

McSweeney, M; Seetharaman, K

2015-01-01

This review presents an overview of drying technologies and its impact on the polyphenol content of vegetables and fruits. Polyphenols contribute to many health benefits and can act as antioxidants. Specifically an increased intake of polyphenols has been shown to decrease the incidence of cardiovascular disease; furthermore, it has been shown to help reduce the risk of neurodegenerative diseases in humans. Many researchers have reported on the effect of different drying techniques on the polyphenol content in fruits and vegetables. Polyphenol degradation mechanisms proposed in literature and pretreatments that potentially lead to higher retention of polyphenols during drying are also discussed.

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

Science.gov (United States)

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

Polyphenols: Extraction Methods, Antioxidative Action, Bioavailability and Anticarcinogenic Effects

Directory of Open Access Journals (Sweden)

Eva Brglez Mojzer

2016-07-01

Full Text Available Being secondary plant metabolites, polyphenols represent a large and diverse group of substances abundantly present in a majority of fruits, herbs and vegetables. The current contribution is focused on their bioavailability, antioxidative and anticarcinogenic properties. An overview of extraction methods is also given, with supercritical fluid extraction highlighted as a promising eco-friendly alternative providing exceptional separation and protection from degradation of unstable polyphenols. The protective role of polyphenols against reactive oxygen and nitrogen species, UV light, plant pathogens, parasites and predators results in several beneficial biological activities giving rise to prophylaxis or possibly even to a cure for several prevailing human diseases, especially various cancer types. Omnipresence, specificity of the response and the absence of or low toxicity are crucial advantages of polyphenols as anticancer agents. The main problem represents their low bioavailability and rapid metabolism. One of the promising solutions lies in nanoformulation of polyphenols that prevents their degradation and thus enables significantly higher concentrations to reach the target cells. Another, more practiced, solution is the use of mixtures of various polyphenols that bring synergistic effects, resulting in lowering of the required therapeutic dose and in multitargeted action. The combination of polyphenols with existing drugs and therapies also shows promising results and significantly reduces their toxicity.

Characterization of three bioenergetically active respiratory terminal oxidases in the cyanobacterium Synechocystis sp. strain PCC 6803.

Science.gov (United States)

Pils, D; Schmetterer, G

2001-09-25

Synechocystis sp. PCC 6803 contains three respiratory terminal oxidases (RTOs): cytochrome c oxidase (Cox), quinol oxidase (Cyd), and alternate RTO (ARTO). Mutants lacking combinations of the RTOs were used to characterize these key enzymes of respiration. Pentachlorophenol and 2-heptyl-4-hydroxy-quinoline-N-oxide inhibited Cyd completely, but had little effect on electron transport to the other RTOs. KCN inhibited all three RTOs but the in vivo K(I) for Cox and Cyd was quite different (7 vs. 27 microM), as was their affinity for oxygen (K(M) 1.0 vs. 0.35 microM). ARTO has a very low respiratory activity. However, when uptake of 3-O-methylglucose, an active H+ co-transport, was used to monitor energization of the cytoplasmic membrane, ARTO was similarly effective as the other RTOs. As removal of the gene for cytochrome c(553) had the same effects as removal of ARTO genes, we propose that the ARTO might be a second Cox. The possible functions, localization and regulation of the RTOs are discussed.

Dietary Polyphenols in the Prevention of Stroke

Directory of Open Access Journals (Sweden)

A. Tressera-Rimbau

2017-01-01

Full Text Available Polyphenols have an important protective role against a number of diseases, such as atherosclerosis, brain dysfunction, stroke, cardiovascular diseases, and cancer. Cardiovascular diseases are the number one cause of death worldwide: more people die annually from cardiovascular diseases than from any other cause. The most important behavioural risk factors of heart disease and stroke are unhealthy diet, physical inactivity, tobacco use, and excess alcohol intake. The dietary consumption of polyphenols has shown to be inversely associated with morbidity and mortality by cardio- and cerebrovascular diseases. It is well-known that the protective effects of polyphenols in vivo depend on the grade how they are extracted from food and on their intestinal absorption, metabolism, and biological action with target tissues. The aim of this review was to summarise the relation between polyphenols of different plant sources and stroke in human intervention studies, animal models, and in vitro studies.

Dietary Polyphenols in the Prevention of Stroke

Science.gov (United States)

Eder, M.

2017-01-01

Polyphenols have an important protective role against a number of diseases, such as atherosclerosis, brain dysfunction, stroke, cardiovascular diseases, and cancer. Cardiovascular diseases are the number one cause of death worldwide: more people die annually from cardiovascular diseases than from any other cause. The most important behavioural risk factors of heart disease and stroke are unhealthy diet, physical inactivity, tobacco use, and excess alcohol intake. The dietary consumption of polyphenols has shown to be inversely associated with morbidity and mortality by cardio- and cerebrovascular diseases. It is well-known that the protective effects of polyphenols in vivo depend on the grade how they are extracted from food and on their intestinal absorption, metabolism, and biological action with target tissues. The aim of this review was to summarise the relation between polyphenols of different plant sources and stroke in human intervention studies, animal models, and in vitro studies. PMID:29204249

Study of irradiation effect on curcuma polyphenols

International Nuclear Information System (INIS)

Rejeb, Imen

2008-01-01

The present study was carried out to evaluate the effect of gamma irradiation on curcumin (Curcuma Longa rhizome) component, particularly the polyphenolic fraction. Powdered rhizome was irradiated at 0, 5, 10 and 15 KGy (dose rate of 6 KGy / H). Polyphenolics were extracted and total polyphenols conent (TPC) was quantified using the Folin-Ciocalteau method. The irradiation effect was also evaluated by the HPLC technique. The chromatographic analysis showed that the irradiated and non-irradiated curcumin spectrum gave similar data. The antioxidant and antibacterial activities of the phenolic extracts were also assessed. the anti oxidative potential of the sample was evaluated using two radical scavenging methods with DPPH and ABTS. The antimicrobial analysis showed that the phenolic extracts of curcumin inhibited the growth of the studied microorganisms. Our results showed that irradiated samples were not affected in terms of polyphenols content and characteristics. (Author)

Antioxidative and apoptotic properties of polyphenolic extracts from edible part of artichoke (Cynara scolymus L.) on cultured rat hepatocytes and on human hepatoma cells.

Science.gov (United States)

Miccadei, Stefania; Di Venere, Donato; Cardinali, Angela; Romano, Ferdinando; Durazzo, Alessandra; Foddai, Maria Stella; Fraioli, Rocco; Mobarhan, Sohrab; Maiani, Giuseppe

2008-01-01

Cultured rat hepatocytes and human hepatoma HepG2 cells were used to evaluate the hepatoprotective properties of polyphenolic extracts from the edible part of artichoke (AE). The hepatocytes were exposed to H2O2generated in situ by glucose oxidase and were treated with either AE, or pure chlorogenic acid (ChA) or with the well known antioxidant, N, N'-diphenyl-p-phenilenediamine (DPPD). Addition of glucose oxidase to the culture medium caused depletion of intracellular glutathione (GSH) content, accumulation of malondialdehyde (MDA) in the cultures, as a lipid peroxidation indicator, and cell death. These results demonstrated that AE protected cells from the oxidative stress caused by glucose oxidase, comparable to DPPD. Furthermore, AE, as well as ChA, prevented the loss of total GSH and the accumulation of MDA. Treatment of HepG2 cells for 24 h with AE reduced cell viability in a dose-dependent manner, however, ChA had no prominent effects on the cell death rate. Similarly, AE rather than ChA induced apoptosis, measured by flow cytometric analysis of annexin and by activation of caspase-3, in HepG2 cells. Our findings indicate that AE had a marked antioxidative potential that protects hepatocytes from an oxidative stress. Furthermore, AE reduced cell viability and had an apoptotic activity on a human liver cancer cell line.

Separation of polyphenols and arecoline from areca nut (Areca catechu L.) by solvent extraction, its antioxidant activity, and identification of polyphenols.

Science.gov (United States)

Chavan, Yogita V; Singhal, Rekha S

2013-08-15

Areca nut (Areca catechu L.) or betel nut, a commercial cash crop, is a rich source of polyphenols but also contains toxic alkaloids, mainly arecoline. Separation of these bioactive polyphenols from toxic constituents could propel the safe and beneficial use of betel nut; also it will help arecanut processing industries to produce arecoline-free products. With the aim to develop an effective method for maximum extraction of polyphenols with minimum arecoline, several factors such as nature of the solvent, pH (2-10), substrate concentration (6-14 %) and extraction time (30-150 min) under shaking conditions were evaluated. Qualitative analysis was done using spectrophotometry and high-performance liquid chromatography (HPLC). Maximum extraction of polyphenols (407.47 mg GAE g(-1)), total tannin and its antioxidant activity with minimum arecoline (1.73 mg g(-1) of sample) was achieved by using 80% acetone at pH 4 for 90 min with 10% w/v substrate under shaking conditions. Solvent extraction under optimized parameters gave maximum polyphenols with minimum extraction of arecoline, and highest ratio of polyphenols to arecoline. HPLC and liquid chromatography-mass spectrometry results confirmed the presence of catechin and epicatechin in the extract, which suggests its potential as a source of bioactives. © 2013 Society of Chemical Industry.

The Reciprocal Interactions between Polyphenols and Gut Microbiota and Effects on Bioaccessibility

Science.gov (United States)

Ozdal, Tugba; Sela, David A.; Xiao, Jianbo; Boyacioglu, Dilek; Chen, Fang; Capanoglu, Esra

2016-01-01

As of late, polyphenols have increasingly interested the scientific community due to their proposed health benefits. Much of this attention has focused on their bioavailability. Polyphenol–gut microbiota interactions should be considered to understand their biological functions. The dichotomy between the biotransformation of polyphenols into their metabolites by gut microbiota and the modulation of gut microbiota composition by polyphenols contributes to positive health outcomes. Although there are many studies on the in vivo bioavailability of polyphenols, the mutual relationship between polyphenols and gut microbiota is not fully understood. This review focuses on the biotransformation of polyphenols by gut microbiota, modulation of gut microbiota by polyphenols, and the effects of these two-way mutual interactions on polyphenol bioavailability, and ultimately, human health. PMID:26861391

High nitrogen availability reduces polyphenol content in Sphagnum peat.

Science.gov (United States)

Bragazza, Luca; Freeman, Chris

2007-05-15

Peat mosses of the genus Sphagnum constitute the bulk of living and dead biomass in bogs. These plants contain peculiar polyphenols which hamper litter peat decomposition through their inhibitory activity on microbial breakdown. In the light of the increasing availability of biologically active nitrogen in natural ecosystems, litter derived from Sphagnum mosses is an ideal substrate to test the potential effects of increased atmospheric nitrogen deposition on polyphenol content in litter peat. To this aim, we measured total nitrogen and soluble polyphenol concentration in Sphagnum litter peat collected in 11 European bogs under a chronic gradient of atmospheric nitrogen deposition. Our results demonstrate that increasing nitrogen concentration in Sphagnum litter, as a consequence of increased exogenous nitrogen availability, is accompanied by a decreasing concentration of polyphenols. This inverse relationship is consistent with reports that in Sphagnum mosses, polyphenol and protein biosynthesis compete for the same precursor. Our observation of modified Sphagnum litter chemistry under chronic nitrogen eutrophication has implications in the context of the global carbon balance, because a lower content of decay-inhibiting polyphenols would accelerate litter peat decomposition.

Population-based nutrikinetic modeling of polyphenol exposure

NARCIS (Netherlands)

van Velzen, E.J.J.; Westerhuis, J.A.; Grün, C.H.; Jacobs, D.M.; Eilers, P.H.C.; Mulder, Th.P.; Foltz, M.; Garczarek, U.; Kemperman, R.; Vaughan, E. E.; van Duynhoven, J.P.M.; Smilde, A.K.

2014-01-01

The beneficial health effects of fruits and vegetables have been attributed to their polyphenol content. These compounds undergo many bioconversions in the body. Modeling polyphenol exposure of humans upon intake is a prerequisite for understanding the modulating effect of the food matrix and the

Spirit drinks: a source of dietary polyphenols

Directory of Open Access Journals (Sweden)

Sanja Posavec

2012-01-01

Full Text Available There is a long tradition in the production of spirit drinks and using them in the human diet, especially in the Southeast European and Mediterranean regions. The objective of this study was to evaluate whether and which spirits can serve, and to what extent, as a source of biologically active compounds in the human diet. Polyphenolic compounds are biologically active compounds of fruits, vegetables and derived beverages, which have been implicated in their antioxidant activity. Therefore, the total polyphenol content (TPC and antioxidative properties of 46 spirit drinks and liqueurs produced in Croatia were examined. The total polyphenol content and antioxidant activity were estimated using spectrophotometric methods (Folin-Ciocalteu, DPPH and FRAP, while certain phenols were detected by the HPLC. It was established that spirit drinks aged in wooden casks, such as wine or plum brandy, contain polyphenols ranging from 40-90 mg GAE/L (gallic acid equivalents, whereas walnut or sour cherry liquors contain much more polyphenols ranging from 680-3360 mg GAE/L. The antioxidant activity of analyzed spirit drinks was in correlation with TPC. Walnut and sour cherry liqueur samples had very high antioxidant activity, within the range of those obtained with 1.26 mM Trolox-DPPH assay and 9.5 mM Trolox-FRAP assay.

Polyphenol supplementation: benefits for exercise performance or oxidative stress?

Science.gov (United States)

Myburgh, Kathryn H

2014-05-01

Supplement use among athletes is widespread, including non-traditional and biological compounds. Despite increasing research, a comprehensive and critical review on polyphenol supplementation and exercise is still lacking. This review is relevant for researchers directly involved in the topic, as well as those with a broad interest in athletic performance enhancement and sports nutrition. The purpose of this review is to present background information on groups of polyphenols and their derivatives because their differing chemical structures influence mechanisms of action; to discuss the potential of plant, fruit and vegetable-based biological supplements, high in polyphenol content, to affect exercise performance and biomarkers of oxidative stress and exercise-induced muscle damage; and to critically discuss the exercise studies and biomarkers used. Subjects in the studies reviewed were either sedentary, healthy individuals, or active, recreationally trained or well-trained athletes. Polyphenol supplementation in exercise studies included mainly extracts (multicomponent or purified), juices, infusions or an increased intake of polyphenol-rich foods. This review includes details of supplement doses and exercise test protocols. Many studies considered only the performance or one or two selected biomarkers of antioxidant capacity instead of a comprehensive choice of biomarkers to assess damage to lipids or proteins. Evidence is insufficient to make recommendations for or against the use of polyphenol supplementation (neither specific polyphenols nor specific doses) for either recreational, competitive or elite athletes. Polyphenols have multiple biological effects, and future exercise studies must be designed appropriately and specifically to determine physiological interactions between exercise and the selected supplement, rather than considering performance alone.

Heterologous expression of the Crassostrea gigas (Pacific oyster) alternative oxidase in the yeast Saccharomyces cerevisiae.

Science.gov (United States)

Robertson, Aaron; Schaltz, Kyle; Neimanis, Karina; Staples, James F; McDonald, Allison E

2016-10-01

Alternative oxidase (AOX) is a terminal oxidase within the inner mitochondrial membrane (IMM) present in many organisms where it functions in the electron transport system (ETS). AOX directly accepts electrons from ubiquinol and is therefore capable of bypassing ETS Complexes III and IV. The human genome does not contain a gene coding for AOX, so AOX expression has been suggested as a gene therapy for a range of human mitochondrial diseases caused by genetic mutations that render Complex III and/or IV dysfunctional. An effective means of screening mutations amenable to AOX treatment remains to be devised. We have generated such a tool by heterologously expressing AOX from the Pacific oyster (Crassostrea gigas) in the yeast Saccharomyces cerevisiae under the control of a galactose promoter. Our results show that this animal AOX is monomeric and is correctly targeted to yeast mitochondria. Moreover, when expressed in yeast, Pacific oyster AOX is a functional quinol oxidase, conferring cyanide-resistant growth and myxothiazol-resistant oxygen consumption to yeast cells and isolated mitochondria. This system represents a high-throughput screening tool for determining which Complex III and IV genetic mutations in yeast will be amenable to AOX gene therapy. As many human genes are orthologous to those found in yeast, our invention represents an efficient and cost-effective way to evaluate viable research avenues. In addition, this system provides the opportunity to learn more about the localization, structure, and regulation of AOXs from animals that are not easily reared or manipulated in the lab.

[Association between the canine monoamine oxidase B (MAOB) gene polymorphisms and behavior of puppies in open-field test].

Science.gov (United States)

Li, Xiao-Hui; Xu, Han-Kun; Mao, Da-Gan; Ma, Da-Jun; Chen, Peng; Yang, Li-Guo

2006-11-01

Excitability, activity and exploration behavior of puppies in a novel open-field were tested in a total of 204 two-month-old German shepherd dog, labrador retriever or English springer spaniel puppies. The polymorphisms of monoamine oxidase B gene (MAOB) were detected by PCR-RFLP. Statistics analysis indicated that genotype and allele frequencies of the polymorphisms were significantly different among three breeds (P open-field test. The results showed that MAOB gene polymorphisms had a significant effect on walking time, squares crossed, lying time, the times of standing up against walls(P times of posture change (P=0.064). Walking time and squares crossed were higher in TT genotype puppies than those in TC and CC puppies (P times of posture change and standing up against walls were also higher than those in CC (P time in CC genotype puppies were higher than that in TT (P walking time, lying time, squares crossed, the times of posture change, the times of standing up against walls in the three dog breeds that was highly statistically significant (P open-field test and TT genotype has favorable effects in these behavior traits.

[The X+ chronic granulomatous disease as a fabulous model to study the NADPH oxidase complex activation].

Science.gov (United States)

Stasia, Marie-José

2007-05-01

Chronic granulomatous disease (CGD) is a rare inherited disorder in which phagocytes lack NADPH oxidase activity. Patients with CGD suffer from recurrent bacterial and fungal infections because of the absence of superoxide anions (O2- degrees ) generatingsystem. The NADPH oxidase complex is composed of a membranous cytochrome b558, cytosolic proteins p67phox, p47phox, p40phox and two small GTPases Rac2 and Rap1A. Cytochrome b558 consists of two sub-units gp91phox and p22phox. The most common form of CGD is due to mutations in CYBB gene encoding gp91phox. In some rare cases, the mutated gp91phox is normally expressed but is devoided of oxidase activity. These variants called X+ CGD, have provided interesting informations about oxidase activation mechanisms. However modelization of such variants is necessary to obtain enough biological material for studies at the molecular level. A cellular model (knock-out PLB-985 cells) has been developed for expressing recombinant mutated gp91phox for functional analysis of the oxidase complex. Recent works demonstrated that this cell line genetically deficient in gp91phox is a powerful tool for functional analysis of the NADPH oxidase complex activation.

Norrie disease gene is distinct from the monoamine oxidase genes.

Science.gov (United States)

Sims, K B; Ozelius, L; Corey, T; Rinehart, W B; Liberfarb, R; Haines, J; Chen, W J; Norio, R; Sankila, E; de la Chapelle, A

1989-09-01

The genes for MAO-A and MAO-B appear to be very close to the Norrie disease gene, on the basis of loss and/or disruption of the MAO genes and activities in atypical Norrie disease patients deleted for the DXS7 locus; linkage among the MAO genes, the Norrie disease gene, and the DXS7 locus; and mapping of all these loci to the chromosomal region Xp11. The present study provides evidence that the MAO genes are not disrupted in "classic" Norrie disease patients. Genomic DNA from these "nondeletion" Norrie disease patients did not show rearrangements at the MAOA or DXS7 loci. Normal levels of MAO-A activities, as well as normal amounts and size of the MAO-A mRNA, were observed in cultured skin fibroblasts from these patients, and MAO-B activity in their platelets was normal. Catecholamine metabolites evaluated in plasma and urine were in the control range. Thus, although some atypical Norrie disease patients lack both MAO-A and MAO-B activities, MAO does not appear to be an etiologic factor in classic Norrie disease.

Interactions between CYP3A4 and Dietary Polyphenols

Directory of Open Access Journals (Sweden)

Loai Basheer

2015-01-01

Full Text Available The human cytochrome P450 enzymes (P450s catalyze oxidative reactions of a broad spectrum of substrates and play a critical role in the metabolism of xenobiotics, such as drugs and dietary compounds. CYP3A4 is known to be the main enzyme involved in the metabolism of drugs and most other xenobiotics. Dietary compounds, of which polyphenolics are the most studied, have been shown to interact with CYP3A4 and alter its expression and activity. Traditionally, the liver was considered the prime site of CYP3A-mediated first-pass metabolic extraction, but in vitro and in vivo studies now suggest that the small intestine can be of equal or even greater importance for the metabolism of polyphenolics and drugs. Recent studies have pointed to the role of gut microbiota in the metabolic fate of polyphenolics in human, suggesting their involvement in the complex interactions between dietary polyphenols and CYP3A4. Last but not least, all the above suggests that coadministration of drugs and foods that are rich in polyphenols is expected to stimulate undesirable clinical consequences. This review focuses on interactions between dietary polyphenols and CYP3A4 as they relate to structural considerations, food-drug interactions, and potential negative consequences of interactions between CYP3A4 and polyphenols.

Oxidase-based biocatalytic processes

DEFF Research Database (Denmark)

Ramesh, Hemalata; Woodley, John; Krühne, Ulrich

interestingbiocatalystsbecause they use a mild oxidant (oxygen) as a substrateas opposed to their chemical counterparts which use strong oxidants such as permanganates. A class of oxidases calledmonoamine oxidases has been used as the central case study for the thesis. The rationale for choosing thissystemis that it has been...

Polyphenols produced during red wine ageing.

Science.gov (United States)

Brouillard, R; George, F; Fougerousse, A

1997-01-01

Over the past few years, it has been accepted that a moderate red wine consumption is a factor beneficial to human health. Indeed, people of France and Italy, the two major wine-producing European countries, eat a lot of fatty foods but suffer less from fatal heart strokes than people in North-America or in the northern regions of Europe, where wine is not consumed on a regular basis. For a time, ethanol was thought to be the "good" chemical species hiding behind what is known as the "French paradox". Researchers now have turned their investigations towards a family of natural substances called "polyphenols", which are only found in plants and are abundant in grapes. It is well known that these molecules behave as radical scavengers and antioxidants, and it has been demonstrated that they can protect cholesterol in the LDL species from oxidation, a process thought to be at the origin of many fatal heart attacks. However, taken one by one, it remains difficult to demonstrate which are the best polyphenols as far as their antioxidant activities are concerned. The main obstacle in that kind of research is not the design of the chemical and biological tests themselves, but surprisingly enough, the limited access to chemically pure and structurally elucidated polyphenolic compounds. In this article, particular attention will be paid to polyphenols of red wine made from Vitis vinifera cultivars. With respect to the "French paradox", we address the following question: are wine polyphenolic compounds identical to those found in grapes (skin, pulp and seed), or are there biochemical modifications specifically taking place on the native flavonoids when a wine ages? Indeed, structural changes occur during wine conservation, and one of the most studied of those changes concerns red wine colour evolution, called "wine ageing". As a wine ages, it has been demonstrated that the initially present grape pigments slowly turn into new more stable red pigments. That phenomenon goes on

Green Tea and Other Tea Polyphenols: Effects on Sebum Production and Acne Vulgaris

Directory of Open Access Journals (Sweden)

Suzana Saric

2016-12-01

Full Text Available Polyphenols are antioxidant molecules found in many foods including nuts, fruits, vegetables, chocolate, wine, and tea. Polyphenols have antimicrobial, anti-inflammatory, and antineoplastic properties. Recent studies suggest that tea polyphenols may be used for reducing sebum production in the skin and for treatment of acne vulgaris. This review examines the evidence for use of topically and orally ingested tea polyphenols against sebum production and for acne treatment and prevention. The PubMed database was searched for studies on tea polyphenols, sebum secretion, and acne vulgaris. Of the 59 studies found, eight met the inclusion criteria. Two studies evaluated tea polyphenol effects on sebum production; six studies examined tea polyphenol effects on acne vulgaris. Seven studies evaluated topical tea polyphenols; one study examined systemic tea polyphenols. None of the studies evaluated both topical and systemic tea polyphenols. Tea polyphenol sources included green tea (six studies and tea, type not specified (two studies. Overall, there is some evidence that tea polyphenols in topical formulation may be beneficial in reducing sebum secretion and in treatment of acne. Research studies of high quality and with large sample sizes are needed to assess the efficacy of tea polyphenols in topical and oral prevention of acne vulgaris and lipid synthesis by the sebaceous glands.

The Characteristics of Cytochrome C Oxidase Gene Subunit I in Wild Silkmoth Cricula trifenestrata Helfer and Its Evaluation for Species Marker

Directory of Open Access Journals (Sweden)

Suriana

2012-08-01

Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.

Antioxidant and Antimicrobial Activity of Polyphenol Extracts from ...

African Journals Online (AJOL)

Methods: Polyphenol content was determined using spectrophotometric and High performance liquid ... Keywords: European cornel, Blackthorn, Wild blackberry, Polyphenols, Antioxidant, Antimicrobial. Tropical ... Acetonitrile, and acetic acid of HPLC-grade were ..... Anthocyanin Quantification and radical scavenging.

Prolonged Exposure of Cortical Neurons to Oligomeric Amyloid-β Impairs NMDA Receptor Function Via NADPH Oxidase-Mediated ROS Production: Protective Effect of Green Tea (--Epigallocatechin-3-Gallate

Directory of Open Access Journals (Sweden)

Yan He

2011-01-01

Full Text Available Excessive production of Aβ (amyloid β-peptide has been shown to play an important role in the pathogenesis of AD (Alzheimer's disease. Although not yet well understood, aggregation of Aβ is known to cause toxicity to neurons. Our recent study demonstrated the ability for oligomeric Aβ to stimulate the production of ROS (reactive oxygen species in neurons through an NMDA (N-methyl-D-aspartate-dependent pathway. However, whether prolonged exposure of neurons to aggregated Aβ is associated with impairment of NMDA receptor function has not been extensively investigated. In the present study, we show that prolonged exposure of primary cortical neurons to Aβ oligomers caused mitochondrial dysfunction, an attenuation of NMDA receptor-mediated Ca2+ influx and inhibition of NMDA-induced AA (arachidonic acid release. Mitochondrial dysfunction and the decrease in NMDA receptor activity due to oligomeric Aβ are associated with an increase in ROS production. Gp91ds-tat, a specific peptide inhibitor of NADPH oxidase, and Mn(III-tetrakis(4-benzoic acid-porphyrin chloride, an ROS scavenger, effectively abrogated Aβ-induced ROS production. Furthermore, Aβ-induced mitochondrial dysfunction, impairment of NMDA Ca2+ influx and ROS production were prevented by pretreatment of neurons with EGCG [(–-epigallocatechin-3-gallate], a major polyphenolic component of green tea. Taken together, these results support a role for NADPH oxidase-mediated ROS production in the cytotoxic effects of Aβ, and demonstrate the therapeutic potential of EGCG and other dietary polyphenols in delaying onset or retarding the progression of AD.

Complete mitochondrial genome of Zeugodacus tau (Insecta: Tephritidae and differentiation of Z. tau species complex by mitochondrial cytochrome c oxidase subunit I gene.

Directory of Open Access Journals (Sweden)

Hoi-Sen Yong

Full Text Available The tephritid fruit fly Zeugodacus tau (Walker is a polyphagous fruit pest of economic importance in Asia. Studies based on genetic markers indicate that it forms a species complex. We report here (1 the complete mitogenome of Z. tau from Malaysia and comparison with that of China as well as the mitogenome of other congeners, and (2 the relationship of Z. tau taxa from different geographical regions based on sequences of cytochrome c oxidase subunit I gene. The complete mitogenome of Z. tau had a total length of 15631 bp for the Malaysian specimen (ZT3 and 15835 bp for the China specimen (ZT1, with similar gene order comprising 37 genes (13 protein-coding genes-PCGs, 2 rRNA genes, and 22 tRNA genes and a non-coding A + T-rich control region (D-loop. Based on 13 PCGs and 15 mt-genes, Z. tau NC_027290 (China and Z. tau ZT1 (China formed a sister group in the lineage containing also Z. tau ZT3 (Malaysia. Phylogenetic analysis based on partial sequences of cox1 gene indicates that the taxa from China, Japan, Laos, Malaysia, Bangladesh, India, Sri Lanka, and Z. tau sp. A from Thailand belong to Z. tau sensu stricto. A complete cox1 gene (or 13 PCGs or 15 mt-genes instead of partial sequence is more appropriate for determining phylogenetic relationship.

Analytical techniques for the study of polyphenol-protein interactions.

Science.gov (United States)

Poklar Ulrih, Nataša

2017-07-03

This mini review focuses on advances in biophysical techniques to study polyphenol interactions with proteins. Polyphenols have many beneficial pharmacological properties, as a result of which they have been the subject of intensive studies. The most conventional techniques described here can be divided into three groups: (i) methods used for screening (in-situ methods); (ii) methods used to gain insight into the mechanisms of polyphenol-protein interactions; and (iii) methods used to study protein aggregation and precipitation. All of these methods used to study polyphenol-protein interactions are based on modifications to the physicochemical properties of the polyphenols or proteins after binding/complex formation in solution. To date, numerous review articles have been published in the field of polyphenols. This review will give a brief insight in computational methods and biosensors and cell-based methods, spectroscopic methods including fluorescence emission, UV-vis adsorption, circular dichroism, Fourier transform infrared and mass spectrometry, nuclear magnetic resonance, X-ray diffraction, and light scattering techniques including small-angle X-ray scattering and small-angle neutron scattering, and calorimetric techniques (isothermal titration calorimetry and differential scanning calorimetry), microscopy, the techniques which have been successfully used for polyphenol-protein interactions. At the end the new methods based on single molecule detection with high potential to study polyphenol-protein interactions will be presented. The advantages and disadvantages of each technique will be discussed as well as the thermodynamic, kinetic or structural parameters, which can be obtained. The other relevant biophysical experimental techniques that have proven to be valuable, such electrochemical methods, hydrodynamic techniques and chromatographic techniques will not be described here.

Evaluation of polyphenol content in different parts of physalis ixocarpa

International Nuclear Information System (INIS)

Bakht, J.; Shafi, M.

2016-01-01

In the current study extracts of leaf, stem, fruit and calyx with different polarity was investigated for their phenolic content using high performance liquid chromatography and spectrophotometric assay. Among different parts, stem contain high concentration of total polyphenol and gallic acid. The effect of extraction solvent on polyphenol quantification was observed in both assays. Spectrophotometric analysis of the data regarding polyphenol content indicated that among different extracts from the stem, leaf and fruit tissues; ethyl acetate extracted fraction of stem measured maximum polyphenol content of 110.376 mgGAE/g of dry extract. The ethyl acetate extracted sample of leaf showed high polyphenol (Gallic acid) content of 95 mg GAE/g of dry extract using high performance liquid chromatography assay. The amounts of phenolic content (Gallic acid) extracted from the parts of the plant with the different solvent ranged from 0.0354- 95 mg GAE/g of the dry extract using HPLC, however, spectrophotometric assay indicated total polyphenol ranged from 38-110.37 mgGAE g-1 of the dry extract. The current study suggested that ethyl acetate is an effective solvent for the extraction of polyphenol in different parts of P. ixocarapa. (author)

Quantum dots as optical labels for ultrasensitive detection of polyphenols.

Science.gov (United States)

Akshath, Uchangi Satyaprasad; Shubha, Likitha R; Bhatt, Praveena; Thakur, Munna Singh

2014-07-15

Considering the fact that polyphenols have versatile activity in-vivo, its detection and quantification is very much important for a healthy diet. Laccase enzyme can convert polyphenols to yield mono/polyquinones which can quench Quantum dots fluorescence. This phenomenon of charge transfer from quinones to QDs was exploited as optical labels to detect polyphenols. CdTe QD may undergo dipolar interaction with quinones as a result of broad spectral absorption due to multiple excitonic states resulting from quantum confinement effects. Thus, "turn-off" fluorescence method was applied for ultrasensitive detection of polyphenols by using laccase. We observed proportionate quenching of QDs fluorescence with respect to polyphenol concentration in the range of 100 µg to 1 ng/mL. Also, quenching of the photoluminescence was highly efficient and stable and could detect individual and total polyphenols with high sensitivity (LOD-1 ng/mL). Moreover, proposed method was highly efficient than any other reported methods in terms of sensitivity, specificity and selectivity. Therefore, a novel optical sensor was developed for the detection of polyphenols at a sensitive level based on the charge transfer mechanism. Copyright © 2014 Elsevier B.V. All rights reserved.

Estimated Dietary Polyphenol Intake and Major Food and Beverage Sources among Elderly Japanese

Directory of Open Access Journals (Sweden)

Chie Taguchi

2015-12-01

Full Text Available Estimating polyphenol intake contributes to the understanding of polyphenols’ health benefits. However, information about human polyphenol intake is scarce, especially in the elderly. This study aimed to estimate the dietary intake and major sources of polyphenols and to determine whether there is any relationship between polyphenol intake and micronutrient intake in healthy elderly Japanese. First, 610 subjects (569 men, 41 women; aged 67.3 ± 6.1 years completed food frequency questionnaires. We then calculated their total polyphenol intake using our polyphenol content database. Their average total polyphenol intake was 1492 ± 665 mg/day, the greatest part of which was provided by beverages (79.1%. The daily polyphenol intake differed largely among individuals (183–4854 mg/day, also attributable mostly to beverage consumption. Coffee (43.2% and green tea (26.6% were the major sources of total polyphenol; the top 20 food items accounted for >90%. The polyphenol intake did not strongly correlate with the intake of any micronutrient, suggesting that polyphenols may exert health benefits independently of nutritional intake. The polyphenol intake in this elderly population was slightly higher than previous data in Japanese adults, and beverages such as coffee and green tea contributed highly to the intake.

of polyphenolic compounds in Ilex Sp.

Directory of Open Access Journals (Sweden)

Zwyrzykowska Anna

2015-11-01

Full Text Available Natural compounds are an important source of desired biological activity which help to improve nutritional status, enhance productivity and bring many health benefits. The leaves of the Ilex paraguariensis (Aquifoliaceae are used for preparing a beverage known as yerba mate and represent a proven source of natural polyphenols which are known to foster biological activity with the emphasis on antioxidant properties. In present work we focused on the polyphenolic content of air-dried leaves of Ilex aquifolium L., Ilex aquifolium ‘Argentea Mariginata’, Ilex meserveae ‘Blue Angel’, and a commercially available mate as the reference product. Liquid chromatography combined with mass spectrometry (HPLC and LC-MS and thin layer chromatography (TLC, were used to establish polyphenolic substances content in aqueous methanolic extracts obtained from the biological matter. Up to 20 polyphenolic compounds were identified in the extracts, including rutin, quinic acid and its caffeoyl esters, i.e. chlorogenic acid and its isomers as well as dicaffeoyl derivatives. We took chlorogenic acid and rutin as reference compounds to quantify their levels in the extracts. It was determined that in all tested plants, high levels of these antioxidants were present. This led us to the conclusion that their leaves might serve as valuable food additives.

Comparison of Effects on Gene Expression Activity of Low-Molecular-Weight Lychee Fruit Polyphenol (Oligonol®, Adenosine, and Minoxidil in Human Dermal Papilla Cells

Directory of Open Access Journals (Sweden)

Koji Wakame

2017-06-01

Full Text Available Background: Oligonol® (OLG is a functional food product and ingredient for cosmetics derived from a lychee fruit polyphenol. It has been reported to act on the skin as an anti-inflammatory and prevent UVB-induced skin damage. Aim: In this study, with the aim of exploring new functionalities of OLG on the scalp, we investigated the effect of OLG on human dermal papilla cells by comparing with adenosine and minoxidil at the genetic level. Method: OLG, adenosine, and minoxidil were applied to human dermal papilla cell lines for 24 h, after which VEGF, FGF-7, WNT5a, and WNT10a mRNA expressions were measured by real-time PCR analysis. Additionally, using DNA microarrays, we investigated the effect on 205 inflammation-related genes. Result: Consequently, in human dermal papilla cell lines, FGF-7 and WNT10a mRNA expression were observed in 100 µg/mL OLG-supplemented cells. The results of the DNA microarray analysis showed that 10 genes were suppressed by OLG. Conclusions: OLG may be expected to affect function of human dermal papilla cell by regulating the expression of genes related to cell proliferation and inflammation.

Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and Papaverine Biosynthesis*

Science.gov (United States)

Hagel, Jillian M.; Beaudoin, Guillaume A. W.; Fossati, Elena; Ekins, Andrew; Martin, Vincent J. J.; Facchini, Peter J.

2012-01-01

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The Km values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism. PMID:23118227

Characterization of a flavoprotein oxidase from opium poppy catalyzing the final steps in sanguinarine and papaverine biosynthesis.

Science.gov (United States)

Hagel, Jillian M; Beaudoin, Guillaume A W; Fossati, Elena; Ekins, Andrew; Martin, Vincent J J; Facchini, Peter J

2012-12-14

Benzylisoquinoline alkaloids are a diverse class of plant specialized metabolites that includes the analgesic morphine, the antimicrobials sanguinarine and berberine, and the vasodilator papaverine. The two-electron oxidation of dihydrosanguinarine catalyzed by dihydrobenzophenanthridine oxidase (DBOX) is the final step in sanguinarine biosynthesis. The formation of the fully conjugated ring system in sanguinarine is similar to the four-electron oxidations of (S)-canadine to berberine and (S)-tetrahydropapaverine to papaverine. We report the isolation and functional characterization of an opium poppy (Papaver somniferum) cDNA encoding DBOX, a flavoprotein oxidase with homology to (S)-tetrahydroprotoberberine oxidase and the berberine bridge enzyme. A query of translated opium poppy stem transcriptome databases using berberine bridge enzyme yielded several candidate genes, including an (S)-tetrahydroprotoberberine oxidase-like sequence selected for heterologous expression in Pichia pastoris. The recombinant enzyme preferentially catalyzed the oxidation of dihydrosanguinarine to sanguinarine but also converted (RS)-tetrahydropapaverine to papaverine and several protoberberine alkaloids to oxidized forms, including (RS)-canadine to berberine. The K(m) values of 201 and 146 μm for dihydrosanguinarine and the protoberberine alkaloid (S)-scoulerine, respectively, suggested high concentrations of these substrates in the plant. Virus-induced gene silencing to reduce DBOX transcript levels resulted in a corresponding reduction in sanguinarine, dihydrosanguinarine, and papaverine accumulation in opium poppy roots in support of DBOX as a multifunctional oxidative enzyme in BIA metabolism.

Characterization of tea polyphenols as potential environment-friendly fire retardants

Science.gov (United States)

Yao, Fengqi; Zhai, Chunjie; Wang, Haihui; Tao, Junjun

2018-02-01

In this work we investigated the oxidation properties of tea polyphenols and their potential as the fire retardants. Two types of tea polyphenols were adopted, which were extracted from red tea and green tea leaves, respectively. Their macroscopic performance during pyrolysis and oxidation at elevated temperatures were examined by using a heating furnace. Mass change, heat evolution and gas products of tea polyphenols during heating in air were also monitored by using a thermo-gravimetric analyzer (TGA) integrated with a differential scanning calorimeter (DSC) in conjunction with online Fourier Transform Infrared Spectroscopy (FTIR) and mass spectroscopy (MS). A tea polyphenol sample first becomes a brown semi-fluid after heating, and gradually turns into highly-porous black chars with significantly expanded volume. By raising the temperature to ∼550 °C at a rate of 10 °C/min, the mass of a sample reduces by nearly 70% to form a large quantity of inert gases that are mainly composed of H2O and CO2. It was found that the aerial oxidation products of tea polyphenols in the solid phase possess good heat insulation property; meanwhile, the substantial release of a lot of water and its evaporation during oxidation of tea polyphenols removes a large amount of heat from a sample located in a heating environment. The heat insulation of tea polyphenols may withstand up to 550 °C. The present work confirms tea polyphenols as potential superior and environment-friendly fire retardants.

Expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and mitochondrial oxidative phosphorylation in septic patients.

Directory of Open Access Journals (Sweden)

Laura A Nucci

Full Text Available Sepsis is a complex disease that is characterized by activation and inhibition of different cell signaling pathways according to the disease stage. Here, we evaluated genes involved in the TLR signaling pathway, oxidative phosphorylation and oxidative metabolism, aiming to assess their interactions and resulting cell functions and pathways that are disturbed in septic patients.Blood samples were obtained from 16 patients with sepsis secondary to community acquired pneumonia at admission (D0, and after 7 days (D7, N = 10 of therapy. Samples were also collected from 8 healthy volunteers who were matched according to age and gender. Gene expression of 84 genes was performed by real-time polymerase chain reactions. Their expression was considered up- or down-regulated when the fold change was greater than 1.5 compared to the healthy volunteers. A p-value of ≤ 0.05 was considered significant.Twenty-two genes were differently expressed in D0 samples; most of them were down-regulated. When gene expression was analyzed according to the outcomes, higher number of altered genes and a higher intensity in the disturbance was observed in non-survivor than in survivor patients. The canonical pathways altered in D0 samples included interferon and iNOS signaling; the role of JAK1, JAK2 and TYK2 in interferon signaling; mitochondrial dysfunction; and superoxide radical degradation pathways. When analyzed according to outcomes, different pathways were disturbed in surviving and non-surviving patients. Mitochondrial dysfunction, oxidative phosphorylation and superoxide radical degradation pathway were among the most altered in non-surviving patients.Our data show changes in the expression of genes belonging to the interacting TLR cascades, NADPH-oxidase and oxidative phosphorylation. Importantly, distinct patterns are clearly observed in surviving and non-surviving patients. Interferon signaling, marked by changes in JAK-STAT modulation, had prominent changes in

Interactions between yeast lees and wine polyphenols during simulation of wine aging. II. Analysis of desorbed polyphenol compounds from yeast lees.

Science.gov (United States)

Mazauric, Jean-Paul; Salmon, Jean-Michel

2006-05-31

In the first part of this work, the analysis of the polyphenolic compounds remaining in the wine after different contact times with yeast lees during simulation of red wine aging was undertaken. To achieve a more precise view of the wine polyphenols adsorbed on lees during red wine aging and to establish a clear balance between adsorbed and remnant polyphenol compounds, the specific analysis of the chemical composition of the adsorbed polyphenolic compounds (condensed tannins and anthocyanins) after their partial desorbtion from yeast lees by denaturation treatments was realized in the second part of the study. The total recovery of polyphenol compounds from yeast lees was not complete, since a rather important part of the initial wine colored polyphenols, especially those with a dominant blue color component, remained strongly adsorbed on yeast lees, as monitored by color tristimulus and reflectance spectra measurements. All anthocyanins were recovered at a rather high percentage (about 62%), and it was demonstrated that they were not adsorbed in relation with their sole polarity. Very few monomeric phenolic compounds were extracted from yeast lees. With the use of drastic denaturing treatments, the total recovery of condensed tannins reached 83%. Such tannins extracted from yeast lees exhibited very high polymeric size and a rather high percentage of galloylated residues by comparison with initial wine tannins, indicating that nonpolar tannins were preferentially desorbed from yeast lees by the extraction treatments.

Polyphenols as Modulators of Aquaporin Family in Health and Disease

Directory of Open Access Journals (Sweden)

Diana Fiorentini

2015-01-01

Full Text Available Polyphenols are bioactive molecules widely distributed in fruits, vegetables, cereals, and beverages. Polyphenols in food sources are extensively studied for their role in the maintenance of human health and in the protection against development of chronic/degenerative diseases. Polyphenols act mainly as antioxidant molecules, protecting cell constituents against oxidative damage. The enormous number of polyphenolic compounds leads to huge different mechanisms of action not fully understood. Recently, some evidence is emerging about the role of polyphenols, such as curcumin, pinocembrin, resveratrol, and quercetin, in modulating the activity of some aquaporin (AQP isoforms. AQPs are integral, small hydrophobic water channel proteins, extensively expressed in many organs and tissues, whose major function is to facilitate the transport of water or glycerol over cell plasma membranes. Here we summarize AQP physiological functions and report emerging evidence on the implication of these proteins in a number of pathophysiological processes. In particular, this review offers an overview about the role of AQPs in brain, eye, skin diseases, and metabolic syndrome, focusing on the ability of polyphenols to modulate AQP expression. This original analysis can contribute to elucidating some peculiar effects exerted by polyphenols and can lead to the development of an innovative potential preventive/therapeutic strategy.

Polyphenols as Modulators of Aquaporin Family in Health and Disease.

Science.gov (United States)

Fiorentini, Diana; Zambonin, Laura; Dalla Sega, Francesco Vieceli; Hrelia, Silvana

2015-01-01

Polyphenols are bioactive molecules widely distributed in fruits, vegetables, cereals, and beverages. Polyphenols in food sources are extensively studied for their role in the maintenance of human health and in the protection against development of chronic/degenerative diseases. Polyphenols act mainly as antioxidant molecules, protecting cell constituents against oxidative damage. The enormous number of polyphenolic compounds leads to huge different mechanisms of action not fully understood. Recently, some evidence is emerging about the role of polyphenols, such as curcumin, pinocembrin, resveratrol, and quercetin, in modulating the activity of some aquaporin (AQP) isoforms. AQPs are integral, small hydrophobic water channel proteins, extensively expressed in many organs and tissues, whose major function is to facilitate the transport of water or glycerol over cell plasma membranes. Here we summarize AQP physiological functions and report emerging evidence on the implication of these proteins in a number of pathophysiological processes. In particular, this review offers an overview about the role of AQPs in brain, eye, skin diseases, and metabolic syndrome, focusing on the ability of polyphenols to modulate AQP expression. This original analysis can contribute to elucidating some peculiar effects exerted by polyphenols and can lead to the development of an innovative potential preventive/therapeutic strategy.

Paraquat and maneb co-exposure induces noradrenergic locus coeruleus neurodegeneration through NADPH oxidase-mediated microglial activation

International Nuclear Information System (INIS)

Hou, Liyan; Zhang, Cong; Wang, Ke; Liu, Xiaofang; Wang, Hongwei; Che, Yuning; Sun, Fuqiang; Zhou, Xueying; Zhao, Xiulan; Wang, Qingshan

2017-01-01

Highlights: • Microglial activation induced by paraquat and maneb precedes noradrenergic neurodegeneration in locus coeruleus. • NADPH oxidase activation contributes to microglia-mediated neuroinflammation and related noradrenergic neurodegeneration. • Inhibition of NADPH oxidase by apocynin protects noradrenergic neurons against paraquat and maneb-induced toxicity. - Abstract: Co-exposure to paraquat (PQ) and maneb (Mb) has been shown to increase the risk of Parkinson’s disease (PD) and dopaminergic (DA) neurodegeneration in the substantia nigra pars compacta (SNpc) is observed in PQ and Mb-treated experimental animals. The loss of noradrenergic locus coeruleus (LC/NE) neurons in brainstem is a common feature shared by multiple neurodegenerative diseases, including PD. However, whether PQ and Mb is able to damage LC/NE neurons remains undefined. In this study, mice treated with combined PQ and Mb displayed progressive LC/NE neurodegeneration. Time course studies revealed that the activation of microglia preceded LC/NE neurodegeneration. Mechanistically, the activation of NADPH oxidase contributed to microglial activation and subsequent LC/NE neurodegeneration. We found that PQ and Mb co-exposure induced activation of NADPH oxidase as shown by increased superoxide production and membrane translocation of p47 phox , a cytosolic subunit of NADPH oxidase. Inhibition of NADPH oxidase by apocynin, a widely used NADPH oxidase inhibitor, suppressed microglial activation and gene expressions of proinflammatory factors. Furthermore, reduced activation of nuclear factor-κB (NF-κB) pathway was observed in apocynin-treated mice. More importantly, inhibition of NADPH oxidase by apocynin afforded LC/NE neuroprotection against PQ and Mb-induced neurotoxicity. Thus, our findings revealed the critical role NADPH oxidase-mediated microglial activation in driving LC/NE neurodegeneration induced by PQ and Mb, providing new insights into the pathogenesis of environmental

Plant-Derived Polyphenols Interact with Staphylococcal Enterotoxin A and Inhibit Toxin Activity.

Science.gov (United States)

Shimamura, Yuko; Aoki, Natsumi; Sugiyama, Yuka; Tanaka, Takashi; Murata, Masatsune; Masuda, Shuichi

2016-01-01

This study was performed to investigate the inhibitory effects of 16 different plant-derived polyphenols on the toxicity of staphylococcal enterotoxin A (SEA). Plant-derived polyphenols were incubated with the cultured Staphylococcus aureus C-29 to investigate the effects of these samples on SEA produced from C-29 using Western blot analysis. Twelve polyphenols (0.1-0.5 mg/mL) inhibited the interaction between the anti-SEA antibody and SEA. We examined whether the polyphenols could directly interact with SEA after incubation of these test samples with SEA. As a result, 8 polyphenols (0.25 mg/mL) significantly decreased SEA protein levels. In addition, the polyphenols that interacted with SEA inactivated the toxin activity of splenocyte proliferation induced by SEA. Polyphenols that exerted inhibitory effects on SEA toxic activity had a tendency to interact with SEA. In particular, polyphenol compounds with 1 or 2 hexahydroxydiphenoyl groups and/or a galloyl group, such as eugeniin, castalagin, punicalagin, pedunculagin, corilagin and geraniin, strongly interacted with SEA and inhibited toxin activity at a low concentration. These polyphenols may be used to prevent S. aureus infection and staphylococcal food poisoning.

Plant-Derived Polyphenols Interact with Staphylococcal Enterotoxin A and Inhibit Toxin Activity.

Directory of Open Access Journals (Sweden)

Yuko Shimamura

Full Text Available This study was performed to investigate the inhibitory effects of 16 different plant-derived polyphenols on the toxicity of staphylococcal enterotoxin A (SEA. Plant-derived polyphenols were incubated with the cultured Staphylococcus aureus C-29 to investigate the effects of these samples on SEA produced from C-29 using Western blot analysis. Twelve polyphenols (0.1-0.5 mg/mL inhibited the interaction between the anti-SEA antibody and SEA. We examined whether the polyphenols could directly interact with SEA after incubation of these test samples with SEA. As a result, 8 polyphenols (0.25 mg/mL significantly decreased SEA protein levels. In addition, the polyphenols that interacted with SEA inactivated the toxin activity of splenocyte proliferation induced by SEA. Polyphenols that exerted inhibitory effects on SEA toxic activity had a tendency to interact with SEA. In particular, polyphenol compounds with 1 or 2 hexahydroxydiphenoyl groups and/or a galloyl group, such as eugeniin, castalagin, punicalagin, pedunculagin, corilagin and geraniin, strongly interacted with SEA and inhibited toxin activity at a low concentration. These polyphenols may be used to prevent S. aureus infection and staphylococcal food poisoning.

Guava leaves polyphenolics-rich extract inhibits vital enzymes implicated in gout and hypertension in vitro.

Science.gov (United States)

Irondi, Emmanuel Anyachukwu; Agboola, Samson Olalekan; Oboh, Ganiyu; Boligon, Aline Augusti; Athayde, Margareth Linde; Shode, Francis O

2016-01-01

Elevated uric acid level, an index of gout resulting from the over-activity of xanthine oxidase (XO), increases the risk of developing hypertension. However, research has shown that plant-derived inhibitors of XO and angiotensin 1-converting enzyme (ACE), two enzymes implicated in gout and hypertension, respectively, can prevent or ameliorate both diseases, without noticeable side effects. Hence, this study characterized the polyphenolics composition of guava leaves extract and evaluated its inhibitory effect on XO and ACE in vitro. The polyphenolics (flavonoids and phenolic acids) were characterized using high-performance liquid chromatography (HPLC) coupled with diode array detection (DAD). The XO, ACE, and Fe(2+)-induced lipid peroxidation inhibitory activities, and free radicals (2,2-diphenylpicrylhydrazyl [DPPH]* and 2,2´-azino-bis-3-ethylbenzthiazoline-6-sulphonic [ABTS]*(+)) scavenging activities of the extract were determined using spectrophotometric methods. Flavonoids were present in the extract in the order of quercetin > kaempferol > catechin > quercitrin > rutin > luteolin > epicatechin; while phenolic acids were in the order of caffeic acid > chlorogenic acid > gallic acids. The extract effectively inhibited XO, ACE and Fe(2+)-induced lipid peroxidation in a dose-dependent manner; having half-maximal inhibitory concentrations (IC50) of 38.24 ± 2.32 μg/mL, 21.06 ± 2.04 μg/mL and 27.52 ± 1.72 μg/mL against XO, ACE and Fe(2+)-induced lipid peroxidation, respectively. The extract also strongly scavenged DPPH* and ABTS*(+). Guava leaves extract could serve as functional food for managing gout and hypertension and attenuating the oxidative stress associated with both diseases.

Anticancer Efficacy of Polyphenols and Their Combinations

Directory of Open Access Journals (Sweden)

Aleksandra Niedzwiecki

2016-09-01

Full Text Available Polyphenols, found abundantly in plants, display many anticarcinogenic properties including their inhibitory effects on cancer cell proliferation, tumor growth, angiogenesis, metastasis, and inflammation as well as inducing apoptosis. In addition, they can modulate immune system response and protect normal cells against free radicals damage. Most investigations on anticancer mechanisms of polyphenols were conducted with individual compounds. However, several studies, including ours, have indicated that anti-cancer efficacy and scope of action can be further enhanced by combining them synergistically with chemically similar or different compounds. While most studies investigated the anti-cancer effects of combinations of two or three compounds, we used more comprehensive mixtures of specific polyphenols and mixtures of polyphenols with vitamins, amino acids and other micronutrients. The mixture containing quercetin, curcumin, green tea, cruciferex, and resveratrol (PB demonstrated significant inhibition of the growth of Fanconi anemia head and neck squamous cell carcinoma and dose-dependent inhibition of cell proliferation, matrix metalloproteinase (MMP-2 and -9 secretion, cell migration and invasion through Matrigel. PB was found effective in inhibition of fibrosarcoma HT-1080 and melanoma A2058 cell proliferation, MMP-2 and -9 expression, invasion through Matrigel and inducing apoptosis, important parameters for cancer prevention. A combination of polyphenols (quercetin and green tea extract with vitamin C, amino acids and other micronutrients (EPQ demonstrated significant suppression of ovarian cancer ES-2 xenograft tumor growth and suppression of ovarian tumor growth and lung metastasis from IP injection of ovarian cancer A-2780 cells. The EPQ mixture without quercetin (NM also has shown potent anticancer activity in vivo and in vitro in a few dozen cancer cell lines by inhibiting tumor growth and metastasis, MMP-2 and -9 secretion, invasion

Interactions between yeast lees and wine polyphenols during simulation of wine aging: I. Analysis of remnant polyphenolic compounds in the resulting wines.

Science.gov (United States)

Mazauric, Jean-Paul; Salmon, Jean-Michel

2005-07-13

Wine aging on yeast lees is a traditional enological practice used during the manufacture of wines. This technique has increased in popularity in recent years for the aging of red wines. Although wine polyphenols interact with yeast lees to a limited extent, such interactions have a large effect on the reactivity toward oxygen of wine polyphenolic compounds and yeast lees. Various domains of the yeast cell wall are protected by wine polyphenols from the action of extracellular hydrolytic enzymatic activities. Polysaccharides released during autolysis are thought to exert a significant effect on the sensory qualities of wine. We studied the chemical composition of polyphenolic compounds remaining in solution or adsorbed on yeast lees after various contact times during the simulation of wine aging. The analysis of the remnant polyphenols in the wine indicated that wine polyphenols adsorption on yeast lees follows biphasic kinetics. An initial and rapid fixation is followed by a slow, constant, and saturating fixation that reaches its maximum after about 1 week. Only very few monomeric phenolic compounds remained adsorbed on yeast lees, and no preferential adsorption of low or high polymeric size tannins occurred. The remnant condensed tannins in the wine contained fewer epigallocatechin units than the initial tannins, indicating that polar condensed tannins were preferentially adsorbed on yeast lees. Conversely, the efficiency of anthocyanin adsorption on yeast lees was unrelated to its polarity.

Modulation of neurotrophic signaling pathways by polyphenols

Directory of Open Access Journals (Sweden)

Moosavi F

2015-12-01

Full Text Available Fatemeh Moosavi,1,2 Razieh Hosseini,1,2 Luciano Saso,3 Omidreza Firuzi1 1Medicinal and Natural Products Chemistry Research Center, Shiraz University of Medical Sciences, Shiraz, Iran; 2Department of Pharmacology, School of Veterinary Medicine, Shiraz University, Shiraz, Iran; 3Department of Physiology and Pharmacology “Vittorio Erspamer”, Sapienza University of Rome, Rome, Italy Abstract: Polyphenols are an important class of phytochemicals, and several lines of evidence have demonstrated their beneficial effects in the context of a number of pathologies including neurodegenerative disorders such as Alzheimer’s and Parkinson’s disease. In this report, we review the studies on the effects of polyphenols on neuronal survival, growth, proliferation and differentiation, and the signaling pathways involved in these neurotrophic actions. Several polyphenols including flavonoids such as baicalein, daidzein, luteolin, and nobiletin as well as nonflavonoid polyphenols such as auraptene, carnosic acid, curcuminoids, and hydroxycinnamic acid derivatives including caffeic acid phentyl ester enhance neuronal survival and promote neurite outgrowth in vitro, a hallmark of neuronal differentiation. Assessment of underlying mechanisms, especially in PC12 neuronal-like cells, reveals that direct agonistic effect on tropomyosin receptor kinase (Trk receptors, the main receptors of neurotrophic factors including nerve growth factor (NGF and brain-derived neurotrophic factor (BDNF explains the action of few polyphenols such as 7,8-dihydroxyflavone. However, several other polyphenolic compounds activate extracellular signal-regulated kinase (ERK and phosphoinositide 3-kinase (PI3K/Akt pathways. Increased expression of neurotrophic factors in vitro and in vivo is the mechanism of neurotrophic action of flavonoids such as scutellarin, daidzein, genistein, and fisetin, while compounds like apigenin and ferulic acid increase cyclic adenosine monophosphate

Plant polyphenols and their anti-cariogenic properties: a review

OpenAIRE

Ferrazzano, G.F.; Amato, I.; Ingenito, A.; Zarrelli, A.; Pinto, G.; Pollio, A.

2011-01-01

Polyphenols constitute one of the most common groups of substances in plants. Polyphenolic compounds have been reported to have a wide range of biological activities, many of which are related to their conventional antioxidant action; however, increasing scientific knowledge has highlighted their potential activity in preventing oral disease, including the prevention of tooth decay. The aim of this review is to show the emerging findings on the anti-cariogenic properties of polyphenols, which...

Visual expression analysis of the responses of the alternative oxidase gene (aox1) to heat shock, oxidative, and osmotic stresses in conidia of citric acid-producing Aspergillus niger.

Science.gov (United States)

Honda, Yuki; Hattori, Takasumi; Kirimura, Kohtaro

2012-03-01

The citric acid-producing filamentous fungus Aspergillus niger WU-2223L shows cyanide-insensitive respiration catalyzed by alternative oxidase in addition to the cytochrome pathway. Sequence analysis of the 5' flanking region of the alternative oxidase gene (aox1) revealed a potential heat shock element (HSE) and a stress response element (STRE). We have previously confirmed aox1 expression in conidia. In this study, to confirm whether the upstream region of aox1 responds to various stresses, we used a visual expression analysis system for single-cell conidia of the A. niger strain AOXEGFP-1. This strain harbored a fusion gene comprising aox1 and egfp, which encodes the enhanced green fluorescent protein (EGFP). The fluorescence intensity of EGFP increased in conidia of A. niger AOXEGFP-1 that were subjected to heat shock at 35-45 °C, oxidative stress by exposure to 5mM paraquat or 1 mM t-butylhydroperoxide, or osmotic stresses by exposure to 0.5 M KCl or 1.0 M mannitol. These results indicate that the putative HSE and STRE in the upstream region of aox1 directly or indirectly respond to heat shock, oxidative, and osmotic stresses. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Metabolic fate of polyphenols in the human superorganism

NARCIS (Netherlands)

van Duynhoven, J.; Vaughan, E. E.; Jacobs, D.M.; Kemperman, R. A.; van Velzen, E.J.J.; Gross, G.; Roger, L. C.; Possemiers, S.; Smilde, A.K.; Doré, J.; Westerhuis, J.A.; van der Wiele, T.

2011-01-01

Dietary polyphenols are components of many foods such as tea, fruit, and vegetables and are associated with several beneficial health effects although, so far, largely based on epidemiological studies. The intact forms of complex dietary polyphenols have limited bioavailability, with low circulating

Antioxidant and Antimicrobial Activity of Polyphenol Extracts from ...

African Journals Online (AJOL)

Purpose: To assess the antioxidant and antimicrobial activities of polyphenolic extracts of three wild red wild berry fruit species from Southeast Serbia, viz, European cornel (Cornus mas), blackthorn (Prunus spinosa L.) and wild blackberry (Rubus fruticosus). Methods: Polyphenol content was determined using ...

Aroma changes of black tea prepared from methyl jasmonate treated tea plants*

Science.gov (United States)

Shi, Jiang; Wang, Li; Ma, Cheng-ying; Lv, Hai-peng; Chen, Zong-mao; Lin, Zhi

2014-01-01

Methyl jasmonate (MeJA) was widely applied in promoting food quality. Aroma is one of the key indicators in judging the quality of tea. This study examined the effect of exogenous MeJA treatment on tea aroma. The aroma components in black tea prepared from MeJA-treated fresh tea leaves were extracted using headspace solid-phase microextraction (HS-SPME) and were analyzed using gas chromatography-mass spectrometry (GC-MS) and GC-olfactometry (GC-O). Forty-five volatile compounds were identified. The results revealed that the MeJA-treated black tea had higher levels of terpene alcohols and hexenyl esters than the untreated tea. Moreover, several newly components, including copaene, cubenol, and indole, were induced by the MeJA treatment. The activities of polyphenol oxidase and β-glucosidase in fresh tea leaves changed after the MeJA treatment. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the gene expression levels of polyphenol oxidase and β-primeverosidase were upregulated by two and three folds, respectively, by the MeJA treatment (Ptea was clearly improved. PMID:24711352

Red wine polyphenols prevent metabolic and cardiovascular alterations associated with obesity in Zucker fatty rats (Fa/Fa.

Directory of Open Access Journals (Sweden)

Abdelali Agouni

Full Text Available BACKGROUND: Obesity is associated with increased risks for development of cardiovascular diseases. Epidemiological studies report an inverse association between dietary flavonoid consumption and mortality from cardiovascular diseases. We studied the potential beneficial effects of dietary supplementation of red wine polyphenol extract, Provinols, on obesity-associated alterations with respect to metabolic disturbances and cardiovascular functions in Zucker fatty (ZF rats. METHODOLOGY/PRINCIPAL FINDINGS: ZF rats or their lean littermates received normal diet or supplemented with Provinols for 8 weeks. Provinols improved glucose metabolism by reducing plasma glucose and fructosamine in ZF rats. Moreover, it reduced circulating triglycerides and total cholesterol as well as LDL-cholesterol in ZF rats. Echocardiography measurements demonstrated that Provinols improved cardiac performance as evidenced by an increase in left ventricular fractional shortening and cardiac output associated with decreased peripheral arterial resistances in ZF rats. Regarding vascular function, Provinols corrected endothelial dysfunction in aortas from ZF rats by improving endothelium-dependent relaxation in response to acetylcholine (Ach. Provinols enhanced NO bioavailability resulting from increased nitric oxide (NO production through enhanced endothelial NO-synthase (eNOS activity and reduced superoxide anion release via decreased expression of NADPH oxidase membrane sub-unit, Nox-1. In small mesenteric arteries, although Provinols did not affect the endothelium-dependent response to Ach; it enhanced the endothelial-derived hyperpolarizing factor component of the response. CONCLUSIONS/SIGNIFICANCE: Use of red wine polyphenols may be a potential mechanism for prevention of cardiovascular and metabolic alterations associated with obesity.

Hypoxia-response element (HRE)-directed transcriptional regulation of the rat lysyl oxidase gene in response to cobalt and cadmium.

Science.gov (United States)

Gao, Song; Zhou, Jing; Zhao, Yinzhi; Toselli, Paul; Li, Wande

2013-04-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5'-ACGTG-3') exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10-100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)-treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at -387/-383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation.

Expression of ACC oxidase promoter-GUS fusions in tomato and Nicotiana plumbaginifolia regulated by developmental and environmental stimuli.

Science.gov (United States)

Blume, B; Grierson, D

1997-10-01

The enzyme ACC oxidase, catalysing the last step in the biosynthesis of the plant hormone ethylene, is encoded by a small multigene family in tomato, comprising three members, LEACO1, LEACO2 and LEACO3. LEACO1 is the major gene expressed during ripening, leaf senescence, and wounding (Barry et al., 1996). To investigate the transcriptional regulation of ACC oxidase gene expression, chimeric fusions between the beta-glucuronidase reporter gene and 97 bp of 5' UTR plus 124, 396 and 1825 bp, respectively, of 5' untranscribed LEACO1 sequence were constructed and introduced into Lycopersicon esculentum (Mill cv. Ailsa Craig) and Nicotiana plumbaginifolia. Analysis of transgenic tomatoes indicated that the region containing nucleotides -124 to +97 of the LEACO1 gene is sufficient to confer a marked increase in GUS activity during fruit ripening, albeit at very low levels. Fusion of 396 and 1825 bp of LEACO1 upstream sequence resulted in strong and specific induction of GUS expression in situations known to be accompanied by enhanced ethylene production. Reporter gene expression was similar to that of the endogenous LEACO1 gene, with major increases especially during fruit ripening, senescence and abscission of leaves and, to a lesser extent, of flowers. Analysis of transgenic N. plumbaginifolia plants confirmed the pattern of LEACO1 promoter activity detected in tomato leaves and flowers. Reporter gene expression was also induced following wounding, treatment with ethylene, and pathogen infection. Histochemical analysis illustrated localized GUS activity in the pericarp of ripening fruit, abscission zones of senescent petioles and unfertilized flowers, and at wound sites. These results demonstrate that ACC oxidase is regulated at the transcriptional level in a wide range of cell types at different developmental stages and in response to several external stimuli.

COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

Science.gov (United States)

Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

2009-09-01

Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

Interactions of polyphenols with carbohydrates, lipids and proteins.

Science.gov (United States)

Jakobek, Lidija

2015-05-15

Polyphenols are secondary metabolites in plants, investigated intensively because of their potential positive effects on human health. Their bioavailability and mechanism of positive effects have been studied, in vitro and in vivo. Lately, a high number of studies takes into account the interactions of polyphenols with compounds present in foods, like carbohydrates, proteins or lipids, because these food constituents can have significant effects on the activity of phenolic compounds. This paper reviews the interactions between phenolic compounds and lipids, carbohydrates and proteins and their impact on polyphenol activity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Exploring flavin-containing carbohydrate oxidases

NARCIS (Netherlands)

Ferrari, Alessandro Renato

2017-01-01

Oxidases are enzymes capable of removing one or more electrons from their substrate and transfer them to molecular oxygen, forming hydrogen peroxide. Due to their high regio- and enantioselectivity, their use is preferred over traditional organic chemistry methods. Among the oxidases, flavoprotein

NADPH oxidase-mediated generation of reactive oxygen species: A new mechanism for X-ray-induced HeLa cell death

International Nuclear Information System (INIS)

Liu Qing; He Xiaoqing; Liu Yongsheng; Du Bingbing; Wang Xiaoyan; Zhang Weisheng; Jia Pengfei; Dong Jingmei; Ma Jianxiu; Wang Xiaohu; Li Sha; Zhang Hong

2008-01-01

Oxidative damage is an important mechanism in X-ray-induced cell death. Radiolysis of water molecules is a source of reactive oxygen species (ROS) that contribute to X-ray-induced cell death. In this study, we showed by ROS detection and a cell survival assay that NADPH oxidase has a very important role in X-ray-induced cell death. Under X-ray irradiation, the upregulation of the expression of NADPH oxidase membrane subunit gp91 phox was dose-dependent. Meanwhile, the cytoplasmic subunit p47 phox was translocated to the cell membrane and localized with p22 phox and gp91 phox to form reactive NADPH oxidase. Our data suggest, for the first time, that NADPH oxidase-mediated generation of ROS is an important contributor to X-ray-induced cell death. This suggests a new target for combined gene transfer and radiotherapy.

Promoter isolation and characterization of GhAO-like1, a Gossypium hirsutum gene similar to multicopper oxidases that is highly expressed in reproductive organs.

Science.gov (United States)

Lambret-Frotté, Julia; Artico, Sinara; Muniz Nardeli, Sarah; Fonseca, Fernando; Brilhante Oliveira-Neto, Osmundo; Grossi-de-Sá, Maria Fatima; Alves-Ferreira, Marcio

2016-01-01

Cotton is one of the most economically important cultivated crops. It is the major source of natural fiber for the textile industry and an important target for genetic modification for both biotic stress and herbicide tolerance. Therefore, the characterization of genes and regulatory regions that might be useful for genetic transformation is indispensable. The isolation and characterization of new regulatory regions is of great importance to drive transgene expression in genetically modified crops. One of the major drawbacks in cotton production is pest damage; therefore, the most promising, cost-effective, and sustainable method for pest control is the development of genetically resistant cotton lines. Considering this scenario, our group isolated and characterized the promoter region of a MCO (multicopper oxidase) from Gossypium hirsutum, named GhAO-like1 (ascorbate oxidase-like1). The quantitative expression, together with the in vivo characterization of the promoter region reveals that GhAO-like1 has a flower- and fruit-specific expression pattern. The GUS activity is mainly observed in stamens, as expected considering that the GhAO-like1 regulatory sequence is enriched in cis elements, which have been characterized as a target of reproductive tissue specific transcription factors. Both histological and quantitative analyses in Arabidopsis thaliana have confirmed flower (mainly in stamens) and fruit expression of GhAO-like1. In the present paper, we isolated and characterized both in silico and in vivo the promoter region of the GhAO-like1 gene. The regulatory region of GhAO-like1 might be useful to confer tissue-specific expression in genetically modified plants.

Chromatographic Methods for the Analysis of Polyphenols in Wines

Directory of Open Access Journals (Sweden)

Medić-Šarić, M.

2009-03-01

Full Text Available Wine is an excellent source of various classes of polyphenols, including phenolic acids, flavonoids, and trihydroxystilbene resveratrol (Fig.1. Polyphenols play a major role in wine quality since they contribute to the sensory characteristics of wine, particularly color and astringency. A recent interest in these substances has been stimulated by abundant evidence of their beneficial effects on human health, such as anticarcinogenic, antiinflamatory and antimicrobial activities. Therefore, numerous studies have been performed in the attempt to analyze polyphenols in wine. This paper reviews the current advances in the determination of polyphenols in wine by the major chromatographic techniques such as thin-layer chromatography (TLC and high-performance liquid chromatography (HPLC.The great complexity of the polyphenolic content of wine and the difficulty in obtaining some of the standards usually require sample preparation before analysis. Two methods for sample preparation, liquid-liquid extraction and solid-phase extraction, are most commonly applied. Hydrolysis is applied frequently, but not exclusively, to remove the sugar moieties from glycosides.TLC on silica gel plates is useful for the rapid and low-cost separation and identification of the polyphenols present in wine (Fig. 2. Densitometric quantitative analysis of polyphenols in wine extracts is usually performed by scanning the TLC plates with UV light at wavelengths of 350–365 nm or 250–260 nm (Fig. 3. For the evaluation of the most efficient mobile phase and an optimal choice of the combination of two or more mobile phases, two methods may be applied: information theory and numerical taxonomy. HPLC currently represents the most popular technique for the analysis of polyphenols in wine. For this purpose, a reversed-phase HPLC method that uses gradient elution with binary elution system is usually employed. Routine detection is based on measurement of UV-Vis absorption with a diode

Polyphenol-Rich Lentils and Their Health Promoting Effects

Directory of Open Access Journals (Sweden)

Kumar Ganesan

2017-11-01

Full Text Available Lentil (Lens culinaris; Family: Fabaceae is a potential functional dietary ingredient which has polyphenol-rich content. Several studies have demonstrated that the consumption of lentil is immensely connected to the reduction in the incidence of diseases such as diabetes, obesity, cancers and cardiovascular diseases due to its bioactive compounds. There has been increasing scientific interest in the study area of lentils as the functional food due to its high nutritive value, polyphenols, and other bioactive compounds. These polyphenols and the bioactive compounds found in lentil play an important role in the prevention of those degenerative diseases in humans. Besides that, it has health-promoting effects. Based on the in vitro, in-vivo and clinical studies, the present review focuses to provide more information on the nutritional compositions, bioactive compounds including polyphenols and health-promoting effects of lentils. Health-promoting information was gathered and orchestrated at a suitable place in the review.

A Prospective Evaluation of Plasma Polyphenol Levels and Colon Cancer Risk

DEFF Research Database (Denmark)

Murphy, Neil; Achaintre, David; Zamora-Ros, Raul

2018-01-01

Polyphenols have been shown to exert biological activity in experimental models of colon cancer; however, human data linking specific polyphenols to colon cancer is limited. We assessed the relationship between pre-diagnostic plasma polyphenols and colon cancer risk in a case-control study nested...

Structure, organization, and transcriptional regulation of a family of copper radical oxidase genes in the lignin-degrading basidiomycete Phanerochaete chrysosporium

Science.gov (United States)

Amber Vanden Wymelenberg; Grzegorz Sabat; Michael Mozuch; Philip J. Kersten; Dan Cullen; Robert A. Blanchette

2006-01-01

The white rot basidiomycete Phanerochaete chrysosporium produces an array of nonspecific extracellular enzymes thought to be involved in lignin degradation, including lignin peroxidases, manganese peroxidases, and the H2O2-generating copper radical oxidase, glyoxal oxidase (GLX). Preliminary analysis of the P. chrysosporium draft genome had identified six sequences...

New insights into the roles of NADPH oxidases in sexual development and ascospore germination in Sordaria macrospora.

Science.gov (United States)

Dirschnabel, Daniela Elisabeth; Nowrousian, Minou; Cano-Domínguez, Nallely; Aguirre, Jesus; Teichert, Ines; Kück, Ulrich

2014-03-01

NADPH oxidase (NOX)-derived reactive oxygen species (ROS) act as signaling determinants that induce different cellular processes. To characterize NOX function during fungal development, we utilized the genetically tractable ascomycete Sordaria macrospora. Genome sequencing of a sterile mutant led us to identify the NADPH oxidase encoding nox1 as a gene required for fruiting body formation, regular hyphal growth, and hyphal fusion. These phenotypes are shared by nor1, lacking the NOX regulator NOR1. Further phenotypic analyses revealed a high correlation between increased ROS production and hyphal fusion deficiencies in nox1 and other sterile mutants. A genome-wide transcriptional profiling analysis of mycelia and isolated protoperithecia from wild type and nox1 revealed that nox1 inactivation affects the expression of genes related to cytoskeleton remodeling, hyphal fusion, metabolism, and mitochondrial respiration. Genetic analysis of nox2, lacking the NADPH oxidase 2 gene, nor1, and transcription factor deletion mutant ste12, revealed a strict melanin-dependent ascospore germination defect, indicating a common genetic pathway for these three genes. We report that gsa3, encoding a G-protein α-subunit, and sac1, encoding cAMP-generating adenylate cyclase, act in a separate pathway during the germination process. The finding that cAMP inhibits ascospore germination in a melanin-dependent manner supports a model in which cAMP inhibits NOX2 activity, thus suggesting a link between both pathways. Our results expand the current knowledge on the role of NOX enzymes in fungal development and provide a frame to define upstream and downstream components of the NOX signaling pathways in fungi.

Polyphenol profiles of French cider apple varieties (Malus domestica sp.).

Science.gov (United States)

Sanoner, P; Guyot, S; Marnet, N; Molle, D; Drilleau, J P

1999-12-01

The cortex of 14 French apple varieties (12 cider and 2 juice varieties), one English cider variety, and one dessert apple (i.e., Golden Delicious) were studied for their polyphenol composition. Total polyphenols were assayed by the Folin-Ciocalteu method, and the precise polyphenolic composition (monomeric catechins, proanthocyanidins, hydroxycinnamic acids, and dihydrochalcones) was obtained by HPLC following thiolysis. ESI-MS and ESI-MS/MS analyses showed that chlorogenic acid and p-coumaroylquinic acid were methylated under the conditions of thiolysis. Depending on the variety, the global polyphenol concentration varied from 1 to 7 g per kilogram of fresh cortex. Cider varieties globally showed a higher polyphenol concentration than the dessert apple Golden Delicious, bitter varieties being the more concentrated. The proportion of the polyphenol classes varied greatly from one cultivar to another. For all varieties, procyanidins were always the predominant class. They were mainly constituted of (-)-epicatechin units with a small proportion of (+)-catechin as a terminal unit. The average degree of polymerization ranged between 4.2 and 7.5 depending upon the variety with an exception for the sharp varieties Guillevic and Avrolles which showed significant concentrations of procyanidins with DPn of 40 and 50, respectively.

Impact of polyphenolic extracts on resistance to fungal ...

African Journals Online (AJOL)

Our results lend support of the creation of varieties bean high in polyphenols, which act as natural preservatives and bio-effective agents, and offer an alternative to chemical agents for protection of harvested beans in storage structures. Keywords: Polyphenols, antifungal activity, dry bean. African Journal of Biotechnology ...

Physical and antibacterial properties of edible films formulated with apple skin polyphenols.

Science.gov (United States)

Du, W-X; Olsen, C W; Avena-Bustillos, R J; Friedman, M; McHugh, T H

2011-03-01

Fruit and vegetable skins have polyphenolic compounds, terpenes, and phenols with antimicrobial and antioxidant activity. These flavoring plant essential oil components are generally regarded as safe. Edible films made from fruits or vegetables containing apple skin polyphenols have the potential to be used commercially to protect food against contamination by pathogenic bacteria. The main objective of this study was to evaluate physical properties as well as antimicrobial activities against Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella enterica of apple skin polyphenols at 0% to 10% (w/w) concentrations in apple puree film-forming solutions formulated into edible films. Commercial apple skin polyphenol powder had a water activity of 0.44 and high total soluble phenolic compounds and antioxidant capacity (995.3 mg chlorogenic acid/100 g and 14.4 mg Trolox/g, respectively). Antimicrobial activities of edible film containing apple skin polyphenols were determined by the overlay method. Apple edible film with apple skin polyphenols was highly effective against L. monocytogenes. The minimum concentration need to inactive L. monocytogenes was 1.5%. However, apple skin polyphenols did not show any antimicrobial effect against E. coli O157:H7 and S. enterica even at 10% level. The presence of apple skin polyphenols reduced water vapor permeability of films. Apple skin polyphenols increased elongation of films and darkened the color of films. The results of the present study show that apple skin polyphenols can be used to prepare apple-based antimicrobial edible films with good physical properties for food applications by direct contact.

Role of pH in oxidase variability of Aeromonas hydrophila.

OpenAIRE

Hunt, L K; Overman, T L; Otero, R B

1981-01-01

Some strains of Aeromonas hydrophila may be oxidase negative or only weakly oxidase positive by the Kovacs method taken from the surface of a differential medium, such as MacConkey agar. Six strains of A. hydrophila, two oxidase variable, one oxidase constant, and three weakly oxidase positive on MacConkey agar, were studied to determine the cause of oxidase variability. The bacteriostatic dyes in MacConkey agar were considered possible inhibitors of the oxidase reaction. The concentration of...

Polyphenol-enriched berry extracts naturally modulate reactive proteins in model foods.

Science.gov (United States)

Lila, Mary Ann; Schneider, Maggie; Devlin, Amy; Plundrich, Nathalie; Laster, Scott; Foegeding, E Allen

2017-12-13

Healthy foods like polyphenol-rich berries and high quality edible proteins are in demand in today's functional food marketplace, but it can be difficult to formulate convenient food products with physiologically-relevant amounts of these ingredients and still maintain product quality. In part, this is because proteins can interact with other food ingredients and precipitate destabilizing events, which can disrupt food structure and diminish shelf life. Proteins in foods can also interact with human receptors to provoke adverse consequences such as allergies. When proteins and polyphenols were pre-aggregated into stable colloidal particles prior to use as ingredients, highly palatable food formulations (with reduced astringency of polyphenols) could be prepared, and the overall structural properties of food formulations were significantly improved. All of the nutritive and phytoactive benefits of the proteins and concentrated polyphenols remained highly bioavailable, but the protein molecules in the particle matrix did not self-aggregate into networks or react with other food ingredients. Both the drainage half-life (a marker of structural stability) and the yield stress (resistance to flow) of model foams made with the protein-polyphenol particles were increased in a dose-dependent manner. Of high significance in this complexation process, the reactive allergenic epitopes of certain proteins were effectively blunted by binding with polyphenols, attenuating the allergenicity of the food proteins. Porcine macrophages produced TNF-α proinflammatory cytokine when provoked with whey protein, but, this response was blocked completely when the cells were stimulated with particles that complexed whey protein with cinnamon-derived polyphenols. Cytokine and chemokine production characteristic of allergic reactions were blocked by the polyphenols, allowing for the potential creation of hypoallergenic protein-berry polyphenol enriched foods.

Effect of different NADH oxidase levels on glucose metabolism by Lactococus lactis : kinetics of intracellular metabolite pools determined by in vivo nuclear magnetic resonance

NARCIS (Netherlands)

Neves, A.R.; Ramos, A.; Costa, H.; Swam, van I.I.; Hugenholtz, J.; Kleerebezem, M.; Vos, de W.M.; Santos, H.

2002-01-01

Three isogenic strains of Lactococcus lactis with different levels of H2O-forming NADH oxidase activity were used to study the effect of oxygen on glucose metabolism: the parent strain L. lactis MG1363, a NOX- strain harboring a deletion of the gene coding for H2O-forming NADH oxidase, and a NOX

Haematological and biochemical effects of polyphenolics in animal models.

Science.gov (United States)

Gnanamani, Arumugam; Sudha, Munusamy; Deepa, G; Sudha, M; Deivanai, K; Sadulla, S

2008-07-01

Polyphenols of natural and synthetic origin are exploited in tanning sector to convert putrescible skin/hide to non-putrescible leather. However, only 30-40% of the inputs have been taken up for processing, the remaining is released as unspent. The existing conventional wastewater treatment systems are inefficient in removing or degrading these unspent polyphenols and thus detrimental to ecosystem. The present study demonstrates the evaluation of impact of both synthetic and natural polyphenols on biochemical and haematological properties of blood and serum in animal models. The results reveal that concentrations of polyphenols play a major role. At higher concentrations, irrespective of their nature, there was a marked change in the lipid profile (81% reduction), followed by insignificant change in glucose levels, RBC and WBC counts and other haematological parameters. At lower concentrations, no significant changes in the above said properties were observed.

Polyphenol Bioaccessibility and Sugar Reducing Capacity of Black, Green, and White Teas

Directory of Open Access Journals (Sweden)

Shelly Coe

2013-01-01

Full Text Available Tea (Camellia sinensis is a widely consumed beverage and recognised for its potential enhancing effect on human health due to its rich polyphenol content. While a number of studies have investigated the quantity and type of polyphenols present in different tea samples, no study has reported the potential effect of digestive enzymes on the availability of tea polyphenols for human absorption or the subsequent impact on glycaemic response. The objectives of the present study were to assess the total polyphenol content of different teas, to assess the bioaccessibility of polyphenols in whole and bagged teas, and to determine the effect of black, white, and green tea infusions on sugar release. All of the teas were a significant source of polyphenols (10–116 mg Gallic acid equivalents/g. There was an overall increase in the release of polyphenols from both the bagged and the whole teas following in vitro digestion. Bagged green tea significantly ( reduced rapidly digestible starch from white bread samples compared to control and black and white bagged teas. The present study confirms that tea is a rich source of polyphenols and highlights the potential benefits it may have on modulating glycaemic response in humans.

Differential protective effects of red wine polyphenol extracts (RWEs) on colon carcinogenesis.

Science.gov (United States)

Mazué, Frédéric; Delmas, Dominique; Murillo, Genoveva; Saleiro, Diana; Limagne, Emeric; Latruffe, Norbert

2014-04-01

Various epidemiological studies have shown that a regular and moderate consumption of red wine is correlated with a decreased relative risk of developing coronary heart disease and cancer. These health benefits are commonly attributed to high contents of polyphenols, particularly resveratrol, representing important sources of antioxidants. However, resveratrol does not seem to be the only bioactive compound present in the wine which contains numerous other polyphenols. The present study investigates the efficiency of red wine extracts (RWEs), containing different polyphenols, on colon cancer cell proliferation in vitro and on colonic aberrant crypt foci (ACF) in vivo. Proliferation, cell cycle analysis and incidence of ACF were monitored to examine the effects of RWEs. RWEs derived from a long vinification process exhibit superior anti-proliferative activity in colon cancer cells and prevent the appearance of ACF in mice. Interestingly, quercetin and resveratrol, representing two major bio-active polyphenols, exhibit synergistic anti-proliferative effects. These data suggest that the efficacy of RWEs on colon carcinogenesis may depend on the polyphenolic content, synergistic interaction of bio-active polyphenols and modulation of cellular uptake of polyphenols.

Alternative oxidase in the branched mitochondrial respiratory network: an overview on structure, function, regulation, and role

Directory of Open Access Journals (Sweden)

Sluse F.E.

1998-01-01

Full Text Available Plants and some other organisms including protists possess a complex branched respiratory network in their mitochondria. Some pathways of this network are not energy-conserving and allow sites of energy conservation to be bypassed, leading to a decrease of the energy yield in the cells. It is a challenge to understand the regulation of the partitioning of electrons between the various energy-dissipating and -conserving pathways. This review is focused on the oxidase side of the respiratory chain that presents a cyanide-resistant energy-dissipating alternative oxidase (AOX besides the cytochrome pathway. The known structural properties of AOX are described including transmembrane topology, dimerization, and active sites. Regulation of the alternative oxidase activity is presented in detail because of its complexity. The alternative oxidase activity is dependent on substrate availability: total ubiquinone concentration and its redox state in the membrane and O2 concentration in the cell. The alternative oxidase activity can be long-term regulated (gene expression or short-term (post-translational modification, allosteric activation regulated. Electron distribution (partitioning between the alternative and cytochrome pathways during steady-state respiration is a crucial measurement to quantitatively analyze the effects of the various levels of regulation of the alternative oxidase. Three approaches are described with their specific domain of application and limitations: kinetic approach, oxygen isotope differential discrimination, and ADP/O method (thermokinetic approach. Lastly, the role of the alternative oxidase in non-thermogenic tissues is discussed in relation to the energy metabolism balance of the cell (supply in reducing equivalents/demand in energy and carbon and with harmful reactive oxygen species formation.

The scavenging effects of tea polyphenol and quercetin on active oxygen species

International Nuclear Information System (INIS)

Fang Ruoying; Cheng Jiwu; Hu Tianxi; Tu Tiechen; Dong Jirong; Wang Wenfeng; Lin Nianyun

1993-01-01

The abilities of scavenging active oxygen species, O 2 free radical and OH., by tea polyphenols and quercetin have been studied by chemiluminescence, ESR and pulse radiolysis. Tea polyphenols and quercetin are all phenolic antioxidants. The synergetic studies show that both tea polyphenols and quercetin are strong free radical scavengers. Tea polyphenols are better than quercetin. the results from CL studies are in good accord with those from ESR and PR studies

Burkholderia pseudomallei Evades Nramp1 (Slc11a1- and NADPH Oxidase-Mediated Killing in Macrophages and Exhibits Nramp1-Dependent Virulence Gene Expression

Directory of Open Access Journals (Sweden)

Veerachat Muangsombut

2017-08-01

Full Text Available Bacterial survival in macrophages can be affected by the natural resistance-associated macrophage protein 1 (Nramp1; also known as solute carrier family 11 member a1 or Slc11a1 which localizes to phagosome membranes and transports divalent cations, including iron. Little is known about the role of Nramp1 in Burkholderia infection, in particular whether this differs for pathogenic species like Burkholderia pseudomallei causing melioidosis or non-pathogenic species like Burkholderia thailandensis. Here we show that transfected macrophages stably expressing wild-type Nramp1 (Nramp1+ control the net replication of B. thailandensis, but not B. pseudomallei. Control of B. thailandensis was associated with increased cytokine responses, and could be abrogated by blocking NADPH oxidase-mediated production of reactive oxygen species but not by blocking generation of reactive nitrogen species. The inability of Nramp1+ macrophages to control B. pseudomallei was associated with rapid escape of bacteria from phagosomes, as indicated by decreased co-localization with LAMP1 compared to B. thailandensis. A B. pseudomallei bipB mutant impaired in escape from phagosomes was controlled to a greater extent than the parent strain in Nramp1+ macrophages, but was also attenuated in Nramp1− cells. Consistent with reduced escape from phagosomes, B. thailandensis formed fewer multinucleated giant cells in Nramp1+ macrophages at later time points compared to B. pseudomallei. B. pseudomallei exhibited elevated transcription of virulence-associated genes of Type VI Secretion System cluster 1 (T6SS-1, the Bsa Type III Secretion System (T3SS-3 and the bimA gene required for actin-based motility in Nramp1+ macrophages. Nramp1+ macrophages were found to contain decreased iron levels that may impact on expression of such genes. Our data show that B. pseudomallei is able to evade Nramp1- and NADPH oxidase-mediated killing in macrophages and that expression of virulence

Development of a Rapid and Simple Method to Remove Polyphenols from Plant Extracts

Directory of Open Access Journals (Sweden)

Imali Ranatunge

2017-01-01

Full Text Available Polyphenols are secondary metabolites of plants, which are responsible for prevention of many diseases. Polyvinylpolypyrrolidone (PVPP has a high affinity towards polyphenols. This method involves the use of PVPP column to remove polyphenols under centrifugal force. Standards of gallic acid, epigallocatechin gallate, vanillin, and tea extracts (Camellia sinensis were used in this study. PVPP powder was packed in a syringe with different quantities. The test samples were layered over the PVPP column and subjected to centrifugation. Supernatant was tested for the total phenol content. The presence of phenolic compounds and caffeine was screened by HPLC and measuring the absorbance at 280. The antioxidant capacity of standards and tea extracts was compared with the polyphenol removed fractions using DPPH scavenging assay. No polyphenols were found in polyphenolic standards or tea extracts after PVPP treatment. The method described in the present study to remove polyphenols is simple, inexpensive, rapid, and efficient and can be employed to investigate the contribution of polyphenols present in natural products to their biological activity.

Cocoa and Dark Chocolate Polyphenols: From Biology to Clinical Applications

OpenAIRE

Thea Magrone; Matteo Antonio Russo; Emilio Jirillo; Emilio Jirillo

2017-01-01

It is well known that cocoa and dark chocolate possess polyphenols as major constituents whose dietary consumption has been associated to beneficial effects. In fact, cocoa and dark chocolate polyphenols exert antioxidant and anti-inflammatory activities switching on some important signaling pathways such as toll-like receptor 4/nuclear factor κB/signal transducer and activator of transcription. In particular, cocoa polyphenols induce release of nitric oxide (NO) through activation of endothe...

Guava leaves polyphenolics-rich extract inhibits vital enzymes implicated in gout and hypertension in vitro

Science.gov (United States)

Irondi, Emmanuel Anyachukwu; Agboola, Samson Olalekan; Oboh, Ganiyu; Boligon, Aline Augusti; Athayde, Margareth Linde; Shode, Francis O.

2016-01-01

Background/Aim: Elevated uric acid level, an index of gout resulting from the over-activity of xanthine oxidase (XO), increases the risk of developing hypertension. However, research has shown that plant-derived inhibitors of XO and angiotensin 1-converting enzyme (ACE), two enzymes implicated in gout and hypertension, respectively, can prevent or ameliorate both diseases, without noticeable side effects. Hence, this study characterized the polyphenolics composition of guava leaves extract and evaluated its inhibitory effect on XO and ACE in vitro. Materials and Methods: The polyphenolics (flavonoids and phenolic acids) were characterized using high-performance liquid chromatography (HPLC) coupled with diode array detection (DAD). The XO, ACE, and Fe2+-induced lipid peroxidation inhibitory activities, and free radicals (2,2-diphenylpicrylhydrazyl [DPPH]* and 2,2´-azino-bis-3-ethylbenzthiazoline-6-sulphonic [ABTS]*+) scavenging activities of the extract were determined using spectrophotometric methods. Results: Flavonoids were present in the extract in the order of quercetin > kaempferol > catechin > quercitrin > rutin > luteolin > epicatechin; while phenolic acids were in the order of caffeic acid > chlorogenic acid > gallic acids. The extract effectively inhibited XO, ACE and Fe2+-induced lipid peroxidation in a dose-dependent manner; having half-maximal inhibitory concentrations (IC50) of 38.24 ± 2.32 μg/mL, 21.06 ± 2.04 μg/mL and 27.52 ± 1.72 μg/mL against XO, ACE and Fe2+-induced lipid peroxidation, respectively. The extract also strongly scavenged DPPH* and ABTS*+. Conclusion: Guava leaves extract could serve as functional food for managing gout and hypertension and attenuating the oxidative stress associated with both diseases. PMID:27104032

Date syrup-derived polyphenols attenuate angiogenic responses and exhibits anti-inflammatory activity mediated by vascular endothelial growth factor and cyclooxygenase-2 expression in endothelial cells.

Science.gov (United States)

Taleb, Hajer; Morris, R Keith; Withycombe, Cathryn E; Maddocks, Sarah E; Kanekanian, Ara D

2016-07-01

Bioactive components such as polyphenols, present in many plants, are purported to have anti-inflammatory and antiangiogenic properties. Date syrup, produced from date fruit of the date palm tree, has traditionally been used to treat a wide range of diseases with etiologies involving angiogenesis and inflammation. It was hypothesized that polyphenols in date syrup reduce angiogenic responses such as cell migration, tube formation, and matrix metalloproteinase activity in an inflammatory model by exhibiting anti-inflammatory activity mediated by vascular endothelial growth factor (VEGF) and the prostaglandin enzyme cyclooxygenase-2 (COX-2) in endothelial cells. Date syrup polyphenols at 60 and 600μg/mL reduced inflammation and suppressed several stages of angiogenesis, including endothelial cell migration, invasion, matrix metalloproteinase activity, and tube formation, without evidence of cytotoxicity. VEGF and COX-2 expression induced by tumor necrosis factor-alpha at both gene expression and protein level was significantly reduced by date syrup polyphenols in comparison to untreated cells. In conclusion, polyphenols in date syrup attenuated angiogenic responses and exhibited anti-inflammatory activity mediated by VEGF and COX-2 expression in endothelial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Plant-Derived Polyphenols Interact with Staphylococcal Enterotoxin A and Inhibit Toxin Activity

OpenAIRE

Shimamura, Yuko; Aoki, Natsumi; Sugiyama, Yuka; Tanaka, Takashi; Murata, Masatsune; Masuda, Shuichi

2016-01-01

This study was performed to investigate the inhibitory effects of 16 different plant-derived polyphenols on the toxicity of staphylococcal enterotoxin A (SEA). Plant-derived polyphenols were incubated with the cultured Staphylococcus aureus C-29 to investigate the effects of these samples on SEA produced from C-29 using Western blot analysis. Twelve polyphenols (0.1-0.5 mg/mL) inhibited the interaction between the anti-SEA antibody and SEA. We examined whether the polyphenols could directly i...

Deciphering the role of NADPH oxidase in complex interactions between maize (Zea mays L.) genotypes and cereal aphids.

Science.gov (United States)

Sytykiewicz, Hubert

2016-07-22

Plant NADPH oxidases (NOXs) encompass a group of membrane-bound enzymes participating in formation of reactive oxygen species (ROS) under physiological conditions as well as in response to environmental stressors. The purpose of the survey was to unveil the role of NADPH oxidase in pro-oxidative responses of maize (Zea mays L.) seedling leaves exposed to cereal aphids' infestation. The impact of apteral females of bird cherry-oat aphid (Rhopalosiphum padi L.) and grain aphid (Sitobion avenae F.) feeding on expression levels of all four NADPH oxidase genes (rbohA, rbohB, rbohC, rbohD) and total activity of NOX enzyme in maize plants were investigated. In addition, inhibitory effect of diphenylene iodonium (DPI) pre-treatment on NOX activity and hydrogen peroxide content in aphid-stressed maize seedlings was studied. Leaf infestation biotests were accomplished on 14-day-old seedlings representing two aphid-resistant varieties (Ambrozja and Waza) and two aphid-susceptible ones (Tasty Sweet and Złota Karłowa). Insects' attack led to profound upregulation of rbohA and rbohD genes in tested host plants, lower elevations were noted in level of rbohB mRNA, whereas abundance of rbohC transcript was not significantly altered. It was uncovered aphid-induced enhancement of NOX activity in examined plants. Higher increases in expression of all investigated rboh genes and activity of NADPH oxidase occurred in tissues of more resistant maize cultivars than in susceptible ones. Furthermore, DPI treatment resulted in strong reduction of NOX activity and H2O2 accumulation in aphid-infested Z. mays plants, thus evidencing circumstantial role of the enzyme in insect-elicited ROS generation. Copyright © 2016 Elsevier Inc. All rights reserved.

Anti-Oxidative Polyphenolic Compounds of Cocoa.

Science.gov (United States)

Nabavi, Seyed F; Sureda, Antoni; Daglia, Maria; Rezaei, Parizad; Nabavi, Seyed M

2015-01-01

Oxidative stress plays a key role in the pathogenesis of different serious chronic diseases such as cancer, diabetes, cardiovascular and neurodegenerative disorders, etc. Recent research has been focused on the beneficial role of dietary antioxidants against oxidative stress both under in vitro and in vivo conditions. Theobroma cacao L. (cacao tree) is an evergreen tree which is native to South America. It is a plant of great economic importance and its seeds are commonly used to produce cocoa powder and chocolate. In addition to its uses in food industry, cocoa is a rich source of polyphenolic antioxidants. There is a plethora of in vitro and in vivo studies that report cocoa antioxidant capacity. The protective activity of cocoa seems to be due to its phytochemical constituents, especially catechins. However, bioavailability of cocoa polyphenolic constituents following oral administration is very low (nanomolar concentrations). In the present paper, we critically reviewed the available literature on the antioxidant and free radical scavenging activities of cocoa and its polyphenolic constituents. In addition to these, we provide brief information about cultivation, phytochemistry, bioavailability and clinical impacts of cocoa.

Chitosan/dextran multilayer microcapsules for polyphenol co-delivery

International Nuclear Information System (INIS)

Paini, Marco; Aliakbarian, Bahar; Casazza, Alessandro A.; Perego, Patrizia; Ruggiero, Carmelina; Pastorino, Laura

2015-01-01

Polysaccharide-based nanostructured polymeric microcapsules were fabricated by the electrostatic layer-by-layer self-assembly technique and used to encapsulate mixtures of four different polyphenols in order to achieve their controlled release. The real-time fabrication of the dextran/chitosan multilayer was monitored by quartz crystal microbalance with dissipation monitoring, and the morphology of the nanostructured polymeric capsules was characterized by scanning electron microscopy. The polyphenol encapsulation was obtained by reversible permeability variation of the capsule shell in ethanol:water mixtures. The loading efficiency in different water:ethanol mixtures and the release rate in acidic conditions were characterized by UV spectroscopy and HPLC. The higher loading efficiency was obtained with an ethanol:water 35:65 phenolic solution, equal to 42.0 ± 0.6%, with a total release of 11.5 ± 0.7 mg of total polyphenols per 11.3 μL of microcapsules after 240 min of incubation in acidic environment. The results suggest that polysaccharide-based capsules can be successfully used to encapsulate and release low water-soluble molecules, such as polyphenols. - Highlights: • Chitosan/dextran nanocapsules were made by layer-by-layer self-assembly technique. • Different ethanol:water mixtures of four polyphenols were encapsulated. • An encapsulation efficiency of 42.0 ± 0.6% was obtained using ethanol:water 35:65. • Release profiles in acidic environment were monitored by UV spectroscopy and HPLC. • Nanocapsules had shown a complete release after 60 min in acidic environment

Chitosan/dextran multilayer microcapsules for polyphenol co-delivery

Energy Technology Data Exchange (ETDEWEB)

Paini, Marco, E-mail: marco.paini@unige.it [Department of Civil, Chemical and Environmental Engineering, University of Genoa, via Opera Pia 15, 16145 Genoa (Italy); Research Center for Biologically Inspired Engineering in Vascular Medicine and Longevity (BELONG), Via Montallegro 1, 16145 Genoa (Italy); Aliakbarian, Bahar; Casazza, Alessandro A.; Perego, Patrizia [Department of Civil, Chemical and Environmental Engineering, University of Genoa, via Opera Pia 15, 16145 Genoa (Italy); Research Center for Biologically Inspired Engineering in Vascular Medicine and Longevity (BELONG), Via Montallegro 1, 16145 Genoa (Italy); Ruggiero, Carmelina; Pastorino, Laura [Department of Informatics, Bioengineering, Robotics and Systems Engineering, University of Genoa, Via Opera Pia 13, 16145 Genoa (Italy)

2015-01-01

Polysaccharide-based nanostructured polymeric microcapsules were fabricated by the electrostatic layer-by-layer self-assembly technique and used to encapsulate mixtures of four different polyphenols in order to achieve their controlled release. The real-time fabrication of the dextran/chitosan multilayer was monitored by quartz crystal microbalance with dissipation monitoring, and the morphology of the nanostructured polymeric capsules was characterized by scanning electron microscopy. The polyphenol encapsulation was obtained by reversible permeability variation of the capsule shell in ethanol:water mixtures. The loading efficiency in different water:ethanol mixtures and the release rate in acidic conditions were characterized by UV spectroscopy and HPLC. The higher loading efficiency was obtained with an ethanol:water 35:65 phenolic solution, equal to 42.0 ± 0.6%, with a total release of 11.5 ± 0.7 mg of total polyphenols per 11.3 μL of microcapsules after 240 min of incubation in acidic environment. The results suggest that polysaccharide-based capsules can be successfully used to encapsulate and release low water-soluble molecules, such as polyphenols. - Highlights: • Chitosan/dextran nanocapsules were made by layer-by-layer self-assembly technique. • Different ethanol:water mixtures of four polyphenols were encapsulated. • An encapsulation efficiency of 42.0 ± 0.6% was obtained using ethanol:water 35:65. • Release profiles in acidic environment were monitored by UV spectroscopy and HPLC. • Nanocapsules had shown a complete release after 60 min in acidic environment.

Curcuma longa polyphenols improve insulin-mediated lipid accumulation and attenuate proinflammatory response of 3T3-L1 adipose cells during oxidative stress through regulation of key adipokines and antioxidant enzymes.

Science.gov (United States)

Septembre-Malaterre, Axelle; Le Sage, Fanny; Hatia, Sarah; Catan, Aurélie; Janci, Laurent; Gonthier, Marie-Paule

2016-07-08

Plant polyphenols may exert beneficial action against obesity-related oxidative stress and inflammation which promote insulin resistance. This study evaluated the effect of polyphenols extracted from French Curcuma longa on 3T3-L1 adipose cells exposed to H2 O2 -mediated oxidative stress. We found that Curcuma longa extract exhibited high amounts of curcuminoids identified as curcumin, demethoxycurcumin, and bisdemethoxycurcumin, which exerted free radical-scavenging activities. Curcuma longa polyphenols improved insulin-mediated lipid accumulation and upregulated peroxisome proliferator-activated receptor-gamma gene expression and adiponectin secretion which decreased in H2 O2 -treated cells. Curcuminoids attenuated H2 O2 -enhanced production of pro-inflammatory molecules such as interleukin-6, tumor necrosis factor-alpha, monocyte chemoattractant protein-1, and nuclear factor κappa B. Moreover, they reduced intracellular levels of reactive oxygen species elevated by H2 O2 and modulated the expression of genes encoding superoxide dismutase and catalase antioxidant enzymes. Collectively, these findings highlight that Curcuma longa polyphenols protect adipose cells against oxidative stress and may improve obesity-related metabolic disorders. © 2016 BioFactors, 42(4):418-430, 2016. © 2016 International Union of Biochemistry and Molecular Biology.

Mitochondrial cytochrome oxidase I gene analysis indicates a restricted genetic background in Finnish noble crayfish (Astacus astacus stocks

Directory of Open Access Journals (Sweden)

Makkonen J.

2015-01-01

Full Text Available The IUCN Red List indexes the noble crayfish (Astacus astacus as vulnerable, with a declining population trend. The main threats to the species are the crayfish plague caused by the oomycete Aphanomyces astaci and the introduced North American crayfish that act as the carriers of this disease. In Finland, the noble crayfish is considered as a native species, which original distribution area covers the southern part of the country, but the species distribution has been dispersed to cover almost the whole country. The aim of this study was to survey the genetic diversity among the Finnish noble crayfish populations. The mitochondrial cytochrome oxidase I (COI-gene was sequenced from 742 individuals representing 59 populations from Finland and Estonia. As a result, only a single haplotype was found. Based on these results, the genetic diversity of noble crayfish in its Northern distribution range is remarkably low. The observed lack of variation can result from several mechanisms including small size of the founder population and the intense spreading of the species by manmade stockings. The restricted diversity can also be caused by eradication of the original populations due to crayfish plague epidemics and spreading of the invasive crayfish species carrying the crayfish plague. It is also possible that all contemporary Finnish noble crayfish populations originate from stockings with no variation in respect to COI-gene.

Plant polyphenols and their anti-cariogenic properties: a review.

Science.gov (United States)

Ferrazzano, Gianmaria F; Amato, Ivana; Ingenito, Aniello; Zarrelli, Armando; Pinto, Gabriele; Pollio, Antonino

2011-02-11

Polyphenols constitute one of the most common groups of substances in plants. Polyphenolic compounds have been reported to have a wide range of biological activities, many of which are related to their conventional antioxidant action; however, increasing scientific knowledge has highlighted their potential activity in preventing oral disease, including the prevention of tooth decay. The aim of this review is to show the emerging findings on the anti-cariogenic properties of polyphenols, which have been obtained from several in vitro studies investigating the effects of these bioactive molecules against Streptococcus mutans, as well as in vivo studies. The analysis of the literature supports the anti-bacterial role of polyphenols on cariogenic streptococci, suggesting (1) a direct effect against S. mutans; (2) an interaction with microbial membrane proteins inhibiting the adherence of bacterial cells to the tooth surface; and (3) the inhibition of glucosyl transferase and amylase. However, more studies, particularly in vivo and in situ, are necessary to establish conclusive evidence for the effectiveness and the clinical applications of these compounds in the prevention of dental caries. It is essential to better determine the nature and distribution of these compounds in our diet and to identify which of the hundreds of existing polyphenols are likely to provide the greatest effects.

Content of polyphenol compound in mangrove and macroalga extracts

Science.gov (United States)

Takarina, N. D.; Patria, M. P.

2017-07-01

Polyphenol or phenolic are compounds containing one or more hydroxyl group of the aromatic ring [1]. These compounds have some activities like antibacterial, antiseptic, and antioxidants. Natural resources like mangrove and macroalga were known containing these compounds. The purpose of the research was to investigate polyphenol content in mangrove and macroalga. Materials used in this research were mangrove (Avicennia sp.) leaves and the whole part of macroalga (Caulerpa racemosa). Samples were dried for 5 days then macerated in order to get an extract. Maceration were done using methanol for 48 hours (first) and 24 hours (second) continously. Polyphenol content was determined using phytochemical screening on both extracts. The quantitative test was carried out to determine catechin and tannin as polyphenol compound. The result showed that catechin was observed in both extracts while tannin in mangrove extract only. According to quantitative test, mangrove has a higher content of catechin and tannin which were 12.37-13.44 % compared to macroalga which was 2.57-4.58 %. Those indicated that both materials can be the source of polyphenol compound with higher content on mangrove. Moreover, according to this result, these resources can be utilized for advanced studies and human needs like medical drug.

Plant Polyphenols and Their Anti-Cariogenic Properties: A Review

Directory of Open Access Journals (Sweden)

Gabriele Pinto

2011-02-01

Full Text Available Polyphenols constitute one of the most common groups of substances in plants. Polyphenolic compounds have been reported to have a wide range of biological activities, many of which are related to their conventional antioxidant action; however, increasing scientific knowledge has highlighted their potential activity in preventing oral disease, including the prevention of tooth decay. The aim of this review is to show the emerging findings on the anti-cariogenic properties of polyphenols, which have been obtained from several in vitro studies investigating the effects of these bioactive molecules against Streptococcus mutans, as well as in vivo studies. The analysis of the literature supports the anti-bacterial role of polyphenols on cariogenic streptococci, suggesting (1 a direct effect against S. mutans; (2 an interaction with microbial membrane proteins inhibiting the adherence of bacterial cells to the tooth surface; and (3 the inhibition of glucosyl transferase and amylase. However, more studies, particularly in vivo and in situ, are necessary to establish conclusive evidence for the effectiveness and the clinical applications of these compounds in the prevention of dental caries. It is essential to better determine the nature and distribution of these compounds in our diet and to identify which of the hundreds of existing polyphenols are likely to provide the greatest effects.

NecroX-7 prevents oxidative stress-induced cardiomyopathy by inhibition of NADPH oxidase activity in rats

Energy Technology Data Exchange (ETDEWEB)

Park, Joonghoon; Park, Eok; Ahn, Bong-Hyun; Kim, Hyoung Jin [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Park, Ji-hoon [Department of Biochemistry, School of Medicine, Chungnam National University, Daejeon, 301-747 (Korea, Republic of); Koo, Sun Young; Kwak, Hyo-Shin; Park, Heui Sul; Kim, Dong Wook; Song, Myoungsub; Yim, Hyeon Joo; Seo, Dong Ook [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of); Kim, Soon Ha, E-mail: shakim@lgls.com [LG Life Sciences Ltd., R and D Park, Daejeon, 305-380 (Korea, Republic of)

2012-08-15

Oxidative stress is one of the causes of cardiomyopathy. In the present study, NecroXs, novel class of mitochondrial ROS/RNS scavengers, were evaluated for cardioprotection in in vitro and in vivo model, and the putative mechanism of the cardioprotection of NecroX-7 was investigated by global gene expression profiling and subsequent biochemical analysis. NecroX-7 prevented tert-butyl hydroperoxide (tBHP)-induced death of H9C2 rat cardiomyocytes at EC{sub 50} = 0.057 μM. In doxorubicin (DOX)-induced cardiomyopathy in rats, NecroX-7 significantly reduced the plasma levels of creatine kinase (CK-MB) and lactate dehydrogenase (LDH) which were increased by DOX treatment (p < 0.05). Microarray analysis revealed that 21 genes differentially expressed in tBHP-treated H9C2 cells were involved in ‘Production of reactive oxygen species’ (p = 0.022), and they were resolved by concurrent NecroX-7 treatment. Gene-to-gene networking also identified that NecroX-7 relieved cell death through Ncf1/p47phox and Rac2 modulation. In subsequent biochemical analysis, NecroX-7 inhibited NADPH oxidase (NOX) activity by 53.3% (p < 0.001). These findings demonstrate that NecroX-7, in part, provides substantial protection of cardiomyopathy induced by tBHP or DOX via NOX-mediated cell death. -- Highlights: ► NecroX-7 prevented tert-butyl hydroperoxide-induced in vitro cardiac cell death. ► NecroX-7 ameliorated doxorubicin-induced in vivo cardiomyopathy. ► NecroX-7 prevented oxidative stress and necrosis-enriched transcriptional changes. ► NecroX-7 effectively inhibited NADPH oxidase activation. ► Cardioprotection of Necro-7 was brought on by modulation of NADPH oxidase activity.

Biochemical characterization of sap (latex) of a few Indian mango varieties.

Science.gov (United States)

John, K Saby; Bhat, S G; Prasada Rao, U J S

2003-01-01

Mango sap (latex) from four Indian varieties was studied for its composition. Sap was separated into non-aqueous and aqueous phases. Earlier, we reported that the non-aqueous phase contained mainly mono-terpenes having raw mango aroma (Phytochemistry 52 (1999) 891). In the present study biochemical composition of the aqueous phase was studied. Aqueous phase contained little amount of protein (2.0-3.5 mg/ml) but showed high polyphenol oxidase (147-214 U/mg protein) and peroxidase (401-561 U/mg protein) activities. It contained low amounts of polyphenols and protease activities. On native PAGE, all the major protein bands exhibited both polyphenol oxidase and peroxidase activities. Both polyphenol oxidase and peroxidase activities were found to be stable in the aqueous phase of sap at 4 degrees C. Sap contained large amount of non-dialyzable and non-starchy carbohydrate (260-343 mg/ml sap) which may be responsible for maintaining a considerable pressure of fluid in the ducts. Thus, the mango sap could be a valuable by-product in the mango industry as it contains some of the valuable enzymes and aroma components.

Polyphenols as potential therapeutical agents against cardiovascular diseases.

Science.gov (United States)

Curin, Yann; Andriantsitohaina, Ramaroson

2005-01-01

Increasing evidence suggests that polyphenols from fruits, vegetables and beverages such as wine and tea may exert protective effects on the cardiovascular system. Indeed, research in the field of polyphenols points out their antioxidant and free radical scavenging properties, leading to lower low-density lipoprotein (LDL) oxidation and platelet aggregation. These compounds are also able to modulate the generation of nitric oxide (NO) from vascular endothelium and to interfere with the mechanisms leading to inflammation and endothelial apoptosis, contributing to the prevention of the endothelial dysfunction, known to play a central role in the pathogenesis of cardiovascular diseases. This article reviews the potential targets of polyphenols involved in the complex pathophysiological events occurring in cardiovascular diseases, such as hypertension, atherosclerosis and stroke.

[Mass Transfer Kinetics Model of Ultrasonic Extraction of Pomegranate Peel Polyphenols].

Science.gov (United States)

Wang, Zhan-yi; Zhang, Li-hua; Wang, Yu-hai; Zhang, Yuan-hu; Ma, Li; Zheng, Dan-dan

2015-05-01

The dynamic mathematical model of ultrasonic extraction of polyphenols from pomegranate peel was constructed with the Fick's second law as the theoretical basis. The spherical model was selected, with mass concentrations of pomegranate peel polyphenols as the index, 50% ethanol as the extraction solvent and ultrasonic extraction as the extraction method. In different test conditions including the liquid ratio, extraction temperature and extraction time, a series of kinetic parameters were solved, such as the extraction process (k), relative raffinate rate, surface diffusion coefficient(D(S)), half life (t½) and the apparent activation energy (E(a)). With the extraction temperature increasing, k and D(S) were gradually increased with t½ decreasing,which indicated that the elevated temperature was favorable to the extraction of pomegranate peel polyphenols. The exponential equation of relative raffinate rate showed that the established numerical dynamics model fitted the extraction of pomegranate peel polyphenols, and the relationship between the reaction conditions and pomegranate peel polyphenols concentration was well reflected by the model. Based on the experimental results, a feasible and reliable kinetic model for ultrasonic extraction of polyphenols from pomegranate peel is established, which can be used for the optimization control of engineering magnifying production.

Enhancing the polyphenol content of a red-fleshed Japanese plum (Prunus salicina Lindl.) nectar by incorporating a polyphenol-rich extract from the skins.

Science.gov (United States)

de Beer, Dalene; Steyn, Naomi; Joubert, Elizabeth; Muller, Nina

2012-10-01

Plum skins are a waste product generated during production of plum juice or pulp. Polyphenols, shown to have various health-promoting properties, can be recovered from this waste product. Red-fleshed plum nectar formulations containing plum skin extract in varying amounts were characterised in terms of intensity of sensory attributes, consumer acceptability, colour, polyphenol content and antioxidant activity. Commercial beverages containing red fruits were used as benchmarks. The polyphenolic profile of the plum skin extract was similar to that of the pulp, including anthocyanins, flavonols, flavan-3-ols and a phenolic acid. Addition of the extract to plum nectar, which enhanced the colour, polyphenol content and antioxidant capacity, was limited by its negative sensory impact. The formulations were deemed acceptable by consumers, although a decrease in positive sensory attributes (plum flavour, plum aroma and sweetness) and an increase in negative sensory attributes (plant-like flavour, plant-like aroma, acidity and astringency) were observed with increasing skin extract content. The formulations compared favourably with commercial beverages in terms of colour total polyphenol content and antioxidant activity. Plum skins were successfully used to enhance the functional status of plum nectar. Use of a functional ingredient from plum skins is, therefore, a feasible value-addition strategy. Copyright © 2012 Society of Chemical Industry.

Polyphenols as Possible Markers of Botanical Origin of Honey.

Science.gov (United States)

Gašić, Uroš M; Milojković-Opsenica, Dušanka M; Tešić, Živoslav Lj

2017-07-01

In recent years, the botanical and geographical origin of food has become an important topic in the context of food quality and safety, as well as consumer protection, in accordance with international standards. Finding chemical markers, especially phytochemicals, characteristic for some kind of food is the subject of interest of a significant number of researchers in the world. This paper is focused on the use of polyphenols as potential markers for the determination of botanical origin of honey. It includes a review of the polyphenols present in various honey samples and the methods for their separation and identification. Special emphasis in this paper is placed on the identification of honey polyphenols using advanced LC-MS techniques in order to find specific markers of botanical origin of honey. In this regard, this study gives an overview of the literature that describes the use of LC-MS techniques for the isolation and determination of honey polyphenols. This review focuses on the research performed in the past two decades.

Minerals and Total Polyphenolic Content of Some Vegetal Powders

Directory of Open Access Journals (Sweden)

Roxana E. TUFEANU

2017-11-01

Full Text Available The total polyphenolic content and minerals were determined for chia seeds, Psyllium husks and watermelon rind powder. The minerals content was performed by using the Inductively Coupled Plasma Optical Emissions Spectrometer and Atomic Absorption Spectrometer, technique FIAS-Furnace (for Se. The sample with the highest content of polyphenols was chia (2.69 mg GAE/g s. followed by the watermelon rind powder. Reduced amounts of polyphenols were found in the Psyllium husks. Also, the total polyphenol concentration increased with the increase of the extraction time on the ultrasonic water bath. Minerals analysis indicated that powders obtained from chia seeds and watermelon rind contained large amounts of potassium, calcium, phosphorus and magnesium. The most abundant mineral in the Psyllium husks powder was found potassium, followed by calcium. In conclusion, these powders can be used as ingredients for functional food and food supplements production due to the high nutritional content and bioactive properties.

Global Liver Gene Expression Analysis on a Murine Metabolic Syndrome Model Treated by Low-molecular-weight Lychee Fruit Polyphenol (Oligonol®).

Science.gov (United States)

Uchiyama, Hironobu; Uehara, Kaori; Nagashima, Takayuki; Nakata, Akifumi; Sato, Keisuke; Mihara, Yoshihiro; Komatsu, Ken-Ich; Takanari, Jun; Shimizu, Shigeomi; Wakame, Koji

2016-07-01

Oligonol® (OLG) is a low-molecular-weight lychee fruit polyphenol mainly containing catechin-type monomers and oligomers of proanthocyanidins. Dietary OLG supplementation reportedly improves lipid metabolism disorder and lowers the visceral fat level in animal and human studies. Thus, we investigated the mechanism behind the protective and beneficial effects of OLG on a Western diet (WD)-induced metabolic syndrome (MetS) of a murine model. Using the C57BL/6J mouse for the MetS model, mice were divided into three groups: control (normal diet: ND), Western diet (WD) and WD + 0.5% OLG (OLG) groups. The WD group was fed a high-calorie (high fructose plus high fat) diet for 12 weeks to develop MetS. At week 12, all mice were sacrificed and the blood and liver were obtained for histological and biological examinations and RNA sequencing (RNA-Seq). Body weight, liver weight, plasma triglycerides (TG), total cholesterol (T-Cho) and alanine aminotransferase (ATS) levels of both OLG groups were significantly lower than those of the WD group. On histological examination of the liver, the area of fatty deposits was shown to be suppressed by OLG administration. Expression gene analysis in the liver of WD- versus OLG-fed mice by RNA-Seq showed that 464/45,706 genes exhibited a significant change of expression (corrected p-value metabolism-related genes Lpin1, Adig and Cidea were regulated by OLG administration. OLG may function to suppress MetS and the progression of geriatric diseases in WD-fed mice by regulating the expression of lipid metabolism, inflammation and tumor-related genes in the liver. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

Science.gov (United States)

Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

2009-01-01

The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

Energy Technology Data Exchange (ETDEWEB)

Johnson, J.L.; Rajagopalan, K.V. (Duke Univ. Medical Center, Durham, NC (USA)); London, R.E. (National Institute of Environmental Health Science, Research Triangle Park, NC (USA))

1989-09-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and {sup 31}P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well.

Covalently bound phosphate residues in bovine milk xanthine oxidase and in glucose oxidase from Aspergillus niger: A reevaluation

International Nuclear Information System (INIS)

Johnson, J.L.; Rajagopalan, K.V.; London, R.E.

1989-01-01

The reported presence of covalently bound phosphate residues in flavoproteins has significant implications with regard to the catalytic mechanisms and structural stability of the specific enzymes themselves and in terms of general cellular metabolic regulation. These considerations have led to a reevaluation of the presence of covalently bound phosphorus in the flavoproteins xanthine oxidase and glucose oxidase. Milk xanthine oxidase purified by a procedure that includes anion-exchange chromatography is shown to contain three phosphate residues. All three are noncovalently associated with the protein, two with the FAD cofactor, and one with the molybdenum cofactor. Results of chemical analysis and 31 P NMR spectroscopy indicate that enzyme purified by this method contains no phosphoserine residues. Xanthine oxidase preparations purified by chromatography on calcium phosphate gel in place of DEAE-Sephadex yielded higher phosphate-to-protein ratios, which could be reduced to the expected values by additional purification on a folate affinity column. Highly active, highly purified preparations of glucose oxidase are shown to contain only the two phosphate residues of the FAD cofactor. The covalently bound bridging phosphate reported by others may arise in aged or degraded preparations of the enzyme but appears not to be a constituent of functional glucose oxidase. These results suggest that the presence of covalent phosphate residues in other flavoproteins should be rigorously reevaluated as well

SNARE zippering is hindered by polyphenols in the neuron

Energy Technology Data Exchange (ETDEWEB)

Yang, Yoosoo [Department of Genetic Engineering and Center for Human Interface Nanotechnology, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Biomedical Research Institute, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Kim, Se-Hyun; Heo, Paul; Kong, Byoungjae; Shin, Jonghyeok; Jung, Young-Hun; Yoon, Keejung; Chung, Woo-Jae [Department of Genetic Engineering and Center for Human Interface Nanotechnology, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of); Shin, Yeon-Kyun [Biomedical Research Institute, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Department of Biochemistry, Biophysics, and Molecular Biology, Iowa State University, Ames, IA 50011 (United States); Kweon, Dae-Hyuk, E-mail: dhkweon@skku.edu [Department of Genetic Engineering and Center for Human Interface Nanotechnology, Sungkyunkwan University, Suwon 440-746 (Korea, Republic of)

2014-07-18

Highlights: • Membrane fusion driven by SNARE complex is hindered by several polyphenols. • Distinctive inhibitory effect of each polyphenol on SNARE zippering in neuron was examined. • FRET between fluorescence protein-tagged SNAREs probed well SNARE zippering in PC12 cells. • Delphinidin and cyanidin inhibit N-terminal SNARE nucleation in Ca{sup 2+}-independent manner. • Myricetin inhibits Ca{sup 2+}-dependent transmembrane association of SNARE complex. - Abstract: Fusion of synaptic vesicles with the presynaptic plasma membrane in the neuron is mediated by soluble N-ethylmaleimide-sensitive fusion protein-attachment protein receptor (SNARE) proteins. SNARE complex formation is a zippering-like process which initiates at the N-terminus and proceeds to the C-terminal membrane-proximal region. Previously, we showed that this zippering-like process is regulated by several polyphenols, leading to the arrest of membrane fusion and the inhibition of neuroexocytosis. In vitro studies using purified SNARE proteins reconstituted in liposomes revealed that each polyphenol uniquely regulates SNARE zippering. However, the unique regulatory effect of each polyphenol in cells has not yet been examined. In the present study, we observed SNARE zippering in neuronal PC12 cells by measuring the fluorescence resonance energy transfer (FRET) changes of a cyan fluorescence protein (CFP) and a yellow fluorescence protein (YFP) fused to the N-termini or C-termini of SNARE proteins. We show that delphinidin and cyanidin inhibit the initial N-terminal nucleation of SNARE complex formation in a Ca{sup 2+}-independent manner, while myricetin inhibits Ca{sup 2+}-dependent transmembrane domain association of the SNARE complex in the cell. This result explains how polyphenols exhibit botulinum neurotoxin-like activity in vivo.

Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

Science.gov (United States)

Li, Wande

2013-01-01

Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

Dietary polyphenol supplementation prevents alterations of spatial navigation in middle-aged mice

Directory of Open Access Journals (Sweden)

Julien eBensalem

2016-02-01

Full Text Available Spatial learning and memory deficits associated with hippocampal synaptic plasticity impairments are commonly observed during aging. Besides, the beneficial role of dietary polyphenols has been suggested as potential functional food candidates to prevent this memory decline. Indeed, polyphenols could potentiate the signaling pathways of synaptic plasticity underlying learning and memory. In this study, spatial learning deficits of middle-aged mice were first highlighted and characterized according to navigation patterns in the Morris water maze task. An eight-week polyphenol-enriched diet, containing a polyphenol-rich extract from grape and blueberry (PEGB (from the Neurophenols Consortium with high contents of flavonoids, stilbenes and phenolic acids, was then successful in reversing these age-induced effects. The use of spatial strategies was indeed delayed with aging whereas a polyphenol supplementation could promote the occurrence of spatial strategies. These behavioral results were associated with neurobiological changes: while the expression of hippocampal CaMKII mRNA levels was reduced in middle-aged animals, the polyphenol-enriched diet could rescue them. Besides, an increased expression of NGF mRNA levels was also observed in supplemented adult and middle-aged mice. Thus these data suggest that supplementation with polyphenols could be an efficient nutritional way to prevent age-induced cognitive decline.

New cellulose–lignin hydrogels and their application in controlled release of polyphenols

International Nuclear Information System (INIS)

Ciolacu, Diana; Oprea, Ana Maria; Anghel, Narcis; Cazacu, Georgeta; Cazacu, Maria

2012-01-01

Novel superabsorbant cellulose–lignin hydrogels (CL) were prepared by a new two-step procedure consisting in dissolving cellulose in an alkaline solution with further mixing with lignin, followed by the chemical crosslinking with epichlorohydrin. The crosslinking occurrence was verified by Fourier Transform Infrared spectroscopy (FT-IR). The effect of the structure features of cellulose–lignin hydrogels on their dehydration heat was evaluated by Differential Scanning Calorimetry (DSC). The Scanning Electron Microscopy (SEM) images reveal some morphological aspects of the hydrogels. The degree as well as the rate of swelling in a mixture of water:ethanol = 19:1 were estimated. The possible application of these hydrogels as controlled release systems was tested. Polyphenols known as having a wide range of biological effects were selected to be incorporated in such hydrogels by an optimal procedure. The extract of grapes seeds from the Chambourcin type was used as a source of polyphenols (PF). The amount of the incorporated polyphenols was estimated by UV–VIS measurements. Characterization of the hydrogels containing polyphenols was performed by FTIR spectroscopy. Some parameters were estimated based on the registered spectra, as H-bond energy (E H ), the asymmetric index (a/b) and the enthalpy of H-bond formation (ΔH). The modifications of the thermal behavior and morphology induced by the presence of the polyphenols in hydrogels were highlighted by DSC and SEM, respectively. The release of polyphenols from CL hydrogels depended on the lignin content from matrices, as assessed by spectral studies. Both loading with polyphenols and their release can be controlled by the composition of the hydrogels. The kinetic of polyphenols release was studied. - Highlights: ► A unique method to obtain cellulose–lignin hydrogels. ► The application of these hydrogels as controlled release systems was tested. ► Polyphenols from grapes seed as active ingredient. �

Polyphenol-Rich Dry Common Beans (Phaseolus vulgaris L.) and Their Health Benefits

Science.gov (United States)

Ganesan, Kumar

2017-01-01

Polyphenols are plant metabolites with potent anti-oxidant properties, which help to reduce the effects of oxidative stress-induced dreaded diseases. The evidence demonstrated that dietary polyphenols are of emerging increasing scientific interest due to their role in the prevention of degenerative diseases in humans. Possible health beneficial effects of polyphenols are based on the human consumption and their bioavailability. Common beans (Phaseolus vulgaris L.) are a greater source of polyphenolic compounds with numerous health promoting properties. Polyphenol-rich dry common beans have potential effects on human health, and possess anti-oxidant, anti-diabetic, anti-obesity, anti-inflammatory and anti-mutagenic and anti-carcinogenic properties. Based on the studies, the current comprehensive review aims to provide up-to-date information on the nutritional compositions and health-promoting effect of polyphenol-rich common beans, which help to explore their therapeutic values for future clinical studies. Investigation of common beans and their impacts on human health were obtained from various library databases and electronic searches (Science Direct PubMed, and Google Scholar). PMID:29113066

Systematic analysis of the polyphenol metabolome using the Phenol-Explorer database.

Science.gov (United States)

Rothwell, Joseph A; Urpi-Sarda, Mireia; Boto-Ordoñez, Maria; Llorach, Rafael; Farran-Codina, Andreu; Barupal, Dinesh Kumar; Neveu, Vanessa; Manach, Claudine; Andres-Lacueva, Cristina; Scalbert, Augustin

2016-01-01

The Phenol-Explorer web database details 383 polyphenol metabolites identified in human and animal biofluids from 221 publications. Here, we exploit these data to characterize and visualize the polyphenol metabolome, the set of all metabolites derived from phenolic food components. Qualitative and quantitative data on 383 polyphenol metabolites as described in 424 human and animal intervention studies were systematically analyzed. Of these metabolites, 301 were identified without prior enzymatic hydrolysis of biofluids, and included glucuronide and sulfate esters, glycosides, aglycones, and O-methyl ethers. Around one-third of these compounds are also known as food constituents and corresponded to polyphenols absorbed without further metabolism. Many ring-cleavage metabolites formed by gut microbiota were noted, mostly derived from hydroxycinnamates, flavanols, and flavonols. Median maximum plasma concentrations (C(max)) of all human metabolites were 0.09 and 0.32 μM when consumed from foods or dietary supplements, respectively. Median time to reach maximum plasma concentration in humans (T(max)) was 2.18 h. These data show the complexity of the polyphenol metabolome and the need to take into account biotransformations to understand in vivo bioactivities and the role of dietary polyphenols in health and disease. © 2015 The Authors. Molecular Nutrition & Food Research published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibition of nicotine-DNA adduct formation by polyphenolic compounds in vitro

International Nuclear Information System (INIS)

Cheng Yan; Wang Haifang; Sun Hongfang; Li Hongli

2004-01-01

Nicotine[3-(1-methyl-2-pyrrolidinyl)-pyridine], a major alkaloid in tobacco products, has proven to be a potential genotoxic compound. Some polyphenolic compounds can suppress the DNA adduction, and hence act as the potential inhibitors of carcinogenesis. In this study, the inhibitory effects of three polyphenolic compounds, curcumin (diferuloylmethane), resveratrol (trans-3, 5, 4-trihydroxystilbene) and tea polyphenols, on the nicotine-DNA adduction have been investigated in vitro using radiolabelled nicotine and liquid scintillation counting (LSC) technique. Also, the inhibition mechanism of these chemopreventive agents in regard to the activity of the biotransformation enzymes, including cytochrome P450 (CYP450), cytochrome b 5 (CYb 5 ) and glutathione S-transferase (GST), has been studied. The results demonstrated that these three polyphenols induced marked dose-dependent decrease in nicotine-DNA adducts as compared with the controls. The elimination rate of adducts reached above 46% at the highest dose for all the three agents with 51.6% for resveratrol. Correspondingly, three polyphenols all suppressed CYP450 and CYb 5 , whereas curcumin and resveratrol induced GST. The authors may arrive at a point that the three polyphenols are beneficial to prevent the nicotine adduct formation, and thus may be used to block the potential carcinogenesis induced by nicotine. (authors)

Polyphenol composition and antioxidant activity of Kei-apple (Dovyalis caffra) juice.

Science.gov (United States)

Loots, Du Toit; van der Westhuizen, Francois H; Jerling, Johann

2006-02-22

The polyphenolic and ascorbate (ASC) components as well as the antioxidant capacity of Kei-apple (Dovyalis caffra) juice were analyzed and compared to three other fruit juices. The Kei-apple juice had significantly the highest total polyphenolic concentrations (1013 mg gallic acid equivalent/L), and solid phase (C(18)) fractionation identified the majority of these polyphenols to be phenolic acids. The Kei-apple juice also had significantly the highest ASC concentrations (658 mg/L), which showed exceptional heat stability with very little conversion to dehydroascorbate (DHA). Antioxidant capacities of both the unfractionated fruit juices and their solid phase-extracted fractions, as determined by oxygen radical absorbance capacity and ferric reducing antioxidant power analyses, correlated well to the polyphenol concentrations. Gas chromatography-mass spectrometry analyses showed caffeic acid as the most abundant polyphenol present (128.7 mg/L) in the Kei-apple juice; it contributed to 63% of the total antioxidant capacity (of all of the individual compounds identified). Other notable polyphenols identified in higher concentrations included p-coumaric acid, p-hydroxyphenylacetic acid, and protocatechuic acid. Our results therefore support the putative high antioxidant value linked to this fruit and better define this potential in terms of the major antioxidants that exist in the Kei-apple.

Dietary Polyphenols, Mediterranean Diet, Prediabetes, and Type 2 Diabetes: A Narrative Review of the Evidence

Directory of Open Access Journals (Sweden)

Marta Guasch-Ferré

2017-01-01

Full Text Available Dietary polyphenols come mainly from plant-based foods including fruits, vegetables, whole grains, coffee, tea, and nuts. Polyphenols may influence glycemia and type 2 diabetes (T2D through different mechanisms, such as promoting the uptake of glucose in tissues, and therefore improving insulin sensitivity. This review aims to summarize the evidence from clinical trials and observational prospective studies linking dietary polyphenols to prediabetes and T2D, with a focus on polyphenol-rich foods characteristic of the Mediterranean diet. We aimed to describe the metabolic biomarkers related to polyphenol intake and genotype-polyphenol interactions modulating the effects on T2D. Intakes of polyphenols, especially flavan-3-ols, and their food sources have demonstrated beneficial effects on insulin resistance and other cardiometabolic risk factors. Several prospective studies have shown inverse associations between polyphenol intake and T2D. The Mediterranean diet and its key components, olive oil, nuts, and red wine, have been inversely associated with insulin resistance and T2D. To some extent, these associations may be attributed to the high amount of polyphenols and bioactive compounds in typical foods conforming this traditional dietary pattern. Few studies have suggested that genetic predisposition can modulate the relationship between polyphenols and T2D risk. In conclusion, the intake of polyphenols may be beneficial for both insulin resistance and T2D risk.

Identification and characterization of aldehyde oxidases (AOXs) in the cotton bollworm

Science.gov (United States)

Xu, Wei; Liao, Yalin

2017-12-01

Aldehyde oxidases (AOXs) are a family of metabolic enzymes that oxidize aldehydes into carboxylic acids; therefore, they play critical roles in detoxification and degradation of chemicals. By using transcriptomic and genomic approaches, we successfully identified six putative AOX genes (HarmAOX1-6) from cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae). In silico expression profile, reverse transcription (RT)-PCR, and quantitative PCR (qPCR) analyses showed that HarmAOX1 is highly expressed in adult antennae, tarsi, and larval mouthparts, so they may play an important role in degrading plant-derived compounds. HarmAOX2 is highly and specifically expressed in adult antennae, suggesting a candidate pheromone-degrading enzyme (PDE) to inactivate the sex pheromone components (Z)-11-hexadecenal and (Z)-9-hexadecenal. RNA sequencing data further demonstrated that a number of host plants they feed on could significantly upregulate the expression levels of HarmAOX1 in larvae. This study improves our understanding of insect aldehyde oxidases and insect-plant interactions.

Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

Science.gov (United States)

Rathinam, T; Gadde, U; Chapman, H D

2015-07-01

Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

Quantitation of immunoadsorbed flavoprotein oxidases by luminol-mediated chemiluminescence.

Science.gov (United States)

Hinkkanen, A; Maly, F E; Decker, K

1983-04-01

The detection of the flavoenzymes 6-hydroxy-L-nicotine oxidase and 6-hydroxy-D-nicotine oxidase at the sub-femtomol level was achieved by coupling the reaction of the immunoadsorbed proteins to the peroxidase-catalysed oxidation of luminol. The H2O2-producing oxidases retained their full activity when bound to the respective immobilized antibodies. This fact allowed the concentration of the enzymes from very dilute solutions and the quantitative assay of their activities in the microU range. Due to strict stereoselectivity and the absence of immunological cross-reactivity, the two flavoproteins could be determined in the same solution. This method was used to measure the 6-hydroxy-D-nicotine oxidase and 6-hydroxy-L-nicotine oxidase activities in Escherichia coli RR1 and different Arthrobacter strains cultured under non-inducing conditions. The same activity ratio of 6-hydroxy-L-nicotine oxidase/6-hydroxy-D-nicotine oxidase as in D L-nicotine-induced cells of A. oxidans was observed in non-induced wild type and in riboflavin-requiring (rf-) mutant cells of this aerob.

26 - 31 Bello paid

African Journals Online (AJOL)

DR. AMIN

The effect of pH on the activity and stability of crude polyphenol oxidase (PPO) ... decrease in the activity of the enzyme, and can be a good way of controlling undesirable changes ... diphenol oxidases are present in plants, the ratio of.

Identification, expression, and taxonomic distribution of alternative oxidases in non-angiosperm plants.

Science.gov (United States)

Neimanis, Karina; Staples, James F; Hüner, Norman P A; McDonald, Allison E

2013-09-10

Alternative oxidase (AOX) is a terminal ubiquinol oxidase present in the respiratory chain of all angiosperms investigated to date, but AOX distribution in other members of the Viridiplantae is less clear. We assessed the taxonomic distribution of AOX using bioinformatics. Multiple sequence alignments compared AOX proteins and examined amino acid residues involved in AOX catalytic function and post-translational regulation. Novel AOX sequences were found in both Chlorophytes and Streptophytes and we conclude that AOX is widespread in the Viridiplantae. AOX multigene families are common in non-angiosperm plants and the appearance of AOX1 and AOX2 subtypes pre-dates the divergence of the Coniferophyta and Magnoliophyta. Residues involved in AOX catalytic function are highly conserved between Chlorophytes and Streptophytes, while AOX post-translational regulation likely differs in these two lineages. We demonstrate experimentally that an AOX gene is present in the moss Physcomitrella patens and that the gene is transcribed. Our findings suggest that AOX will likely exert an influence on plant respiration and carbon metabolism in non-angiosperms such as green algae, bryophytes, liverworts, lycopods, ferns, gnetophytes, and gymnosperms and that further research in these systems is required. Copyright © 2013 Elsevier B.V. All rights reserved.

Dietary intake of total polyphenol and polyphenol classes and the risk of colorectal cancer in the European Prospective Investigation into Cancer and Nutrition (EPIC) cohort

DEFF Research Database (Denmark)

Zamora-Ros, Raul; Cayssials, Valerie; Jenab, Mazda

2018-01-01

Polyphenols may play a chemopreventive role in colorectal cancer (CRC); however, epidemiological evidence supporting a role for intake of individual polyphenol classes, other than flavonoids is insufficient. We evaluated the association between dietary intakes of total and individual classes and ...

Skin photoprotection by natural polyphenols: anti-inflammatory, antioxidant and DNA repair mechanisms.

Science.gov (United States)

Nichols, Joi A; Katiyar, Santosh K

2010-03-01

Epidemiological, clinical and laboratory studies have implicated solar ultraviolet (UV) radiation in various skin diseases including, premature aging of the skin and melanoma and non-melanoma skin cancers. Chronic UV radiation exposure-induced skin diseases or skin disorders are caused by the excessive induction of inflammation, oxidative stress and DNA damage, etc. The use of chemopreventive agents, such as plant polyphenols, to inhibit these events in UV-exposed skin is gaining attention. Chemoprevention refers to the use of agents that can inhibit, reverse or retard the process of these harmful events in the UV-exposed skin. A wide variety of polyphenols or phytochemicals, most of which are dietary supplements, have been reported to possess substantial skin photoprotective effects. This review article summarizes the photoprotective effects of some selected polyphenols, such as green tea polyphenols, grape seed proanthocyanidins, resveratrol, silymarin and genistein, on UV-induced skin inflammation, oxidative stress and DNA damage, etc., with a focus on mechanisms underlying the photoprotective effects of these polyphenols. The laboratory studies conducted in animal models suggest that these polyphenols have the ability to protect the skin from the adverse effects of UV radiation, including the risk of skin cancers. It is suggested that polyphenols may favorably supplement sunscreens protection, and may be useful for skin diseases associated with solar UV radiation-induced inflammation, oxidative stress and DNA damage.

Forging a modern generation of polyphenol-based therapeutics.

Science.gov (United States)

Wright, Bernice

2013-06-01

The long-standing debate that polyphenol secondary metabolites from dietary plants are important nutritional components continues due to compelling evidence for their abilities to ameliorate degenerative conditions including, cancer, neurological disorders and cardiovascular disease. The clinical use of polyphenols is not, however, mainstream as issues regarding poor selectivity, dosage, toxicity and delivery methods are unresolved. The paper by Rieder et al. suggests that the lack of selectivity, at least for the stilbene, resveratrol, may not be a major limiting factor. The present commentary is a critique of this significant finding that is focused on deciding how the use of resveratrol as clinical medicine could be advanced, and how this new information integrates with current knowledge of polyphenol physiological effects. This commentary suggests that the multi-target nature of polyphenols may be translated into reliable therapy using the current systems/network pharmacology approach concerned with developing viable therapeutic agents that achieve specific effects through interactions with a wide array of targets. This article is a commentary on Rieder et al., pp. 1244-1258 of BJP 167:6. To view this paper visit http://dx.doi.org/10.1111/j.1476-5381.2012.02063.x. © 2013 The Author. British Journal of Pharmacology © 2013 The British Pharmacological Society.

Polyphenolic chemistry of tea and coffee: a century of progress.

Science.gov (United States)

Wang, Yu; Ho, Chi-Tang

2009-09-23

Tea and coffee, the most popular beverages in the world, have been consumed for thousands of years for their alluring flavors and health benefits. Polyphenols, particularly flavonoids and phenolic acids, are of great abundance in tea and coffee and contribute a lot to their flavor and health properties. This paper reviews the polyphenol chemistry of tea and coffee, specifically their stability, and scavenging ability of reactive oxygen species (ROS) and reactive carbonyl species (RCS). During the manufacturing and brewing process, green tea and black tea polyphenols undergo epimerization and oxidation, respectively. Meanwhile, the lactonization and the polymerization of chlorogenic acid are the major causes for the degradation of polyphenols in coffee. Tea catechins, besides having antioxidant properties, have the novel characteristic of trapping reactive carbonyl species. The A ring of the catechins is the binding site for RCS trapping, whereas the B ring is the preferred site for antioxidation.

Biochemical degradation and physical migration of polyphenolic compounds in osmotic dehydrated blueberries with pulsed electric field and thermal pretreatments.

Science.gov (United States)

Yu, Yuanshan; Jin, Tony Z; Fan, Xuetong; Wu, Jijun

2018-01-15

Fresh blueberries were pretreated by pulsed electric fields (PEF) or thermal pretreatment and then were subject to osmotic dehydration. The changes in contents of anthocyanins, predominantly phenolic acids and flavonols, total phenolics, polyphenol oxidase (PPO) activity and antioxidant activity in the blueberry samples during pretreatment and osmotic dehydration were investigated. Biochemical degradation and physical migration of these nutritive compounds from fruits to osmotic solutions were observed during the pretreatments and osmotic dehydration. PEF pretreated samples had the least degradation loss but the most migration loss of these compounds compared to thermally pretreated and control samples. Higher rates of water loss and solid gain during osmotic dehydration were also obtained by PEF pretreatment, reducing the dehydration time from 130 to 48h. PEF pretreated and dehydrated fruits showed superior appearance to thermally pretreated and control samples. Therefore, PEF pretreatment is a preferred technology that balances nutritive quality, appearance, and dehydration rate. Published by Elsevier Ltd.

Quantification of almond skin polyphenols by liquid chromatography-mass spectrometry.

Science.gov (United States)

Bolling, Bradley W; Dolnikowski, Gregory; Blumberg, Jeffrey B; Oliver Chen, C Y

2009-01-01

Reverse phase HPLC coupled to negative mode electrospray ionization (ESI) mass spectrometry (MS) was used to quantify 16 flavonoids and 2 phenolic acids from almond skin extracts. Calibration curves of standard compounds were run daily and daidzein was used as an internal standard. The inter-day relative standard deviation (RSD) of standard curve slopes ranged from 13% to 25% of the mean. On column (OC) limits of detection (LOD) for polyphenols ranged from 0.013 to 1.4 pmol, and flavonoid glycosides had a 7-fold greater sensitivity than aglycones. Limits of quantification were 0.043 to 2.7 pmol OC, with a mean of 0.58 pmol flavonoid OC. Mean inter-day RSD of polyphenols in almond skin extract was 6.8% with a range of 4% to 11%, and intra-day RSD was 2.4%. Liquid nitrogen (LN(2)) or hot water (HW) blanching was used to facilitate removal of the almond skins prior to extraction using assisted solvent extraction (ASE) or steeping with acidified aqueous methanol. Recovery of polyphenols was greatest in HW blanched almond extracts with a mean value of 2.1 mg/g skin. ASE and steeping extracted equivalent polyphenols, although ASE of LN(2) blanched skins yielded 52% more aglycones and 23% less flavonoid glycosides. However, the extraction methods did not alter flavonoid profile of HW blanched almond skins. The recovery of polyphenolic components that were spiked into almond skins before the steeping extraction was 97% on a mass basis. This LC-MS method presents a reliable means of quantifying almond polyphenols.

Reducing effects of polyphenols on metmyoglobin and the in vitro regeneration of bright meat color by polyphenols in the presence of cysteine.

Science.gov (United States)

Miura, Yukari; Inai, Miyuki; Honda, Sari; Masuda, Akiko; Masuda, Toshiya

2014-10-01

The effect of polyphenols and related phenolic compounds on the reduction of metmyoglobin (MetMb) to oxymyoglobin (MbO2), in the presence of cysteine, was investigated. Caffeic acid, dihydrocaffeic acid, and hydroxtyrosol (600 μmol/L) did not show any reducing activity individually. However, their highly potent activity in the reduction of MetMb to MbO2 was observed in the presence of equimolar amounts of cysteine. On the basis of the analytical results for the redox reaction products generated during the MetMb-reducing reaction of caffeic acid, we proposed a mechanism for the polyphenol-mediated reduction of MetMb. As per the proposed mechanism, the antioxidant polyphenols having a catechol substructure can effectively reduce MetMb to MbO2 with chemical assistance from nucleophilic reactive thiol compounds such as cysteine. Moreover, cysteine-coupled polyphenols such as cysteinylcaffeic acids (which are coupling products of caffeic acid and cysteine) can be used as preserving agents for retaining the fresh meat color, because of their powerful reducing effect on MetMb. The reduction of MetMb to MbO2 changes the color of meat from brown to the more desirable bright red.

VITAMIN EFFECT ON THE SYNTHESIS ОF POLYPHENOLIC SUBSTANCES BY BASIDIOMYCETES

Directory of Open Access Journals (Sweden)

Veligodska A. K.

2013-12-01

Full Text Available We studied the influence of certain vitamins on the intensity of the synthesis of polyphenolic compounds and carotenoids by some Basidiomycetes strains, such as Laetiporus sulphureus Ls-08, Fomes fomentarius Ff-1201 and Fistulina hepatica Fh-18. The registration of accumulation of dry biomass and content of polyphenols and carotenoids in the mycelia and culture filtrate of strains that were cultivated on glucose-peptone substrates (GPS with vitamins was performed. The vitamins A, E, C, B1, B12, and PP at the concentration of 0.005, 0.01 and 0.05 g/l were applied as modification of GPS. We founded the species effect on the synthesis of vitamins, polyphenols, and carotenoids. We suggested separate application of vitamins A, E, B1, and B12 at concentration of 0.01 g/ l to induce the synthesis of polyphenols and carotenoids. Results of the study will be used to develop a modification of GPS for the cultivation of strains of polyphenolic substances of basidiomycete origin.

New insights into the antiangiogenic and proangiogenic properties of dietary polyphenols.

Science.gov (United States)

Diniz, Carmen; Suliburska, Joanna; Ferreira, Isabel M P L V O

2017-06-01

Polyphenols can be found in natural products of plant origin, including vegetables, fruits, and beverages. A large number of these plant origin compounds are an integral part of the human diet and in the past decade evidence has shown their beneficial properties in human health, by acting in several cell signaling pathways. Among other beneficial effects, polyphenols have been associated with angiogenesis. Increasing evidence highlighting the ability of dietary polyphenols to influence angiogenesis by interfering with multiple signaling pathways is debated. Particular emphasis is given to the mechanisms that ultimately may induce the formation of capillary-like structures (by increasing endothelial cell proliferation, migration, and invasion) or, conversely, may inhibit the steps of angiogenesis leading to the inhibition/regress of vascular development. Dietary polyphenols can, therefore, be viewed as promising nutraceuticals but important aspects have still to be further investigated, to deep knowledge concerning their concentration-mediated effects, effect of specific polyphenols, and respective metabolites, to ensure their appropriate and effective usefulness as proangiogenic or antiangiogenic nutraceuticals. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Cytochrome oxidase assembly does not require catalytically active cytochrome C.

Science.gov (United States)

Barrientos, Antoni; Pierre, Danielle; Lee, Johnson; Tzagoloff, Alexander

2003-03-14

Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the transfer of electrons from reduced cytochrome c to molecular oxygen. COX assembly requires the coming together of nuclear- and mitochondrial-encoded subunits and the assistance of a large number of nuclear gene products acting at different stages of maturation of the enzyme. In Saccharomyces cerevisiae, expression of cytochrome c, encoded by CYC1 and CYC7, is required not only for electron transfer but also for COX assembly through a still unknown mechanism. We have attempted to distinguish between a functional and structural requirement of cytochrome c in COX assembly. A cyc1/cyc7 double null mutant strain was transformed with the cyc1-166 mutant gene (Schweingruber, M. E., Stewart, J. W., and Sherman, F. (1979) J. Biol. Chem. 254, 4132-4143) that expresses stable but catalytically inactive iso-1-cytochrome c. The COX content of the cyc1/cyc7 double mutant strain harboring non-functional iso-1-cytochrome c has been characterized spectrally, functionally, and immunochemically. The results of these studies demonstrate that cytochrome c plays a structural rather than functional role in assembly of cytochrome c oxidase. In addition to its requirement for COX assembly, cytochrome c also affects turnover of the enzyme. Mutants containing wild type apocytochrome c in mitochondria lack COX, suggesting that only the folded and mature protein is able to promote COX assembly.

Towards functional effects of polyphenols : modulation of energy metabolism revealed

NARCIS (Netherlands)

Boer, de V.C.J.

2007-01-01

A diet rich in fruits and vegetables contains high levels of polyphenols (up to 1 gram per day). Epidemiological studies suggest that a high dietary intake of selected polyphenols can be protective against development of cardiovascular heart diseases in humans. In addition, mechanistic studies

Consumption of polyphenol plants may slow aging and associated diseases.

Science.gov (United States)

Uysal, Utku; Seremet, Sila; Lamping, Jeffrey W; Adams, Jerome M; Liu, Deede Y; Swerdlow, Russell H; Aires, Daniel J

2013-01-01

Slowing aging is a widely shared goal. Plant-derived polyphenols, which are found in commonly consumed food plants such as tea, cocoa, blueberry and grape, have been proposed to have many health benefits, including slowing aging. In-vivo studies have demonstrated the lifespan-extending ability of six polyphenol-containing plants. These include five widely consumed foods (tea, blueberry, cocoa, apple, pomegranate) and a flower commonly used as a folk medicine (betony). These and multiple other plant polyphenols have been shown to have beneficial effects on aging-associated changes across a variety of organisms from worm and fly to rodent and human.

Tea polyphenols dominate the short-term tea (Camellia sinensis) leaf litter decomposition*

Science.gov (United States)

Fan, Dong-mei; Fan, Kai; Yu, Cui-ping; Lu, Ya-ting; Wang, Xiao-chang

2017-01-01

Polyphenols are one of the most important secondary metabolites, and affect the decomposition of litter and soil organic matter. This study aims to monitor the mass loss rate of tea leaf litter and nutrient release pattern, and investigate the role of tea polyphenols played in this process. High-performance liquid chromatography (HPLC) and classical litter bag method were used to simulate the decomposition process of tea leaf litter and track the changes occurring in major polyphenols over eight months. The release patterns of nitrogen, potassium, calcium, and magnesium were also determined. The decomposition pattern of tea leaf litter could be described by a two-phase decomposition model, and the polyphenol/N ratio effectively regulated the degradation process. Most of the catechins decreased dramatically within two months; gallic acid (GA), catechin gallate (CG), and gallocatechin (GC) were faintly detected, while others were outside the detection limits by the end of the experiment. These results demonstrated that tea polyphenols transformed quickly and catechins had an effect on the individual conversion rate. The nutrient release pattern was different from other plants which might be due to the existence of tea polyphenols. PMID:28124839

Tea polyphenols dominate the short-term tea (Camellia sinensis) leaf litter decomposition.

Science.gov (United States)

Fan, Dong-Mei; Fan, Kai; Yu, Cui-Ping; Lu, Ya-Ting; Wang, Xiao-Chang

Polyphenols are one of the most important secondary metabolites, and affect the decomposition of litter and soil organic matter. This study aims to monitor the mass loss rate of tea leaf litter and nutrient release pattern, and investigate the role of tea polyphenols played in this process. High-performance liquid chromatography (HPLC) and classical litter bag method were used to simulate the decomposition process of tea leaf litter and track the changes occurring in major polyphenols over eight months. The release patterns of nitrogen, potassium, calcium, and magnesium were also determined. The decomposition pattern of tea leaf litter could be described by a two-phase decomposition model, and the polyphenol/N ratio effectively regulated the degradation process. Most of the catechins decreased dramatically within two months; gallic acid (GA), catechin gallate (CG), and gallocatechin (GC) were faintly detected, while others were outside the detection limits by the end of the experiment. These results demonstrated that tea polyphenols transformed quickly and catechins had an effect on the individual conversion rate. The nutrient release pattern was different from other plants which might be due to the existence of tea polyphenols.

Cortical enlargement in autism is associated with a functional VNTR in the monoamine oxidase A gene.

Science.gov (United States)

Davis, Lea K; Hazlett, Heather C; Librant, Amy L; Nopoulos, Peggy; Sheffield, Val C; Piven, Joesph; Wassink, Thomas H

2008-10-05

Monoamine oxidase A (MAOA) is an enzyme expressed in the brain that metabolizes dopamine, norepinephrine, epinephrine, and serotonin. Abnormalities of serotonin neurotransmission have long been implicated in the psychopathology of autism. A polymorphism exists within the promoter region of the MAOA gene that influences MAOA expression levels so that "low activity" alleles are associated with increased neurotransmitter levels in the brain. Individuals with autism often exhibit elevated serotonin levels. Additional studies indicate that the "low activity" allele may be associated with lower IQ and more severe autistic symptoms. In this study we genotyped the MAOA promoter polymorphism in a group of 29 males (age 2-3 years) with autism and a group of 39 healthy pediatric controls for whom brain MRI data was available. We found a consistent association between the "low activity" allele and larger brain volumes for regions of the cortex in children with autism but not in controls. We did not find evidence for over-transmission of the "low activity" allele in a separate sample of 114 affected sib pair families. Nor did we find any unknown SNPs in yet another sample of 96 probands. Future studies will determine if there is a more severe clinical phenotype associated with both the "low activity" genotype and the larger brain volumes in our sample.

D-amino acid oxidase activator gene (DAOA) variation affects cerebrospinal fluid homovanillic acid concentrations in healthy Caucasians

DEFF Research Database (Denmark)

Andreou, Dimitrios; Saetre, Peter; Werge, Thomas

2012-01-01

The D-amino acid oxidase activator (DAOA) protein regulates the function of D-amino oxidase (DAO), an enzyme that catalyzes the oxidative deamination of D-3,4-dihydroxyphenylalanine (D-DOPA) and D-serine. D-DOPA is converted to L-3,4-DOPA, a precursor of dopamine, whereas D-serine participates...... in glutamatergic transmission. We hypothesized that DAOA polymorphisms are associated with dopamine, serotonin and noradrenaline turnover in the human brain. Four single-nucleotide polymorphisms, previously reported to be associated with schizophrenia, were genotyped. Cerebrospinal fluid (CSF) samples were drawn...... by lumbar puncture, and the concentrations of the major dopamine metabolite homovanillic acid (HVA), the major serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) and the major noradrenaline metabolite 3-methoxy-4-hydroxyphenylglycol (MHPG) were measured. Two of the investigated polymorphisms, rs...

Enhancing polyphenol extraction from unripe apples by carbohydrate-hydrolyzing enzymes*

Science.gov (United States)

Zheng, Hu-zhe; Hwang, In-Wook; Chung, Shin-Kyo

2009-01-01

The effects of process variables such as enzyme types, enzyme ratio, reaction temperature, pH, time, and ethanol concentration on the extraction of unripe apple polyphenol were investigated. The results indicated that Viscozyme L had the strongest effect on polyphenols extraction and was selected to study the polyphenol composition. The ratio of enzyme (Viscozyme L) to substrate (2 fungal beta-glucanase units (FBG)) at 0.02, reaction at pH 3.7, 50 °C for 12 h, and ethanol concentration of 70% were chosen as the most favorable extraction condition. Total phenolic content (TPC), reducing sugar content (RSC), and extraction yield increased by about 3, 1.5, and 2 times, respectively, compared with control. The contents of p-coumaric acid, ferulic acid, and caffeic acid increased to 8, 4, and 32 times, respectively. The enzyme-aided polyphenol extraction process from unripe apples might be applied to food industry for enhancing bioactive compound production. PMID:19946955

Enhancing polyphenol extraction from unripe apples by carbohydrate-hydrolyzing enzymes.

Science.gov (United States)

Zheng, Hu-zhe; Hwang, In-Wook; Chung, Shin-Kyo

2009-12-01

The effects of process variables such as enzyme types, enzyme ratio, reaction temperature, pH, time, and ethanol concentration on the extraction of unripe apple polyphenol were investigated. The results indicated that Viscozyme L had the strongest effect on polyphenols extraction and was selected to study the polyphenol composition. The ratio of enzyme (Viscozyme L) to substrate (2 fungal beta-glucanase units (FBG)) at 0.02, reaction at pH 3.7, 50 degrees C for 12 h, and ethanol concentration of 70% were chosen as the most favorable extraction condition. Total phenolic content (TPC), reducing sugar content (RSC), and extraction yield increased by about 3, 1.5, and 2 times, respectively, compared with control. The contents of p-coumaric acid, ferulic acid, and caffeic acid increased to 8, 4, and 32 times, respectively. The enzyme-aided polyphenol extraction process from unripe apples might be applied to food industry for enhancing bioactive compound production.

Sensorial properties of red wine polyphenols: Astringency and bitterness.

Science.gov (United States)

Soares, Susana; Brandão, Elsa; Mateus, Nuno; de Freitas, Victor

2017-03-24

Polyphenols have been the subject of numerous research over the past years, being referred as the nutraceuticals of modern life. The healthy properties of these compounds have been associated to a natural chemoprevention of 21st century major diseases such as cancer and neurodegenerative diseases (e.g. Parkinson's and Alzheimer's). This association led to an increased consumption of foodstuffs rich in these compounds such as red wine. Related to the ingestion of polyphenols are the herein revised sensorial properties (astringency and bitterness) which are not still pleasant. This review intends to be an outline both at a sensory as a molecular level of the mechanisms underlying astringency and bitterness of polyphenols. Up-to-date knowledge of this matter is discussed in detail.

Confirmation of a blocked amino terminus of sulfhydryl oxidase

International Nuclear Information System (INIS)

Janolino, V.G.; Morrison-Rowe, S.J.; Swaisgood, H.E.

1990-01-01

The isolation of sulfhydryl oxidase from bovine milk in a suitably pure form for sequencing was carried out by transient covalent affinity chromatography of diafiltered whey using cysteinylsuccinamidopropyl-glass as matrix. The glutathione-eluted proteins were separated by SDS-PAGE. By radiolabeling the affinity chromatography-purified enzyme with [ 14 C]iodoacetate before subjecting to SDS-PAGE, the sulfhydryl oxidase band was identified, because sulfhydryl oxidase is known to be inactivated by alkylation of one sulfhydryl group per mole. The results confirmed that sulfhydryl oxidase corresponds to the 85 (± 5)-kDa band observed on SDS-PAGE. The protein band corresponding to radiolabeled sulfhydryl oxidase was recovered from SDS-PAGE gels by electrophoretic elution and by electroblotting on polyvinylidene difluoride membrane and subjected to gas phase sequencing. Precautions were taken during electrophoretic elution to prevent reactions that result in N-terminal blocking. Both methods of protein recovery yielded negative results when subjected to sequence analysis indicating that the N-terminus of sulfhydryl oxidase is blocked

Genetical polymorphism of acc synthase and ACC oxidase in Apple selections bred in Čačak

Directory of Open Access Journals (Sweden)

Marić Slađana

2005-01-01

Full Text Available The work on breeding new apple cultivars, of improved quality and longer storage life has been going on for a long time at the Fruit and Grape Research Centre in Čačak. As a result nine promising apple selections, that show the range of fruit storage capability (J/l/7, J/l/20, J/2/12, J/2/14, J/ll/31, J/54/53/59, J/60/7/63, Šumatovka 1 O.P. and Šumatovka 2 O.P., were singled out. Fruit ripening is genetically programmed, complex physiological process with the important role of plant hormone ethylene. Allelic polymorphism of the genes encoding ACC synthase and ACC oxidase, enzymes on ethylene biosynthetic pathway, was studied in promising apple selections and compared to their storage life. Polymorphism was detected by the polymerase chain reaction (PCR method and restriction analysis with 6 restriction enzymes. Two alleles of the gene encoding ACC synthase (ACS1-1 and ACS1-2, three alleles of the ACC oxidase gene (a, b and n were identified and a positive test for early seedling selection, the fruits of which will be characterized by long storage life, was indicated.

Immobilization of oxidases and their analytical applications

International Nuclear Information System (INIS)

Yasinzai, M.

2007-01-01

Immobilized enzymes are replacing their soluble counter-parts in nearly every field of application. These enzyme modifications have evolved from a research curiosity into an entire branch of Biotechnology. An immobilization method for flavin containing oxidases and their use in flow injection system is described. An electrochemical detector for H/sub 2/O/sub 2/ is assembled which is used effectively for the determination of glucose using more common glucose oxidase and the simultaneous determination of sugars. The combination of oxidases with hydrolases have been used for the determination of maltose and starch. (author)

NADPH Oxidases: Progress and Opportunities

OpenAIRE

San Martin, Alejandra; Griendling, Kathy K.

2014-01-01

From the initial discovery in 1999 that NADPH oxidases comprise a family of enzymes to our current focus on drug development to treat multiple pathologies related to this enzyme family, progress has been swift and impressive. We have expanded our understanding of the extent of the family, the basic enzymatic biochemistry, the multiple cellular functions controlled by NADPH oxidases, and their varied roles in physiology and diseases. We have developed numerous cell culture tools, animal models...

Variability of the polyphenolic composition of cider apple (Malus domestica) fruits and juices.

Science.gov (United States)

Guyot, Sylvain; Marnet, Nathalie; Sanoner, Philippe; Drilleau, Jean-François

2003-10-08

Five French cider apple varieties were compared on the basis of their detailed polyphenol profile in the cortex and in the juices. Among the factors studied, variety was the most important variability factor in fruits, whereas polyphenol profiles showed an overall stability from one year to another, and a limited decrease of polyphenol concentration was observed during the starch regression period of fruit maturation. In juices, procyanidins remained the preponderant polyphenol class with concentrations up to 2.4 g/L even in centrifuged juices. Compared to the fruits, the average degree of polymerization of procyanidins was significantly reduced in the juice. Centrifugation of the crude juice had only minor effects on the polyphenol composition. For one variety, highly polymerized procyanidins with average degrees of polymerization of 25 were shown to be soluble in the centrifuged juice at a concentration of close to 1.2 g/L. Oxygenation of the juices during processing resulted in a significant decrease of all classes of native polyphenols. Catechins and procyanidins were particularly affected by oxidation, whereas caffeoylquinic acid was partly preserved. The transfer of polyphenols after pressing was maximal for dihydrochalcones and minimal for procyanidins with extraction yield values close to 80 and 30%, respectively.

[The regulation of peroxisomal matrix enzymes (alcohol oxidase and catalase) formation by the product of the gene Mth1 in methylotrophic yeast Pichia methanolica].

Science.gov (United States)

Leonovich, O A; Kurales, Iu A; Dutova, T A; Isakova, E P; Deriabina, Iu I; Rabinovich, Ia M

2009-01-01

Two independent mutant strains of methylotrophic yeast Pichia methanolica (mth1 arg1 and mth2 arg4) from the initial line 616 (ade1 ade5) were investigated. The mutant strains possessed defects in genes MTH1 and MTH2 which resulted in the inability to assimilate methanol as a sole carbon source and the increased activity of alcohol oxidase (AO). The function of the AUG2 gene encoding one of the subunits of AO and CTA1, a probable homolog of peroxisomal catalase of Saccharomyces cereviseae, was investigated by analyses of the molecular forms of isoenzymes. It was shown that optimal conditions for the expression of the AUG2 gene on a medium supplemented with 3% of methanol leads to an increasing synthesis of peroxisomal catalase. The mutant mth1 possessed a dominant formation of AO isoform with electrophoretic mobility which is typical for isogenic form 9, the product of the AUG2 gene, and a decreased level of peroxisomal catalase. The restoration of growth of four spontaneous revertants of the mutant mth1 (Rmth1) on the methanol containing medium was accompanied by an increase in activity of AO isogenic form 9 and peroxisomal catalase. The obtained results confirmed the functional continuity of the structural gene AUG2 in mutant mth1. The correlation of activity of peroxisomal catalase and AO isogenic form 1 in different conditions evidenced the existence of common regulatory elements for genes AUG2 and CTA1 in methilotrophic yeast Pichia methanolica.

Polyphenol-aluminum complex formation: Implications for aluminum tolerance in plants

Science.gov (United States)

Natural polyphenols may play an important role in aluminum detoxification in some plants. We examined the interaction between Al3+ and the purified high molecular weight polyphenols pentagalloyl glucose (940 Da) and oenothein B (1568 Da), and the related compound methyl gallate (184 Da) at pH 4 and ...

Cellular Targets of Dietary Polyphenol Resveratrol

National Research Council Canada - National Science Library

Wu, Joseph M

2006-01-01

To test the hypothesis that resveratrol, a grape derived polyphenol, exerts its chemopreventive properties against prostate cancer by interacting with specific cellular targets, denoted resveratrol targeting proteins (RTPs...

Hormonal effect on polyphenol accumulation in Cassia tissues cultured in vitro

Energy Technology Data Exchange (ETDEWEB)

Shah, R R; Subbaiah, K V; Mehta, A R

1976-06-01

Effects of auxin and kinetin on growth and production of phenolic compounds in cultured Cassia fistula L. tissues were examined. Initiation of polyphenols was largely determined by the auxin concentration in the medium. Growth of the cells in relation to accumulation of polyphenols was studied at different auxin and kinetin concentrations. The accumulation of phenolic materials was essentially restricted to the most rapid phase of the growth cycle. Progressive changes in the pattern of peroxidase activity were followed and their relationship with polyphenol synthesis is examined.

Polyphenols: Benefits to the Cardiovascular System in Health and in Aging

Directory of Open Access Journals (Sweden)

Sandhya Khurana

2013-09-01

Full Text Available Numerous studies have demonstrated the importance of naturally occurring dietary polyphenols in promoting cardiovascular health and emphasized the significant role these compounds play in limiting the effects of cellular aging. Polyphenols such as resveratrol, epigallocatechin gallate (EGCG, and curcumin have been acknowledged for having beneficial effects on cardiovascular health, while some have also been shown to be protective in aging. This review highlights the literature surrounding this topic on the prominently studied and documented polyphenols as pertaining to cardiovascular health and aging.

Confirmation of Two Sibling Species among Anopheles fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene.

Science.gov (United States)

Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan

2012-12-01

Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

Partial protoporphyrinogen oxidase (PPOX gene deletions, due to different Alu-mediated mechanisms, identified by MLPA analysis in patients with variegate porphyria

Directory of Open Access Journals (Sweden)

Barbaro Michela

2013-01-01

Full Text Available Abstract Variegate porphyria (VP is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis. One deletion affects exon 5 and 6 (c.339-197_616+320del1099 and has been identified in four families, most probably after a founder effect. The other extends from exon 5 to exon 9 (c.339-350_987+229del2609 and was found in one family. We show that both deletions are mediated by Alu repeats. Our findings emphasize the usefulness of MLPA analysis as a complement to PPOX gene sequencing analysis for comprehensive genetic diagnostics in patients with VP.

Polyphenols in foods are more complex than often thought.

Science.gov (United States)

Cheynier, Véronique

2005-01-01

Dietary polyphenols show a great diversity of structures, ranging from rather simple molecules (monomers and oligomers) to polymers. Higher-molecular-weight structures (with molecular weights of > 500) are usually designated as tannins, which refers to their ability to interact with proteins. Among them, condensed tannins (proanthocyanidins) are particularly important because of their wide distribution in plants and their contributions to major food qualities. All phenolic compounds are highly unstable and rapidly transformed into various reaction products when the plant cells are damaged (for instance, during food processing), thus adding to the complexity of dietary polyphenol composition. The polyphenol composition of plant-derived foods and beverages depends on that of the raw material used but also on the extraction process and subsequent biochemical and chemical reactions of plant polyphenols. The occurrence of specific tannin-like compounds (ie, thearubigins and theaflavins) arising from enzymatic oxidation is well documented in black tea. Various chemical reactions involving anthocyanins and/or flavanols have been demonstrated to occur during red wine aging. Current knowledge regarding the reaction mechanisms involved in some of these processes and the structures of the resulting products is reviewed. Their effects on organoleptic and nutritional quality are also discussed.

Hypertension, nitric oxide, oxidants, and dietary plant polyphenols.

Science.gov (United States)

Galleano, Monica; Pechanova, Olga; Fraga, Cesar G

2010-12-01

Fruits and vegetables are key foods whose high ingestion is associated with the improvement of numerous pathological conditions, including hypertension. Such health promoting actions have been increasingly ascribed to the antioxidant characteristics of different polyphenols in fruits and vegetables. Consequently, based on this assumption, many beverages and foods rich in polyphenols, grape, tea, cocoa, and soy products and many of their chemical constituents purified, are being studied both, as antioxidants and antihypertensive agents. This paper reviews the current evidence linking high polyphenol consumption with reductions in blood pressure. Basic chemical aspects of flavanols, flavonols, isoflavones and stilbenes, as possible responsible for the observed effects of those foods on blood pressure are included. Human interventions studies by using grapes and wine, cocoa and chocolate, black and green tea, soy products, and purified compounds ((+)-catequin, quercetin, (-)-epigallocatechin gallate) are summarized. The discussed hypothesis, strongly supported by experimental data in animals, is that by regulating nitric oxide bioavailability, polyphenols present in fruits and vegetables affect endothelial function and as a consequence, blood pressure. Even when data are not definitive and many questions remain open, the whole evidence is encouraging to start considering diets that can provide a benefit to hypertensive subjects, and those benefits will be more significant in people that do not have controlled his/her elevated blood pressure.

NADPH oxidase is not an essential mediator of oxidative stress or liver injury in murine MCD diet-induced steatohepatitis.

Science.gov (United States)

dela Peña, Aileen; Leclercq, Isabelle A; Williams, Jacqueline; Farrell, Geoffrey C

2007-02-01

Hepatic oxidative stress is a key feature of metabolic forms of steatohepatitis, but the sources of pro-oxidants are unclear. The NADPH oxidase complex is critical for ROS generation in inflammatory cells; loss of any one component (e.g., gp91phox) renders NADPH oxidase inactive. We tested whether activated inflammatory cells contribute to oxidant stress in steatohepatitis. gp91phox-/- and wildtype (wt) mice were fed a methionine and choline-deficient (MCD) diet. Serum ALT, hepatic triglycerides, histopathology, lipid peroxidation, activation of NF-kappaB, expression of NF-kappaB-regulated genes and macrophage chemokines were measured. After 10 days of MCD dietary feeding, gp91phox-/- and wt mice displayed equivalent hepatocellular injury. After 8 weeks, there were fewer activated macrophages in livers of gp91phox-/- mice than controls, despite similar mRNA levels for MCP and MIP chemokines, but fibrosis was similar. NF-kappaB activation and increased expression of ICAM-1, TNF-alpha and COX-2 mRNA were evident in both genotypes, but in gp91phox-/- mice, expression of these genes was confined to hepatocytes. A functional NADPH oxidase complex does not contribute importantly to oxidative stress in this model and therefore is not obligatory for induction or perpetuation of dietary steatohepatitis.

Optimization of Conditions for Extraction of Polyphenols and the Determination of the Impact of Cooking on Total Polyphenolic, Antioxidant, and Anticholinesterase Activities of Potato

Science.gov (United States)

Laib, Imen; Barkat, Malika

2018-01-01

In this work we optimized the cooking and extraction conditions for obtaining high yields of total polyphenols from potato and studied the effect of three domestic methods of cooking on total phenols, antioxidant activity, and anticholinesterase activities. The optimization of the experiment was carried out by the experimental designs. The extraction of the polyphenols was carried out by maceration and ultrasonication. Determination of the polyphenols was performed by using the Folin-Ciocalteau reagent method. The antioxidant activity was evaluated by three methods: 1,1-diphenyl-2-picryl-hydrazyl (DPPH), 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), and CUPRAC(Cupric reducing antioxidant capacity), the anticholinesterase activity was evaluated by the method of Elmann. The optimum of total phenolic obtained was: 4.668 × 104, 1.406 × 104, 3357.009, 16,208.99 µg Gallic Acid Equivalent (GAE)/g of dry extract for crude potato, steamed potatoes, in boiling water, and by microwave, respectively. The three modes of cooking cause a decrease in the total polyphenol contents, antioxidant and anticholinesterase activities. PMID:29522482

An HPLC-MS analysis of phenolic antioxidants in banana peel

Science.gov (United States)

Banana peels are rich in many nutrients which allow for their use as food ingredients and biofertilizers in tropical agriculture. The phenomenon of rapid peel browning is a common occurrence, and is attributable to the peel’s high polyphenol oxidase activity and high concentrations of polyphenols. ...

Involvement of NADH Oxidase in Competition and Endocarditis Virulence in Streptococcus sanguinis.

Science.gov (United States)

Ge, Xiuchun; Yu, Yang; Zhang, Min; Chen, Lei; Chen, Weihua; Elrami, Fadi; Kong, Fanxiang; Kitten, Todd; Xu, Ping

2016-05-01

Here, we report for the first time that the Streptococcus sanguinis nox gene encoding NADH oxidase is involved in both competition with Streptococcus mutans and virulence for infective endocarditis. An S. sanguinis nox mutant was found to fail to inhibit the growth of Streptococcus mutans under microaerobic conditions. In the presence of oxygen, the recombinant Nox protein of S. sanguinis could reduce oxygen to water and oxidize NADH to NAD(+) The oxidation of NADH to NAD(+) was diminished in the nox mutant. The nox mutant exhibited decreased levels of extracellular H2O2; however, the intracellular level of H2O2 in the mutant was increased. Furthermore, the virulence of the nox mutant was attenuated in a rabbit endocarditis model. The nox mutant also was shown to be more sensitive to blood killing, oxidative and acid stresses, and reduced growth in serum. Thus, NADH oxidase contributes to multiple phenotypes related to competitiveness in the oral cavity and systemic virulence. Copyright © 2016 Ge et al.

Antioxidant activity and nutrient release from polyphenol-enriched cheese in a simulated gastrointestinal environment.

Science.gov (United States)

Lamothe, Sophie; Langlois, Ariane; Bazinet, Laurent; Couillard, Charles; Britten, Michel

2016-03-01

Green tea polyphenols are recognized for their antioxidant properties and their effects on lipid digestion kinetics. Polyphenols are sensitive to degradation in the intestinal environment. Interactions with dairy proteins could modulate the stability and biological activity of polyphenols during digestion. The objective of this study was to evaluate the release of nutrients (polyphenols, fatty acids and peptides) and the antioxidant activity in polyphenol-enriched cheese containing different levels of calcium in a simulated gastrointestinal environment. The relationship between cheese matrix texture, matrix degradation and nutrient release during digestion was also studied. Green tea extract was added to milk at 0% or 0.1%, and cheeses were produced on a laboratory scale. The level of available calcium was adjusted to low (Ca(low)), regular (Ca(reg)) or high (Ca(high)) during the salting step of the cheese-making process. Cheeses were subjected to simulated digestion. The rate and extent of fatty acid release were 21% lower for Ca(low) cheese than for Ca(reg) and Ca(high) cheeses. The greater adhesiveness of Ca(low) cheese, which resulted in lower rates of matrix degradation and proteolysis, contributed to the reduced rate of lipolysis. The presence of green tea extract in cheese reduced the release of free fatty acids at the end of digestion by 7%. The addition of green tea extract increased cheese hardness but did not influence matrix degradation or proteolysis profiles. The formation of complexes between tea polyphenols and proteins within the cheese matrix resulted in a more than twofold increase in polyphenol recovery in the intestinal phase compared with the control (tea polyphenol extract incubated with polyphenol-free cheese). Antioxidant activity was 14% higher in the digest from polyphenol-enriched cheese than in the control. These results suggest that cheese is an effective matrix for the controlled release of nutrients and for the protection of green

A polyphenol-enriched diet and Ascaris suum infection modulate mucosal immune responses and gut microbiota composition in pigs.

Directory of Open Access Journals (Sweden)

Andrew R Williams

Full Text Available Polyphenols are a class of bioactive plant secondary metabolites that are thought to have beneficial effects on gut health, such as modulation of mucosal immune and inflammatory responses and regulation of parasite burdens. Here, we examined the interactions between a polyphenol-rich diet supplement and infection with the enteric nematode Ascaris suum in pigs. Pigs were fed either a basal diet or the same diet supplemented with grape pomace (GP, an industrial by-product rich in polyphenols such as oligomeric proanthocyanidins. Half of the animals in each group were then inoculated with A. suum for 14 days to assess parasite establishment, acquisition of local and systemic immune responses and effects on the gut microbiome. Despite in vitro anthelmintic activity of GP-extracts, numbers of parasite larvae in the intestine were not altered by GP-supplementation. However, the bioactive diet significantly increased numbers of eosinophils induced by A. suum infection in the duodenum, jejunum and ileum, and modulated gene expression in the jejunal mucosa of infected pigs. Both GP-supplementation and A. suum infection induced significant and apparently similar changes in the composition of the prokaryotic gut microbiota, and both also decreased concentrations of isobutyric and isovaleric acid (branched-chain short chain fatty acids in the colon. Our results demonstrate that while a polyphenol-enriched diet in pigs may not directly influence A. suum establishment, it significantly modulates the subsequent host response to helminth infection. Our results suggest an influence of diet on immune function which may potentially be exploited to enhance immunity to helminths.

Modulation of NADPH oxidase activity by known uraemic retention solutes

DEFF Research Database (Denmark)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera

2014-01-01

chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. RESULTS: Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized......BACKGROUND: Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased...... inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. METHODS: Mononuclear leucocytes...

The influence of virus diseases on grape polyphenols of cv. 'Refosk'

International Nuclear Information System (INIS)

Tomazic, I.; Vrhovsek, U.; Korosec-Koruza, Z.

2003-01-01

External stimuli such as microbial infections, ultraviolet radiation, and chemical stressors can modulate the synthesis of polyphenols in the plants. Cv. 'Refosk' was used to show the influence of the GLRaV-1 and rugose wood (RW) on the polyphenols in grape. The infection shifted polyphenols from seeds to grape skins but had no impact on anthocyanins

Gravity Responsive NADH Oxidase of the Plasma Membrane

Science.gov (United States)

Morre, D. James (Inventor)

2002-01-01

A method and apparatus for sensing gravity using an NADH oxidase of the plasma membrane which has been found to respond to unit gravity and low centrifugal g forces. The oxidation rate of NADH supplied to the NADH oxidase is measured and translated to represent the relative gravitational force exerted on the protein. The NADH oxidase of the plasma membrane may be obtained from plant or animal sources or may be produced recombinantly.

Hibiscus sabdariffa leaf polyphenolic extract induces human melanoma cell death, apoptosis, and autophagy.

Science.gov (United States)

Chiu, Chun-Tang; Hsuan, Shu-Wen; Lin, Hui-Hsuan; Hsu, Cheng-Chin; Chou, Fen-Pi; Chen, Jing-Hsien

2015-03-01

Melanoma is the least common but most fatal form of skin cancer. Previous studies have indicated that an aqueous extract of Hibiscus sabdariffa leaves possess hypoglycemic, hypolipidemic, and antioxidant effects. In this study, we want to investigate the anticancer activity of Hibiscus leaf polyphenolic (HLP) extract in melanoma cells. First, HLP was exhibited to be rich in epicatechin gallate (ECG) and other polyphenols. Apoptotic and autophagic activities of HLP and ECG were further evaluated by DAPI stain, cell-cycle analysis, and acidic vascular organelle (AVO) stain. Our results revealed that both HLP and ECG induced the caspases cleavages, Bcl-2 family proteins regulation, and Fas/FasL activation in A375 cells. In addition, we also revealed that the cells presented AVO-positive after HLP treatments. HLP could increase the expressions of autophagy-related proteins autophagy-related gene 5 (ATG5), Beclin1, and light chain 3-II (LC3-II), and induce autophagic cell death in A375 cells. These data indicated that the anticancer effect of HLP, partly contributed by ECG, in A375 cells. HLP potentially could be developed as an antimelanoma agent. © 2015 Institute of Food Technologists®

Phytochemical Composition, Antioxidant and Xanthine Oxidase Inhibitory Activities of Amaranthus cruentus L. and Amaranthus hybridus L. Extracts

Directory of Open Access Journals (Sweden)

Jeanne F. Millogo

2012-06-01

Full Text Available This paper describes a preliminary assessment of the nutraceutical value of Amaranthus cruentus (A. cruentus and Amaranthus hybridus (A. hybridus, two food plant species found in Burkina Faso. Hydroacetonic (HAE, methanolic (ME, and aqueous extracts (AE from the aerial parts were screened for in vitro antioxidant and xanthine oxidase inhibitory activities. Phytochemical analyses revealed the presence of polyphenols, tannins, flavonoids, steroids, terpenoids, saponins and betalains. Hydroacetonic extracts have shown the most diversity for secondary metabolites. The TLC analyses of flavonoids from HAE extracts showed the presence of rutin and other unidentified compounds. The phenolic compound contents of the HAE, ME and AE extracts were determined using the Folin–Ciocalteu method and ranged from 7.55 to 10.18 mg Gallic acid equivalent GAE/100 mg. Tannins, flavonoids, and flavonols ranged from 2.83 to 10.17 mg tannic acid equivalent (TAE/100 mg, 0.37 to 7.06 mg quercetin equivalent (QE /100 mg, and 0.09 to 1.31 mg QE/100 mg, respectively. The betacyanin contents were 40.42 and 6.35 mg Amaranthin Equivalent/100 g aerial parts (dry weight in A. cruentus and A. hybridus, respectively. Free-radical scavenging activity expressed as IC₅₀ (DPPH method and iron reducing power (FRAP method ranged from 56 to 423 µg/mL and from 2.26 to 2.56 mmol AAE/g, respectively. Xanthine oxidase inhibitory activities of extracts of A. cruentus and A. hybridus were 3.18% and 38.22%, respectively. The A. hybridus extract showed the best antioxidant and xanthine oxidase inhibition activities. The results indicated that the phytochemical contents of the two species justify their traditional uses as nutraceutical food plants.

Cotton Ascorbate Oxidase Promotes Cell Growth in Cultured Tobacco Bright Yellow-2 Cells through Generation of Apoplast Oxidation

Science.gov (United States)

Li, Rong; Xin, Shan; Tao, Chengcheng; Jin, Xiang; Li, Hongbin

2017-01-01

Ascorbate oxidase (AO) plays an important role in cell growth through the modulation of reduction/oxidation (redox) control of the apoplast. Here, a cotton (Gossypium hirsutum) apoplastic ascorbate oxidase gene (GhAO1) was obtained from fast elongating fiber tissues. GhAO1 belongs to the multicopper oxidase (MCO) family and includes a signal peptide and several transmembrane regions. Analyses of quantitative real-time polymerase chain reaction (QRT-PCR) and enzyme activity showed that GhAO1 was expressed abundantly in 15-day post-anthesis (dpa) wild-type (WT) fibers in comparison with fuzzless-lintless (fl) mutant ovules. Subcellular distribution analysis in onion cells demonstrated that GhAO1 is localized in the cell wall. In transgenic tobacco bright yellow-2 (BY-2) cells with ectopic overexpression of GhAO1, the enhancement of cell growth with 1.52-fold increase in length versus controls was indicated, as well as the enrichment of both total ascorbate in whole-cells and dehydroascorbate acid (DHA) in apoplasts. In addition, promoted activities of AO and monodehydroascorbate reductase (MDAR) in apoplasts and dehydroascorbate reductase (DHAR) in whole-cells were displayed in transgenic tobacco BY-2 cells. Accumulation of H2O2, and influenced expressions of Ca2+ channel genes with the activation of NtMPK9 and NtCPK5 and the suppression of NtTPC1B were also demonstrated in transgenic tobacco BY-2 cells. Finally, significant induced expression of the tobacco NtAO gene in WT BY-2 cells under indole-3-acetic acid (IAA) treatment appeared; however, the sensitivity of the NtAO gene expression to IAA disappeared in transgenic BY-2 cells, revealing that the regulated expression of the AO gene is under the control of IAA. Taken together, these results provide evidence that GhAO1 plays an important role in fiber cell elongation and may promote cell growth by generating the oxidation of apoplasts, via the auxin-mediated signaling pathway. PMID:28644407

Data on cytochrome c oxidase assembly in mice and human fibroblasts or tissues induced by SURF1 defect

Directory of Open Access Journals (Sweden)

Nikola Kovářová

2016-06-01

Full Text Available This paper describes data related to a research article entitled “Tissue- and species-specific differences in cytochrome c oxidase assembly induced by SURF1 defects” [1]. This paper includes data of the quantitative analysis of individual forms of respiratory chain complexes I, III and IV present in SURF1 knockout (SURF1−/− and control (SURF1+/+ mouse fibroblasts and tissues and in fibroblasts of human control and patients with SURF1 gene mutation. Also it includes data demonstrating response of complex IV, cytochrome c oxidase (COX, to reversible inhibition of mitochondrial translation in SURF1−/− mouse and SURF1 patient fibroblast cell lines.

The conserved baculovirus protein p33 (Ac92) is a flavin adenine dinucleotide-linked sulfhydryl oxidase

International Nuclear Information System (INIS)

Long, C.M.; Rohrmann, G.F.; Merrill, G.F.

2009-01-01

Open reading frame 92 of the Autographa californica baculovirus (Ac92) is one of about 30 core genes present in all sequenced baculovirus genomes. Computer analyses predicted that the Ac92 encoded protein (called p33) and several of its baculovirus orthologs were related to a family of flavin adenine dinucleotide (FAD)-linked sulfhydryl oxidases. Alignment of these proteins indicated that, although they were highly diverse, a number of amino acids in common with the Erv1p/Alrp family of sulfhydryl oxidases are present. Some of these conserved amino acids are predicted to stack against the isoalloxazine and adenine components of FAD, whereas others are involved in electron transfer. To investigate this relationship, Ac92 was expressed in bacteria as a His-tagged fusion protein, purified, and characterized both spectrophotometrically and for its enzymatic activity. The purified protein was found to have the color (yellow) and absorption spectrum consistent with it being a FAD-containing protein. Furthermore, it was demonstrated to have sulfhydryl oxidase activity using dithiothreitol and thioredoxin as substrates.

Skin photoprotection by natural polyphenols: Anti-inflammatory, anti-oxidant and DNA repair mechanisms

Science.gov (United States)

Nichols, Joi A.; Katiyar, Santosh K.

2009-01-01

Epidemiological, clinical and laboratory studies have implicated solar ultraviolet (UV) radiation in various skin diseases including premature aging of the skin and melanoma and nonmelanoma skin cancers. Chronic UV radiation exposure-induced skin diseases or skin disorders are caused by the excessive induction of inflammation, oxidative stress and DNA damage, etc.. The use of chemopreventive agents, such as plant polyphenols, to inhibit these events in UV-exposed skin is gaining attention. Chemoprevention refers to the use of agents that can inhibit, reverse, or retard the process of these harmful events in the UV-exposed skin. A wide variety of polyphenols or phytochemicals, most of which are dietary supplements, have been reported to possess substantial skin photoprotective effects. This review article summarizes the photoprotective effects of some selected polyphenols, such as green tea polyphenols, grape seed proanthocyanidins, resveratrol, silymarin and genistein, on UV-induced skin inflammation, oxidative stress, and DNA damage, etc., with a focus on mechanisms underlying the photoprotective effects of these polyphenols. The laboratory studies conducted in animal models, suggest that these polyphenols have the ability to protect the skin from the adverse effects of UV radiation, including the risk of skin cancers. It is suggested that polyphenols may favorably supplement sunscreens protection, and may be useful for skin diseases associated with solar UV radiation-induced inflammation, oxidative stress and DNA damage. PMID:19898857

Cyanobacterial Lactate Oxidases Serve as Essential Partners in N2 Fixation and Evolved into Photorespiratory Glycolate Oxidases in Plants[w

Science.gov (United States)

Hackenberg, Claudia; Kern, Ramona; Hüge, Jan; Stal, Lucas J.; Tsuji, Yoshinori; Kopka, Joachim; Shiraiwa, Yoshihiro; Bauwe, Hermann; Hagemann, Martin

2011-01-01

Glycolate oxidase (GOX) is an essential enzyme involved in photorespiratory metabolism in plants. In cyanobacteria and green algae, the corresponding reaction is catalyzed by glycolate dehydrogenases (GlcD). The genomes of N2-fixing cyanobacteria, such as Nostoc PCC 7120 and green algae, appear to harbor genes for both GlcD and GOX proteins. The GOX-like proteins from Nostoc (No-LOX) and from Chlamydomonas reinhardtii showed high l-lactate oxidase (LOX) and low GOX activities, whereas glycolate was the preferred substrate of the phylogenetically related At-GOX2 from Arabidopsis thaliana. Changing the active site of No-LOX to that of At-GOX2 by site-specific mutagenesis reversed the LOX/GOX activity ratio of No-LOX. Despite its low GOX activity, No-LOX overexpression decreased the accumulation of toxic glycolate in a cyanobacterial photorespiratory mutant and restored its ability to grow in air. A LOX-deficient Nostoc mutant grew normally in nitrate-containing medium but died under N2-fixing conditions. Cultivation under low oxygen rescued this lethal phenotype, indicating that N2 fixation was more sensitive to O2 in the Δlox Nostoc mutant than in the wild type. We propose that LOX primarily serves as an O2-scavenging enzyme to protect nitrogenase in extant N2-fixing cyanobacteria, whereas in plants it has evolved into GOX, responsible for glycolate oxidation during photorespiration. PMID:21828292

Mass spectrometry in grape and wine chemistry. Part I: polyphenols.

Science.gov (United States)

Flamini, Riccardo

2003-01-01

Mass spectrometry, had and still has, a very important role for research and quality control in the viticulture and enology field, and its analytical power is relevant for structural studies on aroma and polyphenolic compounds. Polyphenols are responsible for the taste and color of wine, and confer astringency and structure to the beverage. The knowledge of the anthocyanic structure is very important to predict the aging attitude of wine, and to attempt to resolve problems about color stability. Moreover, polyphenols are the main compounds related to the benefits of wine consumption in the diet, because of their properties in the treatment of circulatory disorders such as capillary fragility, peripheral chronic venous insufficiency, and microangiopathy of the retina. Liquid Chromatography-Mass Spectrometry (LC-MS) techniques are nowadays the best analytical approach to study polyphenols in grape extracts and wine, and are the most effective tool in the study of the structure of anthocyanins. The MS/MS approach is a very powerful tool that permits anthocyanin aglycone and sugar moiety characterization. LC-MS allows the characterization of complex structures of grape polyphenols, such as procyanidins, proanthocyanidins, prodelphinidins, and tannins, and provides experimental evidence for structures that were previously only hypothesized. The matrix-assisted-laser-desorption-ionization-time-of-flight (MALDI-TOF) technique is suitable to determine the presence of molecules of higher molecular weight with high accuracy, and it has been applied with success to study procyanidin oligomers up to heptamers in the reflectron mode, and up to nonamers in the linear mode. The levels of resveratrol in wine, an important polyphenol well-known for its beneficial effects, have been determined by SPME and LC-MS, and the former approach led to the best results in terms of sensitivity. Copyright 2003 Wiley Periodicals, Inc.

A catechol oxidase AcPPO from cherimoya (Annona cherimola Mill.) is localized to the Golgi apparatus.

Science.gov (United States)

Olmedo, Patricio; Moreno, Adrián A; Sanhueza, Dayan; Balic, Iván; Silva-Sanzana, Christian; Zepeda, Baltasar; Verdonk, Julian C; Arriagada, César; Meneses, Claudio; Campos-Vargas, Reinaldo

2018-01-01

Cherimoya (Annona cherimola) is an exotic fruit with attractive organoleptic characteristics. However, it is highly perishable and susceptible to postharvest browning. In fresh fruit, browning is primarily caused by the polyphenol oxidase (PPO) enzyme catalyzing the oxidation of o-diphenols to quinones, which polymerize to form brown melanin pigment. There is no consensus in the literature regarding a specific role of PPO, and its subcellular localization in different plant species is mainly described within plastids. The present work determined the subcellular localization of a PPO protein from cherimoya (AcPPO). The obtained results revealed that the AcPPO- green fluorescent protein co-localized with a Golgi apparatus marker, and AcPPO activity was present in Golgi apparatus-enriched fractions. Likewise, transient expression assays revealed that AcPPO remained active in Golgi apparatus-enriched fractions obtained from tobacco leaves. These results suggest a putative function of AcPPO in the Golgi apparatus of cherimoya, providing new perspectives on PPO functionality in the secretory pathway, its effects on cherimoya physiology, and the evolution of this enzyme. Copyright © 2017. Published by Elsevier B.V.

Selective methods for polyphenols and sulphur dioxide determination in wines.

Science.gov (United States)

García-Guzmán, Juan J; Hernández-Artiga, María P; Palacios-Ponce de León, Lourdes; Bellido-Milla, Dolores

2015-09-01

A critical review to the methods recommended by international bodies and widely used in the winery industry and research studies was performed. A Laccase biosensor was applied to the selective determination of polyphenols in wines. The biosensor response was characterised and it responds mainly to o-diphenols which are the principal polyphenols responsible for the stability and sensory qualities of wines. The spectrophotometric method to determine free and total sulphur dioxide recommended for beers was applied directly to wines. A sampling of 14 red and white wines was performed and they were analysed for biosensor polyphenol index (IBP) and sulphur dioxide concentration (SO2). The antioxidant capacity by the ABTS(+) spectrophotometric method was also determined. A correlation study was performed to elucidate the influence of the polyphenols and SO2 on the wines stability. High correlations were found between IBP and antioxidant capacity and low correlation between SO2 and antioxidant capacity. To evaluate the benefits of wine drinking a new parameter (IBP/SO2) is proposed. Copyright © 2015 Elsevier Ltd. All rights reserved.

Calcium transport in vesicles energized by cytochrome oxidase

Energy Technology Data Exchange (ETDEWEB)

Rosier, Randy N. [Univ. of Rochester, NY (United States)

1979-01-01

Experiments on the reconstitution of cytochrome oxidase into phospholipid vesicles were carried out using techniques of selectivity energizing the suspensions with ascorbate and cytochrome c or ascorbate, PMS, and internally trapped cytochrome c. It was found that the K⁺ selective ionophore valinomycin stimulated the rate of respiration of cytochrome oxidase vesicles regardless of the direction of the K⁺ flux across the vesicle membranes. The stimulation occurred in the presence of protonophoric uncouplers and in the complete absence of potassium or in detergent-lysed suspensions. Gramicidin had similar effects and it was determined that the ionophores acted by specific interaction with cytochrome oxidase rather than by the previously assumed collapse of membrane potentials. When hydrophobic proteins and appropriate coupling factors were incorporated into the cytochrome oxidase, vesicles phosphorylation of ADP could be coupled to the oxidation reaction of cytochrome oxidase. Relatively low P:O, representing poor coupling of the system, were problematical and precluded measurements of protonmotive force. However the system was used to study ion translocation.

Beer Polyphenols and Menopause: Effects and Mechanisms—A Review of Current Knowledge

Science.gov (United States)

Sandoval-Ramírez, Berner Andrée; M. Lamuela-Raventós, Rosa; Estruch, Ramon; Sasot, Gemma; Doménech, Monica

2017-01-01

Beer is one of the most frequently consumed fermented beverages in the world, and it has been part of the human diet for thousands of years. Scientific evidence obtained from the development of new techniques of food analysis over the last two decades suggests that polyphenol intake derived from moderate beer consumption may play a positive role in different health outcomes including osteoporosis and cardiovascular risk and the relief of vasomotor symptoms, which are commonly experienced during menopause and are an important reason why women seek medical care during this period; here, we review the current knowledge regarding moderate beer consumption and its possible effects on menopausal symptoms. The effect of polyphenol intake on vasomotor symptoms in menopause may be driven by the direct interaction of the phenolic compounds present in beer, such as 8-prenylnaringenin, 6-prenylnaringenin, and isoxanthohumol, with intracellular estrogen receptors that leads to the modulation of gene expression, increase in sex hormone plasma concentrations, and thus modulation of physiological hormone imbalance in menopausal women. Since traditional hormone replacement therapies increase health risks, alternative, safer treatment options are needed to alleviate menopausal symptoms in women. The present work aims to review the current data on this subject. PMID:28904736

Antidepressant-like effects of a cocoa polyphenolic extract in Wistar-Unilever rats.

Science.gov (United States)

Messaoudi, Michaël; Bisson, Jean-François; Nejdi, Amine; Rozan, Pascale; Javelot, Hervé

2008-12-01

Depression is a major public health problem affecting about 12% of the world population. Drugs exist but they have many side effects. In the last few years, natural substances (e.g. flavonoids) have been tested to cure such disorders. Cocoa polyphenolic extract is a complex compound prepared from non-roasted cocoa beans containing high levels of flavonoids. The antidepressant-like effect of cocoa polyphenolic extract was evaluated using the forced swimming test in rats. Cocoa polyphenolic extract significantly reduced the duration of immobility at both doses of 24 mg/kg/14 days and 48 mg/kg/14 days, although no change of motor dysfunction was observed with the two doses tested in the open field. The results of the forced swimming test after a subchronic treatment and after an additional locomotor activity test confirm the assumption that the antidepressant-like effect of cocoa polyphenolic extract in the forced swimming test model is specific. Further, it can be speculated that this effect might be related to its content of active polyphenols.

Antibacterial activity of polyphenolic fraction of Kombucha against Vibrio cholerae: targeting cell membrane.

Science.gov (United States)

Bhattacharya, D; Ghosh, D; Bhattacharya, S; Sarkar, S; Karmakar, P; Koley, H; Gachhui, R

2018-02-01

The present study was undertaken to determine the mechanism of antibacterial activity of a polyphenolic fraction, composed of mainly catechin and isorhamnetin, previously isolated from Kombucha, a 14-day fermented beverage of sugared black tea, against the enteropathogen Vibrio cholerae N16961. Bacterial growth was found to be seriously impaired by the polyphenolic fraction in a dose-dependent manner. Scanning Electron Microscopy demonstrated morphological alterations in bacterial cells when exposed to the polyphenolic fraction in a concentration-dependent manner. Permeabilization assays confirmed that the fraction disrupted bacterial membrane integrity in both time- and dose-dependent manners, which were proportional to the production of intracellular reactive oxygen species (ROS). Furthermore, each of the polyphenols catechin and isorhamnetin showed the ability to permeate bacterial cell membranes by generating oxidative stress, thereby suggesting their role in the antibacterial potential of Kombucha. Thus, the basic mechanism of antibacterial activity of the Kombucha polyphenolic fraction against V. cholerae involved bacterial membrane permeabilization and morphological changes, which might be due to the generation of intracellular ROS. To the best of our knowledge, this is the first report on the investigation of antibacterial mechanism of Kombucha, which is mostly attributed to its polyphenolic content. The emergence of multidrug-resistant Vibrio cholerae strains has hindered an efficient anti-Vibrio therapy. This study has demonstrated the membrane damage-mediated antibacterial mechanism of Kombucha, a popular fermented beverage of sugared tea, which is mostly attributed to its polyphenolic content. This study also implies the exploitation of Kombucha as a potential new source of bioactive polyphenols against V. cholerae. © 2017 The Society for Applied Microbiology.

Cancer Prevention by Tocopherols and Tea Polyphenols

Science.gov (United States)

Yang, Chung S.; Li, Guangxun; Yang, Zhihong; Guan, Fei; Chen, Amber; Ju, Jihyeung

2013-01-01

Tocopherols (vitamin E) and tea polyphenols have been reported to have cancer preventive activities. Large-scale human trials with high doses of alpha-tocopherol, however, have produced disappointing results. This review presents data showing that γ- and δ-tocopherols inhibit colon, lung, mammary and prostate carcinogenesis in animal models, whereas α-tocopherol is ineffective in animal and human studies. Possible mechanisms of action are discussed. A broad cancer preventive activity of green tea polyphenols has been demonstrated in animal models, and many mechanisms have been proposed. The cancer preventive activity of green tea in humans, however, has not been conclusively demonstrated and remains to be further investigated. PMID:23403075

Interaction of tea polyphenols with serum albumins: A fluorescence spectroscopic analysis

Energy Technology Data Exchange (ETDEWEB)

Bose, Adity, E-mail: adityc17j@gmail.com

2016-01-15

Interactions of some tea polyphenols, namely (−) Catechin (C), (−)-epicatechin (EC), (–) epicatechin-3-gallate (ECG), (−)-epigallocatechin (EGC) and (−)-epigallocatechin-3-gallate (EGCG) are outlined with the serum albumin proteins. These interactions had all resulted in binding with the proteins with a concomitant static quenching of the protein fluorescence. A fluorescence technique has been considered as the tool to comprehend the polyphenol–protein interactions mainly and simultaneously other spectroscopic techniques used to verify the results have been discussed. In this mini review the different types of equations usually employed to calculate the binding constant values have been outlined, namely, modified Stern Volmer plot, Scatchard plot and Lineweaver Burk equation, with their corresponding results. The n values (number of binding sites) had always been close to unity suggesting a 1:1 complexation with the polyphenols and the protein. A structural change in the polyphenols has been found to alter the binding constant value and the galloyl moiety attached to the C ring of the polyphenols have been found to play a crucial role in this regard. It has been found that an increase in galloyl moiety increases binding of the catechins with proteins. - Highlights: • Review on interactions of some tea polyphenols with the serum albumin proteins. • Tea polyphenols include Catechin, epigallocatechin-3-gallate, epigallocatechin, epicatechin-3-gallate and epicatechin. • Fluorescence spectroscopic technique is mainly outlined. • Binding constant studies have been given importance. • Galloyl moiety in the C ring is crucial in increasing binding constant.

Intake and time dependence of blueberry flavonoid-induced improvements in vascular function: a randomized, controlled, double-blind, crossover intervention study with mechanistic insights into biological activity.

Science.gov (United States)

Rodriguez-Mateos, Ana; Rendeiro, Catarina; Bergillos-Meca, Triana; Tabatabaee, Setareh; George, Trevor W; Heiss, Christian; Spencer, Jeremy Pe

2013-11-01

There are very limited data regarding the effects of blueberry flavonoid intake on vascular function in healthy humans. We investigated the impact of blueberry flavonoid intake on endothelial function in healthy men and assessed potential mechanisms of action by the assessment of circulating metabolites and neutrophil NADPH oxidase activity. Two randomized, controlled, double-blind, crossover human-intervention trials were conducted with 21 healthy men. Initially, the impact of blueberry flavonoid intake on flow-mediated dilation (FMD) and polyphenol absorption and metabolism was assessed at baseline and 1, 2, 4, and 6 h after consumption of blueberry containing 766, 1278, and 1791 mg total blueberry polyphenols or a macronutrient- and micronutrient-matched control drink (0 mg total blueberry polyphenols). Second, an intake-dependence study was conducted (from baseline to 1 h) with 319, 637, 766, 1278, and 1791 mg total blueberry polyphenols and a control. We observed a biphasic time-dependent increase in FMD, with significant increases at 1-2 and 6 h after consumption of blueberry polyphenols. No significant intake-dependence was observed between 766 and 1791 mg. However, at 1 h after consumption, FMD increased dose dependently to ≤766 mg total blueberry polyphenol intake, after which FMD plateaued. Increases in FMD were closely linked to increases in circulating metabolites and by decreases in neutrophil NADPH oxidase activity at 1-2 and 6 h. Blueberry intake acutely improves vascular function in healthy men in a time- and intake-dependent manner. These benefits may be mechanistically linked to the actions of circulating phenolic metabolites on neutrophil NADPH oxidase activity. This trial was registered at clinicaltrials.gov as NCT01292954 and NCT01829542.

Key role of alternative oxidase in lovastatin solid-state fermentation.

Science.gov (United States)

Pérez-Sánchez, Ailed; Uribe-Carvajal, Salvador; Cabrera-Orefice, Alfredo; Barrios-González, Javier

2017-10-01

Lovastatin is a commercially important secondary metabolite produced by Aspergillus terreus, either by solid-state fermentation or by submerged fermentation. In a previous work, we showed that reactive oxygen species (ROS) accumulation in idiophase positively regulates lovastatin biosynthetic genes. In addition, it has been found that lovastatin-specific production decreases with aeration in solid-state fermentation (SSF). To study this phenomenon, we determined ROS accumulation during lovastatin SSF, under high and low aeration conditions. Paradoxically, high aeration caused lower ROS accumulation, and this was the underlying reason of the aeration effect on lovastatin production. Looking for a mechanism that is lowering ROS production under those conditions, we studied alternative respiration. The alternative oxidase provides an alternative route for electrons passing through the electron transport chain to reduce oxygen. Here, we showed that an alternative oxidase (AOX) is expressed in SSF, and only during idiophase. It was shown that higher aeration induces higher alternative respiration (AOX activity), and this is a mechanism that limits ROS generation and keeps them within healthy limits and adequate signaling limits for lovastatin production. Indeed, the aox gene was induced in idiophase, i.e., at the time of ROS accumulation. Moreover, exogenous ROS (H 2 O 2 ), added to lovastatin solid-state fermentation, induced higher AOX activity. This suggests that high O 2 availability in SSF generates dangerously high ROS, so alternative respiration is induced in SSF, indirectly favoring lovastatin production. Conversely, alternative respiration was not detected in lovastatin-submerged fermentation (SmF), although exogenous ROS also induced relatively low AOX activity in SmF.

H2O2 and NADPH oxidases involve in regulation of 2-(2-phenylethyl)chromones accumulation during salt stress in Aquilaria sinensis calli.

Science.gov (United States)

Wang, Xiaohui; Dong, Xianjuan; Feng, Yingying; Liu, Xiao; Wang, Jinling; Zhang, Zhongxiu; Li, Jun; Zhao, Yunfang; Shi, Shepo; Tu, Pengfei

2018-04-01

2-(2-Phenylethyl)chromones are the main compounds responsible for the quality of agarwood, which is widely used in traditional medicines, incenses and perfumes. H 2 O 2 and NADPH oxidases (also known as respiratory burst oxidase homologs, Rbohs) mediate diverse physiological and biochemical processes in environmental stress responses. However, little is known about the function of H 2 O 2 and NADPH oxidases in 2-(2-phenylethyl)chromones accumulation. In this study, we found that salt stress induced a transient increase in content of H 2 O 2 and 2-(2-phenylethyl)chromones accumulation in Aquilaria sinensis calli. Exogenous H 2 O 2 remarkably decreased the production of 2-(2-phenylethyl)chromones, while dimethylthiourea (DMTU), a scavenger of H 2 O 2 , significantly increased 2-(2-phenylethyl)chromones accumulation in salt treated calli. Three new H 2 O 2 -generating genes, named AsRbohA-C, were isolated and characterized from A. sinensis. Salt stress also induced a transient increase in AsRbohA-C expression and NADPH oxidase activity. Furthermore, exogenous H 2 O 2 increased AsRbohA-C expression and NADPH oxidase activity, while DMTU inhibited AsRbohA-C expression and NADPH oxidase activity under salt stress. Moreover, diphenylene iodonium (DPI), the inhibitor of NADPH oxidases, reduced AsRbohA-C expression and NADPH oxidase activity, but significantly induced 2-(2-phenylethyl)chromones accumulation during salt stress. These results clearly demonstrated the central role of H 2 O 2 and NADPH oxidases in regulation of salt-induced 2-(2-phenylethyl)chromones accumulation in A. sinensis calli. Copyright © 2018 Elsevier B.V. All rights reserved.

Polyphenol oxidases in Physcomitrella: functional PPO1 knockout modulates cytokinin-dependent developmentin the moss Physcomitrella patens

Czech Academy of Sciences Publication Activity Database

Richter, H.; Lieberei, R.; Strnad, Miroslav; Novák, Ondřej; Grúz, Jiří; Rensing, S. A.; von Schwartzenberg, K.

2012-01-01

Roč. 63, č. 14 (2012), s. 5121-5135 ISSN 0022-0957 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511 Keywords : Cytokinins * gene family * gene replacement Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.242, year: 2012

Antioxidative Polyphenols from Defatted Oilseed Cakes: Effect of Solvents

Directory of Open Access Journals (Sweden)

Sue-Siang Teh

2014-02-01

Full Text Available Defatted hemp, flax and canola seed cakes were extracted with different solvent systems namely methanol, ethanol, acetone, methanol 80%, acetone 80% and mixed solvent of methanol:acetone:water (MAW, 7:7:6, v/v/v. Each extract was analyzed for antioxidant capacity using ferric reducing/antioxidant power (FRAP and 2,2-diphenyl-1-picrylhydrazyl (DPPH radical scavenging assays. MAW exhibited the highest extraction of phenolic and flavonoid contents in the seed cakes, followed by acetone 80% and methanol 80%. The antioxidant capacity was proportional to the polyphenols recovery in the extracts. Canola seed cakes possessed the highest recovery of polyphenols and antioxidant capacity, followed by hemp and flax seed cakes. MAW extract of canola contained total phenolic content, 2104.67 ± 2.52 mg GAE/100 g fresh weight; total flavonoids, 37.79 ± 0.04 mg LUE/100 g fresh weight; percentage inhibition of DPPH•, 33.03 ± 0.38%; FRAP assay, 8.78 ± 0.07 μmol Fe (II/g fresh weight. Identification of individual polyphenol compounds were performed HPLC. MAW extract of canola had the highest (P < 0.05 concentration of all individual polyphenols except gallic acid and catechin. Highest concentration of quercetin and luteolin in MAW extract of hemp was obtained among all solvent systems.

Effects of Greek legume plant extracts on xanthine oxidase, catalase and superoxide dismutase activities.

Science.gov (United States)

Spanou, Chrysoula I; Veskoukis, Aristidis S; Stagos, Dimitrios; Liadaki, Kalliopi; Aligiannis, Nectarios; Angelis, Apostolos; Skaltsounis, Alexios-Leandros; Anastasiadi, Maria; Haroutounian, Serkos A; Kouretas, Dimitrios

2012-03-01

Legumes are considered to have beneficial health implications, which have been attributed to their phytochemical content. Polyphenols are considered the most important phytochemical compounds extensively studied for their antioxidant properties. The aim of the present study was to examine the effects of potent antioxidant legume plant extracts on xanthine oxidase (XO), catalase (CAT) and superoxide dismutase (SOD) activities. XO exerts a dual role, as it is the major contributor of free radicals during exercise while it generates uric acid, the most potent antioxidant molecule in plasma. CAT and SOD are two of the main enzymes of the antioxidant defence of tissues. We demonstrate that the majority of the extracts inhibited XO activity, but they had no effect on CAT inhibition and SOD induction when used at low concentrations. These results imply that the tested extracts may be considered as possible source of novel XO inhibitors. However, we have shown that allopurinol administration, a known XO inhibitor, before exercise reduces performance and induces oxidative stress in rats. Considering the fact that the extracts examined had an inhibitory effect on XO activity, possibly posing a restriction in their characterization as antioxidants, phytochemical antioxidant administration before exercise should probably be reconsidered.

Modulation of NADPH oxidase activity by known uraemic retention solutes.

Science.gov (United States)

Schulz, Anna Marta; Terne, Cindy; Jankowski, Vera; Cohen, Gerald; Schaefer, Mandy; Boehringer, Falko; Tepel, Martin; Kunkel, Desiree; Zidek, Walter; Jankowski, Joachim

2014-08-01

Uraemia and cardiovascular disease appear to be associated with an increased oxidative burden. One of the key players in the genesis of reactive oxygen species (ROS) is nicotinamide adenine dinucleotide phosphate (NADPH) oxidase. Based on initial experiments demonstrating a decreased inhibitory effect on NADPH oxidase activity in the presence of plasma from patients with CKD-5D after dialysis compared with before dialysis, we investigated the effect of 48 known and commercially available uraemic retention solutes on the enzymatic activity of NADPH oxidase. Mononuclear leucocytes isolated from buffy coats of healthy volunteers were isolated, lysed and incubated with NADH in the presence of plasma from healthy controls and patients with CKD-5D. Furthermore, the leucocytes were lysed and incubated in the presence of uraemic retention solute of interest and diphenyleneiodonium chloride (DPI), an inhibitor of NADPH oxidase. The effect on enzymatic activity of NADPH oxidase was quantified within an incubation time of 120 min. Thirty-nine of the 48 uraemic retention solutes tested had a significant decreasing effect on NADPH oxidase activity. Oxalate has been characterized as the strongest inhibitor of NADPH oxidase (90% of DPI inhibition). Surprisingly, none of the uraemic retention solutes we investigated was found to increase NADPH oxidase activity. Furthermore, plasma from patients with CKD-5D before dialysis caused significantly higher inhibitory effect on NADPH oxidase activity compared with plasma from healthy subjects. However, this effect was significantly decreased in plasma from patients with CKD-5D after dialysis. The results of this study show that uraemic retention solutes modulated the activity of the NADPH oxidase. The results of this study might be the basis for the development of inhibitors applicable as drug in the situation of increased oxidative stress. © 2014 Stichting European Society for Clinical Investigation Journal Foundation.

Recovery of polyphenols from Pink Guava processing wastes by ultra filtration

International Nuclear Information System (INIS)

Lilis Sukeksi; Che Rosmani Che Hassan; Nik Meriam Sulaiman; Mohamed Kheireddine Aroua

2010-01-01

Full text: Processing of fruits are results in high amounts of waste material that is prone to microbial spoilage and usually represents a problem that is further aggravated by legal restrictions. Polyphenols are a wide variety of compounds that occur in pink guava fruit or others fruits and vegetables. Recovery from pink guava wastes seems to be promising in the case of polyphenols, which are of considerable interest due to their healthy and anti oxidative properties. In this work the performance of commercial tubular PVDF membrane FP 200 with nominal MWCO 200,000, was studied during pretreatment for recovery polyphenols from pink guava processing wastes. The experiments have been carried out at trans-membrane pressure of 0.5 until 2.5 Bar, and all permeate flux significantly decreased with time until a steady-state was established. The steady-state permeates flux reached a maximum at a trans-membrane pressure of about 1 bar. The first results obtained confirm the flux decline at 20 minutes was 35 % of the total flux. Meanwhile concentration of polyphenols at first step reached a steady state after 900 ml of permeate volume (47 %) and the concentration of polyphenols when the permeate volume at VCR = 4 or 3000 ml is 54 %. (author)

Polyphenols: Potential Use in the Prevention and Treatment of Cardiovascular Diseases.

Science.gov (United States)

Giglio, Rosaria Vincenza; Patti, Angelo Maria; Cicero, Arrigo F G; Lippi, Giuseppe; Rizzo, Manfredi; Toth, Peter P; Banach, Maciej

2018-01-01

Polyphenols are bioactive compounds that can be found mostly in foods like fruits, cereals, vegetables, dry legumes, chocolate and beverages such as coffee, tea and wine. They are extensively used in the prevention and treatment of cardiovascular disease (CVD) providing protection against many chronic illnesses. Their effects on human health depend on the amount consumed and on their bioavailability. Many studies have demonstrated that polyphenols have also good effects on the vascular system by lowering blood pressure, improving endothelial function, increasing antioxidant defences, inhibiting platelet aggregation and low-density lipoprotein oxidation, and reducing inflammatory responses. This review is focused on some groups of polyphenols and their effects on several cardiovascular risk factors such as hypertension, oxidative stress, atherogenesis, endothelial dysfunction, carotid artery intima-media thickness, diabetes and lipid disorders. It is proved that these compounds have many cardio protective functions: they alter hepatic cholesterol absorption, triglyceride biosynthesis and lipoprotein secretion, the processing of lipoproteins in plasma, and inflammation. In some cases, human long-term studies did not show conclusive results because they lacked in appropriate controls and in an undefined polyphenol dosing regimen. Rigorous evidence is necessary to demonstrate whether or not polyphenols beneficially impact CVD prevention and treatment. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Alternative Oxidase Transcription Factors AOD2 and AOD5 of Neurospora crassa Control the Expression of Genes Involved in Energy Production and Metabolism.

Science.gov (United States)

Qi, Zhigang; Smith, Kristina M; Bredeweg, Erin L; Bosnjak, Natasa; Freitag, Michael; Nargang, Frank E

2017-02-09

In Neurospora crassa , blocking the function of the standard mitochondrial electron transport chain results in the induction of an alternative oxidase (AOX). AOX transfers electrons directly from ubiquinol to molecular oxygen. AOX serves as a model of retrograde regulation since it is encoded by a nuclear gene that is regulated in response to signals from mitochondria. The N. crassa transcription factors AOD2 and AOD5 are necessary for the expression of the AOX gene. To gain insight into the mechanism by which these factors function, and to determine if they have roles in the expression of additional genes in N. crassa , we constructed strains expressing only tagged versions of the proteins. Cell fractionation experiments showed that both proteins are localized to the nucleus under both AOX inducing and noninducing conditions. Furthermore, chromatin immunoprecipitation and high throughput sequencing (ChIP-seq) analysis revealed that the proteins are bound to the promoter region of the AOX gene under both conditions. ChIP-seq also showed that the transcription factors bind to the upstream regions of a number of genes that are involved in energy production and metabolism. Dependence on AOD2 and AOD5 for the expression of several of these genes was verified by quantitative PCR. The majority of ChIP-seq peaks observed were enriched for both AOD2 and AOD5. However, we also observed occasional sites where one factor appeared to bind preferentially. The most striking of these was a conserved sequence that bound large amounts of AOD2 but little AOD5. This sequence was found within a 310 bp repeat unit that occurs at several locations in the genome. Copyright © 2017 Qi et al.

Real time expression of ACC oxidase and PR-protein genes mediated by Methylobacterium spp. in tomato plants challenged with Xanthomonas campestris pv. vesicatoria.

Science.gov (United States)

Yim, W J; Kim, K Y; Lee, Y W; Sundaram, S P; Lee, Y; Sa, T M

2014-07-15

Biotic stress like pathogenic infection increases ethylene biosynthesis in plants and ethylene inhibitors are known to alleviate the severity of plant disease incidence. This study aimed to reduce the bacterial spot disease incidence in tomato plants caused by Xanthomonas campestris pv. vesicatoria (XCV) by modulating stress ethylene with 1-aminocyclopropane-1-carboxylate (ACC) deaminase activity of Methylobacterium strains. Under greenhouse condition, Methylobacterium strains inoculated and pathogen challenged tomato plants had low ethylene emission compared to pathogen infected ones. ACC accumulation and ACC oxidase (ACO) activity with ACO related gene expression increased in XCV infected tomato plants over Methylobacterium strains inoculated plants. Among the Methylobacterium spp., CBMB12 resulted lowest ACO related gene expression (1.46 Normalized Fold Expression), whereas CBMB20 had high gene expression (3.42 Normalized Fold Expression) in pathogen challenged tomato. But a significant increase in ACO gene expression (7.09 Normalized Fold Expression) was observed in the bacterial pathogen infected plants. In contrast, Methylobacterium strains enhanced β-1,3-glucanase and phenylalanine ammonia-lyase (PAL) enzyme activities in pathogen challenged tomato plants. The respective increase in β-1,3-glucanase related gene expressions due to CBMB12, CBMB15, and CBMB20 strains were 66.3, 25.5 and 10.4% higher over pathogen infected plants. Similarly, PAL gene expression was high with 0.67 and 0.30 Normalized Fold Expression, in pathogen challenged tomato plants inoculated with CBMB12 and CBMB15 strains. The results suggest that ethylene is a crucial factor in bacterial spot disease incidence and that methylobacteria with ACC deaminase activity can reduce the disease severity with ultimate pathogenesis-related protein increase in tomato. Copyright © 2014 Elsevier GmbH. All rights reserved.

Lysyl oxidase in colorectal cancer

DEFF Research Database (Denmark)

Cox, Thomas R; Erler, Janine T

2013-01-01

Colorectal cancer is the third most prevalent form of cancer worldwide and fourth-leading cause of cancer-related mortality, leading to ~600,000 deaths annually, predominantly affecting the developed world. Lysyl oxidase is a secreted, extracellular matrix-modifying enzyme previously suggested...... to act as a tumor suppressor in colorectal cancer. However, emerging evidence has rapidly implicated lysyl oxidase in promoting metastasis of solid tumors and in particular colorectal cancer at multiple stages, affecting tumor cell proliferation, invasion, and angiogenesis. This emerging research has...... advancements in the field of colorectal cancer....

Enhanced anodic Ru(bpy)32+ electrogenerated chemiluminescence by polyphenols

International Nuclear Information System (INIS)

Lei Rong; Xu Xiao; Xu Da; Zhu Gang; Li Na; Liu Huwei; Li Kean

2008-01-01

Anodic Ru(bpy) 3 2+ electrogenerated chemiluminescence (ECL) can be enhanced by polyphenols in alkaline solution. Spin trapping-electron spin resonance (ESR) experiments verified that reactive oxygen species (ROS) were generated during the electrolysis of Ru(bpy) 3 2+ in alkaline solution, and oxidation of quercetin enhanced Ru(bpy) 3 2+ ECL at anodic potential by producing additional ROS. This ECL enhancement can be used to analyze real sample and evaluate antioxidant activity of polyphenols

D-amino acid oxidase gene therapy sensitizes glioma cells to the antiglycolytic effect of 3-bromopyruvate.

Science.gov (United States)

El Sayed, S M; Abou El-Magd, R M; Shishido, Y; Chung, S P; Sakai, T; Watanabe, H; Kagami, S; Fukui, K

2012-01-01

Glioma tumors are refractory to conventional treatment. Glioblastoma multiforme is the most aggressive type of primary brain tumors in humans. In this study, we introduce oxidative stress-energy depletion (OSED) therapy as a new suggested treatment for glioblastoma. OSED utilizes D-amino acid oxidase (DAO), which is a promising therapeutic protein that induces oxidative stress and apoptosis through generating hydrogen peroxide (H2O2). OSED combines DAO with 3-bromopyruvate (3BP), a hexokinase II (HK II) inhibitor that interferes with Warburg effect, a metabolic alteration of most tumor cells that is characterized by enhanced aerobic glycolysis. Our data revealed that 3BP induced depletion of energetic capabilities of glioma cells. 3BP induced H2O2 production as a novel mechanism of its action. C6 glioma transfected with DAO and treated with D-serine together with 3BP-sensitized glioma cells to 3BP and decreased markedly proliferation, clonogenic power and viability in a three-dimensional tumor model with lesser effect on normal astrocytes. DAO gene therapy using atelocollagen as an in vivo transfection agent proved effective in a glioma tumor model in Sprague-Dawley (SD) rats, especially after combination with 3BP. OSED treatment was safe and tolerable in SD rats. OSED therapy may be a promising therapeutic modality for glioma.

Evaluation of oxalate decarboxylase and oxalate oxidase for industrial applications.

Science.gov (United States)

Cassland, Pierre; Sjöde, Anders; Winestrand, Sandra; Jönsson, Leif J; Nilvebrant, Nils-Olof

2010-05-01

Increased recirculation of process water has given rise to problems with formation of calcium oxalate incrusts (scaling) in the pulp and paper industry and in forest biorefineries. The potential in using oxalate decarboxylase from Aspergillus niger for oxalic acid removal in industrial bleaching plant filtrates containing oxalic acid was examined and compared with barley oxalate oxidase. Ten different filtrates from chemical pulping were selected for the evaluation. Oxalate decarboxylase degraded oxalic acid faster than oxalate oxidase in eight of the filtrates, while oxalate oxidase performed better in one filtrate. One of the filtrates inhibited both enzymes. The potential inhibitory effect of selected compounds on the enzymatic activity was tested. Oxalate decarboxylase was more sensitive than oxalate oxidase to hydrogen peroxide. Oxalate decarboxylase was not as sensitive to chlorate and chlorite as oxalate oxidase. Up to 4 mM chlorate ions, the highest concentration tested, had no inhibitory effect on oxalate decarboxylase. Analysis of the filtrates suggests that high concentrations of chlorate present in some of the filtrates were responsible for the higher sensitivity of oxalate oxidase in these filtrates. Oxalate decarboxylase was thus a better choice than oxalate oxidase for treatment of filtrates from chlorine dioxide bleaching.

Improving Glyphosate Oxidation Activity of Glycine Oxidase from Bacillus cereus by Directed Evolution

Science.gov (United States)

Zhan, Tao; Zhang, Kai; Chen, Yangyan; Lin, Yongjun; Wu, Gaobing; Zhang, Lili; Yao, Pei; Shao, Zongze; Liu, Ziduo

2013-01-01

Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops. PMID:24223901

Improving glyphosate oxidation activity of glycine oxidase from Bacillus cereus by directed evolution.

Directory of Open Access Journals (Sweden)

Tao Zhan

Full Text Available Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate. Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO, we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution. Six mutants exhibiting enhanced activity toward glyphosate were screened from two rounds of error-prone PCR combined with site directed mutagenesis, and the beneficial mutations of the six evolved variants were recombined by DNA shuffling. Four recombinants were generated and, when compared with the wild-type BceGO, the most active mutant B3S1 showed the highest activity, exhibiting a 160-fold increase in substrate affinity, a 326-fold enhancement in catalytic efficiency against glyphosate, with little difference between their pH and temperature stabilities. The role of these mutations was explored through structure modeling and molecular docking, revealing that the Arg(51 mutation is near the active site and could be an important residue contributing to the stabilization of glyphosate binding, while the role of the remaining mutations is unclear. These results provide insight into the application of directed evolution in optimizing glycine oxidase function and have laid a foundation for the development of glyphosate-tolerant crops.

Microencapsulation and storage stability of polyphenols from Vitis vinifera grape wastes.

Science.gov (United States)

Aizpurua-Olaizola, Oier; Navarro, Patricia; Vallejo, Asier; Olivares, Maitane; Etxebarria, Nestor; Usobiaga, Aresatz

2016-01-01

Wine production wastes are an interesting source of natural polyphenols. In this work, wine wastes extracts were encapsulated through vibration nozzle microencapsulation using sodium alginate as polymer and calcium chloride as hardening reagent. An experimental design approach was used to obtain calcium-alginate microbeads with high polyphenol content and good morphological features. In this way, the effect of pressure, frequency, voltage and the distance to the gelling bath were optimized for two nozzles of 150 and 300 μm. Long-term stability of the microbeads was studied for 6 months taking into account different storage conditions: temperatures (4 °C and room temperature), in darkness and in presence of light, and the addition of chitosan to the gelling bath. Encapsulated polyphenols were found to be much more stable compared to free polyphenols regardless the encapsulation procedure and storage conditions. Moreover, slightly lower degradation rates were obtained when chitosan was added to the gelling bath. Copyright © 2015 Elsevier Ltd. All rights reserved.

Retaining Oxidative Stability of Emulsified Foods by Novel Nonmigratory Polyphenol Coated Active Packaging.

Science.gov (United States)

Roman, Maxine J; Decker, Eric A; Goddard, Julie M

2016-07-13

Oxidation causes lipid rancidity, discoloration, and nutrient degradation that decrease shelf life of packaged foods. Synthetic additives are effective oxidation inhibitors, but are undesirable to consumers who prefer "clean" label products. The aim of this study was to improve oxidative stability of emulsified foods by a novel nonmigratory polyphenol coated active packaging. Polyphenol coatings were applied to chitosan functionalized polypropylene (PP) by laccase assisted polymerization of catechol and catechin. Polyphenol coated PP exhibited both metal chelating (39.3 ± 2.5 nmol Fe(3+) cm(-2), pH 4.0) and radical scavenging (up to 52.9 ± 1.8 nmol Trolox eq cm(-2)) capacity, resulting in dual antioxidant functionality to inhibit lipid oxidation and lycopene degradation in emulsions. Nonmigratory polyphenol coated PP inhibited ferric iron promoted degradation better than soluble chelators, potentially by partitioning iron from the emulsion droplet interface. This work demonstrates that polyphenol coatings can be designed for advanced material chemistry solutions in active food packaging.

Determination of polyphenol content and colour index in wines through PEDOT-modified electrodes.

Science.gov (United States)

Pigani, Laura; Rioli, Cristina; Foca, Giorgia; Ulrici, Alessandro; Seeber, Renato; Terzi, Fabio; Zanardi, Chiara

2016-10-01

Poly(3,4-ethylenedioxythiophene)-modified electrodes have been used for the estimation of the polyphenolic content and of the colour index of different samples of wines. Synthetic wine solutions, prepared with different amount of oenocyanins, have been analysed spectrophotometrically and electrochemically in order to find a correlation between the total polyphenolic content or colour index and the current peak. The regression curves obtained have been used as external calibration lines for the analysis of several commercial wines, ranging from white to dark red wines. In this way, a rapid estimation of the total polyphenolic content and of the colour index may be accomplished from a single voltammetric measurement. Furthermore, principal component analysis has also been used to evaluate the effect of total polyphenolic content and colour index on the whole voltammetric signals within a selected potential range, both for the synthetic solutions and for the commercial products. Graphical abstract Electrochemical sensors for the rapid determination of colour index and polyphenol content in wines.

Confirmation of Two Sibling Species among Anopheles Fluviatilis Mosquitoes in South and Southeastern Iran by Analysis of Cytochrome Oxidase I Gene

Directory of Open Access Journals (Sweden)

Saied Reza Naddaf

2012-12-01

Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phy­logenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-join­ing method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individ­uals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.

Antioxidant and antibacterial activities of polyphenols from ethnomedicinal plants of Burkina Faso

NARCIS (Netherlands)

Karou, D.; Dicko, M.H.; Simpore, J.; Traore, A.S.

2005-01-01

Polyphenols from four medicinal plants of Burkina Faso, Combretum micranthum, Khaya senegalensis, Pterocarpus erinaceus and Sida acuta, were screened for their antioxidant and antimicrobial activities against pathogenic bacteria. The medicinal plants displayed different polyphenols contents and

The gene expressions of DNA methylation/demethylation enzymes ...

African Journals Online (AJOL)

A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...

Suppressive effects of cacao polyphenols on the development of atherosclerosis in apolipoprotein E-deficient mice.

Science.gov (United States)

Natsume, Midori; Baba, Seigo

2014-01-01

Previous studies in humans have shown that the cacao polyphenols, (-)-epicatechin and its oligomers, prevent in vitro and ex vivo low-density lipoprotein oxidation mediated by free radical generators and metal ions and also reduce plasma LDL-cholesterol levels. The aim of this study was to examine the effects of cacao polyphenols on the development of atherosclerosis in apolipoprotein E-deficient (-/-) mice. Mice aged 8 weeks (n = 90) were randomized into three groups, and fed either normal mouse chow (controls) or chow supplemented with 0.25 or 0.40 % cacao polyphenols for 16 weeks. The mean plaque area in cross-sections of the brachiocephalic trunk was measured and found to be lower in the 0.25 % cacao polyphenol group than in the control group (p cacao polyphenol group (p cacao polyphenols inhibit the development of atherosclerosis in apolipoprotein E-deficient (-/-) mice by reducing oxidative stress and inflammatory responses.

Plant Polyphenolic Antioxidants in Management of Chronic Degenerative Diseases

Directory of Open Access Journals (Sweden)

R.K. Das

2017-12-01

Full Text Available With the over growing global population, degenerative diseases are on rise, despite using modern medicine for its cure. People prefer alternative systems of medicine like natural therapy and polyherbal therapy due to adverse effects of allopathic medication. According to W.H.O. report about 70% of world population relying on natural plant-based therapy. For a suitable, sustainable and cost effective cure use of polyphenolic natural antioxidants may be an appropriate tool. Now a day’s most food and pharmaceutical products contain synthetic antioxidants. But recent data indicating that, long term use of synthetic antioxidants could have carcinogenic effects on human cells. Thus, search for new natural and efficient antioxidants is need of the hour. Phenolic compounds (polyphenols are products of secondary metabolites and constitute one of the most widely distributed groups of substance in plant kingdom with more than 10,000 phenolic structures. Polyphenols are structurally characterized by the presence of one or more aromatic benzene ring compounds with one or more functional hydroxyl groups. Polyphenols are naturally occurring and most abundant antioxidants in human diets found largely in the fruits, vegetables and beverages. Plant flavonoids are the largest and best studied class of polyphenols which include more than 4000 compounds. Numerous studies confirm that, flavonoids exert a protective action on human health and are key components of a healthy and balanced diet. Epidemiological studies and associated meta-analysis correlate and strongly   suggest that, long term consumption of diets rich in plant flavonoids offer protection against development of chronic and degenerative diseases, such as cardiovascular diseases , diabetes , cancer, osteoporosis and neurodegenerative diseases. One of the main reasons for the age related diseases is linked with reduction in cellular oxidative stress. The involvement of reactive oxygen species (ROS in

Polyphenols, Antioxidants and the Sympathetic Nervous System.

Science.gov (United States)

Bruno, Rosa Maria; Ghiadoni, Lorenzo

2018-01-01

A high dietary intake of polyphenols has been associated with a reduced cardiovascular mortality, due to their antioxidant properties. However, growing evidence suggests that counteracting oxidative stress in cardiovascular disease might also reduce sympathetic nervous system overactivity. This article reviews the most commonly used techniques to measure sympathetic activity in humans; the role of sympathetic activation in the pathophysiology of cardiovascular diseases; current evidence demonstrating that oxidative stress is involved in the regulation of sympathetic activity and how antioxidants and polyphenols might counteract sympathetic overactivity, particularly focusing on preliminary data from human studies. The main mechanisms by which polyphenols are cardioprotective are related to the improvement of vascular function and their anti-atherogenic effect. Furthermore, a blood pressure-lowering effect was consistently demonstrated in randomized controlled trials in humans, when the effect of flavonoid-rich foods, such as tea and chocolate, was tested. More recent studies suggest that inhibition of sympathetic overactivity might be one of the mechanisms by which these substances exert their cardioprotective effects. Indeed, an increased adrenergic traffic to the vasculature is a major mechanism of disease in a number of cardiovascular and extra-cardiac diseases, including hypertension, obesity, metabolic syndrome and heart failure. A considerable body of evidence, mostly from experimental studies, support the hypothesis that reactive oxygen species might exert sympathoexcitatory effects both at the central and at the peripheral level. Accordingly, supplementation with antioxidants might reduce adrenergic overdrive to the vasculature and blunt cardiovascular reactivity to stress. While supplementation with "classical" antioxidants such as ROS-scavengers has many limitations, increasing the intake of polyphenol-rich foods seems to be a promising novel therapeutic

Production of rabbit antibodies against purified Glucose oxidase

Directory of Open Access Journals (Sweden)

Muhammad Anjum Zia

2012-02-01

Full Text Available Glucose oxidase is an active oxygen species generating enzyme produced from Aspergillus niger grown in submerged fermentation. Disintegration of the mycelium resulted in high glucose oxidase activity that was subjected to ammonium sulfate precipitation at 60-85% saturation rates that resulted to 6.14 U mg -1 specific activity. Purification of enzyme by anion exchange column (DEAE-Cellulose resulted into 22.53 U mg-1 specific activity and 10.27 fold purification. This was applied to sephadex G-200 column for gel filtration chromatography. It was observed that enzyme achieved 59.37 U mg-1of specific activity with 27.08 fold purity and 64.36% recovery. Purified glucose oxidase was injected into rabbits through intravenous route, to raise the glucose oxidase antibodies. After 30 days incubation period, the rabbits were slaughtered and serum was separated from blood. The antibodies were isolated by ammonium sulfate precipitation and confirmed by agar gel precipitation test. This could be a convenient and low cost alternate assay for the estimation of glucose oxidase in biological fluids. Moreover, such antibodies against the said enzyme could be used in various therapeutic and diagnostic applications.

Tentative identification of polyphenols in Sempervivum tectorum and assessment of the antimicrobial activity of Sempervivum L.

Science.gov (United States)

Abram, V; Donko, M

1999-02-01

Polyphenols were isolated from sliced fresh leaves of Sempervivum tectorum. After 21 h of extraction by methanol and removal of chlorophyll, ethyl acetate was used to separate oligomeric and polymeric polyphenols: 0.07% of oligomeric and 0.13% of polymeric polyphenols were found. After acidic hydrolysis of the oligomeric polyphenols, it was established by TLC, HPLC, and FAB mass spectra that kaempferol was the unique aglycon of the three main oligomeric constituents of S. tectorum. Paper chromatography suggested delphinidol to be the only anthocyanidin detectable in the material obtained by acidic hydrolysis of the polymeric polyphenol fraction. After Haslam degradation of the same polymeric polyphenol fraction, only 4-thiobenzyl-(-)-epigallocatechin and 4-thiobenzyl-(-)-epigallocatechin-3-gallate were found and tentatively identified. We concluded that procyanidins of B2 type could be the major components of the polymeric polyphenol fraction of this plant. Antimicrobial activity of Sempervivum L. leaves against six of seven selected microorganisms was observed.

Modulatory Effects of Polyphenols on Apoptosis Induction: Relevance for Cancer Prevention

Directory of Open Access Journals (Sweden)

Claudio Giovannini

2008-02-01

Full Text Available Polyphenols, occurring in fruit and vegetables, wine, tea, extra virgin olive oil, chocolate and other cocoa products, have been demonstrated to have clear antioxidant properties in vitro, and many of their biological actions have been attributed to their intrinsic reducing capabilities. However, it has become clear that, in complex biological systems, polyphenols exhibit several additional properties which are yet poorly understood. Apoptosis is a genetically controlled and evolutionarily conserved form of cell death of critical importance for the normal embryonic development and for the maintenance of tissue homeostasis in the adult organism. The malfunction of the death machinery may play a primary role in various pathological processes, since too little or too much apoptosis can lead to proliferative or degenerative diseases, respectively. Cancer cells are characterized by a deregulated proliferation, and/or an inability to undergo programmed cell death. A large body of evidence indicates that polyphenols can exert chemopreventive effects towards different organ specific cancers, affecting the overall process of carcinogenesis by several mechanisms: inhibition of DNA synthesis, modulation of ROS production, regulation of cell cycle arrest, modulation of survival/proliferation pathways. In addition, polyphenols can directly influence different points of the apoptotic process, and/or the expression of Int. J. Mol. Sci. 2008, 9 214 regulatory proteins. Although the bulk of data has been obtained in in vitro systems, a number of clinical studies suggesting a preventive and therapeutic effectiveness of polyphenols in vivo is available. However, a deeper knowledge of the underlying mechanisms responsible for the modulation of apoptosis by polyphenols, and their real effectiveness, is necessary in order to propose them as potential chemopreventive and chemotherapeutic candidates for cancer treatment.

Enhanced drought and heat stress tolerance of tobacco plants with ectopically enhanced cytokinin oxidase/dehydrogenase gene expression

Czech Academy of Sciences Publication Activity Database

Macková, Hana; Hronková, Marie; Dobrá, Jana; Turečková, Veronika; Novák, Ondřej; Lubovská, Zuzana; Motyka, Václav; Haisel, Daniel; Hájek, Tomáš; Prášil, I.T.; Gaudinová, Alena; Štorchová, Helena; Ge, Eva; Werner, T.; Schmülling, T.; Vaňková, Radomíra

2013-01-01

Roč. 64, č. 10 (2013), s. 2805-2815 ISSN 0022-0957 R&D Projects: GA ČR GA206/09/2062 Institutional support: RVO:61389030 ; RVO:60077344 ; RVO:67985939 Keywords : cytokinin oxidase * cytokinin * Abscisic acid Subject RIV: ED - Physiology Impact factor: 5.794, year: 2013

Determination of total polyphenol index in wines employing a voltammetric electronic tongue

International Nuclear Information System (INIS)

Cetó, Xavier; Gutiérrez, Juan Manuel; Gutiérrez, Manuel; Céspedes, Francisco; Capdevila, Josefina; Mínguez, Santiago; Jiménez-Jorquera, Cecilia; Valle, Manel del

2012-01-01

Highlights: ► Array of voltammetric sensors modified with nanoparticles or conducting polymers. ► It has been applied in wine analysis to predict polyphenol content index. ► Uses data processing tools such as discrete wavelet transform and artificial neural network. ► Identification of phenolics like gallic acid, catechin, caffeic acid, catechol. ► Predicted polyphenol index agrees with Folin–Ciocalteau method and I 280 index. - Abstract: This work reports the application of a voltammetric electronic tongue system (ET) made from an array of modified graphite-epoxy composites plus a gold microelectrode in the qualitative and quantitative analysis of polyphenols found in wine. Wine samples were analyzed using cyclic voltammetry without any sample pretreatment. The obtained responses were preprocessed employing discrete wavelet transform (DWT) in order to compress and extract significant features from the voltammetric signals, and the obtained approximation coefficients fed a multivariate calibration method (artificial neural network-ANN-or partial least squares-PLS-) which accomplished the quantification of total polyphenol content. External test subset samples results were compared with the ones obtained with the Folin–Ciocalteu (FC) method and UV absorbance polyphenol index (I 280 ) as reference values, with highly significant correlation coefficients of 0.979 and 0.963 in the range from 50 to 2400 mg L −1 gallic acid equivalents, respectively. In a separate experiment, qualitative discrimination of different polyphenols found in wine was also assessed by principal component analysis (PCA).

Chemoenzymatic combination of glucose oxidase with titanium silicalite -1

DEFF Research Database (Denmark)

Vennestrøm, Peter Nicolai Ravnborg; Taarning, Esben; Christensen, Claus H.

2010-01-01

Zeozymes: A proof-of-concept is presented for the chemoenzymatic combination of titanium silicalite-1 zeolite with glucose oxidase. In this combination, glucose is oxidized to gluconic acid and the H2O2 byproduct formed in situ is used for the simultaneous oxidation of chemical substrates. Both...... a soluble glucose oxidase and a truly integrated heterogeneous combination whereby the oxidase enzyme is anchored onto the zeolite surface are reported....

Neuroprotective Effect of Tea Polyphenols on Oxyhemoglobin Induced Subarachnoid Hemorrhage in Mice

Directory of Open Access Journals (Sweden)

Haizhen Mo

2013-01-01

Full Text Available Tea polyphenols are of great benefit to the treatment of several neurodegenerative diseases. In order to explore the neuroprotective effects of tea polyphenols and their potential mechanisms, an established in vivo subarachnoid hemorrhage (SAH model was used and alterations of mitochondrial function, ATP content, and cytochrome c (cyt c in cerebral cortex were detected. This study showed that the alteration of mitochondrial membrane potential was an early event in SAH progression. The trend of ATP production was similar to that of mitochondrial membrane potential, indicating that the lower the mitochondrial membrane potential, lesser the ATP produced. Due to mitochondrial dysfunction, more cyt c was released in the SAH group. Interestingly, the preadministration of tea polyphenols significantly rescued the mitochondrial membrane potential to basal level, as well as the ATP content and the cyt c level in the brain cortex 12 h after SAH. After pretreatment with tea polyphenols, the neurological outcome was also improved. The results provide strong evidence that tea polyphenols enhance neuroprotective effects by inhibiting polarization of mitochondrial membrane potential, increasing ATP content, and blocking cyt c release.

Can Dietary Polyphenols Prevent the Formation of Toxic Compounds from Maillard Reaction?