
Sample records for polycomb group ubiquitin

  1. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*


    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.


    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...

  2. Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg. (United States)

    Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J


    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.

  3. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg* (United States)

    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.


    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366

  4. Transcriptional regulation by Polycomb group proteins

    DEFF Research Database (Denmark)

    Di Croce, Luciano; Helin, Kristian


    Polycomb group (PcG) proteins are epigenetic regulators of transcription that have key roles in stem-cell identity, differentiation and disease. Mechanistically, they function within multiprotein complexes, called Polycomb repressive complexes (PRCs), which modify histones (and other proteins......) and silence target genes. The dynamics of PRC1 and PRC2 components has been the focus of recent research. Here we discuss our current knowledge of the PRC complexes, how they are targeted to chromatin and how the high diversity of the PcG proteins allows these complexes to influence cell identity....

  5. Polycomb group protein-mediated repression of transcription

    DEFF Research Database (Denmark)

    Morey, Lluís; Helin, Kristian


    The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work as transcri......The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work...... as transcriptional repressors is incompletely understood, but involves post-translational modifications of histones by two major PcG protein complexes: polycomb repressive complex 1 and polycomb repressive complex 2....

  6. Polycomb group protein bodybuilding: working out the routines. (United States)

    Sievers, Cem; Paro, Renato


    Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster


    Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.


    The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...

  8. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis* (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long


    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  9. Polycomb-group genes sustaining the stem cell activity

    International Nuclear Information System (INIS)

    Takihara, Yoshihiro


    Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)

  10. Polycomb protein SCML2 associates with USP7 and counteracts histone H2A ubiquitination in the XY chromatin during male meiosis

    NARCIS (Netherlands)

    Luo, Mengcheng; Zhou, Jian; Leu, N. Adrian; Abreu, Carla M.; Wang, Jianle; Anguera, Montserrat C.; de Rooij, Dirk G.; Jasin, Maria; Wang, P. Jeremy


    Polycomb group proteins mediate transcriptional silencing in diverse developmental processes. Sex chromosomes undergo chromosome-wide transcription silencing during male meiosis. Here we report that mouse SCML2 (Sex comb on midleg-like 2), an X chromosome-encoded polycomb protein, is specifically

  11. Altered expression of polycomb group genes in glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Gang Li

    Full Text Available The Polycomb group (PcG proteins play a critical role in histone mediated epigenetics which has been implicated in the malignant evolution of glioblastoma multiforme (GBM. By systematically interrogating The Cancer Genome Atlas (TCGA, we discovered widespread aberrant expression of the PcG members in GBM samples compared to normal brain. The most striking differences were upregulation of EZH2, PHF19, CBX8 and PHC2 and downregulation of CBX7, CBX6, EZH1 and RYBP. Interestingly, changes in EZH2, PHF19, CBX7, CBX6 and EZH1 occurred progressively as astrocytoma grade increased. We validated the aberrant expression of CBX6, CBX7, CBX8 and EZH2 in GBM cell lines by Western blotting and qRT-PCR, and further the aberrant expression of CBX6 in GBM tissue samples by immunohistochemical staining. To determine if there was functional significance to the diminished CBX6 levels in GBM, CBX6 was overexpressed in GBM cells resulting in decreased proliferative capacity. In conclusion, aberrant expression of PcG proteins in GBMs may play a role in the development or maintenance of the malignancy.

  12. Polycomb group proteins in cell cycle progression and cancer

    DEFF Research Database (Denmark)

    Pasini, Diego; Bracken, Adrian P; Helin, Kristian


    Epigenetic deregulation of gene expression is emerging as key mechanism in tumorigenesis. Deregulated activity of the chromatin remodeling Polycomb Repressive Complex 2 (PRC2) has recently been shown to be a frequent event in human tumors. Here we discuss these findings and speculate on the role ...

  13. Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro. (United States)

    Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa


    Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.

  14. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell


    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira


    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...

  15. Pluripotency factors and Polycomb Group proteins repress aryl hydrocarbon receptor expression in murine embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Chia-I Ko


    Full Text Available The aryl hydrocarbon receptor (AHR is a transcription factor and environmental sensor that regulates expression of genes involved in drug-metabolism and cell cycle regulation. Chromatin immunoprecipitation analyses, Ahr ablation in mice and studies with orthologous genes in invertebrates suggest that AHR may also play a significant role in embryonic development. To address this hypothesis, we studied the regulation of Ahr expression in mouse embryonic stem cells and their differentiated progeny. In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. Our results suggest that reversible Ahr repression in ES cells holds the gene poised for expression and allows for a quick switch to activation during embryonic development.

  16. Polycomb-group histone methyltransferase CLF is required for proper somatic recombination in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Na Chen; Wang-Bin Zhou; Ying-Xiang Wang; Ai-Wu Dong; Yu Yu


    Homologous recombination (HR) is a key process during meiosis in reproductive cells and the DNA damage repair process in somatic cells. Although chromatin structure is thought to be crucial for HR, only a smal number of chromatin modifiers have been studied in HR regulation so far. Here, we investigated the function of CURLY LEAF (CLF), a Polycomb-group (PcG) gene responsible for histone3 lysine 27 trimethy-lation (H3K27me3), in somatic and meiotic HR in Arabidopsis thaliana. Although fluorescent protein reporter assays in pol en and seeds showed that the frequency of meiotic cross-over in the loss-of-function mutant clf-29 was not significantly different from that in wild type, there was a lower frequency of HR in clf-29 than in wild type under normal conditions and under bleomycin treatment. The DNA damage levels were compara-ble between clf-29 and wild type, even though several DNA damage repair genes (e.g. ATM, BRCA2a, RAD50, RAD51, RAD54,and PARP2) were expressed at lower levels in clf-29. Under bleomycin treatment, the expression levels of DNA repair genes were similar in clf-29 and wild type, thus CLF may also regulate HR via other mechanisms. These findings expand the current knowledge of PcG function and contribute to general interests of epigenetic regulation in genome stability regulation.

  17. Epigenetic regulation of HIV-1 latency: focus on polycomb group (PcG) proteins. (United States)

    Khan, Sheraz; Iqbal, Mazhar; Tariq, Muhammad; Baig, Shahid M; Abbas, Wasim


    HIV-1 latency allows the virus to persist until reactivation, in a transcriptionally silent form in its cellular reservoirs despite the presence of effective cART. Such viral persistence represents a major barrier to HIV eradication since treatment interruption leads to rebound plasma viremia. Polycomb group (PcG) proteins have recently got a considerable attention in regulating HIV-1 post-integration latency as they are involved in the repression of proviral gene expression through the methylation of histones. This epigenetic regulation plays an important role in the establishment and maintenance of HIV-1 latency. In fact, PcG proteins act in complexes and modulate the epigenetic signatures of integrated HIV-1 promoter. Key role played by PcG proteins in the molecular control of HIV-1 latency has led to hypothesize that PcG proteins may represent a valuable target for future HIV-1 therapy in purging HIV-1 reservoirs. In this regard, various small molecules have been synthesized or explored to specifically block the epigenetic activity of PcG. In this review, we will highlight the possible therapeutic approaches to achieve either a functional or sterilizing cure of HIV-1 infection with special focus on histone methylation by PcG proteins together with current and novel pharmacological approaches to reactivate HIV-1 from latency that could ultimately lead towards a better clearance of viral latent reservoirs.

  18. Polycomb Group Protein YY1 Is an Essential Regulator of Hematopoietic Stem Cell Quiescence

    Directory of Open Access Journals (Sweden)

    Zhanping Lu


    Full Text Available Yin yang 1 (YY1 is a ubiquitous transcription factor and mammalian polycomb group protein (PcG with important functions to regulate embryonic development, lineage differentiation, and cell proliferation. YY1 mediates stable PcG-dependent transcriptional repression via recruitment of PcG proteins that catalyze histone modifications. Many questions remain unanswered regarding how cell- and tissue-specificity is achieved by PcG proteins. Here, we demonstrate that a conditional knockout of Yy1 in hematopoietic stem cells (HSCs decreases long-term repopulating activity and ectopic YY1 expression expands HSCs. Although the YY1 PcG domain is required for Igκ chain rearrangement in B cells, the YY1 mutant lacking the PcG domain retained the capacity to stimulate HSC self-renewal. YY1 deficiency deregulated the genetic network governing HSC cell proliferation and impaired stem cell factor/c-Kit signaling, disrupting mechanisms conferring HSC quiescence. These results reveal a mechanism for how a ubiquitously expressed transcriptional repressor mediates lineage-specific functions to control adult hematopoiesis.

  19. Participation of Polycomb group gene extra sex combs in hedgehog signaling pathway

    International Nuclear Information System (INIS)

    Shindo, Norihisa; Sakai, Atsushi; Yamada, Kouji; Higashinakagawa, Toru


    Polycomb group (PcG) genes are required for stable inheritance of epigenetic states across cell divisions, a phenomenon termed cellular memory. PcG proteins form multimeric nuclear complex which modifies the chromatin structure of target site. Drosophila PcG gene extra sex combs (esc) and its vertebrate orthologs constitute a member of ESC-E(Z) complex, which possesses histone methyltransferase activity. Here we report isolation and characterization of medaka esc homolog, termed oleed. Hypomorphic knock-down of oleed using morpholino antisense oligonucleotides resulted in the fusion of eyes, termed cyclopia. Prechordal plate formation was not substantially impaired, but expression of hedgehog target genes was dependent on oleed, suggesting some link with hedgehog signaling. In support of this implication, histone methylation, which requires the activity of esc gene product, is increased in hedgehog stimulated mouse NIH-3T3 cells. Our data argue for the novel role of esc in hedgehog signaling and provide fundamental insight into the epigenetic mechanisms in general

  20. Human Polycomb group EED protein negatively affects HIV-1 assembly and release

    Directory of Open Access Journals (Sweden)

    Darlix Jean-Luc


    Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group (PcG proteins with WD-40 repeats, has been found to interact with three HIV-1 components, namely the structural Gag matrix protein (MA, the integrase enzyme (IN and the Nef protein. The aim of the present study was to analyze the possible biological role of EED in HIV-1 replication, using the HIV-1-based vector HIV-Luc and EED protein expressed by DNA transfection of 293T cells. Results During the early phase of HIV-1 infection, a slight negative effect on virus infectivity occurred in EED-expressing cells, which appeared to be dependent on EED-MA interaction. At late times post infection, EED caused an important reduction of virus production, from 20- to 25-fold as determined by CAp24 immunoassay, to 10- to 80-fold based on genomic RNA levels, and this decrease was not due to a reduction of Gag protein synthesis. Coexpression of WTNef, or the non-N-myristoylated mutant NefG2A, restored virus yields to levels obtained in the absence of exogenous EED protein. This effect was not observed with mutant NefΔ57 mimicking the Nef core, or with the lipid raft-retargeted fusion protein LAT-Nef. LATAA-Nef, a mutant defective in the lipid raft addressing function, had the same anti-EED effect as WTNef. Cell fractionation and confocal imaging showed that, in the absence of Nef, EED mainly localized in membrane domains different from the lipid rafts. Upon co-expression with WTNef, NefG2A or LATAA-Nef, but not with NefΔ57 or LAT-Nef, EED was found to relocate into an insoluble fraction along with Nef protein. Electron microscopy of HIV-Luc producer cells overexpressing EED showed significant less virus budding at the cell surface compared to control cells, and ectopic assembly and clustering of nuclear pore complexes within the cytoplasm. Conclusion Our data suggested that EED exerted an antiviral activity at the late stage of HIV-1 replication, which included genomic

  1. Transcriptional response of polycomb group genes to status epilepticus in mice is modified by prior exposure to epileptic preconditioning

    Directory of Open Access Journals (Sweden)

    James eReynolds


    Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.

  2. Stable X chromosome inactivation involves the PRC1 Polycomb complex and requires histone MACROH2A1 and the CULLIN3/SPOP ubiquitin E3 ligase

    DEFF Research Database (Denmark)

    Hernández-Muñoz, Inmaculada; Lund, Anders H; van der Stoop, Petra


    X inactivation involves the stable silencing of one of the two X chromosomes in XX female mammals. Initiation of this process occurs during early development and involves Xist (X-inactive-specific transcript) RNA coating and the recruitment of Polycomb repressive complex (PRC) 2 and PRC1 proteins...

  3. KDM2B recruitment of the Polycomb group complex, PRC1.1, requires cooperation between PCGF1 and BCORL1


    Wong, Sarah J.; Gearhart, Micah D.; Taylor, Alexander B.; Nanyes, David R.; Ha, Daniel J.; Robinson, Angela K.; Artigas, Jason A.; Lee, Oliver J.; Demeler, Borries; Hart, P. John; Bardwell, Vivian J.; Kim, Chongwoo A.


    KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and the ...

  4. Polycomb group (PcG) proteins and Pax6 cooperate to inhibit in vivo reprogramming of the developing Drosophila eye. (United States)

    Zhu, Jinjin; Ordway, Alison J; Weber, Lena; Buddika, Kasun; Kumar, Justin P


    How different cells and tissues commit to and determine their fates has been a central question in developmental biology since the seminal embryological experiments conducted by Wilhelm Roux and Hans Driesch in sea urchins and frogs. Here, we demonstrate that Polycomb group (PcG) proteins maintain Drosophila eye specification by suppressing the activation of alternative fate choices. The loss of PcG in the developing eye results in a cellular reprogramming event in which the eye is redirected to a wing fate. This fate transformation occurs with either the individual loss of Polycomb proteins or the simultaneous reduction of the Pleiohomeotic repressive complex and Pax6. Interestingly, the requirement for retinal selector genes is limited to Pax6, as the removal of more downstream members does not lead to the eye-wing transformation. We also show that distinct PcG complexes are required during different developmental windows throughout eye formation. These findings build on earlier observations that the eye can be reprogrammed to initiate head epidermis, antennal and leg development. © 2018. Published by The Company of Biologists Ltd.

  5. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell (United States)

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira


    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154

  6. The immediate early gene product EGR1 and polycomb group proteins interact in epigenetic programming during chondrogenesis.

    Directory of Open Access Journals (Sweden)

    Frank Spaapen

    Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.

  7. Ubiquitin

    DEFF Research Database (Denmark)

    Vinther-Jensen, T.; Simonsen, A. H.; Budtz-Jorgensen, E.


    -expansion negative individuals using surface-enhanced laser desorption/ionization time-of-flight (SELDI-TOF) mass spectrometry. Differences in peak intensity from SELDI-TOF spectra were evaluated. RESULTS: Levels of 10 peaks were statistically significantly different between manifest gene-expansion carriers...... and controls. One of them identified as ubiquitin was shown to be dependent on the Unified Huntington Disease Rating Scale Total Functional Capacity, a pseudo-measure of disease severity (P = 0.001), and the Symbol Digit Modalities Test (0.04) in manifest and CAG-age product score (P = 0.019) in all gene......-expansion carriers. CONCLUSIONS AND RELEVANCE: Multiple studies have shown that the ubiquitin-proteasome system is involved in Huntington's disease pathogenesis and understanding of this involvement may have therapeutic potential in humans. This is the first study on cerebrospinal fluid to confirm the involvement...

  8. Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿


    Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.


    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and othe...

  9. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten


    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  10. Structural Basis of Polycomb Bodies

    Czech Academy of Sciences Publication Activity Database

    Šmigová, J.; Juda, P.; Krejčí, Jana; Raška, I.


    Roč. 60, č. 1 (2014), s. 13-20 ISSN 0015-5500 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA MŠk(CZ) EE2.3.30.0030 Institutional support: RVO:68081707 Keywords : Polycomb group proteins * Polycomb body * post-translational chromatin modifications Subject RIV: BO - Biophysics Impact factor: 1.000, year: 2014

  11. batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor. (United States)

    Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L


    Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

  12. SSX2 is a novel DNA-binding protein that antagonizes polycomb group body formation and gene repression

    DEFF Research Database (Denmark)

    Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden


    Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body...... formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition...

  13. Cooperativity, Specificity, and Evolutionary Stability of Polycomb Targeting in Drosophila

    Directory of Open Access Journals (Sweden)

    Bernd Schuettengruber


    Full Text Available Summary: Metazoan genomes are partitioned into modular chromosomal domains containing active or repressive chromatin. In flies, Polycomb group (PcG response elements (PREs recruit PHO and other DNA-binding factors and act as nucleation sites for the formation of Polycomb repressive domains. The sequence specificity of PREs is not well understood. Here, we use comparative epigenomics and transgenic assays to show that Drosophila domain organization and PRE specification are evolutionarily conserved despite significant cis-element divergence within Polycomb domains, whereas cis-element evolution is strongly correlated with transcription factor binding divergence outside of Polycomb domains. Cooperative interactions of PcG complexes and their recruiting factor PHO stabilize PHO recruitment to low-specificity sequences. Consistently, PHO recruitment to sites within Polycomb domains is stabilized by PRC1. These data suggest that cooperative rather than hierarchical interactions among low-affinity sequences, DNA-binding factors, and the Polycomb machinery are giving rise to specific and strongly conserved 3D structures in Drosophila. : Schuettengruber et al. present an extensive comparative epigenomics data set, providing new insights into cis-driven versus buffered evolution of Polycomb recruitment and Polycomb domain specificity. Using chromatin immunoprecipitation sequencing and transgenic assays, they demonstrate an extremely high conservation of Polycomb repressive domains in five Drosophila species. Using Hi-C and knockout experiments, they challenge the standard hierarchical Polycomb recruitment model and demonstrate that cooperative rather than hierarchical interactions among DNA motifs, transcription factors, and Polycomb group complexes define Polycomb domains.

  14. Characterization of an antagonistic switch between histone H3 lysine 27 methylation and acetylation in the transcriptional regulation of Polycomb group target genes

    DEFF Research Database (Denmark)

    Pasini, Diego; Malatesta, Martina; Jung, Hye Ryung


    Polycomb group (PcG) proteins are transcriptional repressors, which regulate proliferation and cell fate decisions during development, and their deregulated expression is a frequent event in human tumours. The Polycomb repressive complex 2 (PRC2) catalyzes trimethylation (me3) of histone H3 lysine...... are poorly understood. To gain insight into these mechanisms, we have determined the global changes in histone modifications in embryonic stem (ES) cells lacking the PcG protein Suz12 that is essential for PRC2 activity. We show that loss of PRC2 activity results in a global increase in H3K27 acetylation....... The methylation to acetylation switch correlates with the transcriptional activation of PcG target genes, both during ES cell differentiation and in MLL-AF9-transduced hematopoietic stem cells. Moreover, we provide evidence that the acetylation of H3K27 is catalyzed by the acetyltransferases p300 and CBP. Based...

  15. Polycomb Group Proteins RING1A and RING1B Regulate the Vegetative Phase Transition in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jian Li


    Full Text Available Polycomb group (PcG protein-mediated gene silencing is a major regulatory mechanism in higher eukaryotes that affects gene expression at the transcriptional level. Here, we report that two conserved homologous PcG proteins, RING1A and RING1B (RING1A/B, are required for global H2A monoubiquitination (H2Aub in Arabidopsis. The mutation of RING1A/B increased the expression of members of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene family and caused an early vegetative phase transition. The early vegetative phase transition observed in ring1a ring1b double mutant plants was dependent on an SPL family gene, and the H2Aub status of the chromatin at SPL locus was dependent on RING1A/B. Moreover, mutation in RING1A/B affected the miRNA156a-mediated vegetative phase transition, and RING1A/B and the AGO7-miR390-TAS3 pathway were found to additively regulate this transition in Arabidopsis. Together, our results demonstrate that RING1A/B regulates the vegetative phase transition in Arabidopsis through the repression of SPL family genes.

  16. Insulators target active genes to transcription factories and polycomb-repressed genes to polycomb bodies.

    Directory of Open Access Journals (Sweden)

    Hua-Bing Li


    Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.

  17. KDM2B Recruitment of the Polycomb Group Complex, PRC1.1, Requires Cooperation between PCGF1 and BCORL1. (United States)

    Wong, Sarah J; Gearhart, Micah D; Taylor, Alexander B; Nanyes, David R; Ha, Daniel J; Robinson, Angela K; Artigas, Jason A; Lee, Oliver J; Demeler, Borries; Hart, P John; Bardwell, Vivian J; Kim, Chongwoo A


    KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes, and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA-binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and PCGF1, a core component of PRC1.1. The crystal structure of the KDM2B/SKP1/BCORL1/PCGF1 complex illustrates the crucial role played by the PCGF1/BCORL1 heterodimer. The BCORL1 PUFD domain positions residues preceding the RAWUL domain of PCGF1 to create an extended interface for interaction with KDM2B, which is unique to the PCGF1-containing PRC1.1 complex. The structure also suggests how KDM2B might simultaneously function in PRC1.1 and an SCF ubiquitin ligase complex and the possible molecular consequences of BCOR PUFD internal tandem duplications found in pediatric kidney and brain tumors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Comparative analysis of chromatin binding by Sex Comb on Midleg (SCM) and other polycomb group repressors at a Drosophila Hox gene. (United States)

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A


    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.

  19. Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿ (United States)

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.


    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181

  20. Polycomb Group Protein Displacement and Gene Activation through MSK-Dependent H3K27me3S28 Phosphorylation

    DEFF Research Database (Denmark)

    Gehani, Simmi Suman; Agrawal-Singh, Shuchi; Dietrich, Nikolaj


    Epigenetic regulation of chromatin structure is essential for the expression of genes determining cellular specification and function. The Polycomb repressive complex 2 (PRC2) di- and trimethylates histone H3 on lysine 27 (H3K27me2/me3) to establish repression of specific genes in embryonic stem ...

  1. Additional sex combs-like 1 belongs to the enhancer of trithorax and Polycomb Group and genetically interacts with Cbx2 in mice (United States)

    Fisher, C.L.; Lee, I.; Bloyer, S.; Bozza, S.; Chevalier, J.; Dahl, A; Bodner, C.; Helgason, C. D.; Hess, J.L.; Humphries, R.K.; Brock, H.W.


    The Additional sex combs (Asx) gene of Drosophila behaves genetically as an enhancer of trithorax and Polycomb (ETP) in displaying bidirectional homeotic phenotypes, suggesting that is required for maintenance of both activation and silencing of Hox genes. There are 3 murine homologs of Asx called Additional sex combs-like1, 2, and-3. Asxl1 is required for normal adult hematopoiesis; however its embryonic function is unknown. We used a targeted mouse mutant line Asxl1tm1Bc to determine if Asxl1 is required to silence and activate Hox genes in mice during axial patterning. The mutant embryos exhibit simultaneous anterior and posterior transformations of the axial skeleton, consistent with a role for Asxl1 in activation and silencing of Hox genes. Transformations of the axial skeleton are enhanced in compound mutant embryos for the Polycomb group gene M33/Cbx2. Hox a4, a7, and c8 are derepressed in Asxl1tm1Bc mutants in the antero-posterior axis, but Hox c8 expression is reduced in the brain of mutants, consistent with Asxl1 being required both for activation and repression of Hox genes. We discuss the genetic and molecular definition of ETPs, and suggest that the function of Asxl1 depends on its cellular context. PMID:19833123

  2. The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells

    DEFF Research Database (Denmark)

    Bracken, Adrian P; Kleine-Kohlbrecher, Daniela; Dietrich, Nikolaj


    The p16INK4A and p14ARF proteins, encoded by the INK4A-ARF locus, are key regulators of cellular senescence, yet the mechanisms triggering their up-regulation are not well understood. Here, we show that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association...... and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 (PRC2) complex. Significantly, EZH2 is down-regulated in stressed and senescing populations of cells, coinciding with decreased levels of associated H3K27me3, displacement of BMI1, and activation of transcription...

  3. An Automatic Segmentation Method Combining an Active Contour Model and a Classification Technique for Detecting Polycomb-group Proteinsin High-Throughput Microscopy Images. (United States)

    Gregoretti, Francesco; Cesarini, Elisa; Lanzuolo, Chiara; Oliva, Gennaro; Antonelli, Laura


    The large amount of data generated in biological experiments that rely on advanced microscopy can be handled only with automated image analysis. Most analyses require a reliable cell image segmentation eventually capable of detecting subcellular structures.We present an automatic segmentation method to detect Polycomb group (PcG) proteins areas isolated from nuclei regions in high-resolution fluorescent cell image stacks. It combines two segmentation algorithms that use an active contour model and a classification technique serving as a tool to better understand the subcellular three-dimensional distribution of PcG proteins in live cell image sequences. We obtained accurate results throughout several cell image datasets, coming from different cell types and corresponding to different fluorescent labels, without requiring elaborate adjustments to each dataset.

  4. Genome-Wide Identification of Polycomb Target Genes Reveals a Functional Association of Pho with Scm in Bombyx mori


    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro


    Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent ...

  5. SSX and the synovial-sarcoma-specific chimaeric protein SYT-SSX co-localize with the human Polycomb group complex. (United States)

    Soulez, M; Saurin, A J; Freemont, P S; Knight, J C


    Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.

  6. Epigenetic chromatin modifiers in barley: IV. The study of barley Polycomb group (PcG genes during seed development and in response to external ABA

    Directory of Open Access Journals (Sweden)

    Stanca Michele A


    Full Text Available Abstract Background Epigenetic phenomena have been associated with the regulation of active and silent chromatin states achieved by modifications of chromatin structure through DNA methylation, and histone post-translational modifications. The latter is accomplished, in part, through the action of PcG (Polycomb group protein complexes which methylate nucleosomal histone tails at specific sites, ultimately leading to chromatin compaction and gene silencing. Different PcG complex variants operating during different developmental stages have been described in plants. In particular, the so-called FIE/MEA/FIS2 complex governs the expression of genes important in embryo and endosperm development in Arabidopsis. In our effort to understand the epigenetic mechanisms regulating seed development in barley (Hordeum vulgare, an agronomically important monocot plant cultivated for its endosperm, we set out to characterize the genes encoding barley PcG proteins. Results Four barley PcG gene homologues, named HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were identified and structurally and phylogenetically characterized. The corresponding genes HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were mapped onto barley chromosomes 7H, 4H, 2H and 5H, respectively. Expression analysis of the PcG genes revealed significant differences in gene expression among tissues and seed developmental stages and between barley cultivars with varying seed size. Furthermore, HvFIE and HvE(Z gene expression was responsive to the abiotic stress-related hormone abscisic acid (ABA known to be involved in seed maturation, dormancy and germination. Conclusion This study reports the first characterization of the PcG homologues, HvFIE, HvE(Z, HvSu(z12a and HvSu(z12b in barley. All genes co-localized with known chromosomal regions responsible for malting quality related traits, suggesting that they might be used for developing molecular markers to be applied in marker assisted selection. The Pc

  7. The Polycomb Group Protein L3MBTL1 Represses a SMAD5-Mediated Hematopoietic Transcriptional Program in Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Fabiana Perna


    Full Text Available Epigenetic regulation of key transcriptional programs is a critical mechanism that controls hematopoietic development, and, thus, aberrant expression patterns or mutations in epigenetic regulators occur frequently in hematologic malignancies. We demonstrate that the Polycomb protein L3MBTL1, which is monoallelically deleted in 20q- myeloid malignancies, represses the ability of stem cells to drive hematopoietic-specific transcriptional programs by regulating the expression of SMAD5 and impairing its recruitment to target regulatory regions. Indeed, knockdown of L3MBTL1 promotes the development of hematopoiesis and impairs neural cell fate in human pluripotent stem cells. We also found a role for L3MBTL1 in regulating SMAD5 target gene expression in mature hematopoietic cell populations, thereby affecting erythroid differentiation. Taken together, we have identified epigenetic priming of hematopoietic-specific transcriptional networks, which may assist in the development of therapeutic approaches for patients with anemia.

  8. A repetitive elements perspective in Polycomb epigenetics.

    Directory of Open Access Journals (Sweden)

    Valentina eCasa


    Full Text Available Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome rearrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements’ activity is fundamental.Polycomb group (PcG proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins.Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space.

  9. Genome-wide analysis of Polycomb targets in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo


    Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.

  10. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin


    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  11. The Tomato U-Box Type E3 Ligase PUB13 Acts With Group III Ubiquitin E2 Enzymes to Modulate FLS2-Mediated Immune Signaling

    Directory of Open Access Journals (Sweden)

    Bangjun Zhou


    Full Text Available In Arabidopsis and rice, the ubiquitin ligase PUB13-mediated protein degradation plays a significant role in plant pattern-triggered immunity (PTI and flowering time control. The Arabidopsis PUB13 has been shown to attenuate the pattern recognition receptor FLS2-mediated immune signaling by ubiquitinating FLS2 and consequently promoting its degradation by the 26S proteasome. Nevertheless, the cognate ubiquitin-conjugating enzymes (E2 with which PUB13 acts to modulate FLS2-mediated PTI are unknown. To address this question, we investigate here the tomato (Solanum lycopersicum homolog of PUB13, SlPUB13 by utilizing the recently characterized complete set of tomato E2s. Of the 13 groups of tomato E2s, only members in group III are found to interact and act with SlPUB13. Knocking-down of the group III E2 genes enhances callose deposition and induction of the RbohB gene in the immunity-associated, early oxidative burst after flg22 treatment. The group III E2s are also found to work with SlPUB13 to ubiquitinate FLS2 in vitro and are required for PUB13-mediated degradation of FLS2 in vivo upon flg22 treatment, suggesting an essential role for group III E2s in the modulation of FLS2-mediated immune signaling by PUB13. Additionally, another immunity-associated E3, NtCMPG1 is shown to also work specifically with members of group III E2 in the in vitro ubiquitination assay, which implies the group III E2 enzymes may cooperate with many E3 ligases to regulate different aspects of PTI. Taken together, these data corroborate the notion that group III E2 enzymes play an important role in PTI and build a foundation for further functional and mechanistic characterization of tomato PUB13.

  12. A Cbx8-containing polycomb complex facilitates the transition to gene activation during ES cell differentiation.

    Directory of Open Access Journals (Sweden)

    Catherine Creppe


    Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.

  13. Interaction proteomics analysis of polycomb proteins defines distinct PRC1 complexes in mammalian cells

    DEFF Research Database (Denmark)

    Vandamme, Julien; Völkel, Pamela; Rosnoblet, Claire


    Polycomb group (PcG) proteins maintain transcriptional repression of hundreds of genes involved in development, signaling or cancer using chromatin-based epigenetic mechanisms. Biochemical studies in Drosophila have revealed that PcG proteins associate in at least two classes of protein complexes...... known as Polycomb repressive complexes 1 and 2 (PRC1 and PRC2). Drosophila core PRC1 is composed of four subunits, Polycomb (Pc), Sex combs extra (Sce), Polyhomeotic (Ph), and Posterior sex combs (Psc). Each of these proteins has multiple orthologs in vertebrates classified respectively as the CBX, RING...... in order to identify interacting partners of CBX family proteins under the same experimental conditions. Our analysis identified with high confidence about 20 proteins co-eluted with CBX2 and CBX7 tagged proteins, about 40 with CBX4, and around 60 with CBX6 and CBX8. We provide evidences that the CBX...

  14. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS. (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali


    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Terminating protein ubiquitination: Hasta la vista, ubiquitin. (United States)

    Stringer, Daniel K; Piper, Robert C


    Ubiquitination is a post-translational modification that generally directs proteins for degradation by the proteasome or by lysosomes. However, ubiquitination has been implicated in many other cellular processes, including transcriptional regulation, DNA repair, regulation of protein-protein interactions and association with ubiquitin-binding scaffolds. Ubiquitination is a dynamic process. Ubiquitin is added to proteins by E3 ubiquitin ligases as a covalent modification to one or multiple lysine residues as well as non-lysine amino acids. Ubiquitin itself contains seven lysines, each of which can also be ubiquitinated, leading to polyubiquitin chains that are best characterized for linkages occurring through K48 and K63. Ubiquitination can also be reversed by the action of deubiquitination enzymes (DUbs). Like E3 ligases, DUbs play diverse and critical roles in cells. ( 1) Ubiquitin is expressed as a fusion protein, as a linear repeat or as a fusion to ribosomal subunits, and DUbs are necessary to liberate free ubiquitin, making them the first enzyme of the ubiquitin cascade. Proteins destined for degradation by the proteasome or by lysosomes are deubiquitinated prior to their degradation, which allows ubiquitin to be recycled by the cell, contributing to the steady-state pool of free ubiquitin. Proteins destined for degradation by lysosomes are also acted upon by both ligases and DUbs. Deubiquitination can also act as a means to prevent protein degradation, and many proteins are thought to undergo rounds of ubiquitination and deubiquitination, ultimately resulting in either the degradation or stabilization of those proteins. Despite years of study, examining the effects of the ubiquitination of proteins remains quite challenging. This is because the methods that are currently being employed to study ubiquitination are limiting. Here, we briefly examine current strategies to study the effects of ubiquitination and describe an additional novel approach that we have

  16. RavN is a member of a previously unrecognized group of Legionella pneumophila E3 ubiquitin ligases (United States)

    Lin, Yi-Han; Evans, Timothy R.; Doms, Alexandra G.; Beauchene, Nicole A.; Hierro, Aitor


    The eukaryotic ubiquitylation machinery catalyzes the covalent attachment of the small protein modifier ubiquitin to cellular target proteins in order to alter their fate. Microbial pathogens exploit this post-translational modification process by encoding molecular mimics of E3 ubiquitin ligases, eukaryotic enzymes that catalyze the final step in the ubiquitylation cascade. Here, we show that the Legionella pneumophila effector protein RavN belongs to a growing class of bacterial proteins that mimic host cell E3 ligases to exploit the ubiquitylation pathway. The E3 ligase activity of RavN was located within its N-terminal region and was dependent upon interaction with a defined subset of E2 ubiquitin-conjugating enzymes. The crystal structure of the N-terminal region of RavN revealed a U-box-like motif that was only remotely similar to other U-box domains, indicating that RavN is an E3 ligase relic that has undergone significant evolutionary alteration. Substitution of residues within the predicted E2 binding interface rendered RavN inactive, indicating that, despite significant structural changes, the mode of E2 recognition has remained conserved. Using hidden Markov model-based secondary structure analyses, we identified and experimentally validated four additional L. pneumophila effectors that were not previously recognized to possess E3 ligase activity, including Lpg2452/SdcB, a new paralog of SidC. Our study provides strong evidence that L. pneumophila is dedicating a considerable fraction of its effector arsenal to the manipulation of the host ubiquitylation pathway. PMID:29415051

  17. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53. (United States)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias


    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori. (United States)

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro


    Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524) and BmScm (331 out of 532), and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

  19. Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Zhiqing Li

    Full Text Available Polycomb group (PcG proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1, Polycomb repressive complex 2 (PRC2, and Pleiohomeotic repressive complex (PhoRC, to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524 and BmScm (331 out of 532, and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

  20. Jarid2 binds mono-ubiquitylated H2A lysine 119 to mediate crosstalk between Polycomb complexes PRC1 and PRC2

    DEFF Research Database (Denmark)

    Cooper, Sarah; Grijzenhout, Anne; Underwood, Elizabeth


    crosstalk between these modifications is critical for the formation of stable Polycomb domains at target gene loci. While the molecular mechanism for recognition of H3K27me3 by PRC1 is well defined, the interaction of PRC2 with H2AK119u1 is poorly understood. Here we demonstrate a critical role for the PRC2...... cofactor Jarid2 in mediating the interaction of PRC2 with H2AK119u1. We identify a ubiquitin interaction motif at the amino-terminus of Jarid2, and demonstrate that this domain facilitates PRC2 localization to H2AK119u1 both in vivo and in vitro. Our findings ascribe a critical function to Jarid2...... and define a key mechanism that links PRC1 and PRC2 in the establishment of Polycomb domains....

  1. Linear ubiquitination in immunity. (United States)

    Shimizu, Yutaka; Taraborrelli, Lucia; Walczak, Henning


    Linear ubiquitination is a post-translational protein modification recently discovered to be crucial for innate and adaptive immune signaling. The function of linear ubiquitin chains is regulated at multiple levels: generation, recognition, and removal. These chains are generated by the linear ubiquitin chain assembly complex (LUBAC), the only known ubiquitin E3 capable of forming the linear ubiquitin linkage de novo. LUBAC is not only relevant for activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinases (MAPKs) in various signaling pathways, but importantly, it also regulates cell death downstream of immune receptors capable of inducing this response. Recognition of the linear ubiquitin linkage is specifically mediated by certain ubiquitin receptors, which is crucial for translation into the intended signaling outputs. LUBAC deficiency results in attenuated gene activation and increased cell death, causing pathologic conditions in both, mice, and humans. Removal of ubiquitin chains is mediated by deubiquitinases (DUBs). Two of them, OTULIN and CYLD, are constitutively associated with LUBAC. Here, we review the current knowledge on linear ubiquitination in immune signaling pathways and the biochemical mechanisms as to how linear polyubiquitin exerts its functions distinctly from those of other ubiquitin linkage types. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.

  2. Polycomb complexes act redundantly to repress genomic repeats and genes

    DEFF Research Database (Denmark)

    Leeb, Martin; Pasini, Diego; Novatchkova, Maria


    Polycomb complexes establish chromatin modifications for maintaining gene repression and are essential for embryonic development in mice. Here we use pluripotent embryonic stem (ES) cells to demonstrate an unexpected redundancy between Polycomb-repressive complex 1 (PRC1) and PRC2 during...... the formation of differentiated cells. ES cells lacking the function of either PRC1 or PRC2 can differentiate into cells of the three germ layers, whereas simultaneous loss of PRC1 and PRC2 abrogates differentiation. On the molecular level, the differentiation defect is caused by the derepression of a set...

  3. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom


    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  4. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila

    DEFF Research Database (Denmark)

    Bantignies, Frédéric; Roure, Virginie; Comet, Itys


    In Drosophila melanogaster, Hox genes are organized in an anterior and a posterior cluster, called Antennapedia complex and bithorax complex, located on the same chromosome arm and separated by 10 Mb of DNA. Both clusters are repressed by Polycomb group (PcG) proteins. Here, we show that genes...... of the two Hox complexes can interact within nuclear PcG bodies in tissues where they are corepressed. This colocalization increases during development and depends on PcG proteins. Hox gene contacts are conserved in the distantly related Drosophila virilis species and they are part of a large gene...

  5. Ubiquitination in apoptosis signaling

    NARCIS (Netherlands)

    van de Kooij, L.W.


    The work described in this thesis focuses on ubiquitination and protein degradation, with an emphasis on how these processes regulate apoptosis signaling. More specifically, our aims were: 1. To increase the understanding of ubiquitin-mediated regulation of apoptosis signaling. 2. To identify the E3

  6. RYBP Is a K63-Ubiquitin-Chain-Binding Protein that Inhibits Homologous Recombination Repair

    Directory of Open Access Journals (Sweden)

    Mohammad A.M. Ali


    Full Text Available Summary: Ring1-YY1-binding protein (RYBP is a member of the non-canonical polycomb repressive complex 1 (PRC1, and like other PRC1 members, it is best described as a transcriptional regulator. However, several PRC1 members were recently shown to function in DNA repair. Here, we report that RYBP preferentially binds K63-ubiquitin chains via its Npl4 zinc finger (NZF domain. Since K63-linked ubiquitin chains are assembled at DNA double-strand breaks (DSBs, we examined the contribution of RYBP to DSB repair. Surprisingly, we find that RYBP is K48 polyubiquitylated by RNF8 and rapidly removed from chromatin upon DNA damage by the VCP/p97 segregase. High expression of RYBP competitively inhibits recruitment of BRCA1 repair complex to DSBs, reducing DNA end resection and homologous recombination (HR repair. Moreover, breast cancer cell lines expressing high endogenous RYBP levels show increased sensitivity to DNA-damaging agents and poly ADP-ribose polymerase (PARP inhibition. These data suggest that RYBP negatively regulates HR repair by competing for K63-ubiquitin chain binding. : Ali et al. find that RYBP binds K63-linked ubiquitin chains and is removed from DNA damage sites. This K63-ubiquitin binding allows RYBP to hinder the recruitment of BRCA1 and Rad51 to DNA double-strand breaks, thus inhibiting homologous recombination repair. Accordingly, cancer cells expressing high RYBP are more sensitive to DNA-damaging therapies. Keywords: DNA damage response, homologous recombination, ubiquitylation, RYBP, polycomb proteins, double-strand break repair, chromatin, histone modification

  7. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53

    DEFF Research Database (Denmark)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice


    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...

  8. Ubiquitination of specific mitochondrial matrix proteins

    International Nuclear Information System (INIS)

    Lehmann, Gilad; Ziv, Tamar; Braten, Ori; Admon, Arie; Udasin, Ronald G.; Ciechanover, Aaron


    Several protein quality control systems in bacteria and/or mitochondrial matrix from lower eukaryotes are absent in higher eukaryotes. These are transfer-messenger RNA (tmRNA), The N-end rule ATP-dependent protease ClpAP, and two more ATP-dependent proteases, HslUV and ClpXP (in yeast). The lost proteases resemble the 26S proteasome and the role of tmRNA and the N-end rule in eukaryotic cytosol is performed by the ubiquitin proteasome system (UPS). Therefore, we hypothesized that the UPS might have substituted these systems – at least partially – in the mitochondrial matrix of higher eukaryotes. Using three independent experimental approaches, we demonstrated the presence of ubiquitinated proteins in the matrix of isolated yeast mitochondria. First, we show that isolated mitochondria contain ubiquitin (Ub) conjugates, which remained intact after trypsin digestion. Second, we demonstrate that the mitochondrial soluble fraction contains Ub-conjugates, several of which were identified by mass spectrometry and are localized to the matrix. Third, using immunoaffinity enrichment by specific antibodies recognizing digested ubiquitinated peptides, we identified a group of Ub-modified matrix proteins. The modification was further substantiated by separation on SDS-PAGE and immunoblots. Last, we attempted to identify the ubiquitin ligase(s) involved, and identified Dma1p as a trypsin-resistant protein in our mitochondrial preparations. Taken together, these data suggest a yet undefined role for the UPS in regulation of the mitochondrial matrix proteins. -- Highlights: •Mitochondrial matrix contains ubiquitinated proteins. •Ubiquitination occurs most probably in the matrix. •Dma1p is a ubiquitin ligase present in mitochondrial preparations.

  9. Ubiquitination of specific mitochondrial matrix proteins

    Energy Technology Data Exchange (ETDEWEB)

    Lehmann, Gilad [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ziv, Tamar [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Braten, Ori [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Admon, Arie [The Smoler Proteomics Center, Faculty of Biology – Technion-Israel Institute of Technology, Haifa, 32000 (Israel); Udasin, Ronald G. [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel); Ciechanover, Aaron, E-mail: [The Janet and David Polak Tumor and Vascular Biology Research Center and the Technion Integrated Cancer Center (TICC), The Rappaport Faculty of Medicine and Research Institute, Haifa, 31096 (Israel)


    Several protein quality control systems in bacteria and/or mitochondrial matrix from lower eukaryotes are absent in higher eukaryotes. These are transfer-messenger RNA (tmRNA), The N-end rule ATP-dependent protease ClpAP, and two more ATP-dependent proteases, HslUV and ClpXP (in yeast). The lost proteases resemble the 26S proteasome and the role of tmRNA and the N-end rule in eukaryotic cytosol is performed by the ubiquitin proteasome system (UPS). Therefore, we hypothesized that the UPS might have substituted these systems – at least partially – in the mitochondrial matrix of higher eukaryotes. Using three independent experimental approaches, we demonstrated the presence of ubiquitinated proteins in the matrix of isolated yeast mitochondria. First, we show that isolated mitochondria contain ubiquitin (Ub) conjugates, which remained intact after trypsin digestion. Second, we demonstrate that the mitochondrial soluble fraction contains Ub-conjugates, several of which were identified by mass spectrometry and are localized to the matrix. Third, using immunoaffinity enrichment by specific antibodies recognizing digested ubiquitinated peptides, we identified a group of Ub-modified matrix proteins. The modification was further substantiated by separation on SDS-PAGE and immunoblots. Last, we attempted to identify the ubiquitin ligase(s) involved, and identified Dma1p as a trypsin-resistant protein in our mitochondrial preparations. Taken together, these data suggest a yet undefined role for the UPS in regulation of the mitochondrial matrix proteins. -- Highlights: •Mitochondrial matrix contains ubiquitinated proteins. •Ubiquitination occurs most probably in the matrix. •Dma1p is a ubiquitin ligase present in mitochondrial preparations.

  10. Polycomb repressive complex 2 (PRC2 restricts hematopoietic stem cell activity.

    Directory of Open Access Journals (Sweden)

    Ian J Majewski


    Full Text Available Polycomb group proteins are transcriptional repressors that play a central role in the establishment and maintenance of gene expression patterns during development. Using mice with an N-ethyl-N-nitrosourea (ENU-induced mutation in Suppressor of Zeste 12 (Suz12, a core component of Polycomb Repressive Complex 2 (PRC2, we show here that loss of Suz12 function enhances hematopoietic stem cell (HSC activity. In addition to these effects on a wild-type genetic background, mutations in Suz12 are sufficient to ameliorate the stem cell defect and thrombocytopenia present in mice that lack the thrombopoietin receptor (c-Mpl. To investigate the molecular targets of the PRC2 complex in the HSC compartment, we examined changes in global patterns of gene expression in cells deficient in Suz12. We identified a distinct set of genes that are regulated by Suz12 in hematopoietic cells, including eight genes that appear to be highly responsive to PRC2 function within this compartment. These data suggest that PRC2 is required to maintain a specific gene expression pattern in hematopoiesis that is indispensable to normal stem cell function.

  11. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis. (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D


    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  12. One, Two, Three: Polycomb Proteins Hit All Dimensions of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Stefania del Prete


    Full Text Available Polycomb group (PcG proteins contribute to the formation and maintenance of a specific repressive chromatin state that prevents the expression of genes in a particular space and time. Polycomb repressive complexes (PRCs consist of several PcG proteins with specific regulatory or catalytic properties. PRCs are recruited to thousands of target genes, and various recruitment factors, including DNA-binding proteins and non-coding RNAs, are involved in the targeting. PcG proteins contribute to a multitude of biological processes by altering chromatin features at different scales. PcG proteins mediate both biochemical modifications of histone tails and biophysical modifications (e.g., chromatin fiber compaction and three-dimensional (3D chromatin conformation. Here, we review the role of PcG proteins in nuclear architecture, describing their impact on the structure of the chromatin fiber, on chromatin interactions, and on the spatial organization of the genome in nuclei. Although little is known about the role of plant PcG proteins in nuclear organization, much is known in the animal field, and we highlight similarities and differences in the roles of PcG proteins in 3D gene regulation in plants and animals.

  13. Polycomb enables primitive endoderm lineage priming in embryonic stem cells

    DEFF Research Database (Denmark)

    Illingworth, Robert S; Hölzenspies, Jurriaan J; Roske, Fabian V


    Mouse embryonic stem cells (ESCs), like the blastocyst from which they are derived, contain precursors of the epiblast (Epi) and primitive endoderm (PrEn) lineages. While transient in vivo, these precursor populations readily interconvert in vitro. We show that altered transcription is the driver...... polycomb with dynamic changes in transcription and stalled lineage commitment, allowing cells to explore alternative choices prior to a definitive decision....

  14. Polycomb group proteins in hematopoietic stem cell aging and malignancies

    NARCIS (Netherlands)

    Klauke, Karin; de Haan, Gerald

    Protection of the transcriptional "stemness" network is important to maintain a healthy hematopoietic stem cells (HSCs) compartment during the lifetime of the organism. Recent evidence shows that fundamental changes in the epigenetic status of HSCs might be one of the driving forces behind many

  15. Integrated Genomic Analysis of the Ubiquitin Pathway across Cancer Types

    Directory of Open Access Journals (Sweden)

    Zhongqi Ge


    Full Text Available Summary: Protein ubiquitination is a dynamic and reversible process of adding single ubiquitin molecules or various ubiquitin chains to target proteins. Here, using multidimensional omic data of 9,125 tumor samples across 33 cancer types from The Cancer Genome Atlas, we perform comprehensive molecular characterization of 929 ubiquitin-related genes and 95 deubiquitinase genes. Among them, we systematically identify top somatic driver candidates, including mutated FBXW7 with cancer-type-specific patterns and amplified MDM2 showing a mutually exclusive pattern with BRAF mutations. Ubiquitin pathway genes tend to be upregulated in cancer mediated by diverse mechanisms. By integrating pan-cancer multiomic data, we identify a group of tumor samples that exhibit worse prognosis. These samples are consistently associated with the upregulation of cell-cycle and DNA repair pathways, characterized by mutated TP53, MYC/TERT amplification, and APC/PTEN deletion. Our analysis highlights the importance of the ubiquitin pathway in cancer development and lays a foundation for developing relevant therapeutic strategies. : Ge et al. analyze a cohort of 9,125 TCGA samples across 33 cancer types to provide a comprehensive characterization of the ubiquitin pathway. They detect somatic driver candidates in the ubiquitin pathway and identify a cluster of patients with poor survival, highlighting the importance of this pathway in cancer development. Keywords: ubiquitin pathway, pan-cancer analysis, The Cancer Genome Atlas, tumor subtype, cancer prognosis, therapeutic targets, biomarker, FBXW7

  16. Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing (United States)

    Tie, Feng; Banerjee, Rakhee; Saiakhova, Alina R.; Howard, Benny; Monteith, Kelsey E.; Scacheri, Peter C.; Cosgrove, Michael S.; Harte, Peter J.


    Trithorax (TRX) antagonizes epigenetic silencing by Polycomb group (PcG) proteins, stimulates enhancer-dependent transcription, and establishes a ‘cellular memory’ of active transcription of PcG-regulated genes. The mechanisms underlying these TRX functions remain largely unknown, but are presumed to involve its histone H3K4 methyltransferase activity. We report that the SET domains of TRX and TRX-related (TRR) have robust histone H3K4 monomethyltransferase activity in vitro and that Tyr3701 of TRX and Tyr2404 of TRR prevent them from being trimethyltransferases. The trxZ11 missense mutation (G3601S), which abolishes H3K4 methyltransferase activity in vitro, reduces the H3K4me1 but not the H3K4me3 level in vivo. trxZ11 also suppresses the impaired silencing phenotypes of the Pc3 mutant, suggesting that H3K4me1 is involved in antagonizing Polycomb silencing. Polycomb silencing is also antagonized by TRX-dependent H3K27 acetylation by CREB-binding protein (CBP). We show that perturbation of Polycomb silencing by TRX overexpression requires CBP. We also show that TRX and TRR are each physically associated with CBP in vivo, that TRX binds directly to the CBP KIX domain, and that the chromatin binding patterns of TRX and TRR are highly correlated with CBP and H3K4me1 genome-wide. In vitro acetylation of H3K27 by CBP is enhanced on K4me1-containing H3 substrates, and independently altering the H3K4me1 level in vivo, via the H3K4 demethylase LSD1, produces concordant changes in H3K27ac. These data indicate that the catalytic activities of TRX and CBP are physically coupled and suggest that both activities play roles in antagonizing Polycomb silencing, stimulating enhancer activity and cellular memory. PMID:24550119

  17. Mechanisms of mono- and poly-ubiquitination: Ubiquitination specificity depends on compatibility between the E2 catalytic core and amino acid residues proximal to the lysine

    Directory of Open Access Journals (Sweden)

    Sadowski Martin


    Full Text Available Abstract Ubiquitination involves the attachment of ubiquitin to lysine residues on substrate proteins or itself, which can result in protein monoubiquitination or polyubiquitination. Ubiquitin attachment to different lysine residues can generate diverse substrate-ubiquitin structures, targeting proteins to different fates. The mechanisms of lysine selection are not well understood. Ubiquitination by the largest group of E3 ligases, the RING-family E3 s, is catalyzed through co-operation between the non-catalytic ubiquitin-ligase (E3 and the ubiquitin-conjugating enzyme (E2, where the RING E3 binds the substrate and the E2 catalyzes ubiquitin transfer. Previous studies suggest that ubiquitination sites are selected by E3-mediated positioning of the lysine toward the E2 active site. Ultimately, at a catalytic level, ubiquitination of lysine residues within the substrate or ubiquitin occurs by nucleophilic attack of the lysine residue on the thioester bond linking the E2 catalytic cysteine to ubiquitin. One of the best studied RING E3/E2 complexes is the Skp1/Cul1/F box protein complex, SCFCdc4, and its cognate E2, Cdc34, which target the CDK inhibitor Sic1 for K48-linked polyubiquitination, leading to its proteasomal degradation. Our recent studies of this model system demonstrated that residues surrounding Sic1 lysines or lysine 48 in ubiquitin are critical for ubiquitination. This sequence-dependence is linked to evolutionarily conserved key residues in the catalytic region of Cdc34 and can determine if Sic1 is mono- or poly-ubiquitinated. Our studies indicate that amino acid determinants in the Cdc34 catalytic region and their compatibility to those surrounding acceptor lysine residues play important roles in lysine selection. This may represent a general mechanism in directing the mode of ubiquitination in E2 s.

  18. Mel-18, a mammalian Polycomb gene, regulates angiogenic gene expression of endothelial cells. (United States)

    Jung, Ji-Hye; Choi, Hyun-Jung; Maeng, Yong-Sun; Choi, Jung-Yeon; Kim, Minhyung; Kwon, Ja-Young; Park, Yong-Won; Kim, Young-Myeong; Hwang, Daehee; Kwon, Young-Guen


    Mel-18 is a mammalian homolog of Polycomb group (PcG) genes. Microarray analysis revealed that Mel-18 expression was induced during endothelial progenitor cell (EPC) differentiation and correlates with the expression of EC-specific protein markers. Overexpression of Mel-18 promoted EPC differentiation and angiogenic activity of ECs. Accordingly, silencing Mel-18 inhibited EC migration and tube formation in vitro. Gene expression profiling showed that Mel-18 regulates angiogenic genes including kinase insert domain receptor (KDR), claudin 5, and angiopoietin-like 2. Our findings demonstrate, for the first time, that Mel-18 plays a significant role in the angiogenic function of ECs by regulating endothelial gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. Clarifying the impact of polycomb complex component disruption in human cancers. (United States)

    Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko


    The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.

  20. Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism.

    Directory of Open Access Journals (Sweden)

    Erik Södersten


    Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.

  1. Ruled by Ubiquitylation: A New Order for Polycomb Recruitment

    Directory of Open Access Journals (Sweden)

    Yuri B. Schwartz


    Full Text Available Polycomb complexes are found in most cells, but they must be targeted to specific genes in specific cell types in order to regulate pluripotency and differentiation. The recruitment of Polycomb complexes to specific targets has been widely thought to occur in two steps: first, one complex, PRC2, produces histone H3 lysine 27 (H3K27 trimethylation at a specific gene, and then the PRC1 complex is recruited by its ability to bind to H3K27me3. Now, three new articles turn this model upside-down by showing that binding of a variant PRC1 complex and subsequent H2A ubiquitylation of surrounding chromatin is sufficient to trigger the recruitment of PRC2 and H3K27 trimethylation. These studies also show that ubiquitylated H2A is directly sensed by PRC2 and that ablation of PRC1-mediated H2A ubiquitylation impairs genome-wide PRC2 binding and disrupts mouse development.

  2. Chaperones, but not oxidized proteins, are ubiquitinated after oxidative stress

    DEFF Research Database (Denmark)

    Kästle, Marc; Reeg, Sandra; Rogowska-Wrzesinska, Adelina


    of these proteins by MALDI tandem mass spectrometry (MALDI MS/MS). As a result we obtained 24 different proteins which can be categorized into the following groups: chaperones, energy metabolism, cytoskeleton/intermediate filaments, and protein translation/ribosome biogenesis. The special set of identified......, ubiquitinated proteins confirm the thesis that ubiquitination upon oxidative stress is no random process to degrade the mass of oxidized proteins, but concerns a special group of functional proteins....

  3. Alternative epigenetic chromatin states of polycomb target genes.

    Directory of Open Access Journals (Sweden)

    Yuri B Schwartz


    Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.

  4. Ubiquitin domain proteins in disease

    DEFF Research Database (Denmark)

    Klausen, Louise Kjær; Schulze, Andrea; Seeger, Michael


    The human genome encodes several ubiquitin-like (UBL) domain proteins (UDPs). Members of this protein family are involved in a variety of cellular functions and many are connected to the ubiquitin proteasome system, an essential pathway for protein degradation in eukaryotic cells. Despite...... and cancer. Publication history: Republished from Current BioData's Targeted Proteins database (TPdb;

  5. The ubiquitin-proteasome system

    Indian Academy of Sciences (India)

    ... the discovery of protein ubiquitination has led to the recognition of cellular proteolysis as a central area of research in biology. Eukaryotic proteins targeted for degradation by this pathway are first 'tagged' by multimers of a protein known as ubiquitin and are later proteolyzed by a giant enzyme known as the proteasome.

  6. Ubiquitin Proteasome System in Parkinson Disease: a keeper or a witness? (United States)

    Martins-Branco, Diogo; Esteves, Ana R.; Santos, Daniel; Arduino, Daniela M.; Swerdlow, Russell H.; Oliveira, Catarina R.; Januario, Cristina; Cardoso, Sandra M.


    Objective The aim of this work was to evaluate the role of Ubiquitin-Proteasome System (UPS) on mitochondrial-driven alpha-synuclein (aSN) clearance in in vitro, ex vivo and in vivo Parkinson disease (PD) cellular models. Method We used SH-SY5Y ndufa2 knock-down (KD) cells, PD cybrids and peripheral blood mononuclear cells (PBMC) from patients meeting the diagnostic criteria for PD. We quantified aSN aggregation, proteasome activity and protein ubiquitination levels. In PBMC of PD patients population we evaluated aSN levels in plasma and the influence of several demographic characteristics in the above mentioned determinations. Results We found that ubiquitin-independent proteasome activity was up-regulated in SH-SY5Y ndufa2 KD cells while a down regulation was observed in PD cybrids and PBMC. Moreover, we observed an increase in protein ubiquitination that correlates with a decrease in ubiquitin-dependent proteasome activity. Accordingly, proteasome inhibition prevented ubiquitin-dependent aSN clearance. Ubiquitin-independent proteasome activity was positively correlated with ubiquitination in PBMC. We also report a negative correlation of chymotrypsin-like activity with age in control and late-onset PD groups. Total ubiquitin content is positively correlated with aSN oligomers levels, which leads to an age-dependent increase of aSN ubiquitination in LOPD. Moreover, aSN levels are increased in the plasma of PD patients. Interpretation aSN oligomers are ubiquitinated and we identified an ubiquitin-dependent clearance insufficiency with accumulation of both aSN and ubiquitin. However, SH-SY5Y ndufa2 KD cells showed a significant up-regulation of ubiquitin-independent proteasomal enzymatic activity that could mean a cell rescue attempt. Moreover, we identified that UPS function is age-dependent in PBMC. PMID:22921536

  7. RFWD3-Dependent Ubiquitination of RPA Regulates Repair at Stalled Replication Forks. (United States)

    Elia, Andrew E H; Wang, David C; Willis, Nicholas A; Boardman, Alexander P; Hajdu, Ildiko; Adeyemi, Richard O; Lowry, Elizabeth; Gygi, Steven P; Scully, Ralph; Elledge, Stephen J


    We have used quantitative proteomics to profile ubiquitination in the DNA damage response (DDR). We demonstrate that RPA, which functions as a protein scaffold in the replication stress response, is multiply ubiquitinated upon replication fork stalling. Ubiquitination of RPA occurs on chromatin, involves sites outside its DNA binding channel, does not cause proteasomal degradation, and increases under conditions of fork collapse, suggesting a role in repair at stalled forks. We demonstrate that the E3 ligase RFWD3 mediates RPA ubiquitination. RFWD3 is necessary for replication fork restart, normal repair kinetics during replication stress, and homologous recombination (HR) at stalled replication forks. Mutational analysis suggests that multisite ubiquitination of the entire RPA complex is responsible for repair at stalled forks. Multisite protein group sumoylation is known to promote HR in yeast. Our findings reveal a similar requirement for multisite protein group ubiquitination during HR at stalled forks in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. SUMO-targeted ubiquitin ligases. (United States)

    Sriramachandran, Annie M; Dohmen, R Jürgen


    Covalent posttranslational modification with SUMO (small ubiquitin-related modifier) modulates functions of a wide range of proteins in eukaryotic cells. Sumoylation affects the activity, interaction properties, subcellular localization and the stability of its substrate proteins. The recent discovery of a novel class of ubiquitin ligases (E3), termed ULS (E3-S) or STUbL, that recognize sumoylated proteins, links SUMO modification to the ubiquitin/proteasome system. Here we review recent insights into the properties and function of these ligases and their roles in regulating sumoylated proteins. This article is part of a Special Issue entitled: Ubiquitin-Proteasome System. Guest Editors: Thomas Sommer and Dieter H. Wolf. © 2013. Published by Elsevier B.V. All rights reserved.

  9. Switch-Like Roles for Polycomb Proteins from Neurodevelopment to Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Anke Hoffmann


    Full Text Available Polycomb Group (PcG proteins are best-known for maintaining repressive or active chromatin states that are passed on across multiple cell divisions, and thus sustain long-term memory of gene expression. PcG proteins engage different, partly gene- and/or stage-specific, mechanisms to mediate spatiotemporal gene expression during central nervous system development. In the course of this, PcG proteins bind to various cis-regulatory sequences (e.g., promoters, enhancers or silencers and coordinate, as well the interactions between distantly separated genomic regions to control chromatin function at different scales ranging from compaction of the linear chromatin to the formation of topological hubs. Recent findings show that PcG proteins are involved in switch-like changes in gene expression states of selected neural genes during the transition from multipotent to differentiating cells, and then to mature neurons. Beyond neurodevelopment, PcG proteins sustain mature neuronal function and viability, and prevent progressive neurodegeneration in mice. In support of this view, neuropathological findings from human neurodegenerative diseases point to altered PcG functions. Overall, improved insight into the multiplicity of PcG functions may advance our understanding of human neurodegenerative diseases and ultimately pave the way to new therapies.

  10. Effects of exogenous ubiquitin in a polytrauma model with blunt chest trauma (United States)

    Baker, Todd A.; Romero, Jacqueline; Bach, Harold H.; Strom, Joel A.; Gamelli, Richard L.; Majetschak, Matthias


    Objective To determine whether treatment with the CXC chemokine receptor (CXCR) 4 agonist ubiquitin results in beneficial effects in a polytrauma model consisting of bilateral femur fractures plus blunt chest trauma (Injury Severity Score 18-25). Design Treatment study. Setting Research Laboratory. Subjects Seventeen Yorkshire pigs. Interventions Intravenous (i.v.) injection of 1.5 mg/kg ubiquitin or albumin (=control) at 60 min after polytrauma. Measurements and Main Results Anesthetized, mechanically ventilated pigs underwent polytrauma, followed by a simulated 60 min shock phase. At the end of the shock phase ubiquitin or albumin were administered and animals were resuscitated to a mean arterial blood pressure of 70 mmHg until t = 420 min. After i.v. ubiquitin, ubiquitin plasma concentrations increased sixteen-fold to 2870 ± 1015 ng/mL at t = 90 min and decreased with t1/2 = 60 min. Endogenous plasma ubiquitin increased two-fold in the albumin group with peak levels of 359 ± 210 ng/mL. Plasma levels of the cognate CXCR4 ligand stromal cell-derived factor (SDF)-1α were unchanged in both groups. Ubiquitin treatment reduced arterial lactate levels and prevented a continuous decrease in arterial oxygenation, which occurred in the albumin group during resuscitation. Wet weight to dry weight ratios of the lung contralateral from the injury, heart, spleen and jejunum were lower with ubiquitin. With ubiquitin treatment, tissue levels of IL-8, IL-10, TNFα and SDF-1α were reduced in the injured lung and of IL-8 in the contralateral lung, respectively. Conclusions Administration of exogenous ubiquitin modulates the local inflammatory response, improves resuscitation, reduces fluid shifts into tissues and preserves arterial oxygenation after blunt polytrauma with lung injury. This study further supports the notion that ubiquitin is a promising protein therapeutic and implies CXCR4 as a drug target after polytrauma. PMID:22622399

  11. Linear ubiquitination signals in adaptive immune responses. (United States)

    Ikeda, Fumiyo


    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma. (United States)

    Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D; Schlecht, Nicolas F; Einstein, Mark H; Greally, John M


    Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors.

  13. Polycomb proteins control proliferation and transformation independently of cell cycle checkpoints by regulating DNA replication

    DEFF Research Database (Denmark)

    Piunti, Andrea; Rossi, Alessandra; Cerutti, Aurora


    The ability of PRC1 and PRC2 to promote proliferation is a main feature that links polycomb (PcG) activity to cancer. PcGs silence the expression of the tumour suppressor locus Ink4a/Arf, whose products positively regulate pRb and p53 functions. Enhanced PcG activity is a frequent feature of human...

  14. The Arabidopsis GAGA-Binding Factor BASIC PENTACYSTEINE6 Recruits the POLYCOMB-REPRESSIVE COMPLEX1 Component LIKE HETEROCHROMATIN PROTEIN1 to GAGA DNA Motifs. (United States)

    Hecker, Andreas; Brand, Luise H; Peter, Sébastien; Simoncello, Nathalie; Kilian, Joachim; Harter, Klaus; Gaudin, Valérie; Wanke, Dierk


    Polycomb-repressive complexes (PRCs) play key roles in development by repressing a large number of genes involved in various functions. Much, however, remains to be discovered about PRC-silencing mechanisms as well as their targeting to specific genomic regions. Besides other mechanisms, GAGA-binding factors in animals can guide PRC members in a sequence-specific manner to Polycomb-responsive DNA elements. Here, we show that the Arabidopsis (Arabidopsis thaliana) GAGA-motif binding factor protein basic pentacysteine6 (BPC6) interacts with like heterochromatin protein1 (LHP1), a PRC1 component, and associates with vernalization2 (VRN2), a PRC2 component, in vivo. By using a modified DNA-protein interaction enzyme-linked immunosorbant assay, we could show that BPC6 was required and sufficient to recruit LHP1 to GAGA motif-containing DNA probes in vitro. We also found that LHP1 interacts with VRN2 and, therefore, can function as a possible scaffold between BPC6 and VRN2. The lhp1-4 bpc4 bpc6 triple mutant displayed a pleiotropic phenotype, extreme dwarfism and early flowering, which disclosed synergistic functions of LHP1 and group II plant BPC members. Transcriptome analyses supported this synergy and suggested a possible function in the concerted repression of homeotic genes, probably through histone H3 lysine-27 trimethylation. Hence, our findings suggest striking similarities between animal and plant GAGA-binding factors in the recruitment of PRC1 and PRC2 components to Polycomb-responsive DNA element-like GAGA motifs, which must have evolved through convergent evolution. © 2015 American Society of Plant Biologists. All Rights Reserved.

  15. Dynamic survey of mitochondria by ubiquitin (United States)

    Escobar-Henriques, Mafalda; Langer, Thomas


    Ubiquitin is a post-translational modifier with proteolytic and non-proteolytic roles in many biological processes. At mitochondria, it performs regulatory homeostatic functions and contributes to mitochondrial quality control. Ubiquitin is essential for mitochondrial fusion, regulates mitochondria-ER contacts, and participates in maternal mtDNA inheritance. Under stress, mitochondrial dysfunction induces ubiquitin-dependent responses that involve mitochondrial proteome remodeling and culminate in organelle removal by mitophagy. In addition, many ubiquitin-dependent mechanisms have been shown to regulate innate immune responses and xenophagy. Here, we review the emerging roles of ubiquitin at mitochondria. PMID:24569520

  16. Polycomb Protein OsFIE2 Affects Plant Height and Grain Yield in Rice.

    Directory of Open Access Journals (Sweden)

    Xianbo Liu

    Full Text Available Polycomb group (PcG proteins have been shown to affect growth and development in plants. To further elucidate their role in these processes in rice, we isolated and characterized a rice mutant which exhibits dwarfism, reduced seed setting rate, defective floral organ, and small grains. Map-based cloning revealed that abnormal phenotypes were attributed to a mutation of the Fertilization Independent Endosperm 2 (OsFIE2 protein, which belongs to the PcG protein family. So we named the mutant as osfie2-1. Histological analysis revealed that the number of longitudinal cells in the internodes decreased in osfie2-1, and that lateral cell layer of the internodes was markedly thinner than wild-type. In addition, compared to wild-type, the number of large and small vascular bundles decreased in osfie2-1, as well as cell number and cell size in spikelet hulls. OsFIE2 is expressed in most tissues and the coded protein localizes in both nucleus and cytoplasm. Yeast two-hybrid and bimolecular fluorescence complementation assays demonstrated that OsFIE2 interacts with OsiEZ1 which encodes an enhancer of zeste protein previously identified as a histone methylation enzyme. RNA sequencing-based transcriptome profiling and qRT-PCR analysis revealed that some homeotic genes and genes involved in endosperm starch synthesis, cell division/expansion and hormone synthesis and signaling are differentially expressed between osfie2-1 and wild-type. In addition, the contents of IAA, GA3, ABA, JA and SA in osfie2-1 are significantly different from those in wild-type. Taken together, these results indicate that OsFIE2 plays an important role in the regulation of plant height and grain yield in rice.

  17. Non-degradative Ubiquitination of Protein Kinases.

    Directory of Open Access Journals (Sweden)

    K Aurelia Ball


    Full Text Available Growing evidence supports other regulatory roles for protein ubiquitination in addition to serving as a tag for proteasomal degradation. In contrast to other common post-translational modifications, such as phosphorylation, little is known about how non-degradative ubiquitination modulates protein structure, dynamics, and function. Due to the wealth of knowledge concerning protein kinase structure and regulation, we examined kinase ubiquitination using ubiquitin remnant immunoaffinity enrichment and quantitative mass spectrometry to identify ubiquitinated kinases and the sites of ubiquitination in Jurkat and HEK293 cells. We find that, unlike phosphorylation, ubiquitination most commonly occurs in structured domains, and on the kinase domain, ubiquitination is concentrated in regions known to be important for regulating activity. We hypothesized that ubiquitination, like other post-translational modifications, may alter the conformational equilibrium of the modified protein. We chose one human kinase, ZAP-70, to simulate using molecular dynamics with and without a monoubiquitin modification. In Jurkat cells, ZAP-70 is ubiquitinated at several sites that are not sensitive to proteasome inhibition and thus may have other regulatory roles. Our simulations show that ubiquitination influences the conformational ensemble of ZAP-70 in a site-dependent manner. When monoubiquitinated at K377, near the C-helix, the active conformation of the ZAP-70 C-helix is disrupted. In contrast, when monoubiquitinated at K476, near the kinase hinge region, an active-like ZAP-70 C-helix conformation is stabilized. These results lead to testable hypotheses that ubiquitination directly modulates kinase activity, and that ubiquitination is likely to alter structure, dynamics, and function in other protein classes as well.

  18. Polycomb Cbx family members mediate the balance between haematopoietic stem cell self-renewal and differentiation

    DEFF Research Database (Denmark)

    Klauke, Karin; Radulović, Višnja; Broekhuis, Mathilde


    The balance between self-renewal and differentiation of adult stem cells is essential for tissue homeostasis. Here we show that in the haematopoietic system this process is governed by polycomb chromobox (Cbx) proteins. Cbx7 is specifically expressed in haematopoietic stem cells (HSCs), and its...... overexpression enhances self-renewal and induces leukaemia. This effect is dependent on integration into polycomb repressive complex-1 (PRC1) and requires H3K27me3 binding. In contrast, overexpression of Cbx2, Cbx4 or Cbx8 results in differentiation and exhaustion of HSCs. ChIP-sequencing analysis shows that Cbx......7 and Cbx8 share most of their targets; we identified approximately 200 differential targets. Whereas genes targeted by Cbx8 are highly expressed in HSCs and become repressed in progenitors, Cbx7 targets show the opposite expression pattern. Thus, Cbx7 preserves HSC self-renewal by repressing...

  19. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.


    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  20. A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma (United States)

    Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D.; Schlecht, Nicolas F.; Einstein, Mark H.; Greally, John M.


    Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors. PMID:27557505

  1. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.


    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  2. REST-mediated recruitment of polycomb repressor complexes in mammalian cells

    DEFF Research Database (Denmark)

    Dietrich, Nikolaj; Lerdrup, Mads; Landt, Eskild


    Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1......, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest¿/¿ and Eed¿/¿ mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently...... of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest¿/¿ mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context...

  3. Ubiquitination in Periodontal Disease: A Review. (United States)

    Tsuchida, Sachio; Satoh, Mamoru; Takiwaki, Masaki; Nomura, Fumio


    Periodontal disease (periodontitis) is a chronic inflammatory condition initiated by microbial infection that leads to gingival tissue destruction and alveolar bone resorption. The periodontal tissue's response to dental plaque is characterized by the accumulation of polymorphonuclear leukocytes, macrophages, and lymphocytes, all of which release inflammatory mediators and cytokines to orchestrate the immunopathogenesis of periodontal disease. Ubiquitination is achieved by a mechanism that involves a number of factors, including an ubiquitin-activating enzyme, ubiquitin-conjugating enzyme, and ubiquitin-protein ligase. Ubiquitination is a post-translational modification restricted to eukaryotes that are involved in essential host processes. The ubiquitin system has been implicated in the immune response, development, and programmed cell death. Increasing numbers of recent reports have provided evidence that many approaches are delivering promising reports for discovering the relationship between ubiquitination and periodontal disease. The scope of this review was to investigate recent progress in the discovery of ubiquitinated protein in diseased periodontium and to discuss the ubiquitination process in periodontal diseases.

  4. Auto-ubiquitination of Mdm2 Enhances Its Substrate Ubiquitin Ligase Activity* (United States)

    Ranaweera, Ruchira S.; Yang, Xiaolu


    The RING domain E3 ubiquitin ligase Mdm2 is the master regulator of the tumor suppressor p53. It targets p53 for proteasomal degradation, restraining the potent activity of p53 and enabling cell survival and proliferation. Like most E3 ligases, Mdm2 can also ubiquitinate itself. How Mdm2 auto-ubiquitination may influence its substrate ubiquitin ligase activity is undefined. Here we show that auto-ubiquitination of Mdm2 is an activating event. Mdm2 that has been conjugated to polyubiquitin chains, but not to single ubiquitins, exhibits substantially enhanced activity to polyubiquitinate p53. Mechanistically, auto-ubiquitination of Mdm2 facilitates the recruitment of the E2 ubiquitin-conjugating enzyme. This occurs through noncovalent interactions between the ubiquitin chains on Mdm2 and the ubiquitin binding domain on E2s. Mutations that diminish the noncovalent interactions render auto-ubiquitination unable to stimulate Mdm2 substrate E3 activity. These results suggest a model in which polyubiquitin chains on an E3 increase the local concentration of E2 enzymes and permit the processivity of substrate ubiquitination. They also support the notion that autocatalysis may be a prevalent mode for turning on the activity of latent enzymes. PMID:23671280

  5. Polycomb domain formation depends on short and long distance regulatory cues.

    Directory of Open Access Journals (Sweden)

    Bernd Schuettengruber

    Full Text Available BACKGROUND: Polycomb group (PcG proteins dynamically define cellular identities through the epigenetic repression of key developmental genes. In Drosophila, cis-regulatory regions termed PcG response elements (PREs act as nucleation sites for PcG proteins to create large repressive PcG domains that are marked by trimethylation of lysine 27 on histone H3 (H3K27me3. In addition to an action in cis, PREs can interact over long distances, thereby enhancing PcG dependent silencing. How PcG domains are established, which factors limit their propagation in cis, and how long range interactions of PREs in trans affect the chromatin structure is largely unknown. PRINCIPAL FINDINGS: We demonstrate that the insertion of a PRE-containing transgene in the Drosophila genome generates an artificial PcG domain and we analyze its organization by quantitative ChIP and ChIP-on-chip experiments. Intriguingly, a boundary element and known insulator proteins do not necessarily interfere with spreading of H3K27me3. Instead, domain borders correlate with the presence of promoter regions bound by RNA Polymerase II and active chromatin marks. In contrast, genes that are silent during early fly development get included within the PcG domain and this incorporation interferes with gene activation at later developmental stages. Moreover, trans-interaction of the transgenic PRE with its homologous endogenous PRE results in increased PcG binding, correlating with reinforced silencing of genes within the domain borders. CONCLUSIONS: Our results suggest that higher-order organization of PcG-bound chromatin can stabilize gene silencing within PcG domains. Further we propose that multi-protein complexes associated with active promoters are able to define the limits of PcG domains. Future work aimed to pinpoint the factors providing this barrier function will be required to understand the precise molecular mechanism by which active promoter regions can act as boundaries to stop

  6. Ubiquitin--conserved protein or selfish gene? (United States)

    Catic, André; Ploegh, Hidde L


    The posttranslational modifier ubiquitin is encoded by a multigene family containing three primary members, which yield the precursor protein polyubiquitin and two ubiquitin moieties, Ub(L40) and Ub(S27), that are fused to the ribosomal proteins L40 and S27, respectively. The gene encoding polyubiquitin is highly conserved and, until now, those encoding Ub(L40) and Ub(S27) have been generally considered to be equally invariant. The evolution of the ribosomal ubiquitin moieties is, however, proving to be more dynamic. It seems that the genes encoding Ub(L40) and Ub(S27) are actively maintained by homologous recombination with the invariant polyubiquitin locus. Failure to recombine leads to deterioration of the sequence of the ribosomal ubiquitin moieties in several phyla, although this deterioration is evidently constrained by the structural requirements of the ubiquitin fold. Only a few amino acids in ubiquitin are vital for its function, and we propose that conservation of all three ubiquitin genes is driven not only by functional properties of the ubiquitin protein, but also by the propensity of the polyubiquitin locus to act as a 'selfish gene'.

  7. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao


    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  8. Met1-linked Ubiquitination in Immune Signalling

    DEFF Research Database (Denmark)

    Fiil, Berthe Katrine; Gyrd-Hansen, Mads


    Methionine 1-linked ubiquitin chains (Met1-Ub), or linear ubiquitin, has emerged as a central post-translational modification in innate immune signalling. Molecular machinery that assembles, senses and, more recently, disassembles Met1-Ub has been identified, and technical advances have enabled...... identification of physiological substrates for Met1-Ub in response to activation of innate immune receptors. These discoveries have significantly advanced our understanding of how non-degradative ubiquitin modifications control pro-inflammatory responses mediated by nuclear factor κB and mitogen...

  9. Structural basis for ubiquitin recognition by ubiquitin-binding zinc finger of FAAP20.

    Directory of Open Access Journals (Sweden)

    Aya Toma

    Full Text Available Several ubiquitin-binding zinc fingers (UBZs have been reported to preferentially bind K63-linked ubiquitin chains. In particular, the UBZ domain of FAAP20 (FAAP20-UBZ, a member of the Fanconi anemia core complex, seems to recognize K63-linked ubiquitin chains, in order to recruit the complex to DNA interstrand crosslinks and mediate DNA repair. By contrast, it is reported that the attachment of a single ubiquitin to Rev1, a translesion DNA polymerase, increases binding of Rev1 to FAAP20. To clarify the specificity of FAAP20-UBZ, we determined the crystal structure of FAAP20-UBZ in complex with K63-linked diubiquitin at 1.9 Å resolution. In this structure, FAAP20-UBZ interacts only with one of the two ubiquitin moieties. Consistently, binding assays using surface plasmon resonance spectrometry showed that FAAP20-UBZ binds ubiquitin and M1-, K48- and K63-linked diubiquitin chains with similar affinities. Residues in the vicinity of Ala168 within the α-helix and the C-terminal Trp180 interact with the canonical Ile44-centered hydrophobic patch of ubiquitin. Asp164 within the α-helix and the C-terminal loop mediate a hydrogen bond network, which reinforces ubiquitin-binding of FAAP20-UBZ. Mutations of the ubiquitin-interacting residues disrupted binding to ubiquitin in vitro and abolished the accumulation of FAAP20 to DNA damage sites in vivo. Finally, structural comparison among FAAP20-UBZ, WRNIP1-UBZ and RAD18-UBZ revealed distinct modes of ubiquitin binding. UBZ family proteins could be divided into at least three classes, according to their ubiquitin-binding modes.

  10. Origin of the polycomb repressive complex 2 and gene silencing by an E(z) homolog in the unicellular alga Chlamydomonas. (United States)

    Shaver, Scott; Casas-Mollano, J Armando; Cerny, Ronald L; Cerutti, Heriberto


    Polycomb group proteins play an essential role in the maintenance of cell identity and the regulation of development in both animals and plants. The Polycomb Repressive Complex 2 (PRC2) is involved in the establishment of transcriptionally silent chromatin states, in part through its ability to methylate lysine 27 of histone H3 by the Enhancer of zeste [E(z)] subunit. The absence of PRC2 in unicellular model fungi and its function in the repression of genes vital for the development of higher eukaryotes led to the proposal that this complex may have evolved together with the emergence of multicellularity. However, we report here on the widespread presence of PRC2 core subunits in unicellular eukaryotes from the Opisthokonta, Chromalveolata and Archaeplastida supergroups. To gain insight on the role of PRC2 in single celled organisms, we characterized an E(z) homolog, EZH, in the green alga Chlamydomonas reinhardtii. RNAi-mediated suppression of EZH led to defects in the silencing of transgenes and retrotransposons as well as to a global increase in histone post-translational modifications associated with transcriptional activity, such as trimethylation of histone H3 lysine 4 and acetylation of histone H4. On the basis of the parsimony principle, our findings suggest that PRC2 appeared early in eukaryotic evolution, even perhaps in the last unicellular common ancestor of eukaryotes. One of the ancestral roles of PCR2 may have been in defense responses against intragenomic parasites such as transposable elements, prior to being co-opted for lineage specific functions like developmental regulation in multicellular eukaryotes.

  11. Histone H3 Serine 28 Is Essential for Efficient Polycomb-Mediated Gene Repression in Drosophila

    Directory of Open Access Journals (Sweden)

    Philip Yuk Kwong Yung


    Full Text Available Trimethylation at histone H3K27 is central to the polycomb repression system. Juxtaposed to H3K27 is a widely conserved phosphorylatable serine residue (H3S28 whose function is unclear. To assess the importance of H3S28, we generated a Drosophila H3 histone mutant with a serine-to-alanine mutation at position 28. H3S28A mutant cells lack H3S28ph on mitotic chromosomes but support normal mitosis. Strikingly, all methylation states of H3K27 drop in H3S28A cells, leading to Hox gene derepression and to homeotic transformations in adult tissues. These defects are not caused by active H3K27 demethylation nor by the loss of H3S28ph. Biochemical assays show that H3S28A nucleosomes are a suboptimal substrate for PRC2, suggesting that the unphosphorylated state of serine 28 is important for assisting in the function of polycomb complexes. Collectively, our data indicate that the conserved H3S28 residue in metazoans has a role in supporting PRC2 catalysis.

  12. Ubiquitin-mediated proteolysis in Xenopus extract. (United States)

    McDowell, Gary S; Philpott, Anna


    The small protein modifier, ubiquitin, can be covalently attached to proteins in the process of ubiquitylation, resulting in a variety of functional outcomes. In particular, the most commonly-associated and well-studied fate for proteins modified with ubiquitin is their ultimate destruction: degradation by the 26S proteasome via the ubiquitin-proteasome system, or digestion in lysosomes by proteolytic enzymes. From the earliest days of ubiquitylation research, a reliable and versatile "cell-in-a-test-tube" system has been employed in the form of cytoplasmic extracts from the eggs and embryos of the frog Xenopus laevis. Biochemical studies of ubiquitin and protein degradation using this system have led to significant advances particularly in the study of ubiquitin-mediated proteolysis, while the versatility of Xenopus as a developmental model has allowed investigation of the in vivo consequences of ubiquitylation. Here we describe the use and history of Xenopus extract in the study of ubiquitin-mediated protein degradation, and highlight the versatility of this system that has been exploited to uncover mechanisms and consequences of ubiquitylation and proteolysis.

  13. Protection against murine osteoarthritis by inhibition of the 26S proteasome and lysine-48 linked ubiquitination. (United States)

    Radwan, Marta; Wilkinson, David J; Hui, Wang; Destrument, Auriane P M; Charlton, Sarah H; Barter, Matt J; Gibson, Beth; Coulombe, Josée; Gray, Douglas A; Rowan, Andrew D; Young, David A


    To determine whether the process of ubiquitination and/or activity of the 26S proteasome are involved in the induction of osteoarthritis (OA). Bovine cartilage resorption assays, chondrocyte cell-line SW1353 and primary human articular chondrocytes were used with the general proteasome inhibitor MG132 or vehicle to identify a role of the ubiquitin-proteasome system (UPS) in cartilage destruction and matrix metalloproteinase-13 (MMP13) expression. In vivo, MG132 or vehicle, were delivered subcutaneously to mice following destabilisation of the medial meniscus (DMM)-induced OA. Subsequently, DMM was induced in Lys-to-Arg (K48R and K63R) mutant ubiquitin (Ub) transgenic mice. Cytokine signalling in SW1353s was monitored by immunoblotting and novel ubiquitinated substrates identified using Tandem Ubiquitin Binding Entities purification followed by mass spectrometry. The ubiquitination of TRAFD1 was assessed via immunoprecipitation and immunoblotting and its role in cytokine signal-transduction determined using RNA interference and real-time RT-PCR for MMP13 and interleukin-6 (IL6). Supplementation with the proteasome inhibitor MG132 protected cartilage from cytokine-mediated resorption and degradation in vivo in mice following DMM-induced OA. Using transgenic animals only K48R-mutated Ub partially protected against OA compared to wild-type or wild-type Ub transgenic mice, and this was only evident on the medial femoral condyle. After confirming ubiquitination was vital for NF-κB signalling and MMP13 expression, a screen for novel ubiquitinated substrates involved in cytokine-signalling identified TRAFD1; the depletion of which reduced inflammatory mediator-induced MMP13 and IL6 expression. Our data for the first time identifies a role for ubiquitination and the proteasome in the induction of OA via regulation of inflammatory mediator-induced MMP13 expression. These data open avenues of research to determine whether the proteasome, or K48-linked ubiquitination, are

  14. Impact of High Glucose and Proteasome Inhibitor MG132 on Histone H2A and H2B Ubiquitination in Rat Glomerular Mesangial Cells

    Directory of Open Access Journals (Sweden)

    Chenlin Gao


    Full Text Available Background. Hyperglycemia plays a pivotal role in the development of diabetic nephropathy (DN and may be related to epigenetic metabolic memory. One of the most crucial epigenetic mechanisms is histone modification, which is associated with the expression of a fibrosis factor in vascular injury. Aim .In this study, we investigated the ubiquitination of histones H2A and H2B to explore the epigenetic mechanisms of DN. Materials and Methods. The GMCs were cultured as follows: normal group, high glucose group, mannitol group, and intervention group. After 12 hr, 24 hr, and 48 hr, histones ubiquitination, transforming growth factor-β (TGF-β, and fibronectin (FN were measured using WB, RT-PCR, and IF. Result. High glucose can induce the upregulation of FN. H2A ubiquitination in GMCs increased in high glucose group (P<0.01, whereas it decreased significantly in intervention group (P<0.05. In contrast, H2B ubiquitination decreased with an increasing concentration of glucose, but it was recovered in the intervention group (P<0.05. Expression of TGF-β changed in response to abnormal histone ubiquitination. Conclusions. The high glucose may induce H2A ubiquitination and reduce H2B ubiquitination in GMCs. The changes of histone ubiquitination may be due in part to DN by activating TGF-β signaling pathway.

  15. The polycomb group protein Suz12 is required for embryonic stem cell differentiation

    DEFF Research Database (Denmark)

    Pasini, Diego; Bracken, Adrian P; Hansen, Jacob Bo Højberg


    results in early lethality of mouse embryos. Here, we demonstrate that Suz12(-/-) mouse embryonic stem (ES) cells can be established and expanded in tissue culture. The Suz12(-/-) ES cells are characterized by global loss of H3K27 trimethylation (H3K27me3) and higher expression levels of differentiation......-specific genes. Moreover, Suz12(-/-) ES cells are impaired in proper differentiation, resulting in a lack of repression of ES cell markers as well as activation of differentiation-specific genes. Finally, we demonstrate that the PcGs are actively recruited to several genes during ES cell differentiation, which...... despite an increase in H3K27me3 levels is not always sufficient to prevent transcriptional activation. In summary, we demonstrate that Suz12 is required for the establishment of specific expression programs required for ES cell differentiation. Furthermore, we provide evidence that PcGs have different...

  16. The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer (United States)


    J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33

  17. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer (United States)


    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  18. Adhesive pad differentiation in Drosophila melanogaster depends on the Polycomb group gene Su(z)2. (United States)

    Hüsken, Mirko; Hufnagel, Kim; Mende, Katharina; Appel, Esther; Meyer, Heiko; Peisker, Henrik; Tögel, Markus; Wang, Shuoshuo; Wolff, Jonas; Gorb, Stanislav N; Paululat, Achim


    The ability of many insects to walk on vertical smooth surfaces such as glass or even on the ceiling has fascinated biologists for a long time, and has led to the discovery of highly specialized adhesive organs located at the distal end of the animals' legs. So far, research has primarily focused on structural and ultrastructural investigations leading to a deeper understanding of adhesive organ functionality and to the development of new bioinspired materials. Genetic approaches, e.g. the analysis of mutants, to achieve a better understanding of adhesive organ differentiation have not been used so far. Here, we describe the first Drosophila melanogaster mutant that develops malformed adhesive organs, resulting in a complete loss of climbing ability on vertical smooth surfaces. Interestingly, these mutants fail to make close contact between the setal tips and the smooth surface, a crucial condition for wet adhesion mediated by capillary forces. Instead, these flies walk solely on their claws. Moreover, we were able to show that the mutation is caused by a P-element insertion into the Su(z)2 gene locus. Remobilization of the P-element restores climbing ability. Furthermore, we provide evidence that the P-element insertion results in an artificial Su(z)2 transcript, which most likely causes a gain-of-function mutation. We presume that this transcript causes deregulation of yet unknown target genes involved in pulvilli differentiation. Our results nicely demonstrate that the genetically treatable model organism Drosophila is highly suitable for future investigations on adhesive organ differentiation. © 2015. Published by The Company of Biologists Ltd.

  19. The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer (United States)


    new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007

  20. A Review on Ubiquitination of Neurotrophin Receptors: Facts and Perspectives (United States)

    Sánchez-Sánchez, Julia; Arévalo, Juan Carlos


    Ubiquitination is a reversible post-translational modification involved in a plethora of different physiological functions. Among the substrates that are ubiquitinated, neurotrophin receptors (TrkA, TrkB, TrkC, and p75NTR) have been studied recently. TrkA is the most studied receptor in terms of its ubiquitination, and different E3 ubiquitin ligases and deubiquitinases have been implicated in its ubiquitination, whereas not much is known about the other neurotrophin receptors aside from their ubiquitination. Additional studies are needed that focus on the ubiquitination of TrkB, TrkC, and p75NTR in order to further understand the role of ubiquitination in their physiological and pathological functions. Here we review what is currently known regarding the ubiquitination of neurotrophin receptors and its physiological and pathological relevance. PMID:28335430

  1. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels


    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  2. Heat shock induced change in protein ubiquitination in Chlamydomonas

    International Nuclear Information System (INIS)

    Shimogawara, K.; Muto, S.


    Ubiquitin was purified from pea (Pisum sativum L.) and its antibody was produced. Western blot analysis showed that the antibody cross-reacted with ubiquitins from a green alga Chlamydomonas reinhardtii, a brown alga Laminaria angustata and a red alga Porphyridium cruentum but not with ubiquitin from a blue-green alga Synechococcus sp. In Chlamydomonas, the antibody also reacted with some ubiquitinated proteins including 28- and 31-kDa polypeptides. The isoelectric points of Chlamydomonas ubiquitin and the 28- and 31-kDa ubiquitinated proteins were 8.0, 8.9 and 10.3, respectively. The ubiquitinated proteins, including the 28- and 31-kDa polypeptides were detected after in vitro ATP-dependent ubiquitination of Chlamydomonas cell extract with l25 I-labeled bovine ubiquitin. Heat treatment of Chlamydomonas cells (>40°C) caused drastic increase of ubiquitinated proteins with high mol wt (>60kDa), and coordinated redistribution or decrease of other ubiquitinated proteins and free ubiquitin. Quantitative analysis revealed that the 28- and 31-kDa ubiquitinated proteins showed different responses against heat stress, i.e. the former being more sensitive than the latter. (author)

  3. Dengue Virus Genome Uncoating Requires Ubiquitination

    Directory of Open Access Journals (Sweden)

    Laura A. Byk


    Full Text Available The process of genome release or uncoating after viral entry is one of the least-studied steps in the flavivirus life cycle. Flaviviruses are mainly arthropod-borne viruses, including emerging and reemerging pathogens such as dengue, Zika, and West Nile viruses. Currently, dengue virus is one of the most significant human viral pathogens transmitted by mosquitoes and is responsible for about 390 million infections every year around the world. Here, we examined for the first time molecular aspects of dengue virus genome uncoating. We followed the fate of the capsid protein and RNA genome early during infection and found that capsid is degraded after viral internalization by the host ubiquitin-proteasome system. However, proteasome activity and capsid degradation were not necessary to free the genome for initial viral translation. Unexpectedly, genome uncoating was blocked by inhibiting ubiquitination. Using different assays to bypass entry and evaluate the first rounds of viral translation, a narrow window of time during infection that requires ubiquitination but not proteasome activity was identified. In this regard, ubiquitin E1-activating enzyme inhibition was sufficient to stabilize the incoming viral genome in the cytoplasm of infected cells, causing its retention in either endosomes or nucleocapsids. Our data support a model in which dengue virus genome uncoating requires a nondegradative ubiquitination step, providing new insights into this crucial but understudied viral process.

  4. Ubiquitin Accumulation on Disease Associated Protein Aggregates Is Correlated with Nuclear Ubiquitin Depletion, Histone De-Ubiquitination and Impaired DNA Damage Response.

    Directory of Open Access Journals (Sweden)

    Adi Ben Yehuda

    Full Text Available Deposition of ubiquitin conjugates on inclusion bodies composed of protein aggregates is a definitive cytopathological hallmark of neurodegenerative diseases. We show that accumulation of ubiquitin on polyQ IB, associated with Huntington's disease, is correlated with extensive depletion of nuclear ubiquitin and histone de-ubiquitination. Histone ubiquitination plays major roles in chromatin regulation and DNA repair. Accordingly, we observe that cells expressing IB fail to respond to radiomimetic DNA damage, to induce gamma-H2AX phosphorylation and to recruit 53BP1 to damaged foci. Interestingly ubiquitin depletion, histone de-ubiquitination and impaired DNA damage response are not restricted to PolyQ aggregates and are associated with artificial aggregating luciferase mutants. The longevity of brain neurons depends on their capacity to respond to and repair extensive ongoing DNA damage. Impaired DNA damage response, even modest one, could thus lead to premature neuron aging and mortality.

  5. How Polycomb-Mediated Cell Memory Deals With a Changing Environment

    KAUST Repository

    Marasca, Federica; Bodega, Beatrice; Orlando, Valerio


    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

  6. How Polycomb-Mediated Cell Memory Deals With a Changing Environment

    KAUST Repository

    Marasca, Federica


    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

  7. Polycomb-like proteins link the PRC2 complex to CpG islands

    Energy Technology Data Exchange (ETDEWEB)

    Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J.; Bulyk, Martha L.; Shi, Yang; Wang, Zhanxin


    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.

  8. Ubiquitin Signaling: Extreme Conservation as a Source of Diversity

    Directory of Open Access Journals (Sweden)

    Alice Zuin


    Full Text Available Around 2 × 103–2.5 × 103 million years ago, a unicellular organism with radically novel features, ancestor of all eukaryotes, dwelt the earth. This organism, commonly referred as the last eukaryotic common ancestor, contained in its proteome the same functionally capable ubiquitin molecule that all eukaryotic species contain today. The fact that ubiquitin protein has virtually not changed during all eukaryotic evolution contrasts with the high expansion of the ubiquitin system, constituted by hundreds of enzymes, ubiquitin-interacting proteins, protein complexes, and cofactors. Interestingly, the simplest genetic arrangement encoding a fully-equipped ubiquitin signaling system is constituted by five genes organized in an operon-like cluster, and is found in archaea. How did ubiquitin achieve the status of central element in eukaryotic physiology? We analyze here the features of the ubiquitin molecule and the network that it conforms, and propose notions to explain the complexity of the ubiquitin signaling system in eukaryotic cells.

  9. Ubiquitin-dependent system controls radiation induced apoptosis

    International Nuclear Information System (INIS)

    Delic, J.; Magdelenat, H.; Glaisner, S.; Magdelenat, H.; Maciorowski, Z.


    The selective proteolytic pathway, dependent upon 'N-end rule' protein recognition/ubiquitination and on the subsequent proteasome dependent processing of ubiquitin conjugates, operates in apoptosis induced by γ-irradiation. The proteasome inhibitor peptide aldehyde, MG132, efficiently induced apoptosis and was also able (at doses lower than those required for apoptosis induction) to potentiate apoptosis induced by DNA damage. Its specificity is suggested by the induction of the ubiquitin (UbB and UbC) and E1 (ubiquitin activating enzyme) genes and by an altered ubiquitination pattern. More selectively, a di-peptide competitor of the 'N-end rule' of ubiquitin dependent protein processing inhibited radiation induced apoptosis. This inhibition is also followed by an altered ubiquitination pattern and by activation of Poly (ADP-ribose) polymerase (PARP). These data strongly suggest that early apoptosis radiation induced events are controlled by ubiquitin-dependent proteolytic processing. (author)

  10. The Host E3-Ubiquitin Ligase TRIM6 Ubiquitinates the Ebola Virus VP35 Protein and Promotes Virus Replication. (United States)

    Bharaj, Preeti; Atkins, Colm; Luthra, Priya; Giraldo, Maria Isabel; Dawes, Brian E; Miorin, Lisa; Johnson, Jeffrey R; Krogan, Nevan J; Basler, Christopher F; Freiberg, Alexander N; Rajsbaum, Ricardo


    Ebola virus (EBOV), a member of the Filoviridae family, is a highly pathogenic virus that causes severe hemorrhagic fever in humans and is responsible for epidemics throughout sub-Saharan, central, and West Africa. The EBOV genome encodes VP35, an important viral protein involved in virus replication by acting as an essential cofactor of the viral polymerase as well as a potent antagonist of the host antiviral type I interferon (IFN-I) system. By using mass spectrometry analysis and coimmunoprecipitation assays, we show here that VP35 is ubiquitinated on lysine 309 (K309), a residue located on its IFN antagonist domain. We also found that VP35 interacts with TRIM6, a member of the E3-ubiquitin ligase tripartite motif (TRIM) family. We recently reported that TRIM6 promotes the synthesis of unanchored K48-linked polyubiquitin chains, which are not covalently attached to any protein, to induce efficient antiviral IFN-I-mediated responses. Consistent with this notion, VP35 also associated noncovalently with polyubiquitin chains and inhibited TRIM6-mediated IFN-I induction. Intriguingly, we also found that TRIM6 enhances EBOV polymerase activity in a minigenome assay and TRIM6 knockout cells have reduced replication of infectious EBOV, suggesting that VP35 hijacks TRIM6 to promote EBOV replication through ubiquitination. Our work provides evidence that TRIM6 is an important host cellular factor that promotes EBOV replication, and future studies will focus on whether TRIM6 could be targeted for therapeutic intervention against EBOV infection. IMPORTANCE EBOV belongs to a family of highly pathogenic viruses that cause severe hemorrhagic fever in humans and other mammals with high mortality rates (40 to 90%). Because of its high pathogenicity and lack of licensed antivirals and vaccines, EBOV is listed as a tier 1 select-agent risk group 4 pathogen. An important mechanism for the severity of EBOV infection is its suppression of innate immune responses. The EBOV VP35

  11. Principles of ubiquitin and SUMO modifications in DNA repair

    NARCIS (Netherlands)

    Bergink, Steven; Jentsch, Stefan


    With the discovery in the late 1980s that the DNA-repair gene RAD6 encodes a ubiquitin-conjugating enzyme, it became clear that protein modification by ubiquitin conjugation has a much broader significance than had previously been assumed. Now, two decades later, ubiquitin and its cousin SUMO are

  12. Membrane-localized ubiquitin ligase ATL15 functions in sugar-responsive growth regulation in Arabidopsis. (United States)

    Aoyama, Shoki; Terada, Saki; Sanagi, Miho; Hasegawa, Yoko; Lu, Yu; Morita, Yoshie; Chiba, Yukako; Sato, Takeo; Yamaguchi, Junji


    Ubiquitin ligases play important roles in regulating various cellular processes by modulating the protein function of specific ubiquitination targets. The Arabidopsis Tóxicos en Levadura (ATL) family is a group of plant-specific RING-type ubiquitin ligases that localize to membranes via their N-terminal transmembrane-like domains. To date, 91 ATL isoforms have been identified in the Arabidopsis genome, with several ATLs reported to be involved in regulating plant responses to environmental stresses. However, the functions of most ATLs remain unknown. This study, involving transcriptome database analysis, identifies ATL15 as a sugar responsive ATL gene in Arabidopsis. ATL15 expression was rapidly down-regulated in the presence of sugar. The ATL15 protein showed ubiquitin ligase activity in vitro and localized to plasma membrane and endomembrane compartments. Further genetic analyses demonstrated that the atl15 knockout mutants are insensitive to high glucose concentrations, whereas ATL15 overexpression depresses plant growth. In addition, endogenous glucose and starch amounts were reciprocally affected in the atl15 knockout mutants and the ATL15 overexpressors. These results suggest that ATL15 protein plays a significant role as a membrane-localized ubiquitin ligase that regulates sugar-responsive plant growth in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Chromatin-bound IκBα regulates a subset of polycomb target genes in differentiation and cancer. (United States)

    Mulero, María Carmen; Ferres-Marco, Dolors; Islam, Abul; Margalef, Pol; Pecoraro, Matteo; Toll, Agustí; Drechsel, Nils; Charneco, Cristina; Davis, Shelly; Bellora, Nicolás; Gallardo, Fernando; López-Arribillaga, Erika; Asensio-Juan, Elena; Rodilla, Verónica; González, Jessica; Iglesias, Mar; Shih, Vincent; Mar Albà, M; Di Croce, Luciano; Hoffmann, Alexander; Miyamoto, Shigeki; Villà-Freixa, Jordi; López-Bigas, Nuria; Keyes, William M; Domínguez, María; Bigas, Anna; Espinosa, Lluís


    IκB proteins are the primary inhibitors of NF-κB. Here, we demonstrate that sumoylated and phosphorylated IκBα accumulates in the nucleus of keratinocytes and interacts with histones H2A and H4 at the regulatory region of HOX and IRX genes. Chromatin-bound IκBα modulates Polycomb recruitment and imparts their competence to be activated by TNFα. Mutations in the Drosophila IκBα gene cactus enhance the homeotic phenotype of Polycomb mutants, which is not counteracted by mutations in dorsal/NF-κB. Oncogenic transformation of keratinocytes results in cytoplasmic IκBα translocation associated with a massive activation of Hox. Accumulation of cytoplasmic IκBα was found in squamous cell carcinoma (SCC) associated with IKK activation and HOX upregulation. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Ubiquitinated proteins enriched from tumor cells by a ubiquitin binding protein Vx3(A7) as a potent cancer vaccine. (United States)

    Aldarouish, Mohanad; Wang, Huzhan; Zhou, Meng; Hu, Hong-Ming; Wang, Li-Xin


    Our previous studies have demonstrated that autophagosome-enriched vaccine (named DRibbles: DRiPs-containing blebs) induce a potent anti-tumor efficacy in different murine tumor models, in which DRibble-containing ubiquitinated proteins are efficient tumor-specific antigen source for the cross-presentation after being loaded onto dendritic cells. In this study, we sought to detect whether ubiquitinated proteins enriched from tumor cells could be used directly as a novel cancer vaccine. The ubiquitin binding protein Vx3(A7) was used to isolate ubiquitinated proteins from EL4 and B16-F10 tumor cells after blocking their proteasomal degradation pathway. C57BL/6 mice were vaccinated with different doses of Ub-enriched proteins via inguinal lymph nodes or subcutaneous injection and with DRibbles, Ub-depleted proteins and whole cell lysate as comparison groups, respectively. The lymphocytes from the vaccinated mice were re-stimulated with inactivated tumor cells and the levels of IFN-γ in the supernatant were detected by ELISA. Anti-tumor efficacy of Ub-enriched proteins vaccine was evaluated by monitoring tumor growth in established tumor mice models. Graphpad Prism 5.0 was used for all statistical analysis. We found that after stimulation with inactivated tumor cells, the lymphocytes from the Ub-enriched proteins-vaccinated mice secreted high level of IFN-γ in dose dependent manner, in which the priming vaccination via inguinal lymph nodes injection induced higher IFN-γ level than that via subcutaneous injection. Moreover, the level of secreted IFN-γ in the Ub-enriched proteins group was markedly higher than that in the whole cell lysate and Ub-depleted proteins. Interestingly, the lymphocytes from mice vaccinated with Ub-enriched proteins, but not Ub-depleted proteins and whole cell lysates, isolated from EL4 or B16-F10 tumor cells also produced an obvious level of IFN-γ when stimulated alternately with inactivated B16-F10 or EL4 tumor cells. Furthermore, Ub

  15. Dengue Virus Genome Uncoating Requires Ubiquitination. (United States)

    Byk, Laura A; Iglesias, Néstor G; De Maio, Federico A; Gebhard, Leopoldo G; Rossi, Mario; Gamarnik, Andrea V


    The process of genome release or uncoating after viral entry is one of the least-studied steps in the flavivirus life cycle. Flaviviruses are mainly arthropod-borne viruses, including emerging and reemerging pathogens such as dengue, Zika, and West Nile viruses. Currently, dengue virus is one of the most significant human viral pathogens transmitted by mosquitoes and is responsible for about 390 million infections every year around the world. Here, we examined for the first time molecular aspects of dengue virus genome uncoating. We followed the fate of the capsid protein and RNA genome early during infection and found that capsid is degraded after viral internalization by the host ubiquitin-proteasome system. However, proteasome activity and capsid degradation were not necessary to free the genome for initial viral translation. Unexpectedly, genome uncoating was blocked by inhibiting ubiquitination. Using different assays to bypass entry and evaluate the first rounds of viral translation, a narrow window of time during infection that requires ubiquitination but not proteasome activity was identified. In this regard, ubiquitin E1-activating enzyme inhibition was sufficient to stabilize the incoming viral genome in the cytoplasm of infected cells, causing its retention in either endosomes or nucleocapsids. Our data support a model in which dengue virus genome uncoating requires a nondegradative ubiquitination step, providing new insights into this crucial but understudied viral process. Dengue is the most significant arthropod-borne viral infection in humans. Although the number of cases increases every year, there are no approved therapeutics available for the treatment of dengue infection, and many basic aspects of the viral biology remain elusive. After entry, the viral membrane must fuse with the endosomal membrane to deliver the viral genome into the cytoplasm for translation and replication. A great deal of information has been obtained in the last decade

  16. DNA methylation requires a DNMT1 ubiquitin interacting motif (UIM) and histone ubiquitination. (United States)

    Qin, Weihua; Wolf, Patricia; Liu, Nan; Link, Stephanie; Smets, Martha; La Mastra, Federica; Forné, Ignasi; Pichler, Garwin; Hörl, David; Fellinger, Karin; Spada, Fabio; Bonapace, Ian Marc; Imhof, Axel; Harz, Hartmann; Leonhardt, Heinrich


    DNMT1 is recruited by PCNA and UHRF1 to maintain DNA methylation after replication. UHRF1 recognizes hemimethylated DNA substrates via the SRA domain, but also repressive H3K9me3 histone marks with its TTD. With systematic mutagenesis and functional assays, we could show that chromatin binding further involved UHRF1 PHD binding to unmodified H3R2. These complementation assays clearly demonstrated that the ubiquitin ligase activity of the UHRF1 RING domain is required for maintenance DNA methylation. Mass spectrometry of UHRF1-deficient cells revealed H3K18 as a novel ubiquitination target of UHRF1 in mammalian cells. With bioinformatics and mutational analyses, we identified a ubiquitin interacting motif (UIM) in the N-terminal regulatory domain of DNMT1 that binds to ubiquitinated H3 tails and is essential for DNA methylation in vivo. H3 ubiquitination and subsequent DNA methylation required UHRF1 PHD binding to H3R2. These results show the manifold regulatory mechanisms controlling DNMT1 activity that require the reading and writing of epigenetic marks by UHRF1 and illustrate the multifaceted interplay between DNA and histone modifications. The identification and functional characterization of the DNMT1 UIM suggests a novel regulatory principle and we speculate that histone H2AK119 ubiquitination might also lead to UIM-dependent recruitment of DNMT1 and DNA methylation beyond classic maintenance.

  17. Structural Basis for Ubiquitin Recognition and Autoubiquitination by Rabex-5

    International Nuclear Information System (INIS)

    Lee, S.; Tsai, Y.; Mattera, R.; Smith, W.; Kostelansky, M.; Weissman, A.; Bonifacino, J.; Hurley, J.


    Rabex-5 is an exchange factor for Rab5, a master regulator of endosomal trafficking. Rabex-5 binds monoubiquitin, undergoes covalent ubiquitination and contains an intrinsic ubiquitin ligase activity, all of which require an N-terminal A20 zinc finger followed immediately by a helix. The structure of the N-terminal portion of Rabex-5 bound to ubiquitin at 2.5-Angstroms resolution shows that Rabex-5-ubiquitin interactions occur at two sites. The first site is a new type of ubiquitin-binding domain, an inverted ubiquitin-interacting motif, which binds with ∼29-μM affinity to the canonical Ile44 hydrophobic patch on ubiquitin. The second is a diaromatic patch on the A20 zinc finger, which binds with ∼22-μM affinity to a polar region centered on Asp58 of ubiquitin. The A20 zinc-finger diaromatic patch mediates ubiquitin-ligase activity by directly recruiting a ubiquitin-loaded ubiquitin-conjugating enzyme

  18. Cooperativity of the SUMO and Ubiquitin Pathways in Genome Stability

    Directory of Open Access Journals (Sweden)

    Minghua Nie


    Full Text Available Covalent attachment of ubiquitin (Ub or SUMO to DNA repair proteins plays critical roles in maintaining genome stability. These structurally related polypeptides can be viewed as distinct road signs, with each being read by specific protein interaction motifs. Therefore, via their interactions with selective readers in the proteome, ubiquitin and SUMO can elicit distinct cellular responses, such as directing DNA lesions into different repair pathways. On the other hand, through the action of the SUMO-targeted ubiquitin ligase (STUbL family proteins, ubiquitin and SUMO can cooperate in the form of a hybrid signal. These mixed SUMO-ubiquitin chains recruit “effector” proteins such as the AAA+ ATPase Cdc48/p97-Ufd1-Npl4 complex that contain both ubiquitin and SUMO interaction motifs. This review will summarize recent key findings on collaborative and distinct roles that ubiquitin and SUMO play in orchestrating DNA damage responses.

  19. ISG15 inhibits Nedd4 ubiquitin E3 activity and enhances the innate antiviral response. (United States)

    Malakhova, Oxana A; Zhang, Dong-Er


    Interferons regulate diverse immune functions through the transcriptional activation of hundreds of genes involved in anti-viral responses. The interferon-inducible ubiquitin-like protein ISG15 is expressed in cells in response to a variety of stress conditions like viral or bacterial infection and is present in its free form or is conjugated to cellular proteins. In addition, protein ubiquitination plays a regulatory role in the immune system. Many viruses modulate the ubiquitin (Ub) pathway to alter cellular signaling and the antiviral response. Ubiquitination of retroviral group-specific antigen precursors and matrix proteins of the Ebola, vesicular stomatitis, and rabies viruses by Nedd4 family HECT domain E3 ligases is an important step in facilitating viral release. We found that Nedd4 is negatively regulated by ISG15. Free ISG15 specifically bound to Nedd4 and blocked its interaction with Ub-E2 molecules, thus preventing further Ub transfer from E2 to E3. Furthermore, overexpression of ISG15 diminished the ability of Nedd4 to ubiquitinate viral matrix proteins and led to a decrease in the release of Ebola VP40 virus-like particles from the cells. These results point to a mechanistically novel function of ISG15 in the enhancement of the innate anti-viral response through specific inhibition of Nedd4 Ub-E3 activity. To our knowledge, this is the first example of a Ub-like protein with the ability to interfere with Ub-E2 and E3 interaction to inhibit protein ubiquitination.

  20. ρ0 Cells Feature De-Ubiquitination of SLC Transporters and Increased Levels and Fluxes of Amino Acids

    Directory of Open Access Journals (Sweden)

    André Bordinassi Medina


    Full Text Available Solute carrier (SLC transporters are a diverse group of membrane transporter proteins that regulate the cellular flux and distribution of endogenous and xenobiotic compounds. Post-translational modifications (PTMs, such as ubiquitination, have recently emerged as one of the major regulatory mechanisms in protein function and localization. Previously, we showed that SLC amino acid transporters were on average 6-fold de-ubiquitinated and increased amino acid levels were detected in ρ0 cells (lacking mitochondrial DNA, mtDNA compared to parental cells. Here, we elucidated the altered functionality of SLC transporters and their dynamic ubiquitination status by measuring the uptake of several isotopically labeled amino acids in both human osteosarcoma 143B.TK- and ρ0 cells. Our pulse chase analysis indicated that de-ubiquitinated amino acid transporters in ρ0 cells were accompanied by an increased transport rate, which leads to higher levels of amino acids in the cell. Finding SLC transport enhancers is an aim of the pharmaceutical industry in order to compensate for loss of function mutations in these genes. Thus, the ubiquitination status of SLC transporters could be an indicator for their functionality, but evidence for a direct connection between de-ubiquitination and transporter activity has to be further elucidated.

  1. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma. (United States)

    Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald


    The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.

  2. RYBP and Cbx7 Define Specific Biological Functions of Polycomb Complexes in Mouse Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Lluis Morey


    Full Text Available The Polycomb repressive complex 1 (PRC1 is required for decisions of stem cell fate. In mouse embryonic stem cells (ESCs, two major variations of PRC1 complex, defined by the mutually exclusive presence of Cbx7 or RYBP, have been identified. Here, we show that although the genomic localization of the Cbx7- and RYBP-containing PRC1 complexes overlaps in certain genes, it can also be mutually exclusive. At the molecular level, Cbx7 is necessary for recruitment of Ring1B to chromatin, whereas RYBP enhances the PRC1 enzymatic activity. Genes occupied by RYBP show lower levels of Ring1B and H2AK119ub and are consequently more highly transcribed than those bound by Cbx7. At the functional level, we show that genes occupied by RYBP are primarily involved in the regulation of metabolism and cell-cycle progression, whereas those bound by Cbx7 predominantly control early-lineage commitment of ESCs. Altogether, our results indicate that different PRC1 subtypes establish a complex pattern of gene regulation that regulates common and nonoverlapping aspects of ESC pluripotency and differentiation.

  3. The Ubiquitin System and Jasmonate Signaling

    Directory of Open Access Journals (Sweden)

    Astrid Nagels Durand


    Full Text Available The ubiquitin (Ub system is involved in most, if not all, biological processes in eukaryotes. The major specificity determinants of this system are the E3 ligases, which bind and ubiquitinate specific sets of proteins and are thereby responsible for target recruitment to the proteasome or other cellular processing machineries. The Ub system contributes to the regulation of the production, perception and signal transduction of plant hormones. Jasmonic acid (JA and its derivatives, known as jasmonates (JAs, act as signaling compounds regulating plant development and plant responses to various biotic and abiotic stress conditions. We provide here an overview of the current understanding of the Ub system involved in JA signaling.

  4. UUCD: a family-based database of ubiquitin and ubiquitin-like conjugation. (United States)

    Gao, Tianshun; Liu, Zexian; Wang, Yongbo; Cheng, Han; Yang, Qing; Guo, Anyuan; Ren, Jian; Xue, Yu


    In this work, we developed a family-based database of UUCD ( for ubiquitin and ubiquitin-like conjugation, which is one of the most important post-translational modifications responsible for regulating a variety of cellular processes, through a similar E1 (ubiquitin-activating enzyme)-E2 (ubiquitin-conjugating enzyme)-E3 (ubiquitin-protein ligase) enzyme thioester cascade. Although extensive experimental efforts have been taken, an integrative data resource is still not available. From the scientific literature, 26 E1s, 105 E2s, 1003 E3s and 148 deubiquitination enzymes (DUBs) were collected and classified into 1, 3, 19 and 7 families, respectively. To computationally characterize potential enzymes in eukaryotes, we constructed 1, 1, 15 and 6 hidden Markov model (HMM) profiles for E1s, E2s, E3s and DUBs at the family level, separately. Moreover, the ortholog searches were conducted for E3 and DUB families without HMM profiles. Then the UUCD database was developed with 738 E1s, 2937 E2s, 46 631 E3s and 6647 DUBs of 70 eukaryotic species. The detailed annotations and classifications were also provided. The online service of UUCD was implemented in PHP + MySQL + JavaScript + Perl.

  5. The ubiquitin-proteasome system and chromosome 17 in cerebellar granule cells and medulloblastoma subgroups. (United States)

    Vriend, Jerry; Marzban, Hassan


    Chromosome 17 abnormalities are often observed in medulloblastomas (MBs), particularly those classified in the consensus Groups 3 and 4. Herein we review MB signature genes associated with chromosome 17 and the relationship of these signature genes to the ubiquitin-proteasome system. While clinical investigators have not focused on the ubiquitin-proteasome system in relation to MB, a substantial amount of data on the topic has been hidden in the form of supplemental datasets of gene expression. A supplemental dataset associated with the Thompson classification of MBs shows that a subgroup of MB with 17p deletions is characterized by reduced expression of genes for several core particle subunits of the beta ring of the proteasome (β1, β4, β5, β7). One of these genes (PSMB6, the gene for the β1 subunit) is located on chromosome 17, near the telomeric end of 17p. By comparison, in the WNT group of MBs only one core proteasome subunit, β6, associated with loss of a gene (PSMB1) on chromosome 6, was down-regulated in this dataset. The MB subgroups with the worst prognosis have a significant association with chromosome 17 abnormalities and irregularities of APC/C cyclosome genes. We conclude that the expression of proteasome subunit genes and genes for ubiquitin ligases can contribute to prognostic classification of MBs. The therapeutic value of targeting proteasome subunits and ubiquitin ligases in the various subgroups of MB remains to be determined separately for each classification of MB.

  6. Cell Cycle-Dependent Recruitment of Polycomb Proteins to the ASNS Promoter Counteracts C/ebp-Mediated Transcriptional Activation in Bombyx mori (United States)

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro


    Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816

  7. Puromycin induces SUMO and ubiquitin redistribution upon proteasome inhibition

    Energy Technology Data Exchange (ETDEWEB)

    Matsumoto, Hotaru [Course for Biological Sciences, Faculty of Science, Kumamoto University, Kumamoto (Japan); Saitoh, Hisato, E-mail: [Course for Biological Sciences, Faculty of Science, Kumamoto University, Kumamoto (Japan); Department of Biological Sciences, Graduate School of Science and Technology, Kumamoto University, Kumamoto (Japan)


    We have previously reported the co-localization of O-propargyl-puromycin (OP-Puro) with SUMO-2/3 and ubiquitin at promyelocytic leukemia-nuclear bodies (PML-NBs) in the presence of the proteasome inhibitor MG132, implying a role for the ubiquitin family in sequestering OP-puromycylated immature polypeptides to the nucleus during impaired proteasome activity. Here, we found that as expected puromycin induced SUMO-1/2/3 accumulation with ubiquitin at multiple nuclear foci in HeLa cells when co-exposed to MG132. Co-administration of puromycin and MG132 also facilitated redistribution of PML and the SUMO-targeted ubiquitin ligase RNF4 concurrently with SUMO-2/3. As removal of the drugs from the medium led to disappearance of the SUMO-2/3-ubiquitin nuclear foci, our findings indicated that nuclear assembly/disassembly of SUMO-2/3 and ubiquitin was pharmacologically manipulable, supporting our previous observation on OP-Puro, which predicted the ubiquitin family function in sequestrating aberrant proteins to the nucleus. -- Highlights: •Puromycin exhibits the O-propargyl-puromycin effect. •Puromycin induces SUMO redistribution upon proteasome inhibition. •Ubiquitin and RNF4 accumulate at PML-nuclear bodies with SUMO-2/3. •The ubiquitin family may function in nuclear sequestration of immature proteins.

  8. Ubiquitination dynamics in the early-branching eukaryote Giardia intestinalis (United States)

    Niño, Carlos A; Chaparro, Jenny; Soffientini, Paolo; Polo, Simona; Wasserman, Moises


    Ubiquitination is a highly dynamic and versatile posttranslational modification that regulates protein function, stability, and interactions. To investigate the roles of ubiquitination in a primitive eukaryotic lineage, we utilized the early-branching eukaryote Giardia intestinalis. Using a combination of biochemical, immunofluorescence-based, and proteomics approaches, we assessed the ubiquitination status during the process of differentiation in Giardia. We observed that different types of ubiquitin modifications present specific cellular and temporal distribution throughout the Giardia life cycle from trophozoites to cyst maturation. Ubiquitin signal was detected in the wall of mature cysts, and enzymes implicated in cyst wall biogenesis were identified as substrates for ubiquitination. Interestingly, inhibition of proteasome activity did not affect trophozoite replication and differentiation, while it caused a decrease in cyst viability, arguing for proteasome involvement in cyst wall maturation. Using a proteomics approach, we identified around 200 high-confidence ubiquitinated candidates that vary their ubiquitination status during differentiation. Our results indicate that ubiquitination is critical for several cellular processes in this primitive eukaryote. PMID:23613346

  9. Puromycin induces SUMO and ubiquitin redistribution upon proteasome inhibition

    International Nuclear Information System (INIS)

    Matsumoto, Hotaru; Saitoh, Hisato


    We have previously reported the co-localization of O-propargyl-puromycin (OP-Puro) with SUMO-2/3 and ubiquitin at promyelocytic leukemia-nuclear bodies (PML-NBs) in the presence of the proteasome inhibitor MG132, implying a role for the ubiquitin family in sequestering OP-puromycylated immature polypeptides to the nucleus during impaired proteasome activity. Here, we found that as expected puromycin induced SUMO-1/2/3 accumulation with ubiquitin at multiple nuclear foci in HeLa cells when co-exposed to MG132. Co-administration of puromycin and MG132 also facilitated redistribution of PML and the SUMO-targeted ubiquitin ligase RNF4 concurrently with SUMO-2/3. As removal of the drugs from the medium led to disappearance of the SUMO-2/3-ubiquitin nuclear foci, our findings indicated that nuclear assembly/disassembly of SUMO-2/3 and ubiquitin was pharmacologically manipulable, supporting our previous observation on OP-Puro, which predicted the ubiquitin family function in sequestrating aberrant proteins to the nucleus. -- Highlights: •Puromycin exhibits the O-propargyl-puromycin effect. •Puromycin induces SUMO redistribution upon proteasome inhibition. •Ubiquitin and RNF4 accumulate at PML-nuclear bodies with SUMO-2/3. •The ubiquitin family may function in nuclear sequestration of immature proteins.

  10. The human otubain2-ubiquitin structure provides insights into the cleavage specificity of poly-ubiquitin-linkages.

    Directory of Open Access Journals (Sweden)

    Mikael Altun

    Full Text Available Ovarian tumor domain containing proteases cleave ubiquitin (Ub and ubiquitin-like polypeptides from proteins. Here we report the crystal structure of human otubain 2 (OTUB2 in complex with a ubiquitin-based covalent inhibitor, Ub-Br2. The ubiquitin binding mode is oriented differently to how viral otubains (vOTUs bind ubiquitin/ISG15, and more similar to yeast and mammalian OTUs. In contrast to OTUB1 which has exclusive specificity towards Lys48 poly-ubiquitin chains, OTUB2 cleaves different poly-Ub linked chains. N-terminal tail swapping experiments between OTUB1 and OTUB2 revealed how the N-terminal structural motifs in OTUB1 contribute to modulating enzyme activity and Ub-chain selectivity, a trait not observed in OTUB2, supporting the notion that OTUB2 may affect a different spectrum of substrates in Ub-dependent pathways.

  11. Polycomb repression complex 2 is required for the maintenance of retinal progenitor cells and balanced retinal differentiation

    Czech Academy of Sciences Publication Activity Database

    Fujimura, Naoko; Kuželová, Andrea; Ebert, A.; Strnad, Hynek; Láchová, Jitka; Machoň, Ondřej; Busslinger, M.; Kozmik, Zbyněk


    Roč. 433, č. 1 (2018), s. 47-60 ISSN 0012-1606 R&D Projects: GA ČR GA15-23675S; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2015040; GA MŠk ED2.1.00/19.0395 Institutional support: RVO:68378050 Keywords : Retina * Differentiation * Polycomb * Eed Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.944, year: 2016

  12. Rybp, a polycomb complex-associated protein, is required for mouse eye development

    Directory of Open Access Journals (Sweden)

    Schreiber-Agus Nicole


    Full Text Available Abstract Background Rybp (Ring1 and YY1 binding protein is a zinc finger protein which interacts with the members of the mammalian polycomb complexes. Previously we have shown that Rybp is critical for early embryogenesis and that haploinsufficiency of Rybp in a subset of embryos causes failure of neural tube closure. Here we investigated the requirement for Rybp in ocular development using four in vivo mouse models which resulted in either the ablation or overexpression of Rybp. Results Our results demonstrate that loss of a single Rybp allele in conventional knockout mice often resulted in retinal coloboma, an incomplete closure of the optic fissure, characterized by perturbed localization of Pax6 but not of Pax2. In addition, about one half of Rybp-/- Rybp+/+ chimeric embryos also developed retinal colobomas and malformed lenses. Tissue-specific transgenic overexpression of Rybp in the lens resulted in abnormal fiber cell differentiation and severe lens opacification with increased levels of AP-2α and Sox2, and reduced levels of βA4-crystallin gene expression. Ubiquitous transgenic overexpression of Rybp in the entire eye caused abnormal retinal folds, corneal neovascularization, and lens opacification. Additional changes included defects in anterior eye development. Conclusion These studies establish Rybp as a novel gene that has been associated with coloboma. Other genes linked to coloboma encode various classes of transcription factors such as BCOR, CBP, Chx10, Pax2, Pax6, Six3, Ski, Vax1 and Vax2. We propose that the multiple functions for Rybp in regulating mouse retinal and lens development are mediated by genetic, epigenetic and physical interactions between these genes and proteins.

  13. Origin and diversification of TRIM ubiquitin ligases.

    Directory of Open Access Journals (Sweden)

    Ignacio Marín

    Full Text Available Most proteins of the TRIM family (also known as RBCC family are ubiquitin ligases that share a peculiar protein structure, characterized by including an N-terminal RING finger domain closely followed by one or two B-boxes. Additional protein domains found at their C termini have been used to classify TRIM proteins into classes. TRIMs are involved in multiple cellular processes and many of them are essential components of the innate immunity system of animal species. In humans, it has been shown that mutations in several TRIM-encoding genes lead to diverse genetic diseases and contribute to several types of cancer. They had been hitherto detected only in animals. In this work, by comprehensively analyzing the available diversity of TRIM and TRIM-like protein sequences and evaluating their evolutionary patterns, an improved classification of the TRIM family is obtained. Members of one of the TRIM subfamilies defined, called Subfamily A, turn to be present not only in animals, but also in many other eukaryotes, such as fungi, apusozoans, alveolates, excavates and plants. The rest of subfamilies are animal-specific and several of them originated only recently. Subfamily A proteins are characterized by containing a MATH domain, suggesting a potential evolutionary connection between TRIM proteins and a different type of ubiquitin ligases, known as TRAFs, which contain quite similar MATH domains. These results indicate that the TRIM family emerged much earlier than so far thought and contribute to our understanding of its origin and diversification. The structural and evolutionary links with the TRAF family of ubiquitin ligases can be experimentally explored to determine whether functional connections also exist.

  14. HUWE1 and TRIP12 collaborate in degradation of ubiquitin-fusion proteins and misframed ubiquitin.

    Directory of Open Access Journals (Sweden)

    Esben G Poulsen

    Full Text Available In eukaryotic cells an uncleavable ubiquitin moiety conjugated to the N-terminus of a protein signals the degradation of the fusion protein via the proteasome-dependent ubiquitin fusion degradation (UFD pathway. In yeast the molecular mechanism of the UFD pathway has been well characterized. Recently the human E3 ubiquitin-protein ligase TRIP12 was connected with the UFD pathway, but little is otherwise known about this system in mammalian cells. In the present work, we utilized high-throughput imaging on cells transfected with a targeted siRNA library to identify components involved in degradation of the UFD substrate Ub(G76V-YFP. The most significant hits from the screen were the E3 ubiquitin-protein ligase HUWE1, as well as PSMD7 and PSMD14 that encode proteasome subunits. Accordingly, knock down of HUWE1 led to an increase in the steady state level and a retarded degradation of the UFD substrate. Knock down of HUWE1 also led to a stabilization of the physiological UFD substrate UBB(+1. Precipitation experiments revealed that HUWE1 is associated with both the Ub(G76V-YFP substrate and the 26S proteasome, indicating that it functions late in the UFD pathway. Double knock down of HUWE1 and TRIP12 resulted in an additive stabilization of the substrate, suggesting that HUWE1 and TRIP12 function in parallel during UFD. However, even when both HUWE1 and TRIP12 are downregulated, ubiquitylation of the UFD substrate was still apparent, revealing functional redundancy between HUWE1, TRIP12 and yet other ubiquitin-protein ligases.

  15. Reactive Landing of Gramicidin S and Ubiquitin Ions onto Activated Self-Assembled Monolayer Surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Laskin, Julia; Hu, Qichi


    Using mass-selected ion deposition combined with in situ infrared reflection absorption spectroscopy (IRRAS), we examined the reactive landing of gramicidin S and ubiquitin ions onto activated self-assembled monolayer (SAM) surfaces terminated with N-hydroxysuccinimidyl ester (NHS-SAM) and acyl fluoride (COF-SAM) groups. Doubly protonated gramicidin S, [GS+2H]2+, and two charge states of ubiquitin, [U+5H]5+ and [U+13H]13+, were used as model systems, allowing us to explore the effect of the number of free amino groups and the secondary structure on the efficiency of covalent bond formation between the projectile ion and the surface. For all projectile ions, ion deposition resulted in the depletion of IRRAS bands corresponding to the terminal groups on the SAM and the appearance of several new bands not associated with the deposited species. These new bands were assigned to the C=O stretching vibrations of COOH and COO- groups formed on the surface as a result of ion deposition. The presence of these bands was attributed to an alternative reactive landing pathway that competes with covalent bond formation. This pathway with similar yields for both gramicidin S and ubiquitin ions is analogous to the hydrolysis of the NHS ester bond in solution. The covalent bond formation efficiency increased linearly with the number of free amino groups and was found to be lower for the more compact conformation of ubiquitin compared with the fully unfolded conformation. This observation was attributed to the limited availability of amino groups on the surface of the folded conformation. Our results have provided new insights on the efficiency and mechanism of reactive landing of peptides and proteins onto activated SAMs

  16. Denervation-Induced Activation of the Ubiquitin-Proteasome System Reduces Skeletal Muscle Quantity Not Quality. (United States)

    Baumann, Cory W; Liu, Haiming M; Thompson, LaDora V


    It is well known that the ubiquitin-proteasome system is activated in response to skeletal muscle wasting and functions to degrade contractile proteins. The loss of these proteins inevitably reduces skeletal muscle size (i.e., quantity). However, it is currently unknown whether activation of this pathway also affects function by impairing the muscle's intrinsic ability to produce force (i.e., quality). Therefore, the purpose of this study was twofold, (1) document how the ubiquitin-proteasome system responds to denervation and (2) identify the physiological consequences of these changes. To induce soleus muscle atrophy, C57BL6 mice underwent tibial nerve transection of the left hindlimb for 7 or 14 days (n = 6-8 per group). At these time points, content of several proteins within the ubiquitin-proteasome system were determined via Western blot, while ex vivo whole muscle contractility was specifically analyzed at day 14. Denervation temporarily increased several key proteins within the ubiquitin-proteasome system, including the E3 ligase MuRF1 and the proteasome subunits 19S, α7 and β5. These changes were accompanied by reductions in absolute peak force and power, which were offset when expressed relative to physiological cross-sectional area. Contrary to peak force, absolute and relative forces at submaximal stimulation frequencies were significantly greater following 14 days of denervation. Taken together, these data represent two keys findings. First, activation of the ubiquitin-proteasome system is associated with reductions in skeletal muscle quantity rather than quality. Second, shortly after denervation, it appears the muscle remodels to compensate for the loss of neural activity via changes in Ca2+ handling.

  17. Hijacking of the Host Ubiquitin Network by Legionella pneumophila

    Directory of Open Access Journals (Sweden)

    Jiazhang Qiu


    Full Text Available Protein ubiquitination is critical for regulation of numerous eukaryotic cellular processes such as protein homeostasis, cell cycle progression, immune response, DNA repair, and vesicular trafficking. Ubiquitination often leads to the alteration of protein stability, subcellular localization, or interaction with other proteins. Given the importance of ubiquitination in the regulation of host immunity, it is not surprising that many infectious agents have evolved strategies to interfere with the ubiquitination network with sophisticated mechanisms such as functional mimicry. The facultative intracellular pathogen Legionella pneumophila is the causative agent of Legionnaires' disease. L. pneumophila is phagocytosed by macrophages and is able to replicate within a niche called Legionella-containing vacuole (LCV. The biogenesis of LCV is dependent upon the Dot/Icm type IV secretion system which delivers more than 330 effector proteins into host cytosol. The optimal intracellular replication of L. pneumophila requires the host ubiquitin-proteasome system. Furthermore, membranes of the bacterial phagosome are enriched with ubiquitinated proteins in a way that requires its Dot/Icm type IV secretion system, suggesting the involvement of effectors in the manipulation of the host ubiquitination machinery. Here we summarize recent advances in our understanding of mechanisms exploited by L. pneumophila effector proteins to hijack the host ubiquitination pathway.

  18. Promoters active in interphase are bookmarked during mitosis by ubiquitination (United States)

    Arora, Mansi; Zhang, Jie; Heine, George F.; Ozer, Gulcin; Liu, Hui-wen; Huang, Kun; Parvin, Jeffrey D.


    We analyzed modification of chromatin by ubiquitination in human cells and whether this mark changes through the cell cycle. HeLa cells were synchronized at different stages and regions of the genome with ubiquitinated chromatin were identified by affinity purification coupled with next-generation sequencing. During interphase, ubiquitin marked the chromatin on the transcribed regions of ∼70% of highly active genes and deposition of this mark was sensitive to transcriptional inhibition. Promoters of nearly half of the active genes were highly ubiquitinated specifically during mitosis. The ubiquitination at the coding regions in interphase but not at promoters during mitosis was enriched for ubH2B and dependent on the presence of RNF20. Ubiquitin labeling of both promoters during mitosis and transcribed regions during interphase, correlated with active histone marks H3K4me3 and H3K36me3 but not a repressive histone modification, H3K27me3. The high level of ubiquitination at the promoter chromatin during mitosis was transient and was removed within 2 h after the cells exited mitosis and entered the next cell cycle. These results reveal that the ubiquitination of promoter chromatin during mitosis is a bookmark identifying active genes during chromosomal condensation in mitosis, and we suggest that this process facilitates transcriptional reactivation post-mitosis. PMID:22941662

  19. K63-Linked Ubiquitination in Kinase Activation and Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Guocan [Department of Cancer Biology, The University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Gao, Yuan [Department of Molecular and Cellular Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); The University of Texas Graduate School of Biomedical Sciences at Houston, Houston, TX (United States); Li, Liren [Department of Genomic Medicine, The University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Jin, Guoxiang; Cai, Zhen [Department of Molecular and Cellular Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); The University of Texas Graduate School of Biomedical Sciences at Houston, Houston, TX (United States); Chao, Jui-I [Department of Molecular and Cellular Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Department of Biological Science and Technology, National Chiao Tung University, Hsinchu, Taiwan (China); Lin, Hui-Kuan, E-mail: [Department of Molecular and Cellular Oncology, The University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); The University of Texas Graduate School of Biomedical Sciences at Houston, Houston, TX (United States)


    Ubiquitination has been demonstrated to play a pivotal role in multiple biological functions, which include cell growth, proliferation, apoptosis, DNA damage response, innate immune response, and neuronal degeneration. Although the role of ubiquitination in targeting proteins for proteasome-dependent degradation have been extensively studied and well-characterized, the critical non-proteolytic functions of ubiquitination, such as protein trafficking and kinase activation, involved in cell survival and cancer development, just start to emerge, In this review, we will summarize recent progresses in elucidating the non-proteolytic function of ubiquitination signaling in protein kinase activation and its implications in human cancers. The advancement in the understanding of the novel functions of ubiquitination in signal transduction pathways downstream of growth factor receptors may provide novel paradigms for the treatment of human cancers.

  20. K63-Linked Ubiquitination in Kinase Activation and Cancer

    International Nuclear Information System (INIS)

    Wang, Guocan; Gao, Yuan; Li, Liren; Jin, Guoxiang; Cai, Zhen; Chao, Jui-I; Lin, Hui-Kuan


    Ubiquitination has been demonstrated to play a pivotal role in multiple biological functions, which include cell growth, proliferation, apoptosis, DNA damage response, innate immune response, and neuronal degeneration. Although the role of ubiquitination in targeting proteins for proteasome-dependent degradation have been extensively studied and well-characterized, the critical non-proteolytic functions of ubiquitination, such as protein trafficking and kinase activation, involved in cell survival and cancer development, just start to emerge, In this review, we will summarize recent progresses in elucidating the non-proteolytic function of ubiquitination signaling in protein kinase activation and its implications in human cancers. The advancement in the understanding of the novel functions of ubiquitination in signal transduction pathways downstream of growth factor receptors may provide novel paradigms for the treatment of human cancers.

  1. Dynamic ubiquitin signaling in cell cycle regulation. (United States)

    Gilberto, Samuel; Peter, Matthias


    The cell division cycle is driven by a collection of enzymes that coordinate DNA duplication and separation, ensuring that genomic information is faithfully and perpetually maintained. The activity of the effector proteins that perform and coordinate these biological processes oscillates by regulated expression and/or posttranslational modifications. Ubiquitylation is a cardinal cellular modification and is long known for driving cell cycle transitions. In this review, we emphasize emerging concepts of how ubiquitylation brings the necessary dynamicity and plasticity that underlie the processes of DNA replication and mitosis. New studies, often focusing on the regulation of chromosomal proteins like DNA polymerases or kinetochore kinases, are demonstrating that ubiquitylation is a versatile modification that can be used to fine-tune these cell cycle events, frequently through processes that do not involve proteasomal degradation. Understanding how the increasing variety of identified ubiquitin signals are transduced will allow us to develop a deeper mechanistic perception of how the multiple factors come together to faithfully propagate genomic information. Here, we discuss these and additional conceptual challenges that are currently under study toward understanding how ubiquitin governs cell cycle regulation. © 2017 Gilberto and Peter.

  2. KF-1 ubiquitin ligase: an anxiety suppressor

    Directory of Open Access Journals (Sweden)

    Tamotsu Hashimoto-Gotoh


    Full Text Available Anxiety is an instinct that may have developed to promote adaptive survival by evading unnecessary danger. However, excessive anxiety is disruptive and can be a basic disorder of other psychiatric diseases such as depression. The KF-1, a ubiquitin ligase located to the endoplasmic reticulum (ER, may prevent excessive anxiety; kf-1−/− mice exhibit selectively elevated anxiety-like behavior against light or heights. Thus, KF-1 may degrade some target proteins, responsible for promoting anxiety, through the ER-associated degradation pathway, similar to Parkin in Parkinson's disease (PD. Parkin, another ER-ubiquitin ligase, prevents the degeneration of dopaminergic neurons by degrading the target proteins responsible for PD. Molecular phylogenetic studies have revealed that the prototype of kf-1 appeared in the very early phase of animal evolution but was lost, unlike parkin, in the lineage leading up to Drosophila. Therefore, kf-1−/− mice, be a powerful tool for elucidating the molecular mechanisms involved in emotional regulation, and for screening novel anxiolytic/antidepressant compounds.

  3. A unique deubiquitinase that deconjugates phosphoribosyl-linked protein ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Qiu, Jiazhang; Yu, Kaiwen; Fei, Xiaowen; Liu, Yao; Nakayasu, Ernesto S.; Piehowski, Paul D.; Shaw, Jared B.; Puvar, Kedar; Das, Chittaranjan; Liu, Xiaoyun; Luo, Zhao-Qing


    Ubiquitination regulates many aspects of host immunity and thus is a common target for infectious agents. Recent studies revealed that members of the SidE effector family of the bacterial pathogen Legionella pneumophila attacked several small GTPases associated with the endoplasmic reticulum by a novel ubiquitination mechanism that does not require the E1 and E2 enzymes of the host ubiquitination machinery. Following ubiquitin activation by ADP- ribosylation via a mono-ADP-ribosylation motif, ADP-ribosylated ubiquitin is cleaved by a phosphodiesterasedomainwithinSdeA,whichisconcomitantwiththelinkof phosphoribosylated ubiquitin to serine residues in the substrate. Here we demonstrate that the activity of SidEs is regulated by SidJ, another effector encoded by a gene situated in the locus coding for three members of the SidE family (SdeC, SdeB and SdeA). SidJ functions to remove ubiquitin from SidEs-modified substrates by cleaving the phosphodiester bond that links phosphoribosylated ubiquitin to protein substrates. Further, the deubiquitinase activity of SidJ is essential for its role in L. pneumophila infection. Finally, the activity of SidJ is required for efficiently reducing the abundance of ubiquitinated Rab33b in infected cells within a few hours after bacterial uptake. Our results establish SidJ as a deubiquitinase that functions to impose temporal regulation of the activity of the SidE effectors. The identification of SidJ may shed light on future study of signaling cascades mediated by this unique ubiquitination that also potentially regulates cellular processes in eukaryotic cells.

  4. Chemotherapy inhibits skeletal muscle ubiquitin-proteasome-dependent proteolysis. (United States)

    Tilignac, Thomas; Temparis, Sandrine; Combaret, Lydie; Taillandier, Daniel; Pouch, Marie-Noëlle; Cervek, Matjaz; Cardenas, Diana M; Le Bricon, Thierry; Debiton, Eric; Samuels, Susan E; Madelmont, Jean-Claude; Attaix, Didier


    Chemotherapy has cachectic effects, but it is unknown whether cytostatic agents alter skeletal muscle proteolysis. We hypothesized that chemotherapy-induced alterations in protein synthesis should result in the increased incidence of abnormal proteins, which in turn should stimulate ubiquitin-proteasome-dependent proteolysis. The effects of the nitrosourea cystemustine were investigated in skeletal muscles from both healthy and colon 26 adenocarcinoma-bearing mice, an appropriate model for testing the impact of cytostatic agents. Muscle wasting was seen in both groups of mice 4 days after a single cystemustine injection, and the drug further increased the loss of muscle proteins already apparent in tumor-bearing animals. Cystemustine cured the tumor-bearing mice with 100% efficacy. Surprisingly, within 11 days of treatment, rates of muscle proteolysis progressively decreased below basal levels observed in healthy control mice and contributed to the cessation of muscle wasting. Proteasome-dependent proteolysis was inhibited by mechanisms that include reduced mRNA levels for 20S and 26S proteasome subunits, decreased protein levels of 20S proteasome subunits and the S14 non-ATPase subunit of the 26S proteasome, and impaired chymotrypsin- and trypsin-like activities of the enzyme. A combination of cisplatin and ifosfamide, two drugs that are widely used in the treatment of cancer patients, also depressed the expression of proteasomal subunits in muscles from rats bearing the MatB adenocarcinoma below basal levels. Thus, a down-regulation of ubiquitin-proteasome-dependent proteolysis is observed with various cytostatic agents and contributes to reverse the chemotherapy-induced muscle wasting.

  5. PKC-Dependent GlyT1 Ubiquitination Occurs Independent of Phosphorylation: Inespecificity in Lysine Selection for Ubiquitination.

    Directory of Open Access Journals (Sweden)

    Susana P Barrera

    Full Text Available Neurotransmitter transporter ubiquitination is emerging as the main mechanism for endocytosis and sorting of cargo into lysosomes. In this study, we demonstrate PKC-dependent ubiquitination of three different isoforms of the glycine transporter 1 (GlyT1. Incubation of cells expressing transporter with the PKC activator phorbol ester induced a dramatic, time-dependent increase in GlyT1 ubiquitination, followed by accumulation of GlyT1 in EEA1 positive early endosomes. This occurred via a mechanism that was abolished by inhibition of PKC. GlyT1 endocytosis was confirmed in both retinal sections and primary cultures of mouse amacrine neurons. Replacement of only all lysines in the N-and C-termini to arginines prevented ubiquitination and endocytosis, displaying redundancy in the mechanism of ubiquitination. Interestingly, a 40-50% reduction in glycine uptake was detected in phorbol-ester stimulated cells expressing the WT-GlyT1, whereas no significant change was for the mutant protein, demonstrating that endocytosis participates in the reduction of uptake. Consistent with previous findings for the dopamine transporter DAT, ubiquitination of GlyT1 tails functions as sorting signal to deliver transporter into the lysosome and removal of ubiquitination sites dramatically attenuated the rate of GlyT1 degradation. Finally, we showed for the first time that PKC-dependent GlyT1 phosphorylation was not affected by removal of ubiquitination sites, suggesting separate PKC-dependent signaling events for these posttranslational modifications.

  6. The Ubiquitin Binding Domain ZnF UBP Recognizes the C-Terminal Diglycine Motif of Unanchored Ubiquitin

    Energy Technology Data Exchange (ETDEWEB)

    Reyes-Turcu,F.; Horton, J.; Mullally, J.; Heroux, A.; Cheng, X.; Wilkinson, K.


    Ubiquitin is a highly versatile post-translational modification that controls virtually all types of cellular events. Over the past ten years we have learned that diverse forms of ubiquitin modifications and of ubiquitin binding modules co-exist in the cell, giving rise to complex networks of protein:protein interactions. A central problem that continues to puzzle ubiquitinologists is how cells translate this myriad of stimuli into highly specific responses. This is a classical signaling problem. Here, we draw parallels with the phosphorylation signaling pathway and we discuss the expanding repertoire of ubiquitin signals, signal tranducers and signaling-regulated E3 enzymes. We examine recent advances in the field, including a new mechanism of regulation of E3 ligases that relies on ubiquitination.

  7. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila. (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin


    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  8. The mechanism of OTUB1-mediated inhibition of ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Wiener, Reuven; Zhang, Xiangbin; Wang, Tao; Wolberger, Cynthia (JHU)


    Histones are ubiquitinated in response to DNA double-strand breaks (DSB), promoting recruitment of repair proteins to chromatin. UBC13 (also known as UBE2N) is a ubiquitin-conjugating enzyme (E2) that heterodimerizes with UEV1A (also known as UBE2V1) and synthesizes K63-linked polyubiquitin (K63Ub) chains at DSB sites in concert with the ubiquitin ligase (E3), RNF168 (ref. 3). K63Ub synthesis is regulated in a non-canonical manner by the deubiquitinating enzyme, OTUB1 (OTU domain-containing ubiquitin aldehyde-binding protein 1), which binds preferentially to the UBC13-Ub thiolester. Residues amino-terminal to the OTU domain, which had been implicated in ubiquitin binding, are required for binding to UBC13-Ub and inhibition of K63Ub synthesis. Here we describe structural and biochemical studies elucidating how OTUB1 inhibits UBC13 and other E2 enzymes. We unexpectedly find that OTUB1 binding to UBC13-Ub is allosterically regulated by free ubiquitin, which binds to a second site in OTUB1 and increases its affinity for UBC13-Ub, while at the same time disrupting interactions with UEV1A in a manner that depends on the OTUB1 N terminus. Crystal structures of an OTUB1-UBC13 complex and of OTUB1 bound to ubiquitin aldehyde and a chemical UBC13-Ub conjugate show that binding of free ubiquitin to OTUB1 triggers conformational changes in the OTU domain and formation of a ubiquitin-binding helix in the N terminus, thus promoting binding of the conjugated donor ubiquitin in UBC13-Ub to OTUB1. The donor ubiquitin thus cannot interact with the E2 enzyme, which has been shown to be important for ubiquitin transfer. The N-terminal helix of OTUB1 is positioned to interfere with UEV1A binding to UBC13, as well as with attack on the thiolester by an acceptor ubiquitin, thereby inhibiting K63Ub synthesis. OTUB1 binding also occludes the RING E3 binding site on UBC13, thus providing a further component of inhibition. The general features of the inhibition mechanism explain how OTUB1

  9. Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae. (United States)

    Gilon, T; Chomsky, O; Kulka, R G


    Combinations of different ubiquitin-conjugating (Ubc) enzymes and other factors constitute subsidiary pathways of the ubiquitin system, each of which ubiquitinates a specific subset of proteins. There is evidence that certain sequence elements or structural motifs of target proteins are degradation signals which mark them for ubiquitination by a particular branch of the ubiquitin system and for subsequent degradation. Our aim was to devise a way of searching systematically for degradation signals and to determine to which ubiquitin system subpathways they direct the proteins. We have constructed two reporter gene libraries based on the lacZ or URA3 genes which, in Saccharomyces cerevisiae, express fusion proteins with a wide variety of C-terminal extensions. From these, we have isolated clones producing unstable fusion proteins which are stabilized in various ubc mutants. Among these are 10 clones whose products are stabilized in ubc6, ubc7 or ubc6ubc7 double mutants. The C-terminal extensions of these clones, which vary in length from 16 to 50 amino acid residues, are presumed to contain degradation signals channeling proteins for degradation via the UBC6 and/or UBC7 subpathways of the ubiquitin system. Some of these C-terminal tails share similar sequence motifs, and a feature common to almost all of these sequences is a highly hydrophobic region such as is usually located inside globular proteins or inserted into membranes. PMID:9582269

  10. Mcl-1 Ubiquitination: Unique Regulation of an Essential Survival Protein

    Directory of Open Access Journals (Sweden)

    Barbara Mojsa


    Full Text Available Mcl-1 is an anti-apoptotic protein of the Bcl-2 family that is essential for the survival of multiple cell lineages and that is highly amplified in human cancer. Under physiological conditions, Mcl-1 expression is tightly regulated at multiple levels, involving transcriptional, post-transcriptional and post-translational processes. Ubiquitination of Mcl-1, that targets it for proteasomal degradation, allows for rapid elimination of the protein and triggering of cell death, in response to various cellular events. In the last decade, a number of studies have elucidated different pathways controlling Mcl-1 ubiquitination and degradation. Four different E3 ubiquitin-ligases (e.g., Mule, SCFβ-TrCP, SCFFbw7 and Trim17 and one deubiquitinase (e.g., USP9X, that respectively mediate and oppose Mcl-1 ubiquitination, have been formerly identified. The interaction between Mule and Mcl-1 can be modulated by other Bcl-2 family proteins, while recognition of Mcl-1 by the other E3 ubiquitin-ligases and deubiquitinase is influenced by phosphorylation of specific residues in Mcl-1. The protein kinases and E3 ubiquitin-ligases that are involved in the regulation of Mcl-1 stability vary depending on the cellular context, highlighting the complexity and pivotal role of Mcl-1 regulation. In this review, we attempt to recapitulate progress in understanding Mcl-1 regulation by the ubiquitin-proteasome system.

  11. Genome-Wide Identification, Phylogenetic and Expression Analyses of the Ubiquitin-Conjugating Enzyme Gene Family in Maize (United States)

    Jue, Dengwei; Sang, Xuelian; Lu, Shengqiao; Dong, Chen; Zhao, Qiufang; Chen, Hongliang; Jia, Liqiang


    Background Ubiquitination is a post-translation modification where ubiquitin is attached to a substrate. Ubiquitin-conjugating enzymes (E2s) play a major role in the ubiquitin transfer pathway, as well as a variety of functions in plant biological processes. To date, no genome-wide characterization of this gene family has been conducted in maize (Zea mays). Methodology/Principal Findings In the present study, a total of 75 putative ZmUBC genes have been identified and located in the maize genome. Phylogenetic analysis revealed that ZmUBC proteins could be divided into 15 subfamilies, which include 13 ubiquitin-conjugating enzymes (ZmE2s) and two independent ubiquitin-conjugating enzyme variant (UEV) groups. The predicted ZmUBC genes were distributed across 10 chromosomes at different densities. In addition, analysis of exon-intron junctions and sequence motifs in each candidate gene has revealed high levels of conservation within and between phylogenetic groups. Tissue expression analysis indicated that most ZmUBC genes were expressed in at least one of the tissues, indicating that these are involved in various physiological and developmental processes in maize. Moreover, expression profile analyses of ZmUBC genes under different stress treatments (4°C, 20% PEG6000, and 200 mM NaCl) and various expression patterns indicated that these may play crucial roles in the response of plants to stress. Conclusions Genome-wide identification, chromosome organization, gene structure, evolutionary and expression analyses of ZmUBC genes have facilitated in the characterization of this gene family, as well as determined its potential involvement in growth, development, and stress responses. This study provides valuable information for better understanding the classification and putative functions of the UBC-encoding genes of maize. PMID:26606743

  12. HUWE1 and TRIP12 Collaborate in Degradation of Ubiquitin-Fusion Proteins and Misframed Ubiquitin

    DEFF Research Database (Denmark)

    Poulsen, Esben G; Steinhauer, Cornelia; Lees, Michael


    In eukaryotic cells an uncleavable ubiquitin moiety conjugated to the N-terminus of a protein signals the degradation of the fusion protein via the proteasome-dependent ubiquitin fusion degradation (UFD) pathway. In yeast the molecular mechanism of the UFD pathway has been well characterized...... in degradation of the UFD substrate Ub(G76V)-YFP. The most significant hits from the screen were the E3 ubiquitin-protein ligase HUWE1, as well as PSMD7 and PSMD14 that encode proteasome subunits. Accordingly, knock down of HUWE1 led to an increase in the steady state level and a retarded degradation of the UFD...... substrate. Knock down of HUWE1 also led to a stabilization of the physiological UFD substrate UBB(+1). Precipitation experiments revealed that HUWE1 is associated with both the Ub(G76V)-YFP substrate and the 26S proteasome, indicating that it functions late in the UFD pathway. Double knock down of HUWE1...

  13. Simulated pressure denaturation thermodynamics of ubiquitin. (United States)

    Ploetz, Elizabeth A; Smith, Paul E


    Simulations of protein thermodynamics are generally difficult to perform and provide limited information. It is desirable to increase the degree of detail provided by simulation and thereby the potential insight into the thermodynamic properties of proteins. In this study, we outline how to analyze simulation trajectories to decompose conformation-specific, parameter free, thermodynamically defined protein volumes into residue-based contributions. The total volumes are obtained using established methods from Fluctuation Solution Theory, while the volume decomposition is new and is performed using a simple proximity method. Native and fully extended ubiquitin are used as the test conformations. Changes in the protein volumes are then followed as a function of pressure, allowing for conformation-specific protein compressibility values to also be obtained. Residue volume and compressibility values indicate significant contributions to protein denaturation thermodynamics from nonpolar and coil residues, together with a general negative compressibility exhibited by acidic residues. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Water Evaporation and Conformational Changes from Partially Solvated Ubiquitin

    Directory of Open Access Journals (Sweden)

    Saravana Prakash Thirumuruganandham


    Full Text Available Using molecular dynamics simulation, we study the evaporation of water molecules off partially solvated ubiquitin. The evaporation and cooling rates are determined for a molecule at the initial temperature of 300 K. The cooling rate is found to be around 3 K/ns, and decreases with water temperature in the course of the evaporation. The conformation changes are monitored by studying a variety of intermediate partially solvated ubiquitin structures. We find that ubiquitin shrinks with decreasing hydration shell and exposes more of its hydrophilic surface area to the surrounding.

  15. Ubiquitination of the common cytokine receptor γc and regulation of expression by an ubiquitination/deubiquitination machinery

    International Nuclear Information System (INIS)

    Gesbert, Franck; Malarde, Valerie; Dautry-Varsat, Alice


    The common cytokine receptor γ c is shared by the interleukin-2, -4, -7, -9, -15, and -21 receptors, and is essential for lymphocyte proliferation and survival. The regulation of γ c receptor expression level is therefore critical for the ability of cells to respond to these cytokines. We previously reported that γ c is efficiently constitutively internalized and addressed towards a degradation endocytic compartment. We show that γ c is ubiquitinated and also associated to ubiquitinated proteins. We report that the ubiquitin-ligase c-Cbl induces γ c down-regulation. In addition, the ubiquitin-hydrolase, DUB-2, counteracts the effect of c-Cbl on γ c expression. We show that an increase in DUB-2 expression correlates with an increased γ c half-life, resulting in the up-regulation of the receptor. Altogether, we show that γ c is the target of an ubiquitination mechanism and its expression level can be regulated through the activities of a couple of ubiquitin-ligase/ubiquitin-hydrolase enzymes, namely c-Cbl/DUB-2

  16. A role for PCNA ubiquitination in immunoglobulin hypermutation.

    Directory of Open Access Journals (Sweden)

    Hiroshi Arakawa


    Full Text Available Proliferating cell nuclear antigen (PCNA is a DNA polymerase cofactor and regulator of replication-linked functions. Upon DNA damage, yeast and vertebrate PCNA is modified at the conserved lysine K164 by ubiquitin, which mediates error-prone replication across lesions via translesion polymerases. We investigated the role of PCNA ubiquitination in variants of the DT40 B cell line that are mutant in K164 of PCNA or in Rad18, which is involved in PCNA ubiquitination. Remarkably, the PCNA(K164R mutation not only renders cells sensitive to DNA-damaging agents, but also strongly reduces activation induced deaminase-dependent single-nucleotide substitutions in the immunoglobulin light-chain locus. This is the first evidence, to our knowledge, that vertebrates exploit the PCNA-ubiquitin pathway for immunoglobulin hypermutation, most likely through the recruitment of error-prone DNA polymerases.

  17. Curcumin ameliorates skeletal muscle atrophy in type 1 diabetic mice by inhibiting protein ubiquitination. (United States)

    Ono, Taisuke; Takada, Shingo; Kinugawa, Shintaro; Tsutsui, Hiroyuki


    What is the central question of this study? We sought to examine whether curcumin could ameliorate skeletal muscle atrophy in diabetic mice by inhibiting protein ubiquitination, inflammatory cytokines and oxidative stress. What is the main finding and its importance? We found that curcumin ameliorated skeletal muscle atrophy in streptozotocin-induced diabetic mice by inhibiting protein ubiquitination without affecting protein synthesis. This favourable effect of curcumin was possibly due to the inhibition of inflammatory cytokines and oxidative stress. Curcumin may be beneficial for the treatment of muscle atrophy in type 1 diabetes mellitus. Skeletal muscle atrophy develops in patients with diabetes mellitus (DM), especially in type 1 DM, which is associated with chronic inflammation. Curcumin, the active ingredient of turmeric, has various biological actions, including anti-inflammatory and antioxidant properties. We hypothesized that curcumin could ameliorate skeletal muscle atrophy in mice with streptozotocin-induced type 1 DM. C57BL/6 J mice were injected with streptozotocin (200 mg kg(-1) i.p.; DM group) or vehicle (control group). Each group of mice was randomly subdivided into two groups of 10 mice each and fed a diet with or without curcumin (1500 mg kg(-1) day(-1)) for 2 weeks. There were significant decreases in body weight, skeletal muscle weight and cellular cross-sectional area of the skeletal muscle in DM mice compared with control mice, and these changes were significantly attenuated in DM+Curcumin mice without affecting plasma glucose and insulin concentrations. Ubiquitination of protein was increased in skeletal muscle from DM mice and decreased in DM+Curcumin mice. Gene expressions of muscle-specific ubiquitin E3 ligase atrogin-1/MAFbx and MuRF1 were increased in DM and inhibited in DM+Curcumin mice. Moreover, nuclear factor-κB activation, concentrations of the inflammatory cytokines tumour necrosis factor-α and interleukin-1β and oxidative

  18. The effect of acetaminophen on ubiquitin homeostasis in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Angelina Huseinovic

    Full Text Available Acetaminophen (APAP, although considered a safe drug, is one of the major causes of acute liver failure by overdose, and therapeutic chronic use can cause serious health problems. Although the reactive APAP metabolite N-acetyl-p-benzoquinoneimine (NAPQI is clearly linked to liver toxicity, toxicity of APAP is also found without drug metabolism of APAP to NAPQI. To get more insight into mechanisms of APAP toxicity, a genome-wide screen in Saccharomyces cerevisiae for APAP-resistant deletion strains was performed. In this screen we identified genes related to the DNA damage response. Next, we investigated the link between genotype and APAP-induced toxicity or resistance by performing a more detailed screen with a library containing mutants of 1522 genes related to nuclear processes, like DNA repair and chromatin remodelling. We identified 233 strains that had an altered growth rate relative to wild type, of which 107 showed increased resistance to APAP and 126 showed increased sensitivity. Gene Ontology analysis identified ubiquitin homeostasis, regulation of transcription of RNA polymerase II genes, and the mitochondria-to-nucleus signalling pathway to be associated with APAP resistance, while histone exchange and modification, and vesicular transport were connected to APAP sensitivity. Indeed, we observed a link between ubiquitin levels and APAP resistance, whereby ubiquitin deficiency conferred resistance to APAP toxicity while ubiquitin overexpression resulted in sensitivity. The toxicity profile of various chemicals, APAP, and its positional isomer AMAP on a series of deletion strains with ubiquitin deficiency showed a unique resistance pattern for APAP. Furthermore, exposure to APAP increased the level of free ubiquitin and influenced the ubiquitination of proteins. Together, these results uncover a role for ubiquitin homeostasis in APAP-induced toxicity.

  19. Detection of ubiquitinated huntingtin species in intracellular aggregates

    Directory of Open Access Journals (Sweden)

    Katrin eJuenemann


    Full Text Available Protein conformation diseases, including polyglutamine diseases, result from the accumulation and aggregation of misfolded proteins. Huntington’s disease is one of nine diseases caused by an expanded polyglutamine repeat within the affected protein and is hallmarked by intracellular inclusion bodies composed of aggregated N-terminal huntingtin fragments and other sequestered proteins. Fluorescence microscopy and filter trap assay are conventional methods to study protein aggregates, but cannot be used to analyze the presence and levels of post-translational modifications of aggregated huntingtin such as ubiquitination. Ubiquitination of proteins can be a signal for degradation and intracellular localization, but also affects protein activity and protein-protein interactions. The function of ubiquitination relies on its mono- and polymeric isoforms attached to protein substrates. Studying the ubiquitination pattern of aggregated huntingtin fragments offers an important possibility to understand huntingtin degradation and aggregation processes within the cell. For the identification of aggregated huntingtin and its ubiquitinated species, solubilization of the cellular aggregates is mandatory. Here we describe methods to identify post-translational modifications such as ubiquitination of aggregated mutant huntingtin. This approach is specifically described for use with mammalian cell culture and is suitable to study other disease-related proteins prone to aggregate.

  20. Regulation of G Protein-Coupled Receptors by Ubiquitination

    Directory of Open Access Journals (Sweden)

    Kamila Skieterska


    Full Text Available G protein-coupled receptors (GPCRs comprise the largest family of membrane receptors that control many cellular processes and consequently often serve as drug targets. These receptors undergo a strict regulation by mechanisms such as internalization and desensitization, which are strongly influenced by posttranslational modifications. Ubiquitination is a posttranslational modification with a broad range of functions that is currently gaining increased appreciation as a regulator of GPCR activity. The role of ubiquitination in directing GPCRs for lysosomal degradation has already been well-established. Furthermore, this modification can also play a role in targeting membrane and endoplasmic reticulum-associated receptors to the proteasome. Most recently, ubiquitination was also shown to be involved in GPCR signaling. In this review, we present current knowledge on the molecular basis of GPCR regulation by ubiquitination, and highlight the importance of E3 ubiquitin ligases, deubiquitinating enzymes and β-arrestins. Finally, we discuss classical and newly-discovered functions of ubiquitination in controlling GPCR activity.

  1. miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)


    Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

  2. High expression of Polycomb group protein EZH2 predicts poor survival in salivary gland adenoid cystic carcinoma

    NARCIS (Netherlands)

    Vékony, H.; Raaphorst, F.M.; Otte, A.P.; van Lohuizen, M.; Leemans, C.R.; van der Waal, I.; Bloemena, E.


    Background: The prognosis of adenoid cystic carcinoma (ACC), a malignant salivary gland tumour, depends on clinicopathological parameters. To decipher the biological behaviour of ACC, and to identify patients at risk of developing metastases, additional markers are needed. Methods: Expression of the

  3. dKDM2 couples histone H2A ubiquitylation to histone H3 demethylation during Polycomb group silencing

    NARCIS (Netherlands)

    A. Lagarou (Anna); A.B. Mohd Sarip; Y.M. Moshkin (Yuri); G.E. Chalkley (Gillian); K. Bezstarosti (Karel); J.A.A. Demmers (Jeroen); C.P. Verrijzer (Peter)


    textabstractTranscription regulation involves enzyme-mediated changes in chromatin structure. Here, we describe a novel mode of histone crosstalk during gene silencing, in which histone H2A monoubiquitylation is coupled to the removal of histone H3 Lys 36 dimethylation (H3K36me2). This pathway was

  4. The Regulation of Tumor Suppressor p63 by the Ubiquitin-Proteasome System

    Directory of Open Access Journals (Sweden)

    Stephen R. Armstrong


    Full Text Available The protein p63 has been identified as a homolog of the tumor suppressor protein p53 and is capable of inducing apoptosis, cell cycle arrest, or senescence. p63 has at least six isoforms, which can be divided into two major groups: the TAp63 variants that contain the N-terminal transactivation domain and the ΔNp63 variants that lack the N-terminal transactivation domain. The TAp63 variants are generally considered to be tumor suppressors involved in activating apoptosis and suppressing metastasis. ΔNp63 variants cannot induce apoptosis but can act as dominant negative inhibitors to block the function of TAp53, TAp73, and TAp63. p63 is rarely mutated in human tumors and is predominately regulated at the post-translational level by phosphorylation and ubiquitination. This review focuses primarily on regulation of p63 by the ubiquitin E-3 ligase family of enzymes via ubiquitination and proteasome-mediated degradation, and introduces a new key regulator of the p63 protein.

  5. Global-genome Nucleotide Excision Repair Controlled by Ubiquitin/Sumo Modifiers

    Directory of Open Access Journals (Sweden)

    Peter eRuethemann


    Full Text Available Global-genome nucleotide excision repair (GG-NER prevents genome instability by excising a wide range of structurally unrelated DNA base adducts and crosslinks induced by chemical carcinogens, ultraviolet (UV radiation or intracellular metabolic by-products. As a versatile damage sensor, xeroderma pigmentosum group C (XPC protein initiates this generic defense reaction by locating the damage and recruiting the subunits of a large lesion demarcation complex that, in turn, triggers the excision of aberrant DNA by endonucleases. In the very special case of a DNA repair response to UV radiation, the function of this XPC initiator is tightly controlled by the dual action of cullin-type CRL4DDB2 and sumo-targeted RNF111 ubiquitin ligases. This twofold protein ubiquitination system promotes GG-NER reactions by spatially and temporally regulating the interaction of XPC protein with damaged DNA across the nucleosome landscape of chromatin. In the absence of either CRL4DDB2 or RNF111, the DNA excision repair of UV lesions is inefficient, indicating that these two ubiquitin ligases play a critical role in mitigating the adverse biological effects of UV light in the exposed skin.

  6. The Ubiquitin E3 Ligase TRAF6 Exacerbates Ischemic Stroke by Ubiquitinating and Activating Rac1. (United States)

    Li, Tao; Qin, Juan-Juan; Yang, Xia; Ji, Yan-Xiao; Guo, Fangliang; Cheng, Wen-Lin; Wu, Xiaolin; Gong, Fu-Han; Hong, Ying; Zhu, Xue-Yong; Gong, Jun; Wang, Zhihua; Huang, Zan; She, Zhi-Gang; Li, Hongliang


    Stroke is one of the leading causes of morbidity and mortality worldwide. Inflammation, oxidative stress, apoptosis, and excitotoxicity contribute to neuronal death during ischemic stroke; however, the mechanisms underlying these complicated pathophysiological processes remain to be fully elucidated. Here, we found that the expression of tumor necrosis factor receptor-associated factor 6 (TRAF6) was markedly increased after cerebral ischemia/reperfusion (I/R) in mice. TRAF6 ablation in male mice decreased the infarct volume and neurological deficit scores and decreased proinflammatory signaling, oxidative stress, and neuronal death after cerebral I/R, whereas transgenic overexpression of TRAF6 in male mice exhibited the opposite effects. Mechanistically, we demonstrated that TRAF6 induced Rac1 activation and consequently promoted I/R injury by directly binding and ubiquitinating Rac1. Either functionally mutating the TRAF6 ubiquitination site on Rac1 or inactivating Rac1 with a specific inhibitor reversed the deleterious effects of TRAF6 overexpression during I/R injury. In conclusion, our study demonstrated that TRAF6 is a key promoter of ischemic signaling cascades and neuronal death after cerebral I/R injury. Therefore, the TRAF6/Rac1 pathway might be a promising target to attenuate cerebral I/R injury. SIGNIFICANCE STATEMENT Stroke is one of the most severe and devastating neurological diseases globally. The complicated pathophysiological processes restrict the translation of potential therapeutic targets into medicine. Further elucidating the molecular mechanisms underlying cerebral ischemia/reperfusion injury may open a new window for pharmacological interventions to promote recovery from stroke. Our study revealed that ischemia-induced tumor necrosis factor receptor-associated factor 6 (TRAF6) upregulation binds and ubiquitinates Rac1 directly, which promotes neuron death through neuroinflammation and neuro-oxidative signals. Therefore, precisely targeting

  7. Direct Sensing and Discrimination among Ubiquitin and Ubiquitin Chains Using Solid-State Nanopores. (United States)

    Nir, Iftach; Huttner, Diana; Meller, Amit


    Nanopore sensing involves an electrophoretic transport of analytes through a nanoscale pore, permitting label-free sensing at the single-molecule level. However, to date, the detection of individual small proteins has been challenging, primarily due to the poor signal/noise ratio that these molecules produce during passage through the pore. Here, we show that fine adjustment of the buffer pH, close to the isoelectric point, can be used to slow down the translocation speed of the analytes, hence permitting sensing and characterization of small globular proteins. Ubiquitin (Ub) is a small protein of 8.5 kDa, which is well conserved in all eukaryotes. Ub conjugates to proteins as a posttranslational modification called ubiquitination. The immense diversity of Ub substrates, as well as the complexity of Ub modification types and the numerous physiological consequences of these modifications, make Ub and Ub chains an interesting and challenging subject of study. The ability to detect Ub and to identify Ub linkage type at the single-molecule level may provide a novel tool for investigation in the Ub field. This is especially adequate because, for most ubiquitinated substrates, Ub modifies only a few molecules in the cell at a given time. Applying our method to the detection of mono- and poly-Ub molecules, we show that we can analyze their characteristics using nanopores. Of particular importance is that two Ub dimers that are equal in molecular weight but differ in 3D structure due to their different linkage types can be readily discriminated. Thus, to our knowledge, our method offers a novel approach for analyzing proteins in unprecedented detail using solid-state nanopores. Specifically, it provides the basis for development of single-molecule sensing of differently ubiquitinated substrates with different biological significance. Finally, our study serves as a proof of concept for approaching nanopore detection of sub-10-kDa proteins and demonstrates the ability of

  8. A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription. (United States)

    Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien; Pira, Dorcas; Angrand, Pierre-Olivier


    Polycomb repression controls the expression of hundreds of genes involved in development and is mediated by essentially two classes of chromatin-associated protein complexes. The Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27, an epigenetic mark that serves as a docking site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain. Using biochemical approaches and a novel in vivo imaging assay, we show that the short CBX2-2 isoform lacking the Pc box, does not participate in PRC1 protein complexes, but self-associates in vivo and forms complexes of high molecular weight. Furthermore, the CBX2 short isoform is still able to repress transcription, suggesting that Polycomb repression might occur in the absence of PRC1 formation.

  9. Ubiquitin-specific Protease 11 (USP11) Deubiquitinates Hybrid Small Ubiquitin-like Modifier (SUMO)-Ubiquitin Chains to Counteract RING Finger Protein 4 (RNF4)

    DEFF Research Database (Denmark)

    Hendriks, Ivo A; Schimmel, Joost; Eifler, Karolin


    of RNF4 as a counterbalancing factor. In response to DNA damage induced by methyl methanesulfonate, USP11 could counteract RNF4 to inhibit the dissolution of nuclear bodies. Thus, we provide novel insight into cross-talk between ubiquitin and SUMO and uncover USP11 and RNF4 as a balanced SUMO...

  10. Accessing ns-μs side chain dynamics in ubiquitin with methyl RDCs

    International Nuclear Information System (INIS)

    Fares, Christophe; Lakomek, Nils-Alexander; Walter, Korvin F. A.; Frank, Benedikt T. C.; Meiler, Jens; Becker, Stefan; Griesinger, Christian


    This study presents the first application of the model-free analysis (MFA) (Meiler in J Am Chem Soc 123:6098-6107, 2001; Lakomek in J Biomol NMR 34:101-115, 2006) to methyl group RDCs measured in 13 different alignment media in order to describe their supra-τ c dynamics in ubiquitin. Our results indicate that methyl groups vary from rigid to very mobile with good correlation to residue type, distance to backbone and solvent exposure, and that considerable additional dynamics are effective at rates slower than the correlation time τ c . In fact, the average amplitude of motion expressed in terms of order parameters S 2 associated with the supra-τ c window brings evidence to the existence of fluctuations contributing as much additional mobility as those already present in the faster ps-ns time scale measured from relaxation data. Comparison to previous results on ubiquitin demonstrates that the RDC-derived order parameters are dominated both by rotameric interconversions and faster libration-type motions around equilibrium positions. They match best with those derived from a combined J-coupling and residual dipolar coupling approach (Chou in J Am Chem Soc 125:8959-8966, 2003) taking backbone motion into account. In order to appreciate the dynamic scale of side chains over the entire protein, the methyl group order parameters are compared to existing dynamic ensembles of ubiquitin. Of those recently published, the broadest one, namely the EROS ensemble (Lange in Science 320:1471-1475, 2008), fits the collection of methyl group order parameters presented here best. Last, we used the MFA-derived averaged spherical harmonics to perform highly-parameterized rotameric searches of the side chains conformation and find expanded rotamer distributions with excellent fit to our data. These rotamer distributions suggest the presence of concerted motions along the side chains

  11. Sculpting ion channel functional expression with engineered ubiquitin ligases (United States)

    Kanner, Scott A; Morgenstern, Travis


    The functional repertoire of surface ion channels is sustained by dynamic processes of trafficking, sorting, and degradation. Dysregulation of these processes underlies diverse ion channelopathies including cardiac arrhythmias and cystic fibrosis. Ubiquitination powerfully regulates multiple steps in the channel lifecycle, yet basic mechanistic understanding is confounded by promiscuity among E3 ligase/substrate interactions and ubiquitin code complexity. Here we targeted the catalytic domain of E3 ligase, CHIP, to YFP-tagged KCNQ1 ± KCNE1 subunits with a GFP-nanobody to selectively manipulate this channel complex in heterologous cells and adult rat cardiomyocytes. Engineered CHIP enhanced KCNQ1 ubiquitination, eliminated KCNQ1 surface-density, and abolished reconstituted K+ currents without affecting protein expression. A chemo-genetic variation enabling chemical control of ubiquitination revealed KCNQ1 surface-density declined with a ~ 3.5 hr t1/2 by impaired forward trafficking. The results illustrate utility of engineered E3 ligases to elucidate mechanisms underlying ubiquitin regulation of membrane proteins, and to achieve effective post-translational functional knockdown of ion channels. PMID:29256394

  12. FANCL ubiquitinates β-catenin and enhances its nuclear function. (United States)

    Dao, Kim-Hien T; Rotelli, Michael D; Petersen, Curtis L; Kaech, Stefanie; Nelson, Whitney D; Yates, Jane E; Hanlon Newell, Amy E; Olson, Susan B; Druker, Brian J; Bagby, Grover C


    Bone marrow failure is a nearly universal complication of Fanconi anemia. The proteins encoded by FANC genes are involved in DNA damage responses through the formation of a multisubunit nuclear complex that facilitates the E3 ubiquitin ligase activity of FANCL. However, it is not known whether loss of E3 ubiquitin ligase activity accounts for the hematopoietic stem cell defects characteristic of Fanconi anemia. Here we provide evidence that FANCL increases the activity and expression of β-catenin, a key pluripotency factor in hematopoietic stem cells. We show that FANCL ubiquitinates β-catenin with atypical ubiquitin chain extension known to have nonproteolytic functions. Specifically, β-catenin modified with lysine-11 ubiquitin chain extension efficiently activates a lymphocyte enhancer-binding factor-T cell factor reporter. We also show that FANCL-deficient cells display diminished capacity to activate β-catenin leading to reduced transcription of Wnt-responsive targets c-Myc and Cyclin D1. Suppression of FANCL expression in normal human CD34(+) stem and progenitor cells results in fewer β-catenin active cells and inhibits expansion of multilineage progenitors. Together, these results suggest that diminished Wnt/β-catenin signaling may be an underlying molecular defect in FANCL-deficient hematopoietic stem cells leading to their accelerated loss.

  13. Control of flowering and cell fate by LIF2, an RNA binding partner of the polycomb complex component LHP1.

    Directory of Open Access Journals (Sweden)

    David Latrasse

    Full Text Available Polycomb Repressive Complexes (PRC modulate the epigenetic status of key cell fate and developmental regulators in eukaryotes. The chromo domain protein like heterochromatin protein1 (LHP1 is a subunit of a plant PRC1-like complex in Arabidopsis thaliana and recognizes histone H3 lysine 27 trimethylation, a silencing epigenetic mark deposited by the PRC2 complex. We have identified and studied an LHP1-Interacting Factor2 (LIF2. LIF2 protein has RNA recognition motifs and belongs to the large hnRNP protein family, which is involved in RNA processing. LIF2 interacts in vivo, in the cell nucleus, with the LHP1 chromo shadow domain. Expression of LIF2 was detected predominantly in vascular and meristematic tissues. Loss-of-function of LIF2 modifies flowering time, floral developmental homeostasis and gynoecium growth determination. lif2 ovaries have indeterminate growth and produce ectopic inflorescences with severely affected flowers showing proliferation of ectopic stigmatic papillae and ovules in short-day conditions. To look at how LIF2 acts relative to LHP1, we conducted transcriptome analyses in lif2 and lhp1 and identified a common set of deregulated genes, which showed significant enrichment in stress-response genes. By comparing expression of LHP1 targets in lif2, lhp1 and lif2 lhp1 mutants we showed that LIF2 can either antagonize or act with LHP1. Interestingly, repression of the FLC floral transcriptional regulator in lif2 mutant is accompanied by an increase in H3K27 trimethylation at the locus, without any change in LHP1 binding, suggesting that LHP1 is targeted independently from LIF2 and that LHP1 binding does not strictly correlate with gene expression. LIF2, involved in cell identity and cell fate decision, may modulate the activity of LHP1 at specific loci, during specific developmental windows or in response to environmental cues that control cell fate determination. These results highlight a novel link between plant RNA

  14. The ubiquitin proteasome system in glia and its role in neurodegenerative diseases

    NARCIS (Netherlands)

    Jansen, Anne H. P.; Reits, Eric A. J.; Hol, Elly M.


    The ubiquitin proteasome system (UPS) is crucial for intracellular protein homeostasis and for degradation of aberrant and damaged proteins. The accumulation of ubiquitinated proteins is a hallmark of many neurodegenerative diseases, including amyotrophic lateral sclerosis, Alzheimer's, Parkinson's,

  15. Characterization of ubiquitination dependent dynamics in growth factor receptor signaling by quantitative proteomics

    DEFF Research Database (Denmark)

    Akimov, Vyacheslav; Rigbolt, Kristoffer T G; Nielsen, Mogens M


    Protein ubiquitination is a dynamic reversible post-translational modification that plays a key role in the regulation of numerous cellular processes including signal transduction, endocytosis, cell cycle control, DNA repair and gene transcription. The conjugation of the small protein ubiquitin...... investigating ubiquitination on a proteomic scale, mainly due to the inherited complexity and heterogeneity of ubiquitination. We describe here a quantitative proteomics strategy based on the specificity of ubiquitin binding domains (UBDs) and Stable Isotope Labeling by Amino acids in Cell culture (SILAC...... as ubiquitination-dependent events in signaling pathways. In addition to a detailed seven time-point profile of EGFR ubiquitination over 30 minutes of ligand stimulation, our data determined prominent involvement of Lysine-63 ubiquitin branching in EGF signaling. Furthermore, we found two centrosomal proteins, PCM1...

  16. E1AF degradation by a ubiquitin-proteasome pathway

    International Nuclear Information System (INIS)

    Takahashi, Akiko; Higashino, Fumihiro; Aoyagi, Mariko; Yoshida, Koichi; Itoh, Miyuki; Kobayashi, Masanobu; Totsuka, Yasunori; Kohgo, Takao; Shindoh, Masanobu


    E1AF is a member of the ETS family of transcription factors. In mammary tumors, overexpression of E1AF is associated with tumorigenesis, but E1AF protein has hardly been detected and its degradation mechanism is not yet clear. Here we show that E1AF protein is stabilized by treatment with the 26S protease inhibitor MG132. We found that E1AF was modified by ubiquitin through the C-terminal region and ubiquitinated E1AF aggregated in nuclear dots, and that the inhibition of proteasome-activated transcription from E1AF target promoters. These results suggest that E1AF is degraded via the ubiquitin-proteasome pathway, which has some effect on E1AF function

  17. Coordination of the recruitment of the FANCD2 and PALB2 Fanconi anemia proteins by an ubiquitin signaling network. (United States)

    Bick, Gregory; Zhang, Fan; Meetei, A Ruhikanta; Andreassen, Paul R


    Fanconi anemia (FA) is a chromosome instability syndrome and the 20 identified FA proteins are organized into two main arms which are thought to function at distinct steps in the repair of DNA interstrand crosslinks (ICLs). These two arms include the upstream FA pathway, which culminates in the monoubiquitination of FANCD2 and FANCI, and downstream breast cancer (BRCA)-associated proteins that interact in protein complexes. How, and whether, these two groups of FA proteins are integrated is unclear. Here, we show that FANCD2 and PALB2, as indicators of the upstream and downstream arms, respectively, colocalize independently of each other in response to DNA damage induced by mitomycin C (MMC). We also show that ubiquitin chains are induced by MMC and colocalize with both FANCD2 and PALB2. Our finding that the RNF8 E3 ligase has a role in recruiting FANCD2 and PALB2 also provides support for the hypothesis that the two branches of the FA-BRCA pathway are coordinated by ubiquitin signaling. Interestingly, we find that the RNF8 partner, MDC1, as well as the ubiquitin-binding protein, RAP80, specifically recruit PALB2, while a different ubiquitin-binding protein, FAAP20, functions only in the recruitment of FANCD2. Thus, FANCD2 and PALB2 are not recruited in a single linear pathway, rather we define how their localization is coordinated and integrated by a network of ubiquitin-related proteins. We propose that such regulation may enable upstream and downstream FA proteins to act at distinct steps in the repair of ICLs.

  18. Deficiency of UBE2T, the E2 Ubiquitin Ligase Necessary for FANCD2 and FANCI Ubiquitination, Causes FA-T Subtype of Fanconi Anemia. (United States)

    Rickman, Kimberly A; Lach, Francis P; Abhyankar, Avinash; Donovan, Frank X; Sanborn, Erica M; Kennedy, Jennifer A; Sougnez, Carrie; Gabriel, Stacey B; Elemento, Olivier; Chandrasekharappa, Settara C; Schindler, Detlev; Auerbach, Arleen D; Smogorzewska, Agata


    Fanconi anemia (FA) is a rare bone marrow failure and cancer predisposition syndrome resulting from pathogenic mutations in genes encoding proteins participating in the repair of DNA interstrand crosslinks (ICLs). Mutations in 17 genes (FANCA-FANCS) have been identified in FA patients, defining 17 complementation groups. Here, we describe an individual presenting with typical FA features who is deficient for the ubiquitin-conjugating enzyme (E2), UBE2T. UBE2T is known to interact with FANCL, the E3 ubiquitin-ligase component of the multiprotein FA core complex, and is necessary for the monoubiquitination of FANCD2 and FANCI. Proband fibroblasts do not display FANCD2 and FANCI monoubiquitination, do not form FANCD2 foci following treatment with mitomycin C, and are hypersensitive to crosslinking agents. These cellular defects are complemented by expression of wild-type UBE2T, demonstrating that deficiency of the protein UBE2T can lead to Fanconi anemia. UBE2T gene gains an alias of FANCT. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Deficiency of UBE2T, the E2 Ubiquitin Ligase Necessary for FANCD2 and FANCI Ubiquitination, Causes FA-T Subtype of Fanconi Anemia

    Directory of Open Access Journals (Sweden)

    Kimberly A. Rickman


    Full Text Available Fanconi anemia (FA is a rare bone marrow failure and cancer predisposition syndrome resulting from pathogenic mutations in genes encoding proteins participating in the repair of DNA interstrand crosslinks (ICLs. Mutations in 17 genes (FANCA-FANCS have been identified in FA patients, defining 17 complementation groups. Here, we describe an individual presenting with typical FA features who is deficient for the ubiquitin-conjugating enzyme (E2, UBE2T. UBE2T is known to interact with FANCL, the E3 ubiquitin-ligase component of the multiprotein FA core complex, and is necessary for the monoubiquitination of FANCD2 and FANCI. Proband fibroblasts do not display FANCD2 and FANCI monoubiquitination, do not form FANCD2 foci following treatment with mitomycin C, and are hypersensitive to crosslinking agents. These cellular defects are complemented by expression of wild-type UBE2T, demonstrating that deficiency of the protein UBE2T can lead to Fanconi anemia. UBE2T gene gains an alias of FANCT.

  20. Role of Ubiquitination in IGF-1 Receptor Signaling and Degradation


    Sehat, Bita; Andersson, Sandra; Vasilcanu, Radu; Girnita, Leonard; Larsson, Olle


    BACKGROUND: The insulin-like growth factor 1 receptor (IGF-1R) plays numerous crucial roles in cancer biology. The majority of knowledge on IGF-1R signaling is concerned with its role in the activation of the canonical phosphatidyl inositol-3 kinase (PI3K)/Akt and MAPK/ERK pathways. However, the role of IGF-1R ubiquitination in modulating IGF-1R function is an area of current research. In light of this we sought to determine the relationship between IGF-1R phosphorylation, ubiquitination, and...

  1. Polycomb repressive complex 2 regulates MiR-200b in retinal endothelial cells: potential relevance in diabetic retinopathy.

    Directory of Open Access Journals (Sweden)

    Michael Anthony Ruiz

    Full Text Available Glucose-induced augmented vascular endothelial growth factor (VEGF production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in diabetes are not known. Histone methyltransferase complex, Polycomb Repressive Complex 2 (PRC2, has been shown to repress miRNAs in neoplastic process. We hypothesized that, in diabetes, PRC2 represses miR-200b through its histone H3 lysine-27 trimethylation mark. We show that human retinal microvascular endothelial cells exposed to high levels of glucose regulate miR-200b repression through histone methylation and that inhibition of PRC2 increases miR-200b while reducing VEGF. Furthermore, retinal tissue from animal models of diabetes showed increased expression of major PRC2 components, demonstrating in vivo relevance. This research established a repressive relationship between PRC2 and miR-200b, providing evidence of a novel mechanism of miRNA regulation through histone methylation.

  2. Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation. (United States)

    Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki


    The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  3. Molecular characterization and functional analysis of ubiquitin extension genes from the potato cyst nematode Globodera rostochiensis (United States)

    Ubiquitin is a highly conserved 76-amino acid protein found in every eukaryotic cell. It has been proposed that ubiquitin has many cellular functions including DNA repair, transcription regulation, regulation of cell cycle and apoptosis. We identified two ubiquitin extension genes (Gr-Ubi1 and Gr-Ub...

  4. Qualitative ubiquitome unveils the potential significances of protein lysine ubiquitination in hyphal growth of Aspergillus nidulans. (United States)

    Chu, Xin-Ling; Feng, Ming-Guang; Ying, Sheng-Hua


    Protein ubiquitination is an evolutionarily conserved post-translational modification process in eukaryotes, and it plays an important role in many biological processes. Aspergillus nidulans, a model filamentous fungus, contributes to our understanding of cellular physiology, metabolism and genetics, but its ubiquitination is not completely revealed. In this study, the ubiquitination sites in the proteome of A. nidulans were identified using a highly sensitive mass spectrometry combined with immuno-affinity enrichment of the ubiquitinated peptides. The 4816 ubiquitination sites were identified in 1913 ubiquitinated proteins, accounting for 18.1% of total proteins in A. nidulans. Bioinformatic analysis suggested that the ubiquitinated proteins associated with a number of biological functions and displayed various sub-cellular localisations. Meanwhile, seven motifs were revealed from the ubiquitinated peptides, and significantly over-presented in the different pathways. Comparison of the enriched functional catalogues indicated that the ubiquitination functions divergently during growth of A. nidulans and Saccharomyces cerevisiae. Additionally, the proteins in A. nidulans-specific sub-category (cell growth/morphogenesis) were subjected to the protein interaction analysis which demonstrated that ubiquitination is involved in the comprehensive protein interactions. This study presents a first proteomic view of ubiquitination in the filamentous fungus, and provides an initial framework for exploring the physiological roles of ubiquitination in A. nidulans.

  5. Mechanism for the selective conjugation of ubiquitin to phytochrome

    Energy Technology Data Exchange (ETDEWEB)

    Vierstra, R.D.


    The goal of this project is to understand at the molecular level how phytochrome functions and how intracellular proteins are degraded. Phytochrome is marked for degradation by covalent attachment of ubiquitin. Ubiquitin-phytochrome conjugates (UbP) were characterized with respect to formation kinetics, subcellular localization and site of ubiquitin attachment. UbP appears to be a general phenomenon during phytochrome degradation in a variety of species. UbP was isolated from oat seedlings and characterized. Residues 747-830 of phytochrome have been identified as a possible attachment site for ubiquitin. By placing the gene for etiolated phytochrome in tobacco we have created a transgenic system for over expressing phytochrome. The effects of this over expression are described, and it appears that tobacco degrades this foreign protein through formation of UbP. We have created a series of site-directed mutants of the oat phytochrome gene, and are in the process of characterizing them to determine sequence requirements for ubiquination. 8 refs., 1 fig. (MHB)

  6. Regulation of AMPA Receptor Trafficking by Protein Ubiquitination

    Directory of Open Access Journals (Sweden)

    Jocelyn Widagdo


    Full Text Available The molecular mechanisms underlying plastic changes in the strength and connectivity of excitatory synapses have been studied extensively for the past few decades and remain the most attractive cellular models of learning and memory. One of the major mechanisms that regulate synaptic plasticity is the dynamic adjustment of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA-type glutamate receptor content on the neuronal plasma membrane. The expression of surface AMPA receptors (AMPARs is controlled by the delicate balance between the biosynthesis, dendritic transport, exocytosis, endocytosis, recycling and degradation of the receptors. These processes are dynamically regulated by AMPAR interacting proteins as well as by various post-translational modifications that occur on their cytoplasmic domains. In the last few years, protein ubiquitination has emerged as a major regulator of AMPAR intracellular trafficking. Dysregulation of AMPAR ubiquitination has also been implicated in the pathophysiology of Alzheimer’s disease. Here we review recent advances in the field and provide insights into the role of protein ubiquitination in regulating AMPAR membrane trafficking and function. We also discuss how aberrant ubiquitination of AMPARs contributes to the pathogenesis of various neurological disorders, including Alzheimer’s disease, chronic stress and epilepsy.

  7. Hydrophobic Collapse of Ubiquitin Generates Rapid Protein-Water Motions. (United States)

    Wirtz, Hanna; Schäfer, Sarah; Hoberg, Claudius; Reid, Korey M; Leitner, David M; Havenith, Martina


    We report time-resolved measurements of the coupled protein-water modes of solvated ubiquitin during protein folding. Kinetic terahertz absorption (KITA) spectroscopy serves as a label-free technique for monitoring large scale conformational changes and folding of proteins subsequent to a sudden T-jump. We report here KITA measurements at an unprecedented time resolution of 500 ns, a resolution 2 orders of magnitude better than those of any previous KITA measurements, which reveal the coupled ubiquitin-solvent dynamics even in the initial phase of hydrophobic collapse. Complementary equilibrium experiments and molecular simulations of ubiquitin solutions are performed to clarify non-equilibrium contributions and reveal the molecular picture upon a change in structure, respectively. On the basis of our results, we propose that in the case of ubiquitin a rapid (<500 ns) initial phase of the hydrophobic collapse from the elongated protein to a molten globule structure precedes secondary structure formation. We find that these very first steps, including large-amplitude changes within the unfolded manifold, are accompanied by a rapid (<500 ns) pronounced change of the coupled protein-solvent response. The KITA response upon secondary structure formation exhibits an opposite sign, which indicates a distinct effect on the solvent-exposed surface.

  8. Ubiquitin regulates GGA3-mediated degradation of BACE1. (United States)

    Kang, Eugene L; Cameron, Andrew N; Piazza, Fabrizio; Walker, Kendall R; Tesco, Giuseppina


    BACE1 (beta-site amyloid precursor protein-cleaving enzyme 1) is a membrane-tethered member of the aspartyl proteases, essential for the production of beta-amyloid, a toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. The BACE1 C-terminal fragment contains a DXXLL motif that has been shown to bind the VHS (VPS27, Hrs, and STAM) domain of GGA1-3 (Golgi-localized gamma-ear-containing ARF-binding proteins). GGAs are trafficking molecules involved in the transport of proteins containing the DXXLL signal from the Golgi complex to endosomes. Moreover, GGAs bind ubiquitin and traffic synthetic and endosomal ubiquitinated cargoes to lysosomes. We have previously shown that depletion of GGA3 results in increased BACE1 levels and activity because of impaired lysosomal degradation. Here, we report that the accumulation of BACE1 is rescued by the ectopic expression of GGA3 in H4 neuroglioma cells depleted of GGA3. Accordingly, the overexpression of GGA3 reduces the levels of BACE1 and beta-amyloid. We then established that mutations in the GGA3 VPS27, Hrs, and STAM domain (N91A) or in BACE1 di-leucine motif (L499A/L500A), able to abrogate their binding, did not affect the ability of ectopically expressed GGA3 to rescue BACE1 accumulation in cells depleted of GGA3. Instead, we found that BACE1 is ubiquitinated at lysine 501 and is mainly monoubiquitinated and Lys-63-linked polyubiquitinated. Finally, a GGA3 mutant with reduced ability to bind ubiquitin (GGA3L276A) was unable to regulate BACE1 levels both in rescue and overexpression experiments. These findings indicate that levels of GGA3 tightly and inversely regulate BACE1 levels via interaction with ubiquitin sorting machinery.

  9. Ubiquitin Regulates GGA3-mediated Degradation of BACE1* (United States)

    Kang, Eugene L.; Cameron, Andrew N.; Piazza, Fabrizio; Walker, Kendall R.; Tesco, Giuseppina


    BACE1 (β-site amyloid precursor protein-cleaving enzyme 1) is a membrane-tethered member of the aspartyl proteases, essential for the production of β-amyloid, a toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. The BACE1 C-terminal fragment contains a DXXLL motif that has been shown to bind the VHS (VPS27, Hrs, and STAM) domain of GGA1–3 (Golgi-localized γ-ear-containing ARF-binding proteins). GGAs are trafficking molecules involved in the transport of proteins containing the DXXLL signal from the Golgi complex to endosomes. Moreover, GGAs bind ubiquitin and traffic synthetic and endosomal ubiquitinated cargoes to lysosomes. We have previously shown that depletion of GGA3 results in increased BACE1 levels and activity because of impaired lysosomal degradation. Here, we report that the accumulation of BACE1 is rescued by the ectopic expression of GGA3 in H4 neuroglioma cells depleted of GGA3. Accordingly, the overexpression of GGA3 reduces the levels of BACE1 and β-amyloid. We then established that mutations in the GGA3 VPS27, Hrs, and STAM domain (N91A) or in BACE1 di-leucine motif (L499A/L500A), able to abrogate their binding, did not affect the ability of ectopically expressed GGA3 to rescue BACE1 accumulation in cells depleted of GGA3. Instead, we found that BACE1 is ubiquitinated at lysine 501 and is mainly monoubiquitinated and Lys-63-linked polyubiquitinated. Finally, a GGA3 mutant with reduced ability to bind ubiquitin (GGA3L276A) was unable to regulate BACE1 levels both in rescue and overexpression experiments. These findings indicate that levels of GGA3 tightly and inversely regulate BACE1 levels via interaction with ubiquitin sorting machinery. PMID:20484053

  10. Photosensitivity to Triflusal: Formation of a Photoadduct with Ubiquitin Demonstrated by Photophysical and Proteomic Techniques

    Directory of Open Access Journals (Sweden)

    E Nuin


    Full Text Available Triflusal is a platelet aggregation inhibitor chemically related to acetylsalicylic acid, which is used for the prevention and/or treatment of vascular thromboembolisms, which acts as a prodrug. Actually, after oral administration it is absorbed primarily in the small intestine, binds to plasma proteins (99% and is rapidly biotransformed in the liver into its deacetylated active metabolite 2-hydroxy-4-trifluoromethylbenzoic acid (HTB. In healthy humans, the half-life of triflusal is ca. 0.5 h, whereas for HTB it is ca. 35 h. From a pharmacological point of view, it is interesting to note that HTB is itself highly active as a platelet anti-aggregant agent. Indeed, studies on the clinical profile of both drug and metabolite have shown no significant differences between them.It has been evidenced that HTB displays ability to induce photoallergy in humans. This phenomenon involves a cell-mediated immune response, which is initiated by covalent binding of a light-activated photosensitizer (or a species derived therefrom to a protein. In this context, small proteins like ubiquitin could be appropriate models for investigating covalent binding by means of MS/MS and peptide fingerprint analysis. In previous work, it was shown that HTB forms covalent photoadducts with isolated lysine. Interestingly, ubiquitin contains seven lysine residues that could be modified by a similar reaction. With this background, the aim of the present work is to explore adduct formation between the triflusal metabolite and ubiquitin as model protein upon sunlight irradiation, combining proteomic and photophysical (fluorescence and laser flash photolysis techniques.Photophysical and proteomic analysis demonstrate monoadduct formation as the major outcome of the reaction. Interestingly, addition can take place at any of the -amino groups of the lysine residues of the protein and involves replacement of the trifluoromethyl moiety with a new amide function. This process can in

  11. Aerobic exercise training improves oxidative stress and ubiquitin proteasome system activity in heart of spontaneously hypertensive rats. (United States)

    de Andrade, Luiz Henrique Soares; de Moraes, Wilson Max Almeida Monteiro; Matsuo Junior, Eduardo Hiroshi; de Orleans Carvalho de Moura, Elizabeth; Antunes, Hanna Karen Moreira; Montemor, Jairo; Antonio, Ednei Luiz; Bocalini, Danilo Sales; Serra, Andrey Jorge; Tucci, Paulo José Ferreira; Brum, Patricia Chakur; Medeiros, Alessandra


    The activity of the ubiquitin proteasome system (UPS) and the level of oxidative stress contribute to the transition from compensated cardiac hypertrophy to heart failure in hypertension. Moreover, aerobic exercise training (AET) is an important therapy for the treatment of hypertension, but its effects on the UPS are not completely known. The aim of this study was to evaluate the effect of AET on UPS's activity and oxidative stress level in heart of spontaneously hypertensive rats (SHR). A total of 53 Wistar and SHR rats were randomly divided into sedentary and trained groups. The AET protocol was 5×/week in treadmill for 13 weeks. Exercise tolerance test, non-invasive blood pressure measurement, echocardiographic analyses, and left ventricle hemodynamics were performed during experimental period. The expression of ubiquitinated proteins, 4-hydroxynonenal (4-HNE), Akt, phospho-Akt(ser473), GSK3β, and phospho-GSK3β(ser9) were analyzed by western blotting. The evaluation of lipid hydroperoxide concentration was performed using the xylenol orange method, and the proteasomal chymotrypsin-like activity was measured by fluorimetric assay. Sedentary hypertensive group presented cardiac hypertrophy, unaltered expression of total Akt, phospho-Akt, total GSK3β and phospho-GSK3β, UPS hyperactivity, increased lipid hydroperoxidation as well as elevated expression of 4-HNE but normal cardiac function. In contrast, AET significantly increased exercise tolerance, decreased resting systolic blood pressure and heart rate in hypertensive animals. In addition, the AET increased phospho-Akt expression, decreased phospho-GSK3β, and did not alter the expression of total Akt, total GSK3β, and ubiquitinated proteins, however, significantly attenuated 4-HNE levels, lipid hydroperoxidation, and UPS's activity toward normotensive group levels. Our results provide evidence for the main effect of AET on attenuating cardiac ubiquitin proteasome hyperactivity and oxidative stress in SHR

  12. A novel zinc finger protein Zfp277 mediates transcriptional repression of the Ink4a/arf locus through polycomb repressive complex 1

    DEFF Research Database (Denmark)

    Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu


    . METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....

  13. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena


    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  14. Discovery and Molecular Basis of a Diverse Set of Polycomb Repressive Complex 2 Inhibitors Recognition by EED.

    Directory of Open Access Journals (Sweden)

    Ling Li

    Full Text Available Polycomb repressive complex 2 (PRC2, a histone H3 lysine 27 methyltransferase, plays a key role in gene regulation and is a known epigenetics drug target for cancer therapy. The WD40 domain-containing protein EED is the regulatory subunit of PRC2. It binds to the tri-methylated lysine 27 of the histone H3 (H3K27me3, and through which stimulates the activity of PRC2 allosterically. Recently, we disclosed a novel PRC2 inhibitor EED226 which binds to the K27me3-pocket on EED and showed strong antitumor activity in xenograft mice model. Here, we further report the identification and validation of four other EED binders along with EED162, the parental compound of EED226. The crystal structures for all these five compounds in complex with EED revealed a common deep pocket induced by the binding of this diverse set of compounds. This pocket was created after significant conformational rearrangement of the aromatic cage residues (Y365, Y148 and F97 in the H3K27me3 binding pocket of EED, the width of which was delineated by the side chains of these rearranged residues. In addition, all five compounds interact with the Arg367 at the bottom of the pocket. Each compound also displays unique features in its interaction with EED, suggesting the dynamics of the H3K27me3 pocket in accommodating the binding of different compounds. Our results provide structural insights for rational design of novel EED binder for the inhibition of PRC2 complex activity.

  15. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development.

    Directory of Open Access Journals (Sweden)

    Carolina N Perdigoto


    Full Text Available An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2 in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  16. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development. (United States)

    Perdigoto, Carolina N; Dauber, Katherine L; Bar, Carmit; Tsai, Pai-Chi; Valdes, Victor J; Cohen, Idan; Santoriello, Francis J; Zhao, Dejian; Zheng, Deyou; Hsu, Ya-Chieh; Ezhkova, Elena


    An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh) signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2) in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  17. Direct observation of a single nanoparticle-ubiquitin corona formation (United States)

    Ding, Feng; Radic, Slaven; Chen, Ran; Chen, Pengyu; Geitner, Nicholas K.; Brown, Jared M.; Ke, Pu Chun


    The advancement of nanomedicine and the increasing applications of nanoparticles in consumer products have led to administered biological exposure and unintentional environmental accumulation of nanoparticles, causing concerns over the biocompatibility and sustainability of nanotechnology. Upon entering physiological environments, nanoparticles readily assume the form of a nanoparticle-protein corona that dictates their biological identity. Consequently, understanding the structure and dynamics of a nanoparticle-protein corona is essential for predicting the fate, transport, and toxicity of nanomaterials in living systems and for enabling the vast applications of nanomedicine. Here we combined multiscale molecular dynamics simulations and complementary experiments to characterize the silver nanoparticle-ubiquitin corona formation. Notably, ubiquitins competed with citrates for the nanoparticle surface, governed by specific electrostatic interactions. Under a high protein/nanoparticle stoichiometry, ubiquitins formed a multi-layer corona on the particle surface. The binding exhibited an unusual stretched-exponential behavior, suggesting a rich binding kinetics. Furthermore, the binding destabilized the α-helices while increasing the β-sheet content of the proteins. This study revealed the atomic and molecular details of the structural and dynamic characteristics of nanoparticle-protein corona formation.The advancement of nanomedicine and the increasing applications of nanoparticles in consumer products have led to administered biological exposure and unintentional environmental accumulation of nanoparticles, causing concerns over the biocompatibility and sustainability of nanotechnology. Upon entering physiological environments, nanoparticles readily assume the form of a nanoparticle-protein corona that dictates their biological identity. Consequently, understanding the structure and dynamics of a nanoparticle-protein corona is essential for predicting the fate

  18. Mastermind-Like 1 Is Ubiquitinated: Functional Consequences for Notch Signaling.

    Directory of Open Access Journals (Sweden)

    Mozhgan Farshbaf

    Full Text Available Early studies demonstrated the involvement of ubiquitination of the Notch intracellular domain for rapid turnover of the transcriptional complex at Notch target genes. It was shown that this ubiquitination was promoted by the co-activator Mastermind like 1 (MAML1. MAML1 also contains numerous lysine residues that may also be ubiquitinated and necessary for protein regulation. In this study, we show that over-expressed MAML1 is ubiquitinated and identify eight conserved lysine residues which are required for ubiquitination. We also show that p300 stimulates ubiquitination and that Notch inhibits ubiquitination. Furthermore, we show that a mutant MAML1 that has decreased ubiquitination shows increased output from a HES1 reporter gene assay. Therefore, we speculate that ubiquitination of MAML1 might be a mechanism to maintain low levels of the protein until needed for transcriptional activation. In summary, this study identifies that MAML1 is ubiquitinated in the absence of Notch signaling to maintain low levels of MAML1 in the cell. Our data supports the notion that a precise and tight regulation of the Notch pathway is required for this signaling pathway.

  19. StUbEx PLUS-A Modified Stable Tagged Ubiquitin Exchange System for Peptide Level Purification and In-Depth Mapping of Ubiquitination Sites

    DEFF Research Database (Denmark)

    Akimov, Vyacheslav; Olsen, Louise C B; Hansen, Sten V F


    repair, and signal transduction. Because of its importance for numerous cellular functions, ubiquitination has become an intense topic of research in recent years, and proteomics tools have greatly facilitated the identification of many ubiquitination targets. Taking advantage of the StUbEx strategy...

  20. Beyond ubiquitination: the atypical functions of Fbxo7 and other F-box proteins. (United States)

    Nelson, David E; Randle, Suzanne J; Laman, Heike


    F-box proteins (FBPs) are substrate-recruiting subunits of Skp1-cullin1-FBP (SCF)-type E3 ubiquitin ligases. To date, 69 FBPs have been identified in humans, but ubiquitinated substrates have only been identified for a few, with the majority of FBPs remaining 'orphans'. In recent years, a growing body of work has identified non-canonical, SCF-independent roles for about 12% of the human FBPs. These atypical FBPs affect processes as diverse as transcription, cell cycle regulation, mitochondrial dynamics and intracellular trafficking. Here, we provide a general review of FBPs, with a particular emphasis on these expanded functions. We review Fbxo7 as an exemplar of this special group as it has well-defined roles in both SCF and non-SCF complexes. We review its function as a cell cycle regulator, via its ability to stabilize p27 protein and Cdk6 complexes, and as a proteasome regulator, owing to its high affinity binding to PI31. We also highlight recent advances in our understanding of Fbxo7 function in Parkinson's disease, where it functions in the regulation of mitophagy with PINK1 and Parkin. We postulate that a few extraordinary FBPs act as platforms that seamlessly segue their canonical and non-canonical functions to integrate different cellular pathways and link their regulation.

  1. Ubiquitin-aldehyde: a general inhibitor of ubiquitin-recycling processes

    International Nuclear Information System (INIS)

    Hershko, A.; Rose, I.A.


    The generation and characterization of ubiquitin (Ub)-aldehyde, a potent inhibitor of Ub-C-terminal hydrolase, has previously been reported. The authors examine the action of this compound on the Ub-mediated proteolytic pathway using the system derived from rabbit reticulocytes. Addition of Ub-aldehyde was found to strongly inhibit breakdown of added 125 I-labeled lysozyme, but inhibition was overcome by increasing concentrations of Ub. The following evidence shows the effect of Ub-aldehyde on protein breakdown to be indirectly caused by its interference with the recycling of Ub, leading to exhaustion of the supply of free Ub: (i) Ub-aldehyde markedly increased the accumulation of Ub-protein conjugates coincident with a much decreased rate of conjugate breakdown; (ii) release of Ub from isolated Ub-protein conjugates in the absence of ATP (and therefore not coupled to protein degradation) is markedly inhibited by Ub-aldehyde. On the other hand, the ATP-dependent degradation of the protein moiety of Ub conjugates, which is an integral part of the proteolytic process, is not inhibited by this agent; (iii) direct measurement of levels of free Ub showed a rapid disappearance caused by the inhibitor. The Ub is found to be distributed in derivatives of a wide range of molecular weight classes. It thus seems that Ub-aldehyde, previously demonstrated to inhibit the hydrolysis of Ub conjugates of small molecules, also inhibits the activity of a series of enzymes that regenerate free Ub from adducts with proteins and intermediates in protein breakdown

  2. An H3K9/S10 methyl-phospho switch modulates Polycomb and Pol II binding at repressed genes during differentiation. (United States)

    Sabbattini, Pierangela; Sjoberg, Marcela; Nikic, Svetlana; Frangini, Alberto; Holmqvist, Per-Henrik; Kunowska, Natalia; Carroll, Tom; Brookes, Emily; Arthur, Simon J; Pombo, Ana; Dillon, Niall


    Methylated histones H3K9 and H3K27 are canonical epigenetic silencing modifications in metazoan organisms, but the relationship between the two modifications has not been well characterized. H3K9me3 coexists with H3K27me3 in pluripotent and differentiated cells. However, we find that the functioning of H3K9me3 is altered by H3S10 phosphorylation in differentiated postmitotic osteoblasts and cycling B cells. Deposition of H3K9me3/S10ph at silent genes is partially mediated by the mitogen- and stress-activated kinases (MSK1/2) and the Aurora B kinase. Acquisition of H3K9me3/S10ph during differentiation correlates with loss of paused S5 phosphorylated RNA polymerase II, which is present on Polycomb-regulated genes in embryonic stem cells. Reduction of the levels of H3K9me3/S10ph by kinase inhibition results in increased binding of RNAPIIS5ph and the H3K27 methyltransferase Ezh1 at silent promoters. Our results provide evidence of a novel developmentally regulated methyl-phospho switch that modulates Polycomb regulation in differentiated cells and stabilizes repressed states.

  3. Regulating the 20S Proteasome Ubiquitin-Independent Degradation Pathway

    Directory of Open Access Journals (Sweden)

    Gili Ben-Nissan


    Full Text Available For many years, the ubiquitin-26S proteasome degradation pathway was considered the primary route for proteasomal degradation. However, it is now becoming clear that proteins can also be targeted for degradation by the core 20S proteasome itself. Degradation by the 20S proteasome does not require ubiquitin tagging or the presence of the 19S regulatory particle; rather, it relies on the inherent structural disorder of the protein being degraded. Thus, proteins that contain unstructured regions due to oxidation, mutation, or aging, as well as naturally, intrinsically unfolded proteins, are susceptible to 20S degradation. Unlike the extensive knowledge acquired over the years concerning degradation by the 26S proteasome, relatively little is known about the means by which 20S-mediated proteolysis is controlled. Here, we describe our current understanding of the regulatory mechanisms that coordinate 20S proteasome-mediated degradation, and highlight the gaps in knowledge that remain to be bridged.

  4. Role of the Ubiquitin Proteasome System in Regulating Skin Pigmentation

    Directory of Open Access Journals (Sweden)

    Hideya Ando


    Full Text Available Pigmentation of the skin, hair and eyes is regulated by tyrosinase, the critical rate-limiting enzyme in melanin synthesis by melanocytes. Tyrosinase is degraded endogenously, at least in part, by the ubiquitin proteasome system (UPS. Several types of inherited hypopigmentary diseases, such as oculocutaneous albinism and Hermansky-Pudlak syndrome, involve the aberrant processing and/or trafficking of tyrosinase and its subsequent degradation which can occur due to the quality-control machinery. Studies on carbohydrate modifications have revealed that tyrosinase in the endoplasmic reticulum (ER is proteolyzed via ER-associated protein degradation and that tyrosinase degradation can also occur following its complete maturation in the Golgi. Among intrinsic factors that regulate the UPS, fatty acids have been shown to modulate tyrosinase degradation in contrasting manners through increased or decreased amounts of ubiquitinated tyrosinase that leads to its accelerated or decelerated degradation by proteasomes.

  5. Proteolysis targeting peptide (PROTAP) strategy for protein ubiquitination and degradation. (United States)

    Zheng, Jing; Tan, Chunyan; Xue, Pengcheng; Cao, Jiakun; Liu, Feng; Tan, Ying; Jiang, Yuyang


    Ubiquitination proteasome pathway (UPP) is the most important and selective way to degrade proteins in vivo. Here, a novel proteolysis targeting peptide (PROTAP) strategy, composed of a target protein binding peptide, a linker and a ubiquitin E3 ligase recognition peptide, was designed to recruit both target protein and E3 ligase and then induce polyubiquitination and degradation of the target protein through UPP. In our study, the PROTAP strategy was proved to be a general method with high specificity using Bcl-xL protein as model target in vitro and in cells, which indicates that the strategy has great potential for in vivo application. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Alterations of ubiquitin related proteins in the pathology and development of schizophrenia: Evidence from human and animal studies. (United States)

    Andrews, Jessica L; Goodfellow, Frederic J; Matosin, Natalie; Snelling, Mollie K; Newell, Kelly A; Huang, Xu-Feng; Fernandez-Enright, Francesca


    Gene expression analyses in post-mortem schizophrenia brains suggest that a number of ubiquitin proteasome system (UPS) genes are associated with schizophrenia; however the status of UPS proteins in the schizophrenia brain is largely unknown. Ubiquitin related proteins are inherently involved in memory, neuronal survival and morphology, which are processes implicated in neurodevelopmental disorders such as schizophrenia. We examined levels of five UPS proteins (Protein Inhibitor of Activated STAT2 [PIAS2], F-Box and Leucine rich repeat protein 21 [FBXL21], Mouse Double Minute 2 homolog [MDM2], Ubiquitin Carboxyl-Terminal Hydrolase-L1 [UCHL1] and Ubiquitin Conjugating Enzyme E2D1 [UBE2D1]) involved in these neuronal processes, within the dorsolateral prefrontal cortex of post-mortem schizophrenia subjects and matched controls (n = 30/group), in addition to across neurodevelopmental time-points (juvenile, adolescent and adult stages of life), utilizing a well-established neurodevelopmental phencyclidine (PCP) animal model of schizophrenia. We observed significant reductions in PIAS2, FBXL21 and MDM2 in schizophrenia subjects compared to controls (p-values ranging from 0.002 to 0.004). In our developmental PCP model, MDM2 protein was significantly reduced in adult PCP-treated rats compared to controls (p = 0.034). Additionally, FBXL21 (p = 0.022) and UCHL1 (p = 0.022) were significantly decreased, whilst UBE2D1 was increased (p = 0.022), in juvenile phencyclidine-treated rats compared to controls. This is the first study reporting alterations of UPS proteins in post-mortem human schizophrenia subjects and in a neurodevelopmental model of schizophrenia. The findings from this study provide strong support for a role of these UPS proteins in the pathology and development of schizophrenia. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Viral Mimicry to Usurp Ubiquitin and SUMO Host Pathways

    Directory of Open Access Journals (Sweden)

    Peter Wimmer


    Full Text Available Posttranslational modifications (PTMs of proteins include enzymatic changes by covalent addition of cellular regulatory determinants such as ubiquitin (Ub and small ubiquitin-like modifier (SUMO moieties. These modifications are widely used by eukaryotic cells to control the functional repertoire of proteins. Over the last decade, it became apparent that the repertoire of ubiquitiylation and SUMOylation regulating various biological functions is not restricted to eukaryotic cells, but is also a feature of human virus families, used to extensively exploit complex host-cell networks and homeostasis. Intriguingly, besides binding to host SUMO/Ub control proteins and interfering with the respective enzymatic cascade, many viral proteins mimic key regulatory factors to usurp this host machinery and promote efficient viral outcomes. Advanced detection methods and functional studies of ubiquitiylation and SUMOylation during virus-host interplay have revealed that human viruses have evolved a large arsenal of strategies to exploit these specific PTM processes. In this review, we highlight the known viral analogs orchestrating ubiquitin and SUMO conjugation events to subvert and utilize basic enzymatic pathways.

  8. UbSRD: The Ubiquitin Structural Relational Database. (United States)

    Harrison, Joseph S; Jacobs, Tim M; Houlihan, Kevin; Van Doorslaer, Koenraad; Kuhlman, Brian


    The structurally defined ubiquitin-like homology fold (UBL) can engage in several unique protein-protein interactions and many of these complexes have been characterized with high-resolution techniques. Using Rosetta's structural classification tools, we have created the Ubiquitin Structural Relational Database (UbSRD), an SQL database of features for all 509 UBL-containing structures in the PDB, allowing users to browse these structures by protein-protein interaction and providing a platform for quantitative analysis of structural features. We used UbSRD to define the recognition features of ubiquitin (UBQ) and SUMO observed in the PDB and the orientation of the UBQ tail while interacting with certain types of proteins. While some of the interaction surfaces on UBQ and SUMO overlap, each molecule has distinct features that aid in molecular discrimination. Additionally, we find that the UBQ tail is malleable and can adopt a variety of conformations upon binding. UbSRD is accessible as an online resource at Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. The ubiquitin family meets the Fanconi anemia proteins. (United States)

    Renaudin, Xavier; Koch Lerner, Leticia; Menck, Carlos Frederico Martins; Rosselli, Filippo


    Fanconi anaemia (FA) is a hereditary disorder characterized by bone marrow failure, developmental defects, predisposition to cancer and chromosomal abnormalities. FA is caused by biallelic mutations that inactivate genes encoding proteins involved in replication stress-associated DNA damage responses. The 20 FANC proteins identified to date constitute the FANC pathway. A key event in this pathway involves the monoubiquitination of the FANCD2-FANCI heterodimer by the collective action of at least 10 different proteins assembled in the FANC core complex. The FANC core complex-mediated monoubiquitination of FANCD2-FANCI is essential to assemble the heterodimer in subnuclear, chromatin-associated, foci and to regulate the process of DNA repair as well as the rescue of stalled replication forks. Several recent works have demonstrated that the activity of the FANC pathway is linked to several other protein post-translational modifications from the ubiquitin-like family, including SUMO and NEDD8. These modifications are related to DNA damage responses but may also affect other cellular functions potentially related to the clinical phenotypes of the syndrome. This review summarizes the interplay between the ubiquitin and ubiquitin-like proteins and the FANC proteins that constitute a major pathway for the surveillance of the genomic integrity and addresses the implications of their interactions in maintaining genome stability. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Ubiquitin regulates TORC1 in yeast Saccharomyces cerevisiae. (United States)

    Hu, Kejin; Guo, Shuguang; Yan, Gonghong; Yuan, Wenjie; Zheng, Yin; Jiang, Yu


    In the yeast Saccharomyces cerevisiae the TOR complex 1 (TORC1) controls many growth-related cellular processes and is essential for cell growth and proliferation. Macrolide antibiotic rapamycin, in complex with a cytosol protein named FKBP12, specifically inhibits TORC1, causing growth arrest. The FKBP12-rapamycin complex interferes with TORC1 function by binding to the FRB domain of the TOR proteins. In an attempt to understand the role of the FRB domain in TOR function, we identified a single point mutation (Tor2(W2041R) ) in the FRB domain of Tor2 that renders yeast cells rapamycin resistant and temperature sensitive. At the permissive temperature, the Tor2 mutant protein is partially defective for binding with Kog1 and TORC1 is impaired for membrane association. At the restrictive temperature, Kog1 but not the Tor2 mutant protein, is rapidly degraded. Overexpression of ubiquitin stabilizes Kog1 and suppresses the growth defect associated with the tor2 mutant at the nonpremissive temperature. We find that ubiquitin binds non-covalently to Kog1, prevents Kog1 from degradation and stabilizes TORC1. Our data reveal a unique role for ubiquitin in regulation of TORC1 and suggest that Kog1 requires association with the Tor proteins for stabilization. © 2016 John Wiley & Sons Ltd.

  11. Ubiquitin C-Terminal Hydrolase L1 in Tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jennifer Hurst-Kennedy


    Full Text Available Ubiquitin carboxyl-terminal hydrolase L1 (UCH-L1, aka PGP9.5 is an abundant, neuronal deubiquitinating enzyme that has also been suggested to possess E3 ubiquitin-protein ligase activity and/or stabilize ubiquitin monomers in vivo. Recent evidence implicates dysregulation of UCH-L1 in the pathogenesis and progression of human cancers. Although typically only expressed in neurons, high levels of UCH-L1 have been found in many nonneuronal tumors, including breast, colorectal, and pancreatic carcinomas. UCH-L1 has also been implicated in the regulation of metastasis and cell growth during the progression of nonsmall cell lung carcinoma, colorectal cancer, and lymphoma. Together these studies suggest UCH-L1 has a potent oncogenic role and drives tumor development. Conversely, others have observed promoter methylation-mediated silencing of UCH-L1 in certain tumor subtypes, suggesting a potential tumor suppressor role for UCH-L1. In this paper, we provide an overview of the evidence supporting the involvement of UCH-L1 in tumor development and discuss the potential mechanisms of action of UCH-L1 in oncogenesis.

  12. Profiling of Ubiquitination Pathway Genes in Peripheral Cells from Patients with Frontotemporal Dementia due to C9ORF72 and GRN Mutations

    Directory of Open Access Journals (Sweden)

    Maria Serpente


    Full Text Available We analysed the expression levels of 84 key genes involved in the regulated degradation of cellular protein by the ubiquitin-proteasome system in peripheral cells from patients with frontotemporal dementia (FTD due to C9ORF72 and GRN mutations, as compared with sporadic FTD and age-matched controls. A SABiosciences PCR array was used to investigate the transcription profile in a discovery population consisting of six patients each in C9ORF72, GRN, sporadic FTD and age-matched control groups. A generalized down-regulation of gene expression compared with controls was observed in C9ORF72 expansion carriers and sporadic FTD patients. In particular, in both groups, four genes, UBE2I, UBE2Q1, UBE2E1 and UBE2N, were down-regulated at a statistically significant (p < 0.05 level. All of them encode for members of the E2 ubiquitin-conjugating enzyme family. In GRN mutation carriers, no statistically significant deregulation of ubiquitination pathway genes was observed, except for the UBE2Z gene, which displays E2 ubiquitin conjugating enzyme activity, and was found to be statistically significant up-regulated (p = 0.006. These preliminary results suggest that the proteasomal degradation pathway plays a role in the pathogenesis of FTD associated with TDP-43 pathology, although different proteins are altered in carriers of GRN mutations as compared with carriers of the C9ORF72 expansion.

  13. VEGFR2 Trafficking, Signaling and Proteolysis is Regulated by the Ubiquitin Isopeptidase USP8. (United States)

    Smith, Gina A; Fearnley, Gareth W; Abdul-Zani, Izma; Wheatcroft, Stephen B; Tomlinson, Darren C; Harrison, Michael A; Ponnambalam, Sreenivasan


    Vascular endothelial growth factor A (VEGF-A) regulates many aspects of vascular function. VEGF-A binding to vascular endothelial growth factor receptor 2 (VEGFR2) stimulates endothelial signal transduction and regulates multiple cellular responses. Activated VEGFR2 undergoes ubiquitination but the enzymes that regulate this post-translational modification are unclear. In this study, the de-ubiquitinating enzyme, USP8, is shown to regulate VEGFR2 trafficking, de-ubiquitination, proteolysis and signal transduction. USP8-depleted endothelial cells displayed altered VEGFR2 ubiquitination and production of a unique VEGFR2 extracellular domain proteolytic fragment caused by VEGFR2 accumulation in the endosome-lysosome system. In addition, perturbed VEGFR2 trafficking impaired VEGF-A-stimulated signal transduction in USP8-depleted cells. Thus, regulation of VEGFR2 ubiquitination and de-ubiquitination has important consequences for the endothelial cell response and vascular physiology. © 2015 The Authors. Traffic published by John Wiley & Sons Ltd.


    Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V


    Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

  15. Structure and catalytic regulatory function of ubiquitin specific protease 11 N-terminal and ubiquitin-like domains. (United States)

    Harper, Stephen; Gratton, Hayley E; Cornaciu, Irina; Oberer, Monika; Scott, David J; Emsley, Jonas; Dreveny, Ingrid


    The ubiquitin specific protease 11 (USP11) is implicated in DNA repair, viral RNA replication, and TGFβ signaling. We report the first characterization of the USP11 domain architecture and its role in regulating the enzymatic activity. USP11 consists of an N-terminal "domain present in USPs" (DUSP) and "ubiquitin-like" (UBL) domain, together referred to as DU domains, and the catalytic domain harboring a second UBL domain. Crystal structures of the DU domains show a tandem arrangement with a shortened β-hairpin at the two-domain interface and altered surface characteristics compared to the homologues USP4 and USP15. A conserved VEVY motif is a signature feature at the two-domain interface that shapes a potential protein interaction site. Small angle X-ray scattering and gel filtration experiments are consistent with the USP11DU domains and full-length USP11 being monomeric. Unexpectedly, we reveal, through kinetic assays of a series of deletion mutants, that the catalytic activity of USP11 is not regulated through intramolecular autoinhibition or activation by the N-terminal DU or UBL domains. Moreover, ubiquitin chain cleavage assays with all eight linkages reveal a preference for Lys(63)-, Lys(6)-, Lys(33)-, and Lys(11)-linked chains over Lys(27)-, Lys(29)-, and Lys(48)-linked and linear chains consistent with USP11's function in DNA repair pathways that is mediated by the protease domain. Our data support a model whereby USP11 domains outside the catalytic core domain serve as protein interaction or trafficking modules rather than a direct regulatory function of the proteolytic activity. This highlights the diversity of USPs in substrate recognition and regulation of ubiquitin deconjugation.

  16. Functional interchangeability of late domains, late domain cofactors and ubiquitin in viral budding.

    Directory of Open Access Journals (Sweden)

    Maria Zhadina


    Full Text Available The membrane scission event that separates nascent enveloped virions from host cell membranes often requires the ESCRT pathway, which can be engaged through the action of peptide motifs, termed late (L- domains, in viral proteins. Viral PTAP and YPDL-like L-domains bind directly to the ESCRT-I and ALIX components of the ESCRT pathway, while PPxY motifs bind Nedd4-like, HECT-domain containing, ubiquitin ligases (e.g. WWP1. It has been unclear precisely how ubiquitin ligase recruitment ultimately leads to particle release. Here, using a lysine-free viral Gag protein derived from the prototypic foamy virus (PFV, where attachment of ubiquitin to Gag can be controlled, we show that several different HECT domains can replace the WWP1 HECT domain in chimeric ubiquitin ligases and drive budding. Moreover, artificial recruitment of isolated HECT domains to Gag is sufficient to stimulate budding. Conversely, the HECT domain becomes dispensable if the other domains of WWP1 are directly fused to an ESCRT-1 protein. In each case where budding is driven by a HECT domain, its catalytic activity is essential, but Gag ubiquitination is dispensable, suggesting that ubiquitin ligation to trans-acting proteins drives budding. Paradoxically, however, we also demonstrate that direct fusion of a ubiquitin moiety to the C-terminus of PFV Gag can also promote budding, suggesting that ubiquitination of Gag can substitute for ubiquitination of trans-acting proteins. Depletion of Tsg101 and ALIX inhibits budding that is dependent on ubiquitin that is fused to Gag, or ligated to trans-acting proteins through the action of a PPxY motif. These studies underscore the flexibility in the ways that the ESCRT pathway can be engaged, and suggest a model in which the identity of the protein to which ubiquitin is attached is not critical for subsequent recruitment of ubiquitin-binding components of the ESCRT pathway and viral budding to proceed.

  17. Stealing the spotlight: CUL4-DDB1 ubiquitin ligase docks WD40-repeat proteins to destroy

    Directory of Open Access Journals (Sweden)

    Zhang Hui


    Full Text Available Abstract Recent investigation of Cullin 4 (CUL4 has ushered this class of multiprotein ubiquitin E3 ligases to center stage as critical regulators of diverse processes including cell cycle regulation, developmental patterning, DNA replication, DNA damage and repair, and epigenetic control of gene expression. CUL4 associates with DNA Damage Binding protein 1 (DDB1 to assemble an ubiquitin E3 ligase that targets protein substrates for ubiquitin-dependent proteolysis. CUL4 ligase activity is also regulated by the covalent attachment of the ubiquitin-like protein NEDD8 to CUL4, or neddylation, and the COP9 signalosome complex (CSN that removes this important modification. Recently, multiple WD40-repeat proteins (WDR were found to interact with DDB1 and serve as the substrate-recognition subunits of the CUL4-DDB1 ubiquitin ligase. As more than 150–300 WDR proteins exist in the human genome, these findings impact a wide array of biological processes through CUL4 ligase-mediated proteolysis. Here, we review the recent progress in understanding the mechanism of CUL4 ubiquitin E3 ligase and discuss the architecture of CUL4-assembled E3 ubiquitin ligase complexes by comparison to CUL1-based E3s (SCF. Then, we will review several examples to highlight the critical roles of CUL4 ubiquitin ligase in genome stability, cell cycle regulation, and histone lysine methylation. Together, these studies provide insights into the mechanism of this novel ubiquitin ligase in the regulation of important biological processes.

  18. Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications.

    Directory of Open Access Journals (Sweden)

    Jose L Ortega Roldan

    Full Text Available SH3 domains constitute a new type of ubiquitin-binding domains. We previously showed that the third SH3 domain (SH3-C of CD2AP binds ubiquitin in an alternative orientation. We have determined the structure of the complex between first CD2AP SH3 domain and ubiquitin and performed a structural and mutational analysis to decipher the determinants of the SH3-C binding mode to ubiquitin. We found that the Phe-to-Tyr mutation in CD2AP and in the homologous CIN85 SH3-C domain does not abrogate ubiquitin binding, in contrast to previous hypothesis and our findings for the first two CD2AP SH3 domains. The similar alternative binding mode of the SH3-C domains of these related adaptor proteins is characterised by a higher affinity to C-terminal extended ubiquitin molecules. We conclude that CD2AP/CIN85 SH3-C domain interaction with ubiquitin constitutes a new ubiquitin-binding mode involved in a different cellular function and thus changes the previously established mechanism of EGF-dependent CD2AP/CIN85 mono-ubiquitination.

  19. The ubiquitin ligase SEVEN IN ABSENTIA (SINA) ubiquitinates a defense-related NAC transcription factor and is involved in defense signaling. (United States)

    Miao, Min; Niu, Xiangli; Kud, Joanna; Du, Xinran; Avila, Julian; Devarenne, Timothy P; Kuhl, Joseph C; Liu, Yongsheng; Xiao, Fangming


    We recently identified a defense-related tomato (Solanum lycopersicum) NAC (NAM, ATAF1,2, CUC2) transcription factor, NAC1, that is subjected to ubiquitin-proteasome system-dependent degradation in plant cells. In this study, we identified a tomato ubiquitin ligase (termed SEVEN IN ABSENTIA3; SINA3) that ubiquitinates NAC1, promoting its degradation. We conducted coimmunoprecipitation and bimolecular fluorescence complementation to determine that SINA3 specifically interacts with the NAC1 transcription factor in the nucleus. Moreover, we found that SINA3 ubiquitinates NAC1 in vitro and promotes NAC1 degradation via polyubiquitination in vivo, indicating that SINA3 is a ubiquitin ligase that ubiquitinates NAC1, promoting its degradation. Our real-time PCR analysis indicated that, in contrast to our previous finding that NAC1 mRNA abundance increases upon Pseudomonas infection, the SINA3 mRNA abundance decreases in response to Pseudomonas infection. Moreover, using Agrobacterium-mediated transient expression, we found that overexpression of SINA3 interferes with the hypersensitive response cell death triggered by multiple plant resistance proteins. These results suggest that SINA3 ubiquitinates a defense-related NAC transcription factor for degradation and plays a negative role in defense signaling. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  20. A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription

    DEFF Research Database (Denmark)

    Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien


    site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial...... diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites...... and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain...


    Directory of Open Access Journals (Sweden)



    Full Text Available El control adecuado del ciclo celular mediante la acción coordinada de la familia de factores de transcripción E2F resulta ser clave para la homeostasis celular. El entender su modo de acción desde una perspectiva epigenética resulta ser un tema de gran actualidad y cambia la visión de cómo es regulado el ciclo celular. Uno de los principales reguladores epigenéticos está conformado por el grupo de proteínas Polycomb (PcG, relacionadas con procesos patológicos como el cáncer, a través de la desregulación a nivel epigenético de genes supresores de tumores como BRCA1, p16 y p53, entre otros. Con relación a lo anterior, la regulación del gen supresor Retinoblastoma (Rb ha sido ampliamente estudiado dada su importante participación como regulador negativo del ciclo celular, pero más reciente se ha demostrado que su modo de acción está relacionado con el grupo de proteínas PcG. Cada uno de los procesos que involucran a componentes de la familia de factores E2F, los miembros de Polycomb y la familia de proteína Rb, parecen ser en cierta medida independientes y, por ende, poco relacionados. Sin embargo, existen evidencias de una convergencia a nivel epigenético en la acción de estos conjuntos de moléculas reguladoras de la progresión del ciclo celular y su desregulación nos puede llevar a entender mejor su contribución al desarrollo de procesos patológicos como el cáncer.

  2. The BAH domain of BAF180 is required for PCNA ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Niimi, Atsuko [Department of Genome Dynamics, Research Institute of Environmental Medicine, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Hopkins, Suzanna R; Downs, Jessica A [Genome Damage and Stability Centre, University of Sussex, Falmer, Brighton BN1 9RQ (United Kingdom); Masutani, Chikahide, E-mail: [Department of Genome Dynamics, Research Institute of Environmental Medicine, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan)


    Highlights: • The expression of BAF180 promotes UV-induced PCNA ubiquitination during S phase. • The BAH domains of BAF180 alone are sufficient to promote PCNA ubiquitination. • The BAH domains are not assembled into the PBAF in the absence of the C-terminus. - Abstract: Monoubiquitination of proliferating cell nuclear antigen (PCNA) is a critical regulator of post replication repair (PRR). The depletion of BAF180, a unique subunit of the PBAF chromatin remodeling complex in human cells results in reduced PCNA ubiquitination leading to less efficient fork progression following DNA damage, but little is known about the mechanism. Here, we report that the expression of exogenous BAF180 in cells promotes PCNA ubiquitination during S-phase after UV irradiation and it persists for many hours. No correlation was observed between the protein level of ubiquitin-specific protease 1 (USP1) and ubiquitinated PCNA in BAF180 expressing cells. Analysis of cells expressing BAF180 deletion mutants showed that the bromo-adjacent homology (BAH) domains are responsible for this effect. Surprisingly, a deletion construct encoding only the BAH domain region is able to increase the level of ubiquitinated PCNA, even though it is unable to be assembled into the PBAF complex. These results suggest that the ATPase-dependent chromatin remodeling activity of PBAF is not necessary, but instead the BAH domains are sufficient to promote PCNA ubiquitination.

  3. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin


    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  4. Proteins containing the UBA domain are able to bind to multi-ubiquitin chains

    DEFF Research Database (Denmark)

    Wilkinson, C R; Seeger, M; Hartmann-Petersen, R


    The UBA domain is a motif found in a variety of proteins, some of which are associated with the ubiquitin-proteasome system. We describe the isolation of a fission-yeast gene, mud1+, which encodes a UBA domain containing protein that is able to bind multi-ubiquitin chains. We show that the UBA do...

  5. Herp regulates Hrd1-mediated ubiquitylation in a ubiquitin-like domain-dependent manner

    DEFF Research Database (Denmark)

    Kny, Melanie; Standera, Sybille; Hartmann-Petersen, Rasmus


    in ER-associated protein degradation (ERAD) and interacts directly with the ubiquitin ligase Hrd1, which is found in high molecular mass complexes of the ER membrane. Here we present the first evidence that Herp regulates Hrd1-mediated ubiquitylation in a ubiquitin-like (UBL) domain-dependent manner. We...

  6. High-throughput siRNA screening applied to the ubiquitin-proteasome system

    DEFF Research Database (Denmark)

    Poulsen, Esben Guldahl; Nielsen, Sofie V.; Pietras, Elin J.


    The ubiquitin-proteasome system is the major pathway for intracellular protein degradation in eukaryotic cells. Due to the large number of genes dedicated to the ubiquitin-proteasome system, mapping degradation pathways for short lived proteins is a daunting task, in particular in mammalian cells...

  7. Determination of the Ubiquitin Fitness Landscape under Seventeen Chemical Conditions in a Classroom Setting (United States)

    Mavor, David Carl


    Ubiquitin is essential for eukaryotic life and varies in only 3 amino acid positions between yeast and humans. However, recent deep sequencing studies indicate that ubiquitin is highly tolerant to single mutations. We hypothesized that this tolerance would be reduced by chemically induced physiologic perturbations. To test this hypothesis, a class…

  8. Ubiquitin C-terminal electrophiles are activity-based probes for identification and mechanistic study of ubiquitin conjugating machinery. (United States)

    Love, Kerry Routenberg; Pandya, Renuka K; Spooner, Eric; Ploegh, Hidde L


    Protein modification by ubiquitin (Ub) and ubiquitin-like modifiers (Ubl) requires the action of activating (E1), conjugating (E2), and ligating (E3) enzymes and is a key step in the specific destruction of proteins. Deubiquitinating enzymes (DUBs) deconjugate substrates modified with Ub/Ubl's and recycle Ub inside the cell. Genome mining based on sequence homology to proteins with known function has assigned many enzymes to this pathway without confirmation of either conjugating or DUB activity. Function-dependent methodologies are still the most useful for rapid identification or assessment of biological activity of expressed proteins from cells. Activity-based protein profiling uses chemical probes that are active-site-directed for the classification of protein activities in complex mixtures. Here we show that the design and use of an expanded set of Ub-based electrophilic probes allowed us to recover and identify members of each enzyme class in the ubiquitin-proteasome system, including E3 ligases and DUBs with previously unverified activity. We show that epitope-tagged Ub-electrophilic probes can be used as activity-based probes for E3 ligase identification by in vitro labeling and activity studies of purified enzymes identified from complex mixtures in cell lysate. Furthermore, the reactivity of our probe with the HECT domain of the E3 Ub ligase ARF-BP1 suggests that multiple cysteines may be in the vicinity of the E2-binding site and are capable of the transfer of Ub to self or to a substrate protein.

  9. Cycle Inhibiting Factors (Cifs: Cyclomodulins That Usurp the Ubiquitin-Dependent Degradation Pathway of Host Cells

    Directory of Open Access Journals (Sweden)

    Eric Oswald


    Full Text Available Cycle inhibiting factors (Cifs are type III secreted effectors produced by diverse pathogenic bacteria. Cifs are “cyclomodulins” that inhibit the eukaryotic host cell cycle and also hijack other key cellular processes such as those controlling the actin network and apoptosis. This review summarizes current knowledge on Cif since its first characterization in enteropathogenic Escherichia coli, the identification of several xenologues in distant pathogenic bacteria, to its structure elucidation and the recent deciphering of its mode of action. Cif impairs the host ubiquitin proteasome system through deamidation of ubiquitin or the ubiquitin-like protein NEDD8 that regulates Cullin-Ring-ubiquitin Ligase (CRL complexes. The hijacking of the ubiquitin-dependent degradation pathway of host cells results in the modulation of various cellular functions such as epithelium renewal, apoptosis and immune response. Cif is therefore a powerful weapon in the continuous arm race that characterizes host-bacteria interactions.

  10. A small-molecule inhibitor of the ubiquitin activating enzyme for cancer treatment. (United States)

    Hyer, Marc L; Milhollen, Michael A; Ciavarri, Jeff; Fleming, Paul; Traore, Tary; Sappal, Darshan; Huck, Jessica; Shi, Judy; Gavin, James; Brownell, Jim; Yang, Yu; Stringer, Bradley; Griffin, Robert; Bruzzese, Frank; Soucy, Teresa; Duffy, Jennifer; Rabino, Claudia; Riceberg, Jessica; Hoar, Kara; Lublinsky, Anya; Menon, Saurabh; Sintchak, Michael; Bump, Nancy; Pulukuri, Sai M; Langston, Steve; Tirrell, Stephen; Kuranda, Mike; Veiby, Petter; Newcomb, John; Li, Ping; Wu, Jing Tao; Powe, Josh; Dick, Lawrence R; Greenspan, Paul; Galvin, Katherine; Manfredi, Mark; Claiborne, Chris; Amidon, Benjamin S; Bence, Neil F


    The ubiquitin-proteasome system (UPS) comprises a network of enzymes that is responsible for maintaining cellular protein homeostasis. The therapeutic potential of this pathway has been validated by the clinical successes of a number of UPS modulators, including proteasome inhibitors and immunomodulatory imide drugs (IMiDs). Here we identified TAK-243 (formerly known as MLN7243) as a potent, mechanism-based small-molecule inhibitor of the ubiquitin activating enzyme (UAE), the primary mammalian E1 enzyme that regulates the ubiquitin conjugation cascade. TAK-243 treatment caused depletion of cellular ubiquitin conjugates, resulting in disruption of signaling events, induction of proteotoxic stress, and impairment of cell cycle progression and DNA damage repair pathways. TAK-243 treatment caused death of cancer cells and, in primary human xenograft studies, demonstrated antitumor activity at tolerated doses. Due to its specificity and potency, TAK-243 allows for interrogation of ubiquitin biology and for assessment of UAE inhibition as a new approach for cancer treatment.

  11. When ubiquitin meets NF-κB: a trove for anti-cancer drug development. (United States)

    Wu, Zhao-Hui; Shi, Yuling


    During the last two decades, the studies on ubiquitination in regulating transcription factor NF-κB activation have elucidated the expanding role of ubiquitination in modulating cellular events by non-proteolytic mechanisms, as well as by proteasomal degradation. The significance of ubiquitination has also been recognized in regulating gene transcription, epigenetic modifications, kinase activation, DNA repair and subcellular translocation. This progress has been translated into novel strategies for developing anti-cancer therapeutics, exemplified by the success of the first FDA-approved proteasome inhibitor drug Bortezomib. Here we discuss the current understanding of the ubiquitin-proteasome system and how it is involved in regulating NF-κB signaling pathways in response to a variety of stimuli. We also focus on the recent progress of anti-cancer drug development targeting various steps of ubiquitination process, and the potential of these drugs in cancer treatment as related to their impact on NF-κB activation.

  12. DMPD: Ubiquitin: tool and target for intracellular NF-kappaB inhibitors. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16982211 Ubiquitin: tool and target for intracellular NF-kappaB inhibitors. (.html) (.csml) Show Ubiquitin: tool and target for intracellular NF-kappaB inhibitors. PubmedID 1698221...1 Title Ubiquitin: tool and target for intracellular NF-kappaB inhibitors. Author

  13. Linear ubiquitin chain induces apoptosis and inhibits tumor growth. (United States)

    Qin, Zhoushuai; Jiang, Wandong; Wang, Guifen; Sun, Ying; Xiao, Wei


    Ubiquitination of proliferating cell nuclear antigen (PCNA) plays an important role in DNA damage response. Ectopic expression of PCNA fused at either terminus with ubiquitin (Ub) lacking two C-terminal glycine residues induces translesion DNA synthesis which resembles synthesis mediated by PCNA monoubiquitination. PCNA fused with Ub containing the C-terminal Gly residues at the C-terminus can be further polyubiquitinated in a Gly-dependent manner, which inhibits cell proliferation and induces ATR-dependent replication checkpoint. In this study, we surprisingly found that PCNA fused to a head-to-tail linear Ub chain induces apoptosis in a Ub chain length-dependent manner. Further investigation revealed that the apoptotic effect is actually induced by the linear Ub chain independently from PCNA, as the Ub chain fused to GFP or an epitope tag still efficiently induces apoptosis. It is revealed that the artificial linear Ub chain differs from endogenously encoded linear Ub chains in that its Ubs contain a Ub-G76S substitution, making the Ub chain resistant to cleavage by deubiquitination enzymes. We demonstrated in this study that ectopic expression of the artificial Ub chain alone in cultured human cancer cells is sufficient to inhibit tumor growth in a xenograft mouse model, making the linear Ub chain a putative anti-cancer agent.

  14. Aβ-Induced Synaptic Alterations Require the E3 Ubiquitin Ligase Nedd4-1. (United States)

    Rodrigues, Elizabeth M; Scudder, Samantha L; Goo, Marisa S; Patrick, Gentry N


    Alzheimer's disease (AD) is a neurodegenerative disease in which patients experience progressive cognitive decline. A wealth of evidence suggests that this cognitive impairment results from synaptic dysfunction in affected brain regions caused by cleavage of amyloid precursor protein into the pathogenic peptide amyloid-β (Aβ). Specifically, it has been shown that Aβ decreases surface AMPARs, dendritic spine density, and synaptic strength, and also alters synaptic plasticity. The precise molecular mechanisms by which this occurs remain unclear. Here we demonstrate a role for ubiquitination in Aβ-induced synaptic dysfunction in cultured rat neurons. We find that Aβ promotes the ubiquitination of AMPARs, as well as the redistribution and recruitment of Nedd4-1, a HECT E3 ubiquitin ligase we previously demonstrated to target AMPARs for ubiquitination and degradation. Strikingly, we show that Nedd4-1 is required for Aβ-induced reductions in surface AMPARs, synaptic strength, and dendritic spine density. Our findings, therefore, indicate an important role for Nedd4-1 and ubiquitin in the synaptic alterations induced by Aβ. Synaptic changes in Alzheimer's disease (AD) include surface AMPAR loss, which can weaken synapses. In a cell culture model of AD, we found that AMPAR loss correlates with increased AMPAR ubiquitination. In addition, the ubiquitin ligase Nedd4-1, known to ubiquitinate AMPARs, is recruited to synapses in response to Aβ. Strikingly, reducing Nedd4-1 levels in this model prevented surface AMPAR loss and synaptic weakening. These findings suggest that, in AD, Nedd4-1 may ubiquitinate AMPARs to promote their internalization and weaken synaptic strength, similar to what occurs in Nedd4-1's established role in homeostatic synaptic scaling. This is the first demonstration of Aβ-mediated control of a ubiquitin ligase to regulate surface AMPAR expression. Copyright © 2016 the authors 0270-6474/16/361590-06$15.00/0.

  15. Nickel compounds induce histone ubiquitination by inhibiting histone deubiquitinating enzyme activity

    International Nuclear Information System (INIS)

    Ke Qingdong; Ellen, Thomas P.; Costa, Max


    Nickel (Ni) compounds are known carcinogens but underlying mechanisms are not clear. Epigenetic changes are likely to play an important role in nickel ion carcinogenesis. Previous studies have shown epigenetic effects of nickel ions, including the loss of histone acetylation and a pronounced increase in dimethylated H3K9 in nickel-exposed cells. In this study, we demonstrated that both water-soluble and insoluble nickel compounds induce histone ubiquitination (uH2A and uH2B) in a variety of cell lines. Investigations of the mechanism by which nickel increases histone ubiquitination in cells reveal that nickel does not affect cellular levels of the substrates of this modification, i.e., ubiquitin, histones, and other non-histone ubiquitinated proteins. In vitro ubiquitination and deubiquitination assays have been developed to further investigate possible effects of nickel on enzymes responsible for histone ubiquitination. Results from the in vitro assays demonstrate that the presence of nickel did not affect the levels of ubiquitinated histones in the ubiquitinating assay. Instead, the addition of nickel significantly prevents loss of uH2A and uH2B in the deubiquitinating assay, suggesting that nickel-induced histone ubiquitination is the result of inhibition of (a) putative deubiquitinating enzyme(s). Additional supporting evidence comes from the comparison of the response to nickel ions with a known deubiquitinating enzyme inhibitor, iodoacetamide (IAA). This study is the first to demonstrate such effects of nickel ions on histone ubiquitination. It also sheds light on the possible mechanisms involved in altering the steady state of this modification. The study provides further evidence that supports the notion that nickel ions alter epigenetic homeostasis in cells, which may lead to altered programs of gene expression and carcinogenesis

  16. E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue. (United States)

    Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok

    Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation.

  17. E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue.

    Directory of Open Access Journals (Sweden)

    Jung Hwa Lim

    Full Text Available Here, we show that E2-EPF ubiquitin carrier protein (UCP elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196. A UCP mutant in which Cys118 was changed to alanine (UCPC118A did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation.

  18. Genetic myostatin decrease in the golden retriever muscular dystrophy model does not significantly affect the ubiquitin proteasome system despite enhancing the severity of disease. (United States)

    Cotten, Steven W; Kornegay, Joe N; Bogan, Daniel J; Wadosky, Kristine M; Patterson, Cam; Willis, Monte S


    Recent studies suggest that inhibiting the protein myostatin, a negative regulator of skeletal muscle mass, may improve outcomes in patients with Duchenne muscular dystrophy by enhancing muscle mass. When the dystrophin-deficient golden retriever muscular dystrophy (GRMD) dog was bred with whippets having a heterozygous mutation for the myostatin gene, affected GRMD dogs with decreased myostatin (GRippets) demonstrated an accelerated physical decline compared to related affected GRMD dogs with full myostatin. To examine the role of the ubiquitin proteasome and calpain systems in this accelerated decline, we determined the expression of the muscle ubiquitin ligases MuRF1, Atrogin-1, RNF25, RNF11, and CHIP: the proteasome subunits PSMA6, PSMB4, and PSME1: and calpain 1/2 by real time PCR in the cranial sartorius and vastus lateralis muscles in control, affected GRMD, and GRippet dogs. While individual affected GRMD and GRippet dogs contributed to an increased variability seen in ubiquitin ligase expression, neither group was significantly different from the control group. The affected GRMD dogs demonstrated significant increases in caspase-like and trypsin-like activity in the cranial sartorius; however, all three proteasome activities in the GRippet muscles did not differ from controls. Increased variability in calpain 1 and calpain 2 expression and activity in the affected GRMD and GRippet groups were identified, but no statistical differences from the control group were seen. These studies suggest a role of myostatin in the disease progression of GRMD, which does not significantly involve key components of the ubiquitin proteasome and calpain systems involved in the protein quality control of sarcomere and other structural skeletal muscle proteins.

  19. Actin and ubiquitin protein sequences support a cercozoan/foraminiferan ancestry for the plasmodiophorid plant pathogens. (United States)

    Archibald, John M; Keeling, Patrick J


    The plasmodiophorids are a group of eukaryotic intracellular parasites that cause disease in a variety of economically significant crops. Plasmodiophorids have traditionally been considered fungi but have more recently been suggested to be members of the Cercozoa, a morphologically diverse group of amoeboid, flagellate, and amoeboflagellate protists. The recognition that Cercozoa constitute a monophyletic lineage has come from phylogenetic analyses of small subunit ribosomal RNA genes. Protein sequence data have suggested that the closest relatives of Cercozoa are the Foraminifera. To further test a cercozoan origin for the plasmodiophorids, we isolated actin genes from Plasmodiophora brassicae, Sorosphaera veronicae, and Spongospora subterranea, and polyubiquitin gene fragments from P. brassicae and S. subterranea. We also isolated actin genes from the chlorarachniophyte Lotharella globosa. In protein phylogenies of actin, the plasmodiophorid sequences consistently branch with Cercozoa and Foraminifera, and weakly branch as the sister group to the foraminiferans. The plasmodiophorid polyubiquitin sequences contain a single amino acid residue insertion at the functionally important processing point between ubiquitin monomers, the same place in which an otherwise unique insertion exists in the cercozoan and foraminiferan proteins. Taken together, these results indicate that plasmodiophorids are indeed related to Cercozoa and Foraminifera, although the relationships amongst these groups remain unresolved.

  20. The tomato Fni3 lysine-63-specific ubiquitin-conjugating enzyme and suv ubiquitin E2 variant positively regulate plant immunity. (United States)

    Mural, Ravi V; Liu, Yao; Rosebrock, Tracy R; Brady, Jennifer J; Hamera, Sadia; Connor, Richard A; Martin, Gregory B; Zeng, Lirong


    The activation of an immune response in tomato (Solanum lycopersicum) against Pseudomonas syringae relies on the recognition of E3 ligase-deficient forms of AvrPtoB by the host protein kinase, Fen. To investigate the mechanisms by which Fen-mediated immunity is regulated, we characterize in this study a Fen-interacting protein, Fni3, and its cofactor, S. lycoperiscum Uev (Suv). Fni3 encodes a homolog of the Ubc13-type ubiquitin-conjugating enzyme that catalyzes exclusively Lys-63-linked ubiquitination, whereas Suv is a ubiquitin-conjugating enzyme variant. The C-terminal region of Fen was necessary for interaction with Fni3, and this interaction was required for cell death triggered by overexpression of Fen in Nicotiana benthamiana leaves. Fni3 was shown to be an active E2 enzyme, but Suv displayed no ubiquitin-conjugating activity; Fni3 and Suv together directed Lys-63-linked ubiquitination. Decreased expression of Fni3, another tomato Ubc13 homolog, Sl-Ubc13-2, or Suv in N. benthamiana leaves diminished cell death associated with Fen-mediated immunity and cell death elicited by several other resistance (R) proteins and their cognate effectors. We also discovered that coexpression of Fen and other R proteins/effectors with a Fni3 mutant that is compromised for ubiquitin-conjugating activity diminished the cell death. These results suggest that Fni3/Sl-Ubc13-2 and Suv regulate the immune response mediated by Fen and other R proteins through Lys-63-linked ubiquitination.

  1. The Tomato Fni3 Lysine-63–Specific Ubiquitin-Conjugating Enzyme and Suv Ubiquitin E2 Variant Positively Regulate Plant Immunity[C][W (United States)

    Mural, Ravi V.; Liu, Yao; Rosebrock, Tracy R.; Brady, Jennifer J.; Hamera, Sadia; Connor, Richard A.; Martin, Gregory B.; Zeng, Lirong


    The activation of an immune response in tomato (Solanum lycopersicum) against Pseudomonas syringae relies on the recognition of E3 ligase–deficient forms of AvrPtoB by the host protein kinase, Fen. To investigate the mechanisms by which Fen-mediated immunity is regulated, we characterize in this study a Fen-interacting protein, Fni3, and its cofactor, S. lycoperiscum Uev (Suv). Fni3 encodes a homolog of the Ubc13-type ubiquitin-conjugating enzyme that catalyzes exclusively Lys-63–linked ubiquitination, whereas Suv is a ubiquitin-conjugating enzyme variant. The C-terminal region of Fen was necessary for interaction with Fni3, and this interaction was required for cell death triggered by overexpression of Fen in Nicotiana benthamiana leaves. Fni3 was shown to be an active E2 enzyme, but Suv displayed no ubiquitin-conjugating activity; Fni3 and Suv together directed Lys-63–linked ubiquitination. Decreased expression of Fni3, another tomato Ubc13 homolog, Sl-Ubc13-2, or Suv in N. benthamiana leaves diminished cell death associated with Fen-mediated immunity and cell death elicited by several other resistance (R) proteins and their cognate effectors. We also discovered that coexpression of Fen and other R proteins/effectors with a Fni3 mutant that is compromised for ubiquitin-conjugating activity diminished the cell death. These results suggest that Fni3/Sl-Ubc13-2 and Suv regulate the immune response mediated by Fen and other R proteins through Lys-63–linked ubiquitination. PMID:24076975

  2. Preparation of ubiquitin-conjugated proteins using an insect cell-free protein synthesis system. (United States)

    Suzuki, Takashi; Ezure, Toru; Ando, Eiji; Nishimura, Osamu; Utsumi, Toshihiko; Tsunasawa, Susumu


    Ubiquitination is one of the most significant posttranslational modifications (PTMs). To evaluate the ability of an insect cell-free protein synthesis system to carry out ubiquitin (Ub) conjugation to in vitro translated proteins, poly-Ub chain formation was studied in an insect cell-free protein synthesis system. Poly-Ub was generated in the presence of Ub aldehyde (UA), a de-ubiquitinating enzyme inhibitor. In vitro ubiquitination of the p53 tumor suppressor protein was also analyzed, and p53 was poly-ubiquitinated when Ub, UA, and Mdm2, an E3 Ub ligase (E3) for p53, were added to the in vitro reaction mixture. These results suggest that the insect cell-free protein synthesis system contains enzymatic activities capable of carrying out ubiquitination. CBB-detectable ubiquitinated p53 was easily purified from the insect cell-free protein synthesis system, allowing analysis of the Ub-conjugated proteins by mass spectrometry (MS). Lys 305 of p53 was identified as one of the Ub acceptor sites using this strategy. Thus, we conclude that the insect cell-free protein synthesis system is a powerful tool for studying various PTMs of eukaryotic proteins including ubiqutination presented here.

  3. Roles of mono-ubiquitinated Smad4 in the formation of Smad transcriptional complexes

    International Nuclear Information System (INIS)

    Wang Bei; Suzuki, Hiroyuki; Kato, Mitsuyasu


    TGF-β activates receptor-regulated Smad (R-Smad) through phosphorylation by type I receptors. Activated R-Smad binds to Smad4 and the complex translocates into the nucleus and stimulates the transcription of target genes through association with co-activators including p300. It is not clear, however, how activated Smad complexes are removed from target genes. In this study, we show that TGF-β enhances the mono-ubiquitination of Smad4. Smad4 mono-ubiquitination was promoted by p300 and suppressed by the c-Ski co-repressor. Smad4 mono-ubiquitination disrupted the interaction with Smad2 in the presence of constitutively active TGF-β type I receptor. Furthermore, mono-ubiquitinated Smad4 was not found in DNA-binding Smad complexes. A Smad4-Ubiquitin fusion protein, which mimics mono-ubiquitinated Smad4, enhanced localization to the cytoplasm. These results suggest that mono-ubiquitination of Smad4 occurs in the transcriptional activator complex and facilitates the turnover of Smad complexes at target genes

  4. Genome-wide identification and characterization of the apple (Malus domestica) HECT ubiquitin-protein ligase family and expression analysis of their responsiveness to abiotic stresses. (United States)

    Xu, Jianing; Xing, Shanshan; Cui, Haoran; Chen, Xuesen; Wang, Xiaoyun


    The ubiquitin-protein ligases (E3s) directly participate in ubiquitin (Ub) transferring to the target proteins in the ubiquitination pathway. The HECT ubiquitin-protein ligase (UPL), one type of E3s, is characterized as containing a conserved HECT domain of approximately 350 amino acids in the C terminus. Some UPLs were found to be involved in trichome development and leaf senescence in Arabidopsis. However, studies on plant UPLs, such as characteristics of the protein structure, predicted functional motifs of the HECT domain, and the regulatory expression of UPLs have all been limited. Here, we present genome-wide identification of the genes encoding UPLs (HECT gene) in apple. The 13 genes (named as MdUPL1-MdUPL13) from ten different chromosomes were divided into four groups by phylogenetic analysis. Among these groups, the encoding genes in the intron-exon structure and the included additional functional domains were quite different. Notably, the F-box domain was first found in MdUPL7 in plant UPLs. The HECT domain in different MdUPL groups also presented different spatial features and three types of conservative motifs were identified. The promoters of each MdUPL member carried multiple stress-response related elements by cis-acting element analysis. Experimental results demonstrated that the expressions of several MdUPLs were quite sensitive to cold-, drought-, and salt-stresses by qRT-PCR assay. The results of this study helped to elucidate the functions of HECT proteins, especially in Rosaceae plants.

  5. Lys48 ubiquitination during the intraerythrocytic cycle of the rodent malaria parasite, Plasmodium chabaudi. (United States)

    González-López, Lorena; Carballar-Lejarazú, Rebeca; Arrevillaga Boni, Gerardo; Cortés-Martínez, Leticia; Cázares-Raga, Febe Elena; Trujillo-Ocampo, Abel; Rodríguez, Mario H; James, Anthony A; Hernández-Hernández, Fidel de la Cruz


    Ubiquitination tags proteins for different functions within the cell. One of the most abundant and studied ubiquitin modification is the Lys48 polyubiquitin chain that modifies proteins for their destruction by proteasome. In Plasmodium is proposed that post-translational regulation is fundamental for parasite development during its complex life-cycle; thus, the objective of this work was to analyze the ubiquitination during Plasmodium chabaudi intraerythrocytic stages. Ubiquitinated proteins were detected during intraerythrocytic stages of Plasmodium chabaudi by immunofluorescent microscopy, bidimensional electrophoresis (2-DE) combined with immunoblotting and mass spectrometry. All the studied stages presented protein ubiquitination and Lys48 polyubiquitination with more abundance during the schizont stage. Three ubiquitinated proteins were identified for rings, five for trophozoites and twenty for schizonts. Only proteins detected with a specific anti- Lys48 polyubiquitin antibody were selected for Mass Spectrometry analysis and two of these identified proteins were selected in order to detect the specific amino acid residues where ubiquitin is placed. Ubiquitinated proteins during the ring and trophozoite stages were related with the invasion process and in schizont proteins were related with nucleic acid metabolism, glycolysis and protein biosynthesis. Most of the ubiquitin detection was during the schizont stage and the Lys48 polyubiquitination during this stage was related to proteins that are expected to be abundant during the trophozoite stage. The evidence that these Lys48 polyubiquitinated proteins are tagged for destruction by the proteasome complex suggests that this type of post-translational modification is important in the regulation of protein abundance during the life-cycle and may also contribute to the parasite cell-cycle progression.

  6. Ubiquitin-specific protease 14 regulates cell proliferation and apoptosis in oral squamous cell carcinoma. (United States)

    Chen, Xiangyun; Wu, Jingjing; Chen, Yitian; Ye, Dongxia; Lei, Hu; Xu, Hanzhang; Yang, Li; Wu, Yingli; Gu, Wenli


    Ubiquitin-specific protease 14, a deubiquitinating enzyme, has been implicated in the tumorigenesis and progression of several cancers, but its role in oral squamous cell carcinoma remains to be elucidated. The aim of this study was to explore the expression pattern and roles of Ubiquitin-specific protease 14 in the occurrence and development of oral squamous cell carcinoma. Interestingly, Ubiquitin-specific protease 14 was overexpressed in oral cancer tissues and cell lines at both mRNA and protein levels. b-AP15, a specific inhibitor of Ubiquitin-specific protease 14, significantly inhibited the growth of cancer cells and increased cell apoptosis in a dose-dependent manner. Moreover, knockdown of Ubiquitin-specific protease 14 by shRNA significantly inhibited the proliferation and migration of cancer cells in vitro. Finally, using a xenograft mouse model of oral squamous cell carcinoma, knockdown of Ubiquitin-specific protease 14 markedly inhibited tumor growth and triggered the cancer cell apoptosis in vivo, supporting previous results. In conclusion, for the first time we have demonstrated the expression pattern of Ubiquitin-specific protease 14 in oral squamous cell carcinoma and verified a relationship with tumor growth and metastasis. These results may highlight new therapeutic strategies for tumor treatment, application of Ubiquitin-specific protease 14 selective inhibitor, such as b-AP15, or knockdown by shRNA. Collectively, Ubiquitin-specific protease 14 could be a potential therapeutic target for oral squamous cell carcinoma patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. NH exchange in point mutants of human ubiquitin. (United States)

    Jahr, Nicole; Fiedler, Erik; Günther, Robert; Hofmann, Hans-Jörg; Berger, Stefan


    Several point mutants of human ubiquitin (Ub(T9V), Ub(F45W), Ub(F45G), and Ub(A46S)) were prepared by recombinant techniques. The NH exchange rate constants were measured by the NMR diffusion and the MEXICO methods and compared with those in the wild type to examine the influence of structural changes and to improve the understanding of this important reaction in studies of protein folding and denaturation. The observed changes follow qualitatively the polarity and steric alterations caused by the introduced amino acids. Attempts to reproduce quantitatively the observed changes by modeling studies and molecular dynamics simulations were not satisfactory. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. The ubiquitin ligase SCFFBXW7α promotes GATA3 degradation. (United States)

    Song, Nan; Cao, Cheng; Tang, Yiman; Bi, Liyuan; Jiang, Yong; Zhou, Yongsheng; Song, Xin; Liu, Ling; Ge, Wenshu


    GATA3 is a key transcription factor in cell fate determination and its dysregulation has been implicated in various types of malignancies. However, how the abundance and function of GATA3 are regulated remains unclear. Here, we report that GATA3 is physically associated with FBXW7α, and FBXW7α destabilizes GATA3 through assembly of a SKP1-CUL1-F-box E3 ligase complex. Importantly, we showed that FBXW7α promotes GATA3 ubiquitination and degradation in a GSK3 dependent manner. Furthermore, we demonstrated that FBXW7α inhibits breast cancer cells survival through destabilizing GATA3, and the expression level of FBXW7α is negatively correlated with that of GATA3 in breast cancer samples. This study indicated that FBXW7α is a critical negative regulator of GATA3 and revealed a pathway for the maintenance of GATA3 abundance in breast cancer cells. © 2017 Wiley Periodicals, Inc.

  9. Ubiquitin-fusion degradation pathway: A new strategy for inducing CD8 cells specific for mycobacterial HSP65

    International Nuclear Information System (INIS)

    Shen Jianying; Hisaeda, Hajime; Chou Bin; Yu Qingsheng; Tu Liping; Himeno, Kunisuke


    The ubiquitin-proteasome system (UPS) plays an indispensable role in inducing MHC class I-restricted CD8 + T cells. In this study, we exploited UPS to induce CD8 + T cells specific for mycobacterial HSP65 (mHSP65), one of the leading vaccine candidates against infection with Mycobacterium tuberculosis. A chimeric DNA termed pU-HSP65 encoding a fusion protein between murine ubiquitin and mHSP65 was constructed, and C57BL/6 (B6) mice were immunized with the DNA using gene gun bombardment. Mice immunized with the chimeric DNA acquired potent resistance against challenge with the syngeneic B16F1 melanoma cells transfected with the mHSP65 gene (HSP65/B16F1), compared with those immunized with DNA encoding only mHSP65. Splenocytes from the former group of mice showed a higher grade of cytotoxic activity against HSP65/B16F1 cells and contained a larger number of granzyme B- or IFN-γ-producing CD8 + T cells compared with those from the latter group of mice

  10. TRIM65 negatively regulates p53 through ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Li, Yang [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Ma, Chengyuan [Department of Neurosurgery, The First Hospital of Jilin University, Changchun 130021 (China); Zhou, Tong [Department of Endocrinology, The First Hospital of Jilin University, Changchun 130021 (China); Liu, Ying [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China); Sun, Luyao [Department of Infectious Diseases, The First Hospital of Jilin University, Changchun 130021 (China); Yu, Zhenxiang, E-mail: [Department of Respiration, The First Hospital of Jilin University, Changchun 130021 (China)


    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediated degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.

  11. Interplays between Sumoylation, SUMO-Targeted Ubiquitin Ligases, and the Ubiquitin-Adaptor Protein Ufd1 in Fission Yeast

    DEFF Research Database (Denmark)

    Køhler, Julie Bonne

    and the specific molecular interactions and sequence of events linking sumoylation, ubiquitylation and substrate degradation, has been largely uncovered. Using the fission yeast model organism I here present evidence for a role of the Ufd1 (ubiquitinfusion degradation 1) protein, and by extension of the Cdc48-Ufd1...... proteasome mediates direct cross-talk between the two modification systems. By contributing to the dynamic turnover of SUMO conjugated species these SUMO-targeted ubiquitin ligases (STUbLs) fulfills essential roles in both yeast and man. However, the specific sumoylated proteins affected by STUbL activity...... either in STUbL or Ufd1 function. In addition to identifying more than 900 unique sumoylated sites, these efforts revealed a number of proteins with upregulated sumoylation either in STUbL and/or Ufd1 mutant cells. These findings propose specific candidate substrates through which STUbL and Cdc48-Ufd1...

  12. Definitive evidence for Ufd2-catalyzed elongation of the ubiquitin chain through Lys48 linkage

    International Nuclear Information System (INIS)

    Saeki, Yasushi; Tayama, Yoko; Toh-e, Akio; Yokosawa, Hideyoshi


    Saccharomyces cerevisiae Ufd2 is a ubiquitin chain elongation factor in the ubiquitin fusion degradation (UFD) pathway and functions in stress tolerance. A recent study has suggested that the mammalian Ufd2 homologue UFD2a catalyzes formation of Lys27- and Lys33-linked polyubiquitin chains rather than the Lys48-linked chain, but the linkage type of the polyubiquitin chain formed by yeast Ufd2 remains unclear. To determine the property of Ufd2, we reconstituted the UFD pathway using purified enzymes from yeast. Direct determination of the ubiquitin chain linkage type in polyubiquitinated UFD substrates by MALDI-TOF mass spectrometry revealed that Ufd2 catalyzes elongation of the ubiquitin chain through Lys48 linkage

  13. Chain Assembly and Disassembly Processes Differently Affect the Conformational Space of Ubiquitin Chains. (United States)

    Kniss, Andreas; Schuetz, Denise; Kazemi, Sina; Pluska, Lukas; Spindler, Philipp E; Rogov, Vladimir V; Husnjak, Koraljka; Dikic, Ivan; Güntert, Peter; Sommer, Thomas; Prisner, Thomas F; Dötsch, Volker


    Ubiquitination is the most versatile posttranslational modification. The information is encoded by linkage type as well as chain length, which are translated by ubiquitin binding domains into specific signaling events. Chain topology determines the conformational space of a ubiquitin chain and adds an additional regulatory layer to this ubiquitin code. In particular, processes that modify chain length will be affected by chain conformations as they require access to the elongation or cleavage sites. We investigated conformational distributions in the context of chain elongation and disassembly using pulsed electron-electron double resonance spectroscopy in combination with molecular modeling. Analysis of the conformational space of diubiquitin revealed conformational selection or remodeling as mechanisms for chain recognition during elongation or hydrolysis, respectively. Chain elongation to tetraubiquitin increases the sampled conformational space, suggesting that a high intrinsic flexibility of K48-linked chains may contribute to efficient proteasomal degradation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Selective Transgenic Expression of Mutant Ubiquitin in Purkinje Cell Stripes in the Cerebellum. (United States)

    Verheijen, Bert M; Gentier, Romina J G; Hermes, Denise J H P; van Leeuwen, Fred W; Hopkins, David A


    The ubiquitin-proteasome system (UPS) is one of the major mechanisms for protein breakdown in cells, targeting proteins for degradation by enzymatically conjugating them to ubiquitin molecules. Intracellular accumulation of ubiquitin-B +1 (UBB +1 ), a frameshift mutant of ubiquitin-B, is indicative of a dysfunctional UPS and has been implicated in several disorders, including neurodegenerative disease. UBB +1 -expressing transgenic mice display widespread labeling for UBB +1 in brain and exhibit behavioral deficits. Here, we show that UBB +1 is specifically expressed in a subset of parasagittal stripes of Purkinje cells in the cerebellar cortex of a UBB +1 -expressing mouse model. This expression pattern is reminiscent of that of the constitutively expressed Purkinje cell antigen HSP25, a small heat shock protein with neuroprotective properties.

  15. Gammaherpesviral Tegument Proteins, PML-Nuclear Bodies and the Ubiquitin-Proteasome System

    Directory of Open Access Journals (Sweden)

    Florian Full


    Full Text Available Gammaherpesviruses like Epstein-Barr virus (EBV and Kaposi’s sarcoma-associated herpesvirus (KSHV subvert the ubiquitin proteasome system for their own benefit in order to facilitate viral gene expression and replication. In particular, viral tegument proteins that share sequence homology to the formylglycineamide ribonucleotide amidotransferase (FGARAT, or PFAS, an enzyme in the cellular purine biosynthesis, are important for disrupting the intrinsic antiviral response associated with Promyelocytic Leukemia (PML protein-associated nuclear bodies (PML-NBs by proteasome-dependent and independent mechanisms. In addition, all herpesviruses encode for a potent ubiquitin protease that can efficiently remove ubiquitin chains from proteins and thereby interfere with several different cellular pathways. In this review, we discuss mechanisms and functional consequences of virus-induced ubiquitination and deubiquitination for early events in gammaherpesviral infection.

  16. Molecular and structural insight into lysine selection on substrate and ubiquitin lysine 48 by the ubiquitin-conjugating enzyme Cdc34

    DEFF Research Database (Denmark)

    Suryadinata, Randy; Holien, Jessica K; Yang, George


    , the mechanisms of lysine selection are not clearly understood. The positioning of lysine(s) toward the E2/E3 active site and residues proximal to lysines are critical in their selection. We investigated determinants of lysine specificity of the ubiquitin-conjugating enzyme Cdc34, toward substrate and Ub lysines....... Evaluation of the relative importance of different residues positioned -2, -1, +1 and +2 toward ubiquitination of its substrate, Sic1, on lysine 50 showed that charged residues in the -1 and -2 positions negatively impact on ubiquitination. Modeling suggests that charged residues at these positions alter...... the native salt-bridge interactions in Ub and Cdc34, resulting in misplacement of Sic1 lysine 50 in the Cdc34 catalytic cleft. During polyubiquitination, Cdc34 showed a strong preference for Ub lysine 48 (K48), with lower activity towards lysine 11 (K11) and lysine 63 (K63). Mutating the -2, -1, +1 and +2...

  17. Bypass of senescence by the polycomb group protein CBX8 through direct binding to the INK4A-ARF locus

    DEFF Research Database (Denmark)

    Dietrich, Nikolaj; Bracken, Adrian P; Trinh, Emmanuelle


    -ARF, and that ectopic expression of CBX8 leads to repression of the Ink4a-Arf locus and bypass of senescence, leading to cellular immortalization. Gene expression and location analysis demonstrate that besides the INK4A-ARF locus, CBX8 also regulates a number of other genes important for cell growth and survival...

  18. Identification of new members of Fertilisation Independent Seed Polycomb Group pathway involved in the control of seed development in Arabidopsis thaliana. (United States)

    Guitton, Anne-Elisabeth; Page, Damian R; Chambrier, Pierre; Lionnet, Claire; Faure, Jean-Emmanuel; Grossniklaus, Ueli; Berger, Frédéric


    In higher plants, double fertilisation initiates seed development. One sperm cell fuses with the egg cell and gives rise to the embryo, the second sperm cell fuses with the central cell and gives rise to the endosperm. The endosperm develops as a syncytium with the gradual organisation of domains along an anteroposterior axis defined by the position of the embryo at the anterior pole and by the attachment to the placenta at the posterior pole. We report that ontogenesis of the posterior pole in Arabidopsis thaliana involves oriented migration of nuclei in the syncytium. We show that this migration is impaired in mutants of the three founding members of the FERTILIZATION INDEPENDENT SEED (FIS) class, MEDEA (MEA), FIS2 and FERTILIZATION INDEPENDENT ENDOSPERM (FIE). A screen based on a green fluorescent protein (GFP) reporter line allowed us to identify two new loci in the FIS pathway, medicis and borgia. We have cloned the MEDICIS gene and show that it encodes the Arabidopsis homologue of the yeast WD40 domain protein MULTICOPY SUPRESSOR OF IRA (MSI1). The mutations at the new fis loci cause the same cellular defects in endosperm development as other fis mutations, including parthenogenetic development, absence of cellularisation, ectopic development of posterior structures and overexpression of the GFP marker.

  19. The Endosome-associated Deubiquitinating Enzyme USP8 Regulates BACE1 Enzyme Ubiquitination and Degradation. (United States)

    Yeates, Eniola Funmilayo Aduke; Tesco, Giuseppina


    The β-site amyloid precursor protein-cleaving enzyme (BACE1) is the rate-limiting enzyme in the production of amyloid-β, the toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. Our previous studies have shown that BACE1 is degraded via the lysosomal pathway and that that depletion of the trafficking molecule Golgi-localized γ-ear-containing ARF-binding protein 3 (GGA3) results in increased BACE1 levels and activity because of impaired lysosomal degradation. We also determined that GGA3 regulation of BACE1 levels requires its ability to bind ubiquitin. Accordingly, we reported that BACE1 is ubiquitinated at lysine 501 and that lack of ubiquitination at lysine 501 produces BACE1 stabilization. Ubiquitin conjugation is a reversible process mediated by deubiquitinating enzymes. The ubiquitin-specific peptidase 8 (USP8), an endosome-associated deubiquitinating enzyme, regulates the ubiquitination, trafficking, and lysosomal degradation of several plasma membrane proteins. Here, we report that RNAi-mediated depletion of USP8 reduced levels of both ectopically expressed and endogenous BACE1 in H4 human neuroglioma cells. Moreover, USP8 depletion increased BACE1 ubiquitination, promoted BACE1 accumulation in the early endosomes and late endosomes/lysosomes, and decreased levels of BACE1 in the recycling endosomes. We also found that decreased BACE1 protein levels were accompanied by a decrease in BACE1-mediated amyloid precursor protein cleavage and amyloid-β levels. Our findings demonstrate that USP8 plays a key role in the trafficking and degradation of BACE1 by deubiquitinating lysine 501. These studies suggest that therapies able to accelerate BACE1 degradation (e.g. by increasing BACE1 ubiquitination) may represent a potential treatment for Alzheimer disease. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. The Endosome-associated Deubiquitinating Enzyme USP8 Regulates BACE1 Enzyme Ubiquitination and Degradation* (United States)

    Yeates, Eniola Funmilayo Aduke; Tesco, Giuseppina


    The β-site amyloid precursor protein-cleaving enzyme (BACE1) is the rate-limiting enzyme in the production of amyloid-β, the toxic peptide that accumulates in the brain of subjects affected by Alzheimer disease. Our previous studies have shown that BACE1 is degraded via the lysosomal pathway and that that depletion of the trafficking molecule Golgi-localized γ-ear-containing ARF-binding protein 3 (GGA3) results in increased BACE1 levels and activity because of impaired lysosomal degradation. We also determined that GGA3 regulation of BACE1 levels requires its ability to bind ubiquitin. Accordingly, we reported that BACE1 is ubiquitinated at lysine 501 and that lack of ubiquitination at lysine 501 produces BACE1 stabilization. Ubiquitin conjugation is a reversible process mediated by deubiquitinating enzymes. The ubiquitin-specific peptidase 8 (USP8), an endosome-associated deubiquitinating enzyme, regulates the ubiquitination, trafficking, and lysosomal degradation of several plasma membrane proteins. Here, we report that RNAi-mediated depletion of USP8 reduced levels of both ectopically expressed and endogenous BACE1 in H4 human neuroglioma cells. Moreover, USP8 depletion increased BACE1 ubiquitination, promoted BACE1 accumulation in the early endosomes and late endosomes/lysosomes, and decreased levels of BACE1 in the recycling endosomes. We also found that decreased BACE1 protein levels were accompanied by a decrease in BACE1-mediated amyloid precursor protein cleavage and amyloid-β levels. Our findings demonstrate that USP8 plays a key role in the trafficking and degradation of BACE1 by deubiquitinating lysine 501. These studies suggest that therapies able to accelerate BACE1 degradation (e.g. by increasing BACE1 ubiquitination) may represent a potential treatment for Alzheimer disease. PMID:27302062

  1. The Crystal Structure and Conformations of an Unbranched Mixed Tri-Ubiquitin Chain Containing K48 and K63 Linkages. (United States)

    Padala, Prasanth; Soudah, Nadine; Giladi, Moshe; Haitin, Yoni; Isupov, Michail N; Wiener, Reuven


    The ability of ubiquitin to function in a wide range of cellular processes is ascribed to its capacity to cause a diverse spectrum of modifications. While a target protein can be modified with monoubiquitin, it can also be modified with ubiquitin chains. The latter include seven types of homotypic chains as well as mixed ubiquitin chains. In a mixed chain, not all the isopeptide bonds are restricted to a specific lysine of ubiquitin, resulting in a chain possessing more than one type of linkage. While structural characterization of homotypic chains has been well elucidated, less is known about mixed chains. Here we present the crystal structure of a mixed tri-ubiquitin chain at 3.1-Å resolution. In the structure, the proximal ubiquitin is connected to the middle ubiquitin via K48 and these two ubiquitins adopt a compact structure as observed in K48 di-ubiquitin. The middle ubiquitin links to the distal ubiquitin via its K63 and these ubiquitins adopt two conformations, suggesting a flexible structure. Using small-angle X-ray scattering, we unexpectedly found differences between the conformational ensembles of the above tri-ubiquitin chains and chains possessing the same linkages but in the reverse order. In addition, cleavage of the K48 linkage by DUB is faster if this linkage is at the distal end. Taken together, our results suggest that in mixed chains, not only the type of the linkages but also their sequence determine the structural and functional properties of the chain. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Ubiquitin-Like Protein from Human Placental Extract Exhibits Collagenase Activity (United States)

    De, Debashree; Datta Chakraborty, Piyali; Mitra, Jyotirmoy; Sharma, Kanika; Mandal, Somnath; Das, Aneesha; Chakrabarti, Saikat; Bhattacharyya, Debasish


    An aqueous extract of human placenta exhibits strong gelatinase/collagenase activity in zymography. 2-D gel electrophoresis of the extract with gelatin zymography in the second dimension displayed a single spot, identified as ubiquitin-like component upon MALDI/TOF MS/MS analysis. Immunoblot indicated presence of ubiquitin and absence of collagenase in the extract. Collagenase activity of the ubiquitin-like component was confirmed from the change in solubility of collagen in aqueous buffer, degradation of collagen by size-exclusion HPLC and atomic force microscopy. Quantification with DQ-gelatin showed that the extract contains 0.04 U/ml of collagenase activity that was inhibited up to 95% by ubiquitin antibody. Ubiquitin from bovine erythrocytes demonstrated mild collagenase activity. Bioinformatics studies suggest that placental ubiquitin and collagenase follow structurally divergent evolution. This thermostable intrinsic collagenase activity of placental extract might have wide physiological relevance in degrading and remodeling collagen as it is used as a drug for wound healing and pelvic inflammatory diseases. PMID:23555718

  3. Fine-tuning the ubiquitin code at DNA double-strand breaks: deubiquitinating enzymes at work

    Directory of Open Access Journals (Sweden)

    Elisabetta eCitterio


    Full Text Available Ubiquitination is a reversible protein modification broadly implicated in cellular functions. Signaling processes mediated by ubiquitin are crucial for the cellular response to DNA double-strand breaks (DSBs, one of the most dangerous types of DNA lesions. In particular, the DSB response critically relies on active ubiquitination by the RNF8 and RNF168 ubiquitin ligases at the chromatin, which is essential for proper DSB signaling and repair. How this pathway is fine-tuned and what the functional consequences are of its deregulation for genome integrity and tissue homeostasis are subject of intense investigation. One important regulatory mechanism is by reversal of substrate ubiquitination through the activity of specific deubiquitinating enzymes (DUBs, as supported by the implication of a growing number of DUBs in DNA damage response (DDR processes. Here, we discuss the current knowledge of how ubiquitin-mediated signaling at DSBs is controlled by deubiquitinating enzymes, with main focus on DUBs targeting histone H2A and on their recent implication in stem cell biology and cancer.

  4. Proteomes and Ubiquitylomes Analysis Reveals the Involvement of Ubiquitination in Protein Degradation in Petunias1 (United States)

    Liu, Juanxu; Wei, Qian; Wang, Rongmin; Yang, Weiyuan; Ma, Yueyue; Chen, Guoju


    Petal senescence is a complex programmed process. It has been demonstrated previously that treatment with ethylene, a plant hormone involved in senescence, can extensively alter transcriptome and proteome profiles in plants. However, little is known regarding the impact of ethylene on posttranslational modification (PTM) or the association between PTM and the proteome. Protein degradation is one of the hallmarks of senescence, and ubiquitination, a major PTM in eukaryotes, plays important roles in protein degradation. In this study, we first obtained reference petunia (Petunia hybrida) transcriptome data via RNA sequencing. Next, we quantitatively investigated the petunia proteome and ubiquitylome and the association between them in petunia corollas following ethylene treatment. In total, 51,799 unigenes, 3,606 proteins, and 2,270 ubiquitination sites were quantified 16 h after ethylene treatment. Treatment with ethylene resulted in 14,448 down-regulated and 6,303 up-regulated unigenes (absolute log2 fold change > 1 and false discovery rate petunia. Several putative ubiquitin ligases were up-regulated at the protein and transcription levels. Our results showed that the global proteome and ubiquitylome were negatively correlated and that ubiquitination could be involved in the degradation of proteins during ethylene-mediated corolla senescence in petunia. Ethylene regulates hormone signaling transduction pathways at both the protein and ubiquitination levels in petunia corollas. In addition, our results revealed that ethylene increases the ubiquitination levels of proteins involved in endoplasmic reticulum-associated degradation. PMID:27810942

  5. Stressing the ubiquitin-proteasome system without 20S proteolytic inhibition selectively kills cervical cancer cells.

    Directory of Open Access Journals (Sweden)

    Ravi K Anchoori

    Full Text Available Cervical cancer cells exhibit an increased requirement for ubiquitin-dependent protein degradation associated with an elevated metabolic turnover rate, and for specific signaling pathways, notably HPV E6-targeted degradation of p53 and PDZ proteins. Natural compounds with antioxidant properties including flavonoids and triterpenoids hold promise as anticancer agents by interfering with ubiquitin-dependent protein degradation. An increasing body of evidence indicates that their α-β unsaturated carbonyl system is the molecular determinant for inhibition of ubiquitin-mediated protein degradation up-stream of the catalytic sites of the 20S proteasome. Herein we report the identification and characterization of a new class of chalcone-based, potent and cell permeable chemical inhibitors of ubiquitin-dependent protein degradation, and a lead compound RAMB1. RAMB1 inhibits ubiquitin-dependent protein degradation without compromising the catalytic activities of the 20S proteasome, a mechanism distinct from that of Bortezomib. Treatment of cervical cancer cells with RAMB1 triggers unfolded protein responses, including aggresome formation and Hsp90 stabilization, and increases p53 steady state levels. RAMB1 treatment results in activation of lysosomal-dependent degradation pathways as a mechanism to compensate for increasing levels of poly-ubiquitin enriched toxic aggregates. Importantly, RAMB1 synergistically triggers cell death of cervical cancer cells when combined with the lysosome inhibitor Chloroquine.

  6. Bacterial Effectors and Their Functions in the Ubiquitin-Proteasome System: Insight from the Modes of Substrate Recognition

    Directory of Open Access Journals (Sweden)

    Minsoo Kim


    Full Text Available Protein ubiquitination plays indispensable roles in the regulation of cell homeostasis and pathogenesis of neoplastic, infectious, and neurodegenerative diseases. Given the importance of this modification, it is to be expected that several pathogenic bacteria have developed the ability to utilize the host ubiquitin system for their own benefit. Modulation of the host ubiquitin system by bacterial effector proteins inhibits innate immune responses and hijacks central signaling pathways. Bacterial effectors mimic enzymes of the host ubiquitin system, but may or may not be structurally similar to the mammalian enzymes. Other effectors bind and modify components of the host ubiquitin system, and some are themselves subject to ubiquitination. This review will describe recent findings, based on structural analyses, regarding how pathogens use post-translational modifications of proteins to establish an infection.

  7. Bacterial effectors and their functions in the ubiquitin-proteasome system: insight from the modes of substrate recognition. (United States)

    Kim, Minsoo; Otsubo, Ryota; Morikawa, Hanako; Nishide, Akira; Takagi, Kenji; Sasakawa, Chihiro; Mizushima, Tsunehiro


    Protein ubiquitination plays indispensable roles in the regulation of cell homeostasis and pathogenesis of neoplastic, infectious, and neurodegenerative diseases. Given the importance of this modification, it is to be expected that several pathogenic bacteria have developed the ability to utilize the host ubiquitin system for their own benefit. Modulation of the host ubiquitin system by bacterial effector proteins inhibits innate immune responses and hijacks central signaling pathways. Bacterial effectors mimic enzymes of the host ubiquitin system, but may or may not be structurally similar to the mammalian enzymes. Other effectors bind and modify components of the host ubiquitin system, and some are themselves subject to ubiquitination. This review will describe recent findings, based on structural analyses, regarding how pathogens use post-translational modifications of proteins to establish an infection.

  8. Mechanism of Ubiquitination and Deubiquitination in the Fanconi Anemia Pathway. (United States)

    van Twest, Sylvie; Murphy, Vincent J; Hodson, Charlotte; Tan, Winnie; Swuec, Paolo; O'Rourke, Julienne J; Heierhorst, Jörg; Crismani, Wayne; Deans, Andrew J


    Monoubiquitination and deubiquitination of FANCD2:FANCI heterodimer is central to DNA repair in a pathway that is defective in the cancer predisposition syndrome Fanconi anemia (FA). The "FA core complex" contains the RING-E3 ligase FANCL and seven other essential proteins that are mutated in various FA subtypes. Here, we purified recombinant FA core complex to reveal the function of these other proteins. The complex contains two spatially separate FANCL molecules that are dimerized by FANCB and FAAP100. FANCC and FANCE act as substrate receptors and restrict monoubiquitination to the FANCD2:FANCI heterodimer in only a DNA-bound form. FANCA and FANCG are dispensable for maximal in vitro ubiquitination. Finally, we show that the reversal of this reaction by the USP1:UAF1 deubiquitinase only occurs when DNA is disengaged. Our work reveals the mechanistic basis for temporal and spatial control of FANCD2:FANCI monoubiquitination that is critical for chemotherapy responses and prevention of Fanconi anemia. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Interactions Controlling the Slow Dynamic Conformational Motions of Ubiquitin

    Directory of Open Access Journals (Sweden)

    Soichiro Kitazawa


    Full Text Available Rational mutation of proteins based on their structural and dynamic characteristics is a useful strategy for amplifying specific fluctuations in proteins. Here, we show the effects of mutation on the conformational fluctuations and thermodynamic stability of ubiquitin. In particular, we focus on the salt bridge between K11 and E34 and the hydrogen bond between I36 and Q41, which are predicted to control the fluctuation between the basic folded state, N1, and the alternatively folded state, N2, of the protein, using high-pressure NMR spectroscopy. The E34A mutation, which disrupts the salt bridge, did not alter picosecond–to–nanosecond, microsecond–to–millisecond dynamic motions, and stability of the protein, while the Q41N mutation, which destabilizes the hydrogen bond, specifically amplified the N1–N2 conformational fluctuation and decreased stability. Based on the observed thermodynamic stabilities of the various conformational states, we showed that in the Q41N mutant, the N1 state is more significantly destabilized than the N2 state, resulting in an increase in the relative population of N2. Identifying the interactions controlling specific motions of a protein will facilitate molecular design to achieve functional dynamics beyond native state dynamics.

  10. The functional interplay between the HIF pathway and the ubiquitin system - more than a one-way road. (United States)

    Günter, Julia; Ruiz-Serrano, Amalia; Pickel, Christina; Wenger, Roland H; Scholz, Carsten C


    The hypoxia inducible factor (HIF) pathway and the ubiquitin system represent major cellular processes that are involved in the regulation of a plethora of cellular signaling pathways and tissue functions. The ubiquitin system controls the ubiquitination of proteins, which is the covalent linkage of one or several ubiquitin molecules to specific targets. This ubiquitination is catalyzed by approximately 1000 different E3 ubiquitin ligases and can lead to different effects, depending on the type of internal ubiquitin chain linkage. The best-studied function is the targeting of proteins for proteasomal degradation. The activity of E3 ligases is antagonized by proteins called deubiquitinases (or deubiquitinating enzymes), which negatively regulate ubiquitin chains. This is performed in most cases by the catalytic removal of these chains from the targeted protein. The HIF pathway is regulated in an oxygen-dependent manner by oxygen-sensing hydroxylases. Covalent modification of HIFα subunits leads to the recruitment of an E3 ligase complex via the von Hippel-Lindau (VHL) protein and the subsequent polyubiquitination and proteasomal degradation of HIFα subunits, demonstrating the regulation of the HIF pathway by the ubiquitin system. This unidirectional effect of an E3 ligase on the HIF pathway is the best-studied example for the interplay between these two important cellular processes. However, additional regulatory mechanisms of the HIF pathway through the ubiquitin system are emerging and, more recently, also the reciprocal regulation of the ubiquitin system through components of the HIF pathway. Understanding these mechanisms and their relevance for the activity of each other is of major importance for the comprehensive elucidation of the oxygen-dependent regulation of cellular processes. This review describes the current knowledge of the functional bidirectional interplay between the HIF pathway and the ubiquitin system on the protein level. Copyright © 2017

  11. Rates of ubiquitin conjugation increase when muscles atrophy, largely through activation of the N-end rule pathway (United States)

    Solomon, V.; Baracos, V.; Sarraf, P.; Goldberg, A. L.


    The rapid loss of muscle mass that accompanies many disease states, such as cancer or sepsis, is primarily a result of increased protein breakdown in muscle, and several observations have suggested an activation of the ubiquitin-proteasome system. Accordingly, in extracts of atrophying muscles from tumor-bearing or septic rats, rates of 125I-ubiquitin conjugation to endogenous proteins were found to be higher than in control extracts. On the other hand, in extracts of muscles from hypothyroid rats, where overall proteolysis is reduced below normal, the conjugation of 125I-ubiquitin to soluble proteins decreased by 50%, and treatment with triiodothyronine (T3) restored ubiquitination to control levels. Surprisingly, the N-end rule pathway, which selectively degrades proteins with basic or large hydrophobic N-terminal residues, was found to be responsible for most of these changes in ubiquitin conjugation. Competitive inhibitors of this pathway that specifically block the ubiquitin ligase, E3alpha, suppressed most of the increased ubiquitin conjugation in the muscle extracts from tumor-bearing and septic rats. These inhibitors also suppressed ubiquitination in normal extracts toward levels in hypothyroid extracts, which showed little E3alpha-dependent ubiquitination. Thus, the inhibitors eliminated most of the differences in ubiquitination under these different pathological conditions. Moreover, 125I-lysozyme, a model N-end rule substrate, was ubiquitinated more rapidly in extracts from tumor-bearing and septic rats, and more slowly in those from hypothyroid rats, than in controls. Thus, the rate of ubiquitin conjugation increases in atrophying muscles, and these hormone- and cytokine-dependent responses are in large part due to activation of the N-end rule pathway.

  12. Ubiquitin Carboxy-Terminal HydrolaseL3 Correlates with Human Sperm Count, Motility and Fertilization. (United States)

    Wang, Meijiao; Yu, Tinghe; Hu, Lina; Cheng, Zhi; Li, Min


    Ubiquitin C-terminal hydrolase L3 (UCHL3) belongs to the group of deubiquitinating enzymes and plays a part in apoptosis of germ cells and the differentiation of spermatocytes into spermatids. However, the exact role of UCHL3 in human spermatogenesis and sperm function remains unknown. Here we examined the level and activity of UCHL3 in spermatozoa from men with asthenozoospermia (A), oligoasthenozoospermia (OA) or normozoospermia (N). Immunofluorescence indicated that UCHL3 was mainly localized in the acrosome and throughout the flagella, and western blotting revealed a lower level in A or OA compared with N (p sperm count, concentration and motility. The UCHL3 level was positively correlated with the normal fertilization rate (FR) and percentage of embryos suitable for transfer/cryopreservation of in vitro fertilization (IVF). The UCHL3 activity was also positively correlated with FR, the percentage of embryos suitable for transfer/cryopreservation and high-quality embryos rate of IVF. Aforementioned correlations were not manifested in intra-cytoplasmic sperm injection (ICSI). These findings suggest that UCHL3 may play a role in male infertility.

  13. Unraveling the biochemistry and provenance of pupylation: a prokaryotic analog of ubiquitination

    Directory of Open Access Journals (Sweden)

    Aravind L


    Full Text Available Abstract Recently Mycobacterium tuberculosis was shown to possess a novel protein modification, in which a small protein Pup is conjugated to the epsilon-amino groups of lysines in target proteins. Analogous to ubiquitin modification in eukaryotes, this remarkable modification recruits proteins for degradation via archaeal-type proteasomes found in mycobacteria and allied actinobacteria. While a mycobacterial protein named PafA was found to be required for this conjugation reaction, its biochemical mechanism has not been elucidated. Using sensitive sequence profile comparison methods we establish that the PafA family proteins are related to the γ-glutamyl-cysteine synthetase and glutamine synthetase. Hence, we predict that PafA is the Pup ligase, which catalyzes the ATP-dependent ligation of the terminal γ-carboxylate of glutamate to lysines, similar to the above enzymes. We further discovered that an ortholog of the eukaryotic PAC2 (e.g. cg2106 is often present in the vicinity of the actinobacterial Pup-proteasome gene neighborhoods and is likely to represent the ancestral proteasomal chaperone. Pup-conjugation is sporadically present outside the actinobacteria in certain lineages, such as verrucomicrobia, nitrospirae, deltaproteobacteria and planctomycetes, and in the latter two lineages it might modify membrane proteins. Reviewers This article was reviewed by M. Madan Babu and Andrei Osterman

  14. Construction and functional characterization of double and triple mutants of parallel beta-bulge of ubiquitin. (United States)

    Sharma, Mrinal; Prabha, C Ratna


    Ubiquitin, a small eukaryotic protein serving as a post-translational modification on many important proteins, plays central role in cellular homeostasis and cell cycle regulation. Ubiquitin features two beta-bulges, the second beta-bulge, located at the C-terminal region of the protein along with type II turn, holds 3 residues Glu64(1), Ser65(2) and Gln2(X). Percent frequency of occurrence of such a sequence in parallel beta-bulge is very low. However, the sequence and structure have been conserved in ubiquitin through out the evolution. Present study involves replacement of residues in unusual beta-bulge of ubiquitin by introducing mutations in combination through site directed mutagenesis, generating double and triple mutants and their functional characterization. Mutant ubiquitins cloned in yeast expression vector YEp96 tested for growth profile, viability assay and heat stress complementation study have revealed significant decrease in growth rate, loss of viability and non-complementation of heat sensitive phenotype with UbE64G-S65D and UbQ2N-E64G-S65D mutations. However, UbQ2N-S65D did not show any negative effects in the above assays. Present results show that, replacement of residues in beta-bulge of ubiquitin exerts severe effects on growth and viability in Saccharomyces cerevisiae due to functional failure of the mutant ubiquitins UbE64G-S65D and UbQ2N-E64G-S65D.

  15. The Ubiquitin-Proteasome System and Microvascular Complications of Diabetes

    Directory of Open Access Journals (Sweden)

    Saeed Yadranji Aghdam


    Full Text Available The ubiquitin-proteasome system (UPS is the mainstay of protein quality control which regulates cell cycle, differentiation and various signal transduction pathways in eukaryotic cells. The timely and selective degradation of surplus and/or aberrant proteins by the UPS is essential for normal cellular physiology. Any disturbance, delay or exaggeration in the process of selection, sequestration, labeling for degradation and degradation of target proteins by the UPS will compromise cellular and tissue homeostasis. High blood glucose or hyperglycemia caused by diabetes disrupts normal vascular function in several target organs including the retina and kidney resulting in the development of diabetic retinopathy (DR and diabetic nephropathy (DN. We and others have shown that hyperglycemia and oxidative stress modulate UPS activity in the retina and kidney. The majority of studies have focused on the kidney and provided insights into the contribution of dysregulated UPS to microvascular damage in DN. The eye is a unique organ in which a semi-fluid medium, the vitreous humor, separates the neural retina and its anastomosed blood vessels from the semi-solid lens tissue. The complexity of the cellular and molecular components of the eye may require a normal functioning and well tuned UPS for healthy vision. Altered UPS activity may contribute to the development of retinal microvascular complications of diabetes. A better understanding of the molecular nature of the ocular UPS function under normal and diabetic conditions is essential for development of novel strategies targeting its activity. This review will discuss the association of retinal vascular cell UPS activity with microvascular damage in DR with emphasis on alterations of the PA28 subunits of the UPS.

  16. Behavioral Characteristics of Ubiquitin-Specific Peptidase 46-Deficient Mice (United States)

    Imai, Saki; Kano, Makoto; Nonoyama, Keiko; Ebihara, Shizufumi


    We have previously identified Usp46, which encodes for ubiquitin-specific peptidase 46, as a quantitative trait gene affecting the immobility time of mice in the tail suspension test (TST) and forced swimming test. The mutation that we identified was a 3-bp deletion coding for lysine (Lys 92), and mice with this mutation (MT mice), as well as Usp46 KO mice exhibited shorter TST immobility times. Behavioral pharmacology suggests that the gamma aminobutyric acid A (GABAA) receptor is involved in regulating TST immobility time. In order to understand how far Usp46 controls behavioral phenotypes, which could be related to mental disorders in humans, we subjected Usp46 MT and KO mice to multiple behavioral tests, including the open field test, ethanol preference test, ethanol-induced loss of righting reflex test, sucrose preference test, novelty-suppressed feeding test, marble burying test, and novel object recognition test. Although behavioral phenotypes of the Usp46 MT and KO mice were not always identical, deficiency of Usp46 significantly affected performance in all these tests. In the open field test, activity levels were lower in Usp46 KO mice than wild type (WT) or MT mice. Both MT and KO mice showed lower ethanol preference and shorter recovery times after ethanol administration. Compared to WT mice, Usp46 MT and KO mice exhibited decreased sucrose preference, took longer latency periods to bite pellets, and buried more marbles in the sucrose preference test, novelty-suppressed feeding test, and marble burying test, respectively. In the novel object recognition test, neither MT nor KO mice showed an increase in exploration of a new object 24 hours after training. These findings indicate that Usp46 regulates a wide range of behavioral phenotypes that might be related to human mental disorders and provides insight into the function of USP46 deubiquitinating enzyme in the neural system. PMID:23472206

  17. Behavioral characteristics of ubiquitin-specific peptidase 46-deficient mice.

    Directory of Open Access Journals (Sweden)

    Saki Imai

    Full Text Available We have previously identified Usp46, which encodes for ubiquitin-specific peptidase 46, as a quantitative trait gene affecting the immobility time of mice in the tail suspension test (TST and forced swimming test. The mutation that we identified was a 3-bp deletion coding for lysine (Lys 92, and mice with this mutation (MT mice, as well as Usp46 KO mice exhibited shorter TST immobility times. Behavioral pharmacology suggests that the gamma aminobutyric acid A (GABAA receptor is involved in regulating TST immobility time. In order to understand how far Usp46 controls behavioral phenotypes, which could be related to mental disorders in humans, we subjected Usp46 MT and KO mice to multiple behavioral tests, including the open field test, ethanol preference test, ethanol-induced loss of righting reflex test, sucrose preference test, novelty-suppressed feeding test, marble burying test, and novel object recognition test. Although behavioral phenotypes of the Usp46 MT and KO mice were not always identical, deficiency of Usp46 significantly affected performance in all these tests. In the open field test, activity levels were lower in Usp46 KO mice than wild type (WT or MT mice. Both MT and KO mice showed lower ethanol preference and shorter recovery times after ethanol administration. Compared to WT mice, Usp46 MT and KO mice exhibited decreased sucrose preference, took longer latency periods to bite pellets, and buried more marbles in the sucrose preference test, novelty-suppressed feeding test, and marble burying test, respectively. In the novel object recognition test, neither MT nor KO mice showed an increase in exploration of a new object 24 hours after training. These findings indicate that Usp46 regulates a wide range of behavioral phenotypes that might be related to human mental disorders and provides insight into the function of USP46 deubiquitinating enzyme in the neural system.

  18. Entropy Transfer between Residue Pairs and Allostery in Proteins: Quantifying Allosteric Communication in Ubiquitin.

    Directory of Open Access Journals (Sweden)

    Aysima Hacisuleyman


    Full Text Available It has recently been proposed by Gunasakaran et al. that allostery may be an intrinsic property of all proteins. Here, we develop a computational method that can determine and quantify allosteric activity in any given protein. Based on Schreiber's transfer entropy formulation, our approach leads to an information transfer landscape for the protein that shows the presence of entropy sinks and sources and explains how pairs of residues communicate with each other using entropy transfer. The model can identify the residues that drive the fluctuations of others. We apply the model to Ubiquitin, whose allosteric activity has not been emphasized until recently, and show that there are indeed systematic pathways of entropy and information transfer between residues that correlate well with the activities of the protein. We use 600 nanosecond molecular dynamics trajectories for Ubiquitin and its complex with human polymerase iota and evaluate entropy transfer between all pairs of residues of Ubiquitin and quantify the binding susceptibility changes upon complex formation. We explain the complex formation propensities of Ubiquitin in terms of entropy transfer. Important residues taking part in allosteric communication in Ubiquitin predicted by our approach are in agreement with results of NMR relaxation dispersion experiments. Finally, we show that time delayed correlation of fluctuations of two interacting residues possesses an intrinsic causality that tells which residue controls the interaction and which one is controlled. Our work shows that time delayed correlations, entropy transfer and causality are the required new concepts for explaining allosteric communication in proteins.

  19. Entropy Transfer between Residue Pairs and Allostery in Proteins: Quantifying Allosteric Communication in Ubiquitin. (United States)

    Hacisuleyman, Aysima; Erman, Burak


    It has recently been proposed by Gunasakaran et al. that allostery may be an intrinsic property of all proteins. Here, we develop a computational method that can determine and quantify allosteric activity in any given protein. Based on Schreiber's transfer entropy formulation, our approach leads to an information transfer landscape for the protein that shows the presence of entropy sinks and sources and explains how pairs of residues communicate with each other using entropy transfer. The model can identify the residues that drive the fluctuations of others. We apply the model to Ubiquitin, whose allosteric activity has not been emphasized until recently, and show that there are indeed systematic pathways of entropy and information transfer between residues that correlate well with the activities of the protein. We use 600 nanosecond molecular dynamics trajectories for Ubiquitin and its complex with human polymerase iota and evaluate entropy transfer between all pairs of residues of Ubiquitin and quantify the binding susceptibility changes upon complex formation. We explain the complex formation propensities of Ubiquitin in terms of entropy transfer. Important residues taking part in allosteric communication in Ubiquitin predicted by our approach are in agreement with results of NMR relaxation dispersion experiments. Finally, we show that time delayed correlation of fluctuations of two interacting residues possesses an intrinsic causality that tells which residue controls the interaction and which one is controlled. Our work shows that time delayed correlations, entropy transfer and causality are the required new concepts for explaining allosteric communication in proteins.

  20. A central role for ubiquitination within a circadian clock protein modification code

    Directory of Open Access Journals (Sweden)

    Katarina eStojkovic


    Full Text Available Circadian rhythms, endogenous cycles of about 24 h in physiology, are generated by a master clock located in the suprachiasmatic nucleus of the hypothalamus and other clocks located in the brain and peripheral tissues. Circadian disruption is known to increase the incidence of various illnesses, such as mental disorders, metabolic syndrome and cancer. At the molecular level, periodicity is established by a set of clock genes via autoregulatory translation-transcription feedback loops. This clock mechanism is regulated by post-translational modifications such as phosphorylation and ubiquitination, which set the pace of the clock. Ubiquitination in particular has been found to regulate the stability of core clock components, but also other clock protein functions. Mutation of genes encoding ubiquitin ligases can cause either elongation or shortening of the endogenous circadian period. Recent research has also started to uncover roles for deubiquitination in the molecular clockwork. Here we review the role of the ubiquitin pathway in regulating the circadian clock and we propose that ubiquitination is a key element in a clock protein modification code that orchestrates clock mechanisms and circadian behavior over the daily cycle.

  1. Regulation of synaptic structure by ubiquitin C-terminal hydrolase L1. (United States)

    Cartier, Anna E; Djakovic, Stevan N; Salehi, Afshin; Wilson, Scott M; Masliah, Eliezer; Patrick, Gentry N


    Ubiquitin C-terminal hydrolase L1 (UCH-L1) is a deubiquitinating enzyme that is selectively and abundantly expressed in the brain, and its activity is required for normal synaptic function. Here, we show that UCH-L1 functions in maintaining normal synaptic structure in hippocampal neurons. We found that UCH-L1 activity is rapidly upregulated by NMDA receptor activation, which leads to an increase in the levels of free monomeric ubiquitin. Conversely, pharmacological inhibition of UCH-L1 significantly reduces monomeric ubiquitin levels and causes dramatic alterations in synaptic protein distribution and spine morphology. Inhibition of UCH-L1 activity increases spine size while decreasing spine density. Furthermore, there is a concomitant increase in the size of presynaptic and postsynaptic protein clusters. Interestingly, however, ectopic expression of ubiquitin restores normal synaptic structure in UCH-L1-inhibited neurons. These findings point to a significant role of UCH-L1 in synaptic remodeling, most likely by modulating free monomeric ubiquitin levels in an activity-dependent manner.

  2. Regulation of Synaptic Structure by the Ubiquitin C-terminal Hydrolase UCH-L1 (United States)

    Cartier, Anna E.; Djakovic, Stevan N.; Salehi, Afshin; Wilson, Scott M.; Masliah, Eliezer; Patrick, Gentry N.


    UCH-L1 is a de-ubiquitinating enzyme that is selectively and abundantly expressed in the brain, and its activity is required for normal synaptic function. Here, we show that UCH-L1 functions in maintaining normal synaptic structure in hippocampal neurons. We have found that UCH-L1 activity is rapidly up-regulated by NMDA receptor activation which leads to an increase in the levels of free monomeric ubiquitin. Conversely, pharmacological inhibition of UCH-L1 significantly reduces monomeric ubiquitin levels and causes dramatic alterations in synaptic protein distribution and spine morphology. Inhibition of UCH-L1 activity increases spine size while decreasing spine density. Furthermore, there is a concomitant increase in the size of pre and postsynaptic protein clusters. Interestingly, however, ectopic expression of ubiquitin restores normal synaptic structure in UCH-L1 inhibited neurons. These findings point to a significant role of UCH-L1 in synaptic remodeling most likely by modulating free monomeric ubiquitin levels in an activity-dependent manner. PMID:19535597

  3. PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}. (United States)

    Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi


    Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

  4. The linear ubiquitin assembly complex (LUBAC) is essential for NLRP3 inflammasome activation (United States)

    Rodgers, Mary A.; Bowman, James W.; Fujita, Hiroaki; Orazio, Nicole; Shi, Mude; Liang, Qiming; Amatya, Rina; Kelly, Thomas J.; Iwai, Kazuhiro; Ting, Jenny


    Linear ubiquitination is a newly discovered posttranslational modification that is currently restricted to a small number of known protein substrates. The linear ubiquitination assembly complex (LUBAC), consisting of HOIL-1L, HOIP, and Sharpin, has been reported to activate NF-κB–mediated transcription in response to receptor signaling by ligating linear ubiquitin chains to Nemo and Rip1. Despite recent advances, the detailed roles of LUBAC in immune cells remain elusive. We demonstrate a novel HOIL-1L function as an essential regulator of the activation of the NLRP3/ASC inflammasome in primary bone marrow–derived macrophages (BMDMs) independently of NF-κB activation. Mechanistically, HOIL-1L is required for assembly of the NLRP3/ASC inflammasome and the linear ubiquitination of ASC, which we identify as a novel LUBAC substrate. Consequently, we find that HOIL-1L−/− mice have reduced IL-1β secretion in response to in vivo NLRP3 stimulation and survive lethal challenge with LPS. Together, these data demonstrate that linear ubiquitination is required for NLRP3 inflammasome activation, defining the molecular events of NLRP3 inflammasome activation and expanding the role of LUBAC as an innate immune regulator. Furthermore, our observation is clinically relevant because patients lacking HOIL-1L expression suffer from pyogenic bacterial immunodeficiency, providing a potential new therapeutic target for enhancing inflammation in immunodeficient patients. PMID:24958845

  5. Dissecting the function of Cullin-RING ubiquitin ligase complex genes in planarian regeneration. (United States)

    Strand, Nicholas S; Allen, John M; Ghulam, Mahjoobah; Taylor, Matthew R; Munday, Roma K; Carrillo, Melissa; Movsesyan, Artem; Zayas, Ricardo M


    The ubiquitin system plays a role in nearly every aspect of eukaryotic cell biology. The enzymes responsible for transferring ubiquitin onto specific substrates are the E3 ubiquitin ligases, a large and diverse family of proteins, for which biological roles and target substrates remain largely undefined. Studies using model organisms indicate that ubiquitin signaling mediates key steps in developmental processes and tissue regeneration. Here, we used the freshwater planarian, Schmidtea mediterranea, to investigate the role of Cullin-RING ubiquitin ligase (CRL) complexes in stem cell regulation during regeneration. We identified six S. mediterranea cullin genes, and used RNAi to uncover roles for homologs of Cullin-1, -3 and -4 in planarian regeneration. The cullin-1 RNAi phenotype included defects in blastema formation, organ regeneration, lesions, and lysis. To further investigate the function of cullin-1-mediated cellular processes in planarians, we examined genes encoding the adaptor protein Skp1 and F-box substrate-recognition proteins that are predicted to partner with Cullin-1. RNAi against skp1 resulted in phenotypes similar to cullin-1 RNAi, and an RNAi screen of the F-box genes identified 19 genes that recapitulated aspects of cullin-1 RNAi, including ones that in mammals are involved in stem cell regulation and cancer biology. Our data provides evidence that CRLs play discrete roles in regenerative processes and provide a platform to investigate how CRLs regulate stem cells in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? (United States)

    Jagoe, R. T.; Goldberg, A. L.


    Studies of many different rodent models of muscle wasting have indicated that accelerated proteolysis via the ubiquitin-proteasome pathway is the principal cause of muscle atrophy induced by fasting, cancer cachexia, metabolic acidosis, denervation, disuse, diabetes, sepsis, burns, hyperthyroidism and excess glucocorticoids. However, our understanding about how muscle proteins are degraded, and how the ubiquitin-proteasome pathway is activated in muscle under these conditions, is still very limited. The identities of the important ubiquitin-protein ligases in skeletal muscle, and the ways in which they recognize substrates are still largely unknown. Recent in-vitro studies have suggested that one set of ubquitination enzymes, E2(14K) and E3(alpha), which are responsible for the 'N-end rule' system of ubiquitination, plays an important role in muscle, especially in catabolic states. However, their functional significance in degrading different muscle proteins is still unclear. This review focuses on the many gaps in our understanding of the functioning of the ubiquitin-proteasome pathway in muscle atrophy, and highlights the strengths and limitations of the different experimental approaches used in such studies.

  7. Polycomb Repressive Complex 2 Enacts Wnt Signaling in Intestinal Homeostasis and Contributes to the Instigation of Stemness in Diseases Entailing Epithelial Hyperplasia or Neoplasia. (United States)

    Oittinen, Mikko; Popp, Alina; Kurppa, Kalle; Lindfors, Katri; Mäki, Markku; Kaikkonen, Minna U; Viiri, Keijo


    Canonical Wnt/β-catenin signaling regulates the homeostasis of intestinal epithelium by controlling the balance between intestinal stem cell self-renewal and differentiation but epigenetic mechanisms enacting the process are not known. We hypothesized that epigenetic regulator, Polycomb Repressive Complex-2 (PRC2), is involved in Wnt-mediated epithelial homeostasis on the crypt-villus axis and aberrancies therein are implicated both in celiac disease and in intestinal malignancies. We found that PRC2 establishes repressive crypt and villus specific trimethylation of histone H3 lysine 27 (H3K27me3) signature on genes responsible for, for example, nutrient transport and cell killing in crypts and, for example, proliferation and differentiation in mature villi, suggesting that PRC2 facilitates the Wnt-governed intestinal homeostasis. When celiac patients are on gluten-containing diet PRC2 is out-of-bounds active and consequently its target genes were found affected in intestinal epithelium. Significant set of effective intestinal PRC2 targets are also differentially expressed in colorectal adenoma and carcinomas. Our results suggest that PRC2 gives rise and maintains polar crypt and villus specific H3K27me3 signatures. As H3K27me3 is a mark enriched in developmentally important genes, identified intestinal PRC2 targets are possibly imperative drivers for enterocyte differentiation and intestinal stem cell maintenance downstream to Wnt-signaling. Our work also elucidates the mechanism sustaining the crypt hyperplasia in celiac disease and suggest that PRC2-dependent fostering of epithelial stemness is a common attribute in intestinal diseases in which epithelial hyperplasia or neoplasia prevails. Finally, this work demonstrates that in intestine PRC2 represses genes having both pro-stemness and pro-differentiation functions, fact need to be considered when designing epigenetic therapies including PRC2 as a drug target. Stem Cells 2017;35:445-457. © 2016 Alpha

  8. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Directory of Open Access Journals (Sweden)

    Amanda Swain


    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  9. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle


    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  10. The E3 ubiquitin ligase RNF185 facilitates the cGAS-mediated innate immune response.

    Directory of Open Access Journals (Sweden)

    Qiang Wang


    Full Text Available The cyclic GMP-AMP synthase (cGAS, upon cytosolic DNA stimulation, catalyzes the formation of the second messenger 2'3'-cGAMP, which then binds to stimulator of interferon genes (STING and activates downstream signaling. It remains to be elucidated how the cGAS enzymatic activity is modulated dynamically. Here, we reported that the ER ubiquitin ligase RNF185 interacted with cGAS during HSV-1 infection. Ectopic-expression or knockdown of RNF185 respectively enhanced or impaired the IRF3-responsive gene expression. Mechanistically, RNF185 specifically catalyzed the K27-linked poly-ubiquitination of cGAS, which promoted its enzymatic activity. Additionally, Systemic Lupus Erythematosus (SLE patients displayed elevated expression of RNF185 mRNA. Collectively, this study uncovers RNF185 as the first E3 ubiquitin ligase of cGAS, shedding light on the regulation of cGAS activity in innate immune responses.

  11. Roles of Ubiquitination and SUMOylation on Prostate Cancer: Mechanisms and Clinical Implications

    Directory of Open Access Journals (Sweden)

    Zhenbang Chen


    Full Text Available The initiation and progression of human prostate cancer are highly associated with aberrant dysregulations of tumor suppressors and proto-oncogenes. Despite that deletions and mutations of tumor suppressors and aberrant elevations of oncogenes at the genetic level are reported to cause cancers, emerging evidence has revealed that cancer progression is largely regulated by posttranslational modifications (PTMs and epigenetic alterations. PTMs play critical roles in gene regulation, cellular functions, tissue development, diseases, malignant progression and drug resistance. Recent discoveries demonstrate that ubiquitination and SUMOylation are complicated but highly-regulated PTMs, and make essential contributions to diseases and cancers by regulation of key factors and signaling pathways. Ubiquitination and SUMOylation pathways can be differentially modulated under various stimuli or stresses in order to produce the sustained oncogenic potentials. In this review, we discuss some new insights about molecular mechanisms on ubiquitination and SUMOylation, their associations with diseases, oncogenic impact on prostate cancer (PCa and clinical implications for PCa treatment.

  12. Histone H1 couples initiation and amplification of ubiquitin signalling after DNA damage

    DEFF Research Database (Denmark)

    Thorslund, Tina; Ripplinger, Anita; Hoffmann, Saskia


    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions that trigger non-proteolytic ubiquitylation of adjacent chromatin areas to generate binding sites for DNA repair factors. This depends on the sequential actions of the E3 ubiquitin ligases RNF8 and RNF168 (refs 1-6), and UBC13 (also...... known as UBE2N), an E2 ubiquitin-conjugating enzyme that specifically generates K63-linked ubiquitin chains. Whereas RNF168 is known to catalyse ubiquitylation of H2A-type histones, leading to the recruitment of repair factors such as 53BP1 (refs 8-10), the critical substrates of RNF8 and K63-linked...

  13. Overexpression of the E2 ubiquitin-conjugating enzyme UbcH10 causes chromosome missegregation and tumor formation.

    NARCIS (Netherlands)

    Ree, J.H.; Jeganathan, K.B.; Malureanu, L.; Deursen, J.M.A. van


    The anaphase-promoting complex/cyclosome (APC/C) E3 ubiquitin ligase functions with the E2 ubiquitin-conjugating enzyme UbcH10 in the orderly progression through mitosis by marking key mitotic regulators for destruction by the 26-S proteasome. UbcH10 is overexpressed in many human cancer types and

  14. The Ubiquitin-Specific Protease 14 (USP14) Is a Critical Regulator of Long-Term Memory Formation (United States)

    Jarome, Timothy J.; Kwapis, Janine L.; Hallengren, Jada J.; Wilson, Scott M.; Helmstetter, Fred J.


    Numerous studies have suggested a role for ubiquitin-proteasome-mediated protein degradation in learning-dependent synaptic plasticity; however, very little is known about how protein degradation is regulated at the level of the proteasome during memory formation. The ubiquitin-specific protease 14 (USP14) is a proteasomal deubiquitinating enzyme…

  15. TRIM37 defective in mulibrey nanism is a novel RING finger ubiquitin E3 ligase

    International Nuclear Information System (INIS)

    Kallijaervi, Jukka; Lahtinen, Ulla; Haemaelaeinen, Riikka; Lipsanen-Nyman, Marita; Palvimo, Jorma J.; Lehesjoki, Anna-Elina


    Mulibrey nanism is an autosomal recessive prenatal-onset growth disorder characterized by dysmorphic features, cardiomyopathy, and hepatomegaly. Mutations in TRIM37 encoding a tripartite motif (TRIM, RING-B-box-coiled-coil)-family protein underlie mulibrey nanism. We investigated the ubiquitin ligase activity predicted for the RING domain of TRIM37 by analyzing its autoubiquitination. Full-length TRIM37 and its TRIM domain were highly polyubiquitinated when co-expressed with ubiquitin. Polyubiquitination was decreased in a mutant protein with disrupted RING domain (Cys35Ser;Cys36Ser) and in the Leu76Pro mutant protein, a disease-associated missense mutation affecting the TRIM domain of TRIM37. Bacterially produced GST-TRIM domain fusion protein, but not its Cys35Ser;Cys36Ser or Leu76Pro mutants, were polyubiquitinated in cell-free conditions, implying RING-dependent modification. Ubiquitin was also identified as an interaction partner for TRIM37 in a yeast two-hybrid screen. Ectopically expressed TRIM37 rapidly formed aggregates that were ubiquitin-, proteasome subunit-, and chaperone-positive in immunofluorescence analysis, defining them as aggresomes. The Cys35Ser;Cys36Ser mutant and the Leu76Pro and Gly322Val patient mutant proteins were markedly less prone to aggregation, implying that aggresomal targeting reflects a physiological function of TRIM37. These findings suggest that TRIM37 acts as a TRIM domain-dependent E3 ubiquitin ligase and imply defective ubiquitin-dependent degradation of an as-yet-unidentified target protein in the pathogenesis of mulibrey nanism

  16. Ubiquitination regulates MHC class II-peptide complex retention and degradation in dendritic cells


    Walseng, Even; Furuta, Kazuyuki; Bosch, Berta; Weih, Karis A.; Matsuki, Yohei; Bakke, Oddmund; Ishido, Satoshi; Roche, Paul A.


    The expression and turnover of MHC class II-peptide complexes (pMHC-II) on the surface of dendritic cells (DCs) is essential for their ability to activate CD4 T cells efficiently. The half-life of surface pMHC-II is significantly greater in activated (mature) DCs than in resting (immature) DCs, but the molecular mechanism leading to this difference remains unknown. We now show that ubiquitination of pMHC-II by the E3 ubiquitin ligase membrane-associated RING-CH 1 (March-I) regulates surface e...

  17. IFT20 modulates ciliary PDGFRα signaling by regulating the stability of Cbl E3 ubiquitin ligases

    DEFF Research Database (Denmark)

    Schmid, Fabian Marc; Schou, Kenneth Bødtker; Vilhelm, Martin Juel


    ciliogenesis, and ciliary localization of the receptor is required for its appropriate ligand-mediated activation by PDGF-AA. However, the mechanisms regulating sorting of PDGFRα and feedback inhibition of PDGFRα signaling at the cilium are unknown. Here, we provide evidence that intraflagellar transport...... protein 20 (IFT20) interacts with E3 ubiquitin ligases c-Cbl and Cbl-b and is required for Cbl-mediated ubiquitination and internalization of PDGFRα for feedback inhibition of receptor signaling. In wild-type cells treated with PDGF-AA, c-Cbl becomes enriched in the cilium, and the receptor...

  18. The E3 ubiquitin ligase RNF146 promotes colorectal cancer by activating the Wnt/β-catenin pathway via ubiquitination of Axin1. (United States)

    Shen, Jiangli; Yu, Zhaohui; Li, Na


    The E3 ubiquitin ligase ring finger protein 146 (RNF146) has been implicated in tumor development. However, the role and clinical significance of RNF146 in colorectal cancer (CRC) remain unknown. In this study, we reported for the first time that RNF146 was upregulated in CRC tissues as well as in cell lines. Further, RNF146 expression was independent prognostic factor for poor outcome of CRC patients. RNF146 knockdown in cell lines inhibited cell growth, promoted cell apoptosis in vitro and suppressed colorectal tumor growth in vivo. Mechanistic investigations revealed that RNF146 exerted oncogenic role through ubiquitination of Axin1 to activate β-catenin signalling. In addition, RNF146 expression was positively correlated with β-catenin expression in CRC tissues. Collectively, our data suggest that RNF146 might function as a oncogene in human CRC, and represent a promising prognostic factor and a valuable therapeutic target for CRC. Copyright © 2018. Published by Elsevier Inc.

  19. Distinct functional domains contribute to degradation of the low density lipoprotein receptor (LDLR) by the E3 ubiquitin ligase inducible Degrader of the LDLR (IDOL)

    NARCIS (Netherlands)

    Sorrentino, Vincenzo; Scheer, Lilith; Santos, Ana; Reits, Eric; Bleijlevens, Boris; Zelcer, Noam


    We recently identified the liver X receptor-regulated E3 ubiquitin ligase inducible degrader of the LDL receptor (IDOL) as a modulator of lipoprotein metabolism. Acting as an E3 ubiquitin ligase, IDOL triggers ubiquitination and subsequent degradation of the low density lipoprotein receptor (LDLR).

  20. DMPD: A pervasive role of ubiquitin conjugation in activation and termination ofIkappaB kinase pathways. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15809659 A pervasive role of ubiquitin conjugation in activation and termination of...csml) Show A pervasive role of ubiquitin conjugation in activation and termination ofIkappaB kinase pathways.... PubmedID 15809659 Title A pervasive role of ubiquitin conjugation in activation and termina

  1. A study on the functions of ubiquitin metabolic system related gene FBG2 in gastric cancer cell line

    Directory of Open Access Journals (Sweden)

    Wu Benyan


    Full Text Available Abstract Background FBG2 (F-BOX6 gene is an important member in ubiquitin metabolic system F-BOX family, and forms E3 complex with the other members in the family. But its role in gastric cancer is still not clear. In the present study, we intended to investigate the influence of FBG2 on the growth, proliferation, apoptosis, invasion and cell cycle of the gastric cancer line MKN45 and gastric cell line HFE145. Methods As a critical component of ubiquitin-protein ligase complex, FBG2 cDNA was subcloned into a constitutive vector PCDNA3.1 followed by transfection in MKN45 and HFE145 by using liposome. Then stable transfectants were selected and appraised. The apoptosis and cell cycles of these clones were analyzed by using flow cytometry. The growth and proliferation were analyzed by cell growth curves and colony-forming assay respectively. The invasion of these clones was tested by using cancer cell migration assay. The FBG2 stable expression clones(MKN-FBG2 and HFE-FBG2 and their control groups were detected and compared respectively. Results MKN-FBG2 grew faster than MKN45 and MKN-PC(MKN45 transfected with PCDNA3.1 vector. HFE-FBG2 grew faster than HFE145 and HFE-PC(HFE145 transfected with PCDNA3.1 vector. The cell counts of MKN-FBG2 in the forth, fifth, sixth and seventh days were significantly more than those of others (P Conclusion FBG2 can promote the growth and proliferation of gastric cancer cells and normal gastric cells. It can help tumor cell maintain malignant phenotype too. But it can have a negative influence on the apoptosis or the ability of invasion of gastric cancer cells.

  2. Feline immunodeficiency virus OrfA alters gene expression of splicing factors and proteasome-ubiquitination proteins

    International Nuclear Information System (INIS)

    Sundstrom, Magnus; Chatterji, Udayan; Schaffer, Lana; Rozieres, Sohela de; Elder, John H.


    Expression of the feline immunodeficiency virus (FIV) accessory protein OrfA (or Orf2) is critical for efficient viral replication in lymphocytes, both in vitro and in vivo. OrfA has been reported to exhibit functions in common with the human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV) accessory proteins Vpr and Tat, although the function of OrfA has not been fully explained. Here, we use microarray analysis to characterize how OrfA modulates the gene expression profile of T-lymphocytes. The primary IL-2-dependent T-cell line 104-C1 was transduced to express OrfA. Functional expression of OrfA was demonstrated by trans complementation of the OrfA-defective clone, FIV-34TF10. OrfA-expressing cells had a slightly reduced cell proliferation rate but did not exhibit any significant alteration in cell cycle distribution. Reverse-transcribed RNA from cells expressing green fluorescent protein (GFP) or GFP + OrfA were hybridized to Affymetrix HU133 Plus 2.0 microarray chips representing more than 47,000 genome-wide transcripts. By using two statistical approaches, 461 (Rank Products) and 277 (ANOVA) genes were identified as modulated by OrfA expression. The functional relevance of the differentially expressed genes was explored by Ingenuity Pathway Analysis. The analyses revealed alterations in genes critical for RNA post-transcriptional modifications and protein ubiquitination as the two most significant functional outcomes of OrfA expression. In these two groups, several subunits of the spliceosome, cellular splicing factors and family members of the proteasome-ubiquitination system were identified. These findings provide novel information on the versatile function of OrfA during FIV infection and indicate a fine-tuning mechanism of the cellular environment by OrfA to facilitate efficient FIV replication

  3. The study of fkbp and ubiquitin reveals interesting aspects of Artemia stress history. (United States)

    Maniatsi, Stefania; Farmaki, Theodora; Abatzopoulos, Theodore J


    Research on stress responses in animals has increased greatly during the last decades. Though most studies focus on the cellular and molecular bases of the stress response mechanisms, the ecological and evolutionary aspects of stress responses gain more and more interest. Here, we use species and parthenogenetic strains of the genus Artemia, an extremophile model organism, to study, for the first time, a protein well known for its chaperone activity and its involvement in stress responses. More specifically, transcription and protein accumulation of an FK506-Binding Protein (FKBP) homologue were investigated under heat and salt stresses. Additionally, the mRNA levels of ubiquitin, a heat-inducible protein related to the proteasomal pathway, were quantitated under these conditions. Biochemical and phylogenetic analyses showed that the studied FKBP orthologue is a typical representative of the family that clusters with other crustacean sequences. The expression was increased in both fkbp and ubiquitin genes after salt and heat stresses. However, our results in combination with the fact that Artemia species and parthenogenetic strains, selected for this study, exhibit different heat or salt tolerance provide useful hints about the evolutionary significance of FKBP and ubiquitin. Regarding FKBP, mRNA expression and protein accumulation seem to depend on the environmental conditions and the evolutionary history of each Artemia population while ubiquitin has a clear and more conserved role under heat shock. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Ubiquitination of Cdc20 by the APC occurs through an intramolecular mechanism (United States)

    Foe, Ian T.; Foster, Scott A.; Cheung, Stephanie K.; DeLuca, Steven Z.; Morgan, David O.; Toczyski, David P.


    SUMMARY Background Cells control progression through late mitosis by regulating Cdc20 and Cdh1, the two mitotic activators of the Anaphase Promoting Complex (APC). The control of Cdc20 protein levels during the cell cycle is not well understood. Results Here, we demonstrate that Cdc20 is degraded in budding yeast by multiple APC-dependent mechanisms. We find that the majority of Cdc20 turnover does not involve a second activator molecule, but instead depends on in cis Cdc20 autoubiquitination while it is bound to its activator-binding site on the APC core. Unlike in trans ubiquitination of Cdc20 substrates, the APC ubiquitinates Cdc20 independent of APC activation by Cdc20’s C-box. Cdc20 turnover by this intramolecular mechanism is cell cycle-regulated, contributing to the decline in Cdc20 levels that occurs after anaphase. Interestingly, high substrate levels in vitro significantly reduce Cdc20 autoubiquitination. Conclusion We show here that Cdc20 fluctuates through the cell cycle via a distinct form of APC-mediated ubiquitination. This in cis autoubiquitination may preferentially occur in early anaphase, following depletion of Cdc20 substrates. This suggests that distinct mechanisms are able to target Cdc20 for ubiquitination at different points during the cell cycle. PMID:22079111

  5. Rictor forms a complex with Cullin-1 to promote SGK1 ubiquitination and destruction (United States)

    Gao, Daming; Wan, Lixin; Inuzuka, Hiroyuki; Berg, Anders H.; Tseng, Alan; Zhai, Bo; Shaik, Shavali; Bennett, Eric; Tron, Adriana E.; Gasser, Jessica A.; Lau, Alan; Gygi, Steven; Harper, J. Wade; DeCaprio, James A.; Toker, Alex; Wei, Wenyi


    Summary The Rictor/mTOR complex (also known as mTORC2) plays a critical role in cellular homeostasis by phosphorylating AGC kinases such as Akt and SGK at their hydrophobic motifs to activate downstream signaling. However, the regulation of mTORC2 and whether it has additional function(s), remains largely unknown. Here we report that Rictor associates with Cullin-1 to form a functional E3 ubiquitin ligase. Rictor, but not Raptor or mTOR alone promotes SGK1 ubiquitination. Loss of Rictor/Cullin-1-mediated ubiquitination leads to increased SGK1 protein levels as detected in Rictor null cells. Moreover, as part of a feedback mechanism, phosphorylation of Rictor at T1135 by multiple AGC kinases disrupts the interaction between Rictor and Cullin-1 to impair SGK1 ubiquitination. These findings indicate that the Rictor/Cullin-1 E3 ligase activity is regulated by a specific signal relay cascade and that misregulation of this mechanism may contribute to the frequent overexpression of SGK1 in various human cancers. PMID:20832730

  6. ERK5 signaling gets XIAPed: a role for ubiquitin in the disassembly of a MAPK cascade (United States)

    Klein, Aileen M; Cobb, Melanie H


    Mitogen-activated protein kinase (MAPK) cascades are tightly controlled through a series of well-characterized phospho-regulatory events. In this issue, Takeda et al (2014) identify the inhibitor of apoptosis protein, XIAP, as a key regulator of ERK5 activation via uncoupling of upstream kinase activity by non-degradative ubiquitination. PMID:25012518

  7. HSV-1 ICP0: An E3 Ubiquitin Ligase That Counteracts Host Intrinsic and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Mirna Perusina Lanfranca


    Full Text Available The herpes simplex virus type 1 (HSV-1 encoded E3 ubiquitin ligase, infected cell protein 0 (ICP0, is required for efficient lytic viral replication and regulates the switch between the lytic and latent states of HSV-1. As an E3 ubiquitin ligase, ICP0 directs the proteasomal degradation of several cellular targets, allowing the virus to counteract different cellular intrinsic and innate immune responses. In this review, we will focus on how ICP0’s E3 ubiquitin ligase activity inactivates the host intrinsic defenses, such as nuclear domain 10 (ND10, SUMO, and the DNA damage response to HSV-1 infection. In addition, we will examine ICP0’s capacity to impair the activation of interferon (innate regulatory mediators that include IFI16 (IFN γ-inducible protein 16, MyD88 (myeloid differentiation factor 88, and Mal (MyD88 adaptor-like protein. We will also consider how ICP0 allows HSV-1 to evade activation of the NF-κB (nuclear factor kappa B inflammatory signaling pathway. Finally, ICP0’s paradoxical relationship with USP7 (ubiquitin specific protease 7 and its roles in intrinsic and innate immune responses to HSV-1 infection will be discussed.

  8. Interplay between Ubiquitin, SUMO, and Poly(ADP-Ribose) in the Cellular Response to Genotoxic Stress (United States)

    Pellegrino, Stefania; Altmeyer, Matthias


    Cells employ a complex network of molecular pathways to cope with endogenous and exogenous genotoxic stress. This multilayered response ensures that genomic lesions are efficiently detected and faithfully repaired in order to safeguard genome integrity. The molecular choreography at sites of DNA damage relies heavily on post-translational modifications (PTMs). Protein modifications with ubiquitin and the small ubiquitin-like modifier SUMO have recently emerged as important regulatory means to coordinate DNA damage signaling and repair. Both ubiquitylation and SUMOylation can lead to extensive chain-like protein modifications, a feature that is shared with yet another DNA damage-induced PTM, the modification of proteins with poly(ADP-ribose) (PAR). Chains of ubiquitin, SUMO, and PAR all contribute to the multi-protein assemblies found at sites of DNA damage and regulate their spatio-temporal dynamics. Here, we review recent advancements in our understanding of how ubiquitin, SUMO, and PAR coordinate the DNA damage response and highlight emerging examples of an intricate interplay between these chain-like modifications during the cellular response to genotoxic stress. PMID:27148359

  9. The APC/C Ubiquitin Ligase: From Cell Biology to Tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Penas, Clara; Ramachandran, Vimal [John P. Hussman Institute for Human Genomics, University of Miami Miller School of Medicine, Miami, FL (United States); Ayad, Nagi George, E-mail: [John P. Hussman Institute for Human Genomics, University of Miami Miller School of Medicine, Miami, FL (United States); Department of Psychiatry and Behavioral Sciences, University of Miami Miller School of Medicine, Miami, FL (United States)


    The ubiquitin proteasome system (UPS) is required for normal cell proliferation, vertebrate development, and cancer cell transformation. The UPS consists of multiple proteins that work in concert to target a protein for degradation via the 26S proteasome. Chains of an 8.5-kDa protein called ubiquitin are attached to substrates, thus allowing recognition by the 26S proteasome. Enzymes called ubiquitin ligases or E3s mediate specific attachment to substrates. Although there are over 600 different ubiquitin ligases, the Skp1–Cullin–F-box (SCF) complexes and the anaphase promoting complex/cyclosome (APC/C) are the most studied. SCF involvement in cancer has been known for some time while APC/C’s cancer role has recently emerged. In this review we will discuss the importance of APC/C to normal cell proliferation and development, underscoring its possible contribution to transformation. We will also examine the hypothesis that modulating a specific interaction of the APC/C may be therapeutically attractive in specific cancer subtypes. Finally, given that the APC/C pathway is relatively new as a cancer target, therapeutic interventions affecting APC/C activity may be beneficial in cancers that are resistant to classical chemotherapy.

  10. Plant Virus Infection and the Ubiquitin Proteasome Machinery: Arms Race along the Endoplasmic Reticulum. (United States)

    Verchot, Jeanmarie


    The endoplasmic reticulum (ER) is central to plant virus replication, translation, maturation, and egress. Ubiquitin modification of ER associated cellular and viral proteins, alongside the actions of the 26S proteasome, are vital for the regulation of infection. Viruses can arrogate ER associated ubiquitination as well as cytosolic ubiquitin ligases with the purpose of directing the ubiquitin proteasome system (UPS) to new targets. Such targets include necessary modification of viral proteins which may stabilize certain complexes, or modification of Argonaute to suppress gene silencing. The UPS machinery also contributes to the regulation of effector triggered immunity pattern recognition receptor immunity. Combining the results of unrelated studies, many positive strand RNA plant viruses appear to interact with cytosolic Ub-ligases to provide novel avenues for controlling the deleterious consequences of disease. Viral interactions with the UPS serve to regulate virus infection in a manner that promotes replication and movement, but also modulates the levels of RNA accumulation to ensure successful biotrophic interactions. In other instances, the UPS plays a central role in cellular immunity. These opposing roles are made evident by contrasting studies where knockout mutations in the UPS can either hamper viruses or lead to more aggressive diseases. Understanding how viruses manipulate ER associated post-translational machineries to better manage virus-host interactions will provide new targets for crop improvement.

  11. Plant Virus Infection and the Ubiquitin Proteasome Machinery: Arms Race along the Endoplasmic Reticulum

    Directory of Open Access Journals (Sweden)

    Jeanmarie Verchot


    Full Text Available The endoplasmic reticulum (ER is central to plant virus replication, translation, maturation, and egress. Ubiquitin modification of ER associated cellular and viral proteins, alongside the actions of the 26S proteasome, are vital for the regulation of infection. Viruses can arrogate ER associated ubiquitination as well as cytosolic ubiquitin ligases with the purpose of directing the ubiquitin proteasome system (UPS to new targets. Such targets include necessary modification of viral proteins which may stabilize certain complexes, or modification of Argonaute to suppress gene silencing. The UPS machinery also contributes to the regulation of effector triggered immunity pattern recognition receptor immunity. Combining the results of unrelated studies, many positive strand RNA plant viruses appear to interact with cytosolic Ub-ligases to provide novel avenues for controlling the deleterious consequences of disease. Viral interactions with the UPS serve to regulate virus infection in a manner that promotes replication and movement, but also modulates the levels of RNA accumulation to ensure successful biotrophic interactions. In other instances, the UPS plays a central role in cellular immunity. These opposing roles are made evident by contrasting studies where knockout mutations in the UPS can either hamper viruses or lead to more aggressive diseases. Understanding how viruses manipulate ER associated post-translational machineries to better manage virus–host interactions will provide new targets for crop improvement.

  12. Inhibition of Ubc13-mediated Ubiquitination by GPS2 Regulates Multiple Stages of B Cell Development. (United States)

    Lentucci, Claudia; Belkina, Anna C; Cederquist, Carly T; Chan, Michelle; Johnson, Holly E; Prasad, Sherry; Lopacinski, Amanda; Nikolajczyk, Barbara S; Monti, Stefano; Snyder-Cappione, Jennifer; Tanasa, Bogdan; Cardamone, M Dafne; Perissi, Valentina


    Non-proteolytic ubiquitin signaling mediated by Lys 63 ubiquitin chains plays a critical role in multiple pathways that are key to the development and activation of immune cells. Our previous work indicates that GPS2 (G-protein Pathway Suppressor 2) is a multifunctional protein regulating TNFα signaling and lipid metabolism in the adipose tissue through modulation of Lys 63 ubiquitination events. However, the full extent of GPS2-mediated regulation of ubiquitination and the underlying molecular mechanisms are unknown. Here, we report that GPS2 is required for restricting the activation of TLR and BCR signaling pathways and the AKT/FOXO1 pathway in immune cells based on direct inhibition of Ubc13 enzymatic activity. Relevance of this regulatory strategy is confirmed in vivo by B cell-targeted deletion of GPS2, resulting in developmental defects at multiple stages of B cell differentiation. Together, these findings reveal that GPS2 genomic and non-genomic functions are critical for the development and cellular homeostasis of B cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Linear ubiquitination is involved in the pathogenesis of optineurin-associated amyotrophic lateral sclerosis (United States)

    Nakazawa, Seshiru; Oikawa, Daisuke; Ishii, Ryohei; Ayaki, Takashi; Takahashi, Hirotaka; Takeda, Hiroyuki; Ishitani, Ryuichiro; Kamei, Kiyoko; Takeyoshi, Izumi; Kawakami, Hideshi; Iwai, Kazuhiro; Hatada, Izuho; Sawasaki, Tatsuya; Ito, Hidefumi; Nureki, Osamu; Tokunaga, Fuminori


    Optineurin (OPTN) mutations cause neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and glaucoma. Although the ALS-associated E478G mutation in the UBAN domain of OPTN reportedly abolishes its NF-κB suppressive activity, the precise molecular basis in ALS pathogenesis still remains unclear. Here we report that the OPTN-UBAN domain is crucial for NF-κB suppression. Our crystal structure analysis reveals that OPTN-UBAN binds linear ubiquitin with homology to NEMO. TNF-α-mediated NF-κB activation is enhanced in OPTN-knockout cells, through increased ubiquitination and association of TNF receptor (TNFR) complex I components. Furthermore, OPTN binds caspase 8, and OPTN deficiency accelerates TNF-α-induced apoptosis by enhancing complex II formation. Immunohistochemical analyses of motor neurons from OPTN-associated ALS patients reveal that linear ubiquitin and activated NF-κB are partially co-localized with cytoplasmic inclusions, and that activation of caspases is elevated. Taken together, OPTN regulates both NF-κB activation and apoptosis via linear ubiquitin binding, and the loss of this ability may lead to ALS. PMID:27552911

  14. Level of ubiquitinated histone H2B in chromatin is coupled to ongoing transcription

    International Nuclear Information System (INIS)

    Davie, J.R.; Murphy, L.C.


    The relationship between transcription and ubiquitination of the histones was investigated. Previous studies have shown that ubiquitinated (u) histone H2B and, to a lesser extend, mono- and polyubiquitinated histone H2A are enriched in transcriptionally active gene-enriched chromatin fractions. Here, the authors show that treatment of T-47D-5 human breast cancer cells with actinomycin D or 5,6-dichloro-1-β-D-ribofuranosylbenzimidazole, inhibitors of heterogeneous nuclear RNA synthesis, selectively reduced the level of uH2B, but not uH2A, uH2A.Z, or polyubiquitinated H2A, in chromatin. Treatment of the cells with low levels of actinomycin D slightly reduced the level of uH2B, suggesting that inhibition of ribosomal RNA synthesis does not have a profound effect on the level of uH2B in chromatin. These results demonstrate that maintenance of the levels of uH2B in chromatin is dependent upon ongoing transcription, particularly the synthesis of hnRNA. Thus, histone H2B would be ubiquitinated when the nucleosome was opened during transcription. Ubiquitination of histone H2B may impede nucleosome refolding, facilitating subsequent rounds of transcription

  15. The APC/C Ubiquitin Ligase: From Cell Biology to Tumorigenesis

    International Nuclear Information System (INIS)

    Penas, Clara; Ramachandran, Vimal; Ayad, Nagi George


    The ubiquitin proteasome system (UPS) is required for normal cell proliferation, vertebrate development, and cancer cell transformation. The UPS consists of multiple proteins that work in concert to target a protein for degradation via the 26S proteasome. Chains of an 8.5-kDa protein called ubiquitin are attached to substrates, thus allowing recognition by the 26S proteasome. Enzymes called ubiquitin ligases or E3s mediate specific attachment to substrates. Although there are over 600 different ubiquitin ligases, the Skp1–Cullin–F-box (SCF) complexes and the anaphase promoting complex/cyclosome (APC/C) are the most studied. SCF involvement in cancer has been known for some time while APC/C’s cancer role has recently emerged. In this review we will discuss the importance of APC/C to normal cell proliferation and development, underscoring its possible contribution to transformation. We will also examine the hypothesis that modulating a specific interaction of the APC/C may be therapeutically attractive in specific cancer subtypes. Finally, given that the APC/C pathway is relatively new as a cancer target, therapeutic interventions affecting APC/C activity may be beneficial in cancers that are resistant to classical chemotherapy.

  16. Smad3 recruits the anaphase-promoting complex for ubiquitination and degradation of SnoN

    International Nuclear Information System (INIS)

    Stroschein, Shannon L.; Bonni, Shirin; Wrana, Jeffrey L.; Luo, Kunxin


    Smad proteins mediate transforming growth factor-b signaling to regulate cell growth and differentiation. SnoN is an important negative regulator of TGFb signaling that functions to maintain the repressed state of TGFb target genes in the absence of ligand. Upon TGFb stimulation, Smad3 and Smad2 translocate into the nucleus and induce a rapid degradation of SnoN, allowing activation of TGFb target genes. Here we show that Smad2- or Smad3-induced degradation of SnoN requires the ubiquitin-dependent proteasome and can be mediated by the anaphase promoting complex (APC) and the UbcH5 family of ubiquitin conjugating enzymes. Smad3 and to a lesser extent, Smad2, interact with both the APC and SnoN, resulting in the recruitment of the APC to SnoN and subsequent ubiquitination of SnoN in a destruction box-dependent manner. In addition to the destruction box, efficient degradation of SnoN also requires the Smad3 binding site in SnoN as well as key lysine residues necessary for ubiquitin attachment. Mutation of either the Smad3 binding site or lysine residues results in stabilization of SnoN and in enhanced antagonism of TGFb signaling. Our studies elucidate an important pathway for the degradation of SnoN and reveal a novel role of the APC in regulation of TGFb signaling

  17. Atomic structure of the APC/C and its mechanism of protein ubiquitination (United States)

    Yang, Jing; McLaughlin, Stephen H.; Barford, David


    The anaphase-promoting complex (APC/C) is a multimeric RING E3 ubiquitin ligase that controls chromosome segregation and mitotic exit. Its regulation by coactivator subunits, phosphorylation, the mitotic checkpoint complex, and interphase inhibitor Emi1 ensures the correct order and timing of distinct cell cycle transitions. Here, we used cryo-electron microscopy to determine atomic structures of APC/C-coactivator complexes with either Emi1 or a UbcH10-ubiquitin conjugate. These structures define the architecture of all APC/C subunits, the position of the catalytic module, and explain how Emi1 mediates inhibition of the two E2s UbcH10 and Ube2S. Definition of Cdh1 interactions with the APC/C indicates how they are antagonized by Cdh1 phosphorylation. The structure of the APC/C with UbcH10-ubiquitin reveals insights into the initiating ubiquitination reaction. Our results provide a quantitative framework for the design of experiments to further investigate APC/C functions in vivo. PMID:26083744

  18. The APC/C Ubiquitin Ligase: From Cell Biology to Tumorigenesis (United States)

    Penas, Clara; Ramachandran, Vimal; Ayad, Nagi George


    The ubiquitin proteasome system (UPS) is required for normal cell proliferation, vertebrate development, and cancer cell transformation. The UPS consists of multiple proteins that work in concert to target a protein for degradation via the 26S proteasome. Chains of an 8.5-kDa protein called ubiquitin are attached to substrates, thus allowing recognition by the 26S proteasome. Enzymes called ubiquitin ligases or E3s mediate specific attachment to substrates. Although there are over 600 different ubiquitin ligases, the Skp1–Cullin–F-box (SCF) complexes and the anaphase promoting complex/cyclosome (APC/C) are the most studied. SCF involvement in cancer has been known for some time while APC/C’s cancer role has recently emerged. In this review we will discuss the importance of APC/C to normal cell proliferation and development, underscoring its possible contribution to transformation. We will also examine the hypothesis that modulating a specific interaction of the APC/C may be therapeutically attractive in specific cancer subtypes. Finally, given that the APC/C pathway is relatively new as a cancer target, therapeutic interventions affecting APC/C activity may be beneficial in cancers that are resistant to classical chemotherapy. PMID:22655255

  19. Ubiquitin-SUMO Circuitry Controls Activated Fanconi Anemia ID Complex Dosage in Response to DNA Damage

    DEFF Research Database (Denmark)

    Gibbs-Seymour, Ian; Oka, Yasuyoshi; Rajendra, Eeson


    We show that central components of the Fanconi anemia (FA) DNA repair pathway, the tumor suppressor proteins FANCI and FANCD2 (the ID complex), are SUMOylated in response to replication fork stalling. The ID complex is SUMOylated in a manner that depends on the ATR kinase, the FA ubiquitin ligase...

  20. TDP-43 in Familial and Sporadic Frontotemporal Lobar Degeneration with Ubiquitin Inclusions

    NARCIS (Netherlands)

    Cairns, Nigel J.; Neumann, Manuela; Bigio, Eileen H.; Holm, Ida E.; Troost, Dirk; Hatanpaa, Kimmo J.; Foong, Chan; White, Charles L.; Schneider, Julie A.; Kretzschmar, Hans A.; Carter, Deborah; Taylor-Reinwald, Lisa; Paulsmeyer, Katherine; Strider, Jeffrey; Gitcho, Michael; Goate, Alison M.; Morris, John C.; Mishrall, Manjari; Kwong, Linda K.; Stieber, Anna; Xu, Yan; Forman, Mark S.; Trojanowski, John Q.; Lee, Virginia M.-Y.; Mackenzie, Ian R. A.


    TAR DNA-binding protein 43 (TDP-43) is a major pathological protein of sporadic and familial frontotemporal lobar degeneration with ubiquitin-positive, tau-negative inclusions (FTLD-U) with or without motor neuron disease (MND). Thus, TDP-43 defines a novel class of neurodegenerative diseases called

  1. Smad3 recruits the anaphase-promoting complex for ubiquitination and degradation of SnoN

    Energy Technology Data Exchange (ETDEWEB)

    Stroschein, Shannon L.; Bonni, Shirin; Wrana, Jeffrey L.; Luo, Kunxin


    Smad proteins mediate transforming growth factor-b signaling to regulate cell growth and differentiation. SnoN is an important negative regulator of TGFb signaling that functions to maintain the repressed state of TGFb target genes in the absence of ligand. Upon TGFb stimulation, Smad3 and Smad2 translocate into the nucleus and induce a rapid degradation of SnoN, allowing activation of TGFb target genes. Here we show that Smad2- or Smad3-induced degradation of SnoN requires the ubiquitin-dependent proteasome and can be mediated by the anaphase promoting complex (APC) and the UbcH5 family of ubiquitin conjugating enzymes. Smad3 and to a lesser extent, Smad2, interact with both the APC and SnoN, resulting in the recruitment of the APC to SnoN and subsequent ubiquitination of SnoN in a destruction box-dependent manner. In addition to the destruction box, efficient degradation of SnoN also requires the Smad3 binding site in SnoN as well as key lysine residues necessary for ubiquitin attachment. Mutation of either the Smad3 binding site or lysine residues results in stabilization of SnoN and in enhanced antagonism of TGFb signaling. Our studies elucidate an important pathway for the degradation of SnoN and reveal a novel role of the APC in regulation of TGFb signaling.

  2. Heterologous SUMO-2/3-ubiquitin chains optimize IκBα degradation and NF-κB activity.

    Directory of Open Access Journals (Sweden)

    Fabienne Aillet

    Full Text Available The NF-κB pathway is regulated by SUMOylation at least at three levels: the inhibitory molecule IκBα, the IKK subunit γ/NEMO and the p52 precursor p100. Here we investigate the role of SUMO-2/3 in the degradation of IκBα and activation of NF-κB mediated by TNFα. We found that under conditions of deficient SUMOylation, an important delay in both TNFα-mediated proteolysis of IκBα and NF-κB dependent transcription occurs. In vitro and ex vivo approaches, including the use of ubiquitin-traps (TUBEs, revealed the formation of chains on IκBα containing SUMO-2/3 and ubiquitin after TNFα stimulation. The integration of SUMO-2/3 appears to promote the formation of ubiquitin chains on IκBα after activation of the TNFα signalling pathway. Furthermore, heterologous chains of SUMO-2/3 and ubiquitin promote a more efficient degradation of IκBα by the 26S proteasome in vitro compared to chains of either SUMO-2/3 or ubiquitin alone. Consistently, Ubc9 silencing reduced the capture of IκBα modified with SUMO-ubiquitin hybrid chains that display a defective proteasome-mediated degradation. Thus, hybrid SUMO-2/3-ubiquitin chains increase the susceptibility of modified IκBα to the action of 26S proteasome, contributing to the optimal control of NF-κB activity after TNFα-stimulation.

  3. Human cytomegalovirus IE1 downregulates Hes1 in neural progenitor cells as a potential E3 ubiquitin ligase.

    Directory of Open Access Journals (Sweden)

    Xi-Juan Liu


    Full Text Available Congenital human cytomegalovirus (HCMV infection is the leading cause of neurological disabilities in children worldwide, but the mechanisms underlying these disorders are far from well-defined. HCMV infection has been shown to dysregulate the Notch signaling pathway in human neural progenitor cells (NPCs. As an important downstream effector of Notch signaling, the transcriptional regulator Hairy and Enhancer of Split 1 (Hes1 is essential for governing NPC fate and fetal brain development. In the present study, we report that HCMV infection downregulates Hes1 protein levels in infected NPCs. The HCMV 72-kDa immediate-early 1 protein (IE1 is involved in Hes1 degradation by assembling a ubiquitination complex and promoting Hes1 ubiquitination as a potential E3 ubiquitin ligase, followed by proteasomal degradation of Hes1. Sp100A, an important component of PML nuclear bodies, is identified to be another target of IE1-mediated ubiquitination. A C-terminal acidic region in IE1, spanning amino acids 451 to 475, is required for IE1/Hes1 physical interaction and IE1-mediated Hes1 ubiquitination, but is dispensable for IE1/Sp100A interaction and ubiquitination. Our study suggests a novel mechanism linking downregulation of Hes1 protein to neurodevelopmental disorders caused by HCMV infection. Our findings also complement the current knowledge of herpesviruses by identifying IE1 as the first potential HCMV-encoded E3 ubiquitin ligase.

  4. The canonical wnt signal restricts the glycogen synthase kinase 3/fbw7-dependent ubiquitination and degradation of eya1 phosphatase. (United States)

    Sun, Ye; Li, Xue


    Haploinsufficiency of Eya1 causes the branchio-oto-renal (BOR) syndrome, and abnormally high levels of Eya1 are linked to breast cancer progression and poor prognosis. Therefore, regulation of Eya1 activity is key to its tissue-specific functions and oncogenic activities. Here, we show that Eya1 is posttranslationally modified by ubiquitin and that its ubiquitination level is self-limited to prevent premature degradation. Eya1 has an evolutionarily conserved CDC4 phosphodegron (CPD) signal, a target site of glycogen synthase kinase 3 (GSK3) kinase and Fbw7 ubiquitin ligase, which is required for Eya1 ubiquitination. Genetic deletion of Fbw7 and pharmacological inhibition of GSK3 significantly decrease Eya1 ubiquitination. Conversely, activation of the phosphatidylinositol 3-kinase (PI3K)/Akt and the canonical Wnt signal suppresses Eya1 ubiquitination. Compound Eya1(+/-); Wnt9b(+/-) mutants exhibit an increased penetrance of renal defect, indicating that they function in the same genetic pathway in vivo. Together, these findings reveal that the canonical Wnt and PI3K/Akt signal pathways restrain the GSK3/Fbw7-dependent Eya1 ubiquitination, and they further suggest that dysregulation of this novel axis contributes to tumorigenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. E3 Ubiquitin Ligase RNF125 Activates Interleukin-36 Receptor Signaling and Contributes to Its Turnover. (United States)

    Saha, Siddhartha S; Caviness, Gary; Yi, Guanghui; Raymond, Ernest L; Mbow, M Lamine; Kao, C Cheng


    Signaling by the interleukin-36 receptor (IL-36R) is linked to inflammatory diseases such as psoriasis. However, the regulation of IL-36R signaling is poorly understood. Activation of IL-36R signaling in cultured cells results in an increased polyubiquitination of the receptor subunit, IL-1Rrp2. Treatment with deubiquitinases shows that the receptor subunit of IL-36R, IL-1Rrp2, is primarily polyubiquitinated at the K63 position, which is associated with endocytic trafficking and signal transduction. A minor amount of ubiquitination is at the K48 position that is associated with protein degradation. A focused siRNA screen identified RNF125, an E3 ubiquitin ligase, to ubiquitinate IL-1Rrp2 upon activation of IL-36R signaling while not affecting the activated IL-1 receptor. Knockdown of RNF125 decreases signal transduction by the IL-36R. Overexpression of RNF125 in HEK293T cells activates IL-36R signaling and increases the ubiquitination of IL-1Rrp2 and its subsequent turnover. RNF125 can coimmunoprecipitate with the IL-36R, and it traffics with IL-1Rrp2 from the cell surface to lysosomes. Mutations of Lys568 and Lys569 in the C-terminal tail of IL-1Rrp2 decrease ubiquitination by RNF125 and increase the steady-state levels of IL-1Rrp2. These results demonstrate that RNF125 has multiple regulatory roles in the signaling, trafficking, and turnover of the IL-36R. © 2017 S. Karger AG, Basel.

  6. Expression Profiling of WSSV ORF 199 and Shrimp Ubiquitin Conjugating Enzyme in WSSV Infected

    Directory of Open Access Journals (Sweden)

    K. Jeena


    Full Text Available White spot syndrome virus (WSSV is one of the major viral pathogens affecting shrimp aquaculture. Four proteins, WSSV199, WSSV 222, WSSV 249 and WSSV 403, from WSSV are predicted to encode a RING-H2 domain, which in presence of ubiquitin conjugating enzyme (E2 in shrimp can function as viral E3 ligase and modulate the host ubiquitin proteasome pathway. Modulation of host ubiquitin proteasome pathway by viral proteins is implicated in viral pathogenesis. In the present study, a time course expression profile analysis of WSSV Open Reading Frame (ORF 199 and Penaeus monodon ubiquitin conjugating enzyme (PmUbc was carried out at 0, 3, 6, 12, 24, 48 and 72 h post WSSV challenge by semi-quantitative RT-PCR as well as Real Time PCR. EF1α was used as reference control to normalize the expression levels. A significant increase in PmUbc expression at 24 h post infection (h.p.i was observed followed by a decline till 72 h.p.i. Expression of WSSV199 was observed at 24 h.p.i in WSSV infected P. monodon. Since the up-regulation of PmUbc was observed at 24 h.p.i where WSSV199 expression was detected, it can be speculated that these proteins might interact with host ubiquitination pathway for viral pathogenesis. However, further studies need to be carried out to unfold the molecular mechanism of interaction between host and virus to devise efficient control strategies for this chaos in the shrimp culture industry.

  7. Ubiquitin fusion expression and tissue-dependent targeting of hG-CSF in transgenic tobacco (United States)


    Background Human granulocyte colony-stimulating factor (hG-CSF) is an important human cytokine which has been widely used in oncology and infection protection. To satisfy clinical needs, expression of recombinant hG-CSF has been studied in several organisms, including rice cell suspension culture and transient expression in tobacco leaves, but there was no published report on its expression in stably transformed plants which can serve as a more economical expression platform with potential industrial application. Results In this study, hG-CSF expression was investigated in transgenic tobacco leaves and seeds in which the accumulation of hG-CSF could be enhanced through fusion with ubiquitin by up to 7 fold in leaves and 2 fold in seeds, leading to an accumulation level of 2.5 mg/g total soluble protein (TSP) in leaves and 1.3 mg/g TSP in seeds, relative to hG-CSF expressed without a fusion partner. Immunoblot analysis showed that ubiquitin was processed from the final protein product, and ubiquitination was up-regulated in all transgenic plants analyzed. Driven by CaMV 35S promoter and phaseolin signal peptide, hG-CSF was observed to be secreted into apoplast in leaves but deposited in protein storage vacuole (PSV) in seeds, indicating that targeting of the hG-CSF was tissue-dependent in transgenic tobacco. Bioactivity assay showed that hG-CSF expressed in both seeds and leaves was bioactive to support the proliferation of NFS-60 cells. Conclusions In this study, the expression of bioactive hG-CSF in transgenic plants was improved through ubiquitin fusion strategy, demonstrating that protein expression can be enhanced in both plant leaves and seeds through fusion with ubiquitin and providing a typical case of tissue-dependent expression of recombinant protein in transgenic plants. PMID:21985646

  8. The role of the ubiquitin proteasome system in the memory process. (United States)

    Lip, Philomena Z Y; Demasi, Marilene; Bonatto, Diego


    Quite intuitive is the notion that memory formation and consolidation is orchestrated by protein synthesis because of the synaptic plasticity necessary for those processes. Nevertheless, recent advances have begun accumulating evidences of a high requirement for protein degradation on the molecular mechanisms of the memory process in the mammalian brain. Because degradation determines protein half-life, degradation has been increasingly recognized as an important intracellular regulatory mechanism. The proteasome is the main player in the degradation of intracellular proteins. Proteasomal substrates are mainly degraded after a post-translational modification by a poly-ubiquitin chain. Latter process, namely poly-ubiquitination, is highly regulated at the step of the ubiquitin molecule transferring to the protein substrate mediated by a set of proteins whose genes represent almost 2% of the human genome. Understanding the role of polyubiquitin-mediated protein degradation has challenging researchers in many fields of investigation as a new source of targets for therapeutic intervention, e.g. E3 ligases that transfer ubiquitin moieties to the substrate. The goal of present work was to uncover mechanisms underlying memory processes regarding the role of the ubiquitin-proteasome system (UPS). For that purpose, preceded of a short review on UPS and memory processes a top-down systems biology approach was applied to establish central proteins involved in memory formation and consolidation highlighting their cross-talking with the UPS. According to that approach, the pattern of expression of several elements of the UPS were found overexpressed in regions of the brain involved in processing cortical inputs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Role of the ubiquitin-proteasome system in brain ischemia: friend or foe? (United States)

    Caldeira, Margarida V; Salazar, Ivan L; Curcio, Michele; Canzoniero, Lorella M T; Duarte, Carlos B


    The ubiquitin-proteasome system (UPS) is a catalytic machinery that targets numerous cellular proteins for degradation, thus being essential to control a wide range of basic cellular processes and cell survival. Degradation of intracellular proteins via the UPS is a tightly regulated process initiated by tagging a target protein with a specific ubiquitin chain. Neurons are particularly vulnerable to any change in protein composition, and therefore the UPS is a key regulator of neuronal physiology. Alterations in UPS activity may induce pathological responses, ultimately leading to neuronal cell death. Brain ischemia triggers a complex series of biochemical and molecular mechanisms, such as an inflammatory response, an exacerbated production of misfolded and oxidized proteins, due to oxidative stress, and the breakdown of cellular integrity mainly mediated by excitotoxic glutamatergic signaling. Brain ischemia also damages protein degradation pathways which, together with the overproduction of damaged proteins and consequent upregulation of ubiquitin-conjugated proteins, contribute to the accumulation of ubiquitin-containing proteinaceous deposits. Despite recent advances, the factors leading to deposition of such aggregates after cerebral ischemic injury remain poorly understood. This review discusses the current knowledge on the role of the UPS in brain function and the molecular mechanisms contributing to UPS dysfunction in brain ischemia with consequent accumulation of ubiquitin-containing proteins. Chemical inhibitors of the proteasome and small molecule inhibitors of deubiquitinating enzymes, which promote the degradation of proteins by the proteasome, were both shown to provide neuroprotection in brain ischemia, and this apparent contradiction is also discussed in this review. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Rsp5 ubiquitin ligase is required for protein trafficking in Saccharomyces cerevisiae COPI mutants.

    Directory of Open Access Journals (Sweden)

    Katarzyna Jarmoszewicz

    Full Text Available Retrograde trafficking from the Golgi to the endoplasmic reticulum (ER depends on the formation of vesicles coated with the multiprotein complex COPI. In Saccharomyces cerevisiae ubiquitinated derivatives of several COPI subunits have been identified. The importance of this modification of COPI proteins is unknown. With the exception of the Sec27 protein (β'COP neither the ubiquitin ligase responsible for ubiquitination of COPI subunits nor the importance of this modification are known. Here we find that the ubiquitin ligase mutation, rsp5-1, has a negative effect that is additive with ret1-1 and sec28Δ mutations, in genes encoding α- and ε-COP, respectively. The double ret1-1 rsp5-1 mutant is also more severely defective in the Golgi-to-ER trafficking compared to the single ret1-1, secreting more of the ER chaperone Kar2p, localizing Rer1p mostly to the vacuole, and increasing sensitivity to neomycin. Overexpression of ubiquitin in ret1-1 rsp5-1 mutant suppresses vacuolar accumulation of Rer1p. We found that the effect of rsp5 mutation on the Golgi-to-ER trafficking is similar to that of sla1Δ mutation in a gene encoding actin cytoskeleton proteins, an Rsp5p substrate. Additionally, Rsp5 and Sla1 proteins were found by co-immunoprecipitation in a complex containing COPI subunits. Together, our results show that Rsp5 ligase plays a role in regulating retrograde Golgi-to-ER trafficking.


    Racca, Joseph D; Chen, Yen-Shan; Yang, Yanwu; Phillips, Nelson B; Weiss, Michael A


    A general problem is posed by analysis of transcriptional thresholds governing cell fate decisions in metazoan development. A model is provided by testis determination in therian mammals. Its key step, Sertoli cell differentiation in the embryonic gonadal ridge, is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in human SRY cause gonadal dysgenesis leading to XY female development (Swyer syndrome). Here, we have characterized an inherited mutation compatible with either male or female somatic phenotypes as observed in an XY father and XY daughter, respectively. The mutation (a crevice-forming substitution at a conserved back surface of the SRY high mobility group box) markedly destabilizes the domain but preserves specific DNA affinity and induced DNA bend angle. On transient transfection of diverse human and rodent cell lines, the variant SRY exhibited accelerated proteasomal degradation (relative to wild type) associated with increased ubiquitination; in vitro susceptibility to ubiquitin-independent ("default") cleavage by the 20S core proteasome was unchanged. The variant's gene regulatory activity (as assessed in a cellular model of the rat embryonic XY gonadal ridge) was reduced by 2-fold relative to wild-type SRY at similar levels of mRNA expression. Chemical proteasome inhibition restored native-like SRY expression and transcriptional activity in association with restored occupancy of a sex-specific enhancer element in principal downstream gene Sox9, demonstrating that the variant SRY exhibits essentially native activity on a per molecule basis. Our findings define a novel mechanism of impaired organogenesis, accelerated ubiquitin-directed proteasomal degradation of a master transcription factor leading to a developmental decision poised at the edge of ambiguity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Insulin alleviates degradation of skeletal muscle protein by inhibiting the ubiquitin-proteasome system in septic rats. (United States)

    Chen, Qiyi; Li, Ning; Zhu, Weiming; Li, Weiqin; Tang, Shaoqiu; Yu, Wenkui; Gao, Tao; Zhang, Juanjuan; Li, Jieshou


    Hypercatabolism is common under septic conditions. Skeletal muscle is the main target organ for hypercatabolism, and this phenomenon is a vital factor in the deterioration of recovery in septic patients. In skeletal muscle, activation of the ubiquitin-proteasome system plays an important role in hypercatabolism under septic status. Insulin is a vital anticatabolic hormone and previous evidence suggests that insulin administration inhibits various steps in the ubiquitin-proteasome system. However, whether insulin can alleviate the degradation of skeletal muscle protein by inhibiting the ubiquitin-proteasome system under septic condition is unclear. This paper confirmed that mRNA and protein levels of the ubiquitin-proteasome system were upregulated and molecular markers of skeletal muscle proteolysis (tyrosine and 3-methylhistidine) simultaneously increased in the skeletal muscle of septic rats. Septic rats were infused with insulin at a constant rate of 2.4 for 8 hours. Concentrations of mRNA and proteins of the ubiquitin-proteasome system and molecular markers of skeletal muscle proteolysis were mildly affected. When the insulin infusion dose increased to 4.8, mRNA for ubiquitin, E2-14 KDa, and the C2 subunit were all sharply downregulated. At the same time, the levels of ubiquitinated proteins, E2-14KDa, and the C2 subunit protein were significantly reduced. Tyrosine and 3-methylhistidine decreased significantly. We concluded that the ubiquitin-proteasome system is important skeletal muscle hypercatabolism in septic rats. Infusion of insulin can reverse the detrimental metabolism of skeletal muscle by inhibiting the ubiquitin-proteasome system, and the effect is proportional to the insulin infusion dose.

  13. Bioinformatics analysis identifies several intrinsically disordered human E3 ubiquitin-protein ligases

    Directory of Open Access Journals (Sweden)

    Wouter Boomsma


    Full Text Available The ubiquitin-proteasome system targets misfolded proteins for degradation. Since the accumulation of such proteins is potentially harmful for the cell, their prompt removal is important. E3 ubiquitin-protein ligases mediate substrate ubiquitination by bringing together the substrate with an E2 ubiquitin-conjugating enzyme, which transfers ubiquitin to the substrate. For misfolded proteins, substrate recognition is generally delegated to molecular chaperones that subsequently interact with specific E3 ligases. An important exception is San1, a yeast E3 ligase. San1 harbors extensive regions of intrinsic disorder, which provide both conformational flexibility and sites for direct recognition of misfolded targets of vastly different conformations. So far, no mammalian ortholog of San1 is known, nor is it clear whether other E3 ligases utilize disordered regions for substrate recognition. Here, we conduct a bioinformatics analysis to examine >600 human and S. cerevisiae E3 ligases to identify enzymes that are similar to San1 in terms of function and/or mechanism of substrate recognition. An initial sequence-based database search was found to detect candidates primarily based on the homology of their ordered regions, and did not capture the unique disorder patterns that encode the functional mechanism of San1. However, by searching specifically for key features of the San1 sequence, such as long regions of intrinsic disorder embedded with short stretches predicted to be suitable for substrate interaction, we identified several E3 ligases with these characteristics. Our initial analysis revealed that another remarkable trait of San1 is shared with several candidate E3 ligases: long stretches of complete lysine suppression, which in San1 limits auto-ubiquitination. We encode these characteristic features into a San1 similarity-score, and present a set of proteins that are plausible candidates as San1 counterparts in humans. In conclusion, our work

  14. A new non-catalytic role for ubiquitin ligase RNF8 in unfolding higher-order chromatin structure

    DEFF Research Database (Denmark)

    Luijsterburg, Martijn S; Acs, Klara; Ackermann, Leena


    The ubiquitin ligases RNF8 and RNF168 orchestrate DNA damage signalling through the ubiquitylation of histone H2A and the recruitment of downstream repair factors. Here, we demonstrate that RNF8, but not RNF168 or the canonical H2A ubiquitin ligase RNF2, mediates extensive chromatin decondensation....... Our data show that CHD4, the catalytic subunit of the NuRD complex, interacts with RNF8 and is essential for RNF8-mediated chromatin unfolding. The chromatin remodelling activity of CHD4 promotes efficient ubiquitin conjugation and assembly of RNF168 and BRCA1 at DNA double-strand breaks....... Interestingly, RNF8-mediated recruitment of CHD4 and subsequent chromatin remodelling were independent of the ubiquitin-ligase activity of RNF8, but involved a non-canonical interaction with the forkhead-associated (FHA) domain. Our study reveals a new mechanism of chromatin remodelling-assisted ubiquitylation...

  15. Cuz1/Ynl155w, a Zinc-dependent Ubiquitin-binding Protein, Protects Cells from Metalloid-induced Proteotoxicity* (United States)

    Hanna, John; Waterman, David; Isasa, Marta; Elsasser, Suzanne; Shi, Yuan; Gygi, Steven; Finley, Daniel


    Protein misfolding is a universal threat to cells. The ubiquitin-proteasome system mediates a cellular stress response capable of eliminating misfolded proteins. Here we identify Cuz1/Ynl155w as a component of the ubiquitin system, capable of interacting with both the proteasome and Cdc48. Cuz1/Ynl155w is regulated by the transcription factor Rpn4, and is required for cells to survive exposure to the trivalent metalloids arsenic and antimony. A related protein, Yor052c, shows similar phenotypes, suggesting a multicomponent stress response pathway. Cuz1/Ynl155w functions as a zinc-dependent ubiquitin-binding protein. Thus, Cuz1/Ynl155w is proposed to protect cells from metalloid-induced proteotoxicity by delivering ubiquitinated substrates to Cdc48 and the proteasome for destruction. PMID:24297164

  16. Nitric oxide prodrug JS-K inhibits ubiquitin E1 and kills tumor cells retaining wild-type p53. (United States)

    Kitagaki, J; Yang, Y; Saavedra, J E; Colburn, N H; Keefer, L K; Perantoni, A O


    Nitric oxide (NO) is a major effector molecule in cancer prevention. A number of studies have shown that NO prodrug JS-K (O(2)-(2,4-dinitrophenyl) 1-[(4-ethoxycarbonyl)piperazin-1-yl]diazen-1-ium-1,2-diolate) induces apoptotic cell death in vitro and in vivo, indicating that it is a promising new therapeutic for cancer. However, the mechanism of its tumor-killing activity remains unclear. Ubiquitin plays an important role in the regulation of tumorigenesis and cell apoptosis. Our earlier report has shown that inactivation of the ubiquitin system through blocking E1 (ubiquitin-activating enzyme) activity preferentially induces apoptosis in p53-expressing transformed cells. As E1 has an active cysteine residue that could potentially interact with NO, we hypothesized that JS-K could inactivate E1 activity. E1 activity was evaluated by detecting ubiquitin-E1 conjugates through immunoblotting. JS-K strikingly inhibits the ubiquitin-E1 thioester formation in cells in a dose-dependent manner with an IC(50) of approximately 2 microM, whereas a JS-K analog that cannot release NO did not affect these levels in cells. Moreover, JS-K decreases total ubiquitylated proteins and increases p53 levels, which is mainly regulated by ubiquitin and proteasomal degradation. Furthermore, JS-K preferentially induces cell apoptosis in p53-expressing transformed cells. These findings indicate that JS-K inhibits E1 activity and kills transformed cells harboring wild-type p53.

  17. Tau protein degradation is catalyzed by the ATP/ubiquitin-independent 20S proteasome under normal cell conditions


    Grune, Tilman; Botzen, Diana; Engels, Martina; Voss, Peter; Kaiser, Barbara; Jung, Tobias; Grimm, Stefanie; Ermak, Gennady; Davies, Kelvin J. A.


    Tau is the major protein exhibiting intracellular accumulation in Alzheimer disease. The mechanisms leading to its accumulation are not fully understood. It has been proposed that the proteasome is responsible for degrading tau but, since proteasomal inhibitors block both the ubiquitin-dependent 26S proteasome and the ubiqutin-independent 20S proteasome pathways, it is not clear which of these pathways is involved in tau degradation. Some involvement of the ubiquitin ligase, CHIP in tau degra...

  18. RMND5 from Xenopus laevis Is an E3 Ubiquitin-Ligase and Functions in Early Embryonic Forebrain Development


    Pfirrmann, Thorsten; Villavicencio-Lorini, Pablo; Subudhi, Abinash K.; Menssen, Ruth; Wolf, Dieter H.; Hollemann, Thomas


    In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of t...

  19. CLCuMuB βC1 Subverts Ubiquitination by Interacting with NbSKP1s to Enhance Geminivirus Infection in Nicotiana benthamiana.

    Directory of Open Access Journals (Sweden)

    Qi Jia


    Full Text Available Viruses interfere with and usurp host machinery and circumvent defense responses to create a suitable cellular environment for successful infection. This is usually achieved through interactions between viral proteins and host factors. Geminiviruses are a group of plant-infecting DNA viruses, of which some contain a betasatellite, known as DNAβ. Here, we report that Cotton leaf curl Multan virus (CLCuMuV uses its sole satellite-encoded protein βC1 to regulate the plant ubiquitination pathway for effective infection. We found that CLCuMu betasatellite (CLCuMuB βC1 interacts with NbSKP1, and interrupts the interaction of NbSKP1s with NbCUL1. Silencing of either NbSKP1s or NbCUL1 enhances the accumulation of CLCuMuV genomic DNA and results in severe disease symptoms in plants. βC1 impairs the integrity of SCFCOI1 and the stabilization of GAI, a substrate of the SCFSYL1 to hinder responses to jasmonates (JA and gibberellins (GA. Moreover, JA treatment reduces viral accumulation and symptoms. These results suggest that CLCuMuB βC1 inhibits the ubiquitination function of SCF E3 ligases through interacting with NbSKP1s to enhance CLCuMuV infection and symptom induction in plants.

  20. Crystallization of mutants of Turnip yellow mosaic virus protease/ubiquitin hydrolase designed to prevent protease self-recognition. (United States)

    Ayach, Maya; Bressanelli, Stéphane


    Processing of the polyprotein of Turnip yellow mosaic virus is mediated by the protease PRO. PRO cleaves at two places, one of which is at the C-terminus of the PRO domain of another polyprotein molecule. In addition to this processing activity, PRO possesses an ubiquitin hydrolase (DUB) activity. The crystal structure of PRO has previously been reported in its polyprotein-processing mode with the C-terminus of one PRO inserted into the catalytic site of the next PRO, generating PRO polymers in the crystal packing of the trigonal space group. Here, two mutants designed to disrupt specific PRO-PRO interactions were generated, produced and purified. Crystalline plates were obtained by seeding and cross-seeding from initial `sea urchin'-like microcrystals of one mutant. The plates diffracted to beyond 2 Å resolution at a synchrotron source and complete data sets were collected for the two mutants. Data processing and analysis indicated that both mutant crystals belonged to the same monoclinic space group, with two molecules of PRO in the asymmetric unit.

  1. Molecular chaperones in targeting misfolded proteins for ubiquitin-dependent degradation

    DEFF Research Database (Denmark)

    Kriegenburg, Franziska; Ellgaard, Lars; Hartmann-Petersen, Rasmus


    The accumulation of misfolded proteins presents a considerable threat to the health of individual cells and has been linked to severe diseases, including neurodegenerative disorders. Considering that, in nature, cells often are exposed to stress conditions that may lead to aberrant protein...... conformational changes, it becomes clear that they must have an efficient quality control apparatus to refold or destroy misfolded proteins. In general, cells rely on molecular chaperones to seize and refold misfolded proteins. If the native state is unattainable, misfolded proteins are targeted for degradation...... via the ubiquitin-proteasome system. The specificity of this proteolysis is generally provided by E3 ubiquitin-protein ligases, hundreds of which are encoded in the human genome. However, rather than binding the misfolded proteins directly, most E3s depend on molecular chaperones to recognize...

  2. The BRCA1 Ubiquitin ligase function sets a new trend for remodelling in DNA repair. (United States)

    Densham, Ruth M; Morris, Joanna R


    The protein product of the breast and ovarian cancer gene, BRCA1, is part of an obligate heterodimer with BARD1. Together these RING bearing proteins act as an E3 ubiquitin ligase. Several functions have been attributed to BRCA1 that contribute to genome integrity but which of these, if any, require this enzymatic function was unclear. Here we review recent studies clarifying the role of BRCA1 E3 ubiquitin ligase in DNA repair. Perhaps the most surprising finding is the narrow range of BRCA1 functions this activity relates to. Remarkably ligase activity promotes chromatin remodelling and 53BP1 positioning through the remodeller SMARCAD1, but the activity is dispensable for the cellular survival in response to cisplatin or replication stressing agents. Implications for therapy response and tumor susceptibility are discussed.

  3. BRK targets Dok1 for ubiquitin-mediated proteasomal degradation to promote cell proliferation and migration.

    Directory of Open Access Journals (Sweden)

    Sayem Miah

    Full Text Available Breast tumor kinase (BRK, also known as protein tyrosine kinase 6 (PTK6, is a non-receptor tyrosine kinase overexpressed in more that 60% of human breast carcinomas. The overexpression of BRK has been shown to sensitize mammary epithelial cells to mitogenic signaling and to promote cell proliferation and tumor formation. The molecular mechanisms of BRK have been unveiled by the identification and characterization of BRK target proteins. Downstream of tyrosine kinases 1 or Dok1 is a scaffolding protein and a substrate of several tyrosine kinases. Herein we show that BRK interacts with and phosphorylates Dok1 specifically on Y362. We demonstrate that this phosphorylation by BRK significantly downregulates Dok1 in a ubiquitin-proteasome-mediated mechanism. Together, these results suggest a novel mechanism of action of BRK in the promotion of tumor formation, which involves the targeting of tumor suppressor Dok1 for degradation through the ubiquitin proteasomal pathway.

  4. BRK targets Dok1 for ubiquitin-mediated proteasomal degradation to promote cell proliferation and migration. (United States)

    Miah, Sayem; Goel, Raghuveera Kumar; Dai, Chenlu; Kalra, Natasha; Beaton-Brown, Erika; Bagu, Edward T; Bonham, Keith; Lukong, Kiven E


    Breast tumor kinase (BRK), also known as protein tyrosine kinase 6 (PTK6), is a non-receptor tyrosine kinase overexpressed in more that 60% of human breast carcinomas. The overexpression of BRK has been shown to sensitize mammary epithelial cells to mitogenic signaling and to promote cell proliferation and tumor formation. The molecular mechanisms of BRK have been unveiled by the identification and characterization of BRK target proteins. Downstream of tyrosine kinases 1 or Dok1 is a scaffolding protein and a substrate of several tyrosine kinases. Herein we show that BRK interacts with and phosphorylates Dok1 specifically on Y362. We demonstrate that this phosphorylation by BRK significantly downregulates Dok1 in a ubiquitin-proteasome-mediated mechanism. Together, these results suggest a novel mechanism of action of BRK in the promotion of tumor formation, which involves the targeting of tumor suppressor Dok1 for degradation through the ubiquitin proteasomal pathway.

  5. Role of the ubiquitin system and tumor viruses in AIDS-related cancer

    Directory of Open Access Journals (Sweden)

    Pagano Joseph S


    Full Text Available Abstract Tumor viruses are linked to approximately 20% of human malignancies worldwide. This review focuses on examples of human oncogenic viruses that manipulate the ubiquitin system in a subset of viral malignancies; those associated with AIDS. The viruses include Kaposi's sarcoma herpesvirus, Epstein-Barr virus and human papilloma virus, which are causally linked to Kaposi's sarcoma, certain B-cell lymphomas and cervical cancer, respectively. We discuss the molecular mechanisms by which these viruses subvert the ubiquitin system and potential viral targets for anti-cancer therapy from the perspective of this system. Publication history: Republished from Current BioData's Targeted Proteins database (TPdb;

  6. Structure and catalytic activation of the TRIM23 RING E3 ubiquitin ligase: DAWIDZIAK et al.

    Energy Technology Data Exchange (ETDEWEB)

    Dawidziak, Daria M. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Sanchez, Jacint G. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Wagner, Jonathan M. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Ganser-Pornillos, Barbie K. [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia; Pornillos, Owen [Department of Molecular Physiology and Biological Physics, University of Virginia, Charlottesville Virginia


    Tripartite motif (TRIM) proteins comprise a large family of RING-type ubiquitin E3 ligases that regulate important biological processes. An emerging general model is that TRIMs form elongated antiparallel coiled-coil dimers that prevent interaction of the two attendant RING domains. The RING domains themselves bind E2 conjugating enzymes as dimers, implying that an active TRIM ligase requires higher-order oligomerization of the basal coiled-coil dimers. Here, we report crystal structures of the TRIM23 RING domain in isolation and in complex with an E2–ubiquitin conjugate. Our results indicate that TRIM23 enzymatic activity requires RING dimerization, consistent with the general model of TRIM activation.

  7. Regulation of the copper chaperone CCS by XIAP-mediated ubiquitination. (United States)

    Brady, Graham F; Galbán, Stefanie; Liu, Xuwen; Basrur, Venkatesha; Gitlin, Jonathan D; Elenitoba-Johnson, Kojo S J; Wilson, Thomas E; Duckett, Colin S


    In order to balance the cellular requirements for copper with its toxic properties, an elegant set of mechanisms has evolved to regulate and buffer intracellular copper. The X-linked inhibitor of apoptosis (XIAP) protein was recently identified as a copper-binding protein and regulator of copper homeostasis, although the mechanism by which XIAP binds copper in the cytosol is unclear. Here we describe the identification of the copper chaperone for superoxide dismutase (CCS) as a mediator of copper delivery to XIAP in cells. We also find that CCS is a target of the E3 ubiquitin ligase activity of XIAP, although interestingly, ubiquitination of CCS by XIAP was found to lead to enhancement of its chaperone activity toward its physiologic target, superoxide dismutase 1, rather than proteasomal degradation. Collectively, our results reveal novel links among apoptosis, copper metabolism, and redox regulation through the XIAP-CCS complex.

  8. Motional properties of unfolded ubiquitin: a model for a random coil protein

    Energy Technology Data Exchange (ETDEWEB)

    Wirmer, Julia [Johann Wolfgang GoeUniversityFrankfurt, Institute for Organic Chemistry and Chemical Biology, Center for Biomolecular Magnetic Resonance (Germany); Peti, Wolfgang [Brown University, Department of Molecular Pharmacology, Physiology and Biotechnology (United States); Schwalbe, Harald [Johann Wolfgang GoeUniversityFrankfurt, Institute for Organic Chemistry and Chemical Biology, Center for Biomolecular Magnetic Resonance (Germany)], E-mail:


    The characterization of unfolded states of proteins has recently attracted considerable interest, as the residual structure present in these states may play a crucial role in determining their folding and misfolding behavior. Here, we investigated the dynamics in the denatured state of ubiquitin in 8 M urea at pH2. Under these conditions, ubiquitin does not have any detectable local residual structure, and uniform {sup 15}N relaxation rates along the sequence indicate the absence of motional restrictions caused by residual secondary structure and/or long-range interactions. A comparison of different models to predict relaxation data in unfolded proteins suggests that the subnanosecond dynamics in unfolded states depend on segmental motions only and do not show a dependence on the residue type but for proline and glycine residues.

  9. Neuromuscular regulation in zebrafish by a large AAA+ ATPase/ubiquitin ligase, mysterin/RNF213 (United States)

    Kotani, Yuri; Morito, Daisuke; Yamazaki, Satoru; Ogino, Kazutoyo; Kawakami, Koichi; Takashima, Seiji; Hirata, Hiromi; Nagata, Kazuhiro


    Mysterin (also known as RNF213) is a huge intracellular protein with two AAA+ ATPase modules and a RING finger ubiquitin ligase domain. Mysterin was originally isolated as a significant risk factor for the cryptogenic cerebrovascular disorder moyamoya disease, and was found to be involved in physiological angiogenesis in zebrafish. However, the function and the physiological significance of mysterin in other than blood vessels remain largely unknown, although mysterin is ubiquitously expressed in animal tissues. In this study, we performed antisense-mediated suppression of a mysterin orthologue in zebrafish larvae and revealed that mysterin-deficient larvae showed significant reduction in fast myofibrils and immature projection of primary motoneurons, leading to severe motor deficits. Fast muscle-specific restoration of mysterin expression cancelled these phenotypes, and interestingly both AAA+ ATPase and ubiquitin ligase activities of mysterin were indispensable for proper fast muscle formation, demonstrating an essential role of mysterin and its enzymatic activities in the neuromuscular regulation in zebrafish. PMID:26530008

  10. Mitochondrial and Ubiquitin Proteasome System Dysfunction in Ageing and Disease: Two Sides of the Same Coin?

    Directory of Open Access Journals (Sweden)

    Jaime M. Ross


    Full Text Available Mitochondrial dysfunction and impairment of the ubiquitin proteasome system have been described as two hallmarks of the ageing process. Additionally, both systems have been implicated in the etiopathogenesis of many age-related diseases, particularly neurodegenerative disorders, such as Alzheimer’s and Parkinson’s disease. Interestingly, these two systems are closely interconnected, with the ubiquitin proteasome system maintaining mitochondrial homeostasis by regulating organelle dynamics, the proteome, and mitophagy, and mitochondrial dysfunction impairing cellular protein homeostasis by oxidative damage. Here, we review the current literature and argue that the interplay of the two systems should be considered in order to better understand the cellular dysfunction observed in ageing and age-related diseases. Such an approach may provide valuable insights into molecular mechanisms underlying the ageing process, and further discovery of treatments to counteract ageing and its associated diseases. Furthermore, we provide a hypothetical model for the heterogeneity described among individuals during ageing.

  11. Impairment of social behavior and communication in mice lacking the Uba6-dependent ubiquitin activation system. (United States)

    Lee, Ji Yeon; Kwak, Minseok; Lee, Peter C W


    The Uba6-Use1 ubiquitin enzyme cascade is a poorly understood arm of the ubiquitin-proteasome system required for mouse development. Recently, we reported that Uba6 brain-specific knockout (termed NKO) mice display abnormal social behavior and neuronal development due to a decreased spine density and accumulation of Ube3a and Shank3. To better characterize a potential role for NKO mice in autism spectrum disorders (ASDs), we performed a comprehensive behavioral characterization of the social behavior and communication of NKO mice. Our behavioral results confirmed that NKO mice display social impairments, as indicated by fewer vocalizations and decreased social interaction. We conclude that UBA6 NKO mice represent a novel ASD mouse model of anti-social and less verbal behavioral symptoms. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. NEMO binds ubiquitinated TANK-binding kinase 1 (TBK1 to regulate innate immune responses to RNA viruses.

    Directory of Open Access Journals (Sweden)

    Lingyan Wang

    Full Text Available RIG-I-like receptors (RLR are intracellular sensors utilized by nearly all cell types for recognition of viral RNA, initiation of antiviral defense, and induction of type I interferons (IFN. TBK1 is a critical kinase implicated in RLR-dependent IFN transcription. Posttranslational modification of TBK1 by K63-linked ubiquitin is required for RLR driven signaling. However, the TBK1 ubiquitin acceptor sites and the function of ubiquitinated TBK1 in the signaling cascade are unknown. We now show that TBK1 is ubiquitinated on residues K69, K154, and K372 in response to infection with RNA virus. The K69 and K154 residues are critical for innate antiviral responses and IFN production. Ubiquitinated TBK1 recruits the downstream adaptor NEMO through ubiquitin binding domains. The assembly of the NEMO/TBK1 complex on the mitochondrial protein MAVS leads to activation of TBK1 kinase activity and phosphorylation of the transcription factor, interferon response factor 3. The combined results refine current views of RLR signaling, define the role of TBK1 polyubiquitination, and detail the mechanisms involved in signalosome assembly.

  13. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway (United States)

    Schwarz, Lindsay A.; Hall, Benjamin J.; Patrick, Gentry N.


    The accurate trafficking of AMPA receptors (AMPARs) to and from the synapse is a critical component of learning and memory in the brain, while dysfunction of AMPAR trafficking is hypothesized to be an underlying mechanism of Alzheimer’s disease. Previous work has shown that ubiquitination of integral membrane proteins is a common post-translational modification used to mediate endocytosis and endocytic sorting of surface proteins in eukaryotic cells. Here we report that mammalian AMPARs become ubiquitinated in response to their activation. Using a mutant of GluA1 that is unable to be ubiquitinated at lysines on its carboxy-terminus, we demonstrate that ubiquitination is required for internalization of surface AMPARs and their trafficking to the lysosome in response to the AMPAR agonist AMPA, but not for internalization of AMPARs in response to the NMDA receptor (NMDAR) agonist NMDA. Through over-expression or RNAi-mediated knockdown, we identify that a specific E3 ligase, Nedd4-1, is necessary for this process. Finally, we show that ubiquitination of GluA1 by Nedd4-1 becomes more prevalent as neurons mature. Together, these data show that ubiquitination of GluA1-containing AMPARs by Nedd4-1 mediates their endocytosis and trafficking to the lysosome. Furthermore, these results provide insight into how hippocampal neurons regulate AMPAR trafficking and degradation with high specificity in response to differing neuronal signaling cues, and suggest that changes to this pathway may occur as neurons mature. PMID:21148011

  14. USP7 Is a Suppressor of PCNA Ubiquitination and Oxidative-Stress-Induced Mutagenesis in Human Cells. (United States)

    Kashiwaba, Shu-ichiro; Kanao, Rie; Masuda, Yuji; Kusumoto-Matsuo, Rika; Hanaoka, Fumio; Masutani, Chikahide


    Mono-ubiquitinated PCNA activates error-prone DNA polymerases; therefore, strict regulation of PCNA mono-ubiquitination is crucial in avoiding undesired mutagenesis. In this study, we used an in vitro assay system to identify USP7 as a deubiquitinating enzyme of mono-ubiquitinated PCNA. Suppression of USP1, a previously identified PCNA deubiquitinase, or USP7 increased UV- and H2O2-induced PCNA mono-ubiquitination in a distinct and additive manner, suggesting that USP1 and USP7 make different contributions to PCNA deubiquitination in human cells. Cell-cycle-synchronization analyses revealed that USP7 suppression increased H2O2-induced PCNA ubiquitination throughout interphase, whereas USP1 suppression specifically increased ubiquitination in S-phase cells. UV-induced mutagenesis was elevated in USP1-suppressed cells, whereas H2O2-induced mutagenesis was elevated in USP7-suppressed cells. These results suggest that USP1 suppresses UV-induced mutations produced in a manner involving DNA replication, whereas USP7 suppresses H2O2-induced mutagenesis involving cell-cycle-independent processes such as DNA repair. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  15. Biochemical function of typical and variant Arabidopsis thaliana U-box E3 ubiquitin-protein ligases

    DEFF Research Database (Denmark)

    Wiborg, Jakob; O'Shea, Charlotte; Skriver, Karen


    of the distant U-box protein, AtPUB49, representing a large family of eukaryotic proteins containing a U-box linked to a cyclophilin-like peptidyl-prolyl cis-trans isomerase domain, was characterized biochemically. AtPUB49 functioned both as a prolyl isomerase and a chaperone by catalysing cis......The variance of the U-box domain in 64 Arabidopsis thaliana (thale cress) E3s (ubiquitin-protein ligases) was used to examine the interactions between E3s and E2s (ubiquitin-conjugating enzymes). E2s and E3s are components of the ubiquitin protein degradation pathway. Seven U-box proteins were...... analysed for their ability to ubiquitinate proteins in vitro in co-operation with different E2s. All U-box domains exhibited ubiquitination activity and interacted productively with UBC4/5-type E2s. Three and four of the U-box domains mediated ubiquitin addition in the presence of UBC13 and UBC7 E2s...

  16. Signals in hepatitis A virus P3 region proteins recognized by the ubiquitin-mediated proteolytic system

    International Nuclear Information System (INIS)

    Losick, Vicki P.; Schlax, Peter E.; Emmons, Rebecca A.; Lawson, T. Glen


    The hepatitis A virus 3C protease and 3D RNA polymerase are present in low concentrations in infected cells. The 3C protease was previously shown to be rapidly degraded by the ubiquitin/26S proteasome system and we present evidence here that the 3D polymerase is also subject to ubiquitination-mediated proteolysis. Our results show that the sequence 32 LGVKDDWLLV 41 in the 3C protease serves as a protein destruction signal recognized by the ubiquitin-protein ligase E3α and that the destruction signal for the RNA polymerase does not require the carboxyl-terminal 137 amino acids. Both the viral 3ABCD polyprotein and the 3CD diprotein were also found to be substrates for ubiquitin-mediated proteolysis. Attempts to determine if the 3C protease or the 3D polymerase destruction signals trigger the ubiquitination and degradation of these precursors yielded evidence suggesting, but not unequivocally proving, that the recognition of the 3D polymerase by the ubiquitin system is responsible

  17. Ubiquitination of the bacterial inositol phosphatase, SopB, regulates its biological activity at the plasma membrane.

    LENUS (Irish Health Repository)

    Knodler, Leigh A


    The Salmonella type III effector, SopB, is an inositol polyphosphate phosphatase that modulates host cell phospholipids at the plasma membrane and the nascent Salmonella-containing vacuole (SCV). Translocated SopB persists for many hours after infection and is ubiquitinated but the significance of this covalent modification has not been investigated. Here we identify by mass spectrometry six lysine residues of SopB that are mono-ubiquitinated. Substitution of these six lysine residues with arginine, SopB-K(6)R, almost completely eliminated SopB ubiquitination. We found that ubiquitination does not affect SopB stability or membrane association, or SopB-dependent events in SCV biogenesis. However, two spatially and temporally distinct events are dependent on ubiquitination, downregulation of SopB activity at the plasma membrane and prolonged retention of SopB on the SCV. Activation of the mammalian pro-survival kinase Akt\\/PKB, a downstream target of SopB, was intensified and prolonged after infection with the SopB-K(6)R mutant. At later times, fewer SCV were decorated with SopB-K(6)R compared with SopB. Instead SopB-K(6)R was present as discrete vesicles spread diffusely throughout the cell. Altogether, our data show that ubiquitination of SopB is not related to its intracellular stability but rather regulates its enzymatic activity at the plasma membrane and intracellular localization.

  18. ABA-dependent inhibition of the ubiquitin proteasome system during germination at high temperature in Arabidopsis. (United States)

    Chiu, Rex Shun; Pan, Shiyue; Zhao, Rongmin; Gazzarrini, Sonia


    During germination, endogenous and environmental factors trigger changes in the transcriptome, translatome and proteome to break dormancy. In Arabidopsis thaliana, the ubiquitin proteasome system (UPS) degrades proteins that promote dormancy to allow germination. While research on the UPS has focused on the identification of proteasomal substrates, little information is known about the regulation of its activity. Here we characterized the activity of the UPS during dormancy release and maintenance by monitoring protein ubiquitination and degradation of two proteasomal substrates: Suc-LLVY-AMC, a well characterized synthetic substrate, and FUSCA3 (FUS3), a dormancy-promoting transcription factor degraded by the 26S proteasome. Our data indicate that proteasome activity and protein ubiquitination increase during imbibition at optimal temperature (21°C), and are required for seed germination. However, abscisic acid (ABA) and supraoptimal temperature (32°C) inhibit germination by dampening both protein ubiquitination and proteasome activity. Inhibition of UPS function by high temperature is reduced by the ABA biosynthesis inhibitor, fluridone, and in ABA biosynthetic mutants, suggesting that it is ABA dependent. Accordingly, inhibition of FUS3 degradation at 32°C is also dependent on ABA. Native gels show that inhibition of proteasome activity is caused by interference with the 26S/30S ratio as well as free 19S and 20S levels, impacting the proteasome degradation cycle. Transfer experiments show that ABA-mediated inhibition of proteasome activity at 21°C is restricted to the first 2 days of germination, a time window corresponding to seed sensitivity to environmental and ABA-mediated growth inhibition. Our data show that ABA and high temperature inhibit germination under unfavourable growth conditions by repressing the UPS. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  19. New strategy for renal fibrosis: Targeting Smad3 proteins for ubiquitination and degradation. (United States)

    Wang, Xin; Feng, Shaozhen; Fan, Jinjin; Li, Xiaoyan; Wen, Qiong; Luo, Ning


    Smad3 is a critical signaling protein in renal fibrosis. Proteolysis targeting chimeric molecules (PROTACs) are small molecules designed to degrade target proteins via ubiquitination. They have three components: (1) a recognition motif for E3 ligase; (2) a linker; and (3) a ligand for the target protein. We aimed to design a new PROTAC to prevent renal fibrosis by targeting Smad3 proteins and using hydroxylated pentapeptide of hypoxia-inducible factor-1α as the recognition motif for von Hippel-Lindau (VHL) ubiquitin ligase (E3). Computer-aided drug design was used to find a specific ligand targeting Smad3. Surface plasmon resonance (SPR) was used to verify and optimize screening results. Synthesized PROTAC was validated by two-stage mass spectrometry. The PROTAC's specificity for VHL (E3 ligase) was proved with two human renal carcinoma cell lines, 786-0 (VHL(-)) and ACHN (VHL(+)), and its anti-fibrosis effect was tested in renal fibrosis cell models. Thirteen small molecular compounds (SMCs) were obtained from the Enamine library using GLIDE molecular docking program. SPR results showed that #8 SMC (EN300-72284) combined best with Smad3 (KD=4.547×10(-5)M). Mass spectrometry showed that synthesized PROTAC had the correct peptide molecular weights. Western blot showed Smad3 was degraded by PROTAC with whole-cell lysate of ACHN but not 786-0. Degradation, but not ubiquitination, of Smad3 was inhibited by proteasome inhibitor MG132. The upregulation of fibronectin and Collagen I induced by TGF-β1 in both renal fibroblast and mesangial cells were inhibited by PROTAC. The new PROTAC might prevent renal fibrosis by targeting Smad3 for ubiquitination and degradation. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Altered ubiquitin causes perturbed calcium homeostasis, hyperactivation of calpain, dysregulated differentiation, and cataract. (United States)

    Liu, Ke; Lyu, Lei; Chin, David; Gao, Junyuan; Sun, Xiurong; Shang, Fu; Caceres, Andrea; Chang, Min-Lee; Rowan, Sheldon; Peng, Junmin; Mathias, Richard; Kasahara, Hideko; Jiang, Shuhong; Taylor, Allen


    Although the ocular lens shares many features with other tissues, it is unique in that it retains its cells throughout life, making it ideal for studies of differentiation/development. Precipitation of proteins results in lens opacification, or cataract, the major blinding disease. Lysines on ubiquitin (Ub) determine fates of Ub-protein substrates. Information regarding ubiquitin proteasome systems (UPSs), specifically of K6 in ubiquitin, is undeveloped. We expressed in the lens a mutant Ub containing a K6W substitution (K6W-Ub). Protein profiles of lenses that express wild-type ubiquitin (WT-Ub) or K6W-Ub differ by only ∼2%. Despite these quantitatively minor differences, in K6W-Ub lenses and multiple model systems we observed a fourfold Ca(2+) elevation and hyperactivation of calpain in the core of the lens, as well as calpain-associated fragmentation of critical lens proteins including Filensin, Fodrin, Vimentin, β-Crystallin, Caprin family member 2, and tudor domain containing 7. Truncations can be cataractogenic. Additionally, we observed accumulation of gap junction Connexin43, and diminished Connexin46 levels in vivo and in vitro. These findings suggest that mutation of Ub K6 alters UPS function, perturbs gap junction function, resulting in Ca(2+) elevation, hyperactivation of calpain, and associated cleavage of substrates, culminating in developmental defects and a cataractous lens. The data show previously unidentified connections between UPS and calpain-based degradative systems and advance our understanding of roles for Ub K6 in eye development. They also inform about new approaches to delay cataract and other protein precipitation diseases.

  1. Discovery of Ubiquitin Deamidases in the Pathogenic Arsenal of Legionella pneumophila

    Directory of Open Access Journals (Sweden)

    Dylan Valleau


    Full Text Available Summary: Legionella pneumophila translocates the largest known arsenal of over 330 pathogenic factors, called “effectors,” into host cells during infection, enabling L. pneumophila to establish a replicative niche inside diverse amebas and human macrophages. Here, we reveal that the L. pneumophila effectors MavC (Lpg2147 and MvcA (Lpg2148 are structural homologs of cycle inhibiting factor (Cif effectors and that the adjacent gene, lpg2149, produces a protein that directly inhibits their activity. In contrast to canonical Cifs, both MavC and MvcA contain an insertion domain and deamidate the residue Gln40 of ubiquitin but not Gln40 of NEDD8. MavC and MvcA are functionally diverse, with only MavC interacting with the human E2-conjugating enzyme UBE2N (Ubc13. MavC deamidates the UBE2N∼Ub conjugate, disrupting Lys63 ubiquitination and dampening NF-κB signaling. Combined, our data reveal a molecular mechanism of host manipulation by pathogenic bacteria and highlight the complex regulatory mechanisms integral to L. pneumophila’s pathogenic strategy. : Legionella pneumophila, possessing the largest known arsenal of effectors, continues to reveal unique approaches to host cell control. Valleau et al. decrypt the functions of a trio of effectors, discovering a pair of ubiquitin-specific deamidases, their regulation by a neighboring dual-specificity protein inhibitor, and a mechanism of NF-κB suppression. Keywords: pathogen-host interaction, ubiquitination, Legionella, UBE2N/Ubc13, NF-κB signaling, Type IV secretion system, effectors, metaeffector, cycle inhibiting factor

  2. Siah1/2 Ubiquitin Ligases in ER Stress Signaling in Melanoma (United States)


    enriched (and downregulated) upon Siah2 KD (Fig 4). RNAseq to identify genes and pathways that are deregulated in the Siah2 KD melanomas, led us...June 2016), Signgene Symposium (Berlin, Germany ; Sept. 2016), European Society for Pigment Cell Research (Milano, Italy; Sept. 2016), Centre National...Flaherty KT, Ronai ZA. Downregulation of the Ubiquitin Ligase RNF125 Underlies Resistance of Melanoma Cells to BRAF Inhibitors via JAK1 Deregulation

  3. Ubiquitination of basal VEGFR2 regulates signal transduction and endothelial function

    Directory of Open Access Journals (Sweden)

    Gina A. Smith


    Full Text Available Cell surface receptors can undergo recycling or proteolysis but the cellular decision-making events that sort between these pathways remain poorly defined. Vascular endothelial growth factor A (VEGF-A and vascular endothelial growth factor receptor 2 (VEGFR2 regulate signal transduction and angiogenesis, but how signaling and proteolysis is regulated is not well understood. Here, we provide evidence that a pathway requiring the E1 ubiquitin-activating enzyme UBA1 controls basal VEGFR2 levels, hence metering plasma membrane receptor availability for the VEGF-A-regulated endothelial cell response. VEGFR2 undergoes VEGF-A-independent constitutive degradation via a UBA1-dependent ubiquitin-linked pathway. Depletion of UBA1 increased VEGFR2 recycling from endosome-to-plasma membrane and decreased proteolysis. Increased membrane receptor availability after UBA1 depletion elevated VEGF-A-stimulated activation of key signaling enzymes such as PLCγ1 and ERK1/2. Although UBA1 depletion caused an overall decrease in endothelial cell proliferation, surviving cells showed greater VEGF-A-stimulated responses such as cell migration and tubulogenesis. Our study now suggests that a ubiquitin-linked pathway regulates the balance between receptor recycling and degradation which in turn impacts on the intensity and duration of VEGF-A-stimulated signal transduction and the endothelial response.

  4. It takes two to tango: Ubiquitin and SUMO in the DNA damage response (United States)

    Bologna, Serena; Ferrari, Stefano


    The complexity of living cells is primarily determined by the genetic information encoded in DNA and gets fully disclosed upon translation. A major determinant of complexity is the reversible post-translational modification (PTM) of proteins, which generates variants displaying distinct biological properties such as subcellular localization, enzymatic activity and the ability to assemble in complexes. Decades of work on phosphorylation have unambiguously proven this concept. In recent years, the covalent attachment of Ubiquitin or Small Ubiquitin-like Modifiers (SUMO) to amino acid residues of target proteins has been recognized as another crucial PTM, re-directing protein fate and protein-protein interactions. This review focuses on the role of ubiquitylation and sumoylation in the control of DNA damage response proteins. To lay the ground, we begin with a description of ubiquitylation and sumoylation, providing established examples of DNA damage response elements that are controlled through these PTMs. We then examine in detail the role of PTMs in the cellular response to DNA double-strand breaks illustrating hierarchy, cross-talk, synergism or antagonism between phosphorylation, ubiquitylation and sumoylation. We conclude offering a perspective on Ubiquitin and SUMO pathways as targets in cancer therapy. PMID:23781231

  5. Interactions between co-expressed Arabidopsis sucrose transporters in the split-ubiquitin system

    Directory of Open Access Journals (Sweden)

    Lalonde Sylvie


    Full Text Available Abstract Background The Arabidopsis genome contains nine sucrose transporter paralogs falling into three clades: SUT1-like, SUT2 and SUT4. The carriers differ in their kinetic properties. Many transport proteins are known to exist as oligomers. The yeast-based split ubiquitin system can be used to analyze the ability of membrane proteins to interact. Results Promoter-GUS fusions were used to analyze the cellular expression of the three transporter genes in transgenic Arabidopsis plants. All three fusion genes are co-expressed in companion cells. Protein-protein interactions between Arabidopsis sucrose transporters were tested using the split ubiquitin system. Three paralogous sucrose transporters are capable of interacting as either homo- or heteromers. The interactions are specific, since a potassium channel and a glucose transporter did not show interaction with sucrose transporters. Also the biosynthetic and metabolizing enzymes, sucrose phosphate phosphatase and sucrose synthase, which were found to be at least in part bound to the plasma membrane, did not specifically interact with sucrose transporters. Conclusions The split-ubiquitin system provides a powerful tool to detect potential interactions between plant membrane proteins by heterologous expression in yeast, and can be used to screen for interactions with membrane proteins as baits. Like other membrane proteins, the Arabidopsis sucrose transporters are able to form oligomers. The biochemical approaches are required to confirm the in planta interaction.

  6. BRCA1 Is a Histone-H2A-Specific Ubiquitin Ligase

    Directory of Open Access Journals (Sweden)

    Reinhard Kalb


    Full Text Available The RING domain proteins BRCA1 and BARD1 comprise a heterodimeric ubiquitin (E3 ligase that is required for the accumulation of ubiquitin conjugates at sites of DNA damage and for silencing at DNA satellite repeat regions. Despite its links to chromatin, the substrate and underlying function of the BRCA1/BARD1 ubiquitin ligase remain unclear. Here, we show that BRCA1/BARD1 specifically ubiquitylates histone H2A in its C-terminal tail on lysines 127 and 129 in vitro and in vivo. The specificity for K127-129 is acquired only when H2A is within a nucleosomal context. Moreover, site-specific targeting of the BRCA1/BARD1 RING domains to chromatin is sufficient for H2Aub foci formation in vivo. Our data establish BRCA1/BARD1 as a histone-H2A-specific E3 ligase, helping to explain its localization and activities on chromatin in cells.

  7. Ubiquitin-Mediated Regulation of Endocytosis by Proteins of the Arrestin Family

    Directory of Open Access Journals (Sweden)

    Michel Becuwe


    Full Text Available In metazoans, proteins of the arrestin family are key players of G-protein-coupled receptors (GPCRS signaling and trafficking. Following stimulation, activated receptors are phosphorylated, thus allowing the binding of arrestins and hence an “arrest” of receptor signaling. Arrestins act by uncoupling receptors from G proteins and contribute to the recruitment of endocytic proteins, such as clathrin, to direct receptor trafficking into the endocytic pathway. Arrestins also serve as adaptor proteins by promoting the recruitment of ubiquitin ligases and participate in the agonist-induced ubiquitylation of receptors, known to have impact on their subcellular localization and stability. Recently, the arrestin family has expanded following the discovery of arrestin-related proteins in other eukaryotes such as yeasts or fungi. Surprisingly, most of these proteins are also involved in the ubiquitylation and endocytosis of plasma membrane proteins, thus suggesting that the role of arrestins as ubiquitin ligase adaptors is at the core of these proteins' functions. Importantly, arrestins are themselves ubiquitylated, and this modification is crucial for their function. In this paper, we discuss recent data on the intricate connections between arrestins and the ubiquitin pathway in the control of endocytosis.

  8. The ubiquitin-proteasome system and autophagy are defective in the taurine-deficient heart. (United States)

    Jong, Chian Ju; Ito, Takashi; Schaffer, Stephen W


    Taurine depletion leads to impaired mitochondrial function, as characterized by reduced ATP production and elevated superoxide generation. These defects can fundamentally alter cardiomyocyte function and if left unchanged can result in cell death. To protect against these stresses, cardiomyocytes possess quality control processes, such as the ubiquitin-proteasome system (UPS) and autophagy, which can rejuvenate cells through the degradation of damaged proteins and organelles. Hence, the present study tested the hypothesis that reactive oxygen species generated by damaged mitochondria initiates UPS and autophagy in the taurine-deficient heart. Using transgenic mice lacking the taurine transporter (TauTKO) as a model of taurine deficiency, it was shown that the levels of ubiquitinated protein were elevated, an effect associated with a decrease in ATP-dependent 26S β5 proteasome activity. Treating the TauTKO mouse with the mitochondria-specific antioxidant, mitoTEMPO, largely abolished the increase in ubiquitinated protein content. The TauTKO heart was also associated with impaired autophagy, characterized by an increase in the initiator, Beclin-1, and autophagosome content, but a defect in the generation of active autophagolysosomes. Although mitoTEMPO treatment only restores the oxidative balance within the mitochondria, it appeared to completely disrupt the crosstalk between the damaged mitochondria and the quality control processes. Thus, mitochondrial oxidative stress is the main trigger initiating the quality control systems in the taurine-deficient heart. We conclude that the activation of the UPS and autophagy is another fundamental function of mitochondria.

  9. Post-translationally modified muscle-specific ubiquitin ligases as circulating biomarkers in experimental cancer cachexia (United States)

    Mota, Roberto; Rodríguez, Jessica E; Bonetto, Andrea; O’Connell, Thomas M; Asher, Scott A; Parry, Traci L; Lockyer, Pamela; McCudden, Christopher R; Couch, Marion E; Willis, Monte S


    Cancer cachexia is a severe wasting syndrome characterized by the progressive loss of lean body mass and systemic inflammation. Up to 80% of cancer patients experience cachexia, with 20-30% of cancer-related deaths directly linked to cachexia. Despite efforts to identify early cachexia and cancer relapse, clinically useful markers are lacking. Recently, we identified the role of muscle-specific ubiquitin ligases Atrogin-1 (MAFbx, FBXO32) and Muscle Ring Finger-1 in the pathogenesis of cardiac atrophy and hypertrophy. We hypothesized that during cachexia, the Atrogin-1 and MuRF1 ubiquitin ligases are released from muscle and migrate to the circulation where they could be detected and serve as a cachexia biomarker. To test this, we induced cachexia in mice using the C26 adenocarcinoma cells or vehicle (control). Body weight, tumor volume, and food consumption were measured from inoculation until ~day 14 to document cachexia. Western blot analysis of serum identified the presence of Atrogin-1 and MuRF1 with unique post-translational modifications consistent with mono- and poly- ubiquitination of Atrogin-1 and MuRF1 found only in cachectic serum. These findings suggest that both increased Atrogin-1 and the presence of unique post-translational modifications may serve as a surrogate marker specific for cachexia. PMID:28979816

  10. Crystal Structure of the Cul2-Rbx1-EloBC-VHL Ubiquitin Ligase Complex. (United States)

    Cardote, Teresa A F; Gadd, Morgan S; Ciulli, Alessio


    Cullin RING E3 ubiquitin ligases (CRLs) function in the ubiquitin proteasome system to catalyze the transfer of ubiquitin from E2 conjugating enzymes to specific substrate proteins. CRLs are large dynamic complexes and attractive drug targets for the development of small-molecule inhibitors and chemical inducers of protein degradation. The atomic details of whole CRL assembly and interactions that dictate subunit specificity remain elusive. Here we present the crystal structure of a pentameric CRL2 VHL complex, composed of Cul2, Rbx1, Elongin B, Elongin C, and pVHL. The structure traps a closed state of full-length Cul2 and a new pose of Rbx1 in a trajectory from closed to open conformation. We characterize hotspots and binding thermodynamics at the interface between Cul2 and pVHL-EloBC and identify mutations that contribute toward a selectivity switch for Cul2 versus Cul5 recognition. Our findings provide structural and biophysical insights into the whole Cul2 complex that could aid future drug targeting. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  11. Genetic immunization based on the ubiquitin-fusion degradation pathway against Trypanosoma cruzi

    Energy Technology Data Exchange (ETDEWEB)

    Chou, Bin [Department of Microbiology and Immunology, Faculty of Medicine, Fukuoka University, 7-45-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan); Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Hiromatsu, Kenji, E-mail: [Department of Microbiology and Immunology, Faculty of Medicine, Fukuoka University, 7-45-1 Nanakuma, Jonan-ku, Fukuoka 814-0180 (Japan); Hisaeda, Hajime; Duan, Xuefeng; Imai, Takashi [Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan); Murata, Shigeo; Tanaka, Keiji [Department of Molecular Oncology, The Tokyo Metropolitan Institute of Medical Science, Tokyo 113-8613 (Japan); Himeno, Kunisuke [Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582 (Japan)


    Cytotoxic CD8{sup +} T cells are particularly important to the development of protective immunity against the intracellular protozoan parasite, Trypanosoma cruzi, the etiological agent of Chagas disease. We have developed a new effective strategy of genetic immunization by activating CD8{sup +} T cells through the ubiquitin-fusion degradation (UFD) pathway. We constructed expression plasmids encoding the amastigote surface protein-2 (ASP-2) of T. cruzi. To induce the UFD pathway, a chimeric gene encoding ubiquitin fused to ASP-2 (pUB-ASP-2) was constructed. Mice immunized with pUB-ASP-2 presented lower parasitemia and longer survival period, compared with mice immunized with pASP-2 alone. Depletion of CD8{sup +} T cells abolished protection against T. cruzi in mice immunized with pUB-ASP-2 while depletion of CD4{sup +} T cells did not influence the effective immunity. Mice deficient in LMP2 or LMP7, subunits of immunoproteasomes, were not able to develop protective immunity induced. These results suggest that ubiquitin-fused antigens expressed in antigen-presenting cells were effectively degraded via the UFD pathway, and subsequently activated CD8{sup +} T cells. Consequently, immunization with pUB-ASP-2 was able to induce potent protective immunity against infection of T. cruzi.

  12. Ubiquitination of basal VEGFR2 regulates signal transduction and endothelial function. (United States)

    Smith, Gina A; Fearnley, Gareth W; Abdul-Zani, Izma; Wheatcroft, Stephen B; Tomlinson, Darren C; Harrison, Michael A; Ponnambalam, Sreenivasan


    Cell surface receptors can undergo recycling or proteolysis but the cellular decision-making events that sort between these pathways remain poorly defined. Vascular endothelial growth factor A (VEGF-A) and vascular endothelial growth factor receptor 2 (VEGFR2) regulate signal transduction and angiogenesis, but how signaling and proteolysis is regulated is not well understood. Here, we provide evidence that a pathway requiring the E1 ubiquitin-activating enzyme UBA1 controls basal VEGFR2 levels, hence metering plasma membrane receptor availability for the VEGF-A-regulated endothelial cell response. VEGFR2 undergoes VEGF-A-independent constitutive degradation via a UBA1-dependent ubiquitin-linked pathway. Depletion of UBA1 increased VEGFR2 recycling from endosome-to-plasma membrane and decreased proteolysis. Increased membrane receptor availability after UBA1 depletion elevated VEGF-A-stimulated activation of key signaling enzymes such as PLCγ1 and ERK1/2. Although UBA1 depletion caused an overall decrease in endothelial cell proliferation, surviving cells showed greater VEGF-A-stimulated responses such as cell migration and tubulogenesis. Our study now suggests that a ubiquitin-linked pathway regulates the balance between receptor recycling and degradation which in turn impacts on the intensity and duration of VEGF-A-stimulated signal transduction and the endothelial response. © 2017. Published by The Company of Biologists Ltd.

  13. Quantitative proteomics and terminomics to elucidate the role of ubiquitination and proteolysis in adaptive immunity. (United States)

    Klein, Theo; Viner, Rosa I; Overall, Christopher M


    Adaptive immunity is the specialized defence mechanism in vertebrates that evolved to eliminate pathogens. Specialized lymphocytes recognize specific protein epitopes through antigen receptors to mount potent immune responses, many of which are initiated by nuclear factor-kappa B activation and gene transcription. Most, if not all, pathways in adaptive immunity are further regulated by post-translational modification (PTM) of signalling proteins, e.g. phosphorylation, citrullination, ubiquitination and proteolytic processing. The importance of PTMs is reflected by genetic or acquired defects in these pathways that lead to a dysfunctional immune response. Here we discuss the state of the art in targeted proteomics and systems biology approaches to dissect the PTM landscape specifically regarding ubiquitination and proteolysis in B- and T-cell activation. Recent advances have occurred in methods for specific enrichment and targeted quantitation. Together with improved instrument sensitivity, these advances enable the accurate analysis of often rare PTM events that are opaque to conventional proteomics approaches, now rendering in-depth analysis and pathway dissection possible. We discuss published approaches, including as a case study the profiling of the N-terminome of lymphocytes of a rare patient with a genetic defect in the paracaspase protease MALT1, a key regulator protease in antigen-driven signalling, which was manifested by elevated linear ubiquitination.This article is part of the themed issue 'Quantitative mass spectrometry'. © 2016 The Authors.

  14. Hijacking of the host SCF ubiquitin ligase machinery by plant pathogens

    Directory of Open Access Journals (Sweden)

    Shimpei eMagori


    Full Text Available The SCF (SKP1-CUL1-F-box protein ubiquitin ligase complex mediates polyubiquitination of proteins targeted for degradation, thereby controlling a plethora of biological processes in eukaryotic cells. Although this ubiquitination machinery is found and functional only in eukaryotes, many non-eukaryotic pathogens also encode F-box proteins, the critical subunits of the SCF complex. Increasing evidence indicates that such non-eukaryotic F-box proteins play an essential role in subverting or exploiting the host ubiquitin/proteasome system for efficient pathogen infection. A recent bioinformatic analysis has identified more than 70 F-box proteins in 22 different bacterial species, suggesting that use of pathogen-encoded F-box effectors in the host cell may be a widespread infection strategy. In this review, we focus on plant pathogen-encoded F-box effectors, such as VirF of Agrobacterium tumefaciens, GALAs of Ralstonia solanacearum, and P0 of Poleroviruses, and discuss the molecular mechanism by which plant pathogens use these factors to manipulate the host cell for their own benefit.

  15. TRIM32 ubiquitin E3 ligase, one enzyme for several pathologies: From muscular dystrophy to tumours. (United States)

    Lazzari, Elisa; Meroni, Germana


    TRIM32 is a member of the TRIpartite Motif family characterised by the presence of an N-terminal three-domain-module that includes a RING domain, which confers E3 ubiquitin ligase activity, one or two B-box domains and a Coiled-Coil region that mediates oligomerisation. Several TRIM32 substrates were identified including muscular proteins and proteins involved in cell cycle regulation and cell motility. As ubiquitination is a versatile post-translational modification that can affect target turnover, sub-cellular localisation or activity, it is likely that diverse substrates may be differentially affected by TRIM32-mediated ubiquitination, reflecting its multi-faceted roles in muscle physiology, cancer and immunity. With particular relevance for muscle physiology, mutations in TRIM32 are associated with autosomal recessive Limb-Girdle Muscular Dystrophy 2H, a muscle-wasting disease with variable clinical spectrum ranging from almost asymptomatic to wheelchair-bound patients. In this review, we will focus on the ability of TRIM32 to mark specific substrates for proteasomal degradation discussing how the TRIM32-proteasome axis may (i) be important for muscle homeostasis and for the pathogenesis of muscular dystrophy; and (ii) define either an oncogenic or tumour suppressive role for TRIM32 in the context of different types of cancer. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Ubiquitome Analysis Reveals PCNA-Associated Factor 15 (PAF15) as a Specific Ubiquitination Target of UHRF1 in Embryonic Stem Cells. (United States)

    Karg, Elisabeth; Smets, Martha; Ryan, Joel; Forné, Ignasi; Qin, Weihua; Mulholland, Christopher B; Kalideris, Georgia; Imhof, Axel; Bultmann, Sebastian; Leonhardt, Heinrich


    Ubiquitination is a multifunctional posttranslational modification controlling the activity, subcellular localization and stability of proteins. The E3 ubiquitin ligase ubiquitin-like PHD and RING finger domain-containing protein 1 (UHRF1) is an essential epigenetic factor that recognizes repressive histone marks as well as hemi-methylated DNA and recruits DNA methyltransferase 1. To explore enzymatic functions of UHRF1 beyond epigenetic regulation, we conducted a comprehensive screen in mouse embryonic stem cells to identify novel ubiquitination targets of UHRF1 and its paralogue UHRF2. We found differentially ubiquitinated peptides associated with a variety of biological processes such as transcriptional regulation and DNA damage response. Most prominently, we identified PCNA-associated factor 15 (PAF15; also known as Pclaf, Ns5atp9, KIAA0101 and OEATC-1) as a specific ubiquitination target of UHRF1. Although the function of PAF15 ubiquitination in translesion DNA synthesis is well characterized, the respective E3 ligase had been unknown. We could show that UHRF1 ubiquitinates PAF15 at Lys 15 and Lys 24 and promotes its binding to PCNA during late S-phase. In summary, we identified novel ubiquitination targets that link UHRF1 to transcriptional regulation and DNA damage response. Copyright © 2017. Published by Elsevier Ltd.

  17. Deciphering the ubiquitin-mediated pathway in apicomplexan parasites: a potential strategy to interfere with parasite virulence. (United States)

    Ponts, Nadia; Yang, Jianfeng; Chung, Duk-Won Doug; Prudhomme, Jacques; Girke, Thomas; Horrocks, Paul; Le Roch, Karine G


    Reversible modification of proteins through the attachment of ubiquitin or ubiquitin-like modifiers is an essential post-translational regulatory mechanism in eukaryotes. The conjugation of ubiquitin or ubiquitin-like proteins has been demonstrated to play roles in growth, adaptation and homeostasis in all eukaryotes, with perturbation of ubiquitin-mediated systems associated with the pathogenesis of many human diseases, including cancer and neurodegenerative disorders. Here we describe the use of an HMM search of functional Pfam domains found in the key components of the ubiquitin-mediated pathway necessary to activate and reversibly modify target proteins in eight apicomplexan parasitic protozoa for which complete or late-stage genome projects exist. In parallel, the same search was conducted on five model organisms, single-celled and metazoans, to generate data to validate both the search parameters employed and aid paralog classification in Apicomplexa. For each of the 13 species investigated, a set of proteins predicted to be involved in the ubiquitylation pathway has been identified and demonstrates increasing component members of the ubiquitylation pathway correlating with organism and genome complexity. Sequence homology and domain architecture analyses facilitated prediction of apicomplexan-specific protein function, particularly those involved in regulating cell division during these parasite's complex life cycles. This study provides a comprehensive analysis of proteins predicted to be involved in the apicomplexan ubiquitin-mediated pathway. Given the importance of such pathway in a wide variety of cellular processes, our data is a key step in elucidating the biological networks that, in part, direct the pathogenicity of these parasites resulting in a massive impact on global health. Moreover, apicomplexan-specific adaptations of the ubiquitylation pathway may represent new therapeutic targets for much needed drugs against apicomplexan parasites.

  18. Expression and cellular distribution of ubiquitin in response to injury in the developing spinal cord of Monodelphis domestica.

    Directory of Open Access Journals (Sweden)

    Natassya M Noor

    Full Text Available Ubiquitin, an 8.5 kDa protein associated with the proteasome degradation pathway has been recently identified as differentially expressed in segment of cord caudal to site of injury in developing spinal cord. Here we describe ubiquitin expression and cellular distribution in spinal cord up to postnatal day P35 in control opossums (Monodelphis domestica and in response to complete spinal transection (T10 at P7, when axonal growth through site of injury occurs, and P28 when this is no longer possible. Cords were collected 1 or 7 days after injury, with age-matched controls and segments rostral to lesion were studied. Following spinal injury ubiquitin levels (western blotting appeared reduced compared to controls especially one day after injury at P28. In contrast, after injury mRNA expression (qRT-PCR was slightly increased at P7 but decreased at P28. Changes in isoelectric point of separated ubiquitin indicated possible post-translational modifications. Cellular distribution demonstrated a developmental shift between earliest (P8 and latest (P35 ages examined, from a predominantly cytoplasmic immunoreactivity to a nuclear expression; staining level and shift to nuclear staining was more pronounced following injury, except 7 days after transection at P28. After injury at P7 immunostaining increased in neurons and additionally in oligodendrocytes at P28. Mass spectrometry showed two ubiquitin bands; the heavier was identified as a fusion product, likely to be an ubiquitin precursor. Apparent changes in ubiquitin expression and cellular distribution in development and response to spinal injury suggest an intricate regulatory system that modulates these responses which, when better understood, may lead to potential therapeutic targets.

  19. The human ubiquitin-conjugating enzyme Cdc34 controls cellular proliferation through regulation of p27Kip1 protein levels

    International Nuclear Information System (INIS)

    Butz, Nicole; Ruetz, Stephan; Natt, Francois; Hall, Jonathan; Weiler, Jan; Mestan, Juergen; Ducarre, Monique; Grossenbacher, Rita; Hauser, Patrick; Kempf, Dominique; Hofmann, Francesco


    Ubiquitin-mediated degradation of the cyclin-dependent kinase inhibitor p27 Kip1 was shown to be required for the activation of key cyclin-dependent kinases, thereby triggering the onset of DNA replication and cell cycle progression. Although the SCF Skp2 ubiquitin ligase has been reported to mediate p27 Kip1 degradation, the nature of the human ubiquitin-conjugating enzyme involved in this process has not yet been determined at the cellular level. Here, we show that antisense oligonucleotides targeting the human ubiquitin-conjugating enzyme Cdc34 downregulate its expression, inhibit the degradation of p27 Kip1 , and prevent cellular proliferation. Elevation of p27 Kip1 protein level is found to be the sole requirement for the inhibition of cellular proliferation induced upon downregulation of Cdc34. Indeed, reducing the expression of p27 Kip1 with a specific antisense oligonucleotide is sufficient to reverse the anti-proliferative phenotype elicited by the Cdc34 antisense. Furthermore, downregulation of Cdc34 is found to specifically increase the abundance of the SCF Skp2 ubiquitin ligase substrate p27 Kip1 , but has no concomitant effect on the level of IkBα and β-catenin, which are known substrates of a closely related SCF ligase

  20. The Sumo-targeted ubiquitin ligase RNF4 regulates the localization and function of the HTLV-1 oncoprotein Tax (United States)

    Fryrear, Kimberly A.; Guo, Xin


    The Really Interesting New Gene (RING) Finger Protein 4 (RNF4) represents a class of ubiquitin ligases that target Small Ubiquitin-like Modifier (SUMO)–modified proteins for ubiquitin modification. To date, the regulatory function of RNF4 appears to be ubiquitin-mediated degradation of sumoylated cellular proteins. In the present study, we show that the Human T-cell Leukemia Virus Type 1 (HTLV-1) oncoprotein Tax is a substrate for RNF4 both in vivo and in vitro. We mapped the RNF4-binding site to a region adjacent to the Tax ubiquitin/SUMO modification sites K280/K284. Interestingly, RNF4 modification of Tax protein results in relocalization of the oncoprotein from the nucleus to the cytoplasm. Overexpression of RNF4, but not the RNF4 RING mutant, resulted in cytoplasmic enrichment of Tax. The RNF4-induced nucleus-to-cytoplasm relocalization was associated with increased NF-κB–mediated and decreased cAMP Response Element-Binding (CREB)–mediated Tax activity. Finally, depletion of RNF4 by RNAi prevented the DNA damage–induced nuclear/cytoplasmic translocation of Tax. These results provide important new insight into STUbL-mediated pathways that regulate the subcellular localization and functional dynamics of viral oncogenes. PMID:22106342

  1. The role of the ubiquitination–proteasome pathway in breast cancer: Use of mouse models for analyzing ubiquitination processes

    International Nuclear Information System (INIS)

    Rossi, Sabrina; Loda, Massimo


    Turnover of several regulatory proteins results from targeted destruction via ubiquitination and subsequent degradation through the proteosome. The timely and irreversible degradation of critical regulators is essential for normal cellular function. The precise biochemical mechanisms that are involved in protein turnover by ubiquitin-mediated degradation have been elucidated using in vitro assays and cell culture systems. However, pathways that lead to ubiquitination of critical regulatory proteins in vivo are more complex, and have both temporal and tissue-specific differences. In vivo models will allow identification of substrates and enzymes of the ubiquitin–proteosome pathway that play important roles in selected tissues and diseases. In addition, assessment of the therapeutic efficacy of drugs designed to inhibit or enhance protein turnover by ubiquitination requires in vivo models. In the present review we describe selected examples of transgenic and knockout models of proteins that are known either to be regulated by ubiquitin-mediated degradation or to have a catalytic function in this process, and to play an important role in breast cancer. We outline the functions of these proteins in vivo and focus on knowledge gained in the comparison of in vivo behavior predicted from cell-free in vitro data or from experiments conducted in cell culture systems

  2. Mass spectrometric and mutational analyses reveal Lys-6-linked polyubiquitin chains catalyzed by BRCA1-BARD1 ubiquitin ligase. (United States)

    Nishikawa, Hiroyuki; Ooka, Seido; Sato, Ko; Arima, Kei; Okamoto, Joji; Klevit, Rachel E; Fukuda, Mamoru; Ohta, Tomohiko


    The breast and ovarian cancer suppressor BRCA1 acquires significant ubiquitin ligase activity when bound to BARD1 as a RING heterodimer. Although the activity may well be important for the role of BRCA1 as a tumor suppressor, the biochemical consequence of the activity is not yet known. Here we report that BRCA1-BARD1 catalyzes Lys-6-linked polyubiquitin chain formation. K6R mutation of ubiquitin dramatically reduces the polyubiquitin products mediated by BRCA1-BARD1 in vitro. BRCA1-BARD1 preferentially utilizes ubiquitin with a single Lys residue at Lys-6 or Lys-29 to mediate autoubiquitination of BRCA1 in vivo. Furthermore, mass spectrometry analysis identified the Lys-6-linked branched ubiquitin fragment from the polyubiquitin chain produced by BRCA1-BARD1 using wild type ubiquitin. The BRCA1-BARD1-mediated Lys-6-linked polyubiquitin chains are deubiquitinated by 26 S proteasome in vitro, whereas autoubiquitinated CUL1 through Lys-48-linked polyubiquitin chains is degraded. Proteasome inhibitors do not alter the steady state level of the autoubiquitinated BRCA1 in vivo. Hence, the results indicate that BRCA1-BARD1 mediates novel polyubiquitin chains that may be distinctly edited by 26 S proteasome from conventional Lys-48-linked polyubiquitin chains.

  3. Functions of Ubiquitin and SUMO in DNA Replication and Replication Stress (United States)

    García-Rodríguez, Néstor; Wong, Ronald P.; Ulrich, Helle D.


    Complete and faithful duplication of its entire genetic material is one of the essential prerequisites for a proliferating cell to maintain genome stability. Yet, during replication DNA is particularly vulnerable to insults. On the one hand, lesions in replicating DNA frequently cause a stalling of the replication machinery, as most DNA polymerases cannot cope with defective templates. This situation is aggravated by the fact that strand separation in preparation for DNA synthesis prevents common repair mechanisms relying on strand complementarity, such as base and nucleotide excision repair, from working properly. On the other hand, the replication process itself subjects the DNA to a series of hazardous transformations, ranging from the exposure of single-stranded DNA to topological contortions and the generation of nicks and fragments, which all bear the risk of inducing genomic instability. Dealing with these problems requires rapid and flexible responses, for which posttranslational protein modifications that act independently of protein synthesis are particularly well suited. Hence, it is not surprising that members of the ubiquitin family, particularly ubiquitin itself and SUMO, feature prominently in controlling many of the defensive and restorative measures involved in the protection of DNA during replication. In this review we will discuss the contributions of ubiquitin and SUMO to genome maintenance specifically as they relate to DNA replication. We will consider cases where the modifiers act during regular, i.e., unperturbed stages of replication, such as initiation, fork progression, and termination, but also give an account of their functions in dealing with lesions, replication stalling and fork collapse. PMID:27242895

  4. Effect of ionizing radiation exposure on Trypanosoma cruzi ubiquitin-proteasome system. (United States)

    Cerqueira, Paula G; Passos-Silva, Danielle G; Vieira-da-Rocha, João P; Mendes, Isabela Cecilia; de Oliveira, Karla A; Oliveira, Camila F B; Vilela, Liza F F; Nagem, Ronaldo A P; Cardoso, Joseane; Nardelli, Sheila C; Krieger, Marco A; Franco, Glória R; Macedo, Andrea M; Pena, Sérgio D J; Schenkman, Sérgio; Gomes, Dawidson A; Guerra-Sá, Renata; Machado, Carlos R


    In recent years, proteasome involvement in the damage response induced by ionizing radiation (IR) became evident. However, whether proteasome plays a direct or indirect role in IR-induced damage response still unclear. Trypanosoma cruzi is a human parasite capable of remarkable high tolerance to IR, suggesting a highly efficient damage response system. Here, we investigate the role of T. cruzi proteasome in the damage response induced by IR. We exposed epimastigotes to high doses of gamma ray and we analyzed the expression and subcellular localization of several components of the ubiquitin-proteasome system. We show that proteasome inhibition increases IR-induced cell growth arrest and proteasome-mediated proteolysis is altered after parasite exposure. We observed nuclear accumulation of 19S and 20S proteasome subunits in response to IR treatments. Intriguingly, the dynamic of 19S particle nuclear accumulation was more similar to the dynamic observed for Rad51 nuclear translocation than the observed for 20S. In the other hand, 20S increase and nuclear translocation could be related with an increase of its regulator PA26 and high levels of proteasome-mediated proteolysis in vitro. The intersection between the opposed peaks of 19S and 20S protein levels was marked by nuclear accumulation of both 20S and 19S together with Ubiquitin, suggesting a role of ubiquitin-proteasome system in the nuclear protein turnover at the time. Our results revealed the importance of proteasome-mediated proteolysis in T. cruzi IR-induced damage response suggesting that proteasome is also involved in T. cruzi IR tolerance. Moreover, our data support the possible direct/signaling role of 19S in DNA damage repair. Based on these results, we speculate that spatial and temporal differences between the 19S particle and 20S proteasome controls proteasome multiple roles in IR damage response. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. The ubiquitin ligase ASB4 promotes trophoblast differentiation through the degradation of ID2.

    Directory of Open Access Journals (Sweden)

    W H Davin Townley-Tilson

    Full Text Available Vascularization of the placenta is a critical developmental process that ensures fetal viability. Although the vascular health of the placenta affects both maternal and fetal well being, relatively little is known about the early stages of placental vascular development. The ubiquitin ligase Ankyrin repeat, SOCS box-containing 4 (ASB4 promotes embryonic stem cell differentiation to vascular lineages and is highly expressed early in placental development. The transcriptional regulator Inhibitor of DNA binding 2 (ID2 negatively regulates vascular differentiation during development and is a target of many ubiquitin ligases. Due to their overlapping spatiotemporal expression pattern in the placenta and contrasting effects on vascular differentiation, we investigated whether ASB4 regulates ID2 through its ligase activity in the placenta and whether this activity mediates vascular differentiation. In mouse placentas, ASB4 expression is restricted to a subset of cells that express both stem cell and endothelial markers. Placentas that lack Asb4 display immature vascular patterning and retain expression of placental progenitor markers, including ID2 expression. Using JAR placental cells, we determined that ASB4 ubiquitinates and represses ID2 expression in a proteasome-dependent fashion. Expression of ASB4 in JAR cells and primary isolated trophoblast stem cells promotes the expression of differentiation markers. In functional endothelial co-culture assays, JAR cells ectopically expressing ASB4 increased endothelial cell turnover and stabilized endothelial tube formation, both of which are hallmarks of vascular differentiation within the placenta. Co-transfection of a degradation-resistant Id2 mutant with Asb4 inhibits both differentiation and functional responses. Lastly, deletion of Asb4 in mice induces a pathology that phenocopies human pre-eclampsia, including hypertension and proteinuria in late-stage pregnant females. These results indicate that

  6. COMMD1 regulates the delta epithelial sodium channel (δENaC) through trafficking and ubiquitination

    International Nuclear Information System (INIS)

    Chang, Tina; Ke, Ying; Ly, Kevin; McDonald, Fiona J.


    Highlights: → The COMM domain of COMMD1 mediates binding to δENaC. → COMMD1 reduces the cell surface population of δENaC. → COMMD1 increases the population of δENaC-ubiquitin. → Both endogenous and transfected δENaC localize with COMMD1 and transferrin suggesting they are located in early/recycling endosomes. -- Abstract: The delta subunit of the epithelial sodium channel (δENaC) is a member of the ENaC/degenerin family of ion channels. δENaC is distinct from the related α-, β- and γENaC subunits, known for their role in sodium homeostasis and blood pressure control, as δENaC is expressed in brain neurons and activated by external protons. COMMD1 (copper metabolism Murr1 domain 1) was previously found to associate with and downregulate δENaC activity. Here, we show that COMMD1 interacts with δENaC through its COMM domain. Co-expression of δENaC with COMMD1 significantly reduced δENaC surface expression, and led to an increase in δENaC ubiquitination. Immunocytochemical and confocal microscopy studies show that COMMD1 promoted localization of δENaC to the early/recycling endosomal pool where the two proteins were localized together. These results suggest that COMMD1 downregulates δENaC activity by reducing δENaC surface expression through promoting internalization of surface δENaC to an intracellular recycling pool, possibly via enhanced ubiquitination.

  7. The ubiquitin ligase tripartite-motif-protein 32 is induced in Duchenne muscular dystrophy. (United States)

    Assereto, Stefania; Piccirillo, Rosanna; Baratto, Serena; Scudieri, Paolo; Fiorillo, Chiara; Massacesi, Manuela; Traverso, Monica; Galietta, Luis J; Bruno, Claudio; Minetti, Carlo; Zara, Federico; Gazzerro, Elisabetta


    Activation of the proteasome pathway is one of the secondary processes of cell damage, which ultimately lead to muscle degeneration and necrosis in Duchenne muscular dystrophy (DMD). In mdx mice, the proteasome inhibitor bortezomib up-regulates the membrane expression of members of the dystrophin complex and reduces the inflammatory reaction. However, chronic inhibition of the 26S proteasome may be toxic, as indicated by the systemic side-effects caused by this drug. Therefore, we sought to determine the components of the ubiquitin-proteasome pathway that are specifically activated in human dystrophin-deficient muscles. The analysis of a cohort of patients with genetically determined DMD or Becker muscular dystrophy (BMD) unveiled a selective up-regulation of the ubiquitin ligase tripartite motif-containing protein 32 (TRIM32). The induction of TRIM32 was due to a transcriptional effect and it correlated with disease severity in BMD patients. In contrast, atrogin1 and muscle RING-finger protein-1 (MuRF-1), which are strongly increased in distinct types of muscular atrophy, were not affected by the DMD dystrophic process. Knock-out models showed that TRIM32 is involved in ubiquitination of muscle cytoskeletal proteins as well as of protein inhibitor of activated STAT protein gamma (Piasγ) and N-myc downstream-regulated gene, two inhibitors of satellite cell proliferation and differentiation. Accordingly, we showed that in DMD/BMD muscle tissue, TRIM32 induction was more pronounced in regenerating myofibers rather than in necrotic muscle cells, thus pointing out a role of this protein in the regulation of human myoblast cell fate. This finding highlights TRIM32 as a possible therapeutic target to favor skeletal muscle regeneration in DMD patients.

  8. Generation and Validation of Intracellular Ubiquitin Variant Inhibitors for USP7 and USP10

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Wei; Sartori, Maria A.; Makhnevych, Taras; Federowicz, Kelly E.; Dong, Xiaohui; Liu, Li; Nim, Satra; Dong, Aiping; Yang, Jingsong; Li, Yanjun; Haddad, Dania; Ernst, Andreas; Heerding, Dirk; Tong, Yufeng; Moffat, Jason; Sidhu, Sachdev S.


    Post-translational modification of the p53 signaling pathway plays an important role in cell cycle progression and stress-induced apoptosis. Indeed, a large body of work has shown that dysregulation of p53 and its E3 ligase MDM2 by the ubiquitin-proteasome system (UPS) promotes carcinogenesis and malignant transformation. Thus, drug discovery efforts have focused on the restoration of wild-type p53 activity or inactivation of oncogenic mutant p53 by targeted inhibition of UPS components, particularly key deubiquitinases (DUBs) of the ubiquitin-specific protease (USP) class. However, development of selective small-molecule USP inhibitors has been challenging, partly due to the highly conserved structural features of the catalytic sites across the class. To tackle this problem, we devised a protein engineering strategy for rational design of inhibitors for DUBs and other UPS proteins. We employed a phage-displayed ubiquitin variant (UbV) library to develop inhibitors targeting the DUBs USP7 and USP10, which are involved in regulating levels of p53 and MDM2. We were able to identify UbVs that bound USP7 or USP10 with high affinity and inhibited deubiquitination activity. We solved the crystal structure of UbV.7.2 and rationalized the molecular basis for enhanced affinity and specificity for USP7. Finally, cell death was increased significantly by UbV.7.2 expression in a colon cancer cell line that was treated with the chemotherapy drug cisplatin, demonstrating the therapeutic potential of inhibiting USP7 by this approach

  9. The Anaphase-Promoting Complex (APC) ubiquitin ligase affects chemosensory behavior in C. elegans. (United States)

    Wang, Julia; Jennings, Alexandra K; Kowalski, Jennifer R


    The regulation of fundamental aspects of neurobiological function has been linked to the ubiquitin signaling system (USS), which regulates the degradation and activity of proteins and is catalyzed by E1, E2, and E3 enzymes. The Anaphase-Promoting Complex (APC) is a multi-subunit E3 ubiquitin ligase that controls diverse developmental and signaling processes in post-mitotic neurons; however, potential roles for the APC in sensory function have yet to be explored. In this study, we examined the effect of the APC ubiquitin ligase on chemosensation in Caenorhabditis elegans by testing chemotaxis to the volatile odorants, diacetyl, pyrazine, and isoamyl alcohol, to which wild-type worms are attracted. Animals with loss of function mutations in either of two alleles (g48 and ye143) of the gene encoding the APC subunit EMB-27 APC6 showed increased chemotaxis towards diacetyl and pyrazine, odorants sensed by AWA neurons, but exhibited normal chemotaxis to isoamyl alcohol, which is sensed by AWC neurons. The statistically significant increase in chemotaxis in the emb-27 APC6 mutants suggests that the APC inhibits AWA-mediated chemosensation in C. elegans. Increased chemotaxis to pyrazine was also seen with mutants lacking another essential APC subunit, MAT-2 APC1; however, mat-2 APC1 mutants exhibited wild type responses to diacetyl. The difference in responsiveness of these two APC subunit mutants may be due to differential strength of these hypomorphic alleles or may indicate the presence of functional sub-complexes of the APC at work in this process. These findings are the first evidence for APC-mediated regulation of chemosensation and lay the groundwork for further studies aimed at identifying the expression levels, function, and targets of the APC in specific sensory neurons. Because of the similarity between human and C. elegans nervous systems, the role of the APC in sensory neurons may also advance our understanding of human sensory function and disease.

  10. Proteolytic regulation of metabolic enzymes by E3 ubiquitin ligase complexes: lessons from yeast. (United States)

    Nakatsukasa, Kunio; Okumura, Fumihiko; Kamura, Takumi


    Eukaryotic organisms use diverse mechanisms to control metabolic rates in response to changes in the internal and/or external environment. Fine metabolic control is a highly responsive, energy-saving process that is mediated by allosteric inhibition/activation and/or reversible modification of preexisting metabolic enzymes. In contrast, coarse metabolic control is a relatively long-term and expensive process that involves modulating the level of metabolic enzymes. Coarse metabolic control can be achieved through the degradation of metabolic enzymes by the ubiquitin-proteasome system (UPS), in which substrates are specifically ubiquitinated by an E3 ubiquitin ligase and targeted for proteasomal degradation. Here, we review select multi-protein E3 ligase complexes that directly regulate metabolic enzymes in Saccharomyces cerevisiae. The first part of the review focuses on the endoplasmic reticulum (ER) membrane-associated Hrd1 and Doa10 E3 ligase complexes. In addition to their primary roles in the ER-associated degradation pathway that eliminates misfolded proteins, recent quantitative proteomic analyses identified native substrates of Hrd1 and Doa10 in the sterol synthesis pathway. The second part focuses on the SCF (Skp1-Cul1-F-box protein) complex, an abundant prototypical multi-protein E3 ligase complex. While the best-known roles of the SCF complex are in the regulation of the cell cycle and transcription, accumulating evidence indicates that the SCF complex also modulates carbon metabolism pathways. The increasing number of metabolic enzymes whose stability is directly regulated by the UPS underscores the importance of the proteolytic regulation of metabolic processes for the acclimation of cells to environmental changes.

  11. COMMD1 regulates the delta epithelial sodium channel ({delta}ENaC) through trafficking and ubiquitination

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Tina; Ke, Ying; Ly, Kevin [Department of Physiology, University of Otago, P.O. Box 913, Dunedin 9054 (New Zealand); McDonald, Fiona J., E-mail: [Department of Physiology, University of Otago, P.O. Box 913, Dunedin 9054 (New Zealand)


    Highlights: {yields} The COMM domain of COMMD1 mediates binding to {delta}ENaC. {yields} COMMD1 reduces the cell surface population of {delta}ENaC. {yields} COMMD1 increases the population of {delta}ENaC-ubiquitin. {yields} Both endogenous and transfected {delta}ENaC localize with COMMD1 and transferrin suggesting they are located in early/recycling endosomes. -- Abstract: The delta subunit of the epithelial sodium channel ({delta}ENaC) is a member of the ENaC/degenerin family of ion channels. {delta}ENaC is distinct from the related {alpha}-, {beta}- and {gamma}ENaC subunits, known for their role in sodium homeostasis and blood pressure control, as {delta}ENaC is expressed in brain neurons and activated by external protons. COMMD1 (copper metabolism Murr1 domain 1) was previously found to associate with and downregulate {delta}ENaC activity. Here, we show that COMMD1 interacts with {delta}ENaC through its COMM domain. Co-expression of {delta}ENaC with COMMD1 significantly reduced {delta}ENaC surface expression, and led to an increase in {delta}ENaC ubiquitination. Immunocytochemical and confocal microscopy studies show that COMMD1 promoted localization of {delta}ENaC to the early/recycling endosomal pool where the two proteins were localized together. These results suggest that COMMD1 downregulates {delta}ENaC activity by reducing {delta}ENaC surface expression through promoting internalization of surface {delta}ENaC to an intracellular recycling pool, possibly via enhanced ubiquitination.

  12. Ubiquitin Ligase gp78 Targets Unglycosylated Prion Protein PrP for Ubiquitylation and Degradation


    Shao, Jia; Choe, Vitnary; Cheng, Haili; Tsai, Yien Che; Weissman, Allan M.; Luo, Shiwen; Rao, Hai


    Prion protein PrP is a central player in several devastating neurodegenerative disorders, including mad cow disease and Creutzfeltd-Jacob disease. Conformational alteration of PrP into an aggregation-prone infectious form PrPSc can trigger pathogenic events. How levels of PrP are regulated is poorly understood. Human PrP is known to be degraded by the proteasome, but the specific proteolytic pathway responsible for PrP destruction remains elusive. Here, we demonstrate that the ubiquitin ligas...

  13. Pseudosubstrate regulation of the SCF(beta-TrCP) ubiquitin ligase by hnRNP-U

    DEFF Research Database (Denmark)

    Davis, Matti; Hatzubai, Ada; Andersen, Jens S


    in the nucleus. Here we report the isolation of the major E3RS-associated protein, hnRNP-U, an abundant nuclear phosphoprotein. This protein occupies E3RS in a specific and stoichiometric manner, stabilizes the E3 component, and is likely responsible for its nuclear localization. hnRNP-U binding was abolished....... Consequently, hnRNP-U engages a highly neddylated active SCF(beta-TrCP), which dissociates in the presence of a high-affinity substrate, resulting in ubiquitination of the latter. Our study points to a novel regulatory mechanism, which secures the localization, stability, substrate binding threshold...

  14. Ubiquitin ligase activity of TFIIH and the transcriptional response to DNA damage. (United States)

    Takagi, Yuichiro; Masuda, Claudio A; Chang, Wei-Hau; Komori, Hirofumi; Wang, Dong; Hunter, Tony; Joazeiro, Claudio A P; Kornberg, Roger D


    Core transcription factor (TF) IIH purified from yeast possesses an E3 ubiquitin (Ub) ligase activity, which resides, at least in part, in a RING finger (RNF) domain of the Ssl1 subunit. Yeast strains mutated in the Ssl1 RNF domain are sensitive to ultraviolet (UV) light and to methyl methanesulfonate (MMS). This increased sensitivity to DNA-damaging agents does not reflect a deficiency in nucleotide excision repair. Rather, it correlates with reduced transcriptional induction of genes involved in DNA repair, suggesting that the E3 Ub ligase activity of TFIIH mediates the transcriptional response to DNA damage.

  15. Unfolding of Ubiquitin Studied by Picosecond Time-Resolved Fluorescence of the Tyrosine Residue


    Noronha, Melinda; Lima, João C.; Bastos, Margarida; Santos, Helena; Maçanita, António L.


    The photophysics of the single tyrosine in bovine ubiquitin (UBQ) was studied by picosecond time-resolved fluorescence spectroscopy, as a function of pH and along thermal and chemical unfolding, with the following results: First, at room temperature (25°C) and below pH 1.5, native UBQ shows single-exponential decays. From pH 2 to 7, triple-exponential decays were observed and the three decay times were attributed to the presence of tyrosine, a tyrosine-carboxylate hydrogen-bonded complex, and...

  16. Molecular polymorphism as a tool for differentiating ground beetles (Carabus species): application of ubiquitin PCR/SSCP analysis. (United States)

    Boge, A; Gerstmeier, R; Einspanier, R


    Differentiation between Carabus species (ground beetle) and subspecies is difficult, although there have been extensive studies. To address this problem we have applied PCR in combination with SSCP analysis focussing on the evolutionally conservative ubiquitin gene to elaborate a new approach to molecular differentiation between species. We report that Carabidae possess an ubiquitin gene and that its gene has a multimeric structure. Differential SSCP analysis was performed with the monomeric form of the gene to generate a clear SSCP pattern. Such PCR/SSCP resulted in reproducible patterns throughout our experiments. Comparing different Carabus species (Carabus granulatus, C. irregularis, C. violaceus and C. auronitens) we could observe clear interspecies differences but no differences between genders. Some species showed some remarkable differences between the individuals. We suggest that the ubiquitin PCR-SSCP technique might be an additional tool for the differentiation of ground beetles.

  17. RMND5 from Xenopus laevis is an E3 ubiquitin-ligase and functions in early embryonic forebrain development. (United States)

    Pfirrmann, Thorsten; Villavicencio-Lorini, Pablo; Subudhi, Abinash K; Menssen, Ruth; Wolf, Dieter H; Hollemann, Thomas


    In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of the skin and its suppression results in malformations of the fore- and midbrain. We therefore suggest that Xenopus laevis Rmnd5, as a subunit of the CTLH complex, is a ubiquitin-ligase targeting an unknown factor for polyubiquitination and subsequent proteasomal degradation for proper fore- and midbrain development.

  18. RMND5 from Xenopus laevis is an E3 ubiquitin-ligase and functions in early embryonic forebrain development.

    Directory of Open Access Journals (Sweden)

    Thorsten Pfirrmann

    Full Text Available In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of the skin and its suppression results in malformations of the fore- and midbrain. We therefore suggest that Xenopus laevis Rmnd5, as a subunit of the CTLH complex, is a ubiquitin-ligase targeting an unknown factor for polyubiquitination and subsequent proteasomal degradation for proper fore- and midbrain development.

  19. Pioglitazone Attenuates Drug-Eluting Stent-Induced Proinflammatory State in Patients by Blocking Ubiquitination of PPAR

    Directory of Open Access Journals (Sweden)

    Zhongxia Wang


    Full Text Available The inflammatory response after polymer-based drug-eluting stent (DES placement has recently emerged as a major concern. The biologic roles of peroxisome proliferator-activated receptor-γ (PPAR-γ activators thiazolidinedione (TZD remain controversial in cardiovascular disease. Herein, we investigated the antiinflammatory effects of pioglitazone (PIO on circulating peripheral blood mononuclear cells (MNCs in patients after coronary DES implantation. Methods and Results. Twenty-eight patients with coronary artery disease and who underwent DES implantations were randomly assigned to pioglitazone (30 mg/d; PIO or placebo (control; Con treatment in addition to optimal standard therapy. After 12 weeks of treatment, plasma concentrations of high-sensitivity C-reactive protein (hs-CRP, interleukin-6 (IL-6, tumor necrosis factor-α (TNF-α, and matrix metalloproteinase-9 (MMP-9 were significantly decreased in PIO group compared to the Con group (P=0.035, 0.011, 0.008, and 0.012, resp.. DES-induced mRNA expressions of IL-6, TNF-α, and MMP-9 in circulating MNC were significantly blocked by PIO (P=0.031, 0.012, and 0.007, resp.. In addition, PIO markedly inhibited DES-enhanced NF-κB function and DES-blocked PPAR-γ activity. Mechanically, DES induced PPAR-γ ubiquitination and degradation in protein level, which can be totally reversed by PIO. Conclusion. PIO treatment attenuated DES-induced PPAR loss, NF-κB activation, and proinflammation, indicating that PIO may have a novel direct protective role in modulating proinflammation in DES era.

  20. Inactivation of the HR6B ubiquitin-conjugating DNA repair enzyme in mice causes male sterility associated with chromatin modification.

    NARCIS (Netherlands)

    J. van Klaveren; J. de Wit (Jan); C.G. van Gurp; M.H.M. Koken (Marcel); M. Vermey; J.H. van Roijen (Jan Herman); J.T.M. Vreeburg (Jan); W.M. Baarends (Willy); D. Bootsma (Dirk); J.A. Grootegoed (Anton); J.H.J. Hoeijmakers (Jan); H.P. Roest (Henk)


    textabstractThe ubiquitin-conjugating yeast enzyme RAD6 and its human homologs hHR6A and hHR6B are implicated in postreplication repair and damage-induced mutagenesis. The yeast protein is also required for sporulation and may modulate chromatin structure via histone ubiquitination. We report the

  1. Ubiquitination-Linked Phosphorylation of the FANCI S/TQ Cluster Contributes to Activation of the Fanconi Anemia I/D2 Complex

    Directory of Open Access Journals (Sweden)

    Ronald S. Cheung


    Full Text Available Repair of interstrand crosslinks by the Fanconi anemia (FA pathway requires both monoubiquitination and de-ubiquitination of the FANCI/FANCD2 (FANCI/D2 complex. In the standing model, the phosphorylation of six sites in the FANCI S/TQ cluster domain occurs upstream of, and promotes, FANCI/D2 monoubiquitination. We generated phospho-specific antibodies against three different S/TQ cluster sites (serines 556, 559, and 565 on human FANCI and found that, in contrast to the standing model, distinct FANCI sites were phosphorylated either predominantly upstream (ubiquitination independent; serine 556 or downstream (ubiquitination-linked; serines 559 and 565 of FANCI/D2 monoubiquitination. Ubiquitination-linked FANCI phosphorylation inhibited FANCD2 de-ubiquitination and bypassed the need to de-ubiquitinate FANCD2 to achieve effective interstrand crosslink repair. USP1 depletion suppressed ubiquitination-linked FANCI phosphorylation despite increasing FANCI/D2 monoubiquitination, providing an explanation of why FANCD2 de-ubiquitination is important for function of the FA pathway. Our work results in a refined model of how FANCI phosphorylation activates the FANCI/D2 complex.

  2. Cellular Ubc2/Rad6 E2 ubiquitin-conjugating enzyme facilitates tombusvirus replication in yeast and plants

    International Nuclear Information System (INIS)

    Imura, Yoshiyuki; Molho, Melissa; Chuang, Chingkai; Nagy, Peter D.


    Mono- and multi-ubiquitination alters the functions and subcellular localization of many cellular and viral proteins. Viruses can co-opt or actively manipulate the ubiquitin network to support viral processes or suppress innate immunity. Using yeast (Saccharomyces cerevisiae) model host, we show that the yeast Rad6p (radiation sensitive 6) E2 ubiquitin-conjugating enzyme and its plant ortholog, AtUbc2, interact with two tombusviral replication proteins and these E2 ubiquitin-conjugating enzymes could be co-purified with the tombusvirus replicase. We demonstrate that TBSV RNA replication and the mono- and bi-ubiquitination level of p33 is decreased in rad6Δ yeast. However, plasmid-based expression of AtUbc2p could complement both defects in rad6Δ yeast. Knockdown of UBC2 expression in plants also decreases tombusvirus accumulation and reduces symptom severity, suggesting that Ubc2p is critical for virus replication in plants. We provide evidence that Rad6p is involved in promoting the subversion of Vps23p and Vps4p ESCRT proteins for viral replicase complex assembly. - Highlights: • Tombusvirus p33 replication protein interacts with cellular RAD6/Ubc2 E2 enzymes. • Deletion of RAD6 reduces tombusvirus replication in yeast. • Silencing of UBC2 in plants inhibits tombusvirus replication. • Mono- and bi-ubiquitination of p33 replication protein in yeast and in vitro. • Rad6p promotes the recruitment of cellular ESCRT proteins into the tombusvirus replicase

  3. Activity-dependent ubiquitination of GluA1 mediates a distinct AMPA receptor endocytosis and sorting pathway. (United States)

    Schwarz, Lindsay A; Hall, Benjamin J; Patrick, Gentry N


    The accurate trafficking of AMPA receptors (AMPARs) to and from the synapse is a critical component of learning and memory in the brain, whereas dysfunction of AMPAR trafficking is hypothesized to be an underlying mechanism of Alzheimer's disease. Previous work has shown that ubiquitination of integral membrane proteins is a common posttranslational modification used to mediate endocytosis and endocytic sorting of surface proteins in eukaryotic cells. Here we report that mammalian AMPARs become ubiquitinated in response to their activation. Using a mutant of GluA1 that is unable to be ubiquitinated at lysines on its C-terminus, we demonstrate that ubiquitination is required for internalization of surface AMPARs and their trafficking to the lysosome in response to the AMPAR agonist AMPA but not for internalization of AMPARs in response to the NMDA receptor agonist NMDA. Through overexpression or RNA interference-mediated knockdown, we identify that a specific E3 ligase, Nedd4-1 (neural-precursor cell-expressed developmentally downregulated gene 4-1), is necessary for this process. Finally, we show that ubiquitination of GluA1 by Nedd4-1 becomes more prevalent as neurons mature. Together, these data show that ubiquitination of GluA1-containing AMPARs by Nedd4-1 mediates their endocytosis and trafficking to the lysosome. Furthermore, these results provide insight into how hippocampal neurons regulate AMPAR trafficking and degradation with high specificity in response to differing neuronal signaling cues and suggest that changes to this pathway may occur as neurons mature.

  4. Ubiquitination of HTLV-I Tax in response to DNA damage regulates nuclear complex formation and nuclear export

    Directory of Open Access Journals (Sweden)

    Marriott Susan J


    Full Text Available Abstract Background The HTLV-I oncoprotein, Tax, is a pleiotropic protein whose activity is partially regulated by its ability to interact with, and perturb the functions of, numerous cellular proteins. Tax is predominantly a nuclear protein that localizes to nuclear foci known as Tax Speckled Structures (TSS. We recently reported that the localization of Tax and its interactions with cellular proteins are altered in response to various forms of genotoxic and cellular stress. The level of cytoplasmic Tax increases in response to stress and this relocalization depends upon the interaction of Tax with CRM1. Cellular pathways and signals that regulate the subcellular localization of Tax remain to be determined. However, post-translational modifications including sumoylation and ubiquitination are known to influence the subcellular localization of Tax and its interactions with cellular proteins. The sumoylated form of Tax exists predominantly in the nucleus while ubiquitinated Tax exists predominantly in the cytoplasm. Therefore, we hypothesized that post-translational modifications of Tax that occur in response to DNA damage regulate the localization of Tax and its interactions with cellular proteins. Results We found a significant increase in mono-ubiquitination of Tax in response to UV irradiation. Mutation of specific lysine residues (K280 and K284 within Tax inhibited DNA damage-induced ubiquitination. In contrast to wild-type Tax, which undergoes transient nucleocytoplasmic shuttling in response to DNA damage, the K280 and K284 mutants were retained in nuclear foci following UV irradiation and remained co-localized with the cellular TSS protein, sc35. Conclusion This study demonstrates that the localization of Tax, and its interactions with cellular proteins, are dynamic following DNA damage and depend on the post-translational modification status of Tax. Specifically, DNA damage induces the ubiquitination of Tax at K280 and K284

  5. Cellular Ubc2/Rad6 E2 ubiquitin-conjugating enzyme facilitates tombusvirus replication in yeast and plants

    Energy Technology Data Exchange (ETDEWEB)

    Imura, Yoshiyuki, E-mail:; Molho, Melissa; Chuang, Chingkai; Nagy, Peter D., E-mail:


    Mono- and multi-ubiquitination alters the functions and subcellular localization of many cellular and viral proteins. Viruses can co-opt or actively manipulate the ubiquitin network to support viral processes or suppress innate immunity. Using yeast (Saccharomyces cerevisiae) model host, we show that the yeast Rad6p (radiation sensitive 6) E2 ubiquitin-conjugating enzyme and its plant ortholog, AtUbc2, interact with two tombusviral replication proteins and these E2 ubiquitin-conjugating enzymes could be co-purified with the tombusvirus replicase. We demonstrate that TBSV RNA replication and the mono- and bi-ubiquitination level of p33 is decreased in rad6Δ yeast. However, plasmid-based expression of AtUbc2p could complement both defects in rad6Δ yeast. Knockdown of UBC2 expression in plants also decreases tombusvirus accumulation and reduces symptom severity, suggesting that Ubc2p is critical for virus replication in plants. We provide evidence that Rad6p is involved in promoting the subversion of Vps23p and Vps4p ESCRT proteins for viral replicase complex assembly. - Highlights: • Tombusvirus p33 replication protein interacts with cellular RAD6/Ubc2 E2 enzymes. • Deletion of RAD6 reduces tombusvirus replication in yeast. • Silencing of UBC2 in plants inhibits tombusvirus replication. • Mono- and bi-ubiquitination of p33 replication protein in yeast and in vitro. • Rad6p promotes the recruitment of cellular ESCRT proteins into the tombusvirus replicase.

  6. A Plastid Protein That Evolved from Ubiquitin and Is Required for Apicoplast Protein Import in Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Justin D. Fellows


    Full Text Available Apicomplexan parasites cause a variety of important infectious diseases, including malaria, toxoplasma encephalitis, and severe diarrhea due to Cryptosporidium. Most apicomplexans depend on an organelle called the apicoplast which is derived from a red algal endosymbiont. The apicoplast is essential for the parasite as the compartment of fatty acid, heme, and isoprenoid biosynthesis. The majority of the approximate 500 apicoplast proteins are nucleus encoded and have to be imported across the four membranes that surround the apicoplast. Import across the second outermost membrane of the apicoplast, the periplastid membrane, depends on an apicoplast-specific endoplasmic reticulum-associated protein degradation (ERAD complex and on enzymes of the associated ubiquitination cascade. However, identification of an apicoplast ubiquitin associated with this machinery has long been elusive. Here we identify a plastid ubiquitin-like protein (PUBL, an apicoplast protein that is derived from a ubiquitin ancestor but that has significantly changed in its primary sequence. PUBL is distinct from known ubiquitin-like proteins, and phylogenomic analyses suggest a clade specific to apicomplexans. We demonstrate that PUBL and the AAA ATPase CDC48AP both act to translocate apicoplast proteins across the periplastid membrane during protein import. Conditional null mutants and genetic complementation show that both proteins are critical for this process and for parasite survival. PUBL residues homologous to those that are required for ubiquitin conjugation onto target proteins are essential for this function, while those required for polyubiquitination and preprotein processing are dispensable. Our experiments provide a mechanistic understanding of the molecular machinery that drives protein import across the membranes of the apicoplast.

  7. A new class of ubiquitin extension proteins secreted by the dorsal pharyngeal gland in plant parasitic cyst nematodes. (United States)

    Tytgat, Tom; Vanholme, Bartel; De Meutter, Jan; Claeys, Myriam; Couvreur, Marjolein; Vanhoutte, Isabelle; Gheysen, Greetje; Van Criekinge, Wim; Borgonie, Gaetan; Coomans, August; Gheysen, Godelieve


    By performing cDNA AFLP on pre- and early parasitic juveniles, we identified genes encoding a novel type of ubiquitin extension proteins secreted by the dorsal pharyngeal gland in the cyst nematode Heterodera schachtii. The proteins consist of three domains, a signal peptide for secretion, a mono-ubiquitin domain, and a short C-terminal positively charged domain. A gfp-fusion of this protein is targeted to the nucleolus in tobacco BY-2 cells. We hypothesize that the C-terminal peptide might have a regulatory function during syncytium formation in plant roots.

  8. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    International Nuclear Information System (INIS)

    Nakada, Shinichiro


    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway

  9. A bacterial E3 ubiquitin ligase targets a host protein kinase to disrupt plant immunity. (United States)

    Rosebrock, Tracy R; Zeng, Lirong; Brady, Jennifer J; Abramovitch, Robert B; Xiao, Fangming; Martin, Gregory B


    Many bacterial pathogens of plants and animals use a type III secretion system to deliver diverse virulence-associated 'effector' proteins into the host cell. The mechanisms by which these effectors act are mostly unknown; however, they often promote disease by suppressing host immunity. One type III effector, AvrPtoB, expressed by the plant pathogen Pseudomonas syringae pv. tomato, has a carboxy-terminal domain that is an E3 ubiquitin ligase. Deletion of this domain allows an amino-terminal region of AvrPtoB (AvrPtoB(1-387)) to be detected by certain tomato varieties leading to immunity-associated programmed cell death. Here we show that a host kinase, Fen, physically interacts with AvrPtoB(1-387 )and is responsible for activating the plant immune response. The AvrPtoB E3 ligase specifically ubiquitinates Fen and promotes its degradation in a proteasome-dependent manner. This degradation leads to disease susceptibility in Fen-expressing tomato lines. Various wild species of tomato were found to exhibit immunity in response to AvrPtoB(1-387 )and not to full-length AvrPtoB. Thus, by acquiring an E3 ligase domain, AvrPtoB has thwarted a highly conserved host resistance mechanism.

  10. The SCF ubiquitin ligase Slimb controls Nerfin-1 turnover in Drosophila. (United States)

    Lin, Xiaohui; Wang, Feng; Li, Yuanpei; Zhai, Chaojun; Wang, Guiping; Zhang, Xiaoting; Gao, Yang; Yi, Tao; Sun, Dan; Wu, Shian


    The C2H2 type zinc-finger transcription factor Nerfin-1 expresses dominantly in Drosophila nervous system and plays an important role in early axon guidance decisions and preventing neurons dedifferentiation. Recently, increasing reports indicated that INSM1 (homologue to nerfin-1 in mammals) is a useful marker for prognosis of neuroendocrine tumors. The dynamic expression of Nerfin-1 is regulated post-transcriptionally by multiple microRNAs; however, its post-translational regulation is still unclear. Here we showed that the protein turnover of Nerfin-1 is regulated by Slimb, the substrate adaptor of SCF Slimb ubiquitin ligase complex. Mechanistically, Slimb associates with Nerfin-1 and promotes it ubiquitination and degradation in Drosophila S2R + cells. Furthermore, we determined that the C-terminal half of Nerfin-1 (Nerfin-1 CT ) is required for its binding to Slimb. Genetic epistasis assays showed that Slimb misexpression antagonizes, while knock-down enhances the activity of Nerfin-1 CT in Drosophila eyes. Our data revealed a new link to understand the underlying mechanism for Nerfin-1 turnover in post-translational level, and provided useful insights in animal development and disease treatment by manipulating the activity of Slimb and Nerfin-1. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. The Roles of VHL-Dependent Ubiquitination in Signaling and Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Qing [Department of Medical Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA (United States); Yang, Haifeng, E-mail: [Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic, Cleveland, OH (United States); Haifeng Yang, E-mail: [Department of Cancer Biology, Lerner Research Institute, Cleveland Clinic, NB-40, 9500 Euclid Avenue, Cleveland, OH 44195 (United States)


    The function of tumor suppressor VHL is compromised in the vast majority of clear cell renal cell carcinoma, and its mutations or loss of expression was causal for this disease. pVHL was found to be a substrate recognition subunit of an E3 ubiquitin ligase, and most of the tumor-derived mutations disrupt this function. pVHL was found to bind to the alpha subunits of hypoxia-inducible factor (HIF) and promote their ubiquitination and proteasomal degradation. Proline hydroxylation on key sites of HIFα provides the binding signal for pVHL E3 ligase complex. Beside HIFα, several other VHL targets have been identified, including activated epidermal growth factor receptor (EGFR), RNA polymerase II subunits RPB1 and hsRPB7, atypical protein kinase C (PKC), Sprouty2, β-adrenergic receptor II, and Myb-binding protein p160. HIFα is the most well studied substrate and has been proven to be critical for pVHL’s tumor suppressor function, but the activated EGFR and PKC and other pVHL substrates might also be important for tumor growth and drug response. Their regulations by pVHL and their relevance to signaling and cancer are discussed.

  12. Purification and crystallization of mono-ubiquitylated ubiquitin receptor Rpn10

    International Nuclear Information System (INIS)

    Keren-Kaplan, Tal; Prag, Gali


    A novel reconstitution system for the modification and purification of ubiquitylated proteins yielded the first diffracting crystals of a ubiquitylated substrate, namely Rpn10. Protein ubiquitylation controls nearly all cellular pathways in eukaryotes. A repertoire of proteins named ubiquitin (Ub) receptors harbouring ubiquitin-binding domains (UBDs) recognize ubiquitylated proteins. These Ub receptors decode the Ub signal by tethering a UBD or UBDs to a functional domain or domains, thus linking the ubiquitylated target to a specific function. The rapid dynamics of ubiquitylation/deubiquitylation has impeded the characterization of ubiquitylated proteins. To bypass this obstacle, a recently developed synthetic system that reconstructs the entire eukaryotic ubiquitylation cascade in Escherichia coli was used to purify the mono-ubiquitylated form of the regulatory proteasomal non-ATPase subunit (Ub-Rpn10) from Saccharomyces cerevisiae. Here, the first crystallization and data collection of Ub-Rpn10 is reported. Purified Ub-Rpn10 was crystallized in 12%(w/v) PEG 20 000, 0.1 M MES pH 6.5 and yielded thin rhombus-shaped crystals. X-ray analysis revealed that these crystals belonged to the monoclinic system C2, with unit-cell parameters a = 107.3, b = 49.7, c = 81.3 Å, α = γ = 90.0, β = 130.5°. A full synchrotron data set has been collected, merged and scaled with a diffraction limit of 3.14 Å

  13. Ubiquitin-like protein UBL5 promotes the functional integrity of the Fanconi anemia pathway. (United States)

    Oka, Yasuyoshi; Bekker-Jensen, Simon; Mailand, Niels


    Ubiquitin and ubiquitin-like proteins (UBLs) function in a wide array of cellular processes. UBL5 is an atypical UBL that does not form covalent conjugates with cellular proteins and which has a known role in modulating pre-mRNA splicing. Here, we report an unexpected involvement of human UBL5 in promoting the function of the Fanconi anemia (FA) pathway for repair of DNA interstrand crosslinks (ICLs), mediated by a specific interaction with the central FA pathway component FANCI. UBL5-deficient cells display spliceosome-independent reduction of FANCI protein stability, defective FANCI function in response to DNA damage and hypersensitivity to ICLs. By mapping the sequence determinants underlying UBL5-FANCI binding, we generated separation-of-function mutants to demonstrate that key aspects of FA pathway function, including FANCI-FANCD2 heterodimerization, FANCD2 and FANCI monoubiquitylation and maintenance of chromosome stability after ICLs, are compromised when the UBL5-FANCI interaction is selectively inhibited by mutations in either protein. Together, our findings establish UBL5 as a factor that promotes the functionality of the FA DNA repair pathway. © 2015 The Authors.

  14. The Ubiquitin Ligase XIAP Recruits LUBAC for NOD2 Signaling in Inflammation and Innate Immunity

    DEFF Research Database (Denmark)

    Damgaard, Rune Busk; Nachbur, Ueli; Yabal, Monica


    Nucleotide-binding and oligomerization domain (NOD)-like receptors constitute a first line of defense against invading bacteria. X-linked Inhibitor of Apoptosis (XIAP) is implicated in the control of bacterial infections, and mutations in XIAP are causally linked to immunodeficiency in X-linked l......Nucleotide-binding and oligomerization domain (NOD)-like receptors constitute a first line of defense against invading bacteria. X-linked Inhibitor of Apoptosis (XIAP) is implicated in the control of bacterial infections, and mutations in XIAP are causally linked to immunodeficiency in X......-linked lymphoproliferative syndrome type-2 (XLP-2). Here, we demonstrate that the RING domain of XIAP is essential for NOD2 signaling and that XIAP contributes to exacerbation of inflammation-induced hepatitis in experimental mice. We find that XIAP ubiquitylates RIPK2 and recruits the linear ubiquitin chain assembly...... signaling. We conclude that XIAP and LUBAC constitute essential ubiquitin ligases in NOD2-mediated inflammatory signaling and propose that deregulation of NOD2 signaling contributes to XLP-2 pathogenesis....

  15. Cellular Cholesterol Regulates Ubiquitination and Degradation of the Cholesterol Export Proteins ABCA1 and ABCG1* (United States)

    Hsieh, Victar; Kim, Mi-Jurng; Gelissen, Ingrid C.; Brown, Andrew J.; Sandoval, Cecilia; Hallab, Jeannette C.; Kockx, Maaike; Traini, Mathew; Jessup, Wendy; Kritharides, Leonard


    The objective of this study was to examine the influence of cholesterol in post-translational control of ABCA1 and ABCG1 protein expression. Using CHO cell lines stably expressing human ABCA1 or ABCG1, we observed that the abundance of these proteins is increased by cell cholesterol loading. The response to increased cholesterol is rapid, is independent of transcription, and appears to be specific for these membrane proteins. The effect is mediated through cholesterol-dependent inhibition of transporter protein degradation. Cell cholesterol loading similarly regulates degradation of endogenously expressed ABCA1 and ABCG1 in human THP-1 macrophages. Turnover of ABCA1 and ABCG1 is strongly inhibited by proteasomal inhibitors and is unresponsive to inhibitors of lysosomal proteolysis. Furthermore, cell cholesterol loading inhibits ubiquitination of ABCA1 and ABCG1. Our findings provide evidence for a rapid, cholesterol-dependent, post-translational control of ABCA1 and ABCG1 protein levels, mediated through a specific and sterol-sensitive mechanism for suppression of transporter protein ubiquitination, which in turn decreases proteasomal degradation. This provides a mechanism for acute fine-tuning of cholesterol transporter activity in response to fluctuations in cell cholesterol levels, in addition to the longer term cholesterol-dependent transcriptional regulation of these genes. PMID:24500716

  16. Armadillo Repeat Containing 8α Binds to HRS and Promotes HRS Interaction with Ubiquitinated Proteins (United States)

    Tomaru, Koji; Ueda, Atsuhisa; Suzuki, Takeyuki; Kobayashi, Nobuaki; Yang, Jun; Yamamoto, Masaki; Takeno, Mitsuhiro; Kaneko, Takeshi; Ishigatsubo, Yoshiaki


    Recently, we reported that a complex with an essential role in the degradation of Fructose-1,6-bisphosphatase in yeast is well conserved in mammalian cells; we named this mammalian complex C-terminal to the Lissencephaly type-1-like homology (CTLH) complex. Although the function of the CTLH complex remains unclear, here we used yeast two-hybrid screening to isolate Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) as a protein binding to a key component of CTLH complex, Armadillo repeat containing 8 (ARMc8) α. The association was confirmed by a yeast two-hybrid assay and a co-immunoprecipitation assay. The proline-rich domain of HRS was essential for the association. As demonstrated through immunofluorescence microscopy, ARMc8α co-localized with HRS. ARMc8α promoted the interaction of HRS with various ubiquitinated proteins through the ubiquitin-interacting motif. These findings suggest that HRS mediates protein endosomal trafficking partly through its interaction with ARMc8α. PMID:20224683

  17. Exploitation of the host cell ubiquitin machinery by microbial effector proteins. (United States)

    Lin, Yi-Han; Machner, Matthias P


    Pathogenic bacteria are in a constant battle for survival with their host. In order to gain a competitive edge, they employ a variety of sophisticated strategies that allow them to modify conserved host cell processes in ways that favor bacterial survival and growth. Ubiquitylation, the covalent attachment of the small modifier ubiquitin to target proteins, is such a pathway. Ubiquitylation profoundly alters the fate of a myriad of cellular proteins by inducing changes in their stability or function, subcellular localization or interaction with other proteins. Given the importance of ubiquitylation in cell development, protein homeostasis and innate immunity, it is not surprising that this post-translational modification is exploited by a variety of effector proteins from microbial pathogens. Here, we highlight recent advances in our understanding of the many ways microbes take advantage of host ubiquitylation, along with some surprising deviations from the canonical theme. The lessons learned from the in-depth analyses of these host-pathogen interactions provide a fresh perspective on an ancient post-translational modification that we thought was well understood.This article is part of a Minifocus on Ubiquitin Regulation and Function. For further reading, please see related articles: 'Mechanisms of regulation and diversification of deubiquitylating enzyme function' by Pawel Leznicki and Yogesh Kulathu ( J. Cell Sci. 130 , 1997-2006). 'Cell scientist to watch - Mads Gyrd-Hansen' ( J. Cell Sci. 130 , 1981-1983). © 2017. Published by The Company of Biologists Ltd.

  18. Dual RING E3 Architectures Regulate Multiubiquitination and Ubiquitin Chain Elongation by APC/C. (United States)

    Brown, Nicholas G; VanderLinden, Ryan; Watson, Edmond R; Weissmann, Florian; Ordureau, Alban; Wu, Kuen-Phon; Zhang, Wei; Yu, Shanshan; Mercredi, Peter Y; Harrison, Joseph S; Davidson, Iain F; Qiao, Renping; Lu, Ying; Dube, Prakash; Brunner, Michael R; Grace, Christy R R; Miller, Darcie J; Haselbach, David; Jarvis, Marc A; Yamaguchi, Masaya; Yanishevski, David; Petzold, Georg; Sidhu, Sachdev S; Kuhlman, Brian; Kirschner, Marc W; Harper, J Wade; Peters, Jan-Michael; Stark, Holger; Schulman, Brenda A


    Protein ubiquitination involves E1, E2, and E3 trienzyme cascades. E2 and RING E3 enzymes often collaborate to first prime a substrate with a single ubiquitin (UB) and then achieve different forms of polyubiquitination: multiubiquitination of several sites and elongation of linkage-specific UB chains. Here, cryo-EM and biochemistry show that the human E3 anaphase-promoting complex/cyclosome (APC/C) and its two partner E2s, UBE2C (aka UBCH10) and UBE2S, adopt specialized catalytic architectures for these two distinct forms of polyubiquitination. The APC/C RING constrains UBE2C proximal to a substrate and simultaneously binds a substrate-linked UB to drive processive multiubiquitination. Alternatively, during UB chain elongation, the RING does not bind UBE2S but rather lures an evolving substrate-linked UB to UBE2S positioned through a cullin interaction to generate a Lys11-linked chain. Our findings define mechanisms of APC/C regulation, and establish principles by which specialized E3-E2-substrate-UB architectures control different forms of polyubiquitination. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Ubiquitination of MBNL1 Is Required for Its Cytoplasmic Localization and Function in Promoting Neurite Outgrowth

    Directory of Open Access Journals (Sweden)

    Pei-Ying Wang


    Full Text Available The Muscleblind-like protein family (MBNL plays an important role in regulating the transition between differentiation and pluripotency and in the pathogenesis of myotonic dystrophy type 1 (DM1, a CTG expansion disorder. How different MBNL isoforms contribute to the differentiation and are affected in DM1 has not been investigated. Here, we show that the MBNL1 cytoplasmic, but not nuclear, isoform promotes neurite morphogenesis and reverses the morphological defects caused by expanded CUG RNA. Cytoplasmic MBNL1 is polyubiquitinated by lysine 63 (K63. Reduced cytoplasmic MBNL1 in the DM1 mouse brain is consistent with the reduced extent of K63 ubiquitination. Expanded CUG RNA induced the deubiqutination of cytoplasmic MBNL1, which resulted in nuclear translocation and morphological impairment that could be ameliorated by inhibiting K63-linked polyubiquitin chain degradation. Our results suggest that K63-linked ubiquitination of MBNL1 is required for its cytoplasmic localization and that deubiquitination of cytoplasmic MBNL1 is pathogenic in the DM1 brain.

  20. The predictive role of E2-EPF ubiquitin carrier protein in esophageal squamous cell carcinoma. (United States)

    Chen, Miao-Fen; Lee, Kuan-Der; Lu, Ming-Shian; Chen, Chih-Cheng; Hsieh, Ming-Ju; Liu, Yun-Hen; Lin, Paul-Yang; Chen, Wen-Cheng


    The ubiquitin proteasome pathway has been implicated in carcinogenesis. However, the role of E2-EPF ubiquitin carrier protein (UCP) in esophageal cancer remains relatively unstudied. In the study, we examined the mRNA level of circulating tumor cells from 60 esophageal cancer patients by membrane arrays consisting of a panel of potential markers including UCP, compared to 40 normal populations. The predictive capacity of UCP was also assessed by immunohistochemical staining of a retrospective series of 84 biopsied esophageal squamous cell carcinomas in relation to clinical outcome. In addition, we studied in vitro biological changes including tumor growth, metastatic capacity, and the sensitivity to irradiation and cisplatin, after experimental manipulation of UCP expression in esophageal cancer cells. By the data of 25-gene membrane array analysis, UCP was the only factor significantly associated with the extent of tumor burden in esophageal cancer patients. Our immunochemistry findings further indicate that UCP positivity was linked to poor response to neoadjuvant therapy and worse survival. In cell culture, inhibited UCP significantly decrease tumor growth and the capacity for metastasis. The epithelial-mesenchymal transition (EMT) induced by VHL/HIF-1alpha-TGF-beta1 pathway might be the underlying mechanism responsible to the more aggressive tumor growth in UCP-positive esophageal cancer. Our results suggest that UCP was significantly associated with poor prognosis of esophageal cancer and may be a new molecular target for therapeutic intervention for esophageal squamous cell carcinoma.

  1. The F-box protein FBXO44 mediates BRCA1 ubiquitination and degradation. (United States)

    Lu, Yunzhe; Li, Jiezhi; Cheng, Dongmei; Parameswaran, Balaji; Zhang, Shaohua; Jiang, Zefei; Yew, P Renee; Peng, Junmin; Ye, Qinong; Hu, Yanfen


    BRCA1 mutations account for a significant proportion of familial breast and ovarian cancers. In addition, reduced BRCA1 protein is associated with sporadic cancer cases in these tissues. At the cellular level, BRCA1 plays a critical role in multiple cellular functions such as DNA repair and cell cycle checkpoint control. Its protein level is regulated in a cell cycle-dependent manner. However, regulation of BRCA1 protein stability is not fully understood. Our earlier study showed that the amino terminus of BRCA1 harbors a degron sequence that is sufficient and necessary for conferring BRCA1 degradation. In the current study, we used mass spectrometry to identify Skp1 that regulates BRCA1 protein stability. Small interfering RNA screening that targets all human F-box proteins uncovered FBXO44 as an important protein that influences BRCA1 protein level. The Skp1-Cul1-F-box-protein44 (SCF(FBXO44)) complex ubiquitinates full-length BRCA1 in vitro. Furthermore, the N terminus of BRCA1 mediates the interaction between BRCA1 and FBXO44. Overexpression of SCF(FBXO44) reduces BRCA1 protein level. Taken together, our work strongly suggests that SCF(FBXO44) is an E3 ubiquitin ligase responsible for BRCA1 degradation. In addition, FBXO44 expression pattern in breast carcinomas suggests that SCF(FBXO44)-mediated BRCA1 degradation might contribute to sporadic breast tumor development.

  2. The F-box Protein FBXO44 Mediates BRCA1 Ubiquitination and Degradation* (United States)

    Lu, Yunzhe; Li, Jiezhi; Cheng, Dongmei; Parameswaran, Balaji; Zhang, Shaohua; Jiang, Zefei; Yew, P. Renee; Peng, Junmin; Ye, Qinong; Hu, Yanfen


    BRCA1 mutations account for a significant proportion of familial breast and ovarian cancers. In addition, reduced BRCA1 protein is associated with sporadic cancer cases in these tissues. At the cellular level, BRCA1 plays a critical role in multiple cellular functions such as DNA repair and cell cycle checkpoint control. Its protein level is regulated in a cell cycle-dependent manner. However, regulation of BRCA1 protein stability is not fully understood. Our earlier study showed that the amino terminus of BRCA1 harbors a degron sequence that is sufficient and necessary for conferring BRCA1 degradation. In the current study, we used mass spectrometry to identify Skp1 that regulates BRCA1 protein stability. Small interfering RNA screening that targets all human F-box proteins uncovered FBXO44 as an important protein that influences BRCA1 protein level. The Skp1-Cul1-F-box-protein44 (SCFFBXO44) complex ubiquitinates full-length BRCA1 in vitro. Furthermore, the N terminus of BRCA1 mediates the interaction between BRCA1 and FBXO44. Overexpression of SCFFBXO44 reduces BRCA1 protein level. Taken together, our work strongly suggests that SCFFBXO44 is an E3 ubiquitin ligase responsible for BRCA1 degradation. In addition, FBXO44 expression pattern in breast carcinomas suggests that SCFFBXO44-mediated BRCA1 degradation might contribute to sporadic breast tumor development. PMID:23086937

  3. GS143, an IκB ubiquitination inhibitor, inhibits allergic airway inflammation in mice

    International Nuclear Information System (INIS)

    Hirose, Koichi; Wakashin, Hidefumi; Oki, Mie; Kagami, Shin-ichiro; Suto, Akira; Ikeda, Kei; Watanabe, Norihiko; Iwamoto, Itsuo; Furuichi, Yasuhiro; Nakajima, Hiroshi


    Asthma is characterized by airway inflammation with intense eosinophil infiltration and mucus hyper-production, in which antigen-specific Th2 cells play critical roles. Nuclear factor-κB (NF-κB) pathway has been demonstrated to be essential for the production of Th2 cytokines and chemokines in the airways in murine asthma models. In the present study, we examined the effect of GS143, a novel small-molecule inhibitor of IκB ubiquitination, on antigen-induced airway inflammation and Th2 cytokine production in mice. Intranasal administration of GS143 prior to antigen challenge suppressed antigen-induced NF-κB activation in the lung of sensitized mice. Intranasal administration of GS143 also inhibited antigen-induced eosinophil and lymphocyte recruitment into the airways as well as the expression of Th2 cytokines and eotaxin in the airways. Moreover, GS143 inhibited antigen-induced differentiation of Th2 cells but not of Th1 cells in vitro. Taken together, these results suggest that IκB ubiquitination inhibitor may have therapeutic potential against asthma

  4. Constitutive endocytosis and turnover of the neuronal glycine transporter GlyT2 is dependent on ubiquitination of a C-terminal lysine cluster.

    Directory of Open Access Journals (Sweden)

    Jaime de Juan-Sanz

    Full Text Available Inhibitory glycinergic neurotransmission is terminated by sodium and chloride-dependent plasma membrane glycine transporters (GlyTs. The mainly glial glycine transporter GlyT1 is primarily responsible for the completion of inhibitory neurotransmission and the neuronal glycine transporter GlyT2 mediates the reuptake of the neurotransmitter that is used to refill synaptic vesicles in the terminal, a fundamental role in the physiology and pathology of glycinergic neurotransmission. Indeed, inhibitory glycinergic neurotransmission is modulated by the exocytosis and endocytosis of GlyT2. We previously reported that constitutive and Protein Kinase C (PKC-regulated endocytosis of GlyT2 is mediated by clathrin and that PKC accelerates GlyT2 endocytosis by increasing its ubiquitination. However, the role of ubiquitination in the constitutive endocytosis and turnover of this protein remains unexplored. Here, we show that ubiquitination of a C-terminus four lysine cluster of GlyT2 is required for constitutive endocytosis, sorting into the slow recycling pathway and turnover of the transporter. Ubiquitination negatively modulates the turnover of GlyT2, such that increased ubiquitination driven by PKC activation accelerates transporter degradation rate shortening its half-life while decreased ubiquitination increases transporter stability. Finally, ubiquitination of GlyT2 in neurons is highly responsive to the free pool of ubiquitin, suggesting that the deubiquitinating enzyme (DUB ubiquitin C-terminal hydrolase-L1 (UCHL1, as the major regulator of neuronal ubiquitin homeostasis, indirectly modulates the turnover of GlyT2. Our results contribute to the elucidation of the mechanisms underlying the dynamic trafficking of this important neuronal protein which has pathological relevance since mutations in the GlyT2 gene (SLC6A5 are the second most common cause of human hyperekplexia.

  5. How Polycomb-Mediated Cell Memory Deals With a Changing Environment: Variations in PcG complexes and proteins assortment convey plasticity to epigenetic regulation as a response to environment. (United States)

    Marasca, Federica; Bodega, Beatrice; Orlando, Valerio


    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment. © 2018 The Authors. BioEssays Published by WILEY Periodicals, Inc.

  6. Augmentation of protein production by a combination of the T7 RNA polymerase system and ubiquitin fusion: Overproduction of the human DNA repair protein, ERCC1, as a ubiquitin fusion protein in Escherichia coli.

    NARCIS (Netherlands)

    M.H.M. Koken (Marcel); J.H. Odijk; M. van Duin (Mark); M.W.J. Fornerod (Maarten); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan)


    textabstractThis article presents the development of a set of new expression vectors for overproduction of proteins in Escherichia coli. The vectors, pETUBI-ES1, 2 and 3, allow in-frame cloning of any sequence with the ubiquitin gene driven by the strong T7f10 promoter. Combination of the T7

  7. The Ubiquitin-associated (UBA) 1 Domain of Schizosaccharomyces pombe Rhp23 Is Essential for the Recognition of Ubiquitin-proteasome System Substrates Both in Vitro and in Vivo* (United States)

    Medina, Bethan; Paraskevopoulos, Konstantinos; Boehringer, Jonas; Sznajder, Anna; Robertson, Morag; Endicott, Jane; Gordon, Colin


    The ubiquitin-proteasome system is essential for maintaining a functional cell. Not only does it remove incorrectly folded proteins, it also regulates protein levels to ensure their appropriate spatial and temporal distribution. Proteins marked for degradation by the addition of Lys48-linked ubiquitin (Ub) chains are recognized by shuttle factors and transported to the 26 S proteasome. One of these shuttle factors, Schizosaccharomyces pombe Rhp23, has an unusual domain architecture. It comprises an N-terminal ubiquitin-like domain that can recognize the proteasome followed by two ubiquitin-associated (UBA) domains, termed UBA1 and UBA2, which can bind Ub. This architecture is conserved up to humans, suggesting that both domains are important for Rhp23 function. Such an extent of conservation raises the question as to why, in contrast to all other shuttle proteins, does Rhp23 require two UBA domains? We performed in vitro Ub binding assays using domain swap chimeric proteins and mutated domains in isolation as well as in the context of the full-length protein to reveal that the Ub binding properties of the UBA domains are context-dependent. In vivo, the internal Rhp23 UBA1 domain provides sufficient Ub recognition for the protein to function without UBA2. PMID:23038266

  8. Memory formation for trace fear conditioning requires ubiquitin-proteasome mediated protein degradation in the prefrontal cortex.

    Directory of Open Access Journals (Sweden)

    David S Reis


    Full Text Available The cellular mechanisms supporting plasticity during memory consolidation have been a subject of considerable interest. De novo protein and mRNA synthesis in several brain areas are critical, and more recently protein degradation, mediated by the ubiquitin-proteasome system (UPS, has been shown to be important. Previous work clearly establishes a relationship between protein synthesis and protein degradation in the amygdala, but it is unclear whether cortical mechanisms of memory consolidation are similar to those in the amygdala. Recent work demonstrating a critical role for prefrontal cortex (PFC in the acquisition and consolidation of fear memory allows us to address this question. Here we use a PFC-dependent fear conditioning protocol to determine whether UPS mediated protein degradation is necessary for memory consolidation in PFC. Groups of rats were trained with auditory delay or trace fear conditioning and sacrificed 60 min after training. PFC tissue was then analyzed to quantify the amount of polyubiquinated protein. Other animals were trained with similar procedures but were infused with either a proteasome inhibitor (clasto-lactacystin β-lactone or a translation inhibitor (anisomycin in the PFC immediately after training. Our results show increased UPS-mediated protein degradation in the PFC following trace but not delay fear conditioning. Additionally, post-training proteasome or translation inhibition significantly impaired trace but not delay fear memory when tested the next day. Our results further support the idea that the PFC is critical for trace but not delay fear conditioning highlight the role of UPS-mediated degradation as critical for synaptic plasticity.

  9. The dynamics of histone H2A ubiquitination in HeLa cells exposed to rapamycin, ethanol, hydroxyurea, ER stress, heat shock and DNA damage. (United States)

    Nakata, Shiori; Watanabe, Tadashi; Nakagawa, Koji; Takeda, Hiroshi; Ito, Akihiro; Fujimuro, Masahiro


    Polyubiquitination plays key roles in proteasome-dependent and independent cellular events, whereas monoubiquitination is involved in gene expression, DNA repair, protein-protein interaction, and protein trafficking. We previously developed an FK2 antibody, which specifically recognizes poly-Ub moieties but not free Ub. To elucidate the role of Ub conjugation in response to cellular stress, we used FK2 to investigate whether chemical stress (rapamycin, ethanol, or hydroxyurea), ER stress (thapsigargin or tunicamycin), heat shock or DNA damage (H2O2 or methyl methanesulfonate) affect the formation of Ub conjugates including histone H2A (hH2A) ubiquitination. First, we found that all forms of stress tested increased poly-ubiquitinated proteins in HeLa cells. Furthermore, rapamycin and hydroxyurea treatment, and ER stress increased ubiquitination of hH2A, while methyl methanesulfonate (MMS) treatment induced deubiquitination of hH2A. The ethanol and H2O2 treatments, and heat shock transiently induced hH2A de-ubiquitination, although deubiquitinated hH2A were ubiquitinated again by subsequent cultivation. We also revealed that FK2 reacts with not only polyubiquitinated proteins but also mono-ubiquitinated hH2A. With the exception of MMS, all forms of stress tested increased the acetylation of K5-hH2A, K9-hH3 and K8-hH4 in addition to ubiquitination. K118 and K119 of hH2A were ubiquitinated in cells under normal conditions, and K119 was the major ubiquitination site. The MMS-treatment and heat shock induced the deubiquitination of both K118 and K119-histone H2A. Interestingly, MMS treatment did not affect cell HeLa cell viability expressing double-mutant hH2A (KK118,119AA-hH2A), while heat shock slightly but significantly decreased viability of double-mutant hH2A expressing cells, indicating that ubiquitination of both sites associates with recovery from heat shock but not MMS treatment. Thus, we characterized FK2 reactivity and demonstrated that various stresses alter

  10. Structure-based in silico identification of ubiquitin-binding domains provides insights into the ALIX-V:ubiquitin complex and retrovirus budding (United States)

    Keren-Kaplan, Tal; Attali, Ilan; Estrin, Michael; Kuo, Lillian S; Farkash, Efrat; Jerabek-Willemsen, Moran; Blutraich, Noa; Artzi, Shay; Peri, Aviyah; Freed, Eric O; Wolfson, Haim J; Prag, Gali


    The ubiquitylation signal promotes trafficking of endogenous and retroviral transmembrane proteins. The signal is decoded by a large set of ubiquitin (Ub) receptors that tether Ub-binding domains (UBDs) to the trafficking machinery. We developed a structure-based procedure to scan the protein data bank for hidden UBDs. The screen retrieved many of the known UBDs. Intriguingly, new potential UBDs were identified, including the ALIX-V domain. Pull-down, cross-linking and E3-independent ubiquitylation assays biochemically corroborated the in silico findings. Guided by the output model, we designed mutations at the postulated ALIX-V:Ub interface. Biophysical affinity measurements using microscale-thermophoresis of wild-type and mutant proteins revealed some of the interacting residues of the complex. ALIX-V binds mono-Ub with a Kd of 119 μM. We show that ALIX-V oligomerizes with a Hill coefficient of 5.4 and IC50 of 27.6 μM and that mono-Ub induces ALIX-V oligomerization. Moreover, we show that ALIX-V preferentially binds K63 di-Ub compared with mono-Ub and K48 di-Ub. Finally, an in vivo functionality assay demonstrates the significance of ALIX-V:Ub interaction in equine infectious anaemia virus budding. These results not only validate the new procedure, but also demonstrate that ALIX-V directly interacts with Ub in vivo and that this interaction can influence retroviral budding. PMID:23361315

  11. Structure-based in silico identification of ubiquitin-binding domains provides insights into the ALIX-V:ubiquitin complex and retrovirus budding. (United States)

    Keren-Kaplan, Tal; Attali, Ilan; Estrin, Michael; Kuo, Lillian S; Farkash, Efrat; Jerabek-Willemsen, Moran; Blutraich, Noa; Artzi, Shay; Peri, Aviyah; Freed, Eric O; Wolfson, Haim J; Prag, Gali


    The ubiquitylation signal promotes trafficking of endogenous and retroviral transmembrane proteins. The signal is decoded by a large set of ubiquitin (Ub) receptors that tether Ub-binding domains (UBDs) to the trafficking machinery. We developed a structure-based procedure to scan the protein data bank for hidden UBDs. The screen retrieved many of the known UBDs. Intriguingly, new potential UBDs were identified, including the ALIX-V domain. Pull-down, cross-linking and E3-independent ubiquitylation assays biochemically corroborated the in silico findings. Guided by the output model, we designed mutations at the postulated ALIX-V:Ub interface. Biophysical affinity measurements using microscale-thermophoresis of wild-type and mutant proteins revealed some of the interacting residues of the complex. ALIX-V binds mono-Ub with a K(d) of 119 μM. We show that ALIX-V oligomerizes with a Hill coefficient of 5.4 and IC(50) of 27.6 μM and that mono-Ub induces ALIX-V oligomerization. Moreover, we show that ALIX-V preferentially binds K63 di-Ub compared with mono-Ub and K48 di-Ub. Finally, an in vivo functionality assay demonstrates the significance of ALIX-V:Ub interaction in equine infectious anaemia virus budding. These results not only validate the new procedure, but also demonstrate that ALIX-V directly interacts with Ub in vivo and that this interaction can influence retroviral budding.

  12. COP1 Controls Abiotic Stress Responses by Modulating AtSIZ1 Function Through its E3 Ubiquitin Ligase Activity

    Directory of Open Access Journals (Sweden)

    Joo Yong Kim


    Full Text Available Ubiquitination and sumoylation are essential post-translational modifications that regulate growth and development processes in plants, including control of hormone signaling mechanisms and responses to stress. This study showed that COP1 (Constitutive photomorphogenic 1 regulated the activity of Arabidopsis E3 SUMO (Small ubiquitin-related modifier ligase AtSIZ1 through its E3 ubiquitin ligase activity. Yeast two hybrid analysis demonstrated that COP1 and AtSIZ1 directly interacted with one another, and subcellular localization assays indicated that COP1 and AtSIZ1 co-localized in nuclear bodies. Analysis of ubiquitination showed that AtSIZ1 was polyubiquitinated by COP1. The AtSIZ1 level was higher in cop1-4 mutants than in wild-type seedlings under light or dark conditions, and overexpression of a dominant-negative (DN-COP1 mutant led to a substantial increase in AtSIZ1 accumulation. In addition, under drought, cold, and high salt conditions, SUMO-conjugate levels were elevated in DN-COP1-overexpressing plants and cop1-4 mutant plants compared to wild-type plants. Taken together, our results indicate that COP1 controls responses to abiotic stress by modulation of AtSIZ1 levels and activity.

  13. Structural basis for c-KIT inhibition by the suppressor of cytokine signaling 6 (SOCS6) ubiquitin ligase

    DEFF Research Database (Denmark)

    Zadjali, Fahad; Pike, Ashley C W; Vesterlund, Mattias


    to substrate residue position pY+6 and envelopes the c-KIT phosphopeptide with a large BG loop insertion that contributes significantly to substrate interaction. We demonstrate that SOCS6 has ubiquitin ligase activity toward c-KIT and regulates c-KIT protein turnover in cells. Our data support a role of SOCS6...

  14. Real Estate in the DNA Damage Response: Ubiquitin and SUMO Ligases Home in on DNA Double-Strand Breaks. (United States)

    Dantuma, Nico P; Pfeiffer, Annika


    Ubiquitin and the ubiquitin-like modifier SUMO are intimately connected with the cellular response to various types of DNA damage. A striking feature is the local accumulation of these proteinaceous post-translational modifications in the direct vicinity to DNA double-strand breaks, which plays a critical role in the formation of ionizing radiation-induced foci. The functional significance of these modifications is the coordinated recruitment and removal of proteins involved in DNA damage signaling and repair in a timely manner. The central orchestrators of these processes are the ubiquitin and SUMO ligases that are responsible for accurately tagging a broad array of chromatin and chromatin-associated proteins thereby changing their behavior or destination. Despite many differences in the mode of action of these enzymes, they share some striking features that are of direct relevance for their function in the DNA damage response. In this review, we outline the molecular mechanisms that are responsible for the recruitment of ubiquitin and SUMO ligases and discuss the importance of chromatin proximity in this process.

  15. Ubiquitin-specific protease 5 is required for the efficient repair of DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Satoshi Nakajima

    Full Text Available During the DNA damage response (DDR, ubiquitination plays an important role in the recruitment and regulation of repair proteins. However, little is known about elimination of the ubiquitination signal after repair is completed. Here we show that the ubiquitin-specific protease 5 (USP5, a deubiquitinating enzyme, is involved in the elimination of the ubiquitin signal from damaged sites and is required for efficient DNA double-strand break (DSB repair. Depletion of USP5 sensitizes cells to DNA damaging agents, produces DSBs, causes delayed disappearance of γH2AX foci after Bleocin treatment, and influences DSB repair efficiency in the homologous recombination pathway but not in the non-homologous end joining pathway. USP5 co-localizes to DSBs induced by laser micro-irradiation in a RAD18-dependent manner. Importantly, polyubiquitin chains at sites of DNA damage remained for longer periods in USP5-depleted cells. Our results show that disassembly of polyubiquitin chains by USP5 at sites of damage is important for efficient DSB repair.

  16. CYLD Limits Lys63- and Met1-Linked Ubiquitin at Receptor Complexes to Regulate Innate Immune Signaling

    Directory of Open Access Journals (Sweden)

    Matous Hrdinka


    Full Text Available Innate immune signaling relies on the deposition of non-degradative polyubiquitin at receptor-signaling complexes, but how these ubiquitin modifications are regulated by deubiquitinases remains incompletely understood. Met1-linked ubiquitin (Met1-Ub is assembled by the linear ubiquitin assembly complex (LUBAC, and this is counteracted by the Met1-Ub-specific deubiquitinase OTULIN, which binds to the catalytic LUBAC subunit HOIP. In this study, we report that HOIP also interacts with the deubiquitinase CYLD but that CYLD does not regulate ubiquitination of LUBAC components. Instead, CYLD limits extension of Lys63-Ub and Met1-Ub conjugated to RIPK2 to restrict signaling and cytokine production. Accordingly, Met1-Ub and Lys63-Ub were individually required for productive NOD2 signaling. Our study thus suggests that LUBAC, through its associated deubiquitinases, coordinates the deposition of not only Met1-Ub but also Lys63-Ub to ensure an appropriate response to innate immune receptor activation.

  17. Soy Glycinin Contains a Functional Inhibitory Sequence against Muscle-Atrophy-Associated Ubiquitin Ligase Cbl-b

    Directory of Open Access Journals (Sweden)

    Tomoki Abe


    Full Text Available Background. Unloading stress induces skeletal muscle atrophy. We have reported that Cbl-b ubiquitin ligase is a master regulator of unloading-associated muscle atrophy. The present study was designed to elucidate whether dietary soy glycinin protein prevents denervation-mediated muscle atrophy, based on the presence of inhibitory peptides against Cbl-b ubiquitin ligase in soy glycinin protein. Methods. Mice were fed either 20% casein diet, 20% soy protein isolate diet, 10% glycinin diet containing 10% casein, or 20% glycinin diet. One week later, the right sciatic nerve was cut. The wet weight, cross sectional area (CSA, IGF-1 signaling, and atrogene expression in hindlimb muscles were examined at 1, 3, 3.5, or 4 days after denervation. Results. 20% soy glycinin diet significantly prevented denervation-induced decreases in muscle wet weight and myofiber CSA. Furthermore, dietary soy protein inhibited denervation-induced ubiquitination and degradation of IRS-1 in tibialis anterior muscle. Dietary soy glycinin partially suppressed the denervation-mediated expression of atrogenes, such as MAFbx/atrogin-1 and MuRF-1, through the protection of IGF-1 signaling estimated by phosphorylation of Akt-1. Conclusions. Soy glycinin contains a functional inhibitory sequence against muscle-atrophy-associated ubiquitin ligase Cbl-b. Dietary soy glycinin protein significantly prevented muscle atrophy after denervation in mice.

  18. The role of ubiquitin in down-regulation and intracellular sorting of membrane proteins: insights from yeast

    Czech Academy of Sciences Publication Activity Database

    Horák, Jaroslav


    Roč. 1614, č. 2 (2003), s. 139-155 ISSN 0005-2736 R&D Projects: GA ČR GA204/01/0272; GA ČR GA204/02/1240 Institutional research plan: CEZ:AV0Z5011922 Keywords : ubiquitin * membrane proteins * yeast Subject RIV: CE - Biochemistry Impact factor: 2.665, year: 2003

  19. Ubiquitination is absolutely required for the degradation of hypoxia-inducible factor - 1 alpha protein in hypoxic conditions

    International Nuclear Information System (INIS)

    Wang, Ronghai; Zhang, Ping; Li, Jinhang; Guan, Hongzai; Shi, Guangjun


    The hypoxia-inducible factor (HIF) is recognized as the master regulator of hypoxia response. HIF-α subunits expression are tightly regulated. In this study, our data show that ts20 cells still expressed detectable E1 protein even at 39.5° C for 12 h, and complete depletion of E1 protein expression at 39.5° C by siRNA enhanced HIF-1α and P53 protein expression. Further inhibition of E1 at 39.5 °C by siRNA, or E1 inhibitor Ube1-41 completely blocked HIF-1α degradation. Moreover, immunoprecipitations of co-transfection of HA-ubiquitin and FLAG–HIF–1α plasmids directly confirmed the involvement of ubiquitin in the hypoxic degradation of HIF-1α. Additionally, hypoxic HIF-1 α degradation is independent of HAF, RACK1, sumoylation or nuclear/cytoplasmic localization. Taken together, our data suggest that constitutive HIF-1α protein degradation in hypoxia is absolutely ubiquitination-dependent, and unidentified E3 ligase may exist for this degradation pathway. - Highlights: • HIF-1α protein is constitutively degraded in hypoxic conditions. • Requirement of ubiquitination for HIF-1α degradation in hypoxia. • Hypoxic HIF-1α degradation is independent of HAF, RACK1, sumoylation or nuclear/cytoplasmic localization.

  20. Ubiquitination is absolutely required for the degradation of hypoxia-inducible factor - 1 alpha protein in hypoxic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Ronghai [Department of Urology, Linzi District People' s Hospital, Zibo, 255400 (China); Zhang, Ping, E-mail: [Department of Gynecology, Qingdao Municipal Hospital, Qingdao, 266011 (China); Li, Jinhang [Department of Gynecology, Qingdao Municipal Hospital, Qingdao, 266011 (China); Guan, Hongzai [Laboratory Department, School of Medicine, Qingdao University, Qingdao, 266071 (China); Shi, Guangjun, E-mail: [Department of Hepatobiliary Surgery, Qingdao Municipal Hospital, Qingdao, 266071 (China)


    The hypoxia-inducible factor (HIF) is recognized as the master regulator of hypoxia response. HIF-α subunits expression are tightly regulated. In this study, our data show that ts20 cells still expressed detectable E1 protein even at 39.5° C for 12 h, and complete depletion of E1 protein expression at 39.5° C by siRNA enhanced HIF-1α and P53 protein expression. Further inhibition of E1 at 39.5 °C by siRNA, or E1 inhibitor Ube1-41 completely blocked HIF-1α degradation. Moreover, immunoprecipitations of co-transfection of HA-ubiquitin and FLAG–HIF–1α plasmids directly confirmed the involvement of ubiquitin in the hypoxic degradation of HIF-1α. Additionally, hypoxic HIF-1 α degradation is independent of HAF, RACK1, sumoylation or nuclear/cytoplasmic localization. Taken together, our data suggest that constitutive HIF-1α protein degradation in hypoxia is absolutely ubiquitination-dependent, and unidentified E3 ligase may exist for this degradation pathway. - Highlights: • HIF-1α protein is constitutively degraded in hypoxic conditions. • Requirement of ubiquitination for HIF-1α degradation in hypoxia. • Hypoxic HIF-1α degradation is independent of HAF, RACK1, sumoylation or nuclear/cytoplasmic localization.

  1. Expression and cellular distribution of ubiquitin in response to injury in the developing spinal cord of Monodelphis domestica

    DEFF Research Database (Denmark)

    Noor, Natassya M; Møllgård, Kjeld; Wheaton, Benjamin J


    to lesion were studied. Following spinal injury ubiquitin levels (western blotting) appeared reduced compared to controls especially one day after injury at P28. In contrast, after injury mRNA expression (qRT-PCR) was slightly increased at P7 but decreased at P28. Changes in isoelectric point of separated...

  2. The ubiquitin-selective segregase VCP/p97 orchestrates the response to DNA double-strand breaks

    DEFF Research Database (Denmark)

    Meerang, Mayura; Ritz, Danilo; Paliwal, Shreya


    Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signalling and repair proteins to the site of lesion. Protein modification with ubiquitin is crucial for the signalling ...

  3. The Prader-Willi syndrome proteins MAGEL2 and necdin regulate leptin receptor cell surface abundance through ubiquitination pathways. (United States)

    Wijesuriya, Tishani Methsala; De Ceuninck, Leentje; Masschaele, Delphine; Sanderson, Matthea R; Carias, Karin Vanessa; Tavernier, Jan; Wevrick, Rachel


    In Prader-Willi syndrome (PWS), obesity is caused by the disruption of appetite-controlling pathways in the brain. Two PWS candidate genes encode MAGEL2 and necdin, related melanoma antigen proteins that assemble into ubiquitination complexes. Mice lacking Magel2 are obese and lack leptin sensitivity in hypothalamic pro-opiomelanocortin neurons, suggesting dysregulation of leptin receptor (LepR) activity. Hypothalamus from Magel2-null mice had less LepR and altered levels of ubiquitin pathway proteins that regulate LepR processing (Rnf41, Usp8, and Stam1). MAGEL2 increased the cell surface abundance of LepR and decreased their degradation. LepR interacts with necdin, which interacts with MAGEL2, which complexes with RNF41 and USP8. Mutations in the MAGE homology domain of MAGEL2 suppress RNF41 stabilization and prevent the MAGEL2-mediated increase of cell surface LepR. Thus, MAGEL2 and necdin together control LepR sorting and degradation through a dynamic ubiquitin-dependent pathway. Loss of MAGEL2 and necdin may uncouple LepR from ubiquitination pathways, providing a cellular mechanism for obesity in PWS. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  4. Fab-based inhibitors reveal ubiquitin independent functions for HIV Vif neutralization of APOBEC3 restriction factors.

    Directory of Open Access Journals (Sweden)

    Jennifer M Binning


    Full Text Available The lentiviral protein Viral Infectivity Factor (Vif counteracts the antiviral effects of host APOBEC3 (A3 proteins and contributes to persistent HIV infection. Vif targets A3 restriction factors for ubiquitination and proteasomal degradation by recruiting them to a multi-protein ubiquitin E3 ligase complex. Here, we describe a degradation-independent mechanism of Vif-mediated antagonism that was revealed through detailed structure-function studies of antibody antigen-binding fragments (Fabs to the Vif complex. Two Fabs were found to inhibit Vif-mediated A3 neutralization through distinct mechanisms: shielding A3 from ubiquitin transfer and blocking Vif E3 assembly. Combined biochemical, cell biological and structural studies reveal that disruption of Vif E3 assembly inhibited A3 ubiquitination but was not sufficient to restore its packaging into viral particles and antiviral activity. These observations establish that Vif can neutralize A3 family members in a degradation-independent manner. Additionally, this work highlights the potential of Fabs as functional probes, and illuminates how Vif uses a multi-pronged approach involving both degradation dependent and independent mechanisms to suppress A3 innate immunity.

  5. Deregulation of the ubiquitin-proteasome system is the predominant molecular pathology in OPMD animal models and patients

    DEFF Research Database (Denmark)

    Anvar, Seyed Yahya; hoen, Peter Ac; Venema, Andrea


    molecular pathways that are consistently associated with OPMD, we performed an integrated high-throughput transcriptome study in affected muscles of OPMD animal models and patients. The ubiquitin-proteasome system (UPS) was found to be the most consistently and significantly OPMD-deregulated pathway across...

  6. The Fbw7 tumor suppressor targets KLF5 for ubiquitin-mediated degradation and suppresses breast cell proliferation. (United States)

    Zhao, Dong; Zheng, Han-Qiu; Zhou, Zhongmei; Chen, Ceshi


    Fbw7 is a tumor suppressor frequently inactivated in cancers. The KLF5 transcription factor promotes breast cell proliferation and tumorigenesis through upregulating FGF-BP. The KLF5 protein degrades rapidly through the ubiquitin proteasome pathway. Here, we show that the Skp1-CUL1-Fbw7 E3 ubiquitin ligase complex (SCF(Fbw7)) targets KLF5 for ubiquitin-mediated degradation in a GSK3beta-mediated KLF5 phosphorylation-dependent manner. Mutation of the critical S303 residue in the KLF5 Cdc4 phospho-degrons motif ((303)SPPSS) abolishes the protein interaction, ubiquitination, and degradation by Fbw7. Inactivation of endogenous Fbw7 remarkably increases the endogenous KLF5 protein abundances. Endogenous Fbw7 suppresses the FGF-BP gene expression and breast cell proliferation through targeting KLF5 for degradation. These findings suggest that Fbw7 inhibits breast cell proliferation at least partially through targeting KLF5 for proteolysis. This new regulatory mechanism of KLF5 degradation may result in useful diagnostic and therapeutic targets for breast cancer and other cancers. Copyright 2010 AACR.

  7. Pax3 stimulates p53 ubiquitination and degradation independent of transcription.

    Directory of Open Access Journals (Sweden)

    Xiao Dan Wang

    Full Text Available Pax3 is a developmental transcription factor that is required for neural tube and neural crest development. We previously showed that inactivating the p53 tumor suppressor protein prevents neural tube and cardiac neural crest defects in Pax3-mutant mouse embryos. This demonstrates that Pax3 regulates these processes by blocking p53 function. Here we investigated the mechanism by which Pax3 blocks p53 function.We employed murine embryonic stem cell (ESC-derived neuronal precursors as a cell culture model of embryonic neuroepithelium or neural crest. Pax3 reduced p53 protein stability, but had no effect on p53 mRNA levels or the rate of p53 synthesis. Full length Pax3 as well as fragments that contained either the DNA-binding paired box or the homeodomain, expressed as GST or FLAG fusion proteins, physically associated with p53 and Mdm2 both in vitro and in vivo. In contrast, Splotch Pax3, which causes neural tube and neural crest defects in homozygous embryos, bound weakly, or not at all, to p53 or Mdm2. The paired domain and homeodomain each stimulated Mdm2-mediated ubiquitination of p53 and p53 degradation in the absence of the Pax3 transcription regulatory domains, whereas Splotch Pax3 did not stimulate p53 ubiquitination or degradation.Pax3 inactivates p53 function by stimulating its ubiquitination and degradation. This process utilizes the Pax3 paired domain and homeodomain but is independent of DNA-binding and transcription regulation. Because inactivating p53 is the only required Pax3 function during neural tube closure and cardiac neural crest development, and inactivating p53 does not require Pax3-dependent transcription regulation, this indicates that Pax3 is not required to function as a transcription factor during neural tube closure and cardiac neural crest development. These findings further suggest novel explanations for PAX3 functions in human diseases, such as in neural crest-derived cancers and Waardenburg syndrome types 1 and 3.

  8. Novel E3 ubiquitin ligases that regulate histone protein levels in the budding yeast Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rakesh Kumar Singh

    Full Text Available Core histone proteins are essential for packaging the genomic DNA into chromatin in all eukaryotes. Since multiple genes encode these histone proteins, there is potential for generating more histones than what is required for chromatin assembly. The positively charged histones have a very high affinity for negatively charged molecules such as DNA, and any excess of histone proteins results in deleterious effects on genomic stability and cell viability. Hence, histone levels are known to be tightly regulated via transcriptional, posttranscriptional and posttranslational mechanisms. We have previously elucidated the posttranslational regulation of histone protein levels by the ubiquitin-proteasome pathway involving the E2 ubiquitin conjugating enzymes Ubc4/5 and the HECT (Homologous to E6-AP C-Terminus domain containing E3 ligase Tom1 in the budding yeast. Here we report the identification of four additional E3 ligases containing the RING (Really Interesting New Gene finger domains that are involved in the ubiquitylation and subsequent degradation of excess histones in yeast. These E3 ligases are Pep5, Snt2 as well as two previously uncharacterized Open Reading Frames (ORFs YKR017C and YDR266C that we have named Hel1 and Hel2 (for Histone E3 Ligases respectively. Mutants lacking these E3 ligases are sensitive to histone overexpression as they fail to degrade excess histones and accumulate high levels of endogenous histones on histone chaperones. Co-immunoprecipitation assays showed that these E3 ligases interact with the major E2 enzyme Ubc4 that is involved in the degradation related ubiquitylation of histones. Using mutagenesis we further demonstrate that the RING domains of Hel1, Hel2 and Snt2 are required for histone regulation. Lastly, mutants corresponding to Hel1, Hel2 and Pep5 are sensitive to replication inhibitors. Overall, our results highlight the importance of posttranslational histone regulatory mechanisms that employ multiple E3

  9. The Role of RUB (related to ubiquitin) Family of Proteins in the Hormone Response. Final Report.

    Energy Technology Data Exchange (ETDEWEB)

    Callis, Judy [Univ. of California, Davis, CA (United States). Dept. of Molecular and Cellular Biology


    The Rub pathway is a conserved protein modification pathway. RUB (called Rubp1 in budding yeast, Nedd8 in animals and RUB in plants) is a ubiquitin-like 76-amino acid protein. It covalently attaches to protein using an enzymatic machinery analogous to the enzymes that attach ubiquitin to its substrate proteins. However, the nature of the complement of Rub-modified proteins in organisms was not clear. From bioinformatics analyses, one can identify a Rub activating enzymes and Rub conjugating enzymes. However, in many cases, their biochemical properties were not described. In DOE-funded work, we made major advances in our understanding of the Rub pathway in yeast and plants, work that is applicable to other organisms as well. There is a multi-subunit enzyme called SCF in all eukaryotes. The SCF consists of several subunits that serve as a scaffold (the cullin, SKP and RBX subunits) and one subunit that interacts with the substrate. This cullin protein (called Cdc53p in yeast and CULLIN 1 in plants and animals) was a known Rub target. In this work, we identified additional Rub targets in yeast as the other cullin-like proteins Cul3p and Rtt101p. Additionally we described the conservation of the Rub pathway because plant RUB1 can conjugated to yeast Cdc53p- in yeast. In the model plant Arabidopsis thaliana, we characterized the Rub activating enzymes and showed that they are not biochemically equivalent. We also showed that the Rub pathway is essential in plants and characterized plants with reduced levels of rub proteins. These plants are affected in multiple developmental processes. We discovered that they over-produce ethylene as dark-grown seedlings. We characterized a mutant allele of CULLIN1 in Arabidopsis with impaired interaction with RBX and showed that it is unstable in vivo. We used our knowledge of monitoring protein degradation to map the degradation determinants in a plant transcription factor. Finally, we took a mass spectrometric approach to identify

  10. Nucleosome acidic patch promotes RNF168- and RING1B/BMI1-dependent H2AX and H2A ubiquitination and DNA damage signaling.

    Directory of Open Access Journals (Sweden)

    Justin W Leung


    Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.

  11. Computational modeling of Repeat1 region of INI1/hSNF5: An evolutionary link with ubiquitin (United States)

    Bhutoria, Savita


    Abstract The structure of a protein can be very informative of its function. However, determining protein structures experimentally can often be very challenging. Computational methods have been used successfully in modeling structures with sufficient accuracy. Here we have used computational tools to predict the structure of an evolutionarily conserved and functionally significant domain of Integrase interactor (INI)1/hSNF5 protein. INI1 is a component of the chromatin remodeling SWI/SNF complex, a tumor suppressor and is involved in many protein‐protein interactions. It belongs to SNF5 family of proteins that contain two conserved repeat (Rpt) domains. Rpt1 domain of INI1 binds to HIV‐1 Integrase, and acts as a dominant negative mutant to inhibit viral replication. Rpt1 domain also interacts with oncogene c‐MYC and modulates its transcriptional activity. We carried out an ab initio modeling of a segment of INI1 protein containing the Rpt1 domain. The structural model suggested the presence of a compact and well defined ββαα topology as core structure in the Rpt1 domain of INI1. This topology in Rpt1 was similar to PFU domain of Phospholipase A2 Activating Protein, PLAA. Interestingly, PFU domain shares similarity with Ubiquitin and has ubiquitin binding activity. Because of the structural similarity between Rpt1 domain of INI1 and PFU domain of PLAA, we propose that Rpt1 domain of INI1 may participate in ubiquitin recognition or binding with ubiquitin or ubiquitin related proteins. This modeling study may shed light on the mode of interactions of Rpt1 domain of INI1 and is likely to facilitate future functional studies of INI1. PMID:27261671

  12. Regulation of HTLV-1 Tax Stability, Cellular Trafficking and NF-κB Activation by the Ubiquitin-Proteasome Pathway (United States)

    Lavorgna, Alfonso; Harhaj, Edward William


    Human T-cell leukemia virus type 1 (HTLV-1) is a complex retrovirus that infects CD4+ T cells and causes adult T-cell leukemia/lymphoma (ATLL) in 3%–5% of infected individuals after a long latent period. HTLV-1 Tax is a trans-activating protein that regulates viral gene expression and also modulates cellular signaling pathways to enhance T-cell proliferation and cell survival. The Tax oncoprotein promotes T-cell transformation, in part via constitutive activation of the NF-κB transcription factor; however, the underlying mechanisms remain unknown. Ubiquitination is a type of post-translational modification that occurs in a three-step enzymatic cascade mediated by E1, E2 and E3 enzymes and regulates protein stability as well as signal transduction, protein trafficking and the DNA damage response. Emerging studies indicate that Tax hijacks the ubiquitin machinery to activate ubiquitin-dependent kinases and downstream NF-κB signaling. Tax interacts with the E2 conjugating enzyme Ubc13 and is conjugated on C-terminal lysine residues with lysine 63-linked polyubiquitin chains. Tax K63-linked polyubiquitination may serve as a platform for signaling complexes since this modification is critical for interactions with NEMO and IKK. In addition to NF-κB signaling, mono- and polyubiquitination of Tax also regulate its subcellular trafficking and stability. Here, we review recent advances in the diverse roles of ubiquitin in Tax function and how Tax usurps the ubiquitin-proteasome pathway to promote oncogenesis. PMID:25341660

  13. Systemic insulin sensitivity is regulated by GPS2 inhibition of AKT ubiquitination and activation in adipose tissue. (United States)

    Cederquist, Carly T; Lentucci, Claudia; Martinez-Calejman, Camila; Hayashi, Vanessa; Orofino, Joseph; Guertin, David; Fried, Susan K; Lee, Mi-Jeong; Cardamone, M Dafne; Perissi, Valentina


    Insulin signaling plays a unique role in the regulation of energy homeostasis and the impairment of insulin action is associated with altered lipid metabolism, obesity, and Type 2 Diabetes. The main aim of this study was to provide further insight into the regulatory mechanisms governing the insulin signaling pathway by investigating the role of non-proteolytic ubiquitination in insulin-mediated activation of AKT. The molecular mechanism of AKT regulation through ubiquitination is first dissected in vitro in 3T3-L1 preadipocytes and then validated in vivo using mice with adipo-specific deletion of GPS2, an endogenous inhibitor of Ubc13 activity (GPS2-AKO mice). Our results indicate that K63 ubiquitination is a critical component of AKT activation in the insulin signaling pathway and that counter-regulation of this step is provided by GPS2 preventing AKT ubiquitination through inhibition of Ubc13 enzymatic activity. Removal of this negative checkpoint, through GPS2 downregulation or genetic deletion, results in sustained activation of insulin signaling both in vitro and in vivo . As a result, the balance between lipid accumulation and utilization is shifted toward storage in the adipose tissue and GPS2-AKO mice become obese under normal laboratory chow diet. However, the adipose tissue of GPS2-AKO mice is not inflamed, the levels of circulating adiponectin are elevated, and systemic insulin sensitivity is overall improved. Our findings characterize a novel layer of regulation of the insulin signaling pathway based on non-proteolytic ubiquitination of AKT and define GPS2 as a previously unrecognized component of the insulin signaling cascade. In accordance with this role, we have shown that GPS2 presence in adipocytes modulates systemic metabolism by restricting the activation of insulin signaling during the fasted state, whereas in absence of GPS2, the adipose tissue is more efficient at lipid storage, and obesity becomes uncoupled from inflammation and insulin

  14. Skp2 regulates androgen receptor through ubiquitin-mediated degradation independent of Akt/mTOR pathways in prostate cancer. (United States)

    Li, Bo; Lu, Wenfu; Yang, Qing; Yu, Xiuping; Matusik, Robert J; Chen, Zhenbang


    The intervention of advanced prostate cancer (PCa) in patients has been commonly depending on androgen deprivation therapy. Despite of tremendous research efforts, however, molecular mechanisms on AR regulation remain poorly understood, particularly for castration resistant prostate cancer (CRPC). Targeting AR and associated factors is considered an effective strategy in PCa treatment. Human prostate cancer cells were used in this study. Manipulations of Skp2 expression were achieved by Skp2 shRNA/siRNA or overexpression of plasmids. Dual luciferase reporter assay was applied for AR activity assessment. Western blot, ubiquitination assay, immunoprecipitation, and immunofluorescence were applied to detect the proteins. Our results demonstrated that Skp2 directly involves the regulation of AR expression through ubiquitination-mediated degradation. Skp2 interacted with AR protein in PCa cells, and enforced expression of Skp2 resulted in a decreased level and activity of AR. By contrast, Skp2 knockdown increased the protein accumulation and activity of AR. Importantly, changes of AR contributed by Skp2 led to subsequent alterations of PSA level in PCa cells. AR ubiquitination was significantly increased upon Skp2 overexpression but greatly reduced upon Skp2 knockdown. AR mutant at K847R abrogated Skp2-mediated ubiquitination of AR. NVP-BEZ235, a dual PI3K/mTOR inhibitor, remarkably inhibited Skp2 level with a striking elevation of AR. The results indicate that Skp2 is an E3 ligase for proteasome-dependent AR degradation, and K847 on AR is the recognition site for Skp2-mediated ubiquitination. Our findings reveal an essential role of Skp2 in AR signaling. © 2013 Wiley Periodicals, Inc.

  15. Degradation Signals Recognized by the Ubc6p-Ubc7p Ubiquitin-Conjugating Enzyme Pair (United States)

    Gilon, Tamar; Chomsky, Orna; Kulka, Richard G.


    Proteolysis by the ubiquitin-proteasome system is highly selective. Specificity is achieved by the cooperation of diverse ubiquitin-conjugating enzymes (Ubcs or E2s) with a variety of ubiquitin ligases (E3s) and other ancillary factors. These recognize degradation signals characteristic of their target proteins. In a previous investigation, we identified signals directing the degradation of β-galactosidase and Ura3p fusion proteins via a subsidiary pathway of the ubiquitin-proteasome system involving Ubc6p and Ubc7p. This pathway has recently been shown to be essential for the degradation of misfolded and regulated proteins in the endoplasmic reticulum (ER) lumen and membrane, which are transported to the cytoplasm via the Sec61p translocon. Mutant backgrounds which prevent retrograde transport of ER proteins (hrd1/der3Δ and sec61-2) did not inhibit the degradation of the β-galactosidase and Ura3p fusions carrying Ubc6p/Ubc7p pathway signals. We therefore conclude that the ubiquitination of these fusion proteins takes place on the cytosolic face of the ER without prior transfer to the ER lumen. The contributions of different sequence elements to a 16-amino-acid-residue Ubc6p-Ubc7p-specific signal were analyzed by mutation. A patch of bulky hydrophobic residues was an essential element. In addition, positively charged residues were found to be essential. Unexpectedly, certain substitutions of bulky hydrophobic or positively charged residues with alanine created novel degradation signals, channeling the degradation of fusion proteins to an unidentified proteasomal pathway not involving Ubc6p and Ubc7p. PMID:10982838

  16. An ethanolic extract of Artemisia dracunculus L. regulates gene expression of ubiquitin-proteasome system enzymes in skeletal muscle: potential role in the treatment of sarcopenic obesity. (United States)

    Kirk-Ballard, Heather; Kilroy, Gail; Day, Britton C; Wang, Zhong Q; Ribnicky, David M; Cefalu, William T; Floyd, Z Elizabeth


    Obesity is linked to insulin resistance, a primary component of metabolic syndrome and type 2 diabetes. The problem of obesity-related insulin resistance is compounded when age-related skeletal muscle loss, called sarcopenia, occurs with obesity. Skeletal muscle loss results from elevated levels of protein degradation and prevention of obesity-related sarcopenic muscle loss will depend on strategies that target pathways involved in protein degradation. An extract from Artemisia dracunculus, termed PMI 5011, improves insulin signaling and increases skeletal muscle myofiber size in a rodent model of obesity-related insulin resistance. The aim of this study was to examine the effect of PMI 5011 on the ubiquitin-proteasome system, a central regulator of muscle protein degradation. Gastrocnemius and vastus lateralis skeletal muscle was obtained from KK-A(y) obese diabetic mice fed a control or 1% (w/w) PMI 5011-supplemented diet. Regulation of genes encoding enzymes of the ubiquitin-proteasome system was determined using real-time quantitative reverse transcriptase polymerase chain reaction. Although MuRF-1 ubiquitin ligase gene expression is consistently down-regulated in skeletal muscle, atrogin-1, Fbxo40, and Traf6 expression is differentially regulated by PMI 5011. Genes encoding other enzymes of the ubiquitin-proteasome system ranging from ubiquitin to ubiquitin-specific proteases are also regulated by PMI 5011. Additionally, expression of the gene encoding the microtubule-associated protein-1 light chain 3 (LC3), a ubiquitin-like protein pivotal to autophagy-mediated protein degradation, is down-regulated by PMI 5011 in the vastus lateralis. PMI 5011 alters the gene expression of ubiquitin-proteasome system enzymes that are essential regulators of skeletal muscle mass. This suggests that PMI 5011 has therapeutic potential in the treatment of obesity-linked sarcopenia by regulating ubiquitin-proteasome-mediated protein degradation. Copyright © 2014 Elsevier Inc

  17. Modification by Ubiquitin-Like Proteins: Significance in Apoptosis and Autophagy Pathways

    Directory of Open Access Journals (Sweden)

    Monde Ntwasa


    Full Text Available Ubiquitin-like proteins (Ubls confer diverse functions on their target proteins. The modified proteins are involved in various biological processes, including DNA replication, signal transduction, cell cycle control, embryogenesis, cytoskeletal regulation, metabolism, stress response, homeostasis and mRNA processing. Modifiers such as SUMO, ATG12, ISG15, FAT10, URM1, and UFM have been shown to modify proteins thus conferring functions related to programmed cell death, autophagy and regulation of the immune system. Putative modifiers such as Domain With No Name (DWNN have been identified in recent times but not fully characterized. In this review, we focus on cellular processes involving human Ubls and their targets. We review current progress in targeting these modifiers for drug design strategies.

  18. The putative roles of the ubiquitin/proteasome pathway in resistance to anticancer therapy. (United States)

    Smith, Laura; Lind, Michael J; Drew, Philip J; Cawkwell, Lynn


    The ubiquitin/proteasome (UP) pathway plays a significant role in many important biological functions and alterations in this pathway have been shown to contribute to the pathology of many human diseases, including cancer. Proteasome inhibition has been well established as a rational strategy for the treatment of multiple myeloma and is currently under investigation for the treatment of other haematological malignancies and solid tumours. Recent evidence suggests that proteasome inhibition may also sensitise tumour cells to the actions of both conventional chemotherapy and radiotherapy, suggesting that this pathway may modify clinical response to anticancer therapy. However, conflicting evidence exists as to the roles of the UP pathway in resistance to treatment. This review endeavours to discuss such roles.

  19. Degradation of human Lipin-1 by BTRC E3 ubiquitin ligase. (United States)

    Ishimoto, Kenji; Hayase, Ayaka; Kumagai, Fumiko; Kawai, Megumi; Okuno, Hiroko; Hino, Nobumasa; Okada, Yoshiaki; Kawamura, Takeshi; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Tachibana, Keisuke; Doi, Takefumi


    Lipin-1 has dual functions in the regulation of lipid and energy metabolism according to its subcellular localization, which is tightly controlled. However, it is unclear how Lipin-1 degradation is regulated. Here, we demonstrate that Lipin-1 is degraded through its DSGXXS motif. We show that Lipin-1 interacts with either of two E3 ubiquitin ligases, BTRC or FBXW11, and that this interaction is DSGXXS-dependent and mediates the attachment of polyubiquitin chains. Further, we demonstrate that degradation of Lipin-1 is regulated by BTRC in the cytoplasm and on membranes. These novel insights into the regulation of human Lipin-1 stability will be useful in planning further studies to elucidate its metabolic processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Ret Finger Protein: An E3 Ubiquitin Ligase Juxtaposed to the XY Body in Meiosis

    Directory of Open Access Journals (Sweden)

    Isabelle Gillot


    Full Text Available During prophase I of male meiosis, the sex chromosomes form a compact structure called XY body that associates with the nuclear membrane of pachytene spermatocytes. Ret Finger Protein is a transcriptional repressor, able to interact with both nuclear matrix-associated proteins and double-stranded DNA. We report the precise and unique localization of Ret Finger Protein in pachytene spermatocytes, in which Ret Finger Protein takes place of lamin B1, between the XY body and the inner nuclear membrane. This localization of Ret Finger Protein does not seem to be associated with O-glycosylation or sumoylation. In addition, we demonstrate that Ret Finger Protein contains an E3 ubiquitin ligase activity. These observations lead to an attractive hypothesis in which Ret Finger Protein would be involved in the positioning and the attachment of XY body to the nuclear lamina of pachytene spermatocytes.

  1. Sterol homeostasis requires regulated degradation of squalene monooxygenase by the ubiquitin ligase Doa10/Teb4

    DEFF Research Database (Denmark)

    Foresti, Ombretta; Ruggiano, Annamaria; Hannibal-Bach, Hans K


    Sterol homeostasis is essential for the function of cellular membranes and requires feedback inhibition of HMGR, a rate-limiting enzyme of the mevalonate pathway. As HMGR acts at the beginning of the pathway, its regulation affects the synthesis of sterols and of other essential mevalonate......-derived metabolites, such as ubiquinone or dolichol. Here, we describe a novel, evolutionarily conserved feedback system operating at a sterol-specific step of the mevalonate pathway. This involves the sterol-dependent degradation of squalene monooxygenase mediated by the yeast Doa10 or mammalian Teb4, a ubiquitin...... ligase implicated in a branch of the endoplasmic reticulum (ER)-associated protein degradation (ERAD) pathway. Since the other branch of ERAD is required for HMGR regulation, our results reveal a fundamental role for ERAD in sterol homeostasis, with the two branches of this pathway acting together...

  2. Expression and purification of lacticin Q by small ubiquitin-related modifier fusion in Escherichia coli. (United States)

    Ma, Qingshan; Yu, Zhanqiao; Han, Bing; Wang, Qing; Zhang, Rijun


    Lacticin Q is a broad-spectrum class II bacteriocin with potential as an alternative to conventional antibiotics. The objective of this study was to produce recombinant lacticin Q using a small ubiquitin-related modifier (SUMO) fusion protein expression system. The 168-bp lacticin Q gene was cloned into the expression vector pET SUMO and transformed into Escherichia coli BL21(DE3). The soluble fusion protein was recovered with a Ni-NTA Sepharose column (95% purity); 130 mg protein was obtained per liter of fermentation culture. The SUMO tag was then proteolytically cleaved from the protein, which was re-applied to the column. Finally, about 32 mg lacticin Q (≥96% purity) was obtained. The recombinant protein exhibited antimicrobial properties similar to that of the native protein, demonstrating that lacticin Q had been successfully expressed by the SUMO fusion system.

  3. PolyUbiquitin chain linkage topology selects the functions from the underlying binding landscape.

    Directory of Open Access Journals (Sweden)

    Yong Wang


    Full Text Available Ubiquitin (Ub can generate versatile molecular signals and lead to different celluar fates. The functional poly-valence of Ub is believed to be resulted from its ability to form distinct polymerized chains with eight linkage types. To provide a full picture of ubiquitin code, we explore the binding landscape of two free Ub monomers and also the functional landscapes of of all eight linkage types by theoretical modeling. Remarkably, we found that most of the compact structures of covalently connected dimeric Ub chains (diUbs pre-exist on the binding landscape. These compact functional states were subsequently validated by corresponding linkage models. This leads to the proposal that the folding architecture of Ub monomer has encoded all functional states into its binding landscape, which is further selected by different topologies of polymeric Ub chains. Moreover, our results revealed that covalent linkage leads to symmetry breaking of interfacial interactions. We further propose that topological constraint not only limits the conformational space for effective switching between functional states, but also selects the local interactions for realizing the corresponding biological function. Therefore, the topological constraint provides a way for breaking the binding symmetry and reaching the functional specificity. The simulation results also provide several predictions that qualitatively and quantitatively consistent with experiments. Importantly, the K48 linkage model successfully predicted intermediate states. The resulting multi-state energy landscape was further employed to reconcile the seemingly contradictory experimental data on the conformational equilibrium of K48-diUb. Our results further suggest that hydrophobic interactions are dominant in the functional landscapes of K6-, K11-, K33- and K48 diUbs, while electrostatic interactions play a more important role in the functional landscapes of K27, K29, K63 and linear linkages.

  4. PolyUbiquitin chain linkage topology selects the functions from the underlying binding landscape. (United States)

    Wang, Yong; Tang, Chun; Wang, Erkang; Wang, Jin


    Ubiquitin (Ub) can generate versatile molecular signals and lead to different celluar fates. The functional poly-valence of Ub is believed to be resulted from its ability to form distinct polymerized chains with eight linkage types. To provide a full picture of ubiquitin code, we explore the binding landscape of two free Ub monomers and also the functional landscapes of of all eight linkage types by theoretical modeling. Remarkably, we found that most of the compact structures of covalently connected dimeric Ub chains (diUbs) pre-exist on the binding landscape. These compact functional states were subsequently validated by corresponding linkage models. This leads to the proposal that the folding architecture of Ub monomer has encoded all functional states into its binding landscape, which is further selected by different topologies of polymeric Ub chains. Moreover, our results revealed that covalent linkage leads to symmetry breaking of interfacial interactions. We further propose that topological constraint not only limits the conformational space for effective switching between functional states, but also selects the local interactions for realizing the corresponding biological function. Therefore, the topological constraint provides a way for breaking the binding symmetry and reaching the functional specificity. The simulation results also provide several predictions that qualitatively and quantitatively consistent with experiments. Importantly, the K48 linkage model successfully predicted intermediate states. The resulting multi-state energy landscape was further employed to reconcile the seemingly contradictory experimental data on the conformational equilibrium of K48-diUb. Our results further suggest that hydrophobic interactions are dominant in the functional landscapes of K6-, K11-, K33- and K48 diUbs, while electrostatic interactions play a more important role in the functional landscapes of K27, K29, K63 and linear linkages.

  5. Ubiquitinated Proteins Isolated From Tumor Cells Are Efficient Substrates for Antigen Cross-Presentation. (United States)

    Yu, Guangjie; Moudgil, Tarsem; Cui, Zhihua; Mou, Yongbin; Wang, Lixin; Fox, Bernard A; Hu, Hong-Ming


    We have previously shown that inhibition of the proteasome causes defective ribosomal products to be shunted into autophagosomes and subsequently released from tumor cells as defective ribosomal products in Blebs (DRibbles). These DRibbles serve as an excellent source of antigens for cross-priming of tumor-specific T cells. Here, we examine the role of ubiquitinated proteins (Ub-proteins) in this pathway. Using purified Ub-proteins from tumor cells that express endogenous tumor-associated antigen or exogenous viral antigen, we tested the ability of these proteins to stimulate antigen-specific T-cell responses, by activation of monocyte-derived dendritic cells generated from human peripheral blood mononuclear cells. Compared with total cell lysates, we found that purified Ub-proteins from both a gp100-specific melanoma cell line and from a lung cancer cell line expressing cytomegalovirus pp65 antigen produced a significantly higher level of IFN-γ in gp100- or pp65-specific T cells, respectively. In addition, Ub-proteins from an allogeneic tumor cell line could be used to stimulate tumor-infiltrating lymphocytes isolated and expanded from non-small cell lung cancer patients. These results establish that Ub-proteins provide a relevant source of antigens for cross-priming of antitumor immune responses in a variety of settings, including endogenous melanoma and exogenous viral antigen presentation, as well as antigen-specific tumor-infiltrating lymphocytes. Thus, ubiquitin can be used as an affinity tag to enrich for unknown tumor-specific antigens from tumor cell lysates to stimulate tumor-specific T cells ex vivo or to be used as vaccines to target short-lived proteins.

  6. Tumor necrosis factor-alpha regulates the Hypocretin system via mRNA degradation and ubiquitination. (United States)

    Zhan, Shuqin; Cai, Guo-Qiang; Zheng, Anni; Wang, Yuping; Jia, Jianping; Fang, Haotian; Yang, Youfeng; Hu, Meng; Ding, Qiang


    Recent studies recognize that Hypocretin system (also known as Orexin) plays a critical role in sleep/wake disorders and feeding behaviors. However, little is known about the regulation of the Hypocretin system. It is also known that tumor necrosis factor alpha (TNF-α) is involved in the regulation of sleep/wake cycle. Here, we test our hypothesis that the Hypocretin system is regulated by TNF-α. Prepro-Hypocretin and Hypocretin receptor 2 (HcrtR2) can be detected at a very low level in rat B35 neuroblastoma cells. In response to TNF-α, Prepro-Hypocretin mRNA and protein levels are down-regulated, and also HcrtR2 protein level is down-regulated in B35 cells. To investigate the mechanism, exogenous rat Prepro-Hypocretin and rat HcrtR2 were overexpressed in B35 cells. In response to TNF-α, protein and mRNA of Prepro-Hypocretin are significantly decreased (by 93% and 94%, respectively), and the half-life of Prepro-Hypocretin mRNA is decreased in a time- and dose-dependent manner. The level of HcrtR2 mRNA level is not affected by TNF-α treatment; however, HcrtR2 protein level is significantly decreased (by 86%) through ubiquitination in B35 cells treated with TNF-α. Downregulation of cellular inhibitor of apoptosis protein-1 and -2 (cIAP-1 and -2) abrogates the HcrtR2 ubiquitination induced by TNF-α. The control green fluorescent protein (GFP) expression is not affected by TNF-α treatment. These studies demonstrate that TNF-α can impair the function of the Hypocretin system by reducing the levels of both Prepro-Hypocretin and HcrtR2. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Autism genome-wide copy number variation reveals ubiquitin and neuronal genes. (United States)

    Glessner, Joseph T; Wang, Kai; Cai, Guiqing; Korvatska, Olena; Kim, Cecilia E; Wood, Shawn; Zhang, Haitao; Estes, Annette; Brune, Camille W; Bradfield, Jonathan P; Imielinski, Marcin; Frackelton, Edward C; Reichert, Jennifer; Crawford, Emily L; Munson, Jeffrey; Sleiman, Patrick M A; Chiavacci, Rosetta; Annaiah, Kiran; Thomas, Kelly; Hou, Cuiping; Glaberson, Wendy; Flory, James; Otieno, Frederick; Garris, Maria; Soorya, Latha; Klei, Lambertus; Piven, Joseph; Meyer, Kacie J; Anagnostou, Evdokia; Sakurai, Takeshi; Game, Rachel M; Rudd, Danielle S; Zurawiecki, Danielle; McDougle, Christopher J; Davis, Lea K; Miller, Judith; Posey, David J; Michaels, Shana; Kolevzon, Alexander; Silverman, Jeremy M; Bernier, Raphael; Levy, Susan E; Schultz, Robert T; Dawson, Geraldine; Owley, Thomas; McMahon, William M; Wassink, Thomas H; Sweeney, John A; Nurnberger, John I; Coon, Hilary; Sutcliffe, James S; Minshew, Nancy J; Grant, Struan F A; Bucan, Maja; Cook, Edwin H; Buxbaum, Joseph D; Devlin, Bernie; Schellenberg, Gerard D; Hakonarson, Hakon


    Autism spectrum disorders (ASDs) are childhood neurodevelopmental disorders with complex genetic origins. Previous studies focusing on candidate genes or genomic regions have identified several copy number variations (CNVs) that are associated with an increased risk of ASDs. Here we present the results from a whole-genome CNV study on a cohort of 859 ASD cases and 1,409 healthy children of European ancestry who were genotyped with approximately 550,000 single nucleotide polymorphism markers, in an attempt to comprehensively identify CNVs conferring susceptibility to ASDs. Positive findings were evaluated in an independent cohort of 1,336 ASD cases and 1,110 controls of European ancestry. Besides previously reported ASD candidate genes, such as NRXN1 (ref. 10) and CNTN4 (refs 11, 12), several new susceptibility genes encoding neuronal cell-adhesion molecules, including NLGN1 and ASTN2, were enriched with CNVs in ASD cases compared to controls (P = 9.5 x 10(-3)). Furthermore, CNVs within or surrounding genes involved in the ubiquitin pathways, including UBE3A, PARK2, RFWD2 and FBXO40, were affected by CNVs not observed in controls (P = 3.3 x 10(-3)). We also identified duplications 55 kilobases upstream of complementary DNA AK123120 (P = 3.6 x 10(-6)). Although these variants may be individually rare, they target genes involved in neuronal cell-adhesion or ubiquitin degradation, indicating that these two important gene networks expressed within the central nervous system may contribute to the genetic