WorldWideScience

Sample records for polycomb genes mediated

  1. Insulators target active genes to transcription factories and polycomb-repressed genes to polycomb bodies.

    Directory of Open Access Journals (Sweden)

    Hua-Bing Li

    2013-04-01

    Full Text Available Polycomb bodies are foci of Polycomb proteins in which different Polycomb target genes are thought to co-localize in the nucleus, looping out from their chromosomal context. We have shown previously that insulators, not Polycomb response elements (PREs, mediate associations among Polycomb Group (PcG targets to form Polycomb bodies. Here we use live imaging and 3C interactions to show that transgenes containing PREs and endogenous PcG-regulated genes are targeted by insulator proteins to different nuclear structures depending on their state of activity. When two genes are repressed, they co-localize in Polycomb bodies. When both are active, they are targeted to transcription factories in a fashion dependent on Trithorax and enhancer specificity as well as the insulator protein CTCF. In the absence of CTCF, assembly of Polycomb bodies is essentially reduced to those representing genomic clusters of Polycomb target genes. The critical role of Trithorax suggests that stable association with a specialized transcription factory underlies the cellular memory of the active state.

  2. Histone H3 Serine 28 Is Essential for Efficient Polycomb-Mediated Gene Repression in Drosophila

    Directory of Open Access Journals (Sweden)

    Philip Yuk Kwong Yung

    2015-06-01

    Full Text Available Trimethylation at histone H3K27 is central to the polycomb repression system. Juxtaposed to H3K27 is a widely conserved phosphorylatable serine residue (H3S28 whose function is unclear. To assess the importance of H3S28, we generated a Drosophila H3 histone mutant with a serine-to-alanine mutation at position 28. H3S28A mutant cells lack H3S28ph on mitotic chromosomes but support normal mitosis. Strikingly, all methylation states of H3K27 drop in H3S28A cells, leading to Hox gene derepression and to homeotic transformations in adult tissues. These defects are not caused by active H3K27 demethylation nor by the loss of H3S28ph. Biochemical assays show that H3S28A nucleosomes are a suboptimal substrate for PRC2, suggesting that the unphosphorylated state of serine 28 is important for assisting in the function of polycomb complexes. Collectively, our data indicate that the conserved H3S28 residue in metazoans has a role in supporting PRC2 catalysis.

  3. Mediator complex cooperatively regulates transcription of retinoic acid target genes with Polycomb Repressive Complex 2 during neuronal differentiation.

    Science.gov (United States)

    Fukasawa, Rikiya; Iida, Satoshi; Tsutsui, Taiki; Hirose, Yutaka; Ohkuma, Yoshiaki

    2015-11-01

    The Mediator complex (Mediator) plays key roles in transcription and functions as the nexus for integration of various transcriptional signals. Previously, we screened for Mediator cyclin-dependent kinase (CDK)-interacting factors and identified three proteins related to chromatin regulation. One of them, SUZ12 is required for both stability and activity of Polycomb Repressive Complex 2 (PRC2). PRC2 primarily suppresses gene expression through histone H3 lysine 27 trimethylation, resulting in stem cell maintenance and differentiation; perturbation of this process leads to oncogenesis. Recent work showed that Mediator contributes to the embryonic stem cell state through DNA loop formation, which is strongly associated with chromatin architecture; however, it remains unclear how Mediator regulates gene expression in cooperation with chromatin regulators (i.e. writers, readers and remodelers). We found that Mediator CDKs interact directly with the PRC2 subunit EZH2, as well as SUZ12. Known PRC2 target genes were deregulated by Mediator CDK knockdown during neuronal differentiation, and both Mediator and PRC2 complexes co-occupied the promoters of developmental genes regulated by retinoic acid. Our results provide a mechanistic link between Mediator and PRC2 during neuronal differentiation. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  4. Polycomb group protein-mediated repression of transcription

    DEFF Research Database (Denmark)

    Morey, Lluís; Helin, Kristian

    2010-01-01

    The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work as transcri......The polycomb group (PcG) proteins are essential for the normal development of multicellular organisms. They form multi-protein complexes that work as transcriptional repressors of several thousand genes controlling differentiation pathways during development. How the PcG proteins work...... as transcriptional repressors is incompletely understood, but involves post-translational modifications of histones by two major PcG protein complexes: polycomb repressive complex 1 and polycomb repressive complex 2....

  5. Polycomb complexes act redundantly to repress genomic repeats and genes

    DEFF Research Database (Denmark)

    Leeb, Martin; Pasini, Diego; Novatchkova, Maria

    2010-01-01

    Polycomb complexes establish chromatin modifications for maintaining gene repression and are essential for embryonic development in mice. Here we use pluripotent embryonic stem (ES) cells to demonstrate an unexpected redundancy between Polycomb-repressive complex 1 (PRC1) and PRC2 during...... the formation of differentiated cells. ES cells lacking the function of either PRC1 or PRC2 can differentiate into cells of the three germ layers, whereas simultaneous loss of PRC1 and PRC2 abrogates differentiation. On the molecular level, the differentiation defect is caused by the derepression of a set...

  6. A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma.

    Science.gov (United States)

    Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D; Schlecht, Nicolas F; Einstein, Mark H; Greally, John M

    2016-09-20

    Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors.

  7. Interactions of Polyhomeotic with Polycomb Group Genes of Drosophila Melanogaster

    OpenAIRE

    Cheng, N. N.; Sinclair, DAR.; Campbell, R. B.; Brock, H. W.

    1994-01-01

    The Polycomb (Pc) group genes of Drosophila are negative regulators of homeotic genes, but individual loci have pleiotropic phenotypes. It has been suggested that Pc group genes might form a regulatory hierarchy, or might be members of a multimeric complex that obeys the law of mass action. Recently, it was shown that polyhomeotic (ph) immunoprecipitates in a multimeric complex that includes Pc. Here, we show that duplications of ph suppress homeotic transformations of Pc and Pcl, supporting ...

  8. A polycomb-mediated epigenetic field defect precedes invasive cervical carcinoma

    Science.gov (United States)

    Wijetunga, Neil Ari; Ben-Dayan, Miriam; Tozour, Jessica; Burk, Robert D.; Schlecht, Nicolas F.; Einstein, Mark H.; Greally, John M.

    2016-01-01

    Human papillomavirus (HPV)-associated cervical carcinoma is preceded by stages of cervical intra-epithelial neoplasia (CIN) that can variably progress to malignancy. Understanding the different molecular processes involved in the progression of pre-malignant CIN is critical to the development of improved predictive and interventional capabilities. We tested the role of regulators of transcription in both the development and the progression of HPV-associated CIN, performing the most comprehensive genomic survey to date of DNA methylation in HPV-associated cervical neoplasia, testing ~2 million loci throughout the human genome in biopsies from 78 HPV+ women, identifying changes starting in early CIN and maintained through carcinogenesis. We identified loci at which DNA methylation is consistently altered, beginning early in the course of neoplastic disease and progressing with disease advancement. While the loss of DNA methylation occurs mostly at intergenic regions, acquisition of DNA methylation is at sites involved in transcriptional regulation, with strong enrichment for targets of polycomb repression. Using an independent cohort from The Cancer Genome Atlas, we validated the loci with increased DNA methylation and found that these regulatory changes were associated with locally decreased gene expression. Secondary validation using immunohistochemistry showed that the progression of neoplasia was associated with increasing polycomb protein expression specifically in the cervical epithelium. We find that perturbations of genomic regulatory processes occur early and persist in cervical carcinoma. The results indicate a polycomb-mediated epigenetic field defect in cervical neoplasia that may represent a target for early, topical interventions using polycomb inhibitors. PMID:27557505

  9. Genome-Wide Identification of Polycomb Target Genes Reveals a Functional Association of Pho with Scm in Bombyx mori

    OpenAIRE

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

    2012-01-01

    Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent ...

  10. Alternative epigenetic chromatin states of polycomb target genes.

    Directory of Open Access Journals (Sweden)

    Yuri B Schwartz

    2010-01-01

    Full Text Available Polycomb (PcG regulation has been thought to produce stable long-term gene silencing. Genomic analyses in Drosophila and mammals, however, have shown that it targets many genes, which can switch state during development. Genetic evidence indicates that critical for the active state of PcG target genes are the histone methyltransferases Trithorax (TRX and ASH1. Here we analyze the repertoire of alternative states in which PcG target genes are found in different Drosophila cell lines and the role of PcG proteins TRX and ASH1 in controlling these states. Using extensive genome-wide chromatin immunoprecipitation analysis, RNAi knockdowns, and quantitative RT-PCR, we show that, in addition to the known repressed state, PcG targets can reside in a transcriptionally active state characterized by formation of an extended domain enriched in ASH1, the N-terminal, but not C-terminal moiety of TRX and H3K27ac. ASH1/TRX N-ter domains and transcription are not incompatible with repressive marks, sometimes resulting in a "balanced" state modulated by both repressors and activators. Often however, loss of PcG repression results instead in a "void" state, lacking transcription, H3K27ac, or binding of TRX or ASH1. We conclude that PcG repression is dynamic, not static, and that the propensity of a target gene to switch states depends on relative levels of PcG, TRX, and activators. N-ter TRX plays a remarkable role that antagonizes PcG repression and preempts H3K27 methylation by acetylation. This role is distinct from that usually attributed to TRX/MLL proteins at the promoter. These results have important implications for Polycomb gene regulation, the "bivalent" chromatin state of embryonic stem cells, and gene expression in development.

  11. Polycomb-group genes sustaining the stem cell activity

    International Nuclear Information System (INIS)

    Takihara, Yoshihiro

    2006-01-01

    Polycomb-group genes (PcG) have a role in constituting the cellular memory mechanisms through which the once expressed phenotypes during development are transmitted thereafter and this review describes, together with authors' findings of sustaining hematopoietic stem cell activity by the PcG products, what molecular bases, involving the control of histone code, are concerned in the memory. Recent investigations have gradually elucidated the outline of epigenetic control mechanisms of the memory: messages are set up as a histone code in the chromatin and the PcG complex recruited by recognition of the code regulates the chromatin structure leading to DNA transcription and maintenance of the phenotype. Proliferation of hematopoietic stem cells ex vivo will be possible if exact and detailed mechanisms for PcG are made clear in future. Such ex vivo techniques are especially awaited for marrow remodeling treatment of hematopoietic failure induced by radiation exposure. (T.I.)

  12. How Polycomb-Mediated Cell Memory Deals With a Changing Environment

    KAUST Repository

    Marasca, Federica; Bodega, Beatrice; Orlando, Valerio

    2018-01-01

    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

  13. How Polycomb-Mediated Cell Memory Deals With a Changing Environment

    KAUST Repository

    Marasca, Federica

    2018-03-09

    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment.

  14. One, Two, Three: Polycomb Proteins Hit All Dimensions of Gene Regulation

    Directory of Open Access Journals (Sweden)

    Stefania del Prete

    2015-07-01

    Full Text Available Polycomb group (PcG proteins contribute to the formation and maintenance of a specific repressive chromatin state that prevents the expression of genes in a particular space and time. Polycomb repressive complexes (PRCs consist of several PcG proteins with specific regulatory or catalytic properties. PRCs are recruited to thousands of target genes, and various recruitment factors, including DNA-binding proteins and non-coding RNAs, are involved in the targeting. PcG proteins contribute to a multitude of biological processes by altering chromatin features at different scales. PcG proteins mediate both biochemical modifications of histone tails and biophysical modifications (e.g., chromatin fiber compaction and three-dimensional (3D chromatin conformation. Here, we review the role of PcG proteins in nuclear architecture, describing their impact on the structure of the chromatin fiber, on chromatin interactions, and on the spatial organization of the genome in nuclei. Although little is known about the role of plant PcG proteins in nuclear organization, much is known in the animal field, and we highlight similarities and differences in the roles of PcG proteins in 3D gene regulation in plants and animals.

  15. Altered expression of polycomb group genes in glioblastoma multiforme.

    Directory of Open Access Journals (Sweden)

    Gang Li

    Full Text Available The Polycomb group (PcG proteins play a critical role in histone mediated epigenetics which has been implicated in the malignant evolution of glioblastoma multiforme (GBM. By systematically interrogating The Cancer Genome Atlas (TCGA, we discovered widespread aberrant expression of the PcG members in GBM samples compared to normal brain. The most striking differences were upregulation of EZH2, PHF19, CBX8 and PHC2 and downregulation of CBX7, CBX6, EZH1 and RYBP. Interestingly, changes in EZH2, PHF19, CBX7, CBX6 and EZH1 occurred progressively as astrocytoma grade increased. We validated the aberrant expression of CBX6, CBX7, CBX8 and EZH2 in GBM cell lines by Western blotting and qRT-PCR, and further the aberrant expression of CBX6 in GBM tissue samples by immunohistochemical staining. To determine if there was functional significance to the diminished CBX6 levels in GBM, CBX6 was overexpressed in GBM cells resulting in decreased proliferative capacity. In conclusion, aberrant expression of PcG proteins in GBMs may play a role in the development or maintenance of the malignancy.

  16. Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism.

    Directory of Open Access Journals (Sweden)

    Erik Södersten

    2014-09-01

    Full Text Available Polycomb group (PcG proteins bind to and repress genes in embryonic stem cells through lineage commitment to the terminal differentiated state. PcG repressed genes are commonly characterized by the presence of the epigenetic histone mark H3K27me3, catalyzed by the Polycomb repressive complex 2. Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation. The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP experiments showed that increased H3K27me3S28p was accompanied by reduced PcG binding to regulatory regions of genes. An analysis of the genome wide distribution of L-DOPA-induced H3K27me3S28 phosphorylation by ChIP sequencing (ChIP-seq in combination with expression analysis by RNA-sequencing (RNA-seq showed that the induction of H3K27me3S28p correlated with increased expression of a subset of PcG repressed genes. We found that induction of H3K27me3S28p persisted during chronic L-DOPA administration to parkisonian mice and correlated with aberrant gene expression. We propose that dopaminergic transmission can activate PcG repressed genes in the adult brain and thereby contribute to long-term maladaptive responses including the motor complications, or dyskinesia, caused by prolonged administration of L-DOPA in Parkinson's disease.

  17. REST-mediated recruitment of polycomb repressor complexes in mammalian cells

    DEFF Research Database (Denmark)

    Dietrich, Nikolaj; Lerdrup, Mads; Landt, Eskild

    2012-01-01

    Polycomb Repressive Complex (PRC) 1 and PRC2 regulate genes involved in differentiation and development. However, the mechanism for how PRC1 and PRC2 are recruited to genes in mammalian cells is unclear. Here we present evidence for an interaction between the transcription factor REST, PRC1......, and increased gene expression. Genome-wide analysis of Polycomb binding in Rest¿/¿ and Eed¿/¿ mouse embryonic stem (mES) cells showed that Rest was required for PRC1 recruitment to a subset of Polycomb regulated neuronal genes. Furthermore, we found that PRC1 can be recruited to Rest binding sites independently...... of CpG islands and the H3K27Me3 mark. Surprisingly, PRC2 was frequently increased around Rest binding sites located in CpG-rich regions in the Rest¿/¿ mES cells, indicating a more complex interplay where Rest also can limit PRC2 recruitment. Therefore, we propose that Rest has context...

  18. Polycomb Cbx family members mediate the balance between haematopoietic stem cell self-renewal and differentiation

    DEFF Research Database (Denmark)

    Klauke, Karin; Radulović, Višnja; Broekhuis, Mathilde

    2013-01-01

    The balance between self-renewal and differentiation of adult stem cells is essential for tissue homeostasis. Here we show that in the haematopoietic system this process is governed by polycomb chromobox (Cbx) proteins. Cbx7 is specifically expressed in haematopoietic stem cells (HSCs), and its...... overexpression enhances self-renewal and induces leukaemia. This effect is dependent on integration into polycomb repressive complex-1 (PRC1) and requires H3K27me3 binding. In contrast, overexpression of Cbx2, Cbx4 or Cbx8 results in differentiation and exhaustion of HSCs. ChIP-sequencing analysis shows that Cbx......7 and Cbx8 share most of their targets; we identified approximately 200 differential targets. Whereas genes targeted by Cbx8 are highly expressed in HSCs and become repressed in progenitors, Cbx7 targets show the opposite expression pattern. Thus, Cbx7 preserves HSC self-renewal by repressing...

  19. A Cbx8-containing polycomb complex facilitates the transition to gene activation during ES cell differentiation.

    Directory of Open Access Journals (Sweden)

    Catherine Creppe

    2014-12-01

    Full Text Available Polycomb proteins play an essential role in maintaining the repression of developmental genes in self-renewing embryonic stem cells. The exact mechanism allowing the derepression of polycomb target genes during cell differentiation remains unclear. Our project aimed to identify Cbx8 binding sites in differentiating mouse embryonic stem cells. Therefore, we used a genome-wide chromatin immunoprecipitation of endogenous Cbx8 coupled to direct massive parallel sequencing (ChIP-Seq. Our analysis identified 171 high confidence peaks. By crossing our data with previously published microarray analysis, we show that several differentiation genes transiently recruit Cbx8 during their early activation. Depletion of Cbx8 partially impairs the transcriptional activation of these genes. Both interaction analysis, as well as chromatin immunoprecipitation experiments support the idea that activating Cbx8 acts in the context of an intact PRC1 complex. Prolonged gene activation results in eviction of PRC1 despite persisting H3K27me3 and H2A ubiquitination. The composition of PRC1 is highly modular and changes when embryonic stem cells commit to differentiation. We further demonstrate that the exchange of Cbx7 for Cbx8 is required for the effective activation of differentiation genes. Taken together, our results establish a function for a Cbx8-containing complex in facilitating the transition from a Polycomb-repressed chromatin state to an active state. As this affects several key regulatory differentiation genes this mechanism is likely to contribute to the robust execution of differentiation programs.

  20. Mel-18, a mammalian Polycomb gene, regulates angiogenic gene expression of endothelial cells.

    Science.gov (United States)

    Jung, Ji-Hye; Choi, Hyun-Jung; Maeng, Yong-Sun; Choi, Jung-Yeon; Kim, Minhyung; Kwon, Ja-Young; Park, Yong-Won; Kim, Young-Myeong; Hwang, Daehee; Kwon, Young-Guen

    2010-10-01

    Mel-18 is a mammalian homolog of Polycomb group (PcG) genes. Microarray analysis revealed that Mel-18 expression was induced during endothelial progenitor cell (EPC) differentiation and correlates with the expression of EC-specific protein markers. Overexpression of Mel-18 promoted EPC differentiation and angiogenic activity of ECs. Accordingly, silencing Mel-18 inhibited EC migration and tube formation in vitro. Gene expression profiling showed that Mel-18 regulates angiogenic genes including kinase insert domain receptor (KDR), claudin 5, and angiopoietin-like 2. Our findings demonstrate, for the first time, that Mel-18 plays a significant role in the angiogenic function of ECs by regulating endothelial gene expression. Copyright © 2010 Elsevier Inc. All rights reserved.

  1. Jarid2 binds mono-ubiquitylated H2A lysine 119 to mediate crosstalk between Polycomb complexes PRC1 and PRC2

    DEFF Research Database (Denmark)

    Cooper, Sarah; Grijzenhout, Anne; Underwood, Elizabeth

    2016-01-01

    crosstalk between these modifications is critical for the formation of stable Polycomb domains at target gene loci. While the molecular mechanism for recognition of H3K27me3 by PRC1 is well defined, the interaction of PRC2 with H2AK119u1 is poorly understood. Here we demonstrate a critical role for the PRC2...... cofactor Jarid2 in mediating the interaction of PRC2 with H2AK119u1. We identify a ubiquitin interaction motif at the amino-terminus of Jarid2, and demonstrate that this domain facilitates PRC2 localization to H2AK119u1 both in vivo and in vitro. Our findings ascribe a critical function to Jarid2...... and define a key mechanism that links PRC1 and PRC2 in the establishment of Polycomb domains....

  2. Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori.

    Science.gov (United States)

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Tatsuke, Tsuneyuki; Zhu, Li; Xu, Jian; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

    2012-01-01

    Polycomb group (PcG) proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1), Polycomb repressive complex 2 (PRC2), and Pleiohomeotic repressive complex (PhoRC), to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524) and BmScm (331 out of 532), and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

  3. Genome-wide identification of polycomb target genes reveals a functional association of Pho with Scm in Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Zhiqing Li

    Full Text Available Polycomb group (PcG proteins are evolutionarily conserved chromatin modifiers and act together in three multimeric complexes, Polycomb repressive complex 1 (PRC1, Polycomb repressive complex 2 (PRC2, and Pleiohomeotic repressive complex (PhoRC, to repress transcription of the target genes. Here, we identified Polycomb target genes in Bombyx mori with holocentric centromere using genome-wide expression screening based on the knockdown of BmSCE, BmESC, BmPHO, or BmSCM gene, which represent the distinct complexes. As a result, the expressions of 29 genes were up-regulated after knocking down 4 PcG genes. Particularly, there is a significant overlap between targets of BmPho (331 out of 524 and BmScm (331 out of 532, and among these, 190 genes function as regulator factors playing important roles in development. We also found that BmPho, as well as BmScm, can interact with other Polycomb components examined in this study. Further detailed analysis revealed that the C-terminus of BmPho containing zinc finger domain is involved in the interaction between BmPho and BmScm. Moreover, the zinc finger domain in BmPho contributes to its inhibitory function and ectopic overexpression of BmScm is able to promote transcriptional repression by Gal4-Pho fusions including BmScm-interacting domain. Loss of BmPho expression causes relocalization of BmScm into the cytoplasm. Collectively, we provide evidence of a functional link between BmPho and BmScm, and propose two Polycomb-related repression mechanisms requiring only BmPho associated with BmScm or a whole set of PcG complexes.

  4. Polycomb Group Protein Displacement and Gene Activation through MSK-Dependent H3K27me3S28 Phosphorylation

    DEFF Research Database (Denmark)

    Gehani, Simmi Suman; Agrawal-Singh, Shuchi; Dietrich, Nikolaj

    2010-01-01

    Epigenetic regulation of chromatin structure is essential for the expression of genes determining cellular specification and function. The Polycomb repressive complex 2 (PRC2) di- and trimethylates histone H3 on lysine 27 (H3K27me2/me3) to establish repression of specific genes in embryonic stem ...

  5. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development.

    Directory of Open Access Journals (Sweden)

    Carolina N Perdigoto

    2016-07-01

    Full Text Available An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2 in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  6. Polycomb-Mediated Repression and Sonic Hedgehog Signaling Interact to Regulate Merkel Cell Specification during Skin Development.

    Science.gov (United States)

    Perdigoto, Carolina N; Dauber, Katherine L; Bar, Carmit; Tsai, Pai-Chi; Valdes, Victor J; Cohen, Idan; Santoriello, Francis J; Zhao, Dejian; Zheng, Deyou; Hsu, Ya-Chieh; Ezhkova, Elena

    2016-07-01

    An increasing amount of evidence indicates that developmental programs are tightly regulated by the complex interplay between signaling pathways, as well as transcriptional and epigenetic processes. Here, we have uncovered coordination between transcriptional and morphogen cues to specify Merkel cells, poorly understood skin cells that mediate light touch sensations. In murine dorsal skin, Merkel cells are part of touch domes, which are skin structures consisting of specialized keratinocytes, Merkel cells, and afferent neurons, and are located exclusively around primary hair follicles. We show that the developing primary hair follicle functions as a niche required for Merkel cell specification. We find that intraepidermal Sonic hedgehog (Shh) signaling, initiated by the production of Shh ligand in the developing hair follicles, is required for Merkel cell specification. The importance of Shh for Merkel cell formation is further reinforced by the fact that Shh overexpression in embryonic epidermal progenitors leads to ectopic Merkel cells. Interestingly, Shh signaling is common to primary, secondary, and tertiary hair follicles, raising the possibility that there are restrictive mechanisms that regulate Merkel cell specification exclusively around primary hair follicles. Indeed, we find that loss of Polycomb repressive complex 2 (PRC2) in the epidermis results in the formation of ectopic Merkel cells that are associated with all hair types. We show that PRC2 loss expands the field of epidermal cells competent to differentiate into Merkel cells through the upregulation of key Merkel-differentiation genes, which are known PRC2 targets. Importantly, PRC2-mediated repression of the Merkel cell differentiation program requires inductive Shh signaling to form mature Merkel cells. Our study exemplifies how the interplay between epigenetic and morphogen cues regulates the complex patterning and formation of the mammalian skin structures.

  7. Participation of Polycomb group gene extra sex combs in hedgehog signaling pathway

    International Nuclear Information System (INIS)

    Shindo, Norihisa; Sakai, Atsushi; Yamada, Kouji; Higashinakagawa, Toru

    2004-01-01

    Polycomb group (PcG) genes are required for stable inheritance of epigenetic states across cell divisions, a phenomenon termed cellular memory. PcG proteins form multimeric nuclear complex which modifies the chromatin structure of target site. Drosophila PcG gene extra sex combs (esc) and its vertebrate orthologs constitute a member of ESC-E(Z) complex, which possesses histone methyltransferase activity. Here we report isolation and characterization of medaka esc homolog, termed oleed. Hypomorphic knock-down of oleed using morpholino antisense oligonucleotides resulted in the fusion of eyes, termed cyclopia. Prechordal plate formation was not substantially impaired, but expression of hedgehog target genes was dependent on oleed, suggesting some link with hedgehog signaling. In support of this implication, histone methylation, which requires the activity of esc gene product, is increased in hedgehog stimulated mouse NIH-3T3 cells. Our data argue for the novel role of esc in hedgehog signaling and provide fundamental insight into the epigenetic mechanisms in general

  8. Chromatin-bound IκBα regulates a subset of polycomb target genes in differentiation and cancer.

    Science.gov (United States)

    Mulero, María Carmen; Ferres-Marco, Dolors; Islam, Abul; Margalef, Pol; Pecoraro, Matteo; Toll, Agustí; Drechsel, Nils; Charneco, Cristina; Davis, Shelly; Bellora, Nicolás; Gallardo, Fernando; López-Arribillaga, Erika; Asensio-Juan, Elena; Rodilla, Verónica; González, Jessica; Iglesias, Mar; Shih, Vincent; Mar Albà, M; Di Croce, Luciano; Hoffmann, Alexander; Miyamoto, Shigeki; Villà-Freixa, Jordi; López-Bigas, Nuria; Keyes, William M; Domínguez, María; Bigas, Anna; Espinosa, Lluís

    2013-08-12

    IκB proteins are the primary inhibitors of NF-κB. Here, we demonstrate that sumoylated and phosphorylated IκBα accumulates in the nucleus of keratinocytes and interacts with histones H2A and H4 at the regulatory region of HOX and IRX genes. Chromatin-bound IκBα modulates Polycomb recruitment and imparts their competence to be activated by TNFα. Mutations in the Drosophila IκBα gene cactus enhance the homeotic phenotype of Polycomb mutants, which is not counteracted by mutations in dorsal/NF-κB. Oncogenic transformation of keratinocytes results in cytoplasmic IκBα translocation associated with a massive activation of Hox. Accumulation of cytoplasmic IκBα was found in squamous cell carcinoma (SCC) associated with IKK activation and HOX upregulation. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. An H3K9/S10 methyl-phospho switch modulates Polycomb and Pol II binding at repressed genes during differentiation.

    Science.gov (United States)

    Sabbattini, Pierangela; Sjoberg, Marcela; Nikic, Svetlana; Frangini, Alberto; Holmqvist, Per-Henrik; Kunowska, Natalia; Carroll, Tom; Brookes, Emily; Arthur, Simon J; Pombo, Ana; Dillon, Niall

    2014-03-01

    Methylated histones H3K9 and H3K27 are canonical epigenetic silencing modifications in metazoan organisms, but the relationship between the two modifications has not been well characterized. H3K9me3 coexists with H3K27me3 in pluripotent and differentiated cells. However, we find that the functioning of H3K9me3 is altered by H3S10 phosphorylation in differentiated postmitotic osteoblasts and cycling B cells. Deposition of H3K9me3/S10ph at silent genes is partially mediated by the mitogen- and stress-activated kinases (MSK1/2) and the Aurora B kinase. Acquisition of H3K9me3/S10ph during differentiation correlates with loss of paused S5 phosphorylated RNA polymerase II, which is present on Polycomb-regulated genes in embryonic stem cells. Reduction of the levels of H3K9me3/S10ph by kinase inhibition results in increased binding of RNAPIIS5ph and the H3K27 methyltransferase Ezh1 at silent promoters. Our results provide evidence of a novel developmentally regulated methyl-phospho switch that modulates Polycomb regulation in differentiated cells and stabilizes repressed states.

  10. Transcriptional response of polycomb group genes to status epilepticus in mice is modified by prior exposure to epileptic preconditioning

    Directory of Open Access Journals (Sweden)

    James eReynolds

    2015-03-01

    Full Text Available Exposure of the brain to brief, non-harmful seizures can activate protective mechanisms that temporarily generate a damage-refractory state. This process, termed epileptic tolerance, is associated with large-scale down-regulation of gene expression. Polycomb group proteins are master controllers of gene silencing during development that are re-activated by injury to the brain. Here we explored the transcriptional response of genes associated with polycomb repressor complex (PRC 1 (Ring1A and Ring1B and Bmi1 and PRC2 (Ezh1, Ezh2 and Suz12, as well as additional transcriptional regulators Sirt1, Yy1 and Yy2, in a mouse model of status epilepticus. Findings were contrasted to changes after status epilepticus in mice previously given brief seizures to evoke tolerance. Real-time quantitative PCR showed status epilepticus prompted an early (1 h increase in expression of several genes in PRC1 and PRC2 in the hippocampus, followed by down-regulation of many of the same genes at later times points (4 , 8 and 24 h. Spatio-temporal differences were found among PRC2 genes in epileptic tolerance, including increased expression of Ezh2, Suz12 and Yy2 relative to the normal injury response to status epilepticus. In contrast, PRC1 complex genes including Ring 1B and Bmi1 displayed differential down-regulation in epileptic tolerance. The present study characterizes polycomb group gene expression following status epilepticus and shows prior seizure exposure produces select changes to PRC1 and PRC2 composition that may influence differential gene expression in epileptic tolerance.

  11. Cell Cycle-Dependent Recruitment of Polycomb Proteins to the ASNS Promoter Counteracts C/ebp-Mediated Transcriptional Activation in Bombyx mori

    Science.gov (United States)

    Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro

    2013-01-01

    Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816

  12. A chromatin insulator driving three-dimensional Polycomb response element (PRE) contacts and Polycomb association with the chromatin fiber

    DEFF Research Database (Denmark)

    Comet, Itys; Schuettengruber, Bernd; Sexton, Tom

    2011-01-01

    to insulate genes from regulatory elements or to take part in long-distance interactions. Using a high-resolution chromatin conformation capture (H3C) method, we show that the Drosophila gypsy insulator behaves as a conformational chromatin border that is able to prohibit contacts between a Polycomb response...... element (PRE) and a distal promoter. On the other hand, two spaced gypsy elements form a chromatin loop that is able to bring an upstream PRE in contact with a downstream gene to mediate its repression. Chromatin immunoprecipitation (ChIP) profiles of the Polycomb protein and its associated H3K27me3...... histone mark reflect this insulator-dependent chromatin conformation, suggesting that Polycomb action at a distance can be organized by local chromatin topology....

  13. The immediate early gene product EGR1 and polycomb group proteins interact in epigenetic programming during chondrogenesis.

    Directory of Open Access Journals (Sweden)

    Frank Spaapen

    Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.

  14. Polycomb complexes and silencing mechanisms

    DEFF Research Database (Denmark)

    Lund, Anders H; van Lohuizen, Maarten

    2004-01-01

    Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....

  15. batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

    Science.gov (United States)

    Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

    2003-02-01

    Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

  16. Origin of the polycomb repressive complex 2 and gene silencing by an E(z) homolog in the unicellular alga Chlamydomonas.

    Science.gov (United States)

    Shaver, Scott; Casas-Mollano, J Armando; Cerny, Ronald L; Cerutti, Heriberto

    2010-05-16

    Polycomb group proteins play an essential role in the maintenance of cell identity and the regulation of development in both animals and plants. The Polycomb Repressive Complex 2 (PRC2) is involved in the establishment of transcriptionally silent chromatin states, in part through its ability to methylate lysine 27 of histone H3 by the Enhancer of zeste [E(z)] subunit. The absence of PRC2 in unicellular model fungi and its function in the repression of genes vital for the development of higher eukaryotes led to the proposal that this complex may have evolved together with the emergence of multicellularity. However, we report here on the widespread presence of PRC2 core subunits in unicellular eukaryotes from the Opisthokonta, Chromalveolata and Archaeplastida supergroups. To gain insight on the role of PRC2 in single celled organisms, we characterized an E(z) homolog, EZH, in the green alga Chlamydomonas reinhardtii. RNAi-mediated suppression of EZH led to defects in the silencing of transgenes and retrotransposons as well as to a global increase in histone post-translational modifications associated with transcriptional activity, such as trimethylation of histone H3 lysine 4 and acetylation of histone H4. On the basis of the parsimony principle, our findings suggest that PRC2 appeared early in eukaryotic evolution, even perhaps in the last unicellular common ancestor of eukaryotes. One of the ancestral roles of PCR2 may have been in defense responses against intragenomic parasites such as transposable elements, prior to being co-opted for lineage specific functions like developmental regulation in multicellular eukaryotes.

  17. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Directory of Open Access Journals (Sweden)

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  18. SSX2 is a novel DNA-binding protein that antagonizes polycomb group body formation and gene repression

    DEFF Research Database (Denmark)

    Gjerstorff, Morten Frier; Relster, Mette Marie; Greve, Katrine Buch Viden

    2014-01-01

    Polycomb group (PcG) complexes regulate cellular identity through epigenetic programming of chromatin. Here, we show that SSX2, a germline-specific protein ectopically expressed in melanoma and other types of human cancers, is a chromatin-associated protein that antagonizes BMI1 and EZH2 PcG body...... formation and derepresses PcG target genes. SSX2 further negatively regulates the level of the PcG-associated histone mark H3K27me3 in melanoma cells, and there is a clear inverse correlation between SSX2/3 expression and H3K27me3 in spermatogenesis. However, SSX2 does not affect the overall composition...

  19. The Role of Polycomb Group Gene Bmi-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2011-09-01

    new tricks. Cell Div. 2006 Jul 24;1:15. 17. Fu M, Wang C, Li Z, Sakamaki T, Pestell RG. Minireview: Cyclin D1: normal and abnormal functions... Pestell RG. Signal transduction mediated by cyclin D1: from mitogens to cell proliferation: a molecular target with therapeutic potential. Cancer...Datar 22 R, Cote R, Pestell R, Albanese C. ErbB-2 induces the cyclin D1 gene in prostate epithelial cells in vitro and in vivo. Cancer Res. 2007

  20. Dopamine signaling leads to loss of Polycomb repression and aberrant gene activation in experimental parkinsonism

    DEFF Research Database (Denmark)

    Södersten, Erik; Feyder, Michael; Lerdrup, Mads

    2014-01-01

    . Here, we present in vivo evidence for a previously unrecognized plasticity of PcG-repressed genes in terminally differentiated brain neurons of parkisonian mice. We show that acute administration of the dopamine precursor, L-DOPA, induces a remarkable increase in H3K27me3S28 phosphorylation....... The induction of the H3K27me3S28p histone mark specifically occurs in medium spiny neurons expressing dopamine D1 receptors and is dependent on Msk1 kinase activity and DARPP-32-mediated inhibition of protein phosphatase-1. Chromatin immunoprecipitation (ChIP) experiments showed that increased H3K27me3S28p...

  1. MUC1-C activates polycomb repressive complexes and downregulates tumor suppressor genes in human cancer cells.

    Science.gov (United States)

    Rajabi, Hasan; Hiraki, Masayuki; Kufe, Donald

    2018-04-01

    The PRC2 and PRC1 complexes are aberrantly expressed in human cancers and have been linked to decreases in patient survival. MUC1-C is an oncoprotein that is also overexpressed in diverse human cancers and is associated with a poor prognosis. Recent studies have supported a previously unreported function for MUC1-C in activating PRC2 and PRC1 in cancer cells. In the regulation of PRC2, MUC1-C (i) drives transcription of the EZH2 gene, (ii) binds directly to EZH2, and (iii) enhances occupancy of EZH2 on target gene promoters with an increase in H3K27 trimethylation. Regarding PRC1, which is recruited to PRC2 sites in the hierarchical model, MUC1-C induces BMI1 transcription, forms a complex with BMI1, and promotes H2A ubiquitylation. MUC1-C thereby contributes to the integration of PRC2 and PRC1-mediated repression of tumor suppressor genes, such as CDH1, CDKN2A, PTEN and BRCA1. Like PRC2 and PRC1, MUC1-C is associated with the epithelial-mesenchymal transition (EMT) program, cancer stem cell (CSC) state, and acquisition of anticancer drug resistance. In concert with these observations, targeting MUC1-C downregulates EZH2 and BMI1, inhibits EMT and the CSC state, and reverses drug resistance. These findings emphasize the significance of MUC1-C as a therapeutic target for inhibiting aberrant PRC function and reprogramming the epigenome in human cancers.

  2. A repetitive elements perspective in Polycomb epigenetics.

    Directory of Open Access Journals (Sweden)

    Valentina eCasa

    2012-10-01

    Full Text Available Repetitive elements comprise over two-thirds of the human genome. For a long time, these elements have received little attention since they were considered non functional. On the contrary, recent evidence indicates that they play central roles in genome integrity, gene expression and disease. Indeed, repeats display meiotic instability associated with disease and are located within common fragile sites, which are hotspots of chromosome rearrangements in tumors. Moreover, a variety of diseases have been associated with aberrant transcription of repetitive elements. Overall this indicates that appropriate regulation of repetitive elements’ activity is fundamental.Polycomb group (PcG proteins are epigenetic regulators that are essential for the normal development of multicellular organisms. Mammalian PcG proteins are involved in fundamental processes, such as cellular memory, cell proliferation, genomic imprinting, X-inactivation, and cancer development. PcG proteins can convey their activity through long-distance interactions also on different chromosomes. This indicates that the 3D organization of PcG proteins contributes significantly to their function. However, it is still unclear how these complex mechanisms are orchestrated and which role PcG proteins play in the multi-level organization of gene regulation. Intriguingly, the greatest proportion of Polycomb-mediated chromatin modifications is located in genomic repeats and it has been suggested that they could provide a binding platform for Polycomb proteins.Here, these lines of evidence are woven together to discuss how repetitive elements could contribute to chromatin organization in the 3D nuclear space.

  3. Characterization of an antagonistic switch between histone H3 lysine 27 methylation and acetylation in the transcriptional regulation of Polycomb group target genes

    DEFF Research Database (Denmark)

    Pasini, Diego; Malatesta, Martina; Jung, Hye Ryung

    2010-01-01

    Polycomb group (PcG) proteins are transcriptional repressors, which regulate proliferation and cell fate decisions during development, and their deregulated expression is a frequent event in human tumours. The Polycomb repressive complex 2 (PRC2) catalyzes trimethylation (me3) of histone H3 lysine...... are poorly understood. To gain insight into these mechanisms, we have determined the global changes in histone modifications in embryonic stem (ES) cells lacking the PcG protein Suz12 that is essential for PRC2 activity. We show that loss of PRC2 activity results in a global increase in H3K27 acetylation....... The methylation to acetylation switch correlates with the transcriptional activation of PcG target genes, both during ES cell differentiation and in MLL-AF9-transduced hematopoietic stem cells. Moreover, we provide evidence that the acetylation of H3K27 is catalyzed by the acetyltransferases p300 and CBP. Based...

  4. Comparative analysis of chromatin binding by Sex Comb on Midleg (SCM) and other polycomb group repressors at a Drosophila Hox gene.

    Science.gov (United States)

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L; Ketel, Carrie S; Mallin, Daniel R; Simon, Jeffrey A

    2010-06-01

    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets.

  5. Epigenetic chromatin modifiers in barley: IV. The study of barley Polycomb group (PcG genes during seed development and in response to external ABA

    Directory of Open Access Journals (Sweden)

    Stanca Michele A

    2010-04-01

    Full Text Available Abstract Background Epigenetic phenomena have been associated with the regulation of active and silent chromatin states achieved by modifications of chromatin structure through DNA methylation, and histone post-translational modifications. The latter is accomplished, in part, through the action of PcG (Polycomb group protein complexes which methylate nucleosomal histone tails at specific sites, ultimately leading to chromatin compaction and gene silencing. Different PcG complex variants operating during different developmental stages have been described in plants. In particular, the so-called FIE/MEA/FIS2 complex governs the expression of genes important in embryo and endosperm development in Arabidopsis. In our effort to understand the epigenetic mechanisms regulating seed development in barley (Hordeum vulgare, an agronomically important monocot plant cultivated for its endosperm, we set out to characterize the genes encoding barley PcG proteins. Results Four barley PcG gene homologues, named HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were identified and structurally and phylogenetically characterized. The corresponding genes HvFIE, HvE(Z, HvSu(z12a, and HvSu(z12b were mapped onto barley chromosomes 7H, 4H, 2H and 5H, respectively. Expression analysis of the PcG genes revealed significant differences in gene expression among tissues and seed developmental stages and between barley cultivars with varying seed size. Furthermore, HvFIE and HvE(Z gene expression was responsive to the abiotic stress-related hormone abscisic acid (ABA known to be involved in seed maturation, dormancy and germination. Conclusion This study reports the first characterization of the PcG homologues, HvFIE, HvE(Z, HvSu(z12a and HvSu(z12b in barley. All genes co-localized with known chromosomal regions responsible for malting quality related traits, suggesting that they might be used for developing molecular markers to be applied in marker assisted selection. The Pc

  6. Adhesive pad differentiation in Drosophila melanogaster depends on the Polycomb group gene Su(z)2.

    Science.gov (United States)

    Hüsken, Mirko; Hufnagel, Kim; Mende, Katharina; Appel, Esther; Meyer, Heiko; Peisker, Henrik; Tögel, Markus; Wang, Shuoshuo; Wolff, Jonas; Gorb, Stanislav N; Paululat, Achim

    2015-04-15

    The ability of many insects to walk on vertical smooth surfaces such as glass or even on the ceiling has fascinated biologists for a long time, and has led to the discovery of highly specialized adhesive organs located at the distal end of the animals' legs. So far, research has primarily focused on structural and ultrastructural investigations leading to a deeper understanding of adhesive organ functionality and to the development of new bioinspired materials. Genetic approaches, e.g. the analysis of mutants, to achieve a better understanding of adhesive organ differentiation have not been used so far. Here, we describe the first Drosophila melanogaster mutant that develops malformed adhesive organs, resulting in a complete loss of climbing ability on vertical smooth surfaces. Interestingly, these mutants fail to make close contact between the setal tips and the smooth surface, a crucial condition for wet adhesion mediated by capillary forces. Instead, these flies walk solely on their claws. Moreover, we were able to show that the mutation is caused by a P-element insertion into the Su(z)2 gene locus. Remobilization of the P-element restores climbing ability. Furthermore, we provide evidence that the P-element insertion results in an artificial Su(z)2 transcript, which most likely causes a gain-of-function mutation. We presume that this transcript causes deregulation of yet unknown target genes involved in pulvilli differentiation. Our results nicely demonstrate that the genetically treatable model organism Drosophila is highly suitable for future investigations on adhesive organ differentiation. © 2015. Published by The Company of Biologists Ltd.

  7. VE-Cadherin–Mediated Epigenetic Regulation of Endothelial Gene Expression

    Science.gov (United States)

    Morini, Marco F.; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I.; Conze, Lei L.; O’Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P.

    2018-01-01

    levels of claudin-5 and VE-PTP. Conclusions: These data extend the knowledge of polycomb-mediated regulation of gene expression to endothelial cell differentiation and vessel maturation. The identified mechanism opens novel therapeutic opportunities to modulate endothelial gene expression and induce vascular normalization through pharmacological inhibition of the polycomb-mediated repression system. PMID:29233846

  8. VE-Cadherin-Mediated Epigenetic Regulation of Endothelial Gene Expression.

    Science.gov (United States)

    Morini, Marco F; Giampietro, Costanza; Corada, Monica; Pisati, Federica; Lavarone, Elisa; Cunha, Sara I; Conze, Lei L; O'Reilly, Nicola; Joshi, Dhira; Kjaer, Svend; George, Roger; Nye, Emma; Ma, Anqi; Jin, Jian; Mitter, Richard; Lupia, Michela; Cavallaro, Ugo; Pasini, Diego; Calado, Dinis P; Dejana, Elisabetta; Taddei, Andrea

    2018-01-19

    data extend the knowledge of polycomb-mediated regulation of gene expression to endothelial cell differentiation and vessel maturation. The identified mechanism opens novel therapeutic opportunities to modulate endothelial gene expression and induce vascular normalization through pharmacological inhibition of the polycomb-mediated repression system. © 2017 The Authors.

  9. Gene Silencing Triggers Polycomb Repressive Complex 2 Recruitment to CpG Islands Genome Wide

    DEFF Research Database (Denmark)

    Riising, Eva Madi; Vacher-Comet, Itys; Leblanc, Benjamin Olivier

    2014-01-01

    -wide ectopic PRC2 recruitment to endogenous PcG target genes found in other tissues. PRC2 binding analysis shows that it is restricted to nucleosome-free CpG islands (CGIs) of untranscribed genes. Our results show that it is the transcriptional state that governs PRC2 binding, and we propose that it binds...

  10. The Role of Polycomb Group Gene BMI-1 in the Development of Prostate Cancer

    Science.gov (United States)

    2013-07-01

    J Clin Invest. 2005; 115:1503-21. 13. Siddique HR, Liao DJ, Mishra SK, Schuster T, Wang L, Matter B et al. Epicatechin-rich cocoa polyphenol...growth factors may result in an upregulation of diverse gene products in CSCs and their differentiated progenies dur- ing the EMT process [32, 33

  11. The Polycomb Group Protein L3MBTL1 Represses a SMAD5-Mediated Hematopoietic Transcriptional Program in Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Fabiana Perna

    2015-04-01

    Full Text Available Epigenetic regulation of key transcriptional programs is a critical mechanism that controls hematopoietic development, and, thus, aberrant expression patterns or mutations in epigenetic regulators occur frequently in hematologic malignancies. We demonstrate that the Polycomb protein L3MBTL1, which is monoallelically deleted in 20q- myeloid malignancies, represses the ability of stem cells to drive hematopoietic-specific transcriptional programs by regulating the expression of SMAD5 and impairing its recruitment to target regulatory regions. Indeed, knockdown of L3MBTL1 promotes the development of hematopoiesis and impairs neural cell fate in human pluripotent stem cells. We also found a role for L3MBTL1 in regulating SMAD5 target gene expression in mature hematopoietic cell populations, thereby affecting erythroid differentiation. Taken together, we have identified epigenetic priming of hematopoietic-specific transcriptional networks, which may assist in the development of therapeutic approaches for patients with anemia.

  12. Epigenetic modification of histone 3 lysine 27: mediator subunit MED25 is required for the dissociation of polycomb repressive complex 2 from the promoter of cytochrome P450 2C9.

    Science.gov (United States)

    Englert, Neal A; Luo, George; Goldstein, Joyce A; Surapureddi, Sailesh

    2015-01-23

    The Mediator complex is vital for the transcriptional regulation of eukaryotic genes. Mediator binds to nuclear receptors at target response elements and recruits chromatin-modifying enzymes and RNA polymerase II. Here, we examine the involvement of Mediator subunit MED25 in the epigenetic regulation of human cytochrome P450 2C9 (CYP2C9). MED25 is recruited to the CYP2C9 promoter through association with liver-enriched HNF4α, and we show that MED25 influences the H3K27 status of the HNF4α binding region. This region was enriched for the activating marker H3K27ac and histone acetyltransferase CREBBP after MED25 overexpression but was trimethylated when MED25 expression was silenced. The epigenetic regulator Polycomb repressive complex (PRC2), which represses expression by methylating H3K27, plays an important role in target gene regulation. Silencing MED25 correlated with increased association of PRC2 not only with the promoter region chromatin but with HNF4α itself. We confirmed the involvement of MED25 for fully functional preinitiation complex recruitment and transcriptional output in vitro. Formaldehyde-assisted isolation of regulatory elements (FAIRE) revealed chromatin conformation changes that were reliant on MED25, indicating that MED25 induced a permissive chromatin state that reflected increases in CYP2C9 mRNA. For the first time, we showed evidence that a functionally relevant human gene is transcriptionally regulated by HNF4α via MED25 and PRC2. CYP2C9 is important for the metabolism of many exogenous chemicals including pharmaceutical drugs as well as endogenous substrates. Thus, MED25 is important for regulating the epigenetic landscape resulting in transcriptional activation of a highly inducible gene, CYP2C9. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. How Polycomb-Mediated Cell Memory Deals With a Changing Environment: Variations in PcG complexes and proteins assortment convey plasticity to epigenetic regulation as a response to environment.

    Science.gov (United States)

    Marasca, Federica; Bodega, Beatrice; Orlando, Valerio

    2018-04-01

    Cells and tissues are continuously exposed to a changing microenvironment, hence the necessity of a flexible modulation of gene expression that in complex organism have been achieved through specialized chromatin mechanisms. Chromatin-based cell memory enables cells to maintain their identity by fixing lineage specific transcriptional programs, ensuring their faithful transmission through cell division; in particular PcG-based memory system evolved to maintain the silenced state of developmental and cell cycle genes. In evolution the complexity of this system have increased, particularly in vertebrates, indicating combinatorial and dynamic properties of Polycomb proteins, in some cases even overflowing outside the cell nucleus. Therefore, their function may not be limited to the imposition of rigid states of genetic programs, but on the ability to recognize signals and allow plastic transcriptional changes in response to different stimuli. Here, we discuss the most novel PcG mediated memory functions in facing and responding to the challenges posed by a fluctuating environment. © 2018 The Authors. BioEssays Published by WILEY Periodicals, Inc.

  14. Transcriptional regulation by Polycomb group proteins

    DEFF Research Database (Denmark)

    Di Croce, Luciano; Helin, Kristian

    2013-01-01

    Polycomb group (PcG) proteins are epigenetic regulators of transcription that have key roles in stem-cell identity, differentiation and disease. Mechanistically, they function within multiprotein complexes, called Polycomb repressive complexes (PRCs), which modify histones (and other proteins......) and silence target genes. The dynamics of PRC1 and PRC2 components has been the focus of recent research. Here we discuss our current knowledge of the PRC complexes, how they are targeted to chromatin and how the high diversity of the PcG proteins allows these complexes to influence cell identity....

  15. Polycomb group protein bodybuilding: working out the routines.

    Science.gov (United States)

    Sievers, Cem; Paro, Renato

    2013-09-30

    Polycomb group (PcG) proteins regulate gene expression by modifying chemical and structural properties of chromatin. Isono et al. (2013) now report in Developmental Cell a polymerization-dependent mechanism used by PcG proteins to form higher-order chromatin structures, referred to as Polycomb bodies, and demonstrate its necessity for gene silencing. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Ruled by Ubiquitylation: A New Order for Polycomb Recruitment

    Directory of Open Access Journals (Sweden)

    Yuri B. Schwartz

    2014-07-01

    Full Text Available Polycomb complexes are found in most cells, but they must be targeted to specific genes in specific cell types in order to regulate pluripotency and differentiation. The recruitment of Polycomb complexes to specific targets has been widely thought to occur in two steps: first, one complex, PRC2, produces histone H3 lysine 27 (H3K27 trimethylation at a specific gene, and then the PRC1 complex is recruited by its ability to bind to H3K27me3. Now, three new articles turn this model upside-down by showing that binding of a variant PRC1 complex and subsequent H2A ubiquitylation of surrounding chromatin is sufficient to trigger the recruitment of PRC2 and H3K27 trimethylation. These studies also show that ubiquitylated H2A is directly sensed by PRC2 and that ablation of PRC1-mediated H2A ubiquitylation impairs genome-wide PRC2 binding and disrupts mouse development.

  17. New Partners in Regulation of Gene Expression: The Enhancer of Trithorax and Polycomb Corto Interacts with Methylated Ribosomal Protein L12 Via Its Chromodomain

    Science.gov (United States)

    Coléno-Costes, Anne; Jang, Suk Min; de Vanssay, Augustin; Rougeot, Julien; Bouceba, Tahar; Randsholt, Neel B.; Gibert, Jean-Michel; Le Crom, Stéphane; Mouchel-Vielh, Emmanuèle

    2012-01-01

    Chromodomains are found in many regulators of chromatin structure, and most of them recognize methylated lysines on histones. Here, we investigate the role of the Drosophila melanogaster protein Corto's chromodomain. The Enhancer of Trithorax and Polycomb Corto is involved in both silencing and activation of gene expression. Over-expression of the Corto chromodomain (CortoCD) in transgenic flies shows that it is a chromatin-targeting module, critical for Corto function. Unexpectedly, mass spectrometry analysis reveals that polypeptides pulled down by CortoCD from nuclear extracts correspond to ribosomal proteins. Furthermore, real-time interaction analyses demonstrate that CortoCD binds with high affinity RPL12 tri-methylated on lysine 3. Corto and RPL12 co-localize with active epigenetic marks on polytene chromosomes, suggesting that both are involved in fine-tuning transcription of genes in open chromatin. RNA–seq based transcriptomes of wing imaginal discs over-expressing either CortoCD or RPL12 reveal that both factors deregulate large sets of common genes, which are enriched in heat-response and ribosomal protein genes, suggesting that they could be implicated in dynamic coordination of ribosome biogenesis. Chromatin immunoprecipitation experiments show that Corto and RPL12 bind hsp70 and are similarly recruited on gene body after heat shock. Hence, Corto and RPL12 could be involved together in regulation of gene transcription. We discuss whether pseudo-ribosomal complexes composed of various ribosomal proteins might participate in regulation of gene expression in connection with chromatin regulators. PMID:23071455

  18. miR-203 inhibits melanoma invasive and proliferative abilities by targeting the polycomb group gene BMI1

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Xiao [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Sun, Yong [Department of Burn and Plastic Surgery, Huai’an First People’s Hospital, Nanjing Medical University, Huai’an 223300 (China); Han, Siqi [Department of Medical Oncology, Jinling Hospital, Nanjing 210002 (China); Zhu, Wei [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Zhang, Haiping, E-mail: zhanghaiping_2000@163.com [Department of Dermatology and Venereal Disease, Xuanwu Hospital, Capital Medical University, Beijing 100053 (China); Lian, Shi, E-mail: lianshi_2020@163.com [Department of Dermatology and Venereal Disease, Capital Medical University, Beijing 100069 (China)

    2015-01-02

    Highlights: • First reported deregulation of miR-203 and up-regulation of BMI1 in metastatic melanoma. • miR-203 decreased BMI1 expression by directly binding to 3′UTR. • Further found miR-203 overexpression suppressed cell invasion and stemness. • Re-expression of BMI1 rescued miR-203-mediated suppression. • miR-203-BMI1 axis may be potential therapeutic targets of melanoma metastasis. - Abstract: Metastasis is the major problem in malignant melanoma, posing a therapeutic challenge to clinicians. The investigation of the underlying mechanism driving this progress remains a large unmet need. In this study, we revealed a miR-203-BMI1 axis that regulated melanoma metastasis. We found significantly deregulation of miR-203 and up-regulation of BMI1 in melanoma, particularly in metastatic melanoma. An inverse correlation between the levels of miR-203 and BMI1 was further observed in melanoma tissues and cell lines. We also identified BMI1 as a downstream target gene of miR-203, which bound to the 3′UTR of BMI1. Overexpression of miR-203 was associated with decreased BMI1 expression and impaired cell invasion and tumor sphere formation activities. Re-expression of BMI1 markedly rescued miR-203-mediated suppression of these events. Taken together, our results demonstrated that miR-203 regulated melanoma invasive and proliferative abilities in part by targeting BMI1, providing new insights into potential mechanisms of melanoma metastasis.

  19. Structural Basis of Polycomb Bodies

    Czech Academy of Sciences Publication Activity Database

    Šmigová, J.; Juda, P.; Krejčí, Jana; Raška, I.

    2014-01-01

    Roč. 60, č. 1 (2014), s. 13-20 ISSN 0015-5500 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA MŠk(CZ) EE2.3.30.0030 Institutional support: RVO:68081707 Keywords : Polycomb group proteins * Polycomb body * post-translational chromatin modifications Subject RIV: BO - Biophysics Impact factor: 1.000, year: 2014

  20. A novel zinc finger protein Zfp277 mediates transcriptional repression of the Ink4a/arf locus through polycomb repressive complex 1

    DEFF Research Database (Denmark)

    Negishi, Masamitsu; Saraya, Atsunori; Mochizuki, Shinobu

    2010-01-01

    . METHODOLOGY/PRINCIPAL FINDINGS: We examined the function of Zinc finger domain-containing protein 277 (Zfp277), a novel zinc finger protein that interacts with the PcG protein Bmi1. Zfp277 binds to the Ink4a/Arf locus in a Bmi1-independent manner and interacts with polycomb repressor complex (PRC) 1 through...... is essential for the recruitment of PRC1 to the Ink4a/Arf locus. Our findings also highlight dynamic regulation of both Zfp277 and PcG proteins by the oxidative stress pathways....

  1. Polycomb group proteins in cell cycle progression and cancer

    DEFF Research Database (Denmark)

    Pasini, Diego; Bracken, Adrian P; Helin, Kristian

    2004-01-01

    Epigenetic deregulation of gene expression is emerging as key mechanism in tumorigenesis. Deregulated activity of the chromatin remodeling Polycomb Repressive Complex 2 (PRC2) has recently been shown to be a frequent event in human tumors. Here we discuss these findings and speculate on the role ...

  2. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  3. Polycomb Group Protein PHF1 Regulates p53-dependent Cell Growth Arrest and Apoptosis*

    Science.gov (United States)

    Yang, Yang; Wang, Chenji; Zhang, Pingzhao; Gao, Kun; Wang, Dejie; Yu, Hongxiu; Zhang, Ting; Jiang, Sirui; Hexige, Saiyin; Hong, Zehui; Yasui, Akira; Liu, Jun O.; Huang, Haojie; Yu, Long

    2013-01-01

    Polycomb group protein PHF1 is well known as a component of a novel EED-EZH2·Polycomb repressive complex 2 complex and plays important roles in H3K27 methylation and Hox gene silencing. PHF1 is also involved in the response to DNA double-strand breaks in human cells, promotes nonhomologous end-joining processes through interaction with Ku70/Ku80. Here, we identified another function of PHF1 as a potential p53 pathway activator in a pathway screen using luminescence reporter assay. Subsequent studies showed PHF1 directly interacts with p53 proteins both in vivo and in vitro and co-localized in nucleus. PHF1 binds to the C-terminal regulatory domain of p53. Overexpression of PHF1 elevated p53 protein level and prolonged its turnover. Knockdown of PHF1 reduced p53 protein level and its target gene expression both in normal state and DNA damage response. Mechanically, PHF1 protects p53 proteins from MDM2-mediated ubiquitination and degradation. Furthermore, we showed that PHF1 regulates cell growth arrest and etoposide-induced apoptosis in a p53-dependent manner. Finally, PHF1 expression was significantly down-regulated in human breast cancer samples. Taken together, we establish PHF1 as a novel positive regulator of the p53 pathway. These data shed light on the potential roles of PHF1 in tumorigenesis and/or tumor progression. PMID:23150668

  4. Genome-wide analysis of Polycomb targets in Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, Yuri B.; Kahn, Tatyana G.; Nix, David A.; Li,Xiao-Yong; Bourgon, Richard; Biggin, Mark; Pirrotta, Vincenzo

    2006-04-01

    Polycomb Group (PcG) complexes are multiprotein assemblages that bind to chromatin and establish chromatin states leading to epigenetic silencing. PcG proteins regulate homeotic genes in flies and vertebrates but little is known about other PcG targets and the role of the PcG in development, differentiation and disease. We have determined the distribution of the PcG proteins PC, E(Z) and PSC and of histone H3K27 trimethylation in the Drosophila genome. At more than 200 PcG target genes, binding sites for the three PcG proteins colocalize to presumptive Polycomb Response Elements (PREs). In contrast, H3 me3K27 forms broad domains including the entire transcription unit and regulatory regions. PcG targets are highly enriched in genes encoding transcription factors but receptors, signaling proteins, morphogens and regulators representing all major developmental pathways are also included.

  5. Drosophila DNA-Binding Proteins in Polycomb Repression

    Directory of Open Access Journals (Sweden)

    Maksim Erokhin

    2018-01-01

    Full Text Available The formation of individual gene expression patterns in different cell types is required during differentiation and development of multicellular organisms. Polycomb group (PcG proteins are key epigenetic regulators responsible for gene repression, and dysregulation of their activities leads to developmental abnormalities and diseases. PcG proteins were first identified in Drosophila, which still remains the most convenient system for studying PcG-dependent repression. In the Drosophila genome, these proteins bind to DNA regions called Polycomb response elements (PREs. A major role in the recruitment of PcG proteins to PREs is played by DNA-binding factors, several of which have been characterized in detail. However, current knowledge is insufficient for comprehensively describing the mechanism of this process. In this review, we summarize and discuss the available data on the role of DNA-binding proteins in PcG recruitment to chromatin.

  6. Polycomb protein SCML2 associates with USP7 and counteracts histone H2A ubiquitination in the XY chromatin during male meiosis

    NARCIS (Netherlands)

    Luo, Mengcheng; Zhou, Jian; Leu, N. Adrian; Abreu, Carla M.; Wang, Jianle; Anguera, Montserrat C.; de Rooij, Dirk G.; Jasin, Maria; Wang, P. Jeremy

    2015-01-01

    Polycomb group proteins mediate transcriptional silencing in diverse developmental processes. Sex chromosomes undergo chromosome-wide transcription silencing during male meiosis. Here we report that mouse SCML2 (Sex comb on midleg-like 2), an X chromosome-encoded polycomb protein, is specifically

  7. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53.

    Science.gov (United States)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice; Kramer, Daniela; Najafova, Zeynab; Weiss, Miriam; Karpiuk, Oleksandra; Kassem, Moustapha; Zhang, Yanping; Lozano, Guillermina; Johnsen, Steven A; Moll, Ute M; Zhang, Xin; Dobbelstein, Matthias

    2016-01-07

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell proliferation. In conclusion, MDM2 supports the Polycomb-mediated repression of lineage-specific genes, independent of p53. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription.

    Science.gov (United States)

    Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien; Pira, Dorcas; Angrand, Pierre-Olivier

    2012-05-01

    Polycomb repression controls the expression of hundreds of genes involved in development and is mediated by essentially two classes of chromatin-associated protein complexes. The Polycomb repressive complex 2 (PRC2) trimethylates histone H3 at lysine 27, an epigenetic mark that serves as a docking site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain. Using biochemical approaches and a novel in vivo imaging assay, we show that the short CBX2-2 isoform lacking the Pc box, does not participate in PRC1 protein complexes, but self-associates in vivo and forms complexes of high molecular weight. Furthermore, the CBX2 short isoform is still able to repress transcription, suggesting that Polycomb repression might occur in the absence of PRC1 formation.

  9. Switch-Like Roles for Polycomb Proteins from Neurodevelopment to Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Anke Hoffmann

    2017-12-01

    Full Text Available Polycomb Group (PcG proteins are best-known for maintaining repressive or active chromatin states that are passed on across multiple cell divisions, and thus sustain long-term memory of gene expression. PcG proteins engage different, partly gene- and/or stage-specific, mechanisms to mediate spatiotemporal gene expression during central nervous system development. In the course of this, PcG proteins bind to various cis-regulatory sequences (e.g., promoters, enhancers or silencers and coordinate, as well the interactions between distantly separated genomic regions to control chromatin function at different scales ranging from compaction of the linear chromatin to the formation of topological hubs. Recent findings show that PcG proteins are involved in switch-like changes in gene expression states of selected neural genes during the transition from multipotent to differentiating cells, and then to mature neurons. Beyond neurodevelopment, PcG proteins sustain mature neuronal function and viability, and prevent progressive neurodegeneration in mice. In support of this view, neuropathological findings from human neurodegenerative diseases point to altered PcG functions. Overall, improved insight into the multiplicity of PcG functions may advance our understanding of human neurodegenerative diseases and ultimately pave the way to new therapies.

  10. Interaction proteomics analysis of polycomb proteins defines distinct PRC1 complexes in mammalian cells

    DEFF Research Database (Denmark)

    Vandamme, Julien; Völkel, Pamela; Rosnoblet, Claire

    2011-01-01

    Polycomb group (PcG) proteins maintain transcriptional repression of hundreds of genes involved in development, signaling or cancer using chromatin-based epigenetic mechanisms. Biochemical studies in Drosophila have revealed that PcG proteins associate in at least two classes of protein complexes...... known as Polycomb repressive complexes 1 and 2 (PRC1 and PRC2). Drosophila core PRC1 is composed of four subunits, Polycomb (Pc), Sex combs extra (Sce), Polyhomeotic (Ph), and Posterior sex combs (Psc). Each of these proteins has multiple orthologs in vertebrates classified respectively as the CBX, RING...... in order to identify interacting partners of CBX family proteins under the same experimental conditions. Our analysis identified with high confidence about 20 proteins co-eluted with CBX2 and CBX7 tagged proteins, about 40 with CBX4, and around 60 with CBX6 and CBX8. We provide evidences that the CBX...

  11. Cooperativity, Specificity, and Evolutionary Stability of Polycomb Targeting in Drosophila

    Directory of Open Access Journals (Sweden)

    Bernd Schuettengruber

    2014-10-01

    Full Text Available Summary: Metazoan genomes are partitioned into modular chromosomal domains containing active or repressive chromatin. In flies, Polycomb group (PcG response elements (PREs recruit PHO and other DNA-binding factors and act as nucleation sites for the formation of Polycomb repressive domains. The sequence specificity of PREs is not well understood. Here, we use comparative epigenomics and transgenic assays to show that Drosophila domain organization and PRE specification are evolutionarily conserved despite significant cis-element divergence within Polycomb domains, whereas cis-element evolution is strongly correlated with transcription factor binding divergence outside of Polycomb domains. Cooperative interactions of PcG complexes and their recruiting factor PHO stabilize PHO recruitment to low-specificity sequences. Consistently, PHO recruitment to sites within Polycomb domains is stabilized by PRC1. These data suggest that cooperative rather than hierarchical interactions among low-affinity sequences, DNA-binding factors, and the Polycomb machinery are giving rise to specific and strongly conserved 3D structures in Drosophila. : Schuettengruber et al. present an extensive comparative epigenomics data set, providing new insights into cis-driven versus buffered evolution of Polycomb recruitment and Polycomb domain specificity. Using chromatin immunoprecipitation sequencing and transgenic assays, they demonstrate an extremely high conservation of Polycomb repressive domains in five Drosophila species. Using Hi-C and knockout experiments, they challenge the standard hierarchical Polycomb recruitment model and demonstrate that cooperative rather than hierarchical interactions among DNA motifs, transcription factors, and Polycomb group complexes define Polycomb domains.

  12. An Evolutionary Conserved Epigenetic Mark of Polycomb Response Elements Implemented by Trx/MLL/COMPASS.

    Science.gov (United States)

    Rickels, Ryan; Hu, Deqing; Collings, Clayton K; Woodfin, Ashley R; Piunti, Andrea; Mohan, Man; Herz, Hans-Martin; Kvon, Evgeny; Shilatifard, Ali

    2016-07-21

    Polycomb response elements (PREs) are specific DNA sequences that stably maintain the developmental pattern of gene expression. Drosophila PREs are well characterized, whereas the existence of PREs in mammals remains debated. Accumulating evidence supports a model in which CpG islands recruit Polycomb group (PcG) complexes; however, which subset of CGIs is selected to serve as PREs is unclear. Trithorax (Trx) positively regulates gene expression in Drosophila and co-occupies PREs to antagonize Polycomb-dependent silencing. Here we demonstrate that Trx-dependent H3K4 dimethylation (H3K4me2) marks Drosophila PREs and maintains the developmental expression pattern of nearby genes. Similarly, the mammalian Trx homolog, MLL1, deposits H3K4me2 at CpG-dense regions that could serve as PREs. In the absence of MLL1 and H3K4me2, H3K27me3 levels, a mark of Polycomb repressive complex 2 (PRC2), increase at these loci. By inhibiting PRC2-dependent H3K27me3 in the absence of MLL1, we can rescue expression of these loci, demonstrating a functional balance between MLL1 and PRC2 activities at these sites. Thus, our study provides rules for identifying cell-type-specific functional mammalian PREs within the human genome. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Polycomb Group Proteins RING1A and RING1B Regulate the Vegetative Phase Transition in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Jian Li

    2017-05-01

    Full Text Available Polycomb group (PcG protein-mediated gene silencing is a major regulatory mechanism in higher eukaryotes that affects gene expression at the transcriptional level. Here, we report that two conserved homologous PcG proteins, RING1A and RING1B (RING1A/B, are required for global H2A monoubiquitination (H2Aub in Arabidopsis. The mutation of RING1A/B increased the expression of members of the SQUAMOSA PROMOTER BINDING PROTEIN-LIKE (SPL gene family and caused an early vegetative phase transition. The early vegetative phase transition observed in ring1a ring1b double mutant plants was dependent on an SPL family gene, and the H2Aub status of the chromatin at SPL locus was dependent on RING1A/B. Moreover, mutation in RING1A/B affected the miRNA156a-mediated vegetative phase transition, and RING1A/B and the AGO7-miR390-TAS3 pathway were found to additively regulate this transition in Arabidopsis. Together, our results demonstrate that RING1A/B regulates the vegetative phase transition in Arabidopsis through the repression of SPL family genes.

  14. Rybp, a polycomb complex-associated protein, is required for mouse eye development

    Directory of Open Access Journals (Sweden)

    Schreiber-Agus Nicole

    2007-04-01

    Full Text Available Abstract Background Rybp (Ring1 and YY1 binding protein is a zinc finger protein which interacts with the members of the mammalian polycomb complexes. Previously we have shown that Rybp is critical for early embryogenesis and that haploinsufficiency of Rybp in a subset of embryos causes failure of neural tube closure. Here we investigated the requirement for Rybp in ocular development using four in vivo mouse models which resulted in either the ablation or overexpression of Rybp. Results Our results demonstrate that loss of a single Rybp allele in conventional knockout mice often resulted in retinal coloboma, an incomplete closure of the optic fissure, characterized by perturbed localization of Pax6 but not of Pax2. In addition, about one half of Rybp-/- Rybp+/+ chimeric embryos also developed retinal colobomas and malformed lenses. Tissue-specific transgenic overexpression of Rybp in the lens resulted in abnormal fiber cell differentiation and severe lens opacification with increased levels of AP-2α and Sox2, and reduced levels of βA4-crystallin gene expression. Ubiquitous transgenic overexpression of Rybp in the entire eye caused abnormal retinal folds, corneal neovascularization, and lens opacification. Additional changes included defects in anterior eye development. Conclusion These studies establish Rybp as a novel gene that has been associated with coloboma. Other genes linked to coloboma encode various classes of transcription factors such as BCOR, CBP, Chx10, Pax2, Pax6, Six3, Ski, Vax1 and Vax2. We propose that the multiple functions for Rybp in regulating mouse retinal and lens development are mediated by genetic, epigenetic and physical interactions between these genes and proteins.

  15. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila

    DEFF Research Database (Denmark)

    Bantignies, Frédéric; Roure, Virginie; Comet, Itys

    2011-01-01

    In Drosophila melanogaster, Hox genes are organized in an anterior and a posterior cluster, called Antennapedia complex and bithorax complex, located on the same chromosome arm and separated by 10 Mb of DNA. Both clusters are repressed by Polycomb group (PcG) proteins. Here, we show that genes...... of the two Hox complexes can interact within nuclear PcG bodies in tissues where they are corepressed. This colocalization increases during development and depends on PcG proteins. Hox gene contacts are conserved in the distantly related Drosophila virilis species and they are part of a large gene...

  16. Mediator and Cohesin Connect Gene Expression and Chromatin Architecture

    Science.gov (United States)

    Kagey, Michael H.; Newman, Jamie J.; Bilodeau, Steve; Zhan, Ye; Orlando, David A.; van Berkum, Nynke L.; Ebmeier, Christopher C.; Goossens, Jesse; Rahl, Peter B.; Levine, Stuart S.; Taatjes, Dylan J.; Dekker, Job; Young, Richard A.

    2010-01-01

    Summary Transcription factors control cell specific gene expression programs through interactions with diverse coactivators and the transcription apparatus. Gene activation may involve DNA loop formation between enhancer-bound transcription factors and the transcription apparatus at the core promoter, but this process is not well understood. We report here that Mediator and Cohesin physically and functionally connect the enhancers and core promoters of active genes in embryonic stem cells. Mediator, a transcriptional coactivator, forms a complex with Cohesin, which can form rings that connect two DNA segments. The Cohesin loading factor Nipbl is associated with Mediator/Cohesin complexes, providing a means to load Cohesin at promoters. DNA looping is observed between the enhancers and promoters occupied by Mediator and Cohesin. Mediator and Cohesin occupy different promoters in different cells, thus generating cell-type specific DNA loops linked to the gene expression program of each cell. PMID:20720539

  17. Polycomb repressive complex 2 (PRC2 restricts hematopoietic stem cell activity.

    Directory of Open Access Journals (Sweden)

    Ian J Majewski

    2008-04-01

    Full Text Available Polycomb group proteins are transcriptional repressors that play a central role in the establishment and maintenance of gene expression patterns during development. Using mice with an N-ethyl-N-nitrosourea (ENU-induced mutation in Suppressor of Zeste 12 (Suz12, a core component of Polycomb Repressive Complex 2 (PRC2, we show here that loss of Suz12 function enhances hematopoietic stem cell (HSC activity. In addition to these effects on a wild-type genetic background, mutations in Suz12 are sufficient to ameliorate the stem cell defect and thrombocytopenia present in mice that lack the thrombopoietin receptor (c-Mpl. To investigate the molecular targets of the PRC2 complex in the HSC compartment, we examined changes in global patterns of gene expression in cells deficient in Suz12. We identified a distinct set of genes that are regulated by Suz12 in hematopoietic cells, including eight genes that appear to be highly responsive to PRC2 function within this compartment. These data suggest that PRC2 is required to maintain a specific gene expression pattern in hematopoiesis that is indispensable to normal stem cell function.

  18. Recent Trends of Polymer Mediated Liposomal Gene Delivery System

    Directory of Open Access Journals (Sweden)

    Shyamal Kumar Kundu

    2014-01-01

    Full Text Available Advancement in the gene delivery system have resulted in clinical successes in gene therapy for patients with several genetic diseases, such as immunodeficiency diseases, X-linked adrenoleukodystrophy (X-ALD blindness, thalassemia, and many more. Among various delivery systems, liposomal mediated gene delivery route is offering great promises for gene therapy. This review is an attempt to depict a portrait about the polymer based liposomal gene delivery systems and their future applications. Herein, we have discussed in detail the characteristics of liposome, importance of polymer for liposome formulation, gene delivery, and future direction of liposome based gene delivery as a whole.

  19. Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

    OpenAIRE

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

    2010-01-01

    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and othe...

  20. Enhancement of plasmid-mediated stable gene expression by ...

    African Journals Online (AJOL)

    ARL

    2012-06-12

    Jun 12, 2012 ... production and faithful translation and processing of proteins (Baldi et al., ..... deeper understanding of the interaction of cellular factors and regulatory DNA .... mediated transgene expression in the rat brain. Gene Ther., 7: ...

  1. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    OpenAIRE

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...

  2. Gene Therapy Mediated Breast Cancer Immunity

    National Research Council Canada - National Science Library

    Nesbit, Heike

    1999-01-01

    .... POE2 is produced by the cyclooxygenase (COX) mediated oxidation of arachidonic acid. The inhibition of COX activity in B7-1 expressing MDA-MB 231 cells restored the proliferative response of T cells...

  3. Host genes involved in Agrobacterium-mediated transformation

    NARCIS (Netherlands)

    Soltani, Jalal

    2009-01-01

    Agrobacterium is the nature’s genetic engineer that can transfer genes across the kingdom barriers to both prokaryotic and eukaryotic host cells. The host genes which are involved in Agrobacterium-mediated transformatiom (AMT) are not well known. Here, I studied in a systematic way to identify the

  4. Positive-negative-selection-mediated gene targeting in rice

    Directory of Open Access Journals (Sweden)

    Zenpei eShimatani

    2015-01-01

    Full Text Available Gene targeting (GT refers to the designed modification of genomic sequence(s through homologous recombination (HR. GT is a powerful tool both for the study of gene function and for molecular breeding. However, in transformation of higher plants, non-homologous end joining (NHEJ occurs overwhelmingly in somatic cells, masking HR-mediated GT. Positive-negative selection (PNS is an approach for finding HR-mediated GT events because it can eliminate NHEJ effectively by expression of a negative-selection marker gene. In rice—a major crop worldwide—reproducible PNS-mediated GT of endogenous genes has now been successfully achieved. The procedure is based on strong PNS using diphtheria toxin A-fragment as a negative marker, and has succeeded in the directed modification of several endogenous rice genes in various ways. In addition to gene knock-outs and knock-ins, a nucleotide substitution in a target gene was also achieved recently. This review presents a summary of the development of the rice PNS system, highlighting its advantages. Different types of gene modification and gene editing aimed at developing new plant breeding technology (NPBT based on PNS are discussed.

  5. Dysregulation of RNA Mediated Gene Expression in Motor Neuron Diseases.

    Science.gov (United States)

    Gonçalves, Inês do Carmo G; Rehorst, Wiebke A; Kye, Min Jeong

    2016-01-01

    Recent findings indicate an important role for RNA-mediated gene expression in motor neuron diseases, including ALS (amyotrophic lateral sclerosis) and SMA (spinal muscular atrophy). ALS, also known as Lou Gehrig's disease, is an adult-onset progressive neurodegenerative disorder, whereby SMA or "children's Lou Gehrig's disease" is considered a pediatric neurodevelopmental disorder. Despite the difference in genetic causes, both ALS and SMA share common phenotypes; dysfunction/loss of motor neurons that eventually leads to muscle weakness and atrophy. With advanced techniques in molecular genetics and cell biology, current data suggest that these two distinct motor neuron diseases share more than phenotypes; ALS and SMA have similar cellular pathological mechanisms including mitochondrial dysfunction, oxidative stress and dysregulation in RNA-mediated gene expression. Here, we will discuss the current findings on these two diseases with specific focus on RNA-mediated gene regulation including miRNA expression, pre-mRNA processing and RNA binding proteins.

  6. DNA-mediated gene transfer into ataxia-telangiectasia cells

    International Nuclear Information System (INIS)

    Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.

    1986-01-01

    The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA

  7. Identification of certain cancer-mediating genes using Gaussian ...

    Indian Academy of Sciences (India)

    2015-09-29

    Sep 29, 2015 ... mance of GFI is compared with 19 exiting cluster validity indices. The results .... Using k-means algorithm on human lung expression data, we have found ... of possible genes that mediate the development of a cancer. In other ...

  8. Trithorax monomethylates histone H3K4 and interacts directly with CBP to promote H3K27 acetylation and antagonize Polycomb silencing

    Science.gov (United States)

    Tie, Feng; Banerjee, Rakhee; Saiakhova, Alina R.; Howard, Benny; Monteith, Kelsey E.; Scacheri, Peter C.; Cosgrove, Michael S.; Harte, Peter J.

    2014-01-01

    Trithorax (TRX) antagonizes epigenetic silencing by Polycomb group (PcG) proteins, stimulates enhancer-dependent transcription, and establishes a ‘cellular memory’ of active transcription of PcG-regulated genes. The mechanisms underlying these TRX functions remain largely unknown, but are presumed to involve its histone H3K4 methyltransferase activity. We report that the SET domains of TRX and TRX-related (TRR) have robust histone H3K4 monomethyltransferase activity in vitro and that Tyr3701 of TRX and Tyr2404 of TRR prevent them from being trimethyltransferases. The trxZ11 missense mutation (G3601S), which abolishes H3K4 methyltransferase activity in vitro, reduces the H3K4me1 but not the H3K4me3 level in vivo. trxZ11 also suppresses the impaired silencing phenotypes of the Pc3 mutant, suggesting that H3K4me1 is involved in antagonizing Polycomb silencing. Polycomb silencing is also antagonized by TRX-dependent H3K27 acetylation by CREB-binding protein (CBP). We show that perturbation of Polycomb silencing by TRX overexpression requires CBP. We also show that TRX and TRR are each physically associated with CBP in vivo, that TRX binds directly to the CBP KIX domain, and that the chromatin binding patterns of TRX and TRR are highly correlated with CBP and H3K4me1 genome-wide. In vitro acetylation of H3K27 by CBP is enhanced on K4me1-containing H3 substrates, and independently altering the H3K4me1 level in vivo, via the H3K4 demethylase LSD1, produces concordant changes in H3K27ac. These data indicate that the catalytic activities of TRX and CBP are physically coupled and suggest that both activities play roles in antagonizing Polycomb silencing, stimulating enhancer activity and cellular memory. PMID:24550119

  9. Polycomb enables primitive endoderm lineage priming in embryonic stem cells

    DEFF Research Database (Denmark)

    Illingworth, Robert S; Hölzenspies, Jurriaan J; Roske, Fabian V

    2016-01-01

    Mouse embryonic stem cells (ESCs), like the blastocyst from which they are derived, contain precursors of the epiblast (Epi) and primitive endoderm (PrEn) lineages. While transient in vivo, these precursor populations readily interconvert in vitro. We show that altered transcription is the driver...... polycomb with dynamic changes in transcription and stalled lineage commitment, allowing cells to explore alternative choices prior to a definitive decision....

  10. Agrobacterium-mediated gene transfer in plants and biosafety considerations.

    Science.gov (United States)

    Mehrotra, Shweta; Goyal, Vinod

    2012-12-01

    Agrobacterium, the natures' genetic engineer, has been used as a vector to create transgenic plants. Agrobacterium-mediated gene transfer in plants is a highly efficient transformation process which is governed by various factors including genotype of the host plant, explant, vector, plasmid, bacterial strain, composition of culture medium, tissue damage, and temperature of co-cultivation. Agrobacterium has been successfully used to transform various economically and horticulturally important monocot and dicot species by standard tissue culture and in planta transformation techniques like floral or seedling infilteration, apical meristem transformation, and the pistil drip methods. Monocots have been comparatively difficult to transform by Agrobacterium. However, successful transformations have been reported in the last few years based on the adjustment of the parameters that govern the responses of monocots to Agrobacterium. A novel Agrobacterium transferred DNA-derived nanocomplex method has been developed which will be highly valuable for plant biology and biotechnology. Agrobacterium-mediated genetic transformation is known to be the preferred method of creating transgenic plants from a commercial and biosafety perspective. Agrobacterium-mediated gene transfer predominantly results in the integration of foreign genes at a single locus in the host plant, without associated vector backbone and is also known to produce marker free plants, which are the prerequisites for commercialization of transgenic crops. Research in Agrobacterium-mediated transformation can provide new and novel insights into the understanding of the regulatory process controlling molecular, cellular, biochemical, physiological, and developmental processes occurring during Agrobacterium-mediated transformation and also into a wide range of aspects on biological safety of transgenic crops to improve crop production to meet the demands of ever-growing world's population.

  11. The Rice Enhancer of Zeste [E(z] Genes SDG711 and SDG718 are respectively involved in Long Day and Short Day Signaling to Mediate the Accurate Photoperiod Control of Flowering time

    Directory of Open Access Journals (Sweden)

    Xiaoyun eLiu

    2014-10-01

    Full Text Available Recent advances in rice flowering studies have shown that the accurate control of flowering by photoperiod is regulated by key mechanisms that involve the regulation of flowering genes including Hd1, Ehd1, Hd3a, and RFT1. The chromatin mechanism involved in the regulation of rice flowering genes is presently not well known. Here we show that the rice E(z genes SDG711 and SDG718, which encode the Polycomb Repressive Complex2 (PRC2 key subunit that is required for trimethylation of histone H3 lysine 27 (H3K27me3, are respectively involved in long day (LD and short day (SD regulation of key flowering genes. The expression of SDG711 and SDG718 is induced by LD and SD, respectively. Over-expression and down-regulation of SDG711 respectively repressed and promoted flowering in LD, but had no effect in SD. By contrast, down-regulation of SDG718 had no effect in LD but delayed flowering in SD. SDG711 and SDG718 repressed OsLF (a repressor of Hd1 respectively in LD and SD, leading to a higher expression of Hd1 thus late flowering in LD and early flowering in SD. SDG711 was also found to be involved in the repression of Ehd1 in LD. SDG711 was shown to directly target to OsLF and Ehd1 loci to mediate H3K27me3 and gene repression. The function of the rice E(z genes in LD repression and SD promotion of flowering suggests that PRC2-mediated epigenetic repression of gene expression is involved in the accurate photoperiod control of rice flowering.

  12. Lineage specific expression of Polycomb Group Proteins in human embryonic stem cells in vitro.

    Science.gov (United States)

    Pethe, Prasad; Pursani, Varsha; Bhartiya, Deepa

    2015-05-01

    Human embryonic (hES) stem cells are an excellent model to study lineage specification and differentiation into various cell types. Differentiation necessitates repression of specific genes not required for a particular lineage. Polycomb Group (PcG) proteins are key histone modifiers, whose primary function is gene repression. PcG proteins form complexes called Polycomb Repressive Complexes (PRCs), which catalyze histone modifications such as H2AK119ub1, H3K27me3, and H3K9me3. PcG proteins play a crucial role during differentiation of stem cells. The expression of PcG transcripts during differentiation of hES cells into endoderm, mesoderm, and ectoderm lineage is yet to be shown. In-house derived hES cell line KIND1 was differentiated into endoderm, mesoderm, and ectoderm lineages; followed by characterization using RT-PCR for HNF4A, CDX2, MEF2C, TBX5, SOX1, and MAP2. qRT-PCR and western blotting was performed to compare expression of PcG transcripts and proteins across all the three lineages. We observed that cells differentiated into endoderm showed upregulation of RING1B, BMI1, EZH2, and EED transcripts. Mesoderm differentiation was characterized by significant downregulation of all PcG transcripts during later stages. BMI1 and RING1B were upregulated while EZH2, SUZ12, and EED remained low during ectoderm differentiation. Western blotting also showed distinct expression of BMI1 and EZH2 during differentiation into three germ layers. Our study shows that hES cells differentiating into endoderm, mesoderm, and ectoderm lineages show distinct PcG expression profile at transcript and protein level. © 2015 International Federation for Cell Biology.

  13. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

    OpenAIRE

    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

    2011-01-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...

  14. Polycomb-like proteins link the PRC2 complex to CpG islands

    Energy Technology Data Exchange (ETDEWEB)

    Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J.; Bulyk, Martha L.; Shi, Yang; Wang, Zhanxin

    2017-09-06

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression1,2 and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components3, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci4,5,6,7,8,9,10,11,12,13. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation14. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.

  15. Polycomb Repressive Complex 2 Enacts Wnt Signaling in Intestinal Homeostasis and Contributes to the Instigation of Stemness in Diseases Entailing Epithelial Hyperplasia or Neoplasia.

    Science.gov (United States)

    Oittinen, Mikko; Popp, Alina; Kurppa, Kalle; Lindfors, Katri; Mäki, Markku; Kaikkonen, Minna U; Viiri, Keijo

    2017-02-01

    Canonical Wnt/β-catenin signaling regulates the homeostasis of intestinal epithelium by controlling the balance between intestinal stem cell self-renewal and differentiation but epigenetic mechanisms enacting the process are not known. We hypothesized that epigenetic regulator, Polycomb Repressive Complex-2 (PRC2), is involved in Wnt-mediated epithelial homeostasis on the crypt-villus axis and aberrancies therein are implicated both in celiac disease and in intestinal malignancies. We found that PRC2 establishes repressive crypt and villus specific trimethylation of histone H3 lysine 27 (H3K27me3) signature on genes responsible for, for example, nutrient transport and cell killing in crypts and, for example, proliferation and differentiation in mature villi, suggesting that PRC2 facilitates the Wnt-governed intestinal homeostasis. When celiac patients are on gluten-containing diet PRC2 is out-of-bounds active and consequently its target genes were found affected in intestinal epithelium. Significant set of effective intestinal PRC2 targets are also differentially expressed in colorectal adenoma and carcinomas. Our results suggest that PRC2 gives rise and maintains polar crypt and villus specific H3K27me3 signatures. As H3K27me3 is a mark enriched in developmentally important genes, identified intestinal PRC2 targets are possibly imperative drivers for enterocyte differentiation and intestinal stem cell maintenance downstream to Wnt-signaling. Our work also elucidates the mechanism sustaining the crypt hyperplasia in celiac disease and suggest that PRC2-dependent fostering of epithelial stemness is a common attribute in intestinal diseases in which epithelial hyperplasia or neoplasia prevails. Finally, this work demonstrates that in intestine PRC2 represses genes having both pro-stemness and pro-differentiation functions, fact need to be considered when designing epigenetic therapies including PRC2 as a drug target. Stem Cells 2017;35:445-457. © 2016 Alpha

  16. Investigating Gene Function in Cereal Rust Fungi by Plant-Mediated Virus-Induced Gene Silencing.

    Science.gov (United States)

    Panwar, Vinay; Bakkeren, Guus

    2017-01-01

    Cereal rust fungi are destructive pathogens, threatening grain production worldwide. Targeted breeding for resistance utilizing host resistance genes has been effective. However, breakdown of resistance occurs frequently and continued efforts are needed to understand how these fungi overcome resistance and to expand the range of available resistance genes. Whole genome sequencing, transcriptomic and proteomic studies followed by genome-wide computational and comparative analyses have identified large repertoire of genes in rust fungi among which are candidates predicted to code for pathogenicity and virulence factors. Some of these genes represent defence triggering avirulence effectors. However, functions of most genes still needs to be assessed to understand the biology of these obligate biotrophic pathogens. Since genetic manipulations such as gene deletion and genetic transformation are not yet feasible in rust fungi, performing functional gene studies is challenging. Recently, Host-induced gene silencing (HIGS) has emerged as a useful tool to characterize gene function in rust fungi while infecting and growing in host plants. We utilized Barley stripe mosaic virus-mediated virus induced gene silencing (BSMV-VIGS) to induce HIGS of candidate rust fungal genes in the wheat host to determine their role in plant-fungal interactions. Here, we describe the methods for using BSMV-VIGS in wheat for functional genomics study in cereal rust fungi.

  17. Comparative Analysis of Chromatin Binding by Sex Comb on Midleg (SCM) and Other Polycomb Group Repressors at a Drosophila Hox Gene▿

    Science.gov (United States)

    Wang, Liangjun; Jahren, Neal; Miller, Ellen L.; Ketel, Carrie S.; Mallin, Daniel R.; Simon, Jeffrey A.

    2010-01-01

    Sex Comb on Midleg (SCM) is a transcriptional repressor in the Polycomb group (PcG), but its molecular role in PcG silencing is not known. Although SCM can interact with Polycomb repressive complex 1 (PRC1) in vitro, biochemical studies have indicated that SCM is not a core constituent of PRC1 or PRC2. Nevertheless, SCM is just as critical for Drosophila Hox gene silencing as canonical subunits of these well-characterized PcG complexes. To address functional relationships between SCM and other PcG components, we have performed chromatin immunoprecipitation studies using cultured Drosophila Schneider line 2 (S2) cells and larval imaginal discs. We find that SCM associates with a Polycomb response element (PRE) upstream of the Ubx gene which also binds PRC1, PRC2, and the DNA-binding PcG protein Pleiohomeotic (PHO). However, SCM is retained at this Ubx PRE despite genetic disruption or knockdown of PHO, PRC1, or PRC2, suggesting that SCM chromatin targeting does not require prior association of these other PcG components. Chromatin immunoprecipitations (IPs) to test the consequences of SCM genetic disruption or knockdown revealed that PHO association is unaffected, but reduced levels of PRE-bound PRC2 and PRC1 were observed. We discuss these results in light of current models for recruitment of PcG complexes to chromatin targets. PMID:20351181

  18. Ultrasound-Mediated Local Drug and Gene Delivery Using Nanocarriers

    Science.gov (United States)

    Zhou, Qiu-Lan; Chen, Zhi-Yi; Yang, Feng

    2014-01-01

    With the development of nanotechnology, nanocarriers have been increasingly used for curative drug/gene delivery. Various nanocarriers are being introduced and assessed, such as polymer nanoparticles, liposomes, and micelles. As a novel theranostic system, nanocarriers hold great promise for ultrasound molecular imaging, targeted drug/gene delivery, and therapy. Nanocarriers, with the properties of smaller particle size, and long circulation time, would be advantageous in diagnostic and therapeutic applications. Nanocarriers can pass through blood capillary walls and cell membrane walls to deliver drugs. The mechanisms of interaction between ultrasound and nanocarriers are not clearly understood, which may be related to cavitation, mechanical effects, thermal effects, and so forth. These effects may induce transient membrane permeabilization (sonoporation) on a single cell level, cell death, and disruption of tissue structure, ensuring noninvasive, targeted, and efficient drug/gene delivery and therapy. The system has been used in various tissues and organs (in vitro or in vivo), including tumor tissues, kidney, cardiac, skeletal muscle, and vascular smooth muscle. In this review, we explore the research progress and application of ultrasound-mediated local drug/gene delivery with nanocarriers. PMID:25202710

  19. Ultrasound-Mediated Local Drug and Gene Delivery Using Nanocarriers

    Directory of Open Access Journals (Sweden)

    Qiu-Lan Zhou

    2014-01-01

    Full Text Available With the development of nanotechnology, nanocarriers have been increasingly used for curative drug/gene delivery. Various nanocarriers are being introduced and assessed, such as polymer nanoparticles, liposomes, and micelles. As a novel theranostic system, nanocarriers hold great promise for ultrasound molecular imaging, targeted drug/gene delivery, and therapy. Nanocarriers, with the properties of smaller particle size, and long circulation time, would be advantageous in diagnostic and therapeutic applications. Nanocarriers can pass through blood capillary walls and cell membrane walls to deliver drugs. The mechanisms of interaction between ultrasound and nanocarriers are not clearly understood, which may be related to cavitation, mechanical effects, thermal effects, and so forth. These effects may induce transient membrane permeabilization (sonoporation on a single cell level, cell death, and disruption of tissue structure, ensuring noninvasive, targeted, and efficient drug/gene delivery and therapy. The system has been used in various tissues and organs (in vitro or in vivo, including tumor tissues, kidney, cardiac, skeletal muscle, and vascular smooth muscle. In this review, we explore the research progress and application of ultrasound-mediated local drug/gene delivery with nanocarriers.

  20. Small ubiquitin-like modifier (SUMO) conjugation impedes transcriptional silencing by the polycomb group repressor Sex Comb on Midleg.

    Science.gov (United States)

    Smith, Matthew; Mallin, Daniel R; Simon, Jeffrey A; Courey, Albert J

    2011-04-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE.

  1. Small Ubiquitin-like Modifier (SUMO) Conjugation Impedes Transcriptional Silencing by the Polycomb Group Repressor Sex Comb on Midleg*

    Science.gov (United States)

    Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.

    2011-01-01

    The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-terminal sterile α motif (SAM) domain, is crucial for the efficient sumoylation of Scm. Scm is associated with the major Polycomb response element (PRE) of the homeotic gene Ultrabithorax (Ubx), and efficient PRE recruitment requires an intact Scm SAM domain. Global reduction of sumoylation augments binding of Scm to the PRE. This is likely to be a direct effect of Scm sumoylation because mutations in the SUMO acceptor sites in Scm enhance its recruitment to the PRE, whereas translational fusion of SUMO to the Scm N terminus interferes with this recruitment. In the metathorax, Ubx expression promotes haltere formation and suppresses wing development. When SUMO levels are reduced, we observe decreased expression of Ubx and partial haltere-to-wing transformation phenotypes. These observations suggest that SUMO negatively regulates Scm function by impeding its recruitment to the Ubx major PRE. PMID:21278366

  2. Recombinant adenovirus-mediated gene transfer suppresses experimental arthritis

    Directory of Open Access Journals (Sweden)

    E. Quattrocchi

    2011-09-01

    Full Text Available Collagen Induced Arthritis (CIA is a widely studied animal model to develop and test novel therapeutic approaches for treating Rheumatoid Arthritis (RA in humans. Soluble Cytotoxic T-Lymphocyte Antigen 4 (CTLA4-Ig, which binds B7 molecule on antigen presenting cells and blocks CD28 mediated T-lymphocyte activation, has been shown to ameliorate experimental autoimmune diseases such as lupus, diabetes and CIA. Objective of our research was to investigate in vivo the effectiveness of blocking the B7/CD28 T-lymphocyte co-stimulatory pathway, utilizing a gene transfer technology, as a therapeutic strategy against CIA. Replication-deficient adenoviruses encoding a chimeric CTLA4-Ig fusion protein, or β-galactosidase as control, have been injected intravenously once at arthritis onset. Disease activity has been monitored by the assessment of clinical score, paw thickness and type II collagen (CII specific cellular and humoral immune responses for 21 days. The adenovirally delivered CTLA4-Ig fusion protein at a dose of 2×108 pfu suppressed established CIA, whereas the control β-galactosidase did not significantly affect the disease course. CII-specific lymphocyte proliferation, IFNg production and anti-CII antibodies were significantly reduced by CTLA4-Ig treatment. Our results demonstrate that blockade of the B7/CD28 co-stimulatory pathway by adenovirus-mediated CTLA4-Ig gene transfer is effective in treating established CIA suggesting its potential in treating RA.

  3. RYBP and Cbx7 Define Specific Biological Functions of Polycomb Complexes in Mouse Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Lluis Morey

    2013-01-01

    Full Text Available The Polycomb repressive complex 1 (PRC1 is required for decisions of stem cell fate. In mouse embryonic stem cells (ESCs, two major variations of PRC1 complex, defined by the mutually exclusive presence of Cbx7 or RYBP, have been identified. Here, we show that although the genomic localization of the Cbx7- and RYBP-containing PRC1 complexes overlaps in certain genes, it can also be mutually exclusive. At the molecular level, Cbx7 is necessary for recruitment of Ring1B to chromatin, whereas RYBP enhances the PRC1 enzymatic activity. Genes occupied by RYBP show lower levels of Ring1B and H2AK119ub and are consequently more highly transcribed than those bound by Cbx7. At the functional level, we show that genes occupied by RYBP are primarily involved in the regulation of metabolism and cell-cycle progression, whereas those bound by Cbx7 predominantly control early-lineage commitment of ESCs. Altogether, our results indicate that different PRC1 subtypes establish a complex pattern of gene regulation that regulates common and nonoverlapping aspects of ESC pluripotency and differentiation.

  4. Gold nanoparticle mediated laser transfection for efficient siRNA mediated gene knock down.

    Directory of Open Access Journals (Sweden)

    Dag Heinemann

    Full Text Available Laser based transfection methods have proven to be an efficient and gentle alternative to established molecule delivery methods like lipofection or electroporation. Among the laser based methods, gold nanoparticle mediated laser transfection bears the major advantage of high throughput and easy usability. This approach uses plasmon resonances on gold nanoparticles unspecifically attached to the cell membrane to evoke transient and spatially defined cell membrane permeabilization. In this study, we explore the parameter regime for gold nanoparticle mediated laser transfection for the delivery of molecules into cell lines and prove its suitability for siRNA mediated gene knock down. The developed setup allows easy usage and safe laser operation in a normal lab environment. We applied a 532 nm Nd:YAG microchip laser emitting 850 ps pulses at a repetition rate of 20.25 kHz. Scanning velocities of the laser spot over the sample of up to 200 mm/s were tested without a decline in perforation efficiency. This velocity leads to a process speed of ∼8 s per well of a 96 well plate. The optimal particle density was determined to be ∼6 particles per cell using environmental scanning electron microscopy. Applying the optimized parameters transfection efficiencies of 88% were achieved in canine pleomorphic adenoma ZMTH3 cells using a fluorescent labeled siRNA while maintaining a high cell viability of >90%. Gene knock down of d2-EGFP was demonstrated and validated by fluorescence repression and western blot analysis. On basis of our findings and established mathematical models we suppose a mixed transfection mechanism consisting of thermal and multiphoton near field effects. Our findings emphasize that gold nanoparticle mediated laser transfection provides an excellent tool for molecular delivery for both, high throughput purposes and the transfection of sensitive cells types.

  5. Gold nanoparticle mediated laser transfection for efficient siRNA mediated gene knock down.

    Science.gov (United States)

    Heinemann, Dag; Schomaker, Markus; Kalies, Stefan; Schieck, Maximilian; Carlson, Regina; Murua Escobar, Hugo; Ripken, Tammo; Meyer, Heiko; Heisterkamp, Alexander

    2013-01-01

    Laser based transfection methods have proven to be an efficient and gentle alternative to established molecule delivery methods like lipofection or electroporation. Among the laser based methods, gold nanoparticle mediated laser transfection bears the major advantage of high throughput and easy usability. This approach uses plasmon resonances on gold nanoparticles unspecifically attached to the cell membrane to evoke transient and spatially defined cell membrane permeabilization. In this study, we explore the parameter regime for gold nanoparticle mediated laser transfection for the delivery of molecules into cell lines and prove its suitability for siRNA mediated gene knock down. The developed setup allows easy usage and safe laser operation in a normal lab environment. We applied a 532 nm Nd:YAG microchip laser emitting 850 ps pulses at a repetition rate of 20.25 kHz. Scanning velocities of the laser spot over the sample of up to 200 mm/s were tested without a decline in perforation efficiency. This velocity leads to a process speed of ∼8 s per well of a 96 well plate. The optimal particle density was determined to be ∼6 particles per cell using environmental scanning electron microscopy. Applying the optimized parameters transfection efficiencies of 88% were achieved in canine pleomorphic adenoma ZMTH3 cells using a fluorescent labeled siRNA while maintaining a high cell viability of >90%. Gene knock down of d2-EGFP was demonstrated and validated by fluorescence repression and western blot analysis. On basis of our findings and established mathematical models we suppose a mixed transfection mechanism consisting of thermal and multiphoton near field effects. Our findings emphasize that gold nanoparticle mediated laser transfection provides an excellent tool for molecular delivery for both, high throughput purposes and the transfection of sensitive cells types.

  6. Gold Nanoparticle Mediated Laser Transfection for Efficient siRNA Mediated Gene Knock Down

    Science.gov (United States)

    Heinemann, Dag; Schomaker, Markus; Kalies, Stefan; Schieck, Maximilian; Carlson, Regina; Escobar, Hugo Murua; Ripken, Tammo; Meyer, Heiko; Heisterkamp, Alexander

    2013-01-01

    Laser based transfection methods have proven to be an efficient and gentle alternative to established molecule delivery methods like lipofection or electroporation. Among the laser based methods, gold nanoparticle mediated laser transfection bears the major advantage of high throughput and easy usability. This approach uses plasmon resonances on gold nanoparticles unspecifically attached to the cell membrane to evoke transient and spatially defined cell membrane permeabilization. In this study, we explore the parameter regime for gold nanoparticle mediated laser transfection for the delivery of molecules into cell lines and prove its suitability for siRNA mediated gene knock down. The developed setup allows easy usage and safe laser operation in a normal lab environment. We applied a 532 nm Nd:YAG microchip laser emitting 850 ps pulses at a repetition rate of 20.25 kHz. Scanning velocities of the laser spot over the sample of up to 200 mm/s were tested without a decline in perforation efficiency. This velocity leads to a process speed of ∼8 s per well of a 96 well plate. The optimal particle density was determined to be ∼6 particles per cell using environmental scanning electron microscopy. Applying the optimized parameters transfection efficiencies of 88% were achieved in canine pleomorphic adenoma ZMTH3 cells using a fluorescent labeled siRNA while maintaining a high cell viability of >90%. Gene knock down of d2-EGFP was demonstrated and validated by fluorescence repression and western blot analysis. On basis of our findings and established mathematical models we suppose a mixed transfection mechanism consisting of thermal and multiphoton near field effects. Our findings emphasize that gold nanoparticle mediated laser transfection provides an excellent tool for molecular delivery for both, high throughput purposes and the transfection of sensitive cells types. PMID:23536802

  7. TET1-Mediated Hydroxymethylation Facilitates Hypoxic Gene Induction in Neuroblastoma

    Directory of Open Access Journals (Sweden)

    Christopher J. Mariani

    2014-06-01

    Full Text Available The ten-eleven-translocation 5-methylcytosine dioxygenase (TET family of enzymes catalyzes the conversion of 5-methylcytosine (5-mC to 5-hydroxymethylcytosine (5-hmC, a modified cytosine base that facilitates gene expression. Cells respond to hypoxia by inducing a transcriptional program regulated in part by oxygen-dependent dioxygenases that require Fe(II and α-ketoglutarate. Given that the TET enzymes also require these cofactors, we hypothesized that the TETs regulate the hypoxia-induced transcriptional program. Here, we demonstrate that hypoxia increases global 5-hmC levels, with accumulation of 5-hmC density at canonical hypoxia response genes. A subset of 5-hmC gains colocalize with hypoxia response elements facilitating DNA demethylation and HIF binding. Hypoxia results in transcriptional activation of TET1, and full induction of hypoxia-responsive genes and global 5-hmC increases require TET1. Finally, we show that 5-hmC increases and TET1 upregulation in hypoxia are HIF-1 dependent. These findings establish TET1-mediated 5-hmC changes as an important epigenetic component of the hypoxic response.

  8. Polycomb Group Protein YY1 Is an Essential Regulator of Hematopoietic Stem Cell Quiescence

    Directory of Open Access Journals (Sweden)

    Zhanping Lu

    2018-02-01

    Full Text Available Yin yang 1 (YY1 is a ubiquitous transcription factor and mammalian polycomb group protein (PcG with important functions to regulate embryonic development, lineage differentiation, and cell proliferation. YY1 mediates stable PcG-dependent transcriptional repression via recruitment of PcG proteins that catalyze histone modifications. Many questions remain unanswered regarding how cell- and tissue-specificity is achieved by PcG proteins. Here, we demonstrate that a conditional knockout of Yy1 in hematopoietic stem cells (HSCs decreases long-term repopulating activity and ectopic YY1 expression expands HSCs. Although the YY1 PcG domain is required for Igκ chain rearrangement in B cells, the YY1 mutant lacking the PcG domain retained the capacity to stimulate HSC self-renewal. YY1 deficiency deregulated the genetic network governing HSC cell proliferation and impaired stem cell factor/c-Kit signaling, disrupting mechanisms conferring HSC quiescence. These results reveal a mechanism for how a ubiquitously expressed transcriptional repressor mediates lineage-specific functions to control adult hematopoiesis.

  9. Pluripotency factors and Polycomb Group proteins repress aryl hydrocarbon receptor expression in murine embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Chia-I Ko

    2014-01-01

    Full Text Available The aryl hydrocarbon receptor (AHR is a transcription factor and environmental sensor that regulates expression of genes involved in drug-metabolism and cell cycle regulation. Chromatin immunoprecipitation analyses, Ahr ablation in mice and studies with orthologous genes in invertebrates suggest that AHR may also play a significant role in embryonic development. To address this hypothesis, we studied the regulation of Ahr expression in mouse embryonic stem cells and their differentiated progeny. In ES cells, interactions between OCT3/4, NANOG, SOX2 and Polycomb Group proteins at the Ahr promoter repress AHR expression, which can also be repressed by ectopic expression of reprogramming factors in hepatoma cells. In ES cells, unproductive RNA polymerase II binds at the Ahr transcription start site and drives the synthesis of short abortive transcripts. Activation of Ahr expression during differentiation follows from reversal of repressive marks in Ahr promoter chromatin, release of pluripotency factors and PcG proteins, binding of Sp factors, establishment of histone marks of open chromatin, and engagement of active RNAPII to drive full-length RNA transcript elongation. Our results suggest that reversible Ahr repression in ES cells holds the gene poised for expression and allows for a quick switch to activation during embryonic development.

  10. Polycomb-group histone methyltransferase CLF is required for proper somatic recombination in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Na Chen; Wang-Bin Zhou; Ying-Xiang Wang; Ai-Wu Dong; Yu Yu

    2014-01-01

    Homologous recombination (HR) is a key process during meiosis in reproductive cells and the DNA damage repair process in somatic cells. Although chromatin structure is thought to be crucial for HR, only a smal number of chromatin modifiers have been studied in HR regulation so far. Here, we investigated the function of CURLY LEAF (CLF), a Polycomb-group (PcG) gene responsible for histone3 lysine 27 trimethy-lation (H3K27me3), in somatic and meiotic HR in Arabidopsis thaliana. Although fluorescent protein reporter assays in pol en and seeds showed that the frequency of meiotic cross-over in the loss-of-function mutant clf-29 was not significantly different from that in wild type, there was a lower frequency of HR in clf-29 than in wild type under normal conditions and under bleomycin treatment. The DNA damage levels were compara-ble between clf-29 and wild type, even though several DNA damage repair genes (e.g. ATM, BRCA2a, RAD50, RAD51, RAD54,and PARP2) were expressed at lower levels in clf-29. Under bleomycin treatment, the expression levels of DNA repair genes were similar in clf-29 and wild type, thus CLF may also regulate HR via other mechanisms. These findings expand the current knowledge of PcG function and contribute to general interests of epigenetic regulation in genome stability regulation.

  11. Polycomb group (PcG) proteins and Pax6 cooperate to inhibit in vivo reprogramming of the developing Drosophila eye.

    Science.gov (United States)

    Zhu, Jinjin; Ordway, Alison J; Weber, Lena; Buddika, Kasun; Kumar, Justin P

    2018-04-04

    How different cells and tissues commit to and determine their fates has been a central question in developmental biology since the seminal embryological experiments conducted by Wilhelm Roux and Hans Driesch in sea urchins and frogs. Here, we demonstrate that Polycomb group (PcG) proteins maintain Drosophila eye specification by suppressing the activation of alternative fate choices. The loss of PcG in the developing eye results in a cellular reprogramming event in which the eye is redirected to a wing fate. This fate transformation occurs with either the individual loss of Polycomb proteins or the simultaneous reduction of the Pleiohomeotic repressive complex and Pax6. Interestingly, the requirement for retinal selector genes is limited to Pax6, as the removal of more downstream members does not lead to the eye-wing transformation. We also show that distinct PcG complexes are required during different developmental windows throughout eye formation. These findings build on earlier observations that the eye can be reprogrammed to initiate head epidermis, antennal and leg development. © 2018. Published by The Company of Biologists Ltd.

  12. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    Science.gov (United States)

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154

  13. Gene Expression by PBMC in Primary Sclerosing Cholangitis: Evidence for Dysregulation of Immune Mediated Genes

    Directory of Open Access Journals (Sweden)

    Christopher A. Aoki

    2006-01-01

    Full Text Available Primary sclerosing cholangitis (PSC is a chronic disease of the bile ducts characterized by an inflammatory infiltrate and obliterative fibrosis. The precise role of the immune system in the pathogenesis of PSC remains unknown. We used RNA microarray analysis to identify immune-related genes and pathways that are differentially expressed in PSC. Messenger RNA (mRNA from peripheral blood mononuclear cells (PBMC was isolated from both patients with PSC and age and sex matched healthy controls. Samples from 5 PSC patients and 5 controls were analyzed by microarray and based upon rigorous statistical analysis of the data, relevant genes were chosen for confirmation by RT-PCR in 10 PSC patients and 10 controls. Using unsupervised hierarchical clustering, gene expression in PSC was statistically different from our control population. Interestingly, genes within the IL-2 receptor beta, IL-6 and MAP Kinase pathways were found to be differently expressed in patients with PSC compared to controls. Further, individual genes, TNF-α induced protein 6 (TNFaip6 and membrane-spanning 4-domains, subfamily A (ms4a were found to be upregulated in PSC while similar to Mothers against decapentaplegic homolog 5 (SMAD 5 was downregulated. In conclusion, several immune-related pathways and genes were differentially expressed in PSC compared to control patients, giving further evidence that this disease is systemic and immune-mediated.

  14. DMPD: Signalling pathways mediating type I interferon gene expression. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17904888 Signalling pathways mediating type I interferon gene expression. Edwards M...hways mediating type I interferon gene expression. PubmedID 17904888 Title Signalling pathways...R, Slater L, Johnston SL. Microbes Infect. 2007 Sep;9(11):1245-51. Epub 2007 Jul 1. (.png) (.svg) (.html) (.csml) Show Signalling pat

  15. Additional sex combs-like 1 belongs to the enhancer of trithorax and Polycomb Group and genetically interacts with Cbx2 in mice

    Science.gov (United States)

    Fisher, C.L.; Lee, I.; Bloyer, S.; Bozza, S.; Chevalier, J.; Dahl, A; Bodner, C.; Helgason, C. D.; Hess, J.L.; Humphries, R.K.; Brock, H.W.

    2009-01-01

    The Additional sex combs (Asx) gene of Drosophila behaves genetically as an enhancer of trithorax and Polycomb (ETP) in displaying bidirectional homeotic phenotypes, suggesting that is required for maintenance of both activation and silencing of Hox genes. There are 3 murine homologs of Asx called Additional sex combs-like1, 2, and-3. Asxl1 is required for normal adult hematopoiesis; however its embryonic function is unknown. We used a targeted mouse mutant line Asxl1tm1Bc to determine if Asxl1 is required to silence and activate Hox genes in mice during axial patterning. The mutant embryos exhibit simultaneous anterior and posterior transformations of the axial skeleton, consistent with a role for Asxl1 in activation and silencing of Hox genes. Transformations of the axial skeleton are enhanced in compound mutant embryos for the Polycomb group gene M33/Cbx2. Hox a4, a7, and c8 are derepressed in Asxl1tm1Bc mutants in the antero-posterior axis, but Hox c8 expression is reduced in the brain of mutants, consistent with Asxl1 being required both for activation and repression of Hox genes. We discuss the genetic and molecular definition of ETPs, and suggest that the function of Asxl1 depends on its cellular context. PMID:19833123

  16. The Mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways.

    Science.gov (United States)

    Wathugala, Deepthi L; Hemsley, Piers A; Moffat, Caroline S; Cremelie, Pieter; Knight, Marc R; Knight, Heather

    2012-07-01

    • Arabidopsis SENSITIVE TO FREEZING6 (SFR6) controls cold- and drought-inducible gene expression and freezing- and osmotic-stress tolerance. Its identification as a component of the MEDIATOR transcriptional co-activator complex led us to address its involvement in other transcriptional responses. • Gene expression responses to Pseudomonas syringae, ultraviolet-C (UV-C) irradiation, salicylic acid (SA) and jasmonic acid (JA) were investigated in three sfr6 mutant alleles by quantitative real-time PCR and susceptibility to UV-C irradiation and Pseudomonas infection were assessed. • sfr6 mutants were more susceptible to both Pseudomonas syringae infection and UV-C irradiation. They exhibited correspondingly weaker PR (pathogenesis-related) gene expression than wild-type Arabidopsis following these treatments or after direct application of SA, involved in response to both UV-C and Pseudomonas infection. Other genes, however, were induced normally in the mutants by these treatments. sfr6 mutants were severely defective in expression of plant defensin genes in response to JA; ectopic expression of defensin genes was provoked in wild-type but not sfr6 by overexpression of ERF5. • SFR6/MED16 controls both SA- and JA-mediated defence gene expression and is necessary for tolerance of Pseudomonas syringae infection and UV-C irradiation. It is not, however, a universal regulator of stress gene transcription and is likely to mediate transcriptional activation of specific regulons only. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

  17. Roles of Prolyl Isomerases in RNA-Mediated Gene Expression

    Directory of Open Access Journals (Sweden)

    Roopa Thapar

    2015-05-01

    Full Text Available The peptidyl-prolyl cis-trans isomerases (PPIases that include immunophilins (cyclophilins and FKBPs and parvulins (Pin1, Par14, Par17 participate in cell signaling, transcription, pre-mRNA processing and mRNA decay. The human genome encodes 19 cyclophilins, 18 FKBPs and three parvulins. Immunophilins are receptors for the immunosuppressive drugs cyclosporin A, FK506, and rapamycin that are used in organ transplantation. Pin1 has also been targeted in the treatment of Alzheimer’s disease, asthma, and a number of cancers. While these PPIases are characterized as molecular chaperones, they also act in a nonchaperone manner to promote protein-protein interactions using surfaces outside their active sites. The immunosuppressive drugs act by a gain-of-function mechanism by promoting protein-protein interactions in vivo. Several immunophilins have been identified as components of the spliceosome and are essential for alternative splicing. Pin1 plays roles in transcription and RNA processing by catalyzing conformational changes in the RNA Pol II C-terminal domain. Pin1 also binds several RNA binding proteins such as AUF1, KSRP, HuR, and SLBP that regulate mRNA decay by remodeling mRNP complexes. The functions of ribonucleoprotein associated PPIases are largely unknown. This review highlights PPIases that play roles in RNA-mediated gene expression, providing insight into their structures, functions and mechanisms of action in mRNP remodeling in vivo.

  18. Gene structure and expression characteristic of a novel odorant receptor gene cluster in the parasitoid wasp Microplitis mediator (Hymenoptera: Braconidae).

    Science.gov (United States)

    Wang, S-N; Shan, S; Zheng, Y; Peng, Y; Lu, Z-Y; Yang, Y-Q; Li, R-J; Zhang, Y-J; Guo, Y-Y

    2017-08-01

    Odorant receptors (ORs) expressed in the antennae of parasitoid wasps are responsible for detection of various lipophilic airborne molecules. In the present study, 107 novel OR genes were identified from Microplitis mediator antennal transcriptome data. Phylogenetic analysis of the set of OR genes from M. mediator and Microplitis demolitor revealed that M. mediator OR (MmedOR) genes can be classified into different subfamilies, and the majority of MmedORs in each subfamily shared high sequence identities and clear orthologous relationships to M. demolitor ORs. Within a subfamily, six MmedOR genes, MmedOR98, 124, 125, 126, 131 and 155, shared a similar gene structure and were tightly linked in the genome. To evaluate whether the clustered MmedOR genes share common regulatory features, the transcription profile and expression characteristics of the six closely related OR genes were investigated in M. mediator. Rapid amplification of cDNA ends-PCR experiments revealed that the OR genes within the cluster were transcribed as single mRNAs, and a bicistronic mRNA for two adjacent genes (MmedOR124 and MmedOR98) was also detected in female antennae by reverse transcription PCR. In situ hybridization experiments indicated that each OR gene within the cluster was expressed in a different number of cells. Moreover, there was no co-expression of the two highly related OR genes, MmedOR124 and MmedOR98, which appeared to be individually expressed in a distinct population of neurons. Overall, there were distinct expression profiles of closely related MmedOR genes from the same cluster in M. mediator. These data provide a basic understanding of the olfactory coding in parasitoid wasps. © 2017 The Royal Entomological Society.

  19. The Mediator Complex MED15 Subunit Mediates Activation of Downstream Lipid-Related Genes by the WRINKLED1 Transcription Factor.

    Science.gov (United States)

    Kim, Mi Jung; Jang, In-Cheol; Chua, Nam-Hai

    2016-07-01

    The Mediator complex is known to be a master coordinator of transcription by RNA polymerase II, and this complex is recruited by transcription factors (TFs) to target promoters for gene activation or repression. The plant-specific TF WRINKLED1 (WRI1) activates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. However, no Mediator subunit has yet been identified that mediates WRI1 transcriptional activity. Promoter-β-glucuronidase fusion experiments showed that MEDIATOR15 (MED15) is expressed in the same cells in the embryo as WRI1. We found that the Arabidopsis (Arabidopsis thaliana) MED15 subunit of the Mediator complex interacts directly with WRI1 in the nucleus. Overexpression of MED15 or WRI1 increased transcript levels of WRI1 target genes involved in glycolysis and fatty acid biosynthesis; these genes were down-regulated in wild-type or WRI1-overexpressing plants by silencing of MED15 However, overexpression of MED15 in the wri1 mutant also increased transcript levels of WRI1 target genes, suggesting that MED15 also may act with other TFs to activate downstream lipid-related genes. Chromatin immunoprecipitation assays confirmed the association of MED15 with six WRI1 target gene promoters. Additionally, silencing of MED15 resulted in reduced fatty acid content in seedlings and mature seeds, whereas MED15 overexpression increased fatty acid content in both developmental stages. Similar results were found in wri1 mutant and WRI1 overexpression lines. Together, our results indicate that the WRI1/MED15 complex transcriptionally regulates glycolysis-related and fatty acid biosynthetic genes during embryogenesis. © 2016 American Society of Plant Biologists. All Rights Reserved.

  20. Epigenetic regulation of HIV-1 latency: focus on polycomb group (PcG) proteins.

    Science.gov (United States)

    Khan, Sheraz; Iqbal, Mazhar; Tariq, Muhammad; Baig, Shahid M; Abbas, Wasim

    2018-01-01

    HIV-1 latency allows the virus to persist until reactivation, in a transcriptionally silent form in its cellular reservoirs despite the presence of effective cART. Such viral persistence represents a major barrier to HIV eradication since treatment interruption leads to rebound plasma viremia. Polycomb group (PcG) proteins have recently got a considerable attention in regulating HIV-1 post-integration latency as they are involved in the repression of proviral gene expression through the methylation of histones. This epigenetic regulation plays an important role in the establishment and maintenance of HIV-1 latency. In fact, PcG proteins act in complexes and modulate the epigenetic signatures of integrated HIV-1 promoter. Key role played by PcG proteins in the molecular control of HIV-1 latency has led to hypothesize that PcG proteins may represent a valuable target for future HIV-1 therapy in purging HIV-1 reservoirs. In this regard, various small molecules have been synthesized or explored to specifically block the epigenetic activity of PcG. In this review, we will highlight the possible therapeutic approaches to achieve either a functional or sterilizing cure of HIV-1 infection with special focus on histone methylation by PcG proteins together with current and novel pharmacological approaches to reactivate HIV-1 from latency that could ultimately lead towards a better clearance of viral latent reservoirs.

  1. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma.

    Science.gov (United States)

    Tagde, Ashujit; Markert, Tahireh; Rajabi, Hasan; Hiraki, Masayuki; Alam, Maroof; Bouillez, Audrey; Avigan, David; Anderson, Kenneth; Kufe, Donald

    2017-09-19

    The polycomb repressive complex 1 (PRC1) includes the BMI1, RING1 and RING2 proteins. BMI1 is required for survival of multiple myeloma (MM) cells. The MUC1-C oncoprotein is aberrantly expressed by MM cells, activates MYC and is also necessary for MM cell survival. The present studies show that targeting MUC1-C with (i) stable and inducible silencing and CRISPR/Cas9 editing and (ii) the pharmacologic inhibitor GO-203, which blocks MUC1-C function, downregulates BMI1, RING1 and RING2 expression. The results demonstrate that MUC1-C drives BMI1 transcription by a MYC-dependent mechanism. MUC1-C thus promotes MYC occupancy on the BMI1 promoter and thereby activates BMI1 expression. We also show that the MUC1-C→MYC pathway induces RING2 expression. Moreover, in contrast to BMI1 and RING2, we found that MUC1-C drives RING1 by an NF-κB p65-dependent mechanism. Targeting MUC1-C and thereby the suppression of these key PRC1 proteins was associated with downregulation of the PRC1 E3 ligase activity as evidenced by decreases in ubiquitylation of histone H2A. Targeting MUC1-C also resulted in activation of the PRC1-repressed tumor suppressor genes, PTEN, CDNK2A and BIM . These findings identify a heretofore unrecognized role for MUC1-C in the epigenetic regulation of MM cells.

  2. Host-Induced Gene Silencing of Rice Blast Fungus Magnaporthe oryzae Pathogenicity Genes Mediated by the Brome Mosaic Virus.

    Science.gov (United States)

    Zhu, Lin; Zhu, Jian; Liu, Zhixue; Wang, Zhengyi; Zhou, Cheng; Wang, Hong

    2017-09-26

    Magnaporthe oryzae is a devastating plant pathogen, which has a detrimental impact on rice production worldwide. Despite its agronomical importance, some newly-emerging pathotypes often overcome race-specific disease resistance rapidly. It is thus desirable to develop a novel strategy for the long-lasting resistance of rice plants to ever-changing fungal pathogens. Brome mosaic virus (BMV)-induced RNA interference (RNAi) has emerged as a useful tool to study host-resistance genes for rice blast protection. Planta-generated silencing of targeted genes inside biotrophic pathogens can be achieved by expression of M. oryzae -derived gene fragments in the BMV-mediated gene silencing system, a technique termed host-induced gene silencing (HIGS). In this study, the effectiveness of BMV-mediated HIGS in M. oryzae was examined by targeting three predicted pathogenicity genes, MoABC1, MoMAC1 and MoPMK1 . Systemic generation of fungal gene-specific small interfering RNA (siRNA) molecules induced by inoculation of BMV viral vectors inhibited disease development and reduced the transcription of targeted fungal genes after subsequent M. oryzae inoculation. Combined introduction of fungal gene sequences in sense and antisense orientation mediated by the BMV silencing vectors significantly enhanced the efficiency of this host-generated trans-specific RNAi, implying that these fungal genes played crucial roles in pathogenicity. Collectively, our results indicated that BMV-HIGS system was a great strategy for protecting host plants against the invasion of pathogenic fungi.

  3. KDM2B recruitment of the Polycomb group complex, PRC1.1, requires cooperation between PCGF1 and BCORL1

    OpenAIRE

    Wong, Sarah J.; Gearhart, Micah D.; Taylor, Alexander B.; Nanyes, David R.; Ha, Daniel J.; Robinson, Angela K.; Artigas, Jason A.; Lee, Oliver J.; Demeler, Borries; Hart, P. John; Bardwell, Vivian J.; Kim, Chongwoo A.

    2016-01-01

    KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and the ...

  4. The Arabidopsis GAGA-Binding Factor BASIC PENTACYSTEINE6 Recruits the POLYCOMB-REPRESSIVE COMPLEX1 Component LIKE HETEROCHROMATIN PROTEIN1 to GAGA DNA Motifs.

    Science.gov (United States)

    Hecker, Andreas; Brand, Luise H; Peter, Sébastien; Simoncello, Nathalie; Kilian, Joachim; Harter, Klaus; Gaudin, Valérie; Wanke, Dierk

    2015-07-01

    Polycomb-repressive complexes (PRCs) play key roles in development by repressing a large number of genes involved in various functions. Much, however, remains to be discovered about PRC-silencing mechanisms as well as their targeting to specific genomic regions. Besides other mechanisms, GAGA-binding factors in animals can guide PRC members in a sequence-specific manner to Polycomb-responsive DNA elements. Here, we show that the Arabidopsis (Arabidopsis thaliana) GAGA-motif binding factor protein basic pentacysteine6 (BPC6) interacts with like heterochromatin protein1 (LHP1), a PRC1 component, and associates with vernalization2 (VRN2), a PRC2 component, in vivo. By using a modified DNA-protein interaction enzyme-linked immunosorbant assay, we could show that BPC6 was required and sufficient to recruit LHP1 to GAGA motif-containing DNA probes in vitro. We also found that LHP1 interacts with VRN2 and, therefore, can function as a possible scaffold between BPC6 and VRN2. The lhp1-4 bpc4 bpc6 triple mutant displayed a pleiotropic phenotype, extreme dwarfism and early flowering, which disclosed synergistic functions of LHP1 and group II plant BPC members. Transcriptome analyses supported this synergy and suggested a possible function in the concerted repression of homeotic genes, probably through histone H3 lysine-27 trimethylation. Hence, our findings suggest striking similarities between animal and plant GAGA-binding factors in the recruitment of PRC1 and PRC2 components to Polycomb-responsive DNA element-like GAGA motifs, which must have evolved through convergent evolution. © 2015 American Society of Plant Biologists. All Rights Reserved.

  5. Homologous gene targeting of a carotenoids biosynthetic gene in Rhodosporidium toruloides by Agrobacterium-mediated transformation.

    Science.gov (United States)

    Sun, Wenyi; Yang, Xiaobing; Wang, Xueying; Lin, Xinping; Wang, Yanan; Zhang, Sufang; Luan, Yushi; Zhao, Zongbao K

    2017-07-01

    To target a carotenoid biosynthetic gene in the oleaginous yeast Rhodosporidium toruloides by using the Agrobacterium-mediated transformation (AMT) method. The RHTO_04602 locus of R. toruloides NP11, previously assigned to code the carotenoid biosynthetic gene CRTI, was amplified from genomic DNA and cloned into the binary plasmid pZPK-mcs, resulting in pZPK-CRT. A HYG-expression cassette was inserted into the CRTI sequence of pZPK-CRT by utilizing the restriction-free clone strategy. The resulted plasmid was used to transform R. toruloides cells according to the AMT method, leading to a few white transformants. Sequencing analysis of those transformants confirmed homologous recombination and insertional inactivation of CRTI. When the white variants were transformed with a CRTI-expression cassette, cells became red and produced carotenoids as did the wild-type strain NP11. Successful homologous targeting of the CrtI locus confirmed the function of RHTO_04602 in carotenoids biosynthesis in R. toruloides. It provided valuable information for metabolic engineering of this non-model yeast species.

  6. Diversification of the Primary Antibody Repertoire by AID-Mediated Gene Conversion.

    Science.gov (United States)

    Lanning, Dennis K; Knight, Katherine L

    2015-01-01

    Gene conversion, mediated by activation-induced cytidine deaminase (AID), has been found to contribute to generation of the primary antibody repertoire in several vertebrate species. Generation of the primary antibody repertoire by gene conversion of immunoglobulin (Ig) genes occurs primarily in gut-associated lymphoid tissues (GALT) and is best described in chicken and rabbit. Here, we discuss current knowledge of the mechanism of gene conversion as well as the contribution of the microbiota in promoting gene conversion of Ig genes. Finally, we propose that the antibody diversification strategy used in GALT species, such as chicken and rabbit, is conserved in a subset of human and mouse B cells.

  7. Polycomb Protein OsFIE2 Affects Plant Height and Grain Yield in Rice.

    Directory of Open Access Journals (Sweden)

    Xianbo Liu

    Full Text Available Polycomb group (PcG proteins have been shown to affect growth and development in plants. To further elucidate their role in these processes in rice, we isolated and characterized a rice mutant which exhibits dwarfism, reduced seed setting rate, defective floral organ, and small grains. Map-based cloning revealed that abnormal phenotypes were attributed to a mutation of the Fertilization Independent Endosperm 2 (OsFIE2 protein, which belongs to the PcG protein family. So we named the mutant as osfie2-1. Histological analysis revealed that the number of longitudinal cells in the internodes decreased in osfie2-1, and that lateral cell layer of the internodes was markedly thinner than wild-type. In addition, compared to wild-type, the number of large and small vascular bundles decreased in osfie2-1, as well as cell number and cell size in spikelet hulls. OsFIE2 is expressed in most tissues and the coded protein localizes in both nucleus and cytoplasm. Yeast two-hybrid and bimolecular fluorescence complementation assays demonstrated that OsFIE2 interacts with OsiEZ1 which encodes an enhancer of zeste protein previously identified as a histone methylation enzyme. RNA sequencing-based transcriptome profiling and qRT-PCR analysis revealed that some homeotic genes and genes involved in endosperm starch synthesis, cell division/expansion and hormone synthesis and signaling are differentially expressed between osfie2-1 and wild-type. In addition, the contents of IAA, GA3, ABA, JA and SA in osfie2-1 are significantly different from those in wild-type. Taken together, these results indicate that OsFIE2 plays an important role in the regulation of plant height and grain yield in rice.

  8. Field distribution and DNA transport in solid tumors during electric field-mediated gene delivery.

    Science.gov (United States)

    Henshaw, Joshua W; Yuan, Fan

    2008-02-01

    Gene therapy has a great potential in cancer treatment. However, the efficacy of cancer gene therapy is currently limited by the lack of a safe and efficient means to deliver therapeutic genes into the nucleus of tumor cells. One method under investigation for improving local gene delivery is based on the use of pulsed electric field. Despite repeated demonstration of its effectiveness in vivo, the underlying mechanisms behind electric field-mediated gene delivery remain largely unknown. Without a thorough understanding of these mechanisms, it will be difficult to further advance the gene delivery. In this review, the electric field-mediated gene delivery in solid tumors will be examined by following individual transport processes that must occur in vivo for a successful gene transfer. The topics of examination include: (i) major barriers for gene delivery in the body, (ii) distribution of electric fields at both cell and tissue levels during the application of external fields, and (iii) electric field-induced transport of genes across each of the barriers. Through this approach, the review summarizes what is known about the mechanisms behind electric field-mediated gene delivery and what require further investigations in future studies.

  9. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    Science.gov (United States)

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights

  10. Negative regulation of RIG-I-mediated antiviral signaling by TRK-fused gene (TFG) protein

    International Nuclear Information System (INIS)

    Lee, Na-Rae; Shin, Han-Bo; Kim, Hye-In; Choi, Myung-Soo; Inn, Kyung-Soo

    2013-01-01

    Highlights: •TRK-fused gene product (TFG) interacts with TRIM25 upon viral infection. •TFG negatively regulates RIG-I mediated antiviral signaling. •TFG depletion leads to enhanced viral replication. •TFG act downstream of MAVS. -- Abstract: RIG-I (retinoic acid inducible gene I)-mediated antiviral signaling serves as the first line of defense against viral infection. Upon detection of viral RNA, RIG-I undergoes TRIM25 (tripartite motif protein 25)-mediated K63-linked ubiquitination, leading to type I interferon (IFN) production. In this study, we demonstrate that TRK-fused gene (TFG) protein, previously identified as a TRIM25-interacting protein, binds TRIM25 upon virus infection and negatively regulates RIG-I-mediated type-I IFN signaling. RIG-I-mediated IFN production and nuclear factor (NF)-κB signaling pathways were upregulated by the suppression of TFG expression. Furthermore, vesicular stomatitis virus (VSV) replication was significantly inhibited by small inhibitory hairpin RNA (shRNA)-mediated knockdown of TFG, supporting the suppressive role of TFG in RIG-I-mediated antiviral signaling. Interestingly, suppression of TFG expression increased not only RIG-I-mediated signaling but also MAVS (mitochondrial antiviral signaling protein)-induced signaling, suggesting that TFG plays a pivotal role in negative regulation of RNA-sensing, RIG-I-like receptor (RLR) family signaling pathways

  11. Efficient Oligo nucleotide mediated CRISPR-Cas9 Gene Editing in Aspergilli

    DEFF Research Database (Denmark)

    Nødvig, Christina Spuur; Hoof, Jakob Blæsbjerg; Kogle, Martin Engelhard

    2018-01-01

    CRISPR-Cas9 technologies are revolutionizing fungal gene editing. Here we show that survival of specific Cas9/sgRNA mediated DNA double strand breaks (DSBs) depends on the non-homologous end-joining, NHEJ, DNA repair pathway and we use this observation to develop a tool to assess protospacer....... niger, and in A. oryzae indicating that this type of repair may be wide spread in filamentous fungi. Importantly, we demonstrate that by using single-stranded oligo nucleotides for CRISPR-Cas9 mediated gene editing it is possible to introduce specific point mutations as well gene deletions...

  12. Polycomb domain formation depends on short and long distance regulatory cues.

    Directory of Open Access Journals (Sweden)

    Bernd Schuettengruber

    Full Text Available BACKGROUND: Polycomb group (PcG proteins dynamically define cellular identities through the epigenetic repression of key developmental genes. In Drosophila, cis-regulatory regions termed PcG response elements (PREs act as nucleation sites for PcG proteins to create large repressive PcG domains that are marked by trimethylation of lysine 27 on histone H3 (H3K27me3. In addition to an action in cis, PREs can interact over long distances, thereby enhancing PcG dependent silencing. How PcG domains are established, which factors limit their propagation in cis, and how long range interactions of PREs in trans affect the chromatin structure is largely unknown. PRINCIPAL FINDINGS: We demonstrate that the insertion of a PRE-containing transgene in the Drosophila genome generates an artificial PcG domain and we analyze its organization by quantitative ChIP and ChIP-on-chip experiments. Intriguingly, a boundary element and known insulator proteins do not necessarily interfere with spreading of H3K27me3. Instead, domain borders correlate with the presence of promoter regions bound by RNA Polymerase II and active chromatin marks. In contrast, genes that are silent during early fly development get included within the PcG domain and this incorporation interferes with gene activation at later developmental stages. Moreover, trans-interaction of the transgenic PRE with its homologous endogenous PRE results in increased PcG binding, correlating with reinforced silencing of genes within the domain borders. CONCLUSIONS: Our results suggest that higher-order organization of PcG-bound chromatin can stabilize gene silencing within PcG domains. Further we propose that multi-protein complexes associated with active promoters are able to define the limits of PcG domains. Future work aimed to pinpoint the factors providing this barrier function will be required to understand the precise molecular mechanism by which active promoter regions can act as boundaries to stop

  13. Environmental factors influencing gene transfer agent (GTA mediated transduction in the subtropical ocean.

    Directory of Open Access Journals (Sweden)

    Lauren D McDaniel

    Full Text Available Microbial genomic sequence analyses have indicated widespread horizontal gene transfer (HGT. However, an adequate mechanism accounting for the ubiquity of HGT has been lacking. Recently, high frequencies of interspecific gene transfer have been documented, catalyzed by Gene Transfer Agents (GTAs of marine α-Proteobacteria. It has been proposed that the presence of bacterial genes in highly purified viral metagenomes may be due to GTAs. However, factors influencing GTA-mediated gene transfer in the environment have not yet been determined. Several genomically sequenced strains containing complete GTA sequences similar to Rhodobacter capsulatus (RcGTA, type strain were screened to ascertain if they produced putative GTAs, and at what abundance. Five of nine marine strains screened to date spontaneously produced virus-like particles (VLP's in stationary phase. Three of these strains have demonstrated gene transfer activity, two of which were documented by this lab. These two strains Roseovarius nubinhibens ISM and Nitratireductor 44B9s, were utilized to produce GTAs designated RnGTA and NrGTA and gene transfer activity was verified in culture. Cell-free preparations of purified RnGTA and NrGTA particles from marked donor strains were incubated with natural microbial assemblages to determine the level of GTA-mediated gene transfer. In conjunction, several ambient environmental parameters were measured including lysogeny indicated by prophage induction. GTA production in culture systems indicated that approximately half of the strains produced GTA-like particles and maximal GTA counts ranged from 10-30% of host abundance. Modeling of GTA-mediated gene transfer frequencies in natural samples, along with other measured environmental variables, indicated a strong relationship between GTA mediated gene transfer and the combined factors of salinity, multiplicity of infection (MOI and ambient bacterial abundance. These results indicate that GTA-mediated

  14. Membrane fusion inducers, chloroquine and spermidine increase lipoplex-mediated gene transfection

    International Nuclear Information System (INIS)

    Wong-Baeza, Carlos; Bustos, Israel; Serna, Manuel; Tescucano, Alonso; Alcantara-Farfan, Veronica; Ibanez, Miguel; Montanez, Cecilia; Wong, Carlos; Baeza, Isabel

    2010-01-01

    Gene transfection into mammalian cells can be achieved with viral and non-viral vectors. Non-viral vectors, such as cationic lipids that form lipoplexes with DNA, are safer and more stable than viral vectors, but their transfection efficiencies are lower. Here we describe that the simultaneous treatment with a membrane fusion inducer (chlorpromazine or procainamide) plus the lysosomotropic agent chloroquine increases lipoplex-mediated gene transfection in human (HEK293 and C-33 A) and rat (PC12) cell lines (up to 9.2-fold), as well as in situ in BALB/c mice spleens and livers (up to 6-fold); and that the polyamine spermidine increases lipoplex-mediated gene transfection and expression in cell cultures. The use of these four drugs provides a novel, safe and relatively inexpensive way to considerably increase lipoplex-mediated gene transfection efficiency.

  15. AAV Vectorization of DSB-mediated Gene Editing Technologies.

    Science.gov (United States)

    Moser, Rachel J; Hirsch, Matthew L

    2016-01-01

    Recent work both at the bench and the bedside demonstrate zinc-finger nucleases (ZFNs), CRISPR/Cas9, and other programmable site-specific endonuclease technologies are being successfully utilized within and alongside AAV vectors to induce therapeutically relevant levels of directed gene editing within the human chromosome. Studies from past decades acknowledge that AAV vector genomes are enhanced substrates for homology-directed repair in the presence or absence of targeted DNA damage within the host genome. Additionally, AAV vectors are currently the most efficient format for in vivo gene delivery with no vector related complications in >100 clinical trials for diverse diseases. At the same time, advancements in the design of custom-engineered site-specific endonucleases and the utilization of elucidated endonuclease formats have resulted in efficient and facile genetic engineering for basic science and for clinical therapies. AAV vectors and gene editing technologies are an obvious marriage, using AAV for the delivery of repair substrate and/or a gene encoding a designer endonuclease; however, while efficient delivery and enhanced gene targeting by vector genomes are advantageous, other attributes of AAV vectors are less desirable for gene editing technologies. This review summarizes the various roles that AAV vectors play in gene editing technologies and provides insight into its trending applications for the treatment of genetic diseases.

  16. BRCA1-mediated repression of select X chromosome genes

    Directory of Open Access Journals (Sweden)

    Ropers H Hilger

    2004-09-01

    Full Text Available Abstract Recently BRCA1 has been implicated in the regulation of gene expression from the X chromosome. In this study the influence of BRCA1 on expression of X chromosome genes was investigated. Complementary DNA microarrays were used to compare the expression levels of X chromosome genes in 18 BRCA1-associated ovarian cancers to those of the 13 "BRCA1-like" and 14 "BRCA2-like" sporadic tumors (as defined by previously reported expression profiling. Significance was determined using parametric statistics with P

  17. Plasmid-Mediated Quinolone Resistance Genes in Escherichia coli ...

    African Journals Online (AJOL)

    Erah

    PMQR) genes and the prevalence of extended spectrum β-lactamase (ESBL) types in Escherichia coli clinical isolates. Methods: Sixty-one ESBL-producing urinary E. coli isolates were studied. An antibiotic susceptibility test was performed ...

  18. Nymphal RNAi: systemic RNAi mediated gene knockdown in juvenile grasshopper

    Directory of Open Access Journals (Sweden)

    Dong Ying

    2005-10-01

    Full Text Available Abstract Background Grasshopper serves as important model system in neuroscience, development and evolution. Representatives of this primitive insect group are also highly relevant targets of pest control efforts. Unfortunately, the lack of genetics or gene specific molecular manipulation imposes major limitations to the study of grasshopper biology. Results We investigated whether juvenile instars of the grasshopper species Schistocerca americana are conducive to gene silencing via the systemic RNAi pathway. Injection of dsRNA corresponding to the eye colour gene vermilion into first instar nymphs triggered suppression of ommochrome formation in the eye lasting through two instars equivalent to 10–14 days in absolute time. QRT-PCR analysis revealed a two fold decrease of target transcript levels in affected animals. Control injections of EGFP dsRNA did not result in detectable phenotypic changes. RT-PCR and in situ hybridization detected ubiquitous expression of the grasshopper homolog of the dsRNA channel protein gene sid-1 in embryos, nymphs and adults. Conclusion Our results demonstrate that systemic dsRNA application elicits specific and long-term gene silencing in juvenile grasshopper instars. The conservation of systemic RNAi in the grasshopper suggests that this pathway can be exploited for gene specific manipulation of juvenile and adult instars in a wide range of primitive insects.

  19. Phasevarions mediate random switching of gene expression in pathogenic Neisseria.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    2009-04-01

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae, the random switching of the modA gene controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable mod genes are also present in Neisseria meningitidis and Neisseria gonorrhoeae, suggesting that phasevarions may occur in these important human pathogens. Phylogenetic studies on phase-variable mod genes associated with type III restriction modification (R-M systems revealed that these organisms have two distinct mod genes--modA and modB. There are also distinct alleles of modA (abundant: modA11, 12, 13; minor: modA4, 15, 18 and modB (modB1, 2. These alleles differ only in their DNA recognition domain. ModA11 was only found in N. meningitidis and modA13 only in N. gonorrhoeae. The recognition site for the modA13 methyltransferase in N. gonorrhoeae strain FA1090 was identified as 5'-AGAAA-3'. Mutant strains lacking the modA11, 12 or 13 genes were made in N. meningitidis and N. gonorrhoeae and their phenotype analyzed in comparison to a corresponding mod ON wild-type strain. Microarray analysis revealed that in all three modA alleles multiple genes were either upregulated or downregulated, some of which were virulence-associated. For example, in N. meningitidis MC58 (modA11, differentially expressed genes included those encoding the candidate vaccine antigens lactoferrin binding proteins A and B. Functional studies using N. gonorrhoeae FA1090 and the clinical isolate O1G1370 confirmed that modA13 ON and OFF strains have distinct phenotypes in antimicrobial resistance, in a primary human cervical epithelial cell model of infection, and in biofilm formation. This study, in conjunction with our previous work in H. influenzae, indicates

  20. Phasevarions mediate random switching of gene expression in pathogenic Neisseria.

    Science.gov (United States)

    Srikhanta, Yogitha N; Dowideit, Stefanie J; Edwards, Jennifer L; Falsetta, Megan L; Wu, Hsing-Ju; Harrison, Odile B; Fox, Kate L; Seib, Kate L; Maguire, Tina L; Wang, Andrew H-J; Maiden, Martin C; Grimmond, Sean M; Apicella, Michael A; Jennings, Michael P

    2009-04-01

    Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes) that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression). In Haemophilus influenzae, the random switching of the modA gene controls expression of a phase-variable regulon of genes (a "phasevarion"), via differential methylation of the genome in the modA ON and OFF states. Phase-variable mod genes are also present in Neisseria meningitidis and Neisseria gonorrhoeae, suggesting that phasevarions may occur in these important human pathogens. Phylogenetic studies on phase-variable mod genes associated with type III restriction modification (R-M) systems revealed that these organisms have two distinct mod genes--modA and modB. There are also distinct alleles of modA (abundant: modA11, 12, 13; minor: modA4, 15, 18) and modB (modB1, 2). These alleles differ only in their DNA recognition domain. ModA11 was only found in N. meningitidis and modA13 only in N. gonorrhoeae. The recognition site for the modA13 methyltransferase in N. gonorrhoeae strain FA1090 was identified as 5'-AGAAA-3'. Mutant strains lacking the modA11, 12 or 13 genes were made in N. meningitidis and N. gonorrhoeae and their phenotype analyzed in comparison to a corresponding mod ON wild-type strain. Microarray analysis revealed that in all three modA alleles multiple genes were either upregulated or downregulated, some of which were virulence-associated. For example, in N. meningitidis MC58 (modA11), differentially expressed genes included those encoding the candidate vaccine antigens lactoferrin binding proteins A and B. Functional studies using N. gonorrhoeae FA1090 and the clinical isolate O1G1370 confirmed that modA13 ON and OFF strains have distinct phenotypes in antimicrobial resistance, in a primary human cervical epithelial cell model of infection, and in biofilm formation. This study, in conjunction with our previous work in H. influenzae, indicates that

  1. Phasevarion mediated epigenetic gene regulation in Helicobacter pylori.

    Directory of Open Access Journals (Sweden)

    Yogitha N Srikhanta

    Full Text Available Many host-adapted bacterial pathogens contain DNA methyltransferases (mod genes that are subject to phase-variable expression (high-frequency reversible ON/OFF switching of gene expression. In Haemophilus influenzae and pathogenic Neisseria, the random switching of the modA gene, associated with a phase-variable type III restriction modification (R-M system, controls expression of a phase-variable regulon of genes (a "phasevarion", via differential methylation of the genome in the modA ON and OFF states. Phase-variable type III R-M systems are also found in Helicobacter pylori, suggesting that phasevarions may also exist in this key human pathogen. Phylogenetic studies on the phase-variable type III modH gene revealed that there are 17 distinct alleles in H. pylori, which differ only in their DNA recognition domain. One of the most commonly found alleles was modH5 (16% of isolates. Microarray analysis comparing the wild-type P12modH5 ON strain to a P12ΔmodH5 mutant revealed that six genes were either up- or down-regulated, and some were virulence-associated. These included flaA, which encodes a flagella protein important in motility and hopG, an outer membrane protein essential for colonization and associated with gastric cancer. This study provides the first evidence of this epigenetic mechanism of gene expression in H. pylori. Characterisation of H. pylori modH phasevarions to define stable immunological targets will be essential for vaccine development and may also contribute to understanding H. pylori pathogenesis.

  2. Polycomb proteins control proliferation and transformation independently of cell cycle checkpoints by regulating DNA replication

    DEFF Research Database (Denmark)

    Piunti, Andrea; Rossi, Alessandra; Cerutti, Aurora

    2014-01-01

    The ability of PRC1 and PRC2 to promote proliferation is a main feature that links polycomb (PcG) activity to cancer. PcGs silence the expression of the tumour suppressor locus Ink4a/Arf, whose products positively regulate pRb and p53 functions. Enhanced PcG activity is a frequent feature of human...

  3. Follistatin allows efficient retroviral-mediated gene transfer into rat liver

    International Nuclear Information System (INIS)

    Borgnon, Josephine; Djamouri, Fatima; Lorand, Isabelle; Rico, Virginie Di; Loux, Nathalie; Pages, Jean-Christophe; Franco, Dominique; Capron, Frederique; Weber, Anne

    2005-01-01

    Retroviral vectors are widely used tools for gene therapy. However, in vivo gene transfer is only effective in dividing cells, which, in liver, requires a regenerative stimulus. Follistatin is effective in promoting liver regeneration after 90% and 70% hepatectomy in rats. We studied its efficacy on liver regeneration and retroviral-mediated gene delivery in 50% hepatectomized rats. When human recombinant follistatin was infused into the portal vein immediately after 50% hepatectomy, hepatocyte proliferation was significantly higher than in control 50% hepatectomized rats. A single injection of virus particles administered 23 h after follistatin infusion resulted in more than 20% gene transduction efficiency in hepatocytes compared to 3% in control rats. It is concluded that a single injection of follistatin induces onset of proliferation in 50% hepatectomized rats and allows efficient retroviral-mediated gene transfer to the liver

  4. Activity-regulated genes as mediators of neural circuit plasticity.

    Science.gov (United States)

    Leslie, Jennifer H; Nedivi, Elly

    2011-08-01

    Modifications of neuronal circuits allow the brain to adapt and change with experience. This plasticity manifests during development and throughout life, and can be remarkably long lasting. Evidence has linked activity-regulated gene expression to the long-term structural and electrophysiological adaptations that take place during developmental critical periods, learning and memory, and alterations to sensory map representations in the adult. In all these cases, the cellular response to neuronal activity integrates multiple tightly coordinated mechanisms to precisely orchestrate long-lasting, functional and structural changes in brain circuits. Experience-dependent plasticity is triggered when neuronal excitation activates cellular signaling pathways from the synapse to the nucleus that initiate new programs of gene expression. The protein products of activity-regulated genes then work via a diverse array of cellular mechanisms to modify neuronal functional properties. Synaptic strengthening or weakening can reweight existing circuit connections, while structural changes including synapse addition and elimination create new connections. Posttranscriptional regulatory mechanisms, often also dependent on activity, further modulate activity-regulated gene transcript and protein function. Thus, activity-regulated genes implement varied forms of structural and functional plasticity to fine-tune brain circuit wiring. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

    Science.gov (United States)

    Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

    2014-01-01

    The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

  6. Receptor-mediated gene delivery using chemically modified chitosan

    International Nuclear Information System (INIS)

    Kim, T H; Jiang, H L; Nah, J W; Cho, M H; Akaike, T; Cho, C S

    2007-01-01

    Chitosan has been investigated as a non-viral vector because it has several advantages such as biocompatibility, biodegradability and low toxicity with high cationic potential. However, the low specificity and low transfection efficiency of chitosan need to be solved prior to clinical application. In this paper, we focused on the galactose or mannose ligand modification of chitosan for enhancement of cell specificity and transfection efficiency via receptor-mediated endocytosis in vitro and in vivo

  7. Nanoparticle-mediated delivery of suicide genes in cancer therapy.

    Science.gov (United States)

    Vago, Riccardo; Collico, Veronica; Zuppone, Stefania; Prosperi, Davide; Colombo, Miriam

    2016-09-01

    Conventional chemotherapeutics have been employed in cancer treatment for decades due to their efficacy in killing the malignant cells, but the other side of the coin showed off-target effects, onset of drug resistance and recurrences. To overcome these limitations, different approaches have been investigated and suicide gene therapy has emerged as a promising alternative. This approach consists in the introduction of genetic materials into cancerous cells or the surrounding tissue to cause cell death or retard the growth of the tumor mass. Despite promising results obtained both in vitro and in vivo, this innovative approach has been limited, for long time, to the treatment of localized tumors, due to the suboptimal efficiency in introducing suicide genes into cancer cells. Nanoparticles represent a valuable non-viral delivery system to protect drugs in the bloodstream, to improve biodistribution, and to limit side effects by achieving target selectivity through surface ligands. In this scenario, the real potential of suicide genes can be translated into clinically viable treatments for patients. In the present review, we summarize the recent advances of inorganic nanoparticles as non-viral vectors in terms of therapeutic efficacy, targeting capacity and safety issues. We describe the main suicide genes currently used in therapy, with particular emphasis on toxin-encoding genes of bacterial and plant origin. In addition, we discuss the relevance of molecular targeting and tumor-restricted expression to improve treatment specificity to cancer tissue. Finally, we analyze the main clinical applications, limitations and future perspectives of suicide gene therapy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. miRNA-mediated functional changes through co-regulating function related genes.

    Directory of Open Access Journals (Sweden)

    Jie He

    Full Text Available BACKGROUND: MicroRNAs play important roles in various biological processes involving fairly complex mechanism. Analysis of genome-wide miRNA microarray demonstrate that a single miRNA can regulate hundreds of genes, but the regulative extent on most individual genes is surprisingly mild so that it is difficult to understand how a miRNA provokes detectable functional changes with such mild regulation. RESULTS: To explore the internal mechanism of miRNA-mediated regulation, we re-analyzed the data collected from genome-wide miRNA microarray with bioinformatics assay, and found that the transfection of miR-181b and miR-34a in Hela and HCT-116 tumor cells regulated large numbers of genes, among which, the genes related to cell growth and cell death demonstrated high Enrichment scores, suggesting that these miRNAs may be important in cell growth and cell death. MiR-181b induced changes in protein expression of most genes that were seemingly related to enhancing cell growth and decreasing cell death, while miR-34a mediated contrary changes of gene expression. Cell growth assays further confirmed this finding. In further study on miR-20b-mediated osteogenesis in hMSCs, miR-20b was found to enhance osteogenesis by activating BMPs/Runx2 signaling pathway in several stages by co-repressing of PPARγ, Bambi and Crim1. CONCLUSIONS: With its multi-target characteristics, miR-181b, miR-34a and miR-20b provoked detectable functional changes by co-regulating functionally-related gene groups or several genes in the same signaling pathway, and thus mild regulation from individual miRNA targeting genes could have contributed to an additive effect. This might also be one of the modes of miRNA-mediated gene regulation.

  9. MDM2 Associates with Polycomb Repressor Complex 2 and Enhances Stemness-Promoting Chromatin Modifications Independent of p53

    DEFF Research Database (Denmark)

    Wienken, Magdalena; Dickmanns, Antje; Nemajerova, Alice

    2016-01-01

    The MDM2 oncoprotein ubiquitinates and antagonizes p53 but may also carry out p53-independent functions. Here we report that MDM2 is required for the efficient generation of induced pluripotent stem cells (iPSCs) from murine embryonic fibroblasts, in the absence of p53. Similarly, MDM2 depletion...... in the context of p53 deficiency also promoted the differentiation of human mesenchymal stem cells and diminished clonogenic survival of cancer cells. Most of the MDM2-controlled genes also responded to the inactivation of the Polycomb Repressor Complex 2 (PRC2) and its catalytic component EZH2. MDM2 physically...... associated with EZH2 on chromatin, enhancing the trimethylation of histone 3 at lysine 27 and the ubiquitination of histone 2A at lysine 119 (H2AK119) at its target genes. Removing MDM2 simultaneously with the H2AK119 E3 ligase Ring1B/RNF2 further induced these genes and synthetically arrested cell...

  10. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    Energy Technology Data Exchange (ETDEWEB)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F [Department of Pharmaceutical Science, Zhujiang Hospital, Southern Medical University, Guangzhou 510282 (China); Yang, B, E-mail: andrewfxu1998@gmail.co [Department of Chemistry, Indiana University-Bloomington, Bloomington, IN 47405 (United States)

    2009-10-07

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  11. Agrobacterium mediated transformation of annexin gene in tobacco ...

    African Journals Online (AJOL)

    STORAGESEVER

    serves as a selectable marker system in plants and its amplification confirmed the presence of annexin ... annexin signaling to many different physiological pro- ..... Lane 7: pGPTV with annexin gene digested with EcoR1 and XbaI. Lane 8:.

  12. Electric pulse-mediated gene delivery to various animal tissues

    DEFF Research Database (Denmark)

    Mir, Lluis M; Moller, Pernille H; André, Franck

    2005-01-01

    therapy, termed electrogenetherapy (EGT as well). By transfecting cells with a long lifetime, such as muscle fibers, a very long-term expression of genes can be obtained. A great variety of tissues have been transfected successfully, from muscle as the most extensively used, to both soft (e.g., spleen...

  13. Functional gene silencing mediated by chitosan/siRNA nanocomplexes

    International Nuclear Information System (INIS)

    Ji, A M; Su, D; Che, O; Li, W S; Sun, L; Zhang, Z Y; Xu, F; Yang, B

    2009-01-01

    Chitosan/siRNA nanoparticles to knock down FHL2 gene expression were reported in this work. The physicochemical properties such as particle size, surface charge, morphology and complex stability of chitosan nanoparticle-incorporated siRNA were evaluated. Nanoparticles which were formulated with chitosan/siRNA exhibited irregular, lamellar and dendritic structures with a hydrodynamic radius size of about 148 nm and net positive charges with zeta-potential value of 58.5 mV. The knockdown effect of the chitosan/siRNA nanoparticles on gene expression in FHL2 over-expressed human colorectal cancer Lovo cells was investigated. The result showed that FHL2 siRNA formulated within chitosan nanoparticles could knock down about 69.6% FHL2 gene expression, which is very similar to the 68.8% reduced gene expression when siRNA was transfected with liposome Lipofectamine. Western analysis further showed significant FHL-2 protein expression reduced by the chitosan/siRNA nanoparticles. The results also showed that blocking FHL2 expression by siRNA could also inhibit the growth and proliferation of human colorectal cancer Lovo cells. The current results demonstrated that chitosan-based siRNA nanoparticles were a very efficient delivery system for siRNA in vivo as previously reported.

  14. Co-factors necessary for PPAR mediated transactivation of endogenous target genes

    DEFF Research Database (Denmark)

    Grøntved, Lars; Nielsen, Ronni; Stunnenberg, Henk

    of endogenous target gene in different cell types are elusive. To mutually compare the ability of the PPAR subtypes to activate endogenous target genes in a given cell, PPARa, PPARb/d and PPARg2 were HA tagged and rapidly, equally and synchronously expressed using adenoviral delivery. Within a few hours after...... subtype specific activation of target genes. Accumulating evidence suggests that transcriptional co-factors can function as master regulators for nuclear receptors and impose promoter selectivity. To study co-factor necessity for PPAR mediated transactivation of endogenous target genes, specific co...

  15. Control of flowering and cell fate by LIF2, an RNA binding partner of the polycomb complex component LHP1.

    Directory of Open Access Journals (Sweden)

    David Latrasse

    Full Text Available Polycomb Repressive Complexes (PRC modulate the epigenetic status of key cell fate and developmental regulators in eukaryotes. The chromo domain protein like heterochromatin protein1 (LHP1 is a subunit of a plant PRC1-like complex in Arabidopsis thaliana and recognizes histone H3 lysine 27 trimethylation, a silencing epigenetic mark deposited by the PRC2 complex. We have identified and studied an LHP1-Interacting Factor2 (LIF2. LIF2 protein has RNA recognition motifs and belongs to the large hnRNP protein family, which is involved in RNA processing. LIF2 interacts in vivo, in the cell nucleus, with the LHP1 chromo shadow domain. Expression of LIF2 was detected predominantly in vascular and meristematic tissues. Loss-of-function of LIF2 modifies flowering time, floral developmental homeostasis and gynoecium growth determination. lif2 ovaries have indeterminate growth and produce ectopic inflorescences with severely affected flowers showing proliferation of ectopic stigmatic papillae and ovules in short-day conditions. To look at how LIF2 acts relative to LHP1, we conducted transcriptome analyses in lif2 and lhp1 and identified a common set of deregulated genes, which showed significant enrichment in stress-response genes. By comparing expression of LHP1 targets in lif2, lhp1 and lif2 lhp1 mutants we showed that LIF2 can either antagonize or act with LHP1. Interestingly, repression of the FLC floral transcriptional regulator in lif2 mutant is accompanied by an increase in H3K27 trimethylation at the locus, without any change in LHP1 binding, suggesting that LHP1 is targeted independently from LIF2 and that LHP1 binding does not strictly correlate with gene expression. LIF2, involved in cell identity and cell fate decision, may modulate the activity of LHP1 at specific loci, during specific developmental windows or in response to environmental cues that control cell fate determination. These results highlight a novel link between plant RNA

  16. Plant–Agrobacterium interaction mediated by ethylene and super-Agrobacterium conferring efficient gene transfer

    OpenAIRE

    Nonaka, Satoko; Ezura, Hiroshi

    2014-01-01

    Agrobacterium tumefaciens has a unique ability to transfer genes into plant genomes. This ability has been utilized for plant genetic engineering. However, the efficiency is not sufficient for all plant species. Several studies have shown that ethylene decreased the Agrobacterium-mediated transformation frequency. Thus, A. tumefaciens with an ability to suppress ethylene evolution would increase the efficiency of Agrobacterium-mediated transformation. Some studies showed that plant growth-pro...

  17. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    Energy Technology Data Exchange (ETDEWEB)

    Guangyu, Zhu; Qin, Lu; Gaojun, Teng; Jinhe, Guo; Hui, Yu; Gang, Deng; Shicheng, He; Wen, Fang; Guozhao, Li; Xiaoying, Wei [Zhongda Hospital, Southeast Univ., Nanjing (China)

    2007-02-15

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  18. Experimental research on treating hepatic carcinoma by arterial injection of liposome mediated p53 genes

    International Nuclear Information System (INIS)

    Zhu Guangyu; Lu Qin; Teng Gaojun; Guo Jinhe; Yu Hui; Deng Gang; He Shicheng; Fang Wen; Li Guozhao; Wei Xiaoying

    2007-01-01

    Objective: To investigate the transfection and expression of p53 genes mediated by liposome and its feasibility in treatment of liver cancer by transcatheter arterial injection on rabbit VX2 hepatocarcinoma model. Methods: pCMV-myc-p53 plasmids, LipofectAMINE and p53-LipofectAMINE complex were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model, respectively, and then protein of cancer tissue was extracted, followed by measuring gene transfection and expression by western blot and immunohistochemistry, p53-LipofectAMlNE complex in different doses were infused into tumor's feeding artery of rabbit VX2 hepatocarcinoma model with the gene transfection and expression detected by the same way. Results: Liposome-mediated p53 gene injected through catheter could be successfully transfected and expressed in the cancer tissue of rabbit VX2 hepatocarcinoma model, with transfection efficiency higher than the gene delivery alone. The efficiency and the gene dose has dose-effect relationship. Conclusions: Treatment of liver cancer by transcatheter arterial injection of p53 genes mediated by liposome is a feasible and effective method, with wide prospect of application. (authors)

  19. Repressor-mediated tissue-specific gene expression in plants

    Science.gov (United States)

    Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA

    2009-02-17

    Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.

  20. Depletion of Mediator Kinase Module Subunits Represses Superenhancer-Associated Genes in Colon Cancer Cells.

    Science.gov (United States)

    Kuuluvainen, Emilia; Domènech-Moreno, Eva; Niemelä, Elina H; Mäkelä, Tomi P

    2018-06-01

    In cancer, oncogene activation is partly mediated by acquired superenhancers, which therefore represent potential targets for inhibition. Superenhancers are enriched for BRD4 and Mediator, and both BRD4 and the Mediator MED12 subunit are disproportionally required for expression of superenhancer-associated genes in stem cells. Here we show that depletion of Mediator kinase module subunit MED12 or MED13 together with MED13L can be used to reduce expression of cancer-acquired superenhancer genes, such as the MYC gene, in colon cancer cells, with a concomitant decrease in proliferation. Whereas depletion of MED12 or MED13/MED13L caused a disproportional decrease of superenhancer gene expression, this was not seen with depletion of the kinases cyclin-dependent kinase 9 (CDK8) and CDK19. MED12-MED13/MED13L-dependent superenhancer genes were coregulated by β-catenin, which has previously been shown to associate with MED12. Importantly, β-catenin depletion caused reduced binding of MED12 at the MYC superenhancer. The effect of MED12 or MED13/MED13L depletion on cancer-acquired superenhancer gene expression was more specific than and partially distinct from that of BRD4 depletion, with the most efficient inhibition seen with combined targeting. These results identify a requirement of MED12 and MED13/MED13L for expression of acquired superenhancer genes in colon cancer, implicating these Mediator subunits as potential therapeutic targets for colon cancer, alone or together with BRD4. Copyright © 2018 American Society for Microbiology.

  1. Thermodynamic control of small RNA-mediated gene silencing

    Directory of Open Access Journals (Sweden)

    Kumiko eUi-Tei

    2012-06-01

    Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.

  2. Identifying genes that mediate anthracyline toxicity in immune cells

    Directory of Open Access Journals (Sweden)

    Amber eFrick

    2015-04-01

    Full Text Available The role of the immune system in response to chemotherapeutic agents remains elusive. The interpatient variability observed in immune and chemotherapeutic cytotoxic responses is likely, at least in part, due to complex genetic differences. Through the use of a panel of genetically diverse mouse inbred strains, we developed a drug screening platform aimed at identifying genes underlying these chemotherapeutic cytotoxic effects on immune cells. Using genome-wide association studies (GWAS, we identified four genome-wide significant quantitative trait loci (QTL that contributed to the sensitivity of doxorubicin and idarubicin in immune cells. Of particular interest, a locus on chromosome 16 was significantly associated with cell viability following idarubicin administration (p = 5.01x10-8. Within this QTL lies App, which encodes amyloid beta precursor protein. Comparison of dose-response curves verified that T-cells in App knockout mice were more sensitive to idarubicin than those of C57BL/6J control mice (p < 0.05.In conclusion, the cellular screening approach coupled with GWAS led to the identification and subsequent validation of a gene involved in T-cell viability after idarubicin treatment. Previous studies have suggested a role for App in in vitro and in vivo cytotoxicity to anticancer agents; the overexpression of App enhances resistance, while the knockdown of this gene is deleterious to cell viability. Thus, further investigations should include performing mechanistic studies, validating additional genes from the GWAS, including Ppfia1 and Ppfibp1, and ultimately translating the findings to in vivo and human studies.

  3. Ultrasound-mediated interferon β gene transfection inhibits growth of malignant melanoma

    International Nuclear Information System (INIS)

    Yamaguchi, Kazuki; Feril, Loreto B.; Tachibana, Katsuro; Takahashi, Akira; Matsuo, Miki; Endo, Hitomi; Harada, Yoshimi; Nakayama, Juichiro

    2011-01-01

    Highlights: → Successful ultrasound-mediated transfection of melanoma (C32) cells with IFN-β genes both in vitro and in vivo. → Ultrasound-mediated IFN-β transfection inhibited proliferation of melanoma cells in vitro. → Ultrasound-mediated IFN-β transfection inhibited melanoma tumor growth in vivo. -- Abstract: We investigated the effects of ultrasound-mediated transfection (sonotransfection) of interferon β (IFN-β) gene on melanoma (C32) both in vitro and in vivo. C32 cells were sonotransfected with IFN-β in vitro. Subcutaneous C32 tumors in mice were sonicated weekly immediately after intra-tumor injection with IFN-β genes mixed with microbubbles. Successful sonotransfection with IFN-β gene in vitro was confirmed by ELISA, which resulted in C32 growth inhibition. In vivo, the growth ratio of tumors transfected with IFN-β gene was significantly lower than the other experimental groups. These results may lead to a new method of treatment against melanoma and other hard-to-treat cancers.

  4. Imaging Herpes Simplex Virus Type 1 Amplicon Vector–Mediated Gene Expression in Human Glioma Spheroids

    Directory of Open Access Journals (Sweden)

    Christine Kaestle

    2011-05-01

    Full Text Available Vectors derived from herpes simplex virus type 1 (HSV-1 have great potential for transducing therapeutic genes into the central nervous system; however, inefficient distribution of vector particles in vivo may limit their therapeutic potential in patients with gliomas. This study was performed to investigate the extent of HSV-1 amplicon vector–mediated gene expression in a three-dimensional glioma model of multicellular spheroids by imaging highly infectious HSV-1 virions expressing green fluorescent protein (HSV-GFP. After infection or microscopy-guided vector injection of glioma spheroids at various spheroid sizes, injection pressures and injection times, the extent of HSV-1 vector–mediated gene expression was investigated via laser scanning microscopy. Infection of spheroids with HSV-GFP demonstrated a maximal depth of vector-mediated GFP expression at 70 to 80 μm. A > 80% transduction efficiency was reached only in small spheroids with a diameter of 90%. The results demonstrated that vector-mediated gene expression in glioma spheroids was strongly dependent on the mode of vector application—injection pressure and injection time being the most important parameters. The assessment of these vector application parameters in tissue models will contribute to the development of safe and efficient gene therapy protocols for clinical application.

  5. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    OpenAIRE

    Chang, Keejong; Qian, Jin; Jiang, MeiSheng; Liu, Yi-Hsin; Wu, Ming-Che; Chen, Chi-Dar; Lai, Chao-Kuen; Lo, Hsin-Lung; Hsiao, Chin-Ton; Brown, Lucy; Bolen, James; Huang, Hsiao-I; Ho, Pei-Yu; Shih, Ping Yao; Yao, Chen-Wen

    2002-01-01

    Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT) that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal ...

  6. BDNF gene delivery mediated by neuron-targeted nanoparticles is neuroprotective in peripheral nerve injury

    OpenAIRE

    Lopes, CDF; Gonçalves, NP; Gomes, CP; Saraiva, MJ; Pêgo, AP

    2017-01-01

    Neuron-targeted gene delivery is a promising strategy to treat peripheral neuropathies. Here we propose the use of polymeric nanoparticles based on thiolated trimethyl chitosan (TMCSH) to mediate targeted gene delivery to peripheral neurons upon a peripheral and minimally invasive intramuscular administration. Nanoparticles were grafted with the non-toxic carboxylic fragment of the tetanus neurotoxin (HC) to allow neuron targeting and were explored to deliver a plasmid DNA encoding for the br...

  7. Optimization of cationic lipid mediated gene transfer: structure-function, physico-chemical, and cellular studies.

    Science.gov (United States)

    Carrière, Marie; Tranchant, Isabelle; Niore, Pierre-Antoine; Byk, Gerardo; Mignet, Nathalie; Escriou, Virginie; Scherman, Daniel; Herscovici, Jean

    2002-01-01

    The rationale design aimed at the enhancement of cationic lipid mediated gene transfer is discussed. These improvements are based on the straight evaluation of the structure-activity relationship and on the introduction of new structures. Much attention have been given to the supramolecular structures of the lipid/DNA complexes, to the effect of serum on gene transfer and to the intracellular trafficking of the lipoplexes. Finally new avenue using reducible cationic lipids has been discussed.

  8. Imaging Herpes Simplex Virus Type 1 Amplicon Vector–Mediated Gene Expression in Human Glioma Spheroids

    OpenAIRE

    Christine Kaestle; Alexandra Winkeler; Raphaela Richter; Heinrich Sauer; Jürgen Hescheler; Cornel Fraefel; Maria Wartenberg; Andreas H. Jacobs

    2011-01-01

    Vectors derived from herpes simplex virus type 1 (HSV-1) have great potential for transducing therapeutic genes into the central nervous system; however, inefficient distribution of vector particles in vivo may limit their therapeutic potential in patients with gliomas. This study was performed to investigate the extent of HSV-1 amplicon vector–mediated gene expression in a three-dimensional glioma model of multicellular spheroids by imaging highly infectious HSV-1 virions expressing green fl...

  9. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    Science.gov (United States)

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  10. Differentiation of Xylella fastidiosa strains via multilocus sequence analysis of environmentally mediated genes (MLSA-E).

    Science.gov (United States)

    Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo

    2012-03-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing improved disease management in economically important crops.

  11. Chloroquine mediated modulation of Anopheles gambiae gene expression.

    Directory of Open Access Journals (Sweden)

    Patrícia Abrantes

    2008-07-01

    Full Text Available Plasmodium development in the mosquito is crucial for malaria transmission and depends on the parasite's interaction with a variety of cell types and specific mosquito factors that have both positive and negative effects on infection. Whereas the defensive response of the mosquito contributes to a decrease in parasite numbers during these stages, some components of the blood meal are known to favor infection, potentiating the risk of increased transmission. The presence of the antimalarial drug chloroquine in the mosquito's blood meal has been associated with an increase in Plasmodium infectivity for the mosquito, which is possibly caused by chloroquine interfering with the capacity of the mosquito to defend against the infection.In this study, we report a detailed survey of the Anopheles gambiae genes that are differentially regulated by the presence of chloroquine in the blood meal, using an A. gambiae cDNA microarray. The effect of chloroquine on transcript abundance was evaluated separately for non-infected and Plasmodium berghei-infected mosquitoes. Chloroquine was found to affect the abundance of transcripts that encode proteins involved in a variety of processes, including immunity, apoptosis, cytoskeleton and the response to oxidative stress. This pattern of differential gene expression may explain the weakened mosquito defense response which accounts for the increased infectivity observed in chloroquine-treated mosquitoes.The results of the present study suggest that chloroquine can interfere with several putative mosquito mechanisms of defense against Plasmodium at the level of gene expression and highlight the need for a better understanding of the impacts of antimalarial agents on parasite transmission.

  12. Advances in ultrasound-targeted microbubble-mediated gene therapy for liver fibrosis.

    Science.gov (United States)

    Huang, Cuiyuan; Zhang, Hong; Bai, Ruidan

    2017-07-01

    Hepatic fibrosis develops as a wound-healing scar in response to acute and chronic liver inflammation and can lead to cirrhosis in patients with chronic hepatitis B and C. The condition arises due to increased synthesis and reduced degradation of extracellular matrix (ECM) and is a common pathological sequela of chronic liver disease. Excessive deposition of ECM in the liver causes liver dysfunction, ascites, and eventually upper gastrointestinal bleeding as well as a series of complications. However, fibrosis can be reversed before developing into cirrhosis and has thus been the subject of extensive researches particularly at the gene level. Currently, therapeutic genes are imported into the damaged liver to delay or prevent the development of liver fibrosis by regulating the expression of exogenous genes. One technique of gene delivery uses ultrasound targeting of microbubbles combined with therapeutic genes where the time and intensity of the ultrasound can control the release process. Ultrasound irradiation of microbubbles in the vicinity of cells changes the permeability of the cell membrane by its cavitation effect and enhances gene transfection. In this paper, recent progress in the field is reviewed with emphasis on the following aspects: the types of ultrasound microbubbles, the construction of an ultrasound-mediated gene delivery system, the mechanism of ultrasound microbubble-mediated gene transfer and the application of ultrasound microbubbles in the treatment of liver fibrosis.

  13. Advances in ultrasound-targeted microbubble-mediated gene therapy for liver fibrosis

    Directory of Open Access Journals (Sweden)

    Cuiyuan Huang

    2017-07-01

    Full Text Available Hepatic fibrosis develops as a wound-healing scar in response to acute and chronic liver inflammation and can lead to cirrhosis in patients with chronic hepatitis B and C. The condition arises due to increased synthesis and reduced degradation of extracellular matrix (ECM and is a common pathological sequela of chronic liver disease. Excessive deposition of ECM in the liver causes liver dysfunction, ascites, and eventually upper gastrointestinal bleeding as well as a series of complications. However, fibrosis can be reversed before developing into cirrhosis and has thus been the subject of extensive researches particularly at the gene level. Currently, therapeutic genes are imported into the damaged liver to delay or prevent the development of liver fibrosis by regulating the expression of exogenous genes. One technique of gene delivery uses ultrasound targeting of microbubbles combined with therapeutic genes where the time and intensity of the ultrasound can control the release process. Ultrasound irradiation of microbubbles in the vicinity of cells changes the permeability of the cell membrane by its cavitation effect and enhances gene transfection. In this paper, recent progress in the field is reviewed with emphasis on the following aspects: the types of ultrasound microbubbles, the construction of an ultrasound-mediated gene delivery system, the mechanism of ultrasound microbubble–mediated gene transfer and the application of ultrasound microbubbles in the treatment of liver fibrosis.

  14. RNAi mediates post-transcriptional repression of gene expression in fission yeast Schizosaccharomyces pombe

    International Nuclear Information System (INIS)

    Smialowska, Agata; Djupedal, Ingela; Wang, Jingwen; Kylsten, Per; Swoboda, Peter; Ekwall, Karl

    2014-01-01

    Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its role in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe

  15. Analysis of a Gene Regulatory Cascade Mediating Circadian Rhythm in Zebrafish

    Science.gov (United States)

    Wang, Haifang; Du, Jiulin; Yan, Jun

    2013-01-01

    In the study of circadian rhythms, it has been a puzzle how a limited number of circadian clock genes can control diverse aspects of physiology. Here we investigate circadian gene expression genome-wide using larval zebrafish as a model system. We made use of a spatial gene expression atlas to investigate the expression of circadian genes in various tissues and cell types. Comparison of genome-wide circadian gene expression data between zebrafish and mouse revealed a nearly anti-phase relationship and allowed us to detect novel evolutionarily conserved circadian genes in vertebrates. We identified three groups of zebrafish genes with distinct responses to light entrainment: fast light-induced genes, slow light-induced genes, and dark-induced genes. Our computational analysis of the circadian gene regulatory network revealed several transcription factors (TFs) involved in diverse aspects of circadian physiology through transcriptional cascade. Of these, microphthalmia-associated transcription factor a (mitfa), a dark-induced TF, mediates a circadian rhythm of melanin synthesis, which may be involved in zebrafish's adaptation to daily light cycling. Our study describes a systematic method to discover previously unidentified TFs involved in circadian physiology in complex organisms. PMID:23468616

  16. Computational modeling identifies key gene regulatory interactions underlying phenobarbital-mediated tumor promotion

    Science.gov (United States)

    Luisier, Raphaëlle; Unterberger, Elif B.; Goodman, Jay I.; Schwarz, Michael; Moggs, Jonathan; Terranova, Rémi; van Nimwegen, Erik

    2014-01-01

    Gene regulatory interactions underlying the early stages of non-genotoxic carcinogenesis are poorly understood. Here, we have identified key candidate regulators of phenobarbital (PB)-mediated mouse liver tumorigenesis, a well-characterized model of non-genotoxic carcinogenesis, by applying a new computational modeling approach to a comprehensive collection of in vivo gene expression studies. We have combined our previously developed motif activity response analysis (MARA), which models gene expression patterns in terms of computationally predicted transcription factor binding sites with singular value decomposition (SVD) of the inferred motif activities, to disentangle the roles that different transcriptional regulators play in specific biological pathways of tumor promotion. Furthermore, transgenic mouse models enabled us to identify which of these regulatory activities was downstream of constitutive androstane receptor and β-catenin signaling, both crucial components of PB-mediated liver tumorigenesis. We propose novel roles for E2F and ZFP161 in PB-mediated hepatocyte proliferation and suggest that PB-mediated suppression of ESR1 activity contributes to the development of a tumor-prone environment. Our study shows that combining MARA with SVD allows for automated identification of independent transcription regulatory programs within a complex in vivo tissue environment and provides novel mechanistic insights into PB-mediated hepatocarcinogenesis. PMID:24464994

  17. A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

    Science.gov (United States)

    Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

    2010-01-01

    RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

  18. Ovarian cancer targeted adenoviral-mediated mda-7/IL-24 gene therapy

    NARCIS (Netherlands)

    Mahasreshti, PJ; Kataram, M; Wu, HJ; Yalavarthy, LP; Carey, D; Dent, P; Chada, S; Alvarez, RD; Haisma, HJ; Fisher, PB; Curiel, DT

    Objective. We have previously shown that adenoviral-mediated melanoma differentiation-associated gene-7 (Ad.mda-7) therapy induces apoptosis in ovarian cancer cells. However, the apoptosis induction was low and directly correlated with infectivity of Ad.mda-7. The objective of this study was to

  19. Optimization of Agrobacterium-mediated transient expression of heterologous genes in spinach

    DEFF Research Database (Denmark)

    Cao, Dang Viet; Pamplona, Reniel S.; Kim, Jiwon

    2017-01-01

    The Agrobacterium-mediated transient assay is a relatively rapid technique and a promising approach for assessing the expression of a gene of interest. Despite the successful application of this transient expression system in several plant species, it is not well understood in spinach. In this st...

  20. Impact of pEGFP mediated ING4 gene on growth of glioma U251 ...

    African Journals Online (AJOL)

    Jane

    2011-06-22

    Jun 22, 2011 ... Full Length Research Paper. Impact of pEGFP mediated ING4 gene on growth of glioma U251 cells and its potential molecular mechanism. Yuefei Deng*, Bingxi Lei and Yiying Zhao. Department of Neurosurgery, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, China.

  1. Silencing SlMED18, tomato Mediator subunit 18 gene, restricts internode elongation and leaf expansion.

    Science.gov (United States)

    Wang, Yunshu; Hu, Zongli; Zhang, Jianling; Yu, XiaoHui; Guo, Jun-E; Liang, Honglian; Liao, Changguang; Chen, Guoping

    2018-02-19

    Mediator complex, a conserved multi-protein, is necessary for controlling RNA polymerase II (Pol II) transcription in eukaryotes. Given little is known about them in tomato, a tomato Mediator subunit 18 gene was isolated and named SlMED18. To further explore the function of SlMED18, the transgenic tomato plants targeting SlMED18 by RNAi-mediated gene silencing were generated. The SlMED18-RNAi lines exhibited multiple developmental defects, including smaller size and slower growth rate of plant and significantly smaller compound leaves. The contents of endogenous bioactive GA 3 in SlMED18 silenced lines were slightly less than that in wild type. Furthermore, qRT-PCR analysis indicated that expression of gibberellins biosynthesis genes such as SlGACPS and SlGA20x2, auxin transport genes (PIN1, PIN4, LAX1 and LAX2) and several key regulators, KNOX1, KNOX2, PHAN and LANCEOLATE(LA), which involved in the leaf morphogenesis were significantly down-regulated in SlMED18-RNAi lines. These results illustrated that SlMED18 plays an essential role in regulating plant internode elongation and leaf expansion in tomato plants and it acts as a key positive regulator of gibberellins biosynthesis and signal transduction as well as auxin proper transport signalling. These findings are the basis for understanding the function of the individual Mediator subunits in tomato.

  2. Agrobacterium-mediated transformation of tomato with the ICE1 transcription factor gene.

    Science.gov (United States)

    Juan, J X; Yu, X H; Jiang, X M; Gao, Z; Zhang, Y; Li, W; Duan, Y D; Yang, G

    2015-01-30

    ICE1 genes play a very important role in plants in cold conditions. To improve the cold resistance of tomato, the ICE1 gene of Arabidopsis thaliana was used to construct the plant expression vector p3301-ICE1, and was overexpressed in tomato through Agrobacterium-mediated transformation. Five strains of resistant plants were obtained. PCR and half-quantitative results showed that the ICE1 gene was transferred to tomato; three strains tested positive. After low-temperature stress treatment, praline content and peroxide and catalase activities in the transgenic tomato plants were higher compared with non-transgenic controls, while malondialdehyde content was clearly lower.

  3. Polycomb repressive complex 2 regulates MiR-200b in retinal endothelial cells: potential relevance in diabetic retinopathy.

    Directory of Open Access Journals (Sweden)

    Michael Anthony Ruiz

    Full Text Available Glucose-induced augmented vascular endothelial growth factor (VEGF production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in diabetes are not known. Histone methyltransferase complex, Polycomb Repressive Complex 2 (PRC2, has been shown to repress miRNAs in neoplastic process. We hypothesized that, in diabetes, PRC2 represses miR-200b through its histone H3 lysine-27 trimethylation mark. We show that human retinal microvascular endothelial cells exposed to high levels of glucose regulate miR-200b repression through histone methylation and that inhibition of PRC2 increases miR-200b while reducing VEGF. Furthermore, retinal tissue from animal models of diabetes showed increased expression of major PRC2 components, demonstrating in vivo relevance. This research established a repressive relationship between PRC2 and miR-200b, providing evidence of a novel mechanism of miRNA regulation through histone methylation.

  4. Strategies to regulate transcription factor-mediated gene positioning and interchromosomal clustering at the nuclear periphery.

    Science.gov (United States)

    Randise-Hinchliff, Carlo; Coukos, Robert; Sood, Varun; Sumner, Michael Chas; Zdraljevic, Stefan; Meldi Sholl, Lauren; Garvey Brickner, Donna; Ahmed, Sara; Watchmaker, Lauren; Brickner, Jason H

    2016-03-14

    In budding yeast, targeting of active genes to the nuclear pore complex (NPC) and interchromosomal clustering is mediated by transcription factor (TF) binding sites in the gene promoters. For example, the binding sites for the TFs Put3, Ste12, and Gcn4 are necessary and sufficient to promote positioning at the nuclear periphery and interchromosomal clustering. However, in all three cases, gene positioning and interchromosomal clustering are regulated. Under uninducing conditions, local recruitment of the Rpd3(L) histone deacetylase by transcriptional repressors blocks Put3 DNA binding. This is a general function of yeast repressors: 16 of 21 repressors blocked Put3-mediated subnuclear positioning; 11 of these required Rpd3. In contrast, Ste12-mediated gene positioning is regulated independently of DNA binding by mitogen-activated protein kinase phosphorylation of the Dig2 inhibitor, and Gcn4-dependent targeting is up-regulated by increasing Gcn4 protein levels. These different regulatory strategies provide either qualitative switch-like control or quantitative control of gene positioning over different time scales. © 2016 Randise-Hinchliff et al.

  5. Adeno-associated virus-mediated gene transfer.

    Science.gov (United States)

    Srivastava, Arun

    2008-09-01

    Although the remarkable versatility and efficacy of recombinant adeno-associated virus 2 (AAV2) vectors in transducing a wide variety of cells and tissues in vitro, and in numerous pre-clinical animal models of human diseases in vivo, have been well established, the published literature is replete with controversies with regard to the efficacy of AAV2 vectors in hematopoietic stem cell (HSC) transduction. A number of factors have contributed to these controversies, the molecular bases of which have begun to come to light in recent years. With the availability of several novel serotypes (AAV1 through AAV12), rational design of AAV capsid mutants, and strategies (self-complementary vector genomes, hematopoietic cell-specific promoters), it is indeed becoming feasible to achieve efficient transduction of HSC by AAV vectors. Using a murine serial bone marrow transplantation model in vivo, we have recently documented stable integration of the proviral AAV genome into mouse chromosomes, which does not lead to any overt hematological abnormalities. Thus, a better understanding of the AAV-HSC interactions, and the availability of a vast repertoire of novel serotype and capsid mutant vectors, are likely to have significant implications in the use of AAV vectors in high-efficiency transduction of HSCs as well as in gene therapy applications involving the hematopoietic system. (c) 2008 Wiley-Liss, Inc.

  6. Kidney-specific Sonoporation-mediated Gene Transfer.

    Science.gov (United States)

    Ishida, Ryo; Kami, Daisuke; Kusaba, Tetsuro; Kirita, Yuhei; Kishida, Tsunao; Mazda, Osam; Adachi, Takaomi; Gojo, Satoshi

    2016-02-01

    Sonoporation can deliver agents to target local organs by systemic administration, while decreasing the associated risk of adverse effects. Sonoporation has been used for a variety of materials and in a variety of organs. Herein, we demonstrated that local sonoporation to the kidney can offer highly efficient transfer of oligonucleotides, which were systemically administrated to the tubular epithelium with high specificity. Ultrasonic wave irradiation to the kidney collapsed the microbubbles and transiently affected the glomerular filtration barrier and increased glomerular permeability. Oligonucleotides were passed through the barrier all at once and were absorbed throughout the tubular epithelium. Tumor necrosis factor alpha (TNFα), which plays a central role in renal ischemia-reperfusion injury, was targeted using small interfering RNA (siRNA) with renal sonoporation in a murine model. The reduction of TNFα expression after single gene transfer significantly inhibited the expression of kidney injury markers, suggesting that systemic administration of siRNA under temporary and local sonoporation could be applicable in the clinical setting of ischemic acute kidney injury.

  7. KAP1 regulates type I interferon/STAT1-mediated IRF-1 gene expression

    International Nuclear Information System (INIS)

    Kamitani, Shinya; Ohbayashi, Norihiko; Ikeda, Osamu; Togi, Sumihito; Muromoto, Ryuta; Sekine, Yuichi; Ohta, Kazuhide; Ishiyama, Hironobu; Matsuda, Tadashi

    2008-01-01

    Signal transducers and activators of transcription (STATs) mediate cell proliferation, differentiation, and survival in immune responses, hematopoiesis, neurogenesis, and other biological processes. Recently, we showed that KAP1 is a novel STAT-binding partner that regulates STAT3-mediated transactivation. KAP1 is a universal co-repressor protein for the KRAB zinc finger protein superfamily of transcriptional repressors. In this study, we found KAP1-dependent repression of interferon (IFN)/STAT1-mediated signaling. We also demonstrated that endogenous KAP1 associates with endogenous STAT1 in vivo. Importantly, a small-interfering RNA-mediated reduction in KAP1 expression enhanced IFN-induced STAT1-dependent IRF-1 gene expression. These results indicate that KAP1 may act as an endogenous regulator of the IFN/STAT1 signaling pathway

  8. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  9. Efficacy of In Vivo Electroporation-Mediated IL-10 Gene Delivery on Survival of Skin Flaps.

    Science.gov (United States)

    Seyed Jafari, S Morteza; Shafighi, Maziar; Beltraminelli, Helmut; Weber, Benedikt; Schmid, Ralph A; Geiser, Thomas; Gazdhar, Amiq; Hunger, Robert E

    2018-04-01

    Despite advances in understanding the underlying mechanisms of flap necrosis and improvement in surgical techniques, skin flap necrosis after reconstructive surgery remains a crucial issue. We investigated the efficacy of electroporation-mediated IL-10 gene transfer to random skin flap with an aim to accelerate wound healing and improve skin flap survival. Nine male Wistar rats (300-330 g) were divided in two groups (a) control group (n = 5), only surgery no gene transfer, and (b) experimental group, received electroporation-mediated IL-10 gene transfer 24 h before the surgery as prophylaxis (n = 4). Random skin flap (McFarlane) was performed in both groups. Planimetry, Laser Doppler imaging, and immunohistochemistry were used to evaluate the effect of IL-10 gene transfer between study groups at day 7. Electroporation-mediated IL-10 gene transfer decreased percentage of flap necrosis (p value = 0.0159) and increased cutaneous perfusion compared to the control group (p value = 0.0159). In addition, Spearman's rank correlation showed a significant negative correlation between percentage of flap necrosis and Laser Index (p value = 0.0083, r -0.83, respectively). Furthermore, significantly higher mean CD31 + vessel density was detected in the experimental group compared to the control group (p value = 0.0159). Additionally, semi-quantitative image analysis showed lower inflammatory cell count in experimental group compared to control group (p value = 0.0317). In vivo electroporation-mediated IL-10 gene transfer reduced necrosis, enhanced survival and vascularity in the ischemic skin flap.

  10. C/EBPβ Mediates Growth Hormone-Regulated Expression of Multiple Target Genes

    Science.gov (United States)

    Cui, Tracy X.; Lin, Grace; LaPensee, Christopher R.; Calinescu, Anda-Alexandra; Rathore, Maanjot; Streeter, Cale; Piwien-Pilipuk, Graciela; Lanning, Nathan; Jin, Hui; Carter-Su, Christin; Qin, Zhaohui S.

    2011-01-01

    Regulation of c-Fos transcription by GH is mediated by CCAAT/enhancer binding protein β (C/EBPβ). This study examines the role of C/EBPβ in mediating GH activation of other early response genes, including Cyr61, Btg2, Socs3, Zfp36, and Socs1. C/EBPβ depletion using short hairpin RNA impaired responsiveness of these genes to GH, as seen for c-Fos. Rescue with wild-type C/EBPβ led to GH-dependent recruitment of the coactivator p300 to the c-Fos promoter. In contrast, rescue with C/EBPβ mutated at the ERK phosphorylation site at T188 failed to induce GH-dependent recruitment of p300, indicating that ERK-mediated phosphorylation of C/EBPβ at T188 is required for GH-induced recruitment of p300 to c-Fos. GH also induced the occupancy of phosphorylated C/EBPβ and p300 on Cyr61, Btg2, and Socs3 at predicted C/EBP-cAMP response element-binding protein motifs in their promoters. Consistent with a role for ERKs in GH-induced expression of these genes, treatment with U0126 to block ERK phosphorylation inhibited their GH-induced expression. In contrast, GH-dependent expression of Zfp36 and Socs1 was not inhibited by U0126. Thus, induction of multiple early response genes by GH in 3T3-F442A cells is mediated by C/EBPβ. A subset of these genes is regulated similarly to c-Fos, through a mechanism involving GH-stimulated ERK 1/2 activation, phosphorylation of C/EBPβ, and recruitment of p300. Overall, these studies suggest that C/EBPβ, like the signal transducer and activator of transcription proteins, regulates multiple genes in response to GH. PMID:21292824

  11. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.; Berry, Kayla N.; Ghosh, Sharmistha; Takahashi, Masateru; Francis, Nicole J.

    2012-01-01

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  12. A Polycomb complex remains bound through DNA replication in the absence of other eukaryotic proteins

    KAUST Repository

    Lengsfeld, Bettina M.

    2012-09-17

    Propagation of chromatin states through DNA replication is central to epigenetic regulation and can involve recruitment of chromatin proteins to replicating chromatin through interactions with replication fork components. Here we show using a fully reconstituted T7 bacteriophage system that eukaryotic proteins are not required to tether the Polycomb complex PRC1 to templates during DNA replication. Instead, DNA binding by PRC1 can withstand passage of a simple replication fork.

  13. In silico analysis of miRNA-mediated gene regulation in OCA and OA genes.

    Science.gov (United States)

    Kamaraj, Balu; Gopalakrishnan, Chandrasekhar; Purohit, Rituraj

    2014-12-01

    Albinism is an autosomal recessive genetic disorder due to low secretion of melanin. The oculocutaneous albinism (OCA) and ocular albinism (OA) genes are responsible for melanin production and also act as a potential targets for miRNAs. The role of miRNA is to inhibit the protein synthesis partially or completely by binding with the 3'UTR of the mRNA thus regulating gene expression. In this analysis, we predicted the genetic variation that occurred in 3'UTR of the transcript which can be a reason for low melanin production thus causing albinism. The single nucleotide polymorphisms (SNPs) in 3'UTR cause more new binding sites for miRNA which binds with mRNA which leads to inhibit the translation process either partially or completely. The SNPs in the mRNA of OCA and OA genes can create new binding sites for miRNA which may control the gene expression and lead to hypopigmentation. We have developed a computational procedure to determine the SNPs in the 3'UTR region of mRNA of OCA (TYR, OCA2, TYRP1 and SLC45A2) and OA (GPR143) genes which will be a potential cause for albinism. We identified 37 SNPs in five genes that are predicted to create 87 new binding sites on mRNA, which may lead to abrogation of the translation process. Expression analysis confirms that these genes are highly expressed in skin and eye regions. It is well supported by enrichment analysis that these genes are mainly involved in eye pigmentation and melanin biosynthesis process. The network analysis also shows how the genes are interacting and expressing in a complex network. This insight provides clue to wet-lab researches to understand the expression pattern of OCA and OA genes and binding phenomenon of mRNA and miRNA upon mutation, which is responsible for inhibition of translation process at genomic levels.

  14. Thermo-Regulation of Genes Mediating Motility and Plant Interactions in Pseudomonas syringae

    Science.gov (United States)

    Hockett, Kevin L.; Burch, Adrien Y.; Lindow, Steven E.

    2013-01-01

    Pseudomonas syringae is an important phyllosphere colonist that utilizes flagellum-mediated motility both as a means to explore leaf surfaces, as well as to invade into leaf interiors, where it survives as a pathogen. We found that multiple forms of flagellum-mediated motility are thermo-suppressed, including swarming and swimming motility. Suppression of swarming motility occurs between 28° and 30°C, which coincides with the optimal growth temperature of P. syringae. Both fliC (encoding flagellin) and syfA (encoding a non-ribosomal peptide synthetase involved in syringafactin biosynthesis) were suppressed with increasing temperature. RNA-seq revealed 1440 genes of the P. syringae genome are temperature sensitive in expression. Genes involved in polysaccharide synthesis and regulation, phage and IS elements, type VI secretion, chemosensing and chemotaxis, translation, flagellar synthesis and motility, and phytotoxin synthesis and transport were generally repressed at 30°C, while genes involved in transcriptional regulation, quaternary ammonium compound metabolism and transport, chaperone/heat shock proteins, and hypothetical genes were generally induced at 30°C. Deletion of flgM, a key regulator in the transition from class III to class IV gene expression, led to elevated and constitutive expression of fliC regardless of temperature, but did not affect thermo-regulation of syfA. This work highlights the importance of temperature in the biology of P. syringae, as many genes encoding traits important for plant-microbe interactions were thermo-regulated. PMID:23527276

  15. Molecular Imaging of Gene Expression and Efficacy following Adenoviral-Mediated Brain Tumor Gene Therapy

    Directory of Open Access Journals (Sweden)

    Alnawaz Rehemtulla

    2002-01-01

    Full Text Available Cancer gene therapy is an active area of research relying upon the transfer and subsequent expression of a therapeutic transgene into tumor cells in order to provide for therapeutic selectivity. Noninvasive assessment of therapeutic response and correlation of the location, magnitude, and duration of transgene expression in vivo would be particularly useful in the development of cancer gene therapy protocols by facilitating optimization of gene transfer protocols, vector development, and prodrug dosing schedules. In this study, we developed an adenoviral vector containing both the therapeutic transgene yeast cytosine deaminase (yCD along with an optical reporter gene (luciferase. Following intratumoral injection of the vector into orthotopic 9L gliomas, anatomical and diffusion-weighted MR images were obtained over time in order to provide for quantitative assessment of overall therapeutic efficacy and spatial heterogeneity of cell kill, respectively. In addition, bioluminescence images were acquired to assess the duration and magnitude of gene expression. MR images revealed significant reduction in tumor growth rates associated with yCD/5-fluorocytosine (5FC gene therapy. Significant increases in mean tumor diffusion values were also observed during treatment with 5FC. Moreover, spatial heterogeneity in tumor diffusion changes were also observed revealing that diffusion magnetic resonance imaging could detect regional therapeutic effects due to the nonuniform delivery and/or expression of the therapeutic yCD transgene within the tumor mass. In addition, in vivo bioluminescence imaging detected luciferase gene expression, which was found to decrease over time during administration of the prodrug providing a noninvasive surrogate marker for monitoring gene expression. These results demonstrate the efficacy of the yCD/5FC strategy for the treatment of brain tumors and reveal the feasibility of using multimodality molecular and functional imaging

  16. Gene expression in blood of children and adolescents: Mediation between childhood maltreatment and major depressive disorder.

    Science.gov (United States)

    Spindola, Leticia Maria; Pan, Pedro Mario; Moretti, Patricia Natalia; Ota, Vanessa Kiyomi; Santoro, Marcos Leite; Cogo-Moreira, Hugo; Gadelha, Ary; Salum, Giovanni; Manfro, Gisele Gus; Mari, Jair Jesus; Brentani, Helena; Grassi-Oliveira, Rodrigo; Brietzke, Elisa; Miguel, Euripedes Constantino; Rohde, Luis Augusto; Sato, João Ricardo; Bressan, Rodrigo Affonseca; Belangero, Sintia Iole

    2017-09-01

    Investigating major depressive disorder (MDD) in childhood and adolescence can help reveal the relative contributions of genetic and environmental factors to MDD, since early stages of disease have less influence of illness exposure. Thus, we investigated the mRNA expression of 12 genes related to the hypothalamic-pituitary-adrenal (HPA) axis, inflammation, neurodevelopment and neurotransmission in the blood of children and adolescents with MDD and tested whether a history of childhood maltreatment (CM) affects MDD through gene expression. Whole-blood mRNA levels of 12 genes were compared among 20 children and adolescents with MDD diagnosis (MDD group), 49 participants without MDD diagnosis but with high levels of depressive symptoms (DS group), and 61 healthy controls (HC group). The differentially expressed genes were inserted in a mediation model in which CM, MDD, and gene expression were, respectively, the independent variable, outcome, and intermediary variable. NR3C1, TNF, TNFR1 and IL1B were expressed at significantly lower levels in the MDD group than in the other groups. CM history did not exert a significant direct effect on MDD. However, an indirect effect of the aggregate expression of the 4 genes mediated the relationship between CM and MDD. In the largest study investigating gene expression in children with MDD, we demonstrated that NR3C1, TNF, TNFR1 and IL1B expression levels are related to MDD and conjunctly mediate the effect of CM history on the risk of developing MDD. This supports a role of glucocorticoids and inflammation as potential effectors of environmental stress in MDD. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    International Nuclear Information System (INIS)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT + colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references

  18. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT/sup +/ colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references.

  19. Nipbl and mediator cooperatively regulate gene expression to control limb development.

    Directory of Open Access Journals (Sweden)

    Akihiko Muto

    2014-09-01

    Full Text Available Haploinsufficiency for Nipbl, a cohesin loading protein, causes Cornelia de Lange Syndrome (CdLS, the most common "cohesinopathy". It has been proposed that the effects of Nipbl-haploinsufficiency result from disruption of long-range communication between DNA elements. Here we use zebrafish and mouse models of CdLS to examine how transcriptional changes caused by Nipbl deficiency give rise to limb defects, a common condition in individuals with CdLS. In the zebrafish pectoral fin (forelimb, knockdown of Nipbl expression led to size reductions and patterning defects that were preceded by dysregulated expression of key early limb development genes, including fgfs, shha, hand2 and multiple hox genes. In limb buds of Nipbl-haploinsufficient mice, transcriptome analysis revealed many similar gene expression changes, as well as altered expression of additional classes of genes that play roles in limb development. In both species, the pattern of dysregulation of hox-gene expression depended on genomic location within the Hox clusters. In view of studies suggesting that Nipbl colocalizes with the mediator complex, which facilitates enhancer-promoter communication, we also examined zebrafish deficient for the Med12 Mediator subunit, and found they resembled Nipbl-deficient fish in both morphology and gene expression. Moreover, combined partial reduction of both Nipbl and Med12 had a strongly synergistic effect, consistent with both molecules acting in a common pathway. In addition, three-dimensional fluorescent in situ hybridization revealed that Nipbl and Med12 are required to bring regions containing long-range enhancers into close proximity with the zebrafish hoxda cluster. These data demonstrate a crucial role for Nipbl in limb development, and support the view that its actions on multiple gene pathways result from its influence, together with Mediator, on regulation of long-range chromosomal interactions.

  20. Gene repair of an Usher syndrome causing mutation by zinc-finger nuclease mediated homologous recombination.

    Science.gov (United States)

    Overlack, Nora; Goldmann, Tobias; Wolfrum, Uwe; Nagel-Wolfrum, Kerstin

    2012-06-26

    Human Usher syndrome (USH) is the most frequent cause of inherited deaf-blindness. It is clinically and genetically heterogeneous, assigned to three clinical types of which the most severe type is USH1. No effective treatment for the ophthalmic component of USH exists. Gene augmentation is an attractive strategy for hereditary retinal diseases. However, several USH genes, like USH1C, are expressed in various isoforms, hampering gene augmentation. As an alternative treatment strategy, we applied the zinc-finger nuclease (ZFN) technology for targeted gene repair of an USH1C, causing mutation by homologous recombination. We designed ZFNs customized for the p.R31X nonsense mutation in Ush1c. We evaluated ZFNs for DNA cleavage capability and analyzed ZFNs biocompatibilities by XTT assays. We demonstrated ZFNs mediated gene repair on genomic level by digestion assays and DNA sequencing, and on protein level by indirect immunofluorescence and Western blot analyses. The specifically designed ZFNs did not show cytotoxic effects in a p.R31X cell line. We demonstrated that ZFN induced cleavage of their target sequence. We showed that simultaneous application of ZFN and rescue DNA induced gene repair of the disease-causing mutation on the genomic level, resulting in recovery of protein expression. In our present study, we analyzed for the first time ZFN-activated gene repair of an USH gene. The data highlight the ability of ZFNs to induce targeted homologous recombination and mediate gene repair in USH. We provide further evidence that the ZFN technology holds great potential to recover disease-causing mutations in inherited retinal disorders.

  1. Fto colocalizes with a satiety mediator oxytocin in the brain and upregulates oxytocin gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Olszewski, Pawel K., E-mail: olsze005@umn.edu [Department of Neuroscience, Functional Pharmacology, Uppsala University, 75124 Uppsala (Sweden); Minnesota Obesity Center, Saint Paul, MN 55108 (United States); Fredriksson, Robert; Eriksson, Jenny D. [Department of Neuroscience, Functional Pharmacology, Uppsala University, 75124 Uppsala (Sweden); Mitra, Anaya [Department of Food Science and Nutrition, Saint Paul, MN 55108 (United States); Radomska, Katarzyna J. [Department of Neuroscience, Functional Pharmacology, Uppsala University, 75124 Uppsala (Sweden); Gosnell, Blake A. [Department of Food Science and Nutrition, Saint Paul, MN 55108 (United States); Solvang, Maria N. [Department of Neuroscience, Functional Pharmacology, Uppsala University, 75124 Uppsala (Sweden); Levine, Allen S. [Minnesota Obesity Center, Saint Paul, MN 55108 (United States); Department of Food Science and Nutrition, Saint Paul, MN 55108 (United States); Schioeth, Helgi B. [Department of Neuroscience, Functional Pharmacology, Uppsala University, 75124 Uppsala (Sweden)

    2011-05-13

    Highlights: {yields} The majority of neurons synthesizing a satiety mediator, oxytocin, coexpress Fto. {yields} The level of colocalization is similar in the male and female brain. {yields} Fto overexpression in hypothalamic neurons increases oxytocin mRNA levels by 50%. {yields} Oxytocin does not affect Fto expression through negative feedback mechanisms. -- Abstract: Single nucleotide polymorphisms in the fat mass and obesity-associated (FTO) gene have been associated with obesity in humans. Alterations in Fto expression in transgenic animals affect body weight, energy expenditure and food intake. Fto, a nuclear protein and proposed transcription co-factor, has been speculated to affect energy balance through a functional relationship with specific genes encoding feeding-related peptides. Herein, we employed double immunohistochemistry and showed that the majority of neurons synthesizing a satiety mediator, oxytocin, coexpress Fto in the brain of male and female mice. We then overexpressed Fto in a murine hypothalamic cell line and, using qPCR, detected a 50% increase in the level of oxytocin mRNA. Expression levels of several other feeding-related genes, including neuropeptide Y (NPY) and Agouti-related protein (AgRP), were unaffected by the FTO transfection. Addition of 10 and 100 nmol oxytocin to the cell culture medium did not affect Fto expression in hypothalamic cells. We conclude that Fto, a proposed transcription co-factor, influences expression of the gene encoding a satiety mediator, oxytocin.

  2. Fto colocalizes with a satiety mediator oxytocin in the brain and upregulates oxytocin gene expression

    International Nuclear Information System (INIS)

    Olszewski, Pawel K.; Fredriksson, Robert; Eriksson, Jenny D.; Mitra, Anaya; Radomska, Katarzyna J.; Gosnell, Blake A.; Solvang, Maria N.; Levine, Allen S.; Schioeth, Helgi B.

    2011-01-01

    Highlights: → The majority of neurons synthesizing a satiety mediator, oxytocin, coexpress Fto. → The level of colocalization is similar in the male and female brain. → Fto overexpression in hypothalamic neurons increases oxytocin mRNA levels by 50%. → Oxytocin does not affect Fto expression through negative feedback mechanisms. -- Abstract: Single nucleotide polymorphisms in the fat mass and obesity-associated (FTO) gene have been associated with obesity in humans. Alterations in Fto expression in transgenic animals affect body weight, energy expenditure and food intake. Fto, a nuclear protein and proposed transcription co-factor, has been speculated to affect energy balance through a functional relationship with specific genes encoding feeding-related peptides. Herein, we employed double immunohistochemistry and showed that the majority of neurons synthesizing a satiety mediator, oxytocin, coexpress Fto in the brain of male and female mice. We then overexpressed Fto in a murine hypothalamic cell line and, using qPCR, detected a 50% increase in the level of oxytocin mRNA. Expression levels of several other feeding-related genes, including neuropeptide Y (NPY) and Agouti-related protein (AgRP), were unaffected by the FTO transfection. Addition of 10 and 100 nmol oxytocin to the cell culture medium did not affect Fto expression in hypothalamic cells. We conclude that Fto, a proposed transcription co-factor, influences expression of the gene encoding a satiety mediator, oxytocin.

  3. A human Polycomb isoform lacking the Pc box does not participate to PRC1 complexes but forms protein assemblies and represses transcription

    DEFF Research Database (Denmark)

    Völkel, Pamela; Le Faou, Perrine; Vandamme, Julien

    2012-01-01

    site for the PRC1 protein complex. Drosophila core PRC1 is composed of four subunits: Polycomb (Pc), Posterior sex combs (Psc), Polyhomeotic (Ph) and Sex combs extra (Sce). Each of these proteins has multiple orthologs in vertebrates, thus generating an enormous scope for potential combinatorial...... diversity. In particular, mammalian genomes encode five Pc family members: CBX2, CBX4, CBX6, CBX7 and CBX8. To complicate matters further, distinct isoforms might arise from single genes. Here, we address the functional role of the two human CBX2 isoforms. Owing to different polyadenylation sites...... and alternative splicing events, the human CBX2 locus produces two transcripts: a 5-exon transcript that encodes the 532-amino acid CBX2-1 isoform that contains the conserved chromodomain and Pc box and a 4-exon transcript encoding a shorter isoform, CBX2-2, lacking the Pc box but still possessing a chromodomain...

  4. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Science.gov (United States)

    Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J

    2015-01-01

    In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  5. Analysis of the siRNA-Mediated Gene Silencing Process Targeting Three Homologous Genes Controlling Soybean Seed Oil Quality.

    Directory of Open Access Journals (Sweden)

    Sha Lu

    Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.

  6. ABI3 mediates dehydration stress recovery response in Arabidopsis thaliana by regulating expression of downstream genes.

    Science.gov (United States)

    Bedi, Sonia; Sengupta, Sourabh; Ray, Anagh; Nag Chaudhuri, Ronita

    2016-09-01

    ABI3, originally discovered as a seed-specific transcription factor is now implicated to act beyond seed physiology, especially during abiotic stress. In non-seed plants, ABI3 is known to act in desiccation stress signaling. Here we show that ABI3 plays a role in dehydration stress response in Arabidopsis. ABI3 gene was upregulated during dehydration stress and its expression was maintained during subsequent stress recovery phases. Comparative gene expression studies in response to dehydration stress and stress recovery were done with genes which had potential ABI3 binding sites in their upstream regulatory regions. Such studies showed that several genes including known seed-specific factors like CRUCIFERIN1, CRUCIFERIN3 and LEA-group of genes like LEA76, LEA6, DEHYDRIN LEA and LEA-LIKE got upregulated in an ABI3-dependent manner, especially during the stress recovery phase. ABI3 got recruited to regions upstream to the transcription start site of these genes during dehydration stress response through direct or indirect DNA binding. Interestingly, ABI3 also binds to its own promoter region during such stress signaling. Nucleosomes covering potential ABI3 binding sites in the upstream sequences of the above-mentioned genes alter positions, and show increased H3 K9 acetylation during stress-induced transcription. ABI3 thus mediates dehydration stress signaling in Arabidopsis through regulation of a group of genes that play a role primarily during stress recovery phase. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Dual CRISPR-Cas9 Cleavage Mediated Gene Excision and Targeted Integration in Yarrowia lipolytica.

    Science.gov (United States)

    Gao, Difeng; Smith, Spencer; Spagnuolo, Michael; Rodriguez, Gabriel; Blenner, Mark

    2018-05-29

    CRISPR-Cas9 technology has been successfully applied in Yarrowia lipolytica for targeted genomic editing including gene disruption and integration; however, disruptions by existing methods typically result from small frameshift mutations caused by indels within the coding region, which usually resulted in unnatural protein. In this study, a dual cleavage strategy directed by paired sgRNAs is developed for gene knockout. This method allows fast and robust gene excision, demonstrated on six genes of interest. The targeted regions for excision vary in length from 0.3 kb up to 3.5 kb and contain both non-coding and coding regions. The majority of the gene excisions are repaired by perfect nonhomologous end-joining without indel. Based on this dual cleavage system, two targeted markerless integration methods are developed by providing repair templates. While both strategies are effective, homology mediated end joining (HMEJ) based method are twice as efficient as homology recombination (HR) based method. In both cases, dual cleavage leads to similar or improved gene integration efficiencies compared to gene excision without integration. This dual cleavage strategy will be useful for not only generating more predictable and robust gene knockout, but also for efficient targeted markerless integration, and simultaneous knockout and integration in Y. lipolytica. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Floral pathway integrator gene expression mediates gradual transmission of environmental and endogenous cues to flowering time.

    Science.gov (United States)

    van Dijk, Aalt D J; Molenaar, Jaap

    2017-01-01

    The appropriate timing of flowering is crucial for the reproductive success of plants. Hence, intricate genetic networks integrate various environmental and endogenous cues such as temperature or hormonal statues. These signals integrate into a network of floral pathway integrator genes. At a quantitative level, it is currently unclear how the impact of genetic variation in signaling pathways on flowering time is mediated by floral pathway integrator genes. Here, using datasets available from literature, we connect Arabidopsis thaliana flowering time in genetic backgrounds varying in upstream signalling components with the expression levels of floral pathway integrator genes in these genetic backgrounds. Our modelling results indicate that flowering time depends in a quite linear way on expression levels of floral pathway integrator genes. This gradual, proportional response of flowering time to upstream changes enables a gradual adaptation to changing environmental factors such as temperature and light.

  9. Floral pathway integrator gene expression mediates gradual transmission of environmental and endogenous cues to flowering time

    Directory of Open Access Journals (Sweden)

    Aalt D.J. van Dijk

    2017-04-01

    Full Text Available The appropriate timing of flowering is crucial for the reproductive success of plants. Hence, intricate genetic networks integrate various environmental and endogenous cues such as temperature or hormonal statues. These signals integrate into a network of floral pathway integrator genes. At a quantitative level, it is currently unclear how the impact of genetic variation in signaling pathways on flowering time is mediated by floral pathway integrator genes. Here, using datasets available from literature, we connect Arabidopsis thaliana flowering time in genetic backgrounds varying in upstream signalling components with the expression levels of floral pathway integrator genes in these genetic backgrounds. Our modelling results indicate that flowering time depends in a quite linear way on expression levels of floral pathway integrator genes. This gradual, proportional response of flowering time to upstream changes enables a gradual adaptation to changing environmental factors such as temperature and light.

  10. Exploration of new perspectives and limitations in Agrobacterium mediated gene transfer technology. Progress report, [June 1, 1992-- May 31, 1994

    Energy Technology Data Exchange (ETDEWEB)

    Marton, L.

    1994-12-31

    This report describes progress aimed at constructing gene-transfer technology for Nicotiana plumbaginifolia. Most actual effort as described herein has so far been directed at exploring new perspectives and limitations in Agrobacterium mediated gene transfer. Accomplishments are described using a core homologous gene targeting vector.

  11. Evaluating the role of CRM1-mediated export for adenovirus gene expression

    International Nuclear Information System (INIS)

    Carter, Christoph C.; Izadpanah, Reza; Bridge, Eileen

    2003-01-01

    A complex of the Adenovirus (Ad) early region 1b 55-kDa (E1b-55kDa) and early region 4 ORF6 34-kDa (E4-34kDa) proteins promotes viral late gene expression. E1b-55kDa and E4-34kDa have leucine-rich nuclear export signals (NESs) similar to that of HIV Rev. It was proposed that E1b-55kDa and/or E4-34kDa might promote the export of Ad late mRNA via their Rev-like NESs, and the transport receptor CRM1. We treated infected cells with the cytotoxin leptomycin B to inhibit CRM1-mediated export; treatment initially delays the onset of late gene expression, but this activity completely recovers as the late phase progresses. We find that the E1b-55kDa NES is not required to promote late gene expression. Previous results showed that E4-34kDa-mediated late gene expression does not require an intact NES (J. Virol. 74 (2000), 6684-6688). Our results indicate that these Ad regulatory proteins promote late gene expression without intact NESs or active CRM1

  12. Transcription factor CREB is involved in CaSR-mediated cytoskeleton gene expression.

    Science.gov (United States)

    Huang, Shuaishuai; Ren, Yu; Wang, Ping; Li, Yanyuan; Wang, Xue; Zhuang, Haihui; Fang, Rong; Wang, Yuduo; Liu, Ningsheng; Hehir, Michael; Zhou, Jeff X

    2015-03-01

    Our previous studies illustrated that a steady increase of intracellular calcium concentration ([Ca2+]i) was important for maintaining microtubules (MTs) rearrangement in apoptotic cells. However, little is known about the effect of calcium sensing receptor (CaSR)-mediated increase in [Ca2+]i on cytoskeleton gene expression. We examined the impact of taxol or CaSR agonist/antagonist on the regulation of [Ca2+]i concentration, cytoskeleton arrangement, phosphorylated CREB and cytoskeleton gene expressions in HeLa cells with dominant negative plasmid of CREB (PM). This study demonstrated that Gdcl3 (a specific CaSR agonist) evoked a rapid increase of [Ca2+]i, formed a rigid bundle of MTs which surrounded the nucleus and decreased the cytoskeleton gene expressions in HeLa cells. These effects were rescued by addition of NPS2390 (a specific CaSR antagonist). Moreover, CaSR activity affected cytoskeleton gene expression through transcription factor CREB. Histoscores of pCREB immunoreactivity in tissues of cervical adenocarcinoma, renal clear cell carcinoma, and diffuse large B-cell lymphoma were markedly increased compared with non malignant tissue. These data demonstrate, for the first time, that CaSR-mediated increase in [Ca2+]i probably modulate cytoskeleton organization and gene expression via transcription factor. © 2014 Wiley Periodicals, Inc.

  13. Integrative analyses reveal a long noncoding RNA-mediated sponge regulatory network in prostate cancer.

    Science.gov (United States)

    Du, Zhou; Sun, Tong; Hacisuleyman, Ezgi; Fei, Teng; Wang, Xiaodong; Brown, Myles; Rinn, John L; Lee, Mary Gwo-Shu; Chen, Yiwen; Kantoff, Philip W; Liu, X Shirley

    2016-03-15

    Mounting evidence suggests that long noncoding RNAs (lncRNAs) can function as microRNA sponges and compete for microRNA binding to protein-coding transcripts. However, the prevalence, functional significance and targets of lncRNA-mediated sponge regulation of cancer are mostly unknown. Here we identify a lncRNA-mediated sponge regulatory network that affects the expression of many protein-coding prostate cancer driver genes, by integrating analysis of sequence features and gene expression profiles of both lncRNAs and protein-coding genes in tumours. We confirm the tumour-suppressive function of two lncRNAs (TUG1 and CTB-89H12.4) and their regulation of PTEN expression in prostate cancer. Surprisingly, one of the two lncRNAs, TUG1, was previously known for its function in polycomb repressive complex 2 (PRC2)-mediated transcriptional regulation, suggesting its sub-cellular localization-dependent function. Our findings not only suggest an important role of lncRNA-mediated sponge regulation in cancer, but also underscore the critical influence of cytoplasmic localization on the efficacy of a sponge lncRNA.

  14. E2F1-mediated transcriptional inhibition of the plasminogen activator inhibitor type 1 gene

    DEFF Research Database (Denmark)

    Koziczak, M; Müller, H; Helin, K

    2001-01-01

    but independent of binding to pocket-binding proteins, suggesting a novel mechanism for E2F-mediated negative gene regulation [Koziczak, M., Krek, W. & Nagamine, Y. (2000) Mol. Cell. Biol. 20, 2014-2022]. However, it remains to be seen whether endogenous E2F can exert a similar effect. We report here that down....... These results all indicate that endogenous E2F can directly repress the PAI-1 gene. DNase I hypersensitive-site analysis of the PAI-1 promoter suggested the involvement of conformation changes in chromatin structure of the PAI-1 promoter. 5' deletion analysis of the PAI-1 promoter showed that multiple sites...

  15. RNAi-mediated double gene knockdown and gustatory perception measurement in honey bees (Apis mellifera).

    Science.gov (United States)

    Wang, Ying; Baker, Nicholas; Amdam, Gro V

    2013-07-25

    This video demonstrates novel techniques of RNA interference (RNAi) which downregulate two genes simultaneously in honey bees using double-stranded RNA (dsRNA) injections. It also presents a protocol of proboscis extension response (PER) assay for measuring gustatory perception. RNAi-mediated gene knockdown is an effective technique downregulating target gene expression. This technique is usually used for single gene manipulation, but it has limitations to detect interactions and joint effects between genes. In the first part of this video, we present two strategies to simultaneously knock down two genes (called double gene knockdown). We show both strategies are able to effectively suppress two genes, vitellogenin (vg) and ultraspiracle (usp), which are in a regulatory feedback loop. This double gene knockdown approach can be used to dissect interrelationships between genes and can be readily applied in different insect species. The second part of this video is a demonstration of proboscis extension response (PER) assay in honey bees after the treatment of double gene knockdown. The PER assay is a standard test for measuring gustatory perception in honey bees, which is a key predictor for how fast a honey bee's behavioral maturation is. Greater gustatory perception of nest bees indicates increased behavioral development which is often associated with an earlier age at onset of foraging and foraging specialization in pollen. In addition, PER assay can be applied to identify metabolic states of satiation or hunger in honey bees. Finally, PER assay combined with pairing different odor stimuli for conditioning the bees is also widely used for learning and memory studies in honey bees.

  16. Mediator Recruitment to Heat Shock Genes Requires Dual Hsf1 Activation Domains and Mediator Tail Subunits Med15 and Med16*

    Science.gov (United States)

    Kim, Sunyoung; Gross, David S.

    2013-01-01

    The evolutionarily conserved Mediator complex is central to the regulation of gene transcription in eukaryotes because it serves as a physical and functional interface between upstream regulators and the Pol II transcriptional machinery. Nonetheless, its role appears to be context-dependent, and the detailed mechanism by which it governs the expression of most genes remains unknown. Here we investigate Mediator involvement in HSP (heat shock protein) gene regulation in the yeast Saccharomyces cerevisiae. We find that in response to thermal upshift, subunits representative of each of the four Mediator modules (Head, Middle, Tail, and Kinase) are rapidly, robustly, and selectively recruited to the promoter regions of HSP genes. Their residence is transient, returning to near-background levels within 90 min. Hsf1 (heat shock factor 1) plays a central role in recruiting Mediator, as indicated by the fact that truncation of either its N- or C-terminal activation domain significantly reduces Mediator occupancy, whereas removal of both activation domains abolishes it. Likewise, ablation of either of two Mediator Tail subunits, Med15 or Med16, reduces Mediator recruitment to HSP promoters, whereas deletion of both abolishes it. Accompanying the loss of Mediator, recruitment of RNA polymerase II is substantially diminished. Interestingly, Mediator antagonizes Hsf1 occupancy of non-induced promoters yet facilitates enhanced Hsf1 association with activated ones. Collectively, our observations indicate that Hsf1, via its dual activation domains, recruits holo-Mediator to HSP promoters in response to acute heat stress through cooperative physical and/or functional interactions with the Tail module. PMID:23447536

  17. Endogenous TasiRNAs mediate non-cell autonomous effects on gene regulation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Rebecca Schwab

    Full Text Available BACKGROUND: Different classes of small RNAs (sRNAs refine the expression of numerous genes in higher eukaryotes by directing protein partners to complementary nucleic acids, where they mediate gene silencing. Plants encode a unique class of sRNAs, called trans-acting small interfering RNAs (tasiRNAs, which post-transcriptionally regulate protein-coding transcripts, as do microRNAs (miRNAs, and both sRNA classes control development through their targets. TasiRNA biogenesis requires multiple components of the siRNA pathway and also miRNAs. But while 21mer siRNAs originating from transgenes can mediate silencing across several cell layers, miRNA action seems spatially restricted to the producing or closely surrounding cells. PRINCIPAL FINDINGS: We have previously described the isolation of a genetrap reporter line for TAS3a, the major locus producing AUXIN RESPONS FACTOR (ARF-regulating tasiRNAs in the Arabidopsis shoot. Its activity is limited to the adaxial (upper side of leaf primordia, thus spatially isolated from ARF-activities, which are located in the abaxial (lower side. We show here by in situ hybridization and reporter fusions that the silencing activities of ARF-regulating tasiRNAs are indeed manifested non-cell autonomously to spatially control ARF activities. CONCLUSIONS/SIGNIFICANCE: Endogenous tasiRNAs are thus mediators of a mobile developmental signal and might provide effective gene silencing at a distance beyond the reach of most miRNAs.

  18. microRNA-mediated R gene regulation: molecular scabbards for double-edged swords.

    Science.gov (United States)

    Deng, Yingtian; Liu, Minglei; Li, Xiaofei; Li, Feng

    2018-02-01

    Plant resistance (R) proteins are immune receptors that recognize pathogen effectors and trigger rapid defense responses, namely effector-triggered immunity. R protein-mediated pathogen resistance is usually race specific. During plant-pathogen coevolution, plant genomes accumulated large numbers of R genes. Even though plant R genes provide important natural resources for breeding disease-resistant crops, their presence in the plant genome comes at a cost. Misregulation of R genes leads to developmental defects, such as stunted growth and reduced fertility. In the past decade, many microRNAs (miRNAs) have been identified to target various R genes in plant genomes. miRNAs reduce R gene levels under normal conditions and allow induction of R gene expression under various stresses. For these reasons, we consider R genes to be double-edged "swords" and miRNAs as molecular "scabbards". In the present review, we summarize the contributions and potential problems of these "swords" and discuss the features and production of the "scabbards", as well as the mechanisms used to pull the "sword" from the "scabbard" when needed.

  19. PLGA Nanoparticles for Ultrasound-Mediated Gene Delivery to Solid Tumors

    Directory of Open Access Journals (Sweden)

    Marxa Figueiredo

    2012-01-01

    Full Text Available This paper focuses on novel approaches in the field of nanotechnology-based carriers utilizing ultrasound stimuli as a means to spatially target gene delivery in vivo, using nanoparticles made with either poly(lactic-co-glycolic acid (PLGA or other polymers. We specifically discuss the potential for gene delivery by particles that are echogenic (amenable to destruction by ultrasound composed either of polymers (PLGA, polystyrene or other contrast agent materials (Optison, SonoVue microbubbles. The use of ultrasound is an efficient tool to further enhance gene delivery by PLGA or other echogenic particles in vivo. Echogenic PLGA nanoparticles are an attractive strategy for ultrasound-mediated gene delivery since this polymer is currently approved by the US Food and Drug Administration for drug delivery and diagnostics in cancer, cardiovascular disease, and also other applications such as vaccines and tissue engineering. This paper will review recent successes and the potential of applying PLGA nanoparticles for gene delivery, which include (a echogenic PLGA used with ultrasound to enhance local gene delivery in tumors or muscle and (b PLGA nanoparticles currently under development, which could benefit in the future from ultrasound-enhanced tumor targeted gene delivery.

  20. Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH

    Directory of Open Access Journals (Sweden)

    Burgis Timothy A

    2009-07-01

    Full Text Available Abstract Background In recent years there has been an increasing problem with Staphylococcus aureus strains that are resistant to treatment with existing antibiotics. An important starting point for the development of new antimicrobial drugs is the identification of "essential" genes that are important for bacterial survival and growth. Results We have developed a robust microarray and PCR-based method, Transposon-Mediated Differential Hybridisation (TMDH, that uses novel bioinformatics to identify transposon inserts in genome-wide libraries. Following a microarray-based screen, genes lacking transposon inserts are re-tested using a PCR and sequencing-based approach. We carried out a TMDH analysis of the S. aureus genome using a large random mariner transposon library of around a million mutants, and identified a total of 351 S. aureus genes important for survival and growth in culture. A comparison with the essential gene list experimentally derived for Bacillus subtilis highlighted interesting differences in both pathways and individual genes. Conclusion We have determined the first comprehensive list of S. aureus essential genes. This should act as a useful starting point for the identification of potential targets for novel antimicrobial compounds. The TMDH methodology we have developed is generic and could be applied to identify essential genes in other bacterial pathogens.

  1. Plant-Mediated Changes in Soil N-Cycling Genes during Revegetation of Copper Mine Tailings

    Directory of Open Access Journals (Sweden)

    Yang Li

    2017-11-01

    Full Text Available Nitrogen limitation represents a major bottleneck during the revegetation of mine tailings. However, controls over key nitrogen-cycling genes in rhizospheric soils under differential vegetation management remain poorly understood. The abundance and transcriptional activity of nitrogen-cycling genes and the enzymatic activity of nitrogen transformation are mediated differentially during revegetation of mine tailings by Imperata cylindrica and Chrysopogon zizanioides plants. Results showed that the highest total organic carbon (TOC, total nitrogen (TN, and NH4+-N contents were found in the rhizosphere of I. cylindrica. The nifH gene abundances differed between I. cylindrica and C. zizanioides, and were higher in I. cylindrica which demonstrated by 3.39-fold higher mRNA transcript abundance of the nifH gene and a 2.15-fold higher nitrogen fixation rate in the rhizosphere. In addition, C. zizanioides exhibited a 4.94-fold higher transcript abundance of the archaeal amoA gene and the highest nitrification rate (1.706 ± 0.293 μg N-NO2- g−1 h−1 in the rhizosphere. In conclusion, I. cylindrica and C. zizanioides stimulated the abundances and activities of nifH gene and archaeal amoA gene, respectively. In addition, I. cylindrica appears to be capable of enhancing nitrogen fixation and exhibited accelerated nitrogen accumulation, which may be particularly useful for the rehabilitation of mine tailings.

  2. Characteristics of nobiletin-mediated alteration of gene expression in cultured cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Nemoto, Kiyomitsu, E-mail: nemoto@u-shizuoka-ken.ac.jp [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan); Ikeda, Ayaka; Yoshida, Chiaki; Kimura, Junko; Mori, Junki [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan); Fujiwara, Hironori [Department of Anti-Dementia Functional Food Development, Research Center of Supercritical Fluid Technology, Graduate School of Engineering, Tohoku University, 6-6-7 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Yokosuka, Akihito; Mimaki, Yoshihiro [Department of Medicinal Pharmacognosy, School of Pharmacy, Tokyo University of Pharmacy and Life Sciences, 1432-1 Horinouchi, Hachioji 192-0392 (Japan); Ohizumi, Yasushi [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan); Department of Anti-Dementia Functional Food Development, Research Center of Supercritical Fluid Technology, Graduate School of Engineering, Tohoku University, 6-6-7 Aoba, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Laboratory of Kampo Medicines, Yokohama College of Pharmacy, 601 Matano-cho, Totsuka-ku, Yokohama 245-0066 (Japan); Degawa, Masakuni [Department of Molecular Toxicology, School of Pharmaceutical Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka 422-8526 (Japan)

    2013-02-15

    Highlights: ► Nobiletin-mediated alterations of gene expression were examined with DNA microarrays. ► Three organ-derived cell lines were treated with 100 μM nobiletin for 24 h. ► In all cell lines, 3 endoplasmic reticulum stress-responsive genes were up-regulated. ► Some cell cycle-regulating and oxidative stress-promoting genes were down-regulated. ► These alterations may contribute to nobiletin-mediated biological effects. -- Abstract: Nobiletin, a polymethoxylated flavonoid that is highly contained in the peels of citrus fruits, exerts a wide variety of beneficial effects, including anti-proliferative effects in cancer cells, repressive effects in hyperlipidemia and hyperglycemia, and ameliorative effects in dementia at in vitro and in vivo levels. In the present study, to further understand the mechanisms of these actions of nobiletin, the nobiletin-mediated alterations of gene expression in three organ-derived cell lines – 3Y1 rat fibroblasts, HuH-7 human hepatocarcinoma cells, and SK-N-SH human neuroblastoma cells – were first examined with DNA microarrays. In all three cell lines, treatments with nobiletin (100 μM) for 24 h resulted in more than 200% increases in the expression levels of five genes, including the endoplasmic reticulum stress-responsive genes Ddit3, Trib3, and Asns, and in less than 50% decreases in the expression levels of seven genes, including the cell cycle-regulating genes Ccna2, Ccne2, and E2f8 and the oxidative stress-promoting gene Txnip. It was also confirmed that in each nobiletin-treated cell line, the levels of the DDIT3 (DNA-damage-inducible transcript 3, also known as CHOP and GADD153) and ASNS (asparagine synthetase) proteins were increased, while the level of the TXNIP (thioredoxin-interacting protein, also known as VDUP1 and TBP-2) protein was decreased. All these findings suggest that nobiletin exerts a wide variety of biological effects, at least partly, through induction of endoplasmic reticulum stress and

  3. The Agricultural Antibiotic Carbadox Induces Phage-mediated Gene Transfer in Salmonella

    Directory of Open Access Journals (Sweden)

    Bradley L. Bearson

    2014-02-01

    Full Text Available Antibiotics are used for disease therapeutic or preventative effects in humans and animals, as well as for enhanced feed conversion efficiency in livestock. Antibiotics can also cause undesirable effects in microbial populations, including selection for antibiotic resistance, enhanced pathogen invasion, and stimulation of horizontal gene transfer. Carbadox is a veterinary antibiotic used in the U.S. during the starter phase of swine production for improved feed efficiency and control of swine dysentery and bacterial swine enteritis. Carbadox has been shown in vitro to induce phage-encoded Shiga toxin in Shiga toxin-producing Escherichia coli and a phage-like element transferring antibiotic resistance genes in Brachyspira hyodysenteriae, but the effect of carbadox on prophages in other bacteria is unknown. This study examined carbadox exposure on prophage induction and genetic transfer in Salmonella enterica serovar Typhimurium, a human foodborne pathogen that frequently colonizes swine without causing disease. S. Typhimurium LT2 exposed to carbadox induced prophage production, resulting in bacterial cell lysis and release of virions that were visible by electron microscopy. Carbadox induction of phage-mediated gene transfer was confirmed by monitoring the transduction of a sodCIII::neo cassette in the Fels-1 prophage from LT2 to a recipient Salmonella strain. Furthermore, carbadox frequently induced generalized transducing phages in multidrug-resistant phage type DT104 and DT120 isolates, resulting in the transfer of chromosomal and plasmid DNA that included antibiotic resistance genes. Our research indicates that exposure of Salmonella to carbadox induces prophages that can transfer virulence and antibiotic resistance genes to susceptible bacterial hosts. Carbadox-induced, phage-mediated gene transfer could serve as a contributing factor in bacterial evolution during animal production, with prophages being a reservoir for bacterial fitness

  4. Altered gene synchrony suggests a combined hormone-mediated dysregulated state in major depression.

    Directory of Open Access Journals (Sweden)

    Chris Gaiteri

    2010-04-01

    Full Text Available Coordinated gene transcript levels across tissues (denoted "gene synchrony" reflect converging influences of genetic, biochemical and environmental factors; hence they are informative of the biological state of an individual. So could brain gene synchrony also integrate the multiple factors engaged in neuropsychiatric disorders and reveal underlying pathologies? Using bootstrapped Pearson correlation for transcript levels for the same genes across distinct brain areas, we report robust gene transcript synchrony between the amygdala and cingulate cortex in the human postmortem brain of normal control subjects (n = 14; Control/Permutated data, p<0.000001. Coordinated expression was confirmed across distinct prefrontal cortex areas in a separate cohort (n = 19 subjects and affected different gene sets, potentially reflecting regional network- and function-dependent transcriptional programs. Genewise regional transcript coordination was independent of age-related changes and array technical parameters. Robust shifts in amygdala-cingulate gene synchrony were observed in subjects with major depressive disorder (MDD, denoted here "depression" (n = 14; MDD/Permutated data, p<0.000001, significantly affecting between 100 and 250 individual genes (10-30% false discovery rate. Biological networks and signal transduction pathways corresponding to the identified gene set suggested putative dysregulated functions for several hormone-type factors previously implicated in depression (insulin, interleukin-1, thyroid hormone, estradiol and glucocorticoids; p<0.01 for association with depression-related networks. In summary, we showed that coordinated gene expression across brain areas may represent a novel molecular probe for brain structure/function that is sensitive to disease condition, suggesting the presence of a distinct and integrated hormone-mediated corticolimbic homeostatic, although maladaptive and pathological, state in major depression.

  5. Intravascular local gene transfer mediated by protein-coated metallic stent.

    Science.gov (United States)

    Yuan, J; Gao, R; Shi, R; Song, L; Tang, J; Li, Y; Tang, C; Meng, L; Yuan, W; Chen, Z

    2001-10-01

    To assess the feasibility, efficiency and selectivity of adenovirus-mediated gene transfer to local arterial wall by protein-coated metallic stent. A replication-defective recombinant adenovirus carrying the Lac Z reporter gene for nuclear-specific beta-galactosidase (Ad-beta gal) was used in this study. The coating for metallic stent was made by immersing it in a gelatin solution containing crosslinker. The coated stents were mounted on a 4.0 or 3.0 mm percutaneous transluminal coronary angioplasty (PTCA) balloon and submersed into a high-titer Ad-beta gal viral stock (2 x 10(10) pfu/ml) for 3 min, and then implanted into the carotid arteries in 4 mini-swines and into the left anterior descending branch of the coronary artery in 2 mini-swines via 8F large lumen guiding catheters. The animals were sacrificed 7 (n = 4), 14 (n = 1) and 21 (n = 1) days after implantation, respectively. The beta-galactosidase expression was assessed by X-gal staining. The results showed that the expression of transgene was detected in all animal. In 1 of carotid artery with an intact intima, the beta-gal expression was limited to endothelial cells. In vessels with denuded endothelium, gene expression was found in the sub-intima, media and adventitia. The transfection efficiency of medial smooth muscle cells was 38.6%. In 2 animals sacrificed 7 days after transfection, a microscopic examination of X-gal-stained samples did not show evidence of transfection in remote organs and arterial segments adjacent to the treated arterial site. Adenovirus-mediated arterial gene transfer to endothelial, smooth muscle cells and adventitia by protein-coated metallic stent is feasible. The transfection efficiency is higher. The coated stent may act as a good carrier of adenovirus-mediated gene transfer and have a potential to prevent restenosis following PTCA.

  6. DNA methylation mediated control of gene expression is critical for development of crown gall tumors.

    Directory of Open Access Journals (Sweden)

    Jochen Gohlke

    Full Text Available Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes

  7. Growth Inhibition of Breast Cancer in Rat by AAV Mediated Angiostatin Gene

    Institute of Scientific and Technical Information of China (English)

    LI Ran; CHEN Hong; REN Chang-shan

    2007-01-01

    Objective: To observe growth inhibition effect of adeno-associated viral vectors (AAV) mediated angiostatin (ANG) gene on implanted breast cancer in rat and its mechanism. Methods: Gene transfer technique was used to transfer AAV-ANG to the tumor. Growth curves were drawn to observe the growth of breast cancer implanted in rat, and immunohistochemical method was used to detect the effects of angiostatin on microvesel density (MVD) of breast cancer implanted in rat. Results: Angiostatin inhibited the growth of breast cancer implanted in rat and decreased the microvessel density of tumor. Conclusion: Expression of an angiostatin transgene can suppress the growth of breast cancer implanted in rat through the inhibition of the growth of microvessels, surggesting that angiostatin gene transfer technique may be effective against breast cancer.

  8. PLGA-Chitosan nanoparticle-mediated gene delivery for oral cancer treatment: A brief review

    Science.gov (United States)

    Bakar, L. M.; Abdullah, M. Z.; Doolaanea, A. A.; Ichwan, S. J. A.

    2017-08-01

    Cancer becomes a serious issue on society with increasing of their growth and proliferation, either in well economic developed countries or not. Recent years, oral cancer is one of the most threatening diseases impairing the quality of life of the patient. Scientists have emphasised on application of gene therapy for oral cancer by using nanoparticle as transportation vectors as a new alternative platform in order to overcome the limitations of conventional approaches. In modern medicine, nanotechnologies’ application, such as nanoparticles-mediated gene delivery, is one of promising tool for therapeutic devices. The objective of this article is to present a brief review summarizes on the current progress of nanotechnology-based gene delivery treatment system targeted for oral cancer.

  9. DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

    Science.gov (United States)

    Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

    2003-04-24

    Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

  10. ADA1 and NET1 genes of yeast mediate both chromosome maintenance and mitochondrial rho- mutagenesis

    International Nuclear Information System (INIS)

    Koltovaya, N.A.; Gerasimova, A.S.; Chekhuta, I.A.; Devin, A.B.

    2002-01-01

    An increase in the mitochondrial (mt) rho - mutagenesis is a well-known response of yeast cells to mutations in the numerous nuclear genes as well as to various kinds of stress. Notwithstanding the extensive studies during several decades the biological significance of this response is not yet fully understood. The genetic approach to solution of this subject includes the study of genes that are required for the high incidence of spontaneous rho - mutants. Previously we found that mutations in certain nuclear genes including CDC28, the central cell-cycle regulation gene, may decrease the spontaneous rho - mutability and simultaneously affect maintenance of the yeast chromosomes and plasmids. The present work provides data on identification of two more genes, resembling CDC28 in this respect. These genes NET1 and ADA1 mediate important regulatory protein-protein interactions in the yeast cell. The effects of net1 and ada1 mutations on the maintenance of yeast mt genome, chromosomes and plasmids as well on cell sensitivity to ionizing radiation are also described. (author)

  11. Adenovirus-mediated IL-12 gene therapy in combination with radiotherapy for murine liver cancer

    International Nuclear Information System (INIS)

    Wei Daoyan; Dai Bingbing; Wang Zhonghe; Chen Shishu

    2001-01-01

    Objective: To investigate the synergistic antitumor effects of adenovirus-mediated IL-12 gene therapy in combination with radiotherapy in mice bearing liver cancer. Methods: Balb/c mice bearing liver cancer received the treatment at day 1 with tumor local irradiation (TLI) of 20 Gy or mask irradiation when tumor size reached 0.6-1.0 cm. Within 1 hour after irradiation, adenovirus containing IL-12 gene or PBS was intra-tumor injected once a week. Forty-eight hours after the second injection, IFN-γ levels in sera and the supernatant of cultured spleen cells were assayed by ELISA, CTL activity of spleen cells was measured by 3 H-TdR release assay, and phenotypes of tumor-infiltrating lymphocytes were analysed by immunohistochemical staining. Results: The growth of tumors in animals treated with a combination of IL-12 gene therapy and TLI was inhibited more significantly than those with either single treatment (P + and CD8 + lymphocyte infiltration and tumor-specific cytolytic activities, and the levels of IFN-γ in sera were higher in IL-12 gene therapy and IL-12 gene therapy combined with TLI groups. Conclusion: These results suggest that IL-12 gene therapy combined with radiotherapy is more effective than both single treatment modalities and can induce specific antitumor immuno-response greatly

  12. ADA1 and NET1 Genes of Yeast Mediate Both Chromosome Maintenance and Mitochondrial $\\rho^{-}$ Mutagenesis

    CERN Document Server

    Koltovaya, N A; Tchekhouta, I A; Devin, A B

    2002-01-01

    An increase in the mitochondrial (mt) rho^- mutagenesis is a well-known respose of yeast cells to mutations in the numerous nuclear genes as well as to various kinds of stress. Notwithstanding the extensive studies during several decades the biological significance of this response is not yet fully understood. The genetic approach to solution of this subject includes the study of genes that are required for the high incidence of spontaneous rho^- mutants. Previously we found that mutations in certain nuclear genes including CDC28, the central cell-cycle regulation gene, may decrease the spontaneous rho^- mutability and simultaneously affect maintenance of the yeast chromosomes and plasmids. The present work provides data on identification of two more genes, resembling CDC28 in this respect. These genes NET1 and ADA1 mediate important regulatory protein-protein interactions in the yeast cell. The effects of net1 and ada1 mutations on the maintenance of yeast mt genome, chromosomes and plasmids as well as on ce...

  13. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  14. LA VÍA RB/E2F Y LA FAMILIA DE PROTEÍNAS REPRESORAS POLYCOMB EN EL DESARROLLO DE CÁNCER

    Directory of Open Access Journals (Sweden)

    MERCEDES IMELDA DÁVALOS-SALAS

    2011-01-01

    Full Text Available El control adecuado del ciclo celular mediante la acción coordinada de la familia de factores de transcripción E2F resulta ser clave para la homeostasis celular. El entender su modo de acción desde una perspectiva epigenética resulta ser un tema de gran actualidad y cambia la visión de cómo es regulado el ciclo celular. Uno de los principales reguladores epigenéticos está conformado por el grupo de proteínas Polycomb (PcG, relacionadas con procesos patológicos como el cáncer, a través de la desregulación a nivel epigenético de genes supresores de tumores como BRCA1, p16 y p53, entre otros. Con relación a lo anterior, la regulación del gen supresor Retinoblastoma (Rb ha sido ampliamente estudiado dada su importante participación como regulador negativo del ciclo celular, pero más reciente se ha demostrado que su modo de acción está relacionado con el grupo de proteínas PcG. Cada uno de los procesos que involucran a componentes de la familia de factores E2F, los miembros de Polycomb y la familia de proteína Rb, parecen ser en cierta medida independientes y, por ende, poco relacionados. Sin embargo, existen evidencias de una convergencia a nivel epigenético en la acción de estos conjuntos de moléculas reguladoras de la progresión del ciclo celular y su desregulación nos puede llevar a entender mejor su contribución al desarrollo de procesos patológicos como el cáncer.

  15. CTCF Mediates the Cell-Type Specific Spatial Organization of the Kcnq5 Locus and the Local Gene Regulation

    OpenAIRE

    Ren, Licheng; Wang, Yang; Shi, Minglei; Wang, Xiaoning; Yang, Zhong; Zhao, Zhihu

    2012-01-01

    Chromatin loops play important roles in the dynamic spatial organization of genes in the nucleus. Growing evidence has revealed that the multivalent functional zinc finger protein CCCTC-binding factor (CTCF) is a master regulator of genome spatial organization, and mediates the ubiquitous chromatin loops within the genome. Using circular chromosome conformation capture (4C) methodology, we discovered that CTCF may be a master organizer in mediating the spatial organization of the kcnq5 gene l...

  16. AAV2-mediated in vivo immune gene therapy of solid tumours

    LENUS (Irish Health Repository)

    Collins, Sara A

    2010-12-20

    Abstract Background Many strategies have been adopted to unleash the potential of gene therapy for cancer, involving a wide range of therapeutic genes delivered by various methods. Immune therapy has become one of the major strategies adopted for cancer gene therapy and seeks to stimulate the immune system to target tumour antigens. In this study, the feasibility of AAV2 mediated immunotherapy of growing tumours was examined, in isolation and combined with anti-angiogenic therapy. Methods Immune-competent Balb\\/C or C57 mice bearing subcutaneous JBS fibrosarcoma or Lewis Lung Carcinoma (LLC) tumour xenografts respectively were treated by intra-tumoural administration of AAV2 vector encoding the immune up-regulating cytokine granulocyte macrophage-colony stimulating factor (GM-CSF) and the co-stimulatory molecule B7-1 to subcutaneous tumours, either alone or in combination with intra-muscular (IM) delivery of AAV2 vector encoding Nk4 14 days prior to tumour induction. Tumour growth and survival was monitored for all animals. Cured animals were re-challenged with tumourigenic doses of the original tumour type. In vivo cytotoxicity assays were used to investigate establishment of cell-mediated responses in treated animals. Results AAV2-mediated GM-CSF, B7-1 treatment resulted in a significant reduction in tumour growth and an increase in survival in both tumour models. Cured animals were resistant to re-challenge, and induction of T cell mediated anti-tumour responses were demonstrated. Adoptive transfer of splenocytes to naïve animals prevented tumour establishment. Systemic production of Nk4 induced by intra-muscular (IM) delivery of Nk4 significantly reduced subcutaneous tumour growth. However, combination of Nk4 treatment with GM-CSF, B7-1 therapy reduced the efficacy of the immune therapy. Conclusions Overall, this study demonstrates the potential for in vivo AAV2 mediated immune gene therapy, and provides data on the inter-relationship between tumour

  17. Expression of PKA inhibitor (PKI) gene abolishes cAMP-mediated protection to endothelial barrier dysfunction.

    Science.gov (United States)

    Lum, H; Jaffe, H A; Schulz, I T; Masood, A; RayChaudhury, A; Green, R D

    1999-09-01

    We investigated the hypothesis that cAMP-dependent protein kinase (PKA) protects against endothelial barrier dysfunction in response to proinflammatory mediators. An E1-, E3-, replication-deficient adenovirus (Ad) vector was constructed containing the complete sequence of PKA inhibitor (PKI) gene (AdPKI). Infection of human microvascular endothelial cells (HMEC) with AdPKI resulted in overexpression of PKI. Treatment with 0.5 microM thrombin increased transendothelial albumin clearance rate (0.012 +/- 0.003 and 0.035 +/- 0.005 microl/min for control and thrombin, respectively); the increase was prevented with forskolin + 3-isobutyl-1-methylxanthine (F + I) treatment. Overexpression of PKI resulted in abrogation of the F + I-induced inhibition of the permeability increase. However, with HMEC infected with ultraviolet-inactivated AdPKI, the F + I-induced inhibition was present. Also, F + I treatment of HMEC transfected with reporter plasmid containing the cAMP response element-directed transcription of the luciferase gene resulted in an almost threefold increase in luciferase activity. Overexpression of PKI inhibited this induction of luciferase activity. The results show that Ad-mediated overexpression of PKI in endothelial cells abrogated the cAMP-mediated protection against increased endothelial permeability, providing direct evidence that cAMP-dependent protein kinase promotes endothelial barrier function.

  18. Comparison of lentiviral and sleeping beauty mediated αβ T cell receptor gene transfer.

    Directory of Open Access Journals (Sweden)

    Anne-Christine Field

    Full Text Available Transfer of tumour antigen-specific receptors to T cells requires efficient delivery and integration of transgenes, and currently most clinical studies are using gamma retroviral or lentiviral systems. Whilst important proof-of-principle data has been generated for both chimeric antigen receptors and αβ T cell receptors, the current platforms are costly, time-consuming and relatively inflexible. Alternative, more cost-effective, Sleeping Beauty transposon-based plasmid systems could offer a pathway to accelerated clinical testing of a more diverse repertoire of recombinant high affinity T cell receptors. Nucleofection of hyperactive SB100X transposase-mediated stable transposition of an optimised murine-human chimeric T cell receptor specific for Wilm's tumour antigen from a Sleeping Beauty transposon plasmid. Whilst transfer efficiency was lower than that mediated by lentiviral transduction, cells could be readily enriched and expanded, and mediated effective target cells lysis in vitro and in vivo. Integration sites of transposed TCR genes in primary T cells were almost randomly distributed, contrasting the predilection of lentiviral vectors for transcriptionally active sites. The results support exploitation of the Sleeping Beauty plasmid based system as a flexible and adaptable platform for accelerated, early-phase assessment of T cell receptor gene therapies.

  19. [PRODUCT OF THE BMI1--A KEY COMPONENT OF POLYCOMB--POSITIVELY REGULATES ADIPOCYTE DIFFERENTIATION OF MOUSE MESENCHYMAL STEM CELLS].

    Science.gov (United States)

    Petrov, N S; Vereschagina, N A; Sushilova, E N; Kropotov, A V; Miheeva, N F; Popov, B V

    2016-01-01

    Bmil is a key component of Polycomb (PcG), which in mammals controls the basic functions of mammalian somatic stem cells (SSC) such as self-renewal and differentiation. Bmi1 supports SSC via transcriptional suppression of genes associated with cell cycle and differentiation. The most studied target genes of Bmi1 are the genes of Ink4 locus, CdkI p16(Ink4a) and p1(Arf), suppression of which due to activating mutations of the BMI1 results in formation of cancer stem cells (CSC) and carcinomas in various tissues. In contrast, inactivation of BMI1 results in cell cycle arrest and cell senescence. Although clinical phenomena of hypo- and hyperactivation of BMI1 are well known, its targets and mechanisms of regulation of tissue specific SSC are still obscure. The goal of this study was to evaluate the regulatory role of BMI1 in adipocyte differentiation (AD) of mouse mesenchymal stem cells (MSC). Induction of AD in mouse MSC of the C3H10T1/2 cell line was associated with an increase in the expression levels of BMI1, the genes of pRb family (RB, p130) and demethylase UTX, but not methyltransferase EZH2, whose products regulate the methylation levels of H3K27. It was observed earlier that H3K27me3 may play the role of the epigenetic switch by promoting AD of human MSC via activating expression of the PPARγ2, the master gene of AD (Hemming et al., 2014). Here we show that inactivation of BMI1 using specific siRNA slows and decreases the levels of AD, but does not abolish it. This is associated with a complete inhibition of the expression of adipogenic marker genes--PPARγ2, ADIPOQ and a decrease in the expression of RB, p130, but not UTX. The results obtained give evidence that the epigenetic mechanism regulating AD differentiation in mouse and human MSC is different.

  20. Agrobacterium Mediated Transient Gene Silencing (AMTS) in Stevia rebaudiana: Insights into Steviol Glycoside Biosynthesis Pathway

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2013-01-01

    Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961

  1. Agrobacterium mediated transient gene silencing (AMTS in Stevia rebaudiana: insights into steviol glycoside biosynthesis pathway.

    Directory of Open Access Journals (Sweden)

    Praveen Guleria

    Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.

  2. The functions of Mediator in Candida albicans support a role in shaping species-specific gene expression.

    Directory of Open Access Journals (Sweden)

    Nathalie Uwamahoro

    Full Text Available The Mediator complex is an essential co-regulator of RNA polymerase II that is conserved throughout eukaryotes. Here we present the first study of Mediator in the pathogenic fungus Candida albicans. We focused on the Middle domain subunit Med31, the Head domain subunit Med20, and Srb9/Med13 from the Kinase domain. The C. albicans Mediator shares some roles with model yeasts Saccharomyces cerevisiae and Schizosaccharomyces pombe, such as functions in the response to certain stresses and the role of Med31 in the expression of genes regulated by the activator Ace2. The C. albicans Mediator also has additional roles in the transcription of genes associated with virulence, for example genes related to morphogenesis and gene families enriched in pathogens, such as the ALS adhesins. Consistently, Med31, Med20, and Srb9/Med13 contribute to key virulence attributes of C. albicans, filamentation, and biofilm formation; and ALS1 is a biologically relevant target of Med31 for development of biofilms. Furthermore, Med31 affects virulence of C. albicans in the worm infection model. We present evidence that the roles of Med31 and Srb9/Med13 in the expression of the genes encoding cell wall adhesins are different between S. cerevisiae and C. albicans: they are repressors of the FLO genes in S. cerevisiae and are activators of the ALS genes in C. albicans. This suggests that Mediator subunits regulate adhesion in a distinct manner between these two distantly related fungal species.

  3. Novel Hematopoietic Target Genes in the NRF2-Mediated Transcriptional Pathway

    Directory of Open Access Journals (Sweden)

    Michelle R. Campbell

    2013-01-01

    Full Text Available Nuclear factor- (erythroid-derived 2 like 2 (NFE2L2, NRF2 is a key transcriptional activator of the antioxidant response pathway and is closely related to erythroid transcription factor NFE2. Under oxidative stress, NRF2 heterodimerizes with small Maf proteins and binds cis-acting enhancer sequences found near oxidative stress response genes. Using the dietary isothiocyanate sulforaphane (SFN to activate NRF2, chromatin immunoprecipitation sequencing (ChIP-seq identified several hundred novel NRF2-mediated targets beyond its role in oxidative stress. Activated NRF2 bound the antioxidant response element (ARE in promoters of several known and novel target genes involved in iron homeostasis and heme metabolism, including known targets FTL and FTH1, as well as novel binding in the globin locus control region. Five novel NRF2 target genes were chosen for followup: AMBP, ABCB6, FECH, HRG-1 (SLC48A1, and TBXAS1. SFN-induced gene expression in erythroid K562 and lymphoid cells were compared for each target gene. NRF2 silencing showed reduced expression in lymphoid, lung, and hepatic cells. Furthermore, stable knockdown of NRF2 negative regulator KEAP1 in K562 cells resulted in increased NQO1, AMBP, and TBXAS1 expression. NFE2 binding sites in K562 cells revealed similar binding profiles as lymphoid NRF2 sites in all potential NRF2 candidates supporting a role for NRF2 in heme metabolism and erythropoiesis.

  4. Ultradian hormone stimulation induces glucocorticoid receptor-mediated pulses of gene transcription.

    Science.gov (United States)

    Stavreva, Diana A; Wiench, Malgorzata; John, Sam; Conway-Campbell, Becky L; McKenna, Mervyn A; Pooley, John R; Johnson, Thomas A; Voss, Ty C; Lightman, Stafford L; Hager, Gordon L

    2009-09-01

    Studies on glucocorticoid receptor (GR) action typically assess gene responses by long-term stimulation with synthetic hormones. As corticosteroids are released from adrenal glands in a circadian and high-frequency (ultradian) mode, such treatments may not provide an accurate assessment of physiological hormone action. Here we demonstrate that ultradian hormone stimulation induces cyclic GR-mediated transcriptional regulation, or gene pulsing, both in cultured cells and in animal models. Equilibrium receptor-occupancy of regulatory elements precisely tracks the ligand pulses. Nascent RNA transcripts from GR-regulated genes are released in distinct quanta, demonstrating a profound difference between the transcriptional programs induced by ultradian and constant stimulation. Gene pulsing is driven by rapid GR exchange with response elements and by GR recycling through the chaperone machinery, which promotes GR activation and reactivation in response to the ultradian hormone release, thus coupling promoter activity to the naturally occurring fluctuations in hormone levels. The GR signalling pathway has been optimized for a prompt and timely response to fluctuations in hormone levels, indicating that biologically accurate regulation of gene targets by GR requires an ultradian mode of hormone stimulation.

  5. Bacteriophage Mediates Efficient Gene Transfer in Combination with Conventional Transfection Reagents.

    Science.gov (United States)

    Donnelly, Amanda; Yata, Teerapong; Bentayebi, Kaoutar; Suwan, Keittisak; Hajitou, Amin

    2015-12-08

    The development of commercially available transfection reagents for gene transfer applications has revolutionized the field of molecular biology and scientific research. However, the challenge remains in ensuring that they are efficient, safe, reproducible and cost effective. Bacteriophage (phage)-based viral vectors have the potential to be utilized for general gene transfer applications within research and industry. Yet, they require adaptations in order to enable them to efficiently enter cells and overcome mammalian cellular barriers, as they infect bacteria only; furthermore, limited progress has been made at increasing their efficiency. The production of a novel hybrid nanocomplex system consisting of two different nanomaterial systems, phage vectors and conventional transfection reagents, could overcome these limitations. Here we demonstrate that the combination of cationic lipids, cationic polymers or calcium phosphate with M13 bacteriophage-derived vectors, engineered to carry a mammalian transgene cassette, resulted in increased cellular attachment, entry and improved transgene expression in human cells. Moreover, addition of a targeting ligand into the nanocomplex system, through genetic engineering of the phage capsid further increased gene expression and was effective in a stable cell line generation application. Overall, this new hybrid nanocomplex system (i) provides enhanced phage-mediated gene transfer; (ii) is applicable for laboratory transfection processes and (iii) shows promise within industry for large-scale gene transfer applications.

  6. Mechanisms of HO-1 mediated attenuation of renal immune injury: a gene profiling study.

    Science.gov (United States)

    Duann, Pu; Lianos, Elias A

    2011-10-01

    Using a mouse model of immune injury directed against the renal glomerular vasculature and resembling human forms of glomerulonephritis (GN), we assessed the effect of targeted expression of the cytoprotective enzyme heme oxygenase (HO)-1. A human (h) HO-1 complementary DNAN (cDNA) sequence was targeted to glomerular epithelial cells (GECs) using a GEC-specific murine nephrin promoter. Injury by administration of antibody against the glomerular basement membrane (anti-GBM) to transgenic (TG) mice with GEC-targeted hHO-1 was attenuated compared with wild-type (WT) controls. To explore changes in the expression of genes that could mediate this salutary effect, we performed gene expression profiling using a microarray analysis of RNA isolated from the renal cortex of WT or TG mice with or without anti-GBM antibody-induced injury. Significant increases in expression were detected in 9 major histocompatibility complex (MHC)-class II genes, 2 interferon-γ (IFN-γ)-inducible guanosine triphosphate (GTP)ases, and 3 genes of the ubiquitin-proteasome system. The increase in MHC-class II and proteasome gene expression in TG mice with injury was validated by real-time polymerase chain reaction (PCR) or Western blot analysis. The observations point to novel mechanisms underlying the cytoprotective effect of HO-1 in renal immune injury. Copyright © 2011. Published by Mosby, Inc.

  7. Bistability and oscillations in gene regulation mediated by small noncoding RNAs.

    Directory of Open Access Journals (Sweden)

    Dengyu Liu

    Full Text Available The interplay of small noncoding RNAs (sRNAs, mRNAs, and proteins has been shown to play crucial roles in almost all cellular processes. As key post-transcriptional regulators of gene expression, the mechanisms and roles of sRNAs in various cellular processes still need to be fully understood. When participating in cellular processes, sRNAs mainly mediate mRNA degradation or translational repression. Here, we show how the dynamics of two minimal architectures is drastically affected by these two mechanisms. A comparison is also given to reveal the implication of the fundamental differences. This study may help us to analyze complex networks assembled by simple modules more easily. A better knowledge of the sRNA-mediated motifs is also of interest for bio-engineering and artificial control.

  8. Mediatization

    DEFF Research Database (Denmark)

    Hjarvard, Stig

    2017-01-01

    Mediatization research shares media effects studies' ambition of answering the difficult questions with regard to whether and how media matter and influence contemporary culture and society. The two approaches nevertheless differ fundamentally in that mediatization research seeks answers...... to these general questions by distinguishing between two concepts: mediation and mediatization. The media effects tradition generally considers the effects of the media to be a result of individuals being exposed to media content, i.e. effects are seen as an outcome of mediated communication. Mediatization...... research is concerned with long-term structural changes involving media, culture, and society, i.e. the influences of the media are understood in relation to how media are implicated in social and cultural changes and how these processes come to create new conditions for human communication and interaction...

  9. ERK1/2 mediates glucose-regulated POMC gene expression in hypothalamic neurons.

    Science.gov (United States)

    Zhang, Juan; Zhou, Yunting; Chen, Cheng; Yu, Feiyuan; Wang, Yun; Gu, Jiang; Ma, Lian; Ho, Guyu

    2015-04-01

    Hypothalamic glucose-sensing neurons regulate the expression of genes encoding feeding-related neuropetides POMC, AgRP, and NPY - the key components governing metabolic homeostasis. AMP-activated protein kinase (AMPK) is postulated to be the molecular mediator relaying glucose signals to regulate the expression of these neuropeptides. Whether other signaling mediator(s) plays a role is not clear. In this study, we investigated the role of ERK1/2 using primary hypothalamic neurons as the model system. The primary neurons were differentiated from hypothalamic progenitor cells. The differentiated neurons possessed the characteristic neuronal cell morphology and expressed neuronal post-mitotic markers as well as leptin-regulated orexigenic POMC and anorexigenic AgRP/NPY genes. Treatment of cells with glucose dose-dependently increased POMC and decreased AgRP/NPY expression with a concurrent suppression of AMPK phosphorylation. In addition, glucose treatment dose-dependently increased the ERK1/2 phosphorylation. Blockade of ERK1/2 activity with its specific inhibitor PD98059 partially (approximately 50%) abolished glucose-induced POMC expression, but had little effect on AgRP/NPY expression. Conversely, blockade of AMPK activity with its specific inhibitor produced a partial (approximately 50%) reversion of low-glucose-suppressed POMC expression, but almost completely blunted the low-glucose-induced AgRP/NPY expression. The results indicate that ERK1/2 mediated POMC but not AgRP/NPY expression. Confirming the in vitro findings, i.c.v. administration of PD98059 in rats similarly attenuated glucose-induced POMC expression in the hypothalamus, but again had little effect on AgRP/NPY expression. The results are indicative of a novel role of ERK1/2 in glucose-regulated POMC expression and offer new mechanistic insights into hypothalamic glucose sensing. © 2015 Society for Endocrinology.

  10. Tyrosine kinase chromosomal translocations mediate distinct and overlapping gene regulation events

    International Nuclear Information System (INIS)

    Kim, Hani; Gillis, Lisa C; Jarvis, Jordan D; Yang, Stuart; Huang, Kai; Der, Sandy; Barber, Dwayne L

    2011-01-01

    Leukemia is a heterogeneous disease commonly associated with recurrent chromosomal translocations that involve tyrosine kinases including BCR-ABL, TEL-PDGFRB and TEL-JAK2. Most studies on the activated tyrosine kinases have focused on proximal signaling events, but little is known about gene transcription regulated by these fusions. Oligonucleotide microarray was performed to compare mRNA changes attributable to BCR-ABL, TEL-PDGFRB and TEL-JAK2 after 1 week of activation of each fusion in Ba/F3 cell lines. Imatinib was used to control the activation of BCR-ABL and TEL-PDGFRB, and TEL-JAK2-mediated gene expression was examined 1 week after Ba/F3-TEL-JAK2 cells were switched to factor-independent conditions. Microarray analysis revealed between 800 to 2000 genes induced or suppressed by two-fold or greater by each tyrosine kinase, with a subset of these genes commonly induced or suppressed among the three fusions. Validation by Quantitative PCR confirmed that eight genes (Dok2, Mrvi1, Isg20, Id1, gp49b, Cxcl10, Scinderin, and collagen Vα1(Col5a1)) displayed an overlapping regulation among the three tested fusion proteins. Stat1 and Gbp1 were induced uniquely by TEL-PDGFRB. Our results suggest that BCR-ABL, TEL-PDGFRB and TEL-JAK2 regulate distinct and overlapping gene transcription profiles. Many of the genes identified are known to be involved in processes associated with leukemogenesis, including cell migration, proliferation and differentiation. This study offers the basis for further work that could lead to an understanding of the specificity of diseases caused by these three chromosomal translocations

  11. Adenoviral vector-mediated gene transfer and neurotransplantation : possibilities and limitations in grafting of the fetal rat suprachiasmatic nucleus

    NARCIS (Netherlands)

    van Esseveldt, K E; Liu, R.; Hermens, W.T.J.M.C.; Verhaagen, J; Boer, G J

    Several studies have reported on the use of primary neural cells transduced by adenoviral vectors as donor cells in neurotransplantation. In the present investigation, we examined whether adenoviral vector-mediated gene transfer could be used to introduce and express a foreign gene in solid neural

  12. Up-regulation of integrin β3 in radioresistant pancreatic cancer impairs adenovirus-mediated gene therapy

    International Nuclear Information System (INIS)

    Egami, Takuya; Ohuchida, Kenoki; Yasui, Takaharu; Onimaru, Manabu; Toma, Hiroki; Sato, Norihiro; Tanaka, Masao; Mizumoto, Kazuhiro; Matsumoto, Kunio

    2009-01-01

    Adenovirus-mediated gene therapy is a promising approach for the treatment of pancreatic cancer. We previously reported that radiation enhanced adenovirus-mediated gene expression in pancreatic cancer, suggesting that adenoviral gene therapy might be more effective in radioresistant pancreatic cancer cells. In the present study, we compared the transduction efficiency of adenovirus-delivered genes in radiosensitive and radioresistant cells, and investigated the underlying mechanisms. We used an adenovirus expressing the hepatocyte growth factor antagonist, NK4 (Ad-NK4), as a representative gene therapy. We established two radioresistant human pancreatic cancer cell lines using fractionated irradiation. Radiosensitive and radioresistant pancreatic cancer cells were infected with Ad-NK4, and NK4 levels in the cells were measured. In order to investigate the mechanisms responsible for the differences in the transduction efficiency between these cells, we measured expression of the genes mediating adenovirus infection and endocytosis. The results revealed that NK4 levels in radioresistant cells were significantly lower (P<0.01) than those in radiosensitive cells, although there were no significant differences in adenovirus uptake between radiosensitive cells and radioresistant cells. Integrin β3 was up-regulated and the Coxsackie virus and adenovirus receptor was down-regulated in radioresistant cells, and inhibition of integrin β3 promoted adenovirus gene transfer. These results suggest that inhibition of integrin β3 in radioresistant pancreatic cancer cells could enhance adenovirus-mediated gene therapy. (author)

  13. A novel radiation responsive cis-acting element regulates gene induction and mediates tissue injury

    International Nuclear Information System (INIS)

    Hallahan, Dennis E.; Virudachalam, Subbulakshmi; Kuchibahtla, Jaya

    1997-01-01

    Purpose: The intracellular adhesion molecule (ICAM-1) binds and activates inflammatory cells and thereby contributes to the pathogenesis of tissue injury. To characterize a model for radiation-induction of tissue injury, we studied radiation-mediated lung injury in mice deficient in the ICAM-1 gene. To study the mechanisms of x-ray mediated ICAM induction, we studied transcriptional activation of the ICAM promoter and nuclear protein binding to the 5' untranslated region of the ICAM gene. Methods: Immunohistochemistry and immunofluorescence were used to study the histologic pattern of ICAM expression in irradiated tissue. The ICAM-1 knockout mice were bred with wild type mice to create heterozygous mice with attenuated ICAM expression. ICAM -/-, ICAM+/- and ICAM +/+ mice were treated with thoracic irradiation and lung sections were stained for leukocyte common antigen (CD45) to study inflammation. To study the mechanism of x-ray induction of ICAM, we linked the 5' untranslated region of the ICAM gene to the luciferase reporter gene and delated DNA segments from the promoter to determine which elements are required for induction. We performed electrophoretic mobility shift analysis of nuclear proteins from irradiated endothelial cells to study transcription factor activation. Results: Immunohistochemistry showed dose and time dependent increases in ICAM protein expression in irradiated lungs which was prolonged as compared to endothelial cells in vitro. The histologic pattern of ICAM expression was in the capillary endothelium and was distinct from the pattern of expression of other radiation-inducible adhesion molecules. ICAM knockout mice had no ICAM expression and no inflammatory cell accumulation in the irradiated lung. ICAM+/+ mice developed leukocyte adhesion to irradiated endothelium within hours of irradiation and radiation pneumonitis 5 to 6 weeks later. The DNA sequence between -981 and -769 (relative to start codon) contains two 16-base pair repeats, each

  14. Ultrasound-mediated vascular gene transfection by cavitation of endothelial-targeted cationic microbubbles.

    Science.gov (United States)

    Xie, Aris; Belcik, Todd; Qi, Yue; Morgan, Terry K; Champaneri, Shivam A; Taylor, Sarah; Davidson, Brian P; Zhao, Yan; Klibanov, Alexander L; Kuliszewski, Michael A; Leong-Poi, Howard; Ammi, Azzdine; Lindner, Jonathan R

    2012-12-01

    Ultrasound-mediated gene delivery can be amplified by acoustic disruption of microbubble carriers that undergo cavitation. We hypothesized that endothelial targeting of microbubbles bearing cDNA is feasible and, through optimizing proximity to the vessel wall, increases the efficacy of gene transfection. Contrast ultrasound-mediated gene delivery is a promising approach for site-specific gene therapy, although there are concerns with the reproducibility of this technique and the safety when using high-power ultrasound. Cationic lipid-shelled decafluorobutane microbubbles bearing a targeting moiety were prepared and compared with nontargeted microbubbles. Microbubble targeting efficiency to endothelial adhesion molecules (P-selectin or intercellular adhesion molecule [ICAM]-1) was tested using in vitro flow chamber studies, intravital microscopy of tumor necrosis factor-alpha (TNF-α)-stimulated murine cremaster muscle, and targeted contrast ultrasound imaging of P-selectin in a model of murine limb ischemia. Ultrasound-mediated transfection of luciferase reporter plasmid charge coupled to microbubbles in the post-ischemic hindlimb muscle was assessed by in vivo optical imaging. Charge coupling of cDNA to the microbubble surface was not influenced by the presence of targeting ligand, and did not alter the cavitation properties of cationic microbubbles. In flow chamber studies, surface conjugation of cDNA did not affect attachment of targeted microbubbles at microvascular shear stresses (0.6 and 1.5 dyne/cm(2)). Attachment in vivo was also not affected by cDNA according to intravital microscopy observations of venular adhesion of ICAM-1-targeted microbubbles and by ultrasound molecular imaging of P-selectin-targeted microbubbles in the post-ischemic hindlimb in mice. Transfection at the site of high acoustic pressures (1.0 and 1.8 MPa) was similar for control and P-selectin-targeted microbubbles but was associated with vascular rupture and hemorrhage. At 0.6 MPa

  15. Discovery and Molecular Basis of a Diverse Set of Polycomb Repressive Complex 2 Inhibitors Recognition by EED.

    Directory of Open Access Journals (Sweden)

    Ling Li

    Full Text Available Polycomb repressive complex 2 (PRC2, a histone H3 lysine 27 methyltransferase, plays a key role in gene regulation and is a known epigenetics drug target for cancer therapy. The WD40 domain-containing protein EED is the regulatory subunit of PRC2. It binds to the tri-methylated lysine 27 of the histone H3 (H3K27me3, and through which stimulates the activity of PRC2 allosterically. Recently, we disclosed a novel PRC2 inhibitor EED226 which binds to the K27me3-pocket on EED and showed strong antitumor activity in xenograft mice model. Here, we further report the identification and validation of four other EED binders along with EED162, the parental compound of EED226. The crystal structures for all these five compounds in complex with EED revealed a common deep pocket induced by the binding of this diverse set of compounds. This pocket was created after significant conformational rearrangement of the aromatic cage residues (Y365, Y148 and F97 in the H3K27me3 binding pocket of EED, the width of which was delineated by the side chains of these rearranged residues. In addition, all five compounds interact with the Arg367 at the bottom of the pocket. Each compound also displays unique features in its interaction with EED, suggesting the dynamics of the H3K27me3 pocket in accommodating the binding of different compounds. Our results provide structural insights for rational design of novel EED binder for the inhibition of PRC2 complex activity.

  16. Loop mediated isothermal amplification: An innovative gene amplification technique for animal diseases

    Directory of Open Access Journals (Sweden)

    Pravas Ranjan Sahoo

    2016-05-01

    Full Text Available India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.

  17. Loop mediated isothermal amplification: An innovative gene amplification technique for animal diseases.

    Science.gov (United States)

    Sahoo, Pravas Ranjan; Sethy, Kamadev; Mohapatra, Swagat; Panda, Debasis

    2016-05-01

    India being a developing country mainly depends on livestock sector for its economy. However, nowadays, there is emergence and reemergence of more transboundary animal diseases. The existing diagnostic techniques are not so quick and with less specificity. To reduce the economy loss, there should be a development of rapid, reliable, robust diagnostic technique, which can work with high degree of sensitivity and specificity. Loop mediated isothermal amplification assay is a rapid gene amplification technique that amplifies nucleic acid under an isothermal condition with a set of designed primers spanning eight distinct sequences of the target. This assay can be used as an emerging powerful, innovative gene amplification diagnostic tool against various pathogens of livestock diseases. This review is to highlight the basic concept and methodology of this assay in livestock disease.

  18. Ultrasound-Mediated Drug/Gene Delivery in Solid Tumor Treatment

    Directory of Open Access Journals (Sweden)

    Yufeng Zhou

    2013-01-01

    Full Text Available Ultrasound is an emerging modality for drug delivery in chemotherapy. This paper reviews this novel technology by first introducing the designs and characteristics of three classes of drug/gene vehicles, microbubble (including nanoemulsion, liposomes, and micelles. In comparison to conventional free drug, the targeted drug-release and delivery through vessel wall and interstitial space to cancerous cells can be activated and enhanced under certain sonication conditions. In the acoustic field, there are several reactions of these drug vehicles, including hyperthermia, bubble cavitation, sonoporation, and sonodynamics, whose physical properties are illustrated for better understanding of this approach. In vitro and in vivo results are summarized, and future directions are discussed. Altogether, ultrasound-mediated drug/gene delivery under imaging guidance provides a promising option in cancer treatment with enhanced agent release and site specificity and reduced toxicity.

  19. Protein kinase D1 signaling in angiogenic gene expression and VEGF-mediated angiogenesis

    Directory of Open Access Journals (Sweden)

    Bin eRen MD, Phd, FAHA

    2016-05-01

    Full Text Available Protein kinase D 1 (PKD-1 is a signaling kinase important in fundamental cell functions including migration, proliferation and differentiation. PKD-1 is also a key regulator of gene expression and angiogenesis that is essential for cardiovascular development and tumor progression. Further understanding molecular aspects of PKD-1 signaling in the regulation of angiogenesis may have translational implications in obesity, cardiovascular disease and cancer. The author will summarize and provide the insights into molecular mechanisms by which PKD-1 regulates transcriptional expression of angiogenic genes, focusing on the transcriptional regulation of CD36 by PKD-1-FoxO1 signaling axis along with the potential implications of this axis in arterial differentiation and morphogenesis. He will also discuss a new concept of dynamic balance between proangiogenic and antiangiogenic signaling in determining angiogenic switch, and stress how PKD-1 signaling regulates VEGF signaling-mediated angiogenesis.

  20. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression

    Science.gov (United States)

    Lebreton, Alice; Cossart, Pascale

    2017-01-01

    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  1. Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

    International Nuclear Information System (INIS)

    Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

    2013-01-01

    In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

  2. Gene-diet-interactions in folate-mediated one-carbon metabolism modify colon cancer risk.

    Science.gov (United States)

    Liu, Amy Y; Scherer, Dominique; Poole, Elizabeth; Potter, John D; Curtin, Karen; Makar, Karen; Slattery, Martha L; Caan, Bette J; Ulrich, Cornelia M

    2013-04-01

    The importance of folate-mediated one-carbon metabolism (FOCM) in colorectal carcinogenesis is emphasized by observations that high dietary folate intake is associated with decreased risk of colon cancer (CC) and its precursors. Additionally, polymorphisms in FOCM-related genes have been repeatedly associated with risk, supporting a causal relationship between folate and colorectal carcinogenesis. We investigated ten candidate polymorphisms with defined or probable functional impact in eight FOCM-related genes (SHMT1, DHFR, DNMT1, MTHFD1, MTHFR, MTRR, TCN2, and TDG) in 1609 CC cases and 1974 controls for association with CC risk and for interaction with dietary factors. No polymorphism was statistically significantly associated with overall risk of CC. However, statistically significant interactions modifying CC risk were observed for DNMT1 I311V with dietary folate, methionine, vitamin B2 , and vitamin B12 intake and for MTRR I22M with dietary folate, a predefined one-carbon dietary pattern, and vitamin B6 intake. We observed statistically significant gene-diet interactions with five additional polymorphisms. Our results provide evidence that FOCM-related dietary intakes modify the association between CC risk and FOCM allelic variants. These findings add to observations showing that folate-related gene-nutrient interactions play an important role in modifying the risk of CC. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Recombinase-mediated reprogramming and dystrophin gene addition in mdx mouse induced pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Chunli Zhao

    Full Text Available A cell therapy strategy utilizing genetically-corrected induced pluripotent stem cells (iPSC may be an attractive approach for genetic disorders such as muscular dystrophies. Methods for genetic engineering of iPSC that emphasize precision and minimize random integration would be beneficial. We demonstrate here an approach in the mdx mouse model of Duchenne muscular dystrophy that focuses on the use of site-specific recombinases to achieve genetic engineering. We employed non-viral, plasmid-mediated methods to reprogram mdx fibroblasts, using phiC31 integrase to insert a single copy of the reprogramming genes at a safe location in the genome. We next used Bxb1 integrase to add the therapeutic full-length dystrophin cDNA to the iPSC in a site-specific manner. Unwanted DNA sequences, including the reprogramming genes, were then precisely deleted with Cre resolvase. Pluripotency of the iPSC was analyzed before and after gene addition, and ability of the genetically corrected iPSC to differentiate into myogenic precursors was evaluated by morphology, immunohistochemistry, qRT-PCR, FACS analysis, and intramuscular engraftment. These data demonstrate a non-viral, reprogramming-plus-gene addition genetic engineering strategy utilizing site-specific recombinases that can be applied easily to mouse cells. This work introduces a significant level of precision in the genetic engineering of iPSC that can be built upon in future studies.

  4. BDNF gene delivery mediated by neuron-targeted nanoparticles is neuroprotective in peripheral nerve injury.

    Science.gov (United States)

    Lopes, Cátia D F; Gonçalves, Nádia P; Gomes, Carla P; Saraiva, Maria J; Pêgo, Ana P

    2017-03-01

    Neuron-targeted gene delivery is a promising strategy to treat peripheral neuropathies. Here we propose the use of polymeric nanoparticles based on thiolated trimethyl chitosan (TMCSH) to mediate targeted gene delivery to peripheral neurons upon a peripheral and minimally invasive intramuscular administration. Nanoparticles were grafted with the non-toxic carboxylic fragment of the tetanus neurotoxin (HC) to allow neuron targeting and were explored to deliver a plasmid DNA encoding for the brain-derived neurotrophic factor (BDNF) in a peripheral nerve injury model. The TMCSH-HC/BDNF nanoparticle treatment promoted the release and significant expression of BDNF in neural tissues, which resulted in an enhanced functional recovery after injury as compared to control treatments (vehicle and non-targeted nanoparticles), associated with an improvement in key pro-regenerative events, namely, the increased expression of neurofilament and growth-associated protein GAP-43 in the injured nerves. Moreover, the targeted nanoparticle treatment was correlated with a significantly higher density of myelinated axons in the distal stump of injured nerves, as well as with preservation of unmyelinated axon density as compared with controls and a protective role in injury-denervated muscles, preventing them from denervation. These results highlight the potential of TMCSH-HC nanoparticles as non-viral gene carriers to deliver therapeutic genes into the peripheral neurons and thus, pave the way for their use as an effective therapeutic intervention for peripheral neuropathies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Stabilizing in vitro ultrasound-mediated gene transfection by regulating cavitation.

    Science.gov (United States)

    Lo, Chia-Wen; Desjouy, Cyril; Chen, Shing-Ru; Lee, Jyun-Lin; Inserra, Claude; Béra, Jean-Christophe; Chen, Wen-Shiang

    2014-03-01

    It is well known that acoustic cavitation can facilitate the inward transport of genetic materials across cell membranes (sonoporation). However, partially due to the unstationary behavior of the initiation and leveling of cavitation, the sonoporation effect is usually unstable, especially in low intensity conditions. A system which is able to regulate the cavitation level during sonication by modulating the applied acoustic intensity with a feedback loop is implemented and its effect on in vitro gene transfection is tested. The regulated system provided better time stability and reproducibility of the cavitation levels than the unregulated conditions. Cultured hepatoma cells (BNL) mixed with 10 μg luciferase plasmids are exposed to 1-MHz pulsed ultrasound with or without cavitation regulation, and the gene transfection efficiency and cell viability are subsequently assessed. Experimental results show that for all exposure intensities (low, medium, and high), stable and intensity dependent, although not higher, gene expression could be achieved in the regulated cavitation system than the unregulated conditions. The cavitation regulation system provides a better control of cavitation and its bioeffect which are crucial important for clinical applications of ultrasound-mediated gene transfection. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Pollen-Mediated Movement of Herbicide Resistance Genes in Lolium rigidum.

    Directory of Open Access Journals (Sweden)

    Iñigo Loureiro

    Full Text Available The transfer of herbicide resistance genes by pollen is a major concern in cross-pollinated species such as annual ryegrass (Lolium rigidum. A two-year study was conducted in the greenhouse, under favorable conditions for pollination, to generate information on potential maximum cross-pollination. This maximum cross-pollination rate was 56.1%. A three-year field trial was also conducted to study the cross-pollination rates in terms of distance and orientation to an herbicide-resistant pollen source. Under field conditions, cross-pollination rates varied from 5.5% to 11.6% in plants adjacent to the pollen source and decreased with increasing distances (1.5 to 8.9% at 15 m distance and up to 4.1% at 25 m in the downwind direction. Environmental conditions influenced the cross-pollination both under greenhouse and field conditions. Data were fit to an exponential decay model to predict gene flow at increasing distances. This model predicted an average gene flow of 7.1% when the pollen donor and recipient plants were at 0 m distance from each other. Pollen-mediated gene flow declined by 50% at 16.7 m from the pollen source, yet under downwind conditions gene flow of 5.2% was predicted at 25 m, the farthest distance studied. Knowledge of cross-pollination rates will be useful for assessing the spread of herbicide resistance genes in L. rigidum and in developing appropriate strategies for its mitigation.

  7. Homologous recombination mediates functional recovery of dysferlin deficiency following AAV5 gene transfer.

    Directory of Open Access Journals (Sweden)

    William E Grose

    Full Text Available The dysferlinopathies comprise a group of untreatable muscle disorders including limb girdle muscular dystrophy type 2B, Miyoshi myopathy, distal anterior compartment syndrome, and rigid spine syndrome. As with other forms of muscular dystrophy, adeno-associated virus (AAV gene transfer is a particularly auspicious treatment strategy, however the size of the DYSF cDNA (6.5 kb negates packaging into traditional AAV serotypes known to express well in muscle (i.e. rAAV1, 2, 6, 8, 9. Potential advantages of a full cDNA versus a mini-gene include: maintaining structural-functional protein domains, evading protein misfolding, and avoiding novel epitopes that could be immunogenic. AAV5 has demonstrated unique plasticity with regards to packaging capacity and recombination of virions containing homologous regions of cDNA inserts has been implicated in the generation of full-length transcripts. Herein we show for the first time in vivo that homologous recombination following AAV5.DYSF gene transfer leads to the production of full length transcript and protein. Moreover, gene transfer of full-length dysferlin protein in dysferlin deficient mice resulted in expression levels sufficient to correct functional deficits in the diaphragm and importantly in skeletal muscle membrane repair. Intravascular regional gene transfer through the femoral artery produced high levels of transduction and enabled targeting of specific muscle groups affected by the dysferlinopathies setting the stage for potential translation to clinical trials. We provide proof of principle that AAV5 mediated delivery of dysferlin is a highly promising strategy for treatment of dysferlinopathies and has far-reaching implications for the therapeutic delivery of other large genes.

  8. Enhanced B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation contributes to ABCC1-mediated chemoresistance and glutathione-mediated survival in acquired topoisomerase II poison-resistant cancer cells.

    Science.gov (United States)

    Chen, Huang-Hui; Chang, Hsin-Huei; Chang, Jang-Yang; Tang, Ya-Chu; Cheng, Yung-Chi; Lin, Li-Mei; Cheng, Shu-Ying; Huang, Chih-Hsiang; Sun, Man-Wu; Chen, Chiung-Tong; Kuo, Ching-Chuan

    2017-12-01

    Nuclear factor erythroid-2-related factor 2 (NRF2) mainly regulates transcriptional activation through antioxidant-responsive elements (AREs) present in the promoters of NRF2 target genes. Recently, we found that NRF2 was overexpressed in a KB-derived drug-resistant cancer cell panel. In this panel, KB-7D cells, which show acquired resistance to topoisomerase II (Top II) poisons, exhibited the highest NRF2 activation. To investigate whether NRF2 directly contributed to acquired resistance against Top II poisons, we manipulated NRF2 by genetic and pharmacological approaches. The result demonstrated that silencing of NRF2 by RNA interference increased the sensitivity and treatment with NRF2 activator decreased the sensitivity of KB and KB-7D cells toward Top II poisons. Further, increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation activated NRF2 signaling in KB-7D cells. Moreover, increased binding of NRF2 to an ARE in the promoter of ATP-binding cassette subfamily C member 1 (ABCC1) directly contributed to Top II poison resistance. In addition, activation of NRF2 increased glutathione level and antioxidant capacity in KB-7D cells compared with that in KB cells; moreover, high glutathione level provided survival advantage to KB-7D cells. Our study is the first to show that aberrant NRF2 activation is via increased B-Raf-mediated NRF2 gene transcription and HATs-mediated NRF2 protein acetylation, which increases the acquired resistance and promote the survival of Top II poison-resistant cancer cells. Importantly, NRF2 downstream effectors ABCC1 and glutathione directly contribute to acquired resistance and survival, respectively. These results suggest that blockade of NRF2 signaling may enhance therapeutic efficacy and reduce the survival of Top II poison-refractory tumors in clinical. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    Directory of Open Access Journals (Sweden)

    Tatiana I Novobrantseva

    2012-01-01

    Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.

  10. Systematic comparison of the response properties of protein and RNA mediated gene regulatory motifs.

    Science.gov (United States)

    Iyengar, Bharat Ravi; Pillai, Beena; Venkatesh, K V; Gadgil, Chetan J

    2017-05-30

    We present a framework enabling the dissection of the effects of motif structure (feedback or feedforward), the nature of the controller (RNA or protein), and the regulation mode (transcriptional, post-transcriptional or translational) on the response to a step change in the input. We have used a common model framework for gene expression where both motif structures have an activating input and repressing regulator, with the same set of parameters, to enable a comparison of the responses. We studied the global sensitivity of the system properties, such as steady-state gain, overshoot, peak time, and peak duration, to parameters. We find that, in all motifs, overshoot correlated negatively whereas peak duration varied concavely with peak time. Differences in the other system properties were found to be mainly dependent on the nature of the controller rather than the motif structure. Protein mediated motifs showed a higher degree of adaptation i.e. a tendency to return to baseline levels; in particular, feedforward motifs exhibited perfect adaptation. RNA mediated motifs had a mild regulatory effect; they also exhibited a lower peaking tendency and mean overshoot. Protein mediated feedforward motifs showed higher overshoot and lower peak time compared to the corresponding feedback motifs.

  11. Gene expression profiling of low-grade endometrial stromal sarcoma indicates fusion protein-mediated activation of the Wnt signaling pathway.

    Science.gov (United States)

    Przybyl, Joanna; Kidzinski, Lukasz; Hastie, Trevor; Debiec-Rychter, Maria; Nusse, Roel; van de Rijn, Matt

    2018-05-01

    Low-grade endometrial stromal sarcomas (LGESS) harbor chromosomal translocations that affect proteins associated with chromatin remodeling Polycomb Repressive Complex 2 (PRC2), including SUZ12, PHF1 and EPC1. Roughly half of LGESS also demonstrate nuclear accumulation of β-catenin, which is a hallmark of Wnt signaling activation. However, the targets affected by the fusion proteins and the role of Wnt signaling in the pathogenesis of these tumors remain largely unknown. Here we report the results of a meta-analysis of three independent gene expression profiling studies on LGESS and immunohistochemical evaluation of nuclear expression of β-catenin and Lef1 in 112 uterine sarcoma specimens obtained from 20 LGESS and 89 LMS patients. Our results demonstrate that 143 out of 310 genes overexpressed in LGESS are known to be directly regulated by SUZ12. In addition, our gene expression meta-analysis shows activation of multiple genes implicated in Wnt signaling. We further emphasize the role of the Wnt signaling pathway by demonstrating concordant nuclear expression of β-catenin and Lef1 in 7/16 LGESS. Based on our findings, we suggest that LGESS-specific fusion proteins disrupt the repressive function of the PRC2 complex similar to the mechanism seen in synovial sarcoma, where the SS18-SSX fusion proteins disrupt the mSWI/SNF (BAF) chromatin remodeling complex. We propose that these fusion proteins in LGESS contribute to overexpression of Wnt ligands with subsequent activation of Wnt signaling pathway and formation of an active β-catenin/Lef1 transcriptional complex. These observations could lead to novel therapeutic approaches that focus on the Wnt pathway in LGESS. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. hTERT promoter mediating gene therapy in laryngeal squamous carcinomas cells in vitro

    International Nuclear Information System (INIS)

    Liao Zhengkai; Zhou Yunfeng; Zhou Fuxiang; Luo Zhiguo; Xiong Jie; Bao Jie; Xie Conghua; Liu Shiquan

    2007-01-01

    Objective: To investigate the relationship among hTERT promoter activity, hTERT mRNA expression, and telomerase activity (TA) in laryngeal squamous carcinomas cell lines, and to evaluate the usefulness of hTERT promoter mediated gene therapy. Methods: After plasmids pGL3-hTERTp were transfected, hTEBT promoter activity, hTERT mRNA expression and TA were determined by luciferase assay, RT-PCR and TRAP-PCR-ELISA, respectively. Plasmid phTERTp-HRP was constructed and transfected, HRP expression was determined by RT-PCR and competent peroxidase activity was confirmed by enzyme activity assay. The cytotoxicity and radiosensitivity of phTERTp-HRP/IAA were determined by clonogenic assay. Results: The relative levels of hTERT promoter activity, hTERT mRNA expression and TA in Hep2R cells were 1.37-fold, 1.43-fold and 1.81-fold compared with Hep2R cells, hTERT promoter activity was closely associated with hTERT mRNA expression and TA levels (P SF 2 ) was 1.24 (Hep2R cells) and 1.20 (Hep 2cells), the parameter a of with or without IAA incubation were 0.090, 0.020 (Hep2R)and 0.099, 0.042 (Hep2). Conclusions: hTERT promoter is applicable in mediating gene therapy in different radiosensitive laryngeal squamous carcinomas cells. hTERTp-HRP/IAA gene therapy may be a promising supplementary method for radiotherapy of laryngeal squamous-cell carcinomas. (authors)

  13. Area-Specific Cell Stimulation via Surface-Mediated Gene Transfer Using Apatite-Based Composite Layers

    Directory of Open Access Journals (Sweden)

    Yushin Yazaki

    2015-04-01

    Full Text Available Surface-mediated gene transfer systems using biocompatible calcium phosphate (CaP-based composite layers have attracted attention as a tool for controlling cell behaviors. In the present study we aimed to demonstrate the potential of CaP-based composite layers to mediate area-specific dual gene transfer and to stimulate cells on an area-by-area basis in the same well. For this purpose we prepared two pairs of DNA–fibronectin–apatite composite (DF-Ap layers using a pair of reporter genes and pair of differentiation factor genes. The results of the area-specific dual gene transfer successfully demonstrated that the cells cultured on a pair of DF-Ap layers that were adjacently placed in the same well showed specific gene expression patterns depending on the gene that was immobilized in theunderlying layer. Moreover, preliminary real-time PCR results indicated that multipotential C3H10T1/2 cells may have a potential to change into different types of cells depending on the differentiation factor gene that was immobilized in the underlying layer, even in the same well. Because DF-Ap layers have a potential to mediate area-specific cell stimulation on their surfaces, they could be useful in tissue engineering applications.

  14. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    Science.gov (United States)

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  15. Both positive and negative regulatory elements mediate expression of a photoregulated CAB gene from Nicotiana plumbaginifolia.

    Science.gov (United States)

    Castresana, C; Garcia-Luque, I; Alonso, E; Malik, V S; Cashmore, A R

    1988-01-01

    We have analyzed promoter regulatory elements from a photoregulated CAB gene (Cab-E) isolated from Nicotiana plumbaginifolia. These studies have been performed by introducing chimeric gene constructs into tobacco cells via Agrobacterium tumefaciens-mediated transformation. Expression studies on the regenerated transgenic plants have allowed us to characterize three positive and one negative cis-acting elements that influence photoregulated expression of the Cab-E gene. Within the upstream sequences we have identified two positive regulatory elements (PRE1 and PRE2) which confer maximum levels of photoregulated expression. These sequences contain multiple repeated elements related to the sequence-ACCGGCCCACTT-. We have also identified within the upstream region a negative regulatory element (NRE) extremely rich in AT sequences, which reduces the level of gene expression in the light. We have defined a light regulatory element (LRE) within the promoter region extending from -396 to -186 bp which confers photoregulated expression when fused to a constitutive nopaline synthase ('nos') promoter. Within this region there is a 132-bp element, extending from -368 to -234 bp, which on deletion from the Cab-E promoter reduces gene expression from high levels to undetectable levels. Finally, we have demonstrated for a full length Cab-E promoter conferring high levels of photoregulated expression, that sequences proximal to the Cab-E TATA box are not replaceable by corresponding sequences from a 'nos' promoter. This contrasts with the apparent equivalence of these Cab-E and 'nos' TATA box-proximal sequences in truncated promoters conferring low levels of photoregulated expression. Images PMID:2901343

  16. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    International Nuclear Information System (INIS)

    Sandhu, Navdeep; Vijayan, Mathilakath M.

    2011-01-01

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  17. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    Energy Technology Data Exchange (ETDEWEB)

    Sandhu, Navdeep [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Vijayan, Mathilakath M., E-mail: mvijayan@uwaterloo.ca [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada)

    2011-05-15

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  18. Tp53 gene mediates distinct dopaminergic neuronal damage in different dopaminergic neurotoxicant models

    Directory of Open Access Journals (Sweden)

    Tao Lu

    2017-01-01

    Full Text Available Tp53, a stress response gene, is involved in diverse cell death pathways and its activation is implicated in the pathogenesis of Parkinson's disease. However, whether the neuronal Tp53 protein plays a direct role in regulating dopaminergic (DA neuronal cell death or neuronal terminal damage in different neurotoxicant models is unknown. In our recent studies, in contrast to the global inhibition of Tp53 function by pharmacological inhibitors and in traditional Tp53 knock-out mice, we examined the effects of DA-specific Tp53 gene deletion after 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine and methamphetamine exposure. Our data suggests that the Tp53 gene might be involved in both neuronal apoptosis and neuronal terminal damage caused by different neurotoxicants. Additional results from other studies also suggest that as a master regulator of many pathways that regulate apoptosis and synaptic terminal damage, it is possible that Tp53 may function as a signaling hub to integrate different signaling pathways to mediate distinctive target pathways. Tp53 protein as a signaling hub might be able to evaluate the microenvironment of neurons, assess the forms and severities of injury incurred, and determine whether apoptotic cell death or neuronal terminal degeneration occurs. Identification of the precise mechanisms activated in distinct neuronal damage caused by different forms and severities of injuries might allow for development of specific Tp53 inhibitors or ways to modulate distinct downstream target pathways involved.

  19. LncRNA H19 and Target Gene-mediated Cleft Palate Induced by TCDD.

    Science.gov (United States)

    Gao, Li Yun; Zhang, Feng Quan; Zhao, Wei Hui; Han, Guang Liang; Wang, Xiao; Li, Qiang; Gao, Shan Shan; Wu, Wei Dong

    2017-09-01

    This study investigated the role of long non-coding RNAs (lncRNAs) in the development of the palatal tissues. Cleft palates in mice were induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Expression levels of long non-coding RNA H19 (lncRNA H19) and insulin-like growth factor 2 (IGF2) gene were measured by quantitative real-time polymerase chain reaction (qRT-PCR). The rate of occurrence of cleft palate was found to be 100% by TCDD exposure, and TCDD could cause short upper limb, cerebral fissure, webbed neck, and short neck. The expression levels of lncRNA H19 and IGF2 gene specifically showed embryo age-related differences on E13, E14, and E15 in the palatal tissues. The expression levels of lncRNA H19 and IGF2 gene showed an inverse relationship on E13, E14, and E15. These findings demonstrated that lncRNA H19 and IGF2 can mediate the development of mouse cleft palate. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  20. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  1. Hypoxia-inducible factor directs POMC gene to mediate hypothalamic glucose sensing and energy balance regulation.

    Directory of Open Access Journals (Sweden)

    Hai Zhang

    2011-07-01

    Full Text Available Hypoxia-inducible factor (HIF is a nuclear transcription factor that responds to environmental and pathological hypoxia to induce metabolic adaptation, vascular growth, and cell survival. Here we found that HIF subunits and HIF2α in particular were normally expressed in the mediobasal hypothalamus of mice. Hypothalamic HIF was up-regulated by glucose to mediate the feeding control of hypothalamic glucose sensing. Two underlying molecular pathways were identified, including suppression of PHDs by glucose metabolites to prevent HIF2α degradation and the recruitment of AMPK and mTOR/S6K to regulate HIF2α protein synthesis. HIF activation was found to directly control the transcription of POMC gene. Genetic approach was then employed to develop conditional knockout mice with HIF inhibition in POMC neurons, revealing that HIF loss-of-function in POMC neurons impaired hypothalamic glucose sensing and caused energy imbalance to promote obesity development. The metabolic effects of HIF in hypothalamic POMC neurons were independent of leptin signaling or pituitary ACTH pathway. Hypothalamic gene delivery of HIF counteracted overeating and obesity under conditions of nutritional excess. In conclusion, HIF controls hypothalamic POMC gene to direct the central nutrient sensing in regulation of energy and body weight balance.

  2. Effect of albumin and dextrose concentration on ultrasound and microbubble mediated gene transfection in vivo.

    Science.gov (United States)

    Browning, Richard J; Mulvana, Helen; Tang, Meng-Xing; Hajnal, Jo V; Wells, Dominic J; Eckersley, Robert J

    2012-06-01

    Ultrasound and microbubble mediated gene transfection has great potential for site-selective, safe gene delivery. Albumin-based microbubbles have shown the greatest transfection efficiency but have not been optimised specifically for this purpose. Additionally, few studies have highlighted desirable properties for transfection specific microbubbles. In this article, microbubbles were made with 2% or 5% (w/v) albumin and 20% or 40% (w/v) dextrose solutions, yielding four distinct bubble types. These were acoustically characterised and their efficiency in transfecting a luciferase plasmid (pGL4.13) into female, CD1 mice myocardia was measured. For either albumin concentration, increasing the dextrose concentration increased scattering, attenuation and resistance to ultrasound, resulting in significantly increased transfection. A significant interaction was noted between albumin and dextrose; 2% albumin bubbles made with 20% dextrose showed the least transfection but the most transfection with 40% dextrose. This trend was seen for both nonlinear scattering and attenuation behaviour but not for resistance to ultrasound or total scatter. We have determined that the attenuation behaviour is an important microbubble characteristic for effective gene transfection using ultrasound. Microbubble behaviour can also be simply controlled by altering the initial ingredients used during manufacture. Copyright © 2012 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  3. Hypoxia-Inducible Factor Directs POMC Gene to Mediate Hypothalamic Glucose Sensing and Energy Balance Regulation

    Science.gov (United States)

    Zhang, Hai; Zhang, Guo; Gonzalez, Frank J.; Park, Sung-min; Cai, Dongsheng

    2011-01-01

    Hypoxia-inducible factor (HIF) is a nuclear transcription factor that responds to environmental and pathological hypoxia to induce metabolic adaptation, vascular growth, and cell survival. Here we found that HIF subunits and HIF2α in particular were normally expressed in the mediobasal hypothalamus of mice. Hypothalamic HIF was up-regulated by glucose to mediate the feeding control of hypothalamic glucose sensing. Two underlying molecular pathways were identified, including suppression of PHDs by glucose metabolites to prevent HIF2α degradation and the recruitment of AMPK and mTOR/S6K to regulate HIF2α protein synthesis. HIF activation was found to directly control the transcription of POMC gene. Genetic approach was then employed to develop conditional knockout mice with HIF inhibition in POMC neurons, revealing that HIF loss-of-function in POMC neurons impaired hypothalamic glucose sensing and caused energy imbalance to promote obesity development. The metabolic effects of HIF in hypothalamic POMC neurons were independent of leptin signaling or pituitary ACTH pathway. Hypothalamic gene delivery of HIF counteracted overeating and obesity under conditions of nutritional excess. In conclusion, HIF controls hypothalamic POMC gene to direct the central nutrient sensing in regulation of energy and body weight balance. PMID:21814490

  4. Agrobacterium tumefaciens-mediated transformation for investigating pathogenicity genes of the phytopathogenic fungus Colletotrichum sansevieriae.

    Science.gov (United States)

    Nakamura, Masayuki; Kuwahara, Hideto; Onoyama, Keisuke; Iwai, Hisashi

    2012-08-01

    Agrobacterium tumefaciens-mediated transformation (AtMT) has become a common technique for DNA transformation of yeast and filamentous fungi. In this study, we first established a protocol of AtMT for the phytopathogenic fungus Colletotrichum sansevieriae. Binary T-DNA vector containing the hygromycin B phosphotransferase gene controlled by the Aspergillus nidulans gpdA promoter and the trpC terminator was constructed with pCAMBIA0380 and used with three different strains LBA4404, GV3101, and GV2260 of A. tumefaciens. Transformants were most effectively obtained when GV2260 and C. sansevieriae Sa-1-2 were co-cultivated; there were about 320 transformants per 10(6) spores. When 1,048 transformants were inoculated on Sansevieria trifasciata, three transformants were found to have completely lost their pathogenicity and two transformants displayed reduced pathogenicity. All of the five transformants had a single copy of T-DNA in their genomes. The three pathogenicity-deficient transformants were subjected to thermal asymmetric interlaced polymerase chain reaction and the reaction allowed us to amplify the sequences flanking the left and/or right borders. The flanking sequences of the two transformants, M154 and M875, showed no homology to any sequences in databases, but the sequences of M678 contained motifs of alpha-1,3-glucan synthase, suggesting that the gene might contribute to the pathogenicity of C. sansevieriae. This study describes a useful method for investigating pathogenicity genes in C. sansevieriae.

  5. Genetic transformation and gene silencing mediated by multiple copies of a transgene in eastern white pine.

    Science.gov (United States)

    Tang, Wei; Newton, Ronald J; Weidner, Douglas A

    2007-01-01

    An efficient transgenic eastern white pine (Pinus strobus L.) plant regeneration system has been established using Agrobacterium tumefaciens strain GV3850-mediated transformation and the green fluorescent protein (gfp) gene as a reporter in this investigation. Stable integration of transgenes in the plant genome of pine was confirmed by polymerase chain reaction (PCR), Southern blot, and northern blot analyses. Transgene expression was analysed in pine T-DNA transformants carrying different numbers of copies of T-DNA insertions. Post-transcriptional gene silencing (PTGS) was mostly obtained in transgenic lines with more than three copies of T-DNA, but not in transgenic lines with one copy of T-DNA. In situ hybridization chromosome analysis of transgenic lines demonstrated that silenced transgenic lines had two or more T-DNA insertions in the same chromosome. These results suggest that two or more T-DNA insertions in the same chromosome facilitate efficient gene silencing in transgenic pine cells expressing green fluorescent protein. There were no differences in shoot differentiation and development between transgenic lines with multiple T-DNA copies and transgenic lines with one or two T-DNA copies.

  6. Socially cued seminal fluid gene expression mediates responses in ejaculate quality to sperm competition risk.

    Science.gov (United States)

    Simmons, Leigh W; Lovegrove, Maxine

    2017-08-30

    There is considerable evidence that males will increase the number of sperm ejaculated in response to sperm competition risk. However, whether they have the capacity to adjust seminal fluid components of the ejaculate has received less attention. Male crickets ( Teleogryllus oceanicus ) have been shown to adjust the viability of sperm in their ejaculate in response to sperm competition risk. Here we show that socially mediated plasticity in sperm viability is probably due, at least in part, to male adjustments in the protein composition of the seminal fluid. Seven seminal fluid protein genes were found to have an increased expression in males exposed to rival calls. Increased expression of these genes was correlated with increased sperm viability in whole ejaculates, and gene knockdown confirmed that at least one of these proteins promotes sperm viability. Our results lend support for recent theoretical models that predict complex responses in male allocation to seminal fluid composition in response to sperm competition risk. © 2017 The Author(s).

  7. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  8. Molecular Evolution at a Meiosis Gene Mediates Species Differences in the Rate and Patterning of Recombination.

    Science.gov (United States)

    Brand, Cara L; Cattani, M Victoria; Kingan, Sarah B; Landeen, Emily L; Presgraves, Daven C

    2018-04-23

    Crossing over between homologous chromosomes during meiosis repairs programmed DNA double-strand breaks, ensures proper segregation at meiosis I [1], shapes the genomic distribution of nucleotide variability in populations, and enhances the efficacy of natural selection among genetically linked sites [2]. Between closely related Drosophila species, large differences exist in the rate and chromosomal distribution of crossing over. Little, however, is known about the molecular genetic changes or population genetic forces that mediate evolved differences in recombination between species [3, 4]. Here, we show that a meiosis gene with a history of rapid evolution acts as a trans-acting modifier of species differences in crossing over. In transgenic flies, the dicistronic gene, mei-217/mei-218, recapitulates a large part of the species differences in the rate and chromosomal distribution of crossing over. These phenotypic differences appear to result from changes in protein sequence not gene expression. Our population genetics analyses show that the protein-coding sequence of mei-218, but not mei-217, has a history of recurrent positive natural selection. By modulating the intensity of centromeric and telomeric suppression of crossing over, evolution at mei-217/-218 has incidentally shaped gross differences in the chromosomal distribution of nucleotide variability between species. We speculate that recurrent bouts of adaptive evolution at mei-217/-218 might reflect a history of coevolution with selfish genetic elements. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Coordination of KSHV Latent and Lytic Gene Control by CTCF-Cohesin Mediated Chromosome Conformation

    Science.gov (United States)

    Kang, Hyojeung; Wiedmer, Andreas; Yuan, Yan; Robertson, Erle; Lieberman, Paul M.

    2011-01-01

    Herpesvirus persistence requires a dynamic balance between latent and lytic cycle gene expression, but how this balance is maintained remains enigmatic. We have previously shown that the Kaposi's Sarcoma-Associated Herpesvirus (KSHV) major latency transcripts encoding LANA, vCyclin, vFLIP, v-miRNAs, and Kaposin are regulated, in part, by a chromatin organizing element that binds CTCF and cohesins. Using viral genome-wide chromatin conformation capture (3C) methods, we now show that KSHV latency control region is physically linked to the promoter regulatory region for ORF50, which encodes the KSHV immediate early protein RTA. Other linkages were also observed, including an interaction between the 5′ and 3′ end of the latency transcription cluster. Mutation of the CTCF-cohesin binding site reduced or eliminated the chromatin conformation linkages, and deregulated viral transcription and genome copy number control. siRNA depletion of CTCF or cohesin subunits also disrupted chromosomal linkages and deregulated viral latent and lytic gene transcription. Furthermore, the linkage between the latent and lytic control region was subject to cell cycle fluctuation and disrupted during lytic cycle reactivation, suggesting that these interactions are dynamic and regulatory. Our findings indicate that KSHV genomes are organized into chromatin loops mediated by CTCF and cohesin interactions, and that these inter-chromosomal linkages coordinate latent and lytic gene control. PMID:21876668

  10. Enhanced transfection by antioxidative polymeric gene carrier that reduces polyplex-mediated cellular oxidative stress.

    Science.gov (United States)

    Lee, Min Sang; Kim, Nak Won; Lee, Kyuri; Kim, Hongtae; Jeong, Ji Hoon

    2013-06-01

    To test the hypothesis in which polyplex-induced oxidative stress may affect overall transfection efficiency, an antioxidative transfection system minimizing cellular oxidative stress was designed for enhanced transfection. An amphiphilic copolymer (PEI-PLGA) was synthesized and used as a micelle-type gene carrier containing hydrophobic antioxidant, α-tocopherol. Cellular oxidative stress and the change of mitochondrial membrane potential after transfection was measured by using a fluorescent probe (H₂DCFDA) and lipophilic cationic probe (JC-1), respectively. Transfection efficiency was determined by measuring a reporter gene (luciferase) expression level. The initial transfection study with conventional PEI/plasmid DNA polyplex showed significant generation of reactive oxygen species (ROS). The PEI-PLGA copolymer successfully carried out the simultaneous delivery of α-tocopherol and plasmid DNA (PEI-PLGA/Toco/pDNA polyplex) into cells, resulting in a significant reduction in cellular ROS generation after transfection and helped to maintain the mitochondrial membrane potential (ΔΨ). In addition, the transfection efficiency was dramatically increased using the antioxidative transfection system. This work showed that oxidative stress would be one of the important factors that should be considered in designing non-viral gene carriers and suggested a possible way to reduce the carrier-mediated oxidative stress, which consequently leads to enhanced transfection.

  11. Histone methylation mediates plasticity of human FOXP3(+) regulatory T cells by modulating signature gene expressions.

    Science.gov (United States)

    He, Haiqi; Ni, Bing; Tian, Yi; Tian, Zhiqiang; Chen, Yanke; Liu, Zhengwen; Yang, Xiaomei; Lv, Yi; Zhang, Yong

    2014-03-01

    CD4(+) FOXP3(+) regulatory T (Treg) cells constitute a heterogeneous and plastic T-cell lineage that plays a pivotal role in maintaining immune homeostasis and immune tolerance. However, the fate of human Treg cells after loss of FOXP3 expression and the epigenetic mechanisms contributing to such a phenotype switch remain to be fully elucidated. In the current study, we demonstrate that human CD4(+) CD25(high) CD127(low/-) Treg cells convert to two subpopulations with distinctive FOXP3(+) and FOXP3(-) phenotypes following in vitro culture with anti-CD3/CD28 and interleukin-2. Digital gene expression analysis showed that upon in vitro expansion, human Treg cells down-regulated Treg cell signature genes, such as FOXP3, CTLA4, ICOS, IKZF2 and LRRC32, but up-regulated a set of T helper lineage-associated genes, especially T helper type 2 (Th2)-associated, such as GATA3, GFI1 and IL13. Subsequent chromatin immunoprecipitation-sequencing of these subpopulations yielded genome-wide maps of their H3K4me3 and H3K27me3 profiles. Surprisingly, reprogramming of Treg cells was associated with differential histone modifications, as evidenced by decreased abundance of permissive H3K4me3 within the down-regulated Treg cell signature genes, such as FOXP3, CTLA4 and LRRC32 loci, and increased abundance of H3K4me3 within the Th2-associated genes, such as IL4 and IL5; however, the H3K27me3 modification profile was not significantly different between the two subpopulations. In conclusion, this study revealed that loss of FOXP3 expression from human Treg cells during in vitro expansion can induce reprogramming to a T helper cell phenotype with a gene expression signature dominated by Th2 lineage-associated genes, and that this cell type conversion may be mediated by histone methylation events. © 2013 John Wiley & Sons Ltd.

  12. Histone methylation mediates plasticity of human FOXP3+ regulatory T cells by modulating signature gene expressions

    Science.gov (United States)

    He, Haiqi; Ni, Bing; Tian, Yi; Tian, Zhiqiang; Chen, Yanke; Liu, Zhengwen; Yang, Xiaomei; Lv, Yi; Zhang, Yong

    2014-01-01

    CD4+ FOXP3+ regulatory T (Treg) cells constitute a heterogeneous and plastic T-cell lineage that plays a pivotal role in maintaining immune homeostasis and immune tolerance. However, the fate of human Treg cells after loss of FOXP3 expression and the epigenetic mechanisms contributing to such a phenotype switch remain to be fully elucidated. In the current study, we demonstrate that human CD4+ CD25high CD127low/− Treg cells convert to two subpopulations with distinctive FOXP3+ and FOXP3− phenotypes following in vitro culture with anti-CD3/CD28 and interleukin-2. Digital gene expression analysis showed that upon in vitro expansion, human Treg cells down-regulated Treg cell signature genes, such as FOXP3, CTLA4, ICOS, IKZF2 and LRRC32, but up-regulated a set of T helper lineage-associated genes, especially T helper type 2 (Th2)-associated, such as GATA3, GFI1 and IL13. Subsequent chromatin immunoprecipitation-sequencing of these subpopulations yielded genome-wide maps of their H3K4me3 and H3K27me3 profiles. Surprisingly, reprogramming of Treg cells was associated with differential histone modifications, as evidenced by decreased abundance of permissive H3K4me3 within the down-regulated Treg cell signature genes, such as FOXP3, CTLA4 and LRRC32 loci, and increased abundance of H3K4me3 within the Th2-associated genes, such as IL4 and IL5; however, the H3K27me3 modification profile was not significantly different between the two subpopulations. In conclusion, this study revealed that loss of FOXP3 expression from human Treg cells during in vitro expansion can induce reprogramming to a T helper cell phenotype with a gene expression signature dominated by Th2 lineage-associated genes, and that this cell type conversion may be mediated by histone methylation events. PMID:24152290

  13. A novel double-enhanced suicide gene therapy in a colon cancer cell line mediated by gef and apoptin.

    Science.gov (United States)

    Boulaiz, Houria; Aránega, Antonia; Cáceres, Blanca; Blanca, Cáceres; Alvarez, Pablo; Pablo, Alvarez; Serrano-Rodríguez, Fernando; Fernando, Rodríguez-Serrano; Carrillo, Esmeralda; Esmeralda, Carrillo; Melguizo, Consolación; Consolación, Melguizo; Prados, Jose; Jose, Prados

    2014-02-01

    Double-suicide gene therapy is a promising strategy for the treatment of advanced cancer. It has become an important research line in the development of gene therapy to overcome the drawbacks of single-gene therapy. The aim of this study was to investigate the usefulness of double-suicide gene therapy with the two suicide genes, gef and apoptin, in colon carcinoma. gef and apoptin genes were cloned into a doxycycline-regulated retrovirus-mediated gene expression system. Expression of both genes in the DLD-1 cell line was confirmed by reverse transcriptase polymerase chain reaction (RT-PCR). Cell viability was determined with the sulforhodamine B colorimetric assay, and the cell cycle was studied by propidium iodide (PI) staining. Annexin V-FITC and PI assays were used to evaluate apoptosis, and the results were confirmed by electron microscopy. The mitochondrial membrane potential was measured by JC-1 assay. Our results showed that the combined expression of gef and apoptin genes was strikingly more effective than the expression of either gene alone. Co-expression of gef and apoptin synergistically enhanced the decrease in cell viability, increasing necrosis and inducing apoptosis in colon cancer cells via the mitochondrial pathway, which can be deficient in advanced or metastatic colon cancer. Double-suicide gene therapy based on gef and apoptin genes may be a candidate for the development of new colon cancer strategies, and further studies are warranted to establish the usefulness of double-suicide gene therapy in vivo.

  14. Causal relationship between the AHSG gene and BMD through fetuin-A and BMI: multiple mediation analysis.

    Science.gov (United States)

    Sritara, C; Thakkinstian, A; Ongphiphadhanakul, B; Chailurkit, L; Chanprasertyothin, S; Ratanachaiwong, W; Vathesatogkit, P; Sritara, P

    2014-05-01

    Using mediation analysis, a causal relationship between the AHSG gene and bone mineral density (BMD) through fetuin-A and body mass index (BMI) mediators was suggested. Fetuin-A, a multifunctional protein of hepatic origin, is associated with bone mineral density. It is unclear if this association is causal. This study aimed at clarification of this issue. A cross-sectional study was conducted among 1,741 healthy workers from the Electricity Generating Authority of Thailand (EGAT) cohort. The alpha-2-Heremans-Schmid glycoprotein (AHSG) rs2248690 gene was genotyped. Three mediation models were constructed using seemingly unrelated regression analysis. First, the ln[fetuin-A] group was regressed on the AHSG gene. Second, the BMI group was regressed on the AHSG gene and the ln[fetuin-A] group. Finally, the BMD model was constructed by fitting BMD on two mediators (ln[fetuin-A] and BMI) and the independent AHSG variable. All three analyses were adjusted for confounders. The prevalence of the minor T allele for the AHSG locus was 15.2%. The AHSG locus was highly related to serum fetuin-A levels (P Multiple mediation analyses showed that AHSG was significantly associated with BMD through the ln[fetuin-A] and BMI pathway, with beta coefficients of 0.0060 (95% CI 0.0038, 0.0083) and 0.0030 (95% CI 0.0020, 0.0045) at the total hip and lumbar spine, respectively. About 27.3 and 26.0% of total genetic effects on hip and spine BMD, respectively, were explained by the mediation effects of fetuin-A and BMI. Our study suggested evidence of a causal relationship between the AHSG gene and BMD through fetuin-A and BMI mediators.

  15. Vitamin D receptor-mediated control of Soggy, Wise, and Hairless gene expression in keratinocytes.

    Science.gov (United States)

    Hsieh, Jui-Cheng; Estess, Rudolf C; Kaneko, Ichiro; Whitfield, G Kerr; Jurutka, Peter W; Haussler, Mark R

    2014-02-01

    The vitamin D receptor (VDR), but not its hormonal ligand, 1,25-dihydroxyvitamin D3 (1,25D), is required for the progression of the mammalian hair cycle. We studied three genes relevant to hair cycle signaling, DKKL1 (Soggy), SOSTDC1 (Wise), and HR (Hairless), to determine whether their expression is regulated by VDR and/or its 1,25D ligand. DKKL1 mRNA was repressed 49-72% by 1,25D in primary human and CCD-1106 KERTr keratinocytes; a functional vitamin D responsive element (VDRE) was identified at -9590 bp in murine Soggy. Similarly, SOSTDC1 mRNA was repressed 41-59% by 1,25D in KERTr and primary human keratinocytes; a functional VDRE was located at -6215 bp in human Wise. In contrast, HR mRNA was upregulated 1.56- to 2.77-fold by 1,25D in primary human and KERTr keratinocytes; a VDRE (TGGTGAgtgAGGACA) consisting of an imperfect direct repeat separated by three nucleotides (DR3) was identified at -7269 bp in the human Hairless gene that mediated dramatic induction, even in the absence of 1,25D ligand. In parallel, a DR4 thyroid hormone responsive element, TGGTGAggccAGGACA, was identified at +1304 bp in the human HR gene that conferred tri-iodothyronine (T3)-independent transcriptional activation. Because the thyroid hormone receptor controls HR expression in the CNS, whereas VDR functions in concert with the HR corepressor specifically in skin, a model is proposed wherein unliganded VDR upregulates the expression of HR, the gene product of which acts as a downstream comodulator to feedback-repress DKKL1 and SOSTDC1, resulting in integration of bone morphogenic protein and Wnt signaling to drive the mammalian hair cycle and/or influencing epidermal function.

  16. Feasibility of baculovirus-mediated reporter gene delivery for efficient monitoring of islet transplantation in vivo

    International Nuclear Information System (INIS)

    Liu, Shuai; Pan, Yu; Lv, Jing; Wu, Haifei; Tian, Jingyan; Zhang, Yifan

    2014-01-01

    Objective: The objective of this study was to explore the feasibility of baculovirus vector-mediated sodium iodide symporter (NIS) gene delivery to monitor islet transplantation. Methods: Baculovirus vectors expressing green fluorescent protein (GFP) or NIS (Bac-GFP and Bac-NIS) were established using the Bac-to-Bac baculovirus expression system. The GFP expression of Bac-GFP-infected rat islets was observed in vitro by fluorescence microscopy. Iodine uptake and inhibition of iodine uptake by NaClO 4 in Bac-NIS-infected islets were dynamically monitored in vitro. Bac-GFP- or Bac-NIS-infected islets were implanted into the left axillary cavity of NOD-SCID mice, and fluorescence imaging and 125 I NanoSPECT/CT imaging were subsequently performed in vivo. Results: Bac-GFP efficiently infected rat islets (over 95% infected at MOI = 40), and the expression of GFP lasted approximately two weeks. NaClO 4 could inhibit iodine uptake by Bac-NIS-infected islets. In vivo imaging revealed that the fluorescence intensity of the transplant sites in Bac-GFP-infected groups was significantly higher than in the non-infected group. Grafts could be clearly observed by 125 I NanoSPECT/CT imaging for up to 8 h. Conclusion: Baculovirus vectors are powerful vehicles for studying rat islets in gene delivery. It is feasible to use a baculovirus vector to delivery an NIS gene for non-invasive monitoring transplanted islets in vivo by the expression of the target gene

  17. Targeted Gene Replacement in Fungal Pathogens via Agrobacterium tumefaciens- Mediated Transformation

    DEFF Research Database (Denmark)

    Frandsen, Rasmus John Normand; Frandsen, Mette; Giese, Nanna Henriette

    2012-01-01

    -step cloning strategies for construction of vectors for Agrobacterium tumefaciens-mediated transformation (ATMT). Targeted genome modifications require integration by a homologous double crossover event, which is achieved by placing target sequences on either side of a selection marker gene in the vector....... Protocols are given for two single-step vector construction techniques. The In-Fusion cloning technique is independent of compatible restriction enzyme sites in the vector and the fragment to be cloned. The method can be directly applied to any vector of choice and it is possible to carry out four fragment...... cloning without the need for subcloning. The cloning efficiency is not always as high as desired, but it still presents an efficient alternative to restriction enzyme and ligase-based cloning systems. The USER technology offers a higher four fragment cloning efficiency than In-Fusion, but depends...

  18. REST mediates androgen receptor actions on gene repression and predicts early recurrence of prostate cancer

    DEFF Research Database (Denmark)

    Svensson, Charlotte; Ceder, Jens; Iglesias Gato, Diego

    2014-01-01

    The androgen receptor (AR) is a key regulator of prostate tumorgenesis through actions that are not fully understood. We identified the repressor element (RE)-1 silencing transcription factor (REST) as a mediator of AR actions on gene repression. Chromatin immunoprecipitation showed that AR binds...... in cell cycle progression, including Aurora Kinase A, that has previously been implicated in the growth of NE-like castration-resistant tumors. The analysis of prostate cancer tissue microarrays revealed that tumors with reduced expression of REST have higher probability of early recurrence, independently...... of their Gleason score. The demonstration that REST modulates AR actions in prostate epithelia and that REST expression is negatively correlated with disease recurrence after prostatectomy, invite a deeper characterization of its role in prostate carcinogenesis....

  19. Radiosensitization effect of recombinant adenoviral-mediated PUMA gene on pancreatic carcinoma cells

    International Nuclear Information System (INIS)

    Zhu Dongming; Zhang Kejun; Li Dechun; Zhu Xuefeng; Yang Yong

    2009-01-01

    Objective: To study the effect of PUMA gene mediated by recombinant adenovirus vector combined with radiation on the pancreatic carcinoma. Methods: The PANC-1 cells were infected with Ad- PUMA (MOI=10, 50 and 100, respectively) for 48 h. The expression of PUMA mRNA and protein was detected by RT-PCR and Western blot, respectively. PANC-1 cells were divided into 4 groups: control group, transfection group, irradiation group and combined treatment group. The cell growth inhibition rate and apoptotic rate of PANC-1 cells were assessed by MTT assay and flow cytometry. Human pancreatic carcinomas were transplanted subcutaneously in nude mice, which were randomized into 4 groups: control group, transfection group, irradiation group and combined treatment group. Tumor growth rate and apoptotic index at different time points were recorded in 35 days. Results: The expression of PUMA mRNA and protein was increased with the increase of MOI of Ad-PUMA, which was does-dependant (MOI=10, mRNA=0.46± 0.02, protein=0.75± 0.09; MOI=50, mRNA=1.12±0.09, protein=1.01±0.18; MOI=100, mRNA=1.50±0.08, protein= 1.80±0.15; P 3 , (39.5±9.23)mm 3 , (33.6±10.3)mm 3 and (52.0±11.43)mm 3 , respectively, P<0.05]. And the apoptotic index was increased in the same manner (AI=0.43±0.05, 0.29±0.10, 0.24±0.05 and 0.00±0.00, respectively, P<0.05). Conclusions: Recombinant adenoviral-mediated PUMA gene combined with irradiation could increase the cell-killing effect on pancreatic carcinoma. It is better than that of either one kind of therapy. (authors)

  20. Radioiodine uptake of undifferentiated thyroid cancer cells by adenovirus-mediated Na+/ I- symporter gene transfer

    Energy Technology Data Exchange (ETDEWEB)

    So, Y.; Lee, Y. J.; Shin, J. H.; Oh, H. J.; Chung, J. K.; Lee, M. C.; Cho, B. Y. [College of Medicine, Univ. of Seoul National, Seoul (Korea, Republic of); Lee, K. H. [Samsung Medical Center, Seoul (Korea, Republic of)

    2003-07-01

    To increase radioiodine uptake on undifferentiated thyroid cancer cell (ARO cells) by adenovirus-mediated human Na+/I- symporter (hNIS) gene transfer. Recombinant adenovirus Ad-hNIS was manufactured successfully. After transfecting Ad-hNIS on ARO cells, in vitro I-125 uptake and efflux studies were performed. For in vivo studies, 1.510'8 p.f.u. (50 1) of Ad-hNIS was injected into xenograft ARO tumors on the R thigh of BALB/c nu/nu mice (n=12), and same amount of normal saline was injected into xenograft ARO tumors on the L thigh. Two, 3, 4 and 6 days after intratumoral injection of Ad-hNIS, I-131 images (3 mice per day) were taken and xenograft tumors on both thighs were all excised. Total RNA was extracted from each tumor tissue and RT-PCR was performed to confirm the hNIS expression of Ad-hNIS injected xenograft ARO tumors. I-125 uptake of Ad-hNIS transfected ARO cells was increased up to 233 folds at 120 minutes in vitro. I-125 efflux study revealed rapid washout of I-125 from Ad-hNIS transfected ARO cells. On dynamic image, I-131 uptake of Ad-hNIS injected ARO tumor was continuously increased until 60 minutes. Mean count ratios of xenograft ARO tumors (R/L) of 60 minutes I-131 images at 2, 3, 4 and 6 days after Ad-hNIS injection were 2.85, 2.54, 2.31, and 2.18, each. On RT-PCR, hNIS expression of Ad-hNIS transfected ARO xenograft tumors was confirmed. Radioiodine uptake was successfully increased in ARO cells by adenovirus-mediated hNIs gene transfer both in vitro and in vivo.

  1. Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.

    Directory of Open Access Journals (Sweden)

    De-Tao Yin

    Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.

  2. The association between well-being and the COMT gene: Dispositional gratitude and forgiveness as mediators.

    Science.gov (United States)

    Liu, Jinting; Gong, Pingyuan; Gao, Xiaoxue; Zhou, Xiaolin

    2017-05-01

    Previous studies have demonstrated the contributions of genetic variants and positive psychological traits (e.g. gratitude and forgiveness) to well-being. However, little is known about how genes interact with positive traits to affect well-being. To investigate to what extent the COMT Val158Met polymorphism modulates well-being and to what extent dispositional gratitude and forgiveness mediate the individual differences in well-being, 445 participants were recruited and required to complete a battery of questionnaires. We found that individuals with a smaller number of the Met alleles reported greater well-being, less depressive symptoms, and greater tendencies for gratitude and forgiveness. Moreover, dispositional gratitude and forgiveness mediated the genotype effects on well-being and depressive symptoms. These results remained significant after controlling for non-genetic factors (socioeconomic status, religious beliefs, romantic relationship status, parenting style). The sample size limits the generalizability of results. This study demonstrates the contribution of the COMT Val158Met polymorphism to individual differences in well-being and suggests a potential psychobiological pathway from dopaminergic and noradrenergic systems to happiness. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Clarifying the impact of polycomb complex component disruption in human cancers.

    Science.gov (United States)

    Yamamoto, Yukiya; Abe, Akihiro; Emi, Nobuhiko

    2014-04-01

    The dysregulation of proper transcriptional control is a major cause of developmental diseases and cancers. Polycomb proteins form chromatin-modifying complexes that transcriptionally silence genome regions in higher eukaryotes. The BCL6 corepressor (BCOR) complex comprises ring finger protein 1B (RNF2/RING1B), polycomb group ring finger 1 (PCGF1), and lysine-specific demethylase 2B (KDM2B) and is uniquely recruited to nonmethylated CpG islands, where it removes histone H3K36me2 and induces repressive histone H2A monoubiquitylation. Germline BCOR mutations have been detected in patients with oculofaciocardiodental and Lenz microphthalmia syndromes, which are inherited conditions. Recently, several variants of BCOR and BCOR-like 1 (BCORL1) chimeric fusion transcripts were reported in human cancers, including acute promyelocytic leukemia, bone sarcoma, and hepatocellular carcinoma. In addition, massively parallel sequencing has identified inactivating somatic BCOR and BCORL1 mutations in patients with acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), chronic myelomonocytic leukemia, medulloblastoma, and retinoblastoma. More importantly, patients with AML and MDS with BCOR mutations exhibit poor prognosis. This perspective highlights the detection of BCOR mutations and fusion transcripts of BCOR and BCORL1 and discusses their importance for diagnosing cancer subtypes and estimating the treatment responses of patients. Furthermore, this perspective proposes the need for additional functional studies to clarify the oncogenic mechanism by which BCOR and BCORL1 are disrupted in cancers, and how this may lead to the development of novel therapeutics. Mol Cancer Res; 12(4); 479-84. ©2014 AACR.

  4. Retroviral-mediated transfer and expression of human β-globin genes in cultured murine and human erythroid cells

    International Nuclear Information System (INIS)

    Weber-Benarous, A.; Cone, R.D.; London, I.M.; Mulligan, R.C.

    1988-01-01

    The authors cloned human β-globin DNA sequences from a genomic library prepared from DNA isolated from the human leukemia cell line K562 and have used the retroviral vector pZip-NeoSV(X)1 to introduce a 3.0-kilobase segment encompassing the globin gene into mouse erythroleukemia cells. Whereas the endogenous K562 β-globin gene is repressed in K562 cells, when introduced into mouse erythroleukemia cells by retroviral-mediated gene transfer, the β-globin gene from K562 cells was transcribed and induced 5-20-fold after treatment of the cells with dimethyl sulfoxide. The transcripts were correctly initiated, and expression and regulation of the K562 gene were identical to the expression of a normal human β-globin gene transferred into mouse erythroleukemia cells in the same way. They have also introduced the normal human β-globin gene into K562 cells using the same retrovirus vector. SP6 analysis of the RNA isolated from the transduced cells showed that the normal β-globin gene was transcribed at a moderately high level, before or after treatment with hemin. Based on these data, they suggest that the lack of expression of the endogenous β-globin gene in K562 cells does not result from an alteration in the gene itself and may not result from a lack of factor(s) necessary for β-lobin gene transcription. Retroviral-mediated transfer of the human β-globin gene may, however, uniquely influence expression of the gene K562 cells

  5. CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool.

    Science.gov (United States)

    Yang, Fayu; Liu, Changbao; Chen, Ding; Tu, Mengjun; Xie, Haihua; Sun, Huihui; Ge, Xianglian; Tang, Lianchao; Li, Jin; Zheng, Jiayong; Song, Zongming; Qu, Jia; Gu, Feng

    2017-06-16

    Cre-loxP, as one of the site-specific genetic manipulation tools, offers a method to study the spatial and temporal regulation of gene expression/inactivation in order to decipher gene function. CRISPR/Cas9-mediated targeted genome engineering technologies are sparking a new revolution in biological research. Whether the traditional site-specific genetic manipulation tool and CRISPR/Cas9 could be combined to create a novel genetic tool for highly specific gene editing is not clear. Here, we successfully generated a CRISPR/Cas9-loxP system to perform gene editing in human cells, providing the proof of principle that these two technologies can be used together for the first time. We also showed that distinct non-homologous end-joining (NHEJ) patterns from CRISPR/Cas9-mediated gene editing of the targeting sequence locates at the level of plasmids (episomal) and chromosomes. Specially, the CRISPR/Cas9-mediated NHEJ pattern in the nuclear genome favors deletions (64%-68% at the human AAVS1 locus versus 4%-28% plasmid DNA). CRISPR/Cas9-loxP, a novel site-specific genetic manipulation tool, offers a platform for the dissection of gene function and molecular insights into DNA-repair pathways. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  6. Gene transfection mediated by polyethyleneimine-polyethylene glycol nanocarrier prevents cisplatin-induced spiral ganglion cell damage

    Directory of Open Access Journals (Sweden)

    Guan-gui Chen

    2015-01-01

    Full Text Available Polyethyleneimine-polyethylene glycol (PEI-PEG, a novel nanocarrier, has been used for transfection and gene therapy in a variety of cells. In our previous study, we successfully carried out PEI-PEG-mediated gene transfer in spiral ganglion cells. It remains unclear whether PEI-PEG could be used for gene therapy with X-linked inhibitor of apoptosis protein (XIAP in the inner ear. In the present study, we performed PEI-PEG-mediated XIAP gene transfection in the cochlea of Sprague-Dawley rats, via scala tympani fenestration, before daily cisplatin injections. Auditory brainstem reflex tests demonstrated the protective effects of XIAP gene therapy on auditory function. Immunohistochemical staining revealed XIAP protein expression in the cytoplasm of cells in the spiral ganglion, the organ of Corti and the stria vascularis. Reverse transcription-PCR detected high levels of XIAP mRNA expression in the cochlea. The present findings suggest that PEI-PEG nanocarrier-mediated XIAP gene transfection results in XIAP expression in the cochlea, prevents damage to cochlear spiral ganglion cells, and protects hearing.

  7. Ku proteins function as corepressors to regulate farnesoid X receptor-mediated gene expression

    International Nuclear Information System (INIS)

    Ohno, Masae; Kunimoto, Masaaki; Nishizuka, Makoto; Osada, Shigehiro; Imagawa, Masayoshi

    2009-01-01

    The farnesoid X receptor (FXR; NR1H4) is a member of the nuclear receptor superfamily and regulates the expression of genes involved in enterohepatic circulation and the metabolism of bile acids. Based on functional analyses, nuclear receptors are divided into regions A-F. To explore the cofactors interacting with FXR, we performed a pull-down assay using GST-fused to the N-terminal A/B region and the C region, which are required for the ligand-independent transactivation and DNA-binding, respectively, of FXR, and nuclear extracts from HeLa cells. We identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs), Ku80, and Ku70 as FXR associated factors. These proteins are known to have an important role in DNA repair, recombination, and transcription. DNA-PKcs mainly interacted with the A/B region of FXR, whereas the Ku proteins interacted with the C region and with the D region (hinge region). Chromatin immunoprecipitation assays revealed that the Ku proteins associated with FXR on the bile salt export pump (BSEP) promoter. Furthermore, we demonstrated that ectopic expression of the Ku proteins decreased the promoter activity and expression of BSEP gene mediated by FXR. These results suggest that the Ku proteins function as corepressors for FXR.

  8. Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

    Directory of Open Access Journals (Sweden)

    Shih Ping Yao

    2002-04-01

    Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

  9. Mipu1, a novel direct target gene, is involved in hypoxia inducible factor 1-mediated cytoprotection.

    Directory of Open Access Journals (Sweden)

    Kangkai Wang

    Full Text Available Mipu1 (myocardial ischemic preconditioning up-regulated protein 1, recently identified in our lab, is a novel zinc-finger transcription factor which is up-regulated during ischemic preconditioning. However, it is not clear what transcription factor contributes to its inducible expression. In the present study, we reported that HIF-1 regulates the inducible expression of Mipu1 which is involved in the cytoprotection of HIF-1α against oxidative stress by inhibiting Bax expression. Our results showed that the inducible expression of Mipu1 was associated with the expression and activation of transcription factor HIF-1 as indicated by cobalt chloride (CoCl2 treatment, HIF-1α overexpression and knockdown assays. EMSA and luciferase reporter gene assays showed that HIF-1α bound to the hypoxia response element (HRE within Mipu1 promoter region and promoted its transcription. Moreover, our results revealed that Mipu1 inhibited the expression of Bax, an important pro-apoptosis protein associated with the intrinsic pathway of apoptosis, elevating the cytoprotection of HIF-1 against hydrogen peroxide (H2O2-mediated injury in H9C2 cells. Our findings implied that Bax may be a potential target gene of transcription factor Mipu1, and provided a novel insight for understanding the cytoprotection of HIF-1 and new clues for further elucidating the mechanisms by which Mipu1 protects cell against pathological stress.

  10. Cellular Immune Response Against Firefly Luciferase After Sleeping Beauty–Mediated Gene Transfer In Vivo

    Science.gov (United States)

    Podetz-Pedersen, Kelly M.; Vezys, Vaiva; Somia, Nikunj V.; Russell, Stephen J.

    2014-01-01

    Abstract The Sleeping Beauty (SB) transposon system has been shown to mediate new gene sequence integration resulting in long-term expression. Here the effectiveness of hyperactive SB100X transposase was tested, and we found that hydrodynamic co-delivery of a firefly luciferase transposon (pT2/CaL) along with SB100X transposase (pCMV-SB100X) resulted in remarkably sustained, high levels of luciferase expression. However, after 4 weeks there was a rapid, animal-by-animal loss of luciferase expression that was not observed in immunodeficient mice. We hypothesized that this sustained, high-level luciferase expression achieved using the SB100X transposase elicits an immune response in pT2/CaL co-administered mice, which was supported by the rapid loss of luciferase expression upon challenge of previously treated animals and in naive animals adoptively transferred with splenocytes from previously treated animals. Specificity of the immune response to luciferase was demonstrated by increased cytokine expression in splenocytes after exposure to luciferase peptide in parallel with MHC I–luciferase peptide tetramer binding. This anti-luciferase immune response observed following continuous, high-level luciferase expression in vivo clearly impacts its use as an in vivo reporter. As both an immunogen and an extremely sensitive reporter, luciferase is also a useful model system for the study of immune responses following in vivo gene transfer and expression. PMID:25093708

  11. Alu-mediated large deletion of the CDSN gene as a cause of peeling skin disease.

    Science.gov (United States)

    Wada, T; Matsuda, Y; Muraoka, M; Toma, T; Takehara, K; Fujimoto, M; Yachie, A

    2014-10-01

    Peeling skin disease (PSD) is an autosomal recessive skin disorder caused by mutations in CDSN and is characterized by superficial peeling of the upper epidermis. Corneodesmosin (CDSN) is a major component of corneodesmosomes that plays an important role in maintaining epidermis integrity. Herein, we report a patient with PSD caused by a novel homozygous large deletion in the 6p21.3 region encompassing the CDSN gene, which abrogates CDSN expression. Several genes including C6orf15, PSORS1C1, PSORS1C2, CCHCR1, and TCF19 were also deleted, however, the patient showed only clinical features typical of PSD. The deletion size was 59.1 kb. Analysis of the sequence surrounding the breakpoint showed that both telomeric and centromeric breakpoints existed within Alu-S sequences that were oriented in opposite directions. These results suggest an Alu-mediated recombination event as the mechanism underlying the deletion in our patient. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Generation of TALE nickase-mediated gene-targeted cows expressing human serum albumin in mammary glands.

    Science.gov (United States)

    Luo, Yan; Wang, Yongsheng; Liu, Jun; Cui, Chenchen; Wu, Yongyan; Lan, Hui; Chen, Qi; Liu, Xu; Quan, Fusheng; Guo, Zekun; Zhang, Yong

    2016-02-08

    Targeting exogenous genes at milk protein loci via gene-targeting technology is an ideal strategy for producing large quantities of pharmaceutical proteins. Transcription-activator-like effector (TALE) nucleases (TALENs) are an efficient genome-editing tool. However, the off-target effects may lead to unintended gene mutations. In this study, we constructed TALENs and TALE nickases directed against exon 2 of the bovine β-lactoglobulin (BLG) locus. The nickases can induce a site-specific DNA single-strand break, without inducing double-strand break and nonhomologous end joining mediated gene mutation, and lower cell apoptosis rate than TALENs. After co-transfecting the bovine fetal fibroblasts with human serum albumin (HSA) gene-targeting vector and TALE nickase expression vectors, approximately 4.8% (40/835) of the cell clones contained HSA at BLG locus. Unexpectedly, one homozygous gene-targeted cell clone (1/835, 0.1%) was obtained by targeting both alleles of BLG in a single round of transfection. The recombinant protein mimicking the endogenous BLG was highly expressed and correctly folded in the mammary glands of the targeted cows, and the expression level of HSA was significantly increased in the homozygous targeted cows. Results suggested that the combination of TALE nickase-mediated gene targeting and somatic cell nuclear transfer is a feasible and safe approach in producing gene-targeted livestock.

  13. The ULT1 and ULT2 trxG genes play overlapping roles in Arabidopsis development and gene regulation.

    Science.gov (United States)

    Monfared, Mona M; Carles, Cristel C; Rossignol, Pascale; Pires, Helena R; Fletcher, Jennifer C

    2013-09-01

    The epigenetic regulation of gene expression is critical for ensuring the proper deployment and stability of defined genome transcription programs at specific developmental stages. The cellular memory of stable gene expression states during animal and plant development is mediated by the opposing activities of Polycomb group (PcG) factors and trithorax group (trxG) factors. Yet, despite their importance, only a few trxG factors have been characterized in plants and their roles in regulating plant development are poorly defined. In this work, we report that the closely related Arabidopsis trxG genes ULTRAPETALA1 (ULT1) and ULT2 have overlapping functions in regulating shoot and floral stem cell accumulation, with ULT1 playing a major role but ULT2 also making a minor contribution. The two genes also have a novel, redundant activity in establishing the apical–basal polarity axis of the gynoecium, indicating that they function in differentiating tissues. Like ULT1 proteins, ULT2 proteins have a dual nuclear and cytoplasmic localization, and the two proteins physically associate in planta. Finally, we demonstrate that ULT1 and ULT2 have very similar overexpression phenotypes and regulate a common set of key development target genes, including floral MADS-box genes and class I KNOX genes. Our results reveal that chromatin remodeling mediated by the ULT1 and ULT2 proteins is necessary to control the development of meristems and reproductive organs. They also suggest that, like their animal counterparts, plant trxG proteins may function in multi-protein complexes to up-regulate the expression of key stage- and tissue-specific developmental regulatory genes.

  14. Amplification of TLO Mediator Subunit Genes Facilitate Filamentous Growth in Candida Spp.

    Science.gov (United States)

    Liu, Zhongle; Moran, Gary P.; Myers, Lawrence C.

    2016-01-01

    Filamentous growth is a hallmark of C. albicans pathogenicity compared to less-virulent ascomycetes. A multitude of transcription factors regulate filamentous growth in response to specific environmental cues. Our work, however, suggests the evolutionary history of C. albicans that resulted in its filamentous growth plasticity may be tied to a change in the general transcription machinery rather than transcription factors and their specific targets. A key genomic difference between C. albicans and its less-virulent relatives, including its closest relative C. dubliniensis, is the unique expansion of the TLO (TeLOmere-associated) gene family in C. albicans. Individual Tlo proteins are fungal-specific subunits of Mediator, a large multi-subunit eukaryotic transcriptional co-activator complex. This amplification results in a large pool of ‘free,’ non-Mediator associated, Tlo protein present in C. albicans, but not in C. dubliniensis or other ascomycetes with attenuated virulence. We show that engineering a large ‘free’ pool of the C. dubliniensis Tlo2 (CdTlo2) protein in C. dubliniensis, through overexpression, results in a number of filamentation phenotypes typically associated only with C. albicans. The amplitude of these phenotypes is proportional to the amount of overexpressed CdTlo2 protein. Overexpression of other C. dubliniensis and C. albicans Tlo proteins do result in these phenotypes. Tlo proteins and their orthologs contain a Mediator interaction domain, and a potent transcriptional activation domain. Nuclear localization of the CdTlo2 activation domain, facilitated naturally by the Tlo Mediator binding domain or artificially through an appended nuclear localization signal, is sufficient for the CdTlo2 overexpression phenotypes. A C. albicans med3 null mutant causes multiple defects including the inability to localize Tlo proteins to the nucleus and reduced virulence in a murine systemic infection model. Our data supports a model in which the

  15. Amplification of TLO Mediator Subunit Genes Facilitate Filamentous Growth in Candida Spp.

    Directory of Open Access Journals (Sweden)

    Zhongle Liu

    2016-10-01

    Full Text Available Filamentous growth is a hallmark of C. albicans pathogenicity compared to less-virulent ascomycetes. A multitude of transcription factors regulate filamentous growth in response to specific environmental cues. Our work, however, suggests the evolutionary history of C. albicans that resulted in its filamentous growth plasticity may be tied to a change in the general transcription machinery rather than transcription factors and their specific targets. A key genomic difference between C. albicans and its less-virulent relatives, including its closest relative C. dubliniensis, is the unique expansion of the TLO (TeLOmere-associated gene family in C. albicans. Individual Tlo proteins are fungal-specific subunits of Mediator, a large multi-subunit eukaryotic transcriptional co-activator complex. This amplification results in a large pool of 'free,' non-Mediator associated, Tlo protein present in C. albicans, but not in C. dubliniensis or other ascomycetes with attenuated virulence. We show that engineering a large 'free' pool of the C. dubliniensis Tlo2 (CdTlo2 protein in C. dubliniensis, through overexpression, results in a number of filamentation phenotypes typically associated only with C. albicans. The amplitude of these phenotypes is proportional to the amount of overexpressed CdTlo2 protein. Overexpression of other C. dubliniensis and C. albicans Tlo proteins do result in these phenotypes. Tlo proteins and their orthologs contain a Mediator interaction domain, and a potent transcriptional activation domain. Nuclear localization of the CdTlo2 activation domain, facilitated naturally by the Tlo Mediator binding domain or artificially through an appended nuclear localization signal, is sufficient for the CdTlo2 overexpression phenotypes. A C. albicans med3 null mutant causes multiple defects including the inability to localize Tlo proteins to the nucleus and reduced virulence in a murine systemic infection model. Our data supports a model in which

  16. Exploration of new perspectives and limitations in Agrobacterium-mediated gene transfer technology. Final report, June 1, 1992--May 31, 1995

    Energy Technology Data Exchange (ETDEWEB)

    Marton, L.

    1996-02-01

    Genetic manipulation of plants often involves the introduction of homologous or partly homologous genes. Ectropic introduction of homologous sequences into plant genomes may trigger epigenetic changes, making expression of the genes unpredictable. The main project objective was to examine the feasibility of using Agrobacterium-mediated gene transfer for homologous gene targeting in plants.

  17. Factors enhancing Agrobacterium tumefaciens-mediated gene transfer in peanut (Arachis hypogaea L.)

    Science.gov (United States)

    Egnin, M.; Mora, A.; Prakash, C. S.; Mortley, D. G. (Principal Investigator)

    1998-01-01

    Parameters enhancing Agrobacterium-mediated transfer of foreign genes to peanut (Arachis hypogaea L.) cells were investigated. An intron-containing beta-glucuronidase uidA (gusA) gene under the transcriptional control of CaMV 35S promoter served as a reporter. Transformation frequency was evaluated by scoring the number of sectors expressing GUS activity on leaf and epicotyl explants. The 'Valencia Select' market type cv. New Mexico was more amenable to Agrobacterium transformation than the 'runner' market type cultivars tested (Florunner, Georgia Runner, Sunrunner, or South Runner). The disarmed Agrobacterium tumefaciens strain EHA101 was superior in facilitating the transfer of uidA gene to peanut cells compared to the disarmed strain C58. Rinsing of explants in half-strength Murashige-Skoog (MS) media prior to infection by Agrobacterium significantly increased the transformation efficiency. The use of cocultivation media containing high auxin [1.0 or 2.5 mg/l (4.53 micromolar or 11.31 micromolar) 2,4-D] and low cytokinin [0.25 or 0.5 mg/l (1.0 micromolar or 2.0 micromolar) BA] promoted higher transformation than either hormone-free or thidiazuron-containing medium. The polarity of the epicotyl during cocultivation was important; explants incubated in an inverted (vertically) manner followed by a vertically upright position resulted in improved transformation and shoot regeneration frequencies. Preculture of explants in MS basal medium or with 2.5 mg thidiazuron per l prior to infection drastically decreased the number of transformed zones. The optimized protocol was used to obtain transient transformation frequencies ranging from 12% to 36% for leaf explants, 15% to 42% for epicotyls. Initial evidence of transformation was obtained by polymerase chain reaction and subsequently confirmed by Southern analysis of regenerated plants.

  18. Lentiviral Vector-Mediated GFP/fluc gene introduction into primary mouse NK cells

    International Nuclear Information System (INIS)

    L, Thi Thanh Hoa; Tae, Seong Ho; Min, Jung Joon

    2007-01-01

    NK cell is a type of lymphocyte that has ability in defense against virus infection and some kinds of cancer diseases. Recently, using genetic engineering, studies about the roles and functions of NK cells have been developing. In this study, we used lentivirus-based vector encoding GFP/Fluc gene to transfer into primary mouse NK cells. This model is a tool in studying characteristics of NK cells. The lentivirus used in this study was a commercial one, named LentiM1.3-Fluc, encoding GFP and Flue reporter genes under the control of the murine cytomegalovirus (MCMV) promoter. LentiM1.3-Fluc was infected into freshly isolated mouse NK cells at 2 20 MOl by incubating or using spin infection. In the spin infection, we gently suspended NK cells in viral fluid, then centrifuged at 2000 rpm, 20 minutes at room temperature and incubated for 1 day. After 1 day, virus was discarded and NK cells were cultured in IL-2 with or without IL-12 supplemented media. Infected NK cells were monitored by using fluorescent microscope for GFP and IVIS machine for Fire-fly luciferase expression. The results showed that using spin infection had much effect on introducing lentiviral vector-mediated reporter gene into NK cells than the way without spin. Also, NK cells which were cultured in IL-2 and IL-12 added media expressed higher fluorescent and luminescent signals than those cultured in only IL-2 supplemented media. When these NK cells were injected subcutaneously in Balb/C mice, the imaging signal was observed transiently. Our study demonstrates that by using a simple method, mouse NK cells can be transfected by lentivirus. And this will be useful in studying biology and therapeutic potential of NK cells. However, we require developing alternative lentiviral vectors with different promoter for in vivo application

  19. The Arabidopsis Mediator Complex Subunits MED16, MED14, and MED2 Regulate Mediator and RNA Polymerase II Recruitment to CBF-Responsive Cold-Regulated Genes[C][W][OPEN

    Science.gov (United States)

    Hemsley, Piers A.; Hurst, Charlotte H.; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R.; De Cothi, Elizabeth A.; Steele, John F.; Knight, Heather

    2014-01-01

    The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation–induced freezing tolerance. In addition, these three subunits are required for low temperature–induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced. PMID:24415770

  20. The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer

    Science.gov (United States)

    2014-03-01

    8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression

  1. Wnt-mediated down-regulation of Sp1 target genes by a transcriptional repressor Sp5

    Czech Academy of Sciences Publication Activity Database

    Fujimura, Naoko; Vacík, Tomáš; Machoň, Ondřej; Vlček, Čestmír; Scalabrin, S.; Speth, M.; Diep, D.; Krauss, S.; Kozmik, Zbyněk

    2007-01-01

    Roč. 282, č. 2 (2007), s. 1225-1237 ISSN 0021-9258 Institutional research plan: CEZ:AV0Z50520514 Keywords : Wnt -mediated signaling * Sp5 transcription factor * Sp1 target genes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.581, year: 2007

  2. An active role for endogenous beta-1,3-glucanase genes in transgene-mediated co-suppression in tobacco.

    Science.gov (United States)

    Sanders, Matthew; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John

    2002-11-01

    Post-transcriptional gene silencing (PTGS) is characterized by the accumulation of short interfering RNAs that are proposed to mediate sequence-specific degradation of cognate and secondary target mRNAs. In plants, it is unclear to what extent endogenous genes contribute to this process. Here, we address the role of the endogenous target genes in transgene-mediated PTGS of beta-1,3-glucanases in tobacco. We found that mRNA sequences of the endogenous glucanase glb gene with varying degrees of homology to the Nicotiana plumbaginifolia gn1 transgene are targeted by the silencing machinery, although less efficiently than corresponding transgene regions. Importantly, we show that endogene-specific nucleotides in the glb sequence provide specificity to the silencing process. Consistent with this finding, small sense and antisense 21- to 23-nucleotide RNAs homologous to the endogenous glb gene were detected. Combined, these data demonstrate that a co-suppressed endogenous glucan ase gene is involved in signal amplification and selection of homologous targets, and show that endogenous genes can actively participate in PTGS in plants. The findings are introduced as a further sophistication of the post-transciptional silencing model.

  3. Identification of highly effective target genes for RNAi-mediated control of emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Duan, Jian J; Palli, Subba R; Rieske, Lynne K

    2018-03-22

    Recent study has shown that RNA interference (RNAi) is efficient in emerald ash borer (EAB), Agrilus planipennis, and that ingestion of double-stranded RNA (dsRNA) targeting specific genes causes gene silencing and mortality in neonates. Here, we report on the identification of highly effective target genes for RNAi-mediated control of EAB. We screened 13 candidate genes in neonate larvae and selected the most effective target genes for further investigation, including their effect on EAB adults and on a non-target organism, Tribolium castaneum. The two most efficient target genes selected, hsp (heat shock 70-kDa protein cognate 3) and shi (shibire), caused up to 90% mortality of larvae and adults. In EAB eggs, larvae, and adults, the hsp is expressed at higher levels when compared to that of shi. Ingestion of dsHSP and dsSHI caused mortality in both neonate larvae and adults. Administration of a mixture of both dsRNAs worked better than either dsRNA by itself. In contrast, injection of EAB.dsHSP and EAB.dsSHI did not cause mortality in T. castaneum. Thus, the two genes identified cause high mortality in the EAB with no apparent phenotype effects in a non-target organism, the red flour beetle, and could be used in RNAi-mediated control of this invasive pest.

  4. AGROBEST: an efficient Agrobacterium-mediated transient expression method for versatile gene function analyses in Arabidopsis seedlings

    Science.gov (United States)

    2014-01-01

    Background Transient gene expression via Agrobacterium-mediated DNA transfer offers a simple and fast method to analyze transgene functions. Although Arabidopsis is the most-studied model plant with powerful genetic and genomic resources, achieving highly efficient and consistent transient expression for gene function analysis in Arabidopsis remains challenging. Results We developed a highly efficient and robust Agrobacterium-mediated transient expression system, named AGROBEST (Agrobacterium-mediated enhanced seedling transformation), which achieves versatile analysis of diverse gene functions in intact Arabidopsis seedlings. Using β-glucuronidase (GUS) as a reporter for Agrobacterium-mediated transformation assay, we show that the use of a specific disarmed Agrobacterium strain with vir gene pre-induction resulted in homogenous GUS staining in cotyledons of young Arabidopsis seedlings. Optimization with AB salts in plant culture medium buffered with acidic pH 5.5 during Agrobacterium infection greatly enhanced the transient expression levels, which were significantly higher than with two existing methods. Importantly, the optimized method conferred 100% infected seedlings with highly increased transient expression in shoots and also transformation events in roots of ~70% infected seedlings in both the immune receptor mutant efr-1 and wild-type Col-0 seedlings. Finally, we demonstrated the versatile applicability of the method for examining transcription factor action and circadian reporter-gene regulation as well as protein subcellular localization and protein–protein interactions in physiological contexts. Conclusions AGROBEST is a simple, fast, reliable, and robust transient expression system enabling high transient expression and transformation efficiency in Arabidopsis seedlings. Demonstration of the proof-of-concept experiments elevates the transient expression technology to the level of functional studies in Arabidopsis seedlings in addition to previous

  5. KDM2B Recruitment of the Polycomb Group Complex, PRC1.1, Requires Cooperation between PCGF1 and BCORL1.

    Science.gov (United States)

    Wong, Sarah J; Gearhart, Micah D; Taylor, Alexander B; Nanyes, David R; Ha, Daniel J; Robinson, Angela K; Artigas, Jason A; Lee, Oliver J; Demeler, Borries; Hart, P John; Bardwell, Vivian J; Kim, Chongwoo A

    2016-10-04

    KDM2B recruits H2A-ubiquitinating activity of a non-canonical Polycomb Repression Complex 1 (PRC1.1) to CpG islands, facilitating gene repression. We investigated the molecular basis of recruitment using in vitro assembly assays to identify minimal components, subcomplexes, and domains required for recruitment. A minimal four-component PRC1.1 complex can be assembled by combining two separately isolated subcomplexes: the DNA-binding KDM2B/SKP1 heterodimer and the heterodimer of BCORL1 and PCGF1, a core component of PRC1.1. The crystal structure of the KDM2B/SKP1/BCORL1/PCGF1 complex illustrates the crucial role played by the PCGF1/BCORL1 heterodimer. The BCORL1 PUFD domain positions residues preceding the RAWUL domain of PCGF1 to create an extended interface for interaction with KDM2B, which is unique to the PCGF1-containing PRC1.1 complex. The structure also suggests how KDM2B might simultaneously function in PRC1.1 and an SCF ubiquitin ligase complex and the possible molecular consequences of BCOR PUFD internal tandem duplications found in pediatric kidney and brain tumors. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Serotonin₂A/C receptors mediate the aggressive phenotype of TLX gene knockout mice.

    Science.gov (United States)

    Juárez, Pablo; Valdovinos, Maria G; May, Michael E; Lloyd, Blair P; Couppis, Maria H; Kennedy, Craig H

    2013-11-01

    Deleting the tailless (TLX) gene in mice produces a highly aggressive phenotype yet to be characterized in terms of heterozygous animals or neurotransmitter mechanisms. We sought to establish pharmacological control over aggression and study the role of serotonin (5-HT)(2A/C) receptors in mediating changes in aggression. We analyzed aggression in mice heterozygous (+/-) or homozygous (-/-) for the TLX gene and wild-types (+/+) using a resident-intruder paradigm. No +/+ mice were aggressive, 36% of +/- TLX and 100% of -/- TLX mice showed aggression. Dose-effect functions were established for clozapine (0.1-1.5mg/kg, ip), ketanserin (0.3-1.25 mg/kg, ip), and (±)-1-(2,5-dimethoxy-4-iodophenyl)-2-aminopropane [(±)DOI] (0.5-2.0 mg/kg, ip). Injecting clozapine decreased the frequency and duration of attacks for +/- TLX and -/- TLX mice. Clozapine did not decrease grooming in either +/- TLX or -/- TLX mice but may have increased locomotion for -/- TLX mice. Injecting ketanserin, a 5-HT(2A/C) receptor antagonist, produced differential decreases in frequency and latency to aggression between genotypes and corresponding increases in locomotor behavior. Injecting (±)DOI, a 5-HT(2A/C) receptor agonist, increased the frequency and duration of attacks, decreased the latency to attacks, and decreased locomotion in +/- and -/- TLX mice. Results of the current study suggest aggression displayed by TLX null and heterozygous mice involves 5-HT(2A/C) receptors. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Retroviral-mediated gene therapy for the differentiation of primary cells into a mineralizing osteoblastic phenotype.

    Science.gov (United States)

    Phillips, Jennifer E; García, Andrés J

    2008-01-01

    Bone tissue engineering has emerged as a promising strategy for the repair of critical-sized skeletal fractures. However, the clinical application of this approach has been limited by the availability of a robust mineralizing cell source. Non-osteogenic cells, such as skin fibroblasts, are an attractive cell-source alternative because they are easy to harvest from autologous donor skin biopsies and display a high capacity for in vitro expansion. We have recently demonstrated that retroviral gene delivery of the osteoblastic transcription factor Runx2/Cbfa1 promotes osteogenic differentiation in primary dermal fibroblasts cultured in monolayer. Notably, sustained expression of Runx2 was not sufficient to promote functional osteogenesis in these cells, and co-treatment with the steroid hormone dexamethasone was required to induce deposition of biologically-equivalent matrix mineralization. On the basis of these results, we then investigated the osteogenic capacity of these genetically engineered fibroblasts when seeded on polymeric scaffolds in vitro and in vivo. These experiments demonstrated that Runx2-expressing fibroblasts seeded on collagen scaffolds produce significant levels of matrix mineralization after 28 days in vivo implantation in a subcutaneous, heterotopic site. Overall, these results offer evidence that transcription factor-based gene therapy may be a powerful strategy for the conversion of a non-osteogenic cellular phenotype into a mineralizing cell source for bone repair applications. This concept may also be applied to control functional differentiation in a broad range of cell types and tissue engineering applications. The chapter below outlines detailed methods for the isolation and ex vivo genetic modification of primary dermal fibroblasts using retroviral-mediated delivery of the Runx2 transgene in both monolayer culture and three-dimensional scaffolds.

  8. Cationic liposome-mediated gene transfer to tumor cells in vitro and in vivo.

    Science.gov (United States)

    Son, K; Sorgi, F; Gao, X; Huang, L

    1997-01-01

    Development of safe and effective technology for delivering functional DNA into cells in an intact organism is crucial to broad applications of gene therapy to human disease. Both viral and nonviral vectors have been developed. Of the technologies currently being studied, liposomal delivery system is particularly attractive. Cationic liposome-mediated gene transfection (lipofection), a relatively new technique pioneered by Felgner and coworkers (1), was highly efficient for transfecting cells in culture. The liposomes were composed of an equimolar mixture of a synthetic cationic lipid N-[1-(2,3,-dioleyloxy)propyl]-N,N,N,-trimethylammonium chloride (DOTMA) and a helper lipid dioleoyl-phosphatidylethanolamine (DOPE) Fig. 1). The DOTMA/DOPE mixture (Lipofectin) forms complexes with DNA by charge interaction upon mixing at room temperature. Other catronic lipids are DOTAP, LipofectAMINE, Lipofectam, and DC-chol. The DOTAP is a diester analog of DOTMA and commercially available. LipofectAMINE and Lipofectam are polycationic lipids with a spermine head group that show increased frequency and activity of eukaryotic cell transfection (2,3). 3β-[N-(N',N'-dimethyaminoaminoethane) carbamoyl] cholesterol (DC-chol) (Fig. 1), a cationic cholesterol derivative, was introduced by Gao and Huang (4) and is routinely used in our laboratory. The DC-chol is now commercially available but can be easily synthesized with a single-step reaction from N,N-dimethylethylenediamine and cholesterol chloroformate (4), and improves the efficiency of transfection with minimal toxicity.Liposomes prepared with DC-chol and DOPE (3∶2 molar ratio) are stable at 4°C for at least 1 yr (unpublished data).

  9. Association of the STAT4 gene with increased susceptibility for some immune-mediated diseases.

    Science.gov (United States)

    Martínez, A; Varadé, J; Márquez, A; Cénit, M C; Espino, L; Perdigones, N; Santiago, J L; Fernández-Arquero, M; de la Calle, H; Arroyo, R; Mendoza, J L; Fernández-Gutiérrez, B; de la Concha, E G; Urcelay, E

    2008-09-01

    The STAT4 gene encodes a transcription factor involved in the signaling pathways of several cytokines, including interleukin-12 (IL-12), the type I interferons, and IL-23. Recently, the association of a STAT4 haplotype marked by rs7574865 with rheumatoid arthritis (RA) and systemic lupus erythematosus was reported. The aim of this study was to investigate the role of this STAT4 tagging polymorphism in other immune-mediated diseases. The study group comprised 2,776 consecutively recruited Spanish individuals: 575 with RA, 440 with multiple sclerosis, 700 with inflammatory bowel disease, 311 with type 1 diabetes, and 723 ethnically matched healthy control subjects. The STAT4 polymorphism rs7574865 was genotyped using a predesigned TaqMan assay. Allele and genotype frequencies in patients and control subjects were compared by chi-square test. The association of STAT4 polymorphism rs7574865 with RA was validated in patients of Spanish origin (for T versus G, P = 1.2 x 10(-6), odds ratio [OR] 1.59, 95% confidence interval [95% CI] 1.31-1.92), and the association was described for the first time in both clinical forms of inflammatory bowel disease, Crohn's disease and ulcerative colitis (for T versus G, P = 0.006, OR 1.29, 95% CI 1.07-1.55), and in type 1 diabetes mellitus (for T versus G, P = 0.008, OR 1.36, 95% CI 1.07-1.71). In contrast, the genotypic distribution of this polymorphism showed no difference between patients with multiple sclerosis and healthy control subjects (for T versus G, P = 0.83, OR 1.02, 95% CI 0.82-1.28). The STAT4 gene is emerging as a novel common risk factor for diverse complex diseases.

  10. Transcriptome Analysis and Screening for Potential Target Genes for RNAi-Mediated Pest Control of the Beet Armyworm, Spodoptera exigua.

    Science.gov (United States)

    Li, Hang; Jiang, Weihua; Zhang, Zan; Xing, Yanru; Li, Fei

    2013-01-01

    The beet armyworm, Spodoptera exigua (Hübner), is a serious pest worldwide that causes significant losses in crops. Unfortunately, genetic resources for the beet armyworm is extremely scarce. To improve these resources we sequenced the transcriptome of S. exigua representing all stages including eggs, 1(st) to 5(th) instar larvae, pupae, male and female adults using the Illumina Solexa platform. We assembled the transcriptome with Trinity that yielded 31,414 contigs. Of these contigs, 18,592 were annotated as protein coding genes by Blast searches against the NCBI nr database. It has been shown that knockdown of important insect genes by dsRNAs or siRNAs is a feasible mechanism to control insect pests. The first key step towards developing an efficient RNAi-mediated pest control technique is to find suitable target genes. To screen for effective target genes in the beet armyworm, we selected nine candidate genes. The sequences of these genes were amplified using the RACE strategy. Then, siRNAs were designed and chemically synthesized. We injected 2 µl siRNA (2 µg/µl) into the 4(th) instar larvae to knock down the respective target genes. The mRNA abundance of target genes decreased to different levels (∼20-94.3%) after injection of siRNAs. Knockdown of eight genes including chitinase7, PGCP, chitinase1, ATPase, tubulin1, arf2, tubulin2 and arf1 caused a significantly high level of mortality compared to the negative control (Ppest control.

  11. Radiochemotherapy of hepatocarcinoma via lentivirus-mediated transfer of human sodium iodide symporter gene and herpes simplex virus thymidine kinase gene

    Energy Technology Data Exchange (ETDEWEB)

    Chen Libo, E-mail: libochen888@hotmail.com [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China); Guo Guoying [Xinyuan Institute of Medicine and Biotechnology, School of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Liu Tianjing; Guo Lihe [Division of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031 (China); Zhu Ruisen [Department of Nuclear Medicine, Shanghai Sixth People' s Hospital, Shanghai Jiao Tong University, Shanghai 200233 (China)

    2011-07-15

    Herpes simplex virus thymidine kinase (HSV-TK) gene/ganciclovir (GCV) system has been widely used as a traditional gene therapy modality, and the sodium/iodide symporter gene (NIS) has been found to be a novel therapeutic gene. Since the therapeutic effects of radioiodine therapy or prodrug chemotherapy on cancers following NIS or HSV-TK gene transfer need to be enhanced, this study was designed to investigate the feasibility of radiochemotherapy for hepatocarcinoma via coexpression of NIS gene and HSV-TK gene. Methods: HepG2 cells were stably transfected with NIS, TK and GFP gene via recombinant lentiviral vector and named HepG2/NTG. Gene expression was examined by reverse transcriptase polymerase chain reaction, fluorescence imaging and iodide uptake. The therapeutic effects were assessed by MTT assay and clonogenic assay. Results: HepG2/NTG cells concentrated {sup 125}I{sup -} up to 76-fold higher than the wild-type cells within 20 min, and the efflux happened with a T{sub 1/2eff} of less than 10 min. The iodide uptake in HepG2/NTG cells was specifically inhibited by sodium perchlorate. Dose-dependent toxicity to HepG2/NTG cells by either GCV or {sup 131}I was revealed by clonogenic assay and MTT assay, respectively. The survival rate of HepG2/NTG cells decreased to 49.7%{+-}2.5%, 43.4%{+-}2.8% and 8.6%{+-}1.2% after exposure to {sup 131}I, GCV and combined therapy, respectively. Conclusion: We demonstrate that radiochemotherapy of hepatocarcinoma via lentiviral-mediated coexpression of NIS gene and HSV-TK gene leads to stronger killing effect than single treatment, and in vivo studies are needed to verify these findings.

  12. Radiochemotherapy of hepatocarcinoma via lentivirus-mediated transfer of human sodium iodide symporter gene and herpes simplex virus thymidine kinase gene

    International Nuclear Information System (INIS)

    Chen Libo; Guo Guoying; Liu Tianjing; Guo Lihe; Zhu Ruisen

    2011-01-01

    Herpes simplex virus thymidine kinase (HSV-TK) gene/ganciclovir (GCV) system has been widely used as a traditional gene therapy modality, and the sodium/iodide symporter gene (NIS) has been found to be a novel therapeutic gene. Since the therapeutic effects of radioiodine therapy or prodrug chemotherapy on cancers following NIS or HSV-TK gene transfer need to be enhanced, this study was designed to investigate the feasibility of radiochemotherapy for hepatocarcinoma via coexpression of NIS gene and HSV-TK gene. Methods: HepG2 cells were stably transfected with NIS, TK and GFP gene via recombinant lentiviral vector and named HepG2/NTG. Gene expression was examined by reverse transcriptase polymerase chain reaction, fluorescence imaging and iodide uptake. The therapeutic effects were assessed by MTT assay and clonogenic assay. Results: HepG2/NTG cells concentrated 125 I - up to 76-fold higher than the wild-type cells within 20 min, and the efflux happened with a T 1/2eff of less than 10 min. The iodide uptake in HepG2/NTG cells was specifically inhibited by sodium perchlorate. Dose-dependent toxicity to HepG2/NTG cells by either GCV or 131 I was revealed by clonogenic assay and MTT assay, respectively. The survival rate of HepG2/NTG cells decreased to 49.7%±2.5%, 43.4%±2.8% and 8.6%±1.2% after exposure to 131 I, GCV and combined therapy, respectively. Conclusion: We demonstrate that radiochemotherapy of hepatocarcinoma via lentiviral-mediated coexpression of NIS gene and HSV-TK gene leads to stronger killing effect than single treatment, and in vivo studies are needed to verify these findings.

  13. Gene therapy for C-26 colon cancer using heparin-polyethyleneimine nanoparticle-mediated survivin T34A

    Directory of Open Access Journals (Sweden)

    Zhang L

    2011-10-01

    Full Text Available Ling Zhang1,*, Xiang Gao1,2,*, Ke Men1, BiLan Wang1, Shuang Zhang1, Jinfeng Qiu1, Meijuan Huang1, MaLing Gou1, Ning Huang2, ZhiYong Qian1, Xia Zhao1, YuQuan Wei11State Key Laboratory of Biotherapy and Cancer Center, West China Hospital, West China Medical School, 2Department of Pathophysiology, College of Preclinical and Forensic Medical Sciences, Sichuan University, Chengdu, People’s Republic of China*These authors contributed equally to this workBackground: Gene therapy provides a novel method for the prevention and treatment of cancer, but the clinical application of gene therapy is restricted, mainly because of the absence of an efficient and safe gene delivery system. Recently, we developed a novel nonviral gene carrier, ie, heparin-polyethyleneimine (HPEI nanoparticles for this purpose.Methods and results: HPEI nanoparticles were used to deliver plasmid-expressing mouse survivin-T34A (ms-T34A to treat C-26 carcinoma in vitro and in vivo. According to the in vitro studies, HPEI nanoparticles could efficiently transfect the pGFP report gene into C-26 cells, with a transfection efficiency of 30.5% ± 2%. Moreover, HPEI nanoparticle-mediated ms-T34A could efficiently inhibit the proliferation of C-26 cells by induction of apoptosis in vitro. Based on the in vivo studies, HPEI nanoparticles could transfect the Lac-Z report gene into C-26 cells in vivo. Intratumoral injection of HPEI nanoparticle-mediated ms-T34A significantly inhibited growth of subcutaneous C-26 carcinoma in vivo by induction of apoptosis and inhibition of angiogenesis.Conclusion: This research suggests that HPEI nanoparticle-mediated ms-T34A may have a promising role in C-26 colon carcinoma therapy.Keywords: gene therapy, mouse survivin-T34A, colon cancer, polyethyleneimine, nanoparticles, cancer therapy

  14. Lentiviral vector-mediated genetic modification of human neural progenitor cells for ex vivo gene therapy.

    Science.gov (United States)

    Capowski, Elizabeth E; Schneider, Bernard L; Ebert, Allison D; Seehus, Corey R; Szulc, Jolanta; Zufferey, Romain; Aebischer, Patrick; Svendsen, Clive N

    2007-07-30

    Human neural progenitor cells (hNPC) hold great potential as an ex vivo system for delivery of therapeutic proteins to the central nervous system. When cultured as aggregates, termed neurospheres, hNPC are capable of significant in vitro expansion. In the current study, we present a robust method for lentiviral vector-mediated gene delivery into hNPC that maintains the differentiation and proliferative properties of neurosphere cultures while minimizing the amount of viral vector used and controlling the number of insertion sites per population. This method results in long-term, stable expression even after differentiation of the hNPC to neurons and astrocytes and allows for generation of equivalent transgenic populations of hNPC. In addition, the in vitro analysis presented predicts the behavior of transgenic lines in vivo when transplanted into a rodent model of Parkinson's disease. The methods presented provide a powerful tool for assessing the impact of factors such as promoter systems or different transgenes on the therapeutic utility of these cells.

  15. Beyond Neuronal Activity Markers: Select Immediate Early Genes in Striatal Neuron Subtypes Functionally Mediate Psychostimulant Addiction

    Directory of Open Access Journals (Sweden)

    Ramesh Chandra

    2017-06-01

    Full Text Available Immediate early genes (IEGs were traditionally used as markers of neuronal activity in striatum in response to stimuli including drugs of abuse such as psychostimulants. Early studies using these neuronal activity markers led to important insights in striatal neuron subtype responsiveness to psychostimulants. Such studies have helped identify striatum as a critical brain center for motivational, reinforcement and habitual behaviors in psychostimulant addiction. While the use of IEGs as neuronal activity markers in response to psychostimulants and other stimuli persists today, the functional role and implications of these IEGs has often been neglected. Nonetheless, there is a subset of research that investigates the functional role of IEGs in molecular, cellular and behavioral alterations by psychostimulants through striatal medium spiny neuron (MSN subtypes, the two projection neuron subtypes in striatum. This review article will address and highlight the studies that provide a functional mechanism by which IEGs mediate psychostimulant molecular, cellular and behavioral plasticity through MSN subtypes. Insight into the functional role of IEGs in striatal MSN subtypes could provide improved understanding into addiction and neuropsychiatric diseases affecting striatum, such as affective disorders and compulsive disorders characterized by dysfunctional motivation and habitual behavior.

  16. Modeling and validation of autoinducer-mediated bacterial gene expression in microfluidic environments

    Science.gov (United States)

    Austin, Caitlin M.; Stoy, William; Su, Peter; Harber, Marie C.; Bardill, J. Patrick; Hammer, Brian K.; Forest, Craig R.

    2014-01-01

    Biosensors exploiting communication within genetically engineered bacteria are becoming increasingly important for monitoring environmental changes. Currently, there are a variety of mathematical models for understanding and predicting how genetically engineered bacteria respond to molecular stimuli in these environments, but as sensors have miniaturized towards microfluidics and are subjected to complex time-varying inputs, the shortcomings of these models have become apparent. The effects of microfluidic environments such as low oxygen concentration, increased biofilm encapsulation, diffusion limited molecular distribution, and higher population densities strongly affect rate constants for gene expression not accounted for in previous models. We report a mathematical model that accurately predicts the biological response of the autoinducer N-acyl homoserine lactone-mediated green fluorescent protein expression in reporter bacteria in microfluidic environments by accommodating these rate constants. This generalized mass action model considers a chain of biomolecular events from input autoinducer chemical to fluorescent protein expression through a series of six chemical species. We have validated this model against experimental data from our own apparatus as well as prior published experimental results. Results indicate accurate prediction of dynamics (e.g., 14% peak time error from a pulse input) and with reduced mean-squared error with pulse or step inputs for a range of concentrations (10 μM–30 μM). This model can help advance the design of genetically engineered bacteria sensors and molecular communication devices. PMID:25379076

  17. Pollen-mediated gene flow in flax (Linum usitatissimum L.): can genetically engineered and organic flax coexist?

    Science.gov (United States)

    Jhala, A J; Bhatt, H; Topinka, K; Hall, L M

    2011-04-01

    Coexistence allows growers and consumers the choice of producing or purchasing conventional or organic crops with known standards for adventitious presence of genetically engineered (GE) seed. Flax (Linum usitatissimum L.) is multipurpose oilseed crop in which product diversity and utility could be enhanced for industrial, nutraceutical and pharmaceutical markets through genetic engineering. If GE flax were released commercially, pollen-mediated gene flow will determine in part whether GE flax could coexist without compromising other markets. As a part of pre-commercialization risk assessment, we quantified pollen-mediated gene flow between two cultivars of flax. Field experiments were conducted at four locations during 2006 and 2007 in western Canada using a concentric donor (20 × 20 m) receptor (120 × 120 m) design. Gene flow was detected through the xenia effect of dominant alleles of high α-linolenic acid (ALA; 18:3(cisΔ9,12,15)) to the low ALA trait. Seeds were harvested from the pollen recipient plots up to a distance of 50 m in eight directions from the pollen donor. High ALA seeds were identified using a thiobarbituric acid test and served as a marker for gene flow. Binomial distribution and power analysis were used to predict the minimum number of seeds statistically required to detect the frequency of gene flow at specific α (confidence interval) and power (1-β) values. As a result of the low frequency of gene flow, approximately 4 million seeds were screened to derive accurate quantification. Frequency of gene flow was highest near the source: averaging 0.0185 at 0.1 m but declined rapidly with distance, 0.0013 and 0.00003 at 3 and 35 m, respectively. Gene flow was reduced to 50% (O₅₀) and 90% (O₉₀) between 0.85 to 2.64 m, and 5.68 to 17.56 m, respectively. No gene flow was detected at any site or year > 35 m distance from the pollen source, suggesting that frequency of gene flow was ≤ 0.00003 (P = 0.95). Although it is not possible to

  18. SSX and the synovial-sarcoma-specific chimaeric protein SYT-SSX co-localize with the human Polycomb group complex.

    Science.gov (United States)

    Soulez, M; Saurin, A J; Freemont, P S; Knight, J C

    1999-04-29

    Chromosome translocation t(X;18)(p11.2;q11.2) is unique to synovial sarcomas and results in an 'in frame' fusion of the SYT gene with the SSX1 or closely-related SSX2 gene. Wild-type SYT and SSX proteins, and the SYT-SSX chimaeric proteins, can modulate transcription in gene reporter assays. To help elucidate the role of these proteins in cell function and neoplasia we have performed immunolabelling experiments to determine their subcellular localization in three cell types. Transient expression of epitope-tagged proteins produced distinctive nuclear staining patterns. The punctate staining of SYT and SYT-SSX proteins showed some similarities. We immunolabelled a series of endogenous nuclear antigens and excluded the SYT and SYT-SSX focal staining from association with these domains (e.g. sites of active transcription, snRNPs). In further experiments we immunolabelled the Polycomb group (PcG) proteins RING1 or BMI-1 and showed that SSX and SYT-SSX proteins, but not SYT, co-localized with these markers. Consistent with this we show that SSX and SYT-SSX associate with chromatin, and also associate with condensed chromatin at metaphase. Noteably, SSX produced a dense signal over the surface of metaphase chromosomes whereas SYT-SSX produced discrete focal staining. Our data indicate that SSX and SYT-SSX proteins are recruited to nuclear domains occupied by PcG complexes, and this provides us with a new insight into the possible function of wild-type SSX and the mechanism by which the aberrant SYT-SSX protein might disrupt fundamental mechanisms controlling cell division and cell fate.

  19. Mediator, TATA-binding Protein, and RNA Polymerase II Contribute to Low Histone Occupancy at Active Gene Promoters in Yeast*

    Science.gov (United States)

    Ansari, Suraiya A.; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z.; Rode, Kara A.; Barber, Wesley T.; Ellis, Laura C.; LaPorta, Erika; Orzechowski, Amanda M.; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H.

    2014-01-01

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. PMID:24727477

  20. Combating oncogene activation associated with retrovirus-mediated gene therapy of X-linked severe combined immunodeficiency

    Directory of Open Access Journals (Sweden)

    B.E. Strauss

    2007-05-01

    Full Text Available A successful gene therapy clinical trial that also encountered serious adverse effects has sparked extensive study and debate about the future directions for retrovirus-mediated interventions. Treatment of X-linked severe combined immunodeficiency with an oncoretrovirus harboring a normal copy of the gc gene was applied in two clinical trials, essentially curing 13 of 16 infants, restoring a normal immune system without the need for additional immune-related therapies. Approximately 3 years after their gene therapy, tragically, 3 of these children, all from the same trial, developed leukemia as a result of this experimental treatment. The current understanding of the mechanism behind this leukemogenesis involves three critical and cooperating factors, i.e., viral integration, oncogene activation, and the function of the therapeutic gene. In this review, we will explore the causes of this unwanted event and some of the possibilities for reducing the risk of its reoccurrence.

  1. Introduction of a rice blight resistance gene, Xa21, into five Chinese rice varieties through an Agrobacterium-mediated system

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A cloned gene, Xa21 was transferred into five widely-used Chinese rice varieties through an Agrobacterium-mediated system, and over 110 independent transgenic lines were obtained. PCR and Southern analysis of transgenic plants revealed the integration of the whole Xa21 gene into the host genomes. The integrated Xa21 gene was stably inherited, and segregated in a 3∶1 ratio in the selfed T1 generation when one copy of the gene was integrated in the transformants. Inoculation tests displayed that transgenic T0 plants and Xa21 PCR-positive T1 plants were highly resistant to bacterial blight disease. The selected Xa21 homozygous resistant transgenic lines with desirable qualities may be propagated as new varieties or utilized in hybrid rice breeding.

  2. Introduction of a rice blight resistance gene, Xa21, into five Chinese rice varieties through an Agrobacterium -mediated system

    Institute of Scientific and Technical Information of China (English)

    翟文学; 李晓兵; 田文忠; 周永力; 潘学彪; 曹守云; 赵显峰; 赵彬; 章琦; 朱立煌

    2000-01-01

    A cloned gene, Xa21 was transferred into five widely-used Chinese rice varieties through an Agrobacterium-mediated system, and over 110 independent transgenic lines were obtained. PCR and Southern analysis of transgenic plants revealed the integration of the whole Xa21 gene into the host genomes. The integrated Xa21 gene was stably inherited, and segregated in a 3 : 1 ratio in the selfed T1 generation when one copy of the gene was integrated in the transfor-mants. Inoculation tests displayed that transgenic T0 plants and Xa21 PCR-positive T1 plants were highly resistant to bacterial blight disease. The selected Xa21 homozygous resistant transgenic lines with desirable qualities may be propagated as new varieties or utilized in hybrid rice breeding.

  3. Core clock, SUB1, and ABAR genes mediate flooding and drought responses via alternative splicing in soybean.

    Science.gov (United States)

    Syed, Naeem H; Prince, Silvas J; Mutava, Raymond N; Patil, Gunvant; Li, Song; Chen, Wei; Babu, Valliyodan; Joshi, Trupti; Khan, Saad; Nguyen, Henry T

    2015-12-01

    Circadian clocks are a great evolutionary innovation and provide competitive advantage during the day/night cycle and under changing environmental conditions. The circadian clock mediates expression of a large proportion of genes in plants, achieving a harmonious relationship between energy metabolism, photosynthesis, and biotic and abiotic stress responses. Here it is shown that multiple paralogues of clock genes are present in soybean (Glycine max) and mediate flooding and drought responses. Differential expression of many clock and SUB1 genes was found under flooding and drought conditions. Furthermore, natural variation in the amplitude and phase shifts in PRR7 and TOC1 genes was also discovered under drought and flooding conditions, respectively. PRR3 exhibited flooding- and drought-specific splicing patterns and may work in concert with PRR7 and TOC1 to achieve energy homeostasis under flooding and drought conditions. Higher expression of TOC1 also coincides with elevated levels of abscisic acid (ABA) and variation in glucose levels in the morning and afternoon, indicating that this response to abiotic stress is mediated by ABA, endogenous sugar levels, and the circadian clock to fine-tune photosynthesis and energy utilization under stress conditions. It is proposed that the presence of multiple clock gene paralogues with variation in DNA sequence, phase, and period could be used to screen exotic germplasm to find sources for drought and flooding tolerance. Furthermore, fine tuning of multiple clock gene paralogues (via a genetic engineering approach) should also facilitate the development of flooding- and drought-tolerant soybean varieties. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  4. Transcriptome analysis highlights defense and signaling pathways mediated by rice pi21 gene with partial resistance to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2016-12-01

    Full Text Available Rice blast disease is one of the most destructive rice diseases worldwide. The pi21 gene confers partial and durable resistance to Magnaporthe oryzae. However, little is known regarding the molecular mechanisms of resistance mediated by the loss-of-function of Pi21. In this study, comparative transcriptome profiling of the Pi21-RNAi transgenic rice line and Nipponbare with M. oryzae infection at different time points (0, 12, 24, 48, and 72 hpi were investigated using RNA sequencing. The results generated 43,222 unique genes mapped to the rice genome. In total, 1,109 differentially expressed genes (DEGs were identified between the Pi21-RNAi line and Nipponbare with M. oryzae infection, with 103, 281, 209, 69, and 678 DEGs at 0, 12, 24, 48, and 72 hpi, respectively. Functional analysis showed that most of the DEGs were involved in metabolism, transport, signaling, and defense. Among the genes assigned to plant–pathogen interaction, we identified 43 receptor kinase genes associated with pathogen-associated molecular pattern recognition and calcium ion influx. The expression levels of brassinolide-insensitive 1, flagellin sensitive 2 and elongation factor Tu receptor, ethylene (ET biosynthesis and signaling genes, were higher in the Pi21-RNAi line than Nipponbare. This suggested that there was a more robust PTI response in Pi21-RNAi plants and that ET signaling was important to rice blast resistance. We also identified 53 transcription factor genes, including WRKY, NAC, DOF, and ERF families that show differential expression between the two genotypes. This study highlights possible candidate genes that may serve a function in the partial rice blast resistance mediated by the loss-of-function of Pi21 and increase our understanding of the molecular mechanisms involved in partial resistance against M. oryzae.

  5. Spatial and temporal assessment of pollen- and seed-mediated gene flow from genetically engineered plum Prunus domestica.

    Directory of Open Access Journals (Sweden)

    Ralph Scorza

    Full Text Available Pollen flow from a 0.46 ha plot of genetically engineered (GE Prunus domestica located in West Virginia, USA was evaluated from 2000-2010. Sentinel plum trees were planted at distances ranging from 132 to 854 m from the center of the GE orchard. Plots of mixed plum varieties and seedlings were located at 384, 484 and 998 m from the GE plot. Bee hives (Apis mellifera were dispersed between the GE plum plot and the pollen flow monitoring sites. Pollen-mediated gene flow from out of the GE plum plot to non-GE plums under the study conditions was low, only occurring at all in 4 of 11 years and then in only 0.31% of the 12,116 seeds analyzed. When it occurred, gene flow, calculated as the number of GUS positive embryos/total embryos sampled, ranged from 0.215% at 132 m from the center of the GE plum plot (28 m from the nearest GE plum tree to 0.033-0.017% at longer distances (384-998 m. Based on the percentage of GUS positive seeds per individual sampled tree the range was 0.4% to 12%. Within the GE field plot, gene flow ranged from 4.9 to 39%. Gene flow was related to distance and environmental conditions. A single year sample from a sentinel plot 132 m from the center of the GE plot accounted for 65% of the total 11-year gene flow. Spatial modeling indicated that gene flow dramatically decreased at distances over 400 m from the GE plot. Air temperature and rainfall were, respectively, positively and negatively correlated with gene flow, reflecting the effects of weather conditions on insect pollinator activity. Seed-mediated gene flow was not detected. These results support the feasibility of coexistence of GE and non-GE plum orchards.

  6. Dual effects of adenovirus-mediated thrombopoietin gene transfer on hepatic oval cell proliferation and platelet counts

    International Nuclear Information System (INIS)

    Ichiba, Miho; Shimomura, Takashi; Murai, Rie; Hashiguchi, Koichi; Saeki, Toshiya; Yoshida, Yoko; Kanbe, Takamasa; Tanabe, Naotada; Tsuchiya, Hiroyuki; Miura, Norimasa; Tajima, Fumihito; Kurimasa, Akihiro; Hamada, Hirofumi; Shiota, Goshi

    2005-01-01

    Thrombopoietin (TPO) is the growth factor for megakaryocytes and platelets, however, it also acts as a potent regulator of stem cell proliferation. To examine the significance of TPO expression in proliferation of hepatic oval cells, the effect of adenovirus-mediated TPO gene transfer into livers of the Solt-Farber model, which mimics the condition where liver regeneration is impaired, was examined. Hepatic TPO mRNA peaked its expression at 2 days after gene transduction and then gradually decreased. The peripheral platelet number began to increase at 4 days (P < 0.05) and reached its plateau at 9 days (P < 0.01). Oval cells expressed c-Mpl, a receptor for TPO as well as immature hematopoietic and hepatocytic surface markers such as CD34 and AFP. The proliferating cell nuclear antigen-positive oval cells in rats into which adenovirus-TPO gene was transferred at 7 and 9 days were significantly greater than those in adenovirus-LacZ gene transferred (P < 0.05, each), and the total numbers of oval cells in the adenovirus-TPO gene transferred at 9 and 13 days were also significantly greater than those in adenovirus-LacZ gene transferred (P < 0.05, each). Expression of SCF protein was increased at 4, 7, and 9 days by TPO gene administration and that of c-Kit was increased at 4 and 7 days. These data suggest that adenovirus-mediated TPO gene transfer stimulated oval cell proliferation in liver as well as increasing peripheral platelet counts, emphasizing the significance of the TPO/c-Mpl system in proliferation of hepatic oval cells

  7. Lipid-mediated glial cell line-derived neurotrophic factor gene transfer to cultured porcine ventral mesencephalic tissue

    DEFF Research Database (Denmark)

    Bauer, Matthias; Meyer, Morten; Brevig, Thomas

    2002-01-01

    Transplantation of dopaminergic ventral mesencephalic (VM) tissue into the basal ganglia of patients with Parkinson's disease (PD) shows at best moderate symptomatic relief in some of the treated cases. Experimental animal studies and clinical trials with allogenic and xenogenic pig-derived VM...... tissue grafts to PD patients indicate that one reason for the poor outcome of neural transplantation is the low survival and differentiation of grafted dopaminergic neurons. To improve dopaminergic cell survival through a gene-therapeutic approach we have established and report here results of lipid-mediated...... numbers of tyrosine hydroxylase-positive neurons in the cultured VM tissue. We conclude that lipid-mediated gene transfer employed on embryonic pig VM explant cultures is a safe and effective method to improve survival of dopaminergic neurons and may become a valuable tool to improve allo...

  8. Identification of a Plasmid-Mediated Quinolone Resistance Gene in Salmonella Isolates from Texas Dairy Farm Environmental Samples.

    Science.gov (United States)

    Cummings, K J; Rodriguez-Rivera, L D; Norman, K N; Ohta, N; Scott, H M

    2017-06-01

    A recent increase in plasmid-mediated quinolone resistance (PMQR) has been detected among Salmonella isolated from humans in the United States, and it is necessary to determine the sources of human infection. We had previously isolated Salmonella from dairy farm environmental samples collected in Texas, and isolates were tested for anti-microbial susceptibility. Two isolates, serotyped as Salmonella Muenster, showed the discordant pattern of nalidixic acid susceptibility and intermediate susceptibility to ciprofloxacin. For this project, whole-genome sequencing of both isolates was performed to detect genes associated with quinolone resistance. The plasmid-mediated qnrB19 gene and IncR plasmid type were identified in both isolates. To our knowledge, this is the first report of PMQR in Salmonella isolated from food animals or agricultural environments in the United States. © 2016 Blackwell Verlag GmbH.

  9. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  10. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  11. Regulation of the Drosophila Enhancer of split and invected-engrailed gene complexes by sister chromatid cohesion proteins.

    Directory of Open Access Journals (Sweden)

    Cheri A Schaaf

    2009-07-01

    Full Text Available The cohesin protein complex was first recognized for holding sister chromatids together and ensuring proper chromosome segregation. Cohesin also regulates gene expression, but the mechanisms are unknown. Cohesin associates preferentially with active genes, and is generally absent from regions in which histone H3 is methylated by the Enhancer of zeste [E(z] Polycomb group silencing protein. Here we show that transcription is hypersensitive to cohesin levels in two exceptional cases where cohesin and the E(z-mediated histone methylation simultaneously coat the entire Enhancer of split and invected-engrailed gene complexes in cells derived from Drosophila central nervous system. These gene complexes are modestly transcribed, and produce seven of the twelve transcripts that increase the most with cohesin knockdown genome-wide. Cohesin mutations alter eye development in the same manner as increased Enhancer of split activity, suggesting that similar regulation occurs in vivo. We propose that cohesin helps restrain transcription of these gene complexes, and that deregulation of similarly cohesin-hypersensitive genes may underlie developmental deficits in Cornelia de Lange syndrome.

  12. A DNA methylation microarray-based study identifies ERG as a gene commonly methylated in prostate cancer.

    Science.gov (United States)

    Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi

    2011-10-01

    DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.

  13. Potential paths for male-mediated gene flow to and from an isolated grizzly bear population

    Science.gov (United States)

    Peck, Christopher P.; van Manen, Frank T.; Costello, Cecily M.; Haroldson, Mark A.; Landenburger, Lisa; Roberts, Lori L.; Bjornlie, Daniel D.; Mace, Richard D.

    2017-01-01

    For several decades, grizzly bear populations in the Greater Yellowstone Ecosystem (GYE) and the Northern Continental Divide Ecosystem (NCDE) have increased in numbers and range extent. The GYE population remains isolated and although effective population size has increased since the early 1980s, genetic connectivity between these populations remains a long-term management goal. With only ~110 km distance separating current estimates of occupied range for these populations, the potential for gene flow is likely greater now than it has been for many decades. We sought to delineate potential paths that would provide the opportunity for male-mediated gene flow between the two populations. We first developed step-selection functions to generate conductance layers using ecological, physical, and anthropogenic landscape features associated with non-stationary GPS locations of 124 male grizzly bears (199 bear-years). We then used a randomized shortest path (RSP) algorithm to estimate the average number of net passages for all grid cells in the study region, when moving from an origin to a destination node. Given habitat characteristics that were the basis for the conductance layer, movements follow certain grid cell sequences more than others and the resulting RSP values thus provide a measure of movement potential. Repeating this process for 100 pairs of random origin and destination nodes, we identified paths for three levels of random deviation (θ) from the least-cost path. We observed broad-scale concordance between model predictions for paths originating in the NCDE and those originating in the GYE for all three levels of movement exploration. Model predictions indicated that male grizzly bear movement between the ecosystems could involve a variety of routes, and verified observations of grizzly bears outside occupied range supported this finding. Where landscape features concentrated paths into corridors (e.g., because of anthropogenic influence), they typically

  14. Stable genetic transformation of Jatropha curcas via Agrobacterium tumefaciens-mediated gene transfer using leaf explants

    KAUST Repository

    Kumar, Nitish; Vijay Anand, K.G.; Pamidimarri, D.V.N. Sudheer; Sarkar, Tanmoy; Reddy, Muppala P.; Radhakrishnan, T.; Kaul, Tanushri; Reddy, M.K.; Sopori, Sudhir K.

    2010-01-01

    Jatropha curcas is an oil bearing species with multiple uses and considerable economic potential as a biofuel crop. A simple and reproducible protocol was developed for Agrobacterium tumefaciens-mediated stable genetic transformation of J. curcas using leaf explains. Agrobacterium strain LBA 4404 harbouring the binary vector pCAMBIA 1304 having sense-dehydration responsive element binding (S-DREB2A), beta-glucuronidase (gus), and hygromycin-phosphotransferase (hpt) genes were used for gene transfer. A number of parameters such as preculture of explains, wounding of leaf explants, Agrobacterium growth phase (OD), infection duration, co-cultivation period, co-cultivation medium pH, and acetosyringone, were studied to optimized transformation efficiency. The highest transformation efficiency was achieved using 4-day precultured, non-wounded leaf explants infected with Agrobacterium culture corresponding to OD(600)=0.6 for 20 min, followed by co-cultivation for 4 days in a co-cultivation medium containing 100 mu M acetosyringone, pH 5.7. Co-cultivated leaf explants were initially cultured on Murashige and Skoog (MS) medium supplemented with 2.27 mu M thidiazuron (TDZ) for regeneration of shoot buds, followed by selection on same medium with 5 mu g ml(-1) hygromycin. Selected shoot buds were transferred to MS medium containing 10 mu M kinetin (Kn), 4.5 mu M 6-benzyl aminopurine (BA), and 5.5 mu M alpha-naphthaleneacetic acid (NAA) for proliferation. The proliferated shoots were elongated on MS medium supplemented with 2.25 mu M BA and 8.5 mu M indole-3-acetic acid (IAA). The elongated shoots were rooted on half strength MS medium supplemented with 15 mu M indole-3-butyric acid (IBA), 5.7 mu M IAA, 5.5 mu M NAA, and 0.25 mg l(-1) activated charcoal. GUS histochemical analysis of the transgenic tissues further confirmed the transformation event. PCR and DNA gel blot hybridization were performed to confirm the presence of transgene. A transformation efficiency of 29% was

  15. Stable genetic transformation of Jatropha curcas via Agrobacterium tumefaciens-mediated gene transfer using leaf explants

    KAUST Repository

    Kumar, Nitish

    2010-07-01

    Jatropha curcas is an oil bearing species with multiple uses and considerable economic potential as a biofuel crop. A simple and reproducible protocol was developed for Agrobacterium tumefaciens-mediated stable genetic transformation of J. curcas using leaf explains. Agrobacterium strain LBA 4404 harbouring the binary vector pCAMBIA 1304 having sense-dehydration responsive element binding (S-DREB2A), beta-glucuronidase (gus), and hygromycin-phosphotransferase (hpt) genes were used for gene transfer. A number of parameters such as preculture of explains, wounding of leaf explants, Agrobacterium growth phase (OD), infection duration, co-cultivation period, co-cultivation medium pH, and acetosyringone, were studied to optimized transformation efficiency. The highest transformation efficiency was achieved using 4-day precultured, non-wounded leaf explants infected with Agrobacterium culture corresponding to OD(600)=0.6 for 20 min, followed by co-cultivation for 4 days in a co-cultivation medium containing 100 mu M acetosyringone, pH 5.7. Co-cultivated leaf explants were initially cultured on Murashige and Skoog (MS) medium supplemented with 2.27 mu M thidiazuron (TDZ) for regeneration of shoot buds, followed by selection on same medium with 5 mu g ml(-1) hygromycin. Selected shoot buds were transferred to MS medium containing 10 mu M kinetin (Kn), 4.5 mu M 6-benzyl aminopurine (BA), and 5.5 mu M alpha-naphthaleneacetic acid (NAA) for proliferation. The proliferated shoots were elongated on MS medium supplemented with 2.25 mu M BA and 8.5 mu M indole-3-acetic acid (IAA). The elongated shoots were rooted on half strength MS medium supplemented with 15 mu M indole-3-butyric acid (IBA), 5.7 mu M IAA, 5.5 mu M NAA, and 0.25 mg l(-1) activated charcoal. GUS histochemical analysis of the transgenic tissues further confirmed the transformation event. PCR and DNA gel blot hybridization were performed to confirm the presence of transgene. A transformation efficiency of 29% was

  16. Gene therapy strategy for long-term myocardial protection using adeno-associated virus-mediated delivery of heme oxygenase gene.

    Science.gov (United States)

    Melo, Luis G; Agrawal, Reitu; Zhang, Lunan; Rezvani, Mojgan; Mangi, Abeel A; Ehsan, Afshin; Griese, Daniel P; Dell'Acqua, Giorgio; Mann, Michael J; Oyama, Junichi; Yet, Shaw-Fang; Layne, Matthew D; Perrella, Mark A; Dzau, Victor J

    2002-02-05

    Ischemia and oxidative stress are the leading mechanisms for tissue injury. An ideal strategy for preventive/protective therapy would be to develop an approach that could confer long-term transgene expression and, consequently, tissue protection from repeated ischemia/reperfusion injury with a single administration of a therapeutic gene. In the present study, we used recombinant adeno-associated virus (rAAV) as a vector for direct delivery of the cytoprotective gene heme oxygenase-1 (HO-1) into the rat myocardium, with the purpose of evaluating this strategy as a therapeutic approach for long-term protection from ischemia-induced myocardial injury. Human HO-1 gene (hHO-1) was delivered to normal rat hearts by intramyocardial injection. AAV-mediated transfer of the hHO-1 gene 8 weeks before acute coronary artery ligation and release led to a dramatic reduction (>75%) in left ventricular myocardial infarction. The reduction in infarct size was accompanied by decreases in myocardial lipid peroxidation and in proapoptotic Bax and proinflammatory interleukin-1beta protein abundance, concomitant with an increase in antiapoptotic Bcl-2 protein level. This suggested that the transgene exerts its cardioprotective effects in part by reducing oxidative stress and associated inflammation and apoptotic cell death. This study documents the beneficial therapeutic effect of rAAV-mediated transfer, before myocardial injury, of a cytoprotective gene that confers long-term myocardial protection from ischemia/reperfusion injury. Our data suggest that this novel "pre-event" gene transfer approach may provide sustained tissue protection from future repeated episodes of injury and may be beneficial as preventive therapy for patients with or at risk of developing coronary ischemic events.

  17. Epstein-Barr Virus (EBV) Latent Protein EBNA3A Directly Targets and Silences the STK39 Gene in B Cells Infected by EBV.

    Science.gov (United States)

    Bazot, Quentin; Paschos, Kostas; Allday, Martin J

    2018-04-01

    Epstein-Barr virus (EBV) establishes latent infection in human B cells and is associated with a wide range of cancers. The EBV nuclear antigen 3 (EBNA3) family proteins are critical for B cell transformation and function as transcriptional regulators. It is well established that EBNA3A and EBNA3C cooperate in the regulation of cellular genes. Here, we demonstrate that the gene STK39 is repressed only by EBNA3A. This is the first example of a gene regulated only by EBNA3A in EBV-transformed lymphoblastoid cell lines (LCLs) without the help of EBNA3C. This was demonstrated using a variety of LCLs carrying either knockout, revertant, or conditional EBNA3 recombinants. Investigating the kinetics of EBNA3A-mediated changes in STK39 expression showed that STK39 becomes derepressed quickly after EBNA3A inactivation. This derepression is reversible as EBNA3A reactivation represses STK39 in the same cells expressing a conditional EBNA3A. STK39 is silenced shortly after primary B cell infection by EBV, and no STK39 -encoded protein (SPAK) is detected 3 weeks postinfection. Chromatin immunoprecipitation (ChIP) analysis indicates that EBNA3A directly binds to a regulatory region downstream of the STK39 transcription start site. For the first time, we demonstrated that the polycomb repressive complex 2 with the deposition of the repressive mark H3K27me3 is not only important for the maintenance of an EBNA3A target gene ( STK39 ) but is also essential for the initial establishment of its silencing. Finally, we showed that DNA methyltransferases are involved in the EBNA3A-mediated repression of STK39 IMPORTANCE EBV is well known for its ability to transform B lymphocytes to continuously proliferating lymphoblastoid cell lines. This is achieved in part by the reprogramming of cellular gene transcription by EBV transcription factors, including the EBNA3 proteins that play a crucial role in this process. In the present study, we found that EBNA3A epigenetically silences STK39 This

  18. Comparison of agrobacterium mediated wheat and barley transformation with nucleoside diphosphate kinase 2 (NDPK2) gene

    International Nuclear Information System (INIS)

    Waheed, U.; Shah, M.M.; Smedley, M.; Harwood, W.

    2016-01-01

    An efficient and reliable transformation system is imperative for improvement of important crop species like barley and wheat. Wheat transformation is complex due to larger genome size and polyploidy while barley has a limitation of genotypic dependency. The objective of current study was to compare the relative transformation efficiency of wheat and barley using specific expression vector pBRACT 214-NDPK2 constructed through gateway cloning carrying Nucleoside Diphosphate Kinase 2 (NDPK2) gene. The vector was used to compare the transformation response in both crops using immature embryos through Agrobacterium mediated transformation. Both wheat and barley showed different responses towards callus induction and regeneration. Immature embryos of 1.5 to 2 mm in diameter was found optimum for wheat callus induction while 1 to 1.5 mm for barley. Both embryogenic and non-embryogenic calli were found in wheat with significantly greater tendency for embryogenecity in barley. The overall regeneration response was found different for all transformed wheat and barley cultivars. Wheat cultivars showed good response initially that drastically slowed down in later stages with the exception of Fielder that reached to the green shoots with good roots. The barley transformed lines showed good regeneration response as compared to wheat. PCR analysis of putative transformants using genomic DNA showed a maximum of 27% transformation efficiency in barely. No true transformation response was obtained in all cultivars of wheat used in this study. The protocol developed for wheat and barley transformation will greatly be helpful in crop improvement programme through genetic engineering especially in diploid relatives of cereals. (author)

  19. Assessment of ptxD gene as an alternative selectable marker for Agrobacterium-mediated maize transformation.

    Science.gov (United States)

    Nahampun, Hartinio N; López-Arredondo, Damar; Xu, Xing; Herrera-Estrella, Luis; Wang, Kan

    2016-05-01

    Bacterial phosphite oxidoreductase gene and chemical phosphite can be used as a selection system for Agrobacterium -mediated maize transformation. Application of phosphite (Phi) on plants can interfere the plant metabolic system leading to stunted growth and lethality. On the other hand, ectopic expression of the ptxD gene in tobacco and Arabidopsis allowed plants to grow in media with Phi as the sole phosphorous source. The phosphite oxidoreductase (PTXD) enzyme catalyzes the conversion of Phi into phosphate (Pi) that can then be metabolized by plants and utilized as their essential phosphorous source. Here we assess an alternative selectable marker based on a bacterial ptxD gene for Agrobacterium-mediated maize transformation. We compared the transformation frequencies of maize using either the ptxD/Phi selection system or a standard herbicide bar/bialaphos selection system. Two maize genotypes, a transformation amenable hybrid Hi II and an inbred B104, were tested. Transgene presence, insertion copy numbers, and ptxD transcript levels were analyzed and compared. This work demonstrates that the ptxD/Phi selection system can be used for Agrobacterium-mediated maize transformation of both type I and type II callus culture and achieve a comparable frequency as that of the herbicide bar/bialaphos selection system.

  20. Timing is critical for effective glucocorticoid receptor mediated repression of the cAMP-induced CRH gene.

    Directory of Open Access Journals (Sweden)

    Siem van der Laan

    Full Text Available Glucocorticoid negative feedback of the hypothalamus-pituitary-adrenal axis is mediated in part by direct repression of gene transcription in glucocorticoid receptor (GR expressing cells. We have investigated the cross talk between the two main signaling pathways involved in activation and repression of corticotrophin releasing hormone (CRH mRNA expression: cyclic AMP (cAMP and GR. We report that in the At-T20 cell-line the glucocorticoid-mediated repression of the cAMP-induced human CRH proximal promoter activity depends on the relative timing of activation of both signaling pathways. Activation of the GR prior to or in conjunction with cAMP signaling results in an effective repression of the cAMP-induced transcription of the CRH gene. In contrast, activation of the GR 10 minutes after onset of cAMP treatment, results in a significant loss of GR-mediated repression. In addition, translocation of ligand-activated GR to the nucleus was found as early as 10 minutes after glucocorticoid treatment. Interestingly, while both signaling cascades counteract each other on the CRH proximal promoter, they synergize on a synthetic promoter containing 'positive' response elements. Since the order of activation of both signaling pathways may vary considerably in vivo, we conclude that a critical time-window exists for effective repression of the CRH gene by glucocorticoids.

  1. Ex-Vivo Gene Therapy Using Lentiviral Mediated Gene Transfer Into Umbilical Cord Blood Derived Stem Cells

    Directory of Open Access Journals (Sweden)

    Hanieh Jalali

    2016-02-01

    Full Text Available Background Introduction of therapeutic genes into the injured site of nervous system can be achieved using transplantation of cellular vehicles containing desired gene. To transfer exogenous genes into the cellular vehicles, lentiviral vectors are one of interested vectors because of advantages such high transduction efficiency of dividing and non-dividing cells. Unrestricted somatic stem cells are subclasses of umbilical cord blood derived stem cells which are appreciate candidates to use as cellular vehicles for ex vivo gene therapy of nervous system. Objectives In current study we investigated the effect of lentiviral vector transduction on the neuronal related features of unrestricted somatic stem cells to indicate the probable and unwanted changes related to transduction procedure. Materials and Methods In this experimental study, lentiviral vector containing green fluorescent protein (GFP were transduced into unrestricted somatic stem cells and its effect was investigated with using MTT assay, qPCR and immunohistochemistry techniques. For statistical comparison of real time PCR results, REST software (2009, Qiagen was used. Results Obtained results showed lentiviral vector transduction did not have cytotoxic effects on unrestricted somatic stem cells and did not change neuronal differentiation capacity of them as well the expression of some neuronal related genes and preserved them in multilineage situation. Conclusions In conclusion, we suggested that lentiviral vectors could be proper vectors to transfer therapeutic gene into unrestricted somatic stem cells to provide a cellular vehicle for ex vivo gene therapy of nervous system disorders.

  2. Inhibition by TNF-alpha and IL-4 of cationic lipid mediated gene transfer in cystic fibrosis tracheal gland cells.

    Science.gov (United States)

    Bastonero, Sonia; Gargouri, Myriem; Ortiou, Sandrine; Guéant, Jean-Louis; Merten, Marc D

    2005-11-01

    In vivo, tracheal gland serous cells highly express the cystic fibrosis transmembrane conductance regulator (cftr) gene. This gene is mutated in the lethal monogenic disease cystic fibrosis (CF). Clinical trials in which the human CFTR cDNA was delivered to the respiratory epithelia of CF patients have resulted in weak and transient gene expression. As CF is characterized by mucus inspissation, airway infection, and severe inflammation, we tested the hypothesis that inflammation and especially two cytokines involved in the Th1/Th2 inflammatory response, interleukin 4 (IL-4) and TNFalpha, could inhibit gene transfer efficiency using a model of human CF tracheal gland cells (CF-KM4) and Lipofectamine reagent as a transfection reagent. The specific secretory defects of CF-KM4 cells were corrected by Lipofectamine-mediated human CFTR gene transfer. However, this was altered when cells were pre-treated with IL-4 and TNFalpha. Inhibition of luciferase reporter gene expression by IL-4 and TNFalpha pre-treated CF-KM4 cells was measured by activity and real-time RT-PCR. Both cytokines induced similar and synergistic inhibition of transgene expression and activity. This cytokine-mediated inhibition could be prevented by anti-inflammatory agents such as glucocorticoids but not by non-steroidal (NSAI) agents. This data suggests that an inflammatory context generated by IL-4 and TNFalpha can inhibit human CFTR gene transfer in CF tracheal gland cells and that glucocorticoids may have a protecting action. Copyright (c) 2005 John Wiley & Sons, Ltd.

  3. Development of Agrobacterium-mediated virus-induced gene silencing and performance evaluation of four marker genes in Gossypium barbadense.

    Directory of Open Access Journals (Sweden)

    Jinhuan Pang

    Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.

  4. Novel neuroprotective function of apical-basal polarity gene crumbs in amyloid beta 42 (aβ42 mediated neurodegeneration.

    Directory of Open Access Journals (Sweden)

    Andrew M Steffensmeier

    Full Text Available Alzheimer's disease (AD, OMIM: 104300, a progressive neurodegenerative disorder with no cure to date, is caused by the generation of amyloid-beta-42 (Aβ42 aggregates that trigger neuronal cell death by unknown mechanism(s. We have developed a transgenic Drosophila eye model where misexpression of human Aβ42 results in AD-like neuropathology in the neural retina. We have identified an apical-basal polarity gene crumbs (crb as a genetic modifier of Aβ42-mediated-neuropathology. Misexpression of Aβ42 caused upregulation of Crb expression, whereas downregulation of Crb either by RNAi or null allele approach rescued the Aβ42-mediated-neurodegeneration. Co-expression of full length Crb with Aβ42 increased severity of Aβ42-mediated-neurodegeneration, due to three fold induction of cell death in comparison to the wild type. Higher Crb levels affect axonal targeting from the retina to the brain. The structure function analysis identified intracellular domain of Crb to be required for Aβ42-mediated-neurodegeneration. We demonstrate a novel neuroprotective role of Crb in Aβ42-mediated-neurodegeneration.

  5. Whole-genome analysis of herbicide-tolerant mutant rice generated by Agrobacterium-mediated gene targeting.

    Science.gov (United States)

    Endo, Masaki; Kumagai, Masahiko; Motoyama, Ritsuko; Sasaki-Yamagata, Harumi; Mori-Hosokawa, Satomi; Hamada, Masao; Kanamori, Hiroyuki; Nagamura, Yoshiaki; Katayose, Yuichi; Itoh, Takeshi; Toki, Seiichi

    2015-01-01

    Gene targeting (GT) is a technique used to modify endogenous genes in target genomes precisely via homologous recombination (HR). Although GT plants are produced using genetic transformation techniques, if the difference between the endogenous and the modified gene is limited to point mutations, GT crops can be considered equivalent to non-genetically modified mutant crops generated by conventional mutagenesis techniques. However, it is difficult to guarantee the non-incorporation of DNA fragments from Agrobacterium in GT plants created by Agrobacterium-mediated GT despite screening with conventional Southern blot and/or PCR techniques. Here, we report a comprehensive analysis of herbicide-tolerant rice plants generated by inducing point mutations in the rice ALS gene via Agrobacterium-mediated GT. We performed genome comparative genomic hybridization (CGH) array analysis and whole-genome sequencing to evaluate the molecular composition of GT rice plants. Thus far, no integration of Agrobacterium-derived DNA fragments has been detected in GT rice plants. However, >1,000 single nucleotide polymorphisms (SNPs) and insertion/deletion (InDels) were found in GT plants. Among these mutations, 20-100 variants might have some effect on expression levels and/or protein function. Information about additive mutations should be useful in clearing out unwanted mutations by backcrossing. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  6. Complementation of a threonine dehydratase-deficient Nicotiana plumbaginifolia mutant after Agrobacterium tumefaciens-mediated transfer of the Saccharomyces cerevisiae ILV1 gene.

    OpenAIRE

    Colau, D; Negrutiu, I; Van Montagu, M; Hernalsteens, J P

    1987-01-01

    The Saccharomyces cerevisiae ILV1 gene, encoding threonine dehydratase (EC 4.2.1.16) was fused to the transferred DNA nopaline synthase promoter and the 3' noncoding region of the octopine synthase gene. It was introduced, by Agrobacterium tumefaciens-mediated gene transfer, into an isoleucine-requiring Nicotiana plumbaginifolia auxotroph deficient in threonine dehydratase. Functional complementation by the ILV1 gene product was demonstrated by the selection of several transformed lines on a ...

  7. Post operative infection and sepsis in humans is associated with deficient gene expression of gammac cytokines and their apoptosis mediators.

    LENUS (Irish Health Repository)

    White, Mary

    2011-06-28

    Abstract Introduction Lymphocyte homeostasis is dependent on the γc cytokines. We hypothesised that sepsis in humans is associated with differential gene expression of the γc cytokines and their associated apoptosis mediators. Methods The study population consisted of a total of 60 patients with severe sepsis, 15 with gram negative bacteraemia, 10 healthy controls and 60 patients undergoing elective lung resection surgery. Pneumonia was diagnosed by CDC NNIC criteria. Gene expression in peripheral blood leukocytes (PBLs) of interleukin (IL)-2, 7, 15 and interferon (IFN)-γ, Bax, Bim, Bcl-2 was determined by qRT-PCR and IL-2 and IL-7 serum protein levels by ELISA. Gene expression of IL-2, 7 and IFN-γ was measured in peripheral blood leukocytes (PBL), cultured in the presence of lipopolysacharide (LPS) and CD3 binding antibody (CD3ab) Results IL-2 gene expression was lower in the bacteraemia group compared with controls, and lower still in the sepsis group (P < 0.0001). IL-7 gene expression was similar in controls and bacteraemia, but lower in sepsis (P < 0.0001). IL-15 gene expression was similar in the three groups. Bcl-2 gene expression was less (P < 0.0001) and Bim gene expression was greater (P = 0.0003) in severe sepsis compared to bacteraemic and healthy controls. Bax gene expression was similar in the three groups. In lung resection surgery patients, post-operative pneumonia was associated with a perioperative decrease in IL-2 mRNA (P < 0.0001) and IL-7 mRNA (P = 0.003). IL-2 protein levels were reduced in sepsis and bacteraemia compared to controls (P = 0.02) but similar in pneumonia and non-pneumonia groups. IL-7 protein levels were similar in all groups. In cultured PBLs, IFN-γ gene expression was decreased in response to LPS and increased in response to CD3ab with sepsis: IL-7 gene expression increased in response to LPS in controls and to CD3ab with sepsis; Bcl-2 gene expression decreased in response to combined CD3ab and IL-2 with sepsis

  8. Menin regulates Inhbb expression through an Akt/Ezh2-mediated H3K27 histone modification.

    Science.gov (United States)

    Gherardi, Samuele; Ripoche, Doriane; Mikaelian, Ivan; Chanal, Marie; Teinturier, Romain; Goehrig, Delphine; Cordier-Bussat, Martine; Zhang, Chang X; Hennino, Ana; Bertolino, Philippe

    2017-04-01

    Although Men1 is a well-known tumour suppressor gene, little is known about the functions of Menin, the protein it encodes for. Since few years, numerous publications support a major role of Menin in the control of epigenetics gene regulation. While Menin interaction with MLL complex favours transcriptional activation of target genes through H3K4me3 marks, Menin also represses gene expression via mechanisms involving the Polycomb repressing complex (PRC). Interestingly, Ezh2, the PRC-methyltransferase that catalyses H3K27me3 repressive marks and Menin have been shown to co-occupy a large number of promoters. However, lack of binding between Menin and Ezh2 suggests that another member of the PRC complex is mediating this indirect interaction. Having found that ActivinB - a TGFβ superfamily member encoded by the Inhbb gene - is upregulated in insulinoma tumours caused by Men1 invalidation, we hypothesize that Menin could directly participate in the epigenetic-repression of Inhbb gene expression. Using Animal model and cell lines, we report that loss of Menin is directly associated with ActivinB-induced expression both in vivo and in vitro. Our work further reveals that ActivinB expression is mediated through a direct modulation of H3K27me3 marks on the Inhbb locus in Menin-KO cell lines. More importantly, we show that Menin binds on the promoter of Inhbb gene where it favours the recruitment of Ezh2 via an indirect mechanism involving Akt-phosphorylation. Our data suggests therefore that Menin could take an important part to the Ezh2-epigenetic repressive landscape in many cells and tissues through its capacity to modulate Akt phosphorylation. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. AAV-mediated gene transfer of the obesity-associated gene Etv5 in rat midbrain does not affect energy balance or motivated behavior.

    Directory of Open Access Journals (Sweden)

    Arjen J Boender

    Full Text Available Several genome-wide association studies have implicated the transcription factor E-twenty- six version 5 (Etv5 in the regulation of body mass index. Further substantiating the role of Etv5 in feeding behavior are the findings that targeted disruption of Etv5 in mice leads to decreased body weight gain and that expression of Etv5 is decreased in the ventral tegmental area and substantia nigra pars compacta (VTA/SNpc after food restriction. As Etv5 has been suggested to influence dopaminergic neurotransmission by driving the expression of genes that are responsible for the synthesis and release of dopamine, we investigated if expression levels of Etv5 are dependent on nutritional state and subsequently influence the expression levels of tyrosine hydroxylase. While it was shown that Etv5 expression in the VTA/SNpc increases after central administration of leptin and that Etv5 was able to drive expression of tyrosine hydroxylase in vitro, AAV-mediated gene transfer of Etv5 into the VTA/SNpc of rats did not alter expression of tyrosine hydroxylase in vivo. Moreover, AAV-mediated gene transfer of Etv5 in the VTA/SNpc did not affect measures of energy balance or performances in a progressive ratio schedule. Thus, these data do not support a role for increased expression of Etv5 in the VTA/SNpc in the regulation of feeding behavior.

  10. Alternative splicing and nonsense-mediated decay of circadian clock genes under environmental stress conditions in Arabidopsis.

    Science.gov (United States)

    Kwon, Young-Ju; Park, Mi-Jeong; Kim, Sang-Gyu; Baldwin, Ian T; Park, Chung-Mo

    2014-05-19

    The circadian clock enables living organisms to anticipate recurring daily and seasonal fluctuations in their growth habitats and synchronize their biology to the environmental cycle. The plant circadian clock consists of multiple transcription-translation feedback loops that are entrained by environmental signals, such as light and temperature. In recent years, alternative splicing emerges as an important molecular mechanism that modulates the clock function in plants. Several clock genes are known to undergo alternative splicing in response to changes in environmental conditions, suggesting that the clock function is intimately associated with environmental responses via the alternative splicing of the clock genes. However, the alternative splicing events of the clock genes have not been studied at the molecular level. We systematically examined whether major clock genes undergo alternative splicing under various environmental conditions in Arabidopsis. We also investigated the fates of the RNA splice variants of the clock genes. It was found that the clock genes, including EARLY FLOWERING 3 (ELF3) and ZEITLUPE (ZTL) that have not been studied in terms of alternative splicing, undergo extensive alternative splicing through diverse modes of splicing events, such as intron retention, exon skipping, and selection of alternative 5' splice site. Their alternative splicing patterns were differentially influenced by changes in photoperiod, temperature extremes, and salt stress. Notably, the RNA splice variants of TIMING OF CAB EXPRESSION 1 (TOC1) and ELF3 were degraded through the nonsense-mediated decay (NMD) pathway, whereas those of other clock genes were insensitive to NMD. Taken together, our observations demonstrate that the major clock genes examined undergo extensive alternative splicing under various environmental conditions, suggesting that alternative splicing is a molecular scheme that underlies the linkage between the clock and environmental stress

  11. Antimetastatic gene expression profiles mediated by retinoic acid receptor beta 2 in MDA-MB-435 breast cancer cells

    International Nuclear Information System (INIS)

    Wallden, Brett; Emond, Mary; Swift, Mari E; Disis, Mary L; Swisshelm, Karen

    2005-01-01

    The retinoic acid receptor beta 2 (RARβ2) gene modulates proliferation and survival of cultured human breast cancer cells. Previously we showed that ectopic expression of RARβ2 in a mouse xenograft model prevented metastasis, even in the absence of the ligand, all-trans retinoic acid. We investigated both cultured cells and xenograft tumors in order to delineate the gene expression profiles responsible for an antimetastatic phenotype. RNA from MDA-MB-435 human breast cancer cells transduced with RARβ2 or empty retroviral vector (LXSN) was analyzed using Agilent Human 1A Oligo microarrays. The one hundred probes with the greatest differential intensity (p < 0.004, jointly) were determined by selecting the top median log ratios from eight-paired microarrays. Validation of differences in expression was done using Northern blot analysis and quantitative RT-PCR (qRT-PCR). We determined expression of selected genes in xenograft tumors. RARβ2 cells exhibit gene profiles with overrepresentation of genes from Xq28 (p = 2 × 10 -8 ), a cytogenetic region that contains a large portion of the cancer/testis antigen gene family. Other functions or factors impacted by the presence of exogenous RARβ2 include mediators of the immune response and transcriptional regulatory mechanisms. Thirteen of fifteen (87%) of the genes evaluated in xenograft tumors were consistent with differences we found in the cell cultures (p = 0.007). Antimetastatic RARβ2 signalling, direct or indirect, results in an elevation of expression for genes such as tumor-cell antigens (CTAG1 and CTAG2), those involved in innate immune response (e.g., RIG-I/DDX58), and tumor suppressor functions (e.g., TYRP1). Genes whose expression is diminished by RARβ2 signalling include cell adhesion functions (e.g, CD164) nutritional or metabolic processes (e.g., FABP6), and the transcription factor, JUN

  12. IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

    Science.gov (United States)

    Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

    2014-01-01

    Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

  13. Alternative splicing and nonsense-mediated decay of circadian clock genes under environmental stress conditions in Arabidopsis

    Science.gov (United States)

    2014-01-01

    Background The circadian clock enables living organisms to anticipate recurring daily and seasonal fluctuations in their growth habitats and synchronize their biology to the environmental cycle. The plant circadian clock consists of multiple transcription-translation feedback loops that are entrained by environmental signals, such as light and temperature. In recent years, alternative splicing emerges as an important molecular mechanism that modulates the clock function in plants. Several clock genes are known to undergo alternative splicing in response to changes in environmental conditions, suggesting that the clock function is intimately associated with environmental responses via the alternative splicing of the clock genes. However, the alternative splicing events of the clock genes have not been studied at the molecular level. Results We systematically examined whether major clock genes undergo alternative splicing under various environmental conditions in Arabidopsis. We also investigated the fates of the RNA splice variants of the clock genes. It was found that the clock genes, including EARLY FLOWERING 3 (ELF3) and ZEITLUPE (ZTL) that have not been studied in terms of alternative splicing, undergo extensive alternative splicing through diverse modes of splicing events, such as intron retention, exon skipping, and selection of alternative 5′ splice site. Their alternative splicing patterns were differentially influenced by changes in photoperiod, temperature extremes, and salt stress. Notably, the RNA splice variants of TIMING OF CAB EXPRESSION 1 (TOC1) and ELF3 were degraded through the nonsense-mediated decay (NMD) pathway, whereas those of other clock genes were insensitive to NMD. Conclusion Taken together, our observations demonstrate that the major clock genes examined undergo extensive alternative splicing under various environmental conditions, suggesting that alternative splicing is a molecular scheme that underlies the linkage between the clock

  14. A set of vectors for introduction of antibiotic resistance genes by in vitro Cre-mediated recombination

    Directory of Open Access Journals (Sweden)

    Vassetzky Yegor S

    2008-12-01

    Full Text Available Abstract Background Introduction of new antibiotic resistance genes in the plasmids of interest is a frequent task in molecular cloning practice. Classical approaches involving digestion with restriction endonucleases and ligation are time-consuming. Findings We have created a set of insertion vectors (pINS carrying genes that provide resistance to various antibiotics (puromycin, blasticidin and G418 and containing a loxP site. Each vector (pINS-Puro, pINS-Blast or pINS-Neo contains either a chloramphenicol or a kanamycin resistance gene and is unable to replicate in most E. coli strains as it contains a conditional R6Kγ replication origin. Introduction of the antibiotic resistance genes into the vector of interest is achieved by Cre-mediated recombination between the replication-incompetent pINS and a replication-competent target vector. The recombination mix is then transformed into E. coli and selected by the resistance marker (kanamycin or chloramphenicol present in pINS, which allows to recover the recombinant plasmids with 100% efficiency. Conclusion Here we propose a simple strategy that allows to introduce various antibiotic-resistance genes into any plasmid containing a replication origin, an ampicillin resistance gene and a loxP site.

  15. Study of male–mediated gene flow across a hybrid zone in the common shrew (Sorex araneus using Y chromosome

    Directory of Open Access Journals (Sweden)

    Andrei V. Polyakov

    2017-06-01

    Full Text Available Despite many studies, the impact of chromosome rearrangements on gene flow between chromosome races of the common shrew (Sorex araneus Linnaeus, 1758 remains unclear. Interracial hybrids form meiotic chromosome complexes that are associated with reduced fertility. Nevertheless comprehensive investigations of autosomal and mitochondrial markers revealed weak or no barrier to gene flow between chromosomally divergent populations. In a narrow zone of contact between the Novosibirsk and Tomsk races hybrids are produced with extraordinarily complex configurations at meiosis I. Microsatellite markers have not revealed any barrier to gene flow, but the phenotypic differentiation between races is greater than may be expected if gene flow was unrestricted. To explore this contradiction we analyzed the distribution of the Y chromosome SNP markers within this hybrid zone. The Y chromosome variants in combination with race specific autosome complements allow backcrosses to be distinguished and their proportion among individuals within the hybrid zone to be evaluated. The balanced ratio of the Y variants observed among the pure race individuals as well as backcrosses reveals no male mediated barrier to gene flow. The impact of reproductive unfitness of backcrosses on gene flow is discussed as a possible mechanism of the preservation of race-specific morphology within the hybrid zone.

  16. dKDM2 couples histone H2A ubiquitylation to histone H3 demethylation during Polycomb group silencing

    NARCIS (Netherlands)

    A. Lagarou (Anna); A.B. Mohd Sarip; Y.M. Moshkin (Yuri); G.E. Chalkley (Gillian); K. Bezstarosti (Karel); J.A.A. Demmers (Jeroen); C.P. Verrijzer (Peter)

    2008-01-01

    textabstractTranscription regulation involves enzyme-mediated changes in chromatin structure. Here, we describe a novel mode of histone crosstalk during gene silencing, in which histone H2A monoubiquitylation is coupled to the removal of histone H3 Lys 36 dimethylation (H3K36me2). This pathway was

  17. Ultrasound-mediated gene delivery of naked plasmid DNA in skeletal muscles: a case for bolus injections.

    Science.gov (United States)

    Sanches, Pedro Gomes; Mühlmeister, Mareike; Seip, Ralf; Kaijzel, Eric; Löwik, Clemens; Böhmer, Marcel; Tiemann, Klaus; Grüll, Holger

    2014-12-10

    Localized gene delivery has many potential clinical applications. However, the nucleic acids (e.g. pDNA and siRNA) are incapable of passively crossing the endothelium, cell membranes and other biological barriers which must be crossed to reach their intracellular targets. A possible solution is the use of ultrasound to burst circulating microbubbles inducing transient permeabilization of surrounding tissues which mediates nucleic acid extravasation and cellular uptake. In this study we report on an optimization of the ultrasound gene delivery technique. Naked pDNA (200 μg) encoding luciferase and SonoVue® microbubbles were co-injected intravenously in mice. The hindlimb skeletal muscles were exposed to ultrasound from a non-focused transducer (1 MHz, 1.25 MPa, PRI 30s) and injection protocols and total amounts as well as ultrasound parameters were systemically varied. Gene expression was quantified relative to a control using a bioluminescence camera system at day 7 after sonication. Bioluminescence ratios in sonicated/control muscles of up to 101× were obtained. In conclusion, we were able to specifically deliver genetic material to the selected skeletal muscles and overall, the use of bolus injections and high microbubble numbers resulted in increased gene expression reflected by stronger bioluminescence signals. Based on our data, bolus injections seem to be required in order to achieve transient highly concentrated levels of nucleic acids and microbubbles at the tissue of interest which upon ultrasound exposure should lead to increased levels of gene delivery. Thus, ultrasound mediated gene delivery is a promising technique for the clinical translation of localized drug delivery. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Post-operative infection and sepsis in humans is associated with deficient gene expression of γc cytokines and their apoptosis mediators.

    LENUS (Irish Health Repository)

    White, Mary

    2011-06-01

    Lymphocyte homeostasis is dependent on the γc cytokines. We hypothesised that sepsis in humans is associated with differential gene expression of the γc cytokines and their associated apoptosis mediators.

  19. Polycomb repression complex 2 is required for the maintenance of retinal progenitor cells and balanced retinal differentiation

    Czech Academy of Sciences Publication Activity Database

    Fujimura, Naoko; Kuželová, Andrea; Ebert, A.; Strnad, Hynek; Láchová, Jitka; Machoň, Ondřej; Busslinger, M.; Kozmik, Zbyněk

    2018-01-01

    Roč. 433, č. 1 (2018), s. 47-60 ISSN 0012-1606 R&D Projects: GA ČR GA15-23675S; GA MŠk(CZ) LQ1604; GA MŠk(CZ) LM2015040; GA MŠk ED2.1.00/19.0395 Institutional support: RVO:68378050 Keywords : Retina * Differentiation * Polycomb * Eed Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.944, year: 2016

  20. Genome-wide Gene Expression Profiling of SCID Mice with T-cell-mediated Colitis

    DEFF Research Database (Denmark)

    Brudzewsky, D.; Pedersen, A. E.; Claesson, M. H.

    2009-01-01

    Inflammatory bowel disease (IBD) is a multifactorial disorder with an unknown aetiology. The aim of this study is to employ a murine model of IBD to identify pathways and genes, which may play a key role in the pathogenesis of IBD and could be important for discovery of new disease markers in human...... and colitis mice, and among these genes there is an overrepresentation of genes involved in inflammatory processes. Some of the most significant genes showing higher expression encode S100A proteins and chemokines involved in trafficking of leucocytes in inflammatory areas. Classification by gene clustering...... based on the genes with the significantly altered gene expression corresponds to two different levels of inflammation as established by the histological scoring of the inflamed rectum. These data demonstrate that this SCID T-cell transfer model is a useful animal model for human IBD and can be used...

  1. The application of nonsense-mediated mRNA decay inhibition to the identification of breast cancer susceptibility genes

    International Nuclear Information System (INIS)

    Johnson, Julie K; Waddell, Nic; Chenevix-Trench, Georgia

    2012-01-01

    Identification of novel, highly penetrant, breast cancer susceptibility genes will require the application of additional strategies beyond that of traditional linkage and candidate gene approaches. Approximately one-third of inherited genetic diseases, including breast cancer susceptibility, are caused by frameshift or nonsense mutations that truncate the protein product [1]. Transcripts harbouring premature termination codons are selectively and rapidly degraded by the nonsense-mediated mRNA decay (NMD) pathway. Blocking the NMD pathway in any given cell will stabilise these mutant transcripts, which can then be detected using gene expression microarrays. This technique, known as gene identification by nonsense-mediated mRNA decay inhibition (GINI), has proved successful in identifying sporadic nonsense mutations involved in many different cancer types. However, the approach has not yet been applied to identify germline mutations involved in breast cancer. We therefore attempted to use GINI on lymphoblastoid cell lines (LCLs) from multiple-case, non- BRCA1/2 breast cancer families in order to identify additional high-risk breast cancer susceptibility genes. We applied GINI to a total of 24 LCLs, established from breast-cancer affected and unaffected women from three multiple-case non-BRCA1/2 breast cancer families. We then used Illumina gene expression microarrays to identify transcripts stabilised by the NMD inhibition. The expression profiling identified a total of eight candidate genes from these three families. One gene, PPARGC1A, was a candidate in two separate families. We performed semi-quantitative real-time reverse transcriptase PCR of all candidate genes but only PPARGC1A showed successful validation by being stabilised in individuals with breast cancer but not in many unaffected members of the same family. Sanger sequencing of all coding and splice site regions of PPARGC1A did not reveal any protein truncating mutations. Haplotype analysis using short

  2. Mediator, TATA-binding protein, and RNA polymerase II contribute to low histone occupancy at active gene promoters in yeast.

    Science.gov (United States)

    Ansari, Suraiya A; Paul, Emily; Sommer, Sebastian; Lieleg, Corinna; He, Qiye; Daly, Alexandre Z; Rode, Kara A; Barber, Wesley T; Ellis, Laura C; LaPorta, Erika; Orzechowski, Amanda M; Taylor, Emily; Reeb, Tanner; Wong, Jason; Korber, Philipp; Morse, Randall H

    2014-05-23

    Transcription by RNA polymerase II (Pol II) in eukaryotes requires the Mediator complex, and often involves chromatin remodeling and histone eviction at active promoters. Here we address the role of Mediator in recruitment of the Swi/Snf chromatin remodeling complex and its role, along with components of the preinitiation complex (PIC), in histone eviction at inducible and constitutively active promoters in the budding yeast Saccharomyces cerevisiae. We show that recruitment of the Swi/Snf chromatin remodeling complex to the induced CHA1 promoter, as well as its association with several constitutively active promoters, depends on the Mediator complex but is independent of Mediator at the induced MET2 and MET6 genes. Although transcriptional activation and histone eviction at CHA1 depends on Swi/Snf, Swi/Snf recruitment is not sufficient for histone eviction at the induced CHA1 promoter. Loss of Swi/Snf activity does not affect histone occupancy of several constitutively active promoters; in contrast, higher histone occupancy is seen at these promoters in Mediator and PIC component mutants. We propose that an initial activator-dependent, nucleosome remodeling step allows PIC components to outcompete histones for occupancy of promoter sequences. We also observe reduced promoter association of Mediator and TATA-binding protein in a Pol II (rpb1-1) mutant, indicating mutually cooperative binding of these components of the transcription machinery and indicating that it is the PIC as a whole whose binding results in stable histone eviction. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. CHD5 is required for neurogenesis and has a dual role in facilitating gene expression and polycomb gene repression

    DEFF Research Database (Denmark)

    Egan, Chris M; Nyman, Ulrika; Skotte, Julie

    2013-01-01

    The chromatin remodeler CHD5 is expressed in neural tissue and is frequently deleted in aggressive neuroblastoma. Very little is known about the function of CHD5 in the nervous system or its mechanism of action. Here we report that depletion of Chd5 in the developing neocortex blocks neuronal...... of this candidate tumor suppressor might contribute to neuroblastoma....

  4. Activity and specificity of TRV-mediated gene editing in plants

    KAUST Repository

    Ali, Zahir; Abulfaraj, Aala A.; Piatek, Marek J.; Mahfouz, Magdy M.

    2015-01-01

    editing in Nicotiana benthamiana. TRV infects the growing points and possesses small genome size; which facilitate cloning, multiplexing, and agroinfections. Here, we report on the persistent activity and specificity of the TRV-mediated CRISPR/Cas9 system

  5. Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei; Ishino, Ruri; Urahama, Norinaga; Hasegawa, Natsumi [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Roeder, Robert G. [Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Ito, Mitsuhiro, E-mail: itomi@med.kobe-u.ac.jp [Laboratory of Hematology, Division of Medical Biophysics, Kobe University Graduate School of Health Sciences, 7-10-2 Tomogaoka, Suma-ku, Kobe 654-0142 (Japan); Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, 1230 York Avenue, New York, NY 10065 (United States); Department of Family and Community Medicine, Kobe University Graduate School of Medicine, 7-5-1 Kusunoki-cho, Chuo-ku, Kobe 654-0142 (Japan); Consolidated Research Institute for Advanced Science and Medical Care, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 159-8555 (Japan)

    2013-10-11

    Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβ gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.

  6. Adenoviral transfer of the heme oxygenase-1 gene protects striatal astrocytes from heme-mediated oxidative injury.

    Science.gov (United States)

    Teng, Zhi-Ping; Chen, Jing; Chau, Lee-Young; Galunic, Nicholas; Regan, Raymond F

    2004-11-01

    Heme oxygenase-1 (HO-1) is induced in the CNS after hemorrhage, and may have an effect on injury to surrounding tissue. Hemin, the preferred substrate of HO, is a neurotoxin that is present in intracranial hematomas. In a prior study, we observed that HO inhibitors increased the vulnerability of cultured cortical astrocytes to heme-mediated oxidative injury. To investigate the effect of HO more specifically, we used an adenoviral vector encoding the human HO-1 gene to specifically increase HO-1 expression. Incubation with 100 MOI of the HO-1 adenovirus (Adv-HHO-1) for 24 h increased both HO-1 protein and HO activity; a control adenovirus lacking the HO-1 gene had no effect. Using a DNA probe that was specific for human HO-1, 80.5 +/- 7.2% of astrocytes were observed to be infected by in situ hybridization. The cell death produced by 30-60 microM hemin was significantly reduced by pretreatment with 100 MOI Adv-HHO-1, as assessed by LDH release, propidium iodide exclusion, and MTT reduction assay. The threefold increase in cell protein oxidation produced by hemin was also attenuated in cultures pretreated with Adv-HHO-1. These results support the hypothesis that HO-1 protects astrocytes from heme-mediated oxidative injury. Specifically increasing astrocytic HO-1 by gene transfer may have a beneficial effect on hemorrhagic CNS injury.

  7. Pollen-mediated gene flow and seed exchange in small-scale Zambian maize farming, implications for biosafety assessment.

    Science.gov (United States)

    Bøhn, Thomas; Aheto, Denis W; Mwangala, Felix S; Fischer, Klara; Bones, Inger Louise; Simoloka, Christopher; Mbeule, Ireen; Schmidt, Gunther; Breckling, Broder

    2016-10-03

    Gene flow in agricultural crops is important for risk assessment of genetically modified (GM) crops, particularly in countries with a large informal agricultural sector of subsistence cultivation. We present a pollen flow model for maize (Zea mays), a major staple crop in Africa. We use spatial properties of fields (size, position) in three small-scale maize farming communities in Zambia and estimate rates of cross-fertilisation between fields sown with different maize varieties (e.g. conventional and transgene). As an additional factor contributing to gene flow, we present data on seed saving and sharing among farmers that live in the same communities. Our results show that: i) maize fields were small and located in immediate vicinity of neighboring fields; ii) a majority of farmers saved and shared seed; iii) modeled rates of pollen-mediated gene flow showed extensive mixing of germplasm between fields and farms and iv) as a result, segregation of GM and non-GM varieties is not likely to be an option in these systems. We conclude that the overall genetic composition of maize, in this and similar agricultural contexts, will be strongly influenced both by self-organised ecological factors (pollen flow), and by socially mediated intervention (seed recycling and sharing).

  8. Regeneration of hyaline cartilage by cell-mediated gene therapy using transforming growth factor beta 1-producing fibroblasts.

    Science.gov (United States)

    Lee, K H; Song, S U; Hwang, T S; Yi, Y; Oh, I S; Lee, J Y; Choi, K B; Choi, M S; Kim, S J

    2001-09-20

    Transforming growth factor beta (TGF-beta) has been considered as a candidate for gene therapy of orthopedic diseases. The possible application of cell-mediated TGF-beta gene therapy as a new treatment regimen for degenerative arthritis was investigated. In this study, fibroblasts expressing active TGF-beta 1 were injected into the knee joints of rabbits with artificially made cartilage defects to evaluate the feasibility of this therapy for orthopedic diseases. Two to 3 weeks after the injection there was evidence of cartilage regeneration, and at 4 to 6 weeks the cartilage defect was completely filled with newly grown hyaline cartilage. Histological analyses of the regenerated cartilage suggested that it was well integrated with the adjacent normal cartilage at the sides of the defect and that the newly formed tissue was indeed hyaline cartilage. Our findings suggest that cell-mediated TGF-beta 1 gene therapy may be a novel treatment for orthopedic diseases in which hyaline cartilage damage has occurred.

  9. Upregulation of the coagulation factor VII gene during glucose deprivation is mediated by activating transcription factor 4.

    Science.gov (United States)

    Cronin, Katherine R; Mangan, Thomas P; Carew, Josephine A

    2012-01-01

    Constitutive production of blood coagulation proteins by hepatocytes is necessary for hemostasis. Stressful conditions trigger adaptive cellular responses and delay processing of most proteins, potentially affecting plasma levels of proteins secreted exclusively by hepatocytes. We examined the effect of glucose deprivation on expression of coagulation proteins by the human hepatoma cell line, HepG2. Expression of coagulation factor VII, which is required for initiation of blood coagulation, was elevated by glucose deprivation, while expression of other coagulation proteins decreased. Realtime PCR and ELISA demonstrated that the relative percentage expression +/- SD of steady-state F7 mRNA and secreted factor VII antigen were significantly increased (from 100+/-15% to 188+/-27% and 100+/-8.8% to 176.3+/-17.3% respectively, pfactor ATF4 and of additional stress-responsive genes. Small interfering RNAs directed against ATF4 potently reduced basal F7 expression, and prevented F7 upregulation by glucose deprivation. The response of the endogenous F7 gene was replicated in reporter gene assays, which further indicated that ATF4 effects were mediated via interaction with an amino acid response element in the F7 promoter. Our data indicated that glucose deprivation enhanced F7 expression in a mechanism reliant on prior ATF4 upregulation primarily due to increased transcription from the ATF4 gene. Of five coagulation protein genes examined, only F7 was upregulated, suggesting that its functions may be important in a systemic response to glucose deprivation stress.

  10. Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

    Science.gov (United States)

    Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

    2017-11-01

    Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  11. CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation.

    Science.gov (United States)

    Miki, Daisuke; Zhang, Wenxin; Zeng, Wenjie; Feng, Zhengyan; Zhu, Jian-Kang

    2018-05-17

    Homologous recombination-based gene targeting is a powerful tool for precise genome modification and has been widely used in organisms ranging from yeast to higher organisms such as Drosophila and mouse. However, gene targeting in higher plants, including the most widely used model plant Arabidopsis thaliana, remains challenging. Here we report a sequential transformation method for gene targeting in Arabidopsis. We find that parental lines expressing the bacterial endonuclease Cas9 from the egg cell- and early embryo-specific DD45 gene promoter can improve the frequency of single-guide RNA-targeted gene knock-ins and sequence replacements via homologous recombination at several endogenous sites in the Arabidopsis genome. These heritable gene targeting can be identified by regular PCR. Our approach enables routine and fine manipulation of the Arabidopsis genome.

  12. Complementary Information Derived from CRISPR Cas9 Mediated Gene Deletion and Suppression. | Office of Cancer Genomics

    Science.gov (United States)

    CRISPR-Cas9 provides the means to perform genome editing and facilitates loss-of-function screens. However, we and others demonstrated that expression of the Cas9 endonuclease induces a gene-independent response that correlates with the number of target sequences in the genome. An alternative approach to suppressing gene expression is to block transcription using a catalytically inactive Cas9 (dCas9). Here we directly compare genome editing by CRISPR-Cas9 (cutting, CRISPRc) and gene suppression using KRAB-dCas9 (CRISPRi) in loss-of-function screens to identify cell essential genes.

  13. Precise gene modification mediated by TALEN and single-stranded oligodeoxynucleotides in human cells.

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    Full Text Available The development of human embryonic stem cells (ESCs and induced pluripotent stem cells (iPSCs facilitates in vitro studies of human disease mechanisms, speeds up the process of drug screening, and raises the feasibility of using cell replacement therapy in clinics. However, the study of genotype-phenotype relationships in ESCs or iPSCs is hampered by the low efficiency of site-specific gene editing. Transcription activator-like effector nucleases (TALENs spurred interest due to the ease of assembly, high efficiency and faithful gene targeting. In this study, we optimized the TALEN design to maximize its genomic cutting efficiency. We showed that using optimized TALENs in conjunction with single-strand oligodeoxynucleotide (ssODN allowed efficient gene editing in human cells. Gene mutations and gene deletions for up to 7.8 kb can be accomplished at high efficiencies. We established human tumor cell lines and H9 ESC lines with homozygous deletion of the microRNA-21 (miR-21 gene and miR-9-2 gene. These cell lines provide a robust platform to dissect the roles these genes play during cell differentiation and tumorigenesis. We also observed that the endogenous homologous chromosome can serve as a donor template for gene editing. Overall, our studies demonstrate the versatility of using ssODN and TALEN to establish genetically modified cells for research and therapeutic application.

  14. The effect of adenovirus-mediated gene expression of FHIT in small cell lung cancer cells

    DEFF Research Database (Denmark)

    Zandi, Roza; Xu, Kai; Poulsen, Hans S

    2011-01-01

    The candidate tumor suppressor fragile histidine traid (FHIT) is frequently inactivated in small cell lung cancer (SCLC). Mutations in the p53 gene also occur in the majority of SCLC leading to the accumulation of the mutant protein. Here we evaluated the effect of FHIT gene therapy alone...

  15. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  16. Differential Cotton leaf crumple virus-VIGS-mediated gene silencing and viral genome localization in different Gossypium hirsutum genetic backgrounds

    KAUST Repository

    Idris, Ali

    2010-12-01

    A Cotton leaf crumple virus (CLCrV)-based gene silencing vector containing a fragment of the Gossypium hirsutum Magnesium chelatase subunit I was used to establish endogenous gene silencing in cotton of varied genetic backgrounds. Biolistic inoculation resulted in systemic and persistent photo-bleaching of the leaves and bolls of the seven cultivars tested, however, the intensity of silencing was variable. CLCrV-VIGS-mediated expression of green fluorescent protein was used to monitor the in planta distribution of the vector, indicating successful phloem invasion in all cultivars tested. Acala SJ-1, one of the cotton cultivars, was identified as a particularly optimal candidate for CLCrV-VIGS-based cotton reverse-genetics. © 2010 Elsevier Ltd.

  17. Multi-omics analysis identifies genes mediating the extension of cell walls in the Arabidopsis thaliana root elongation zone

    DEFF Research Database (Denmark)

    Wilson, Michael H; Holman, Tara J; Sørensen, Iben

    2015-01-01

    Plant cell wall composition is important for regulating growth rates, especially in roots. However, neither analyses of cell wall composition nor transcriptomes on their own can comprehensively reveal which genes and processes are mediating growth and cell elongation rates. This study reveals...... the benefits of carrying out multiple analyses in combination. Sections of roots from five anatomically and functionally defined zones in Arabidopsis thaliana were prepared and divided into three biological replicates. We used glycan microarrays and antibodies to identify the major classes of glycans......)cellular localization of many epitopes. Extensins were localized in epidermal and cortex cell walls, while AGP glycans were specific to different tissues from root-hair cells to the stele. The transcriptome analysis found several gene families peaking in the REZ. These included a large family of peroxidases (which...

  18. Stable X chromosome inactivation involves the PRC1 Polycomb complex and requires histone MACROH2A1 and the CULLIN3/SPOP ubiquitin E3 ligase

    DEFF Research Database (Denmark)

    Hernández-Muñoz, Inmaculada; Lund, Anders H; van der Stoop, Petra

    2005-01-01

    X inactivation involves the stable silencing of one of the two X chromosomes in XX female mammals. Initiation of this process occurs during early development and involves Xist (X-inactive-specific transcript) RNA coating and the recruitment of Polycomb repressive complex (PRC) 2 and PRC1 proteins...

  19. TLR2-dependent inhibition of macrophage responses to IFN-gamma is mediated by distinct, gene-specific mechanisms.

    Directory of Open Access Journals (Sweden)

    Sarah A Benson

    2009-07-01

    Full Text Available Mycobacterium tuberculosis uses multiple mechanisms to avoid elimination by the immune system. We have previously shown that M. tuberculosis can inhibit selected macrophage responses to IFN-gamma through TLR2-dependent and -independent mechanisms. To specifically address the role of TLR2 signaling in mediating this inhibition, we stimulated macrophages with the specific TLR2/1 ligand Pam(3CSK(4 and assayed responses to IFN-gamma. Pam(3CSK(4 stimulation prior to IFN-gamma inhibited transcription of the unrelated IFN-gamma-inducible genes, CIITA and CXCL11. Surface expression of MHC class II and secretion of CXCL11 were greatly reduced as well, indicating that the reduction in transcripts had downstream effects. Inhibition of both genes required new protein synthesis. Using chromatin immunoprecipitation, we found that TLR2 stimulation inhibited IFN-gamma-induced RNA polymerase II binding to the CIITA and CXCL11 promoters. Furthermore, TATA binding protein was unable to bind the TATA box of the CXCL11 promoter, suggesting that assembly of transcriptional machinery was disrupted. However, TLR2 stimulation affected chromatin modifications differently at each of the inhibited promoters. Histone H3 and H4 acetylation was reduced at the CIITA promoter but unaffected at the CXCL11 promoter. In addition, NF-kappaB signaling was required for inhibition of CXCL11 transcription, but not for inhibition of CIITA. Taken together, these results indicate that TLR2-dependent inhibition of IFN-gamma-induced gene expression is mediated by distinct, gene-specific mechanisms that disrupt binding of the transcriptional machinery to the promoters.

  20. Tensor decomposition-based unsupervised feature extraction identifies candidate genes that induce post-traumatic stress disorder-mediated heart diseases.

    Science.gov (United States)

    Taguchi, Y-H

    2017-12-21

    Although post-traumatic stress disorder (PTSD) is primarily a mental disorder, it can cause additional symptoms that do not seem to be directly related to the central nervous system, which PTSD is assumed to directly affect. PTSD-mediated heart diseases are some of such secondary disorders. In spite of the significant correlations between PTSD and heart diseases, spatial separation between the heart and brain (where PTSD is primarily active) prevents researchers from elucidating the mechanisms that bridge the two disorders. Our purpose was to identify genes linking PTSD and heart diseases. In this study, gene expression profiles of various murine tissues observed under various types of stress or without stress were analyzed in an integrated manner using tensor decomposition (TD). Based upon the obtained features, ∼ 400 genes were identified as candidate genes that may mediate heart diseases associated with PTSD. Various gene enrichment analyses supported biological reliability of the identified genes. Ten genes encoding protein-, DNA-, or mRNA-interacting proteins-ILF2, ILF3, ESR1, ESR2, RAD21, HTT, ATF2, NR3C1, TP53, and TP63-were found to be likely to regulate expression of most of these ∼ 400 genes and therefore are candidate primary genes that cause PTSD-mediated heart diseases. Approximately 400 genes in the heart were also found to be strongly affected by various drugs whose known adverse effects are related to heart diseases and/or fear memory conditioning; these data support the reliability of our findings. TD-based unsupervised feature extraction turned out to be a useful method for gene selection and successfully identified possible genes causing PTSD-mediated heart diseases.

  1. A guide to approaching regulatory considerations for lentiviral-mediated gene therapies.

    Science.gov (United States)

    White, Michael; Whittaker, Roger; Stoll, Elizabeth Ann

    2017-06-12

    Lentiviral vectors are increasingly the gene transfer tool of choice for gene or cell therapies, with multiple clinical investigations showing promise for this viral vector in terms of both safety and efficacy. The third-generation vector system is well-characterized, effectively delivers genetic material and maintains long-term stable expression in target cells, delivers larger amounts of genetic material than other methods, is non-pathogenic and does not cause an inflammatory response in the recipient. This report aims to help academic scientists and regulatory managers negotiate the governance framework to achieve successful translation of a lentiviral vector-based gene therapy. The focus is on European regulations, and how they are administered in the United Kingdom, although many of the principles will be similar for other regions including the United States. The report justifies the rationale for using third-generation lentiviral vectors to achieve gene delivery for in vivo and ex vivo applications; briefly summarises the extant regulatory guidance for gene therapies, categorised as advanced therapeutic medicinal products (ATMPs); provides guidance on specific regulatory issues regarding gene therapies; presents an overview of the key stakeholders to be approached when pursuing clinical trials authorization for an ATMP; and includes a brief catalogue of the documentation required to submit an application for regulatory approval of a new gene therapy.

  2. Human Polycomb group EED protein negatively affects HIV-1 assembly and release

    Directory of Open Access Journals (Sweden)

    Darlix Jean-Luc

    2007-06-01

    Full Text Available Abstract Background The human EED protein, a member of the superfamily of Polycomb group (PcG proteins with WD-40 repeats, has been found to interact with three HIV-1 components, namely the structural Gag matrix protein (MA, the integrase enzyme (IN and the Nef protein. The aim of the present study was to analyze the possible biological role of EED in HIV-1 replication, using the HIV-1-based vector HIV-Luc and EED protein expressed by DNA transfection of 293T cells. Results During the early phase of HIV-1 infection, a slight negative effect on virus infectivity occurred in EED-expressing cells, which appeared to be dependent on EED-MA interaction. At late times post infection, EED caused an important reduction of virus production, from 20- to 25-fold as determined by CAp24 immunoassay, to 10- to 80-fold based on genomic RNA levels, and this decrease was not due to a reduction of Gag protein synthesis. Coexpression of WTNef, or the non-N-myristoylated mutant NefG2A, restored virus yields to levels obtained in the absence of exogenous EED protein. This effect was not observed with mutant NefΔ57 mimicking the Nef core, or with the lipid raft-retargeted fusion protein LAT-Nef. LATAA-Nef, a mutant defective in the lipid raft addressing function, had the same anti-EED effect as WTNef. Cell fractionation and confocal imaging showed that, in the absence of Nef, EED mainly localized in membrane domains different from the lipid rafts. Upon co-expression with WTNef, NefG2A or LATAA-Nef, but not with NefΔ57 or LAT-Nef, EED was found to relocate into an insoluble fraction along with Nef protein. Electron microscopy of HIV-Luc producer cells overexpressing EED showed significant less virus budding at the cell surface compared to control cells, and ectopic assembly and clustering of nuclear pore complexes within the cytoplasm. Conclusion Our data suggested that EED exerted an antiviral activity at the late stage of HIV-1 replication, which included genomic

  3. A Rabbit Model for Testing Helper-Dependent Adenovirus-Mediated Gene Therapy for Vein Graft Atherosclerosis

    Directory of Open Access Journals (Sweden)

    Lianxiang Bi

    2017-12-01

    Full Text Available Coronary artery bypass vein grafts are a mainstay of therapy for human atherosclerosis. Unfortunately, the long-term patency of vein grafts is limited by accelerated atherosclerosis. Gene therapy, directed at the vein graft wall, is a promising approach for preventing vein graft atherosclerosis. Because helper-dependent adenovirus (HDAd efficiently transduces grafted veins and confers long-term transgene expression, HDAd is an excellent candidate for delivery of vein graft-targeted gene therapy. We developed a model of vein graft atherosclerosis in fat-fed rabbits and demonstrated long-term (≥20 weeks persistence of HDAd genomes after graft transduction. This model enables quantitation of vein graft hemodynamics, wall structure, lipid accumulation, cellularity, vector persistence, and inflammatory markers on a single graft. Time-course experiments identified 12 weeks after transduction as an optimal time to measure efficacy of gene therapy on the critical variables of lipid and macrophage accumulation. We also used chow-fed rabbits to test whether HDAd infusion in vein grafts promotes intimal growth and inflammation. HDAd did not increase intimal growth, but had moderate—yet significant—pro-inflammatory effects. The vein graft atherosclerosis model will be useful for testing HDAd-mediated gene therapy; however, pro-inflammatory effects of HdAd remain a concern in developing HDAd as a therapy for vein graft disease.

  4. A Rabbit Model for Testing Helper-Dependent Adenovirus-Mediated Gene Therapy for Vein Graft Atherosclerosis.

    Science.gov (United States)

    Bi, Lianxiang; Wacker, Bradley K; Bueren, Emma; Ham, Ervin; Dronadula, Nagadhara; Dichek, David A

    2017-12-15

    Coronary artery bypass vein grafts are a mainstay of therapy for human atherosclerosis. Unfortunately, the long-term patency of vein grafts is limited by accelerated atherosclerosis. Gene therapy, directed at the vein graft wall, is a promising approach for preventing vein graft atherosclerosis. Because helper-dependent adenovirus (HDAd) efficiently transduces grafted veins and confers long-term transgene expression, HDAd is an excellent candidate for delivery of vein graft-targeted gene therapy. We developed a model of vein graft atherosclerosis in fat-fed rabbits and demonstrated long-term (≥20 weeks) persistence of HDAd genomes after graft transduction. This model enables quantitation of vein graft hemodynamics, wall structure, lipid accumulation, cellularity, vector persistence, and inflammatory markers on a single graft. Time-course experiments identified 12 weeks after transduction as an optimal time to measure efficacy of gene therapy on the critical variables of lipid and macrophage accumulation. We also used chow-fed rabbits to test whether HDAd infusion in vein grafts promotes intimal growth and inflammation. HDAd did not increase intimal growth, but had moderate-yet significant-pro-inflammatory effects. The vein graft atherosclerosis model will be useful for testing HDAd-mediated gene therapy; however, pro-inflammatory effects of HdAd remain a concern in developing HDAd as a therapy for vein graft disease.

  5. CRISPR/Cas9 nuclease-mediated gene knock-in in bovine-induced pluripotent cells.

    Science.gov (United States)

    Heo, Young Tae; Quan, Xiaoyuan; Xu, Yong Nan; Baek, Soonbong; Choi, Hwan; Kim, Nam-Hyung; Kim, Jongpil

    2015-02-01

    Efficient and precise genetic engineering in livestock such as cattle holds great promise in agriculture and biomedicine. However, techniques that generate pluripotent stem cells, as well as reliable tools for gene targeting in livestock, are still inefficient, and thus not routinely used. Here, we report highly efficient gene targeting in the bovine genome using bovine pluripotent cells and clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 nuclease. First, we generate induced pluripotent stem cells (iPSCs) from bovine somatic fibroblasts by the ectopic expression of yamanaka factors and GSK3β and MEK inhibitor (2i) treatment. We observed that these bovine iPSCs are highly similar to naïve pluripotent stem cells with regard to gene expression and developmental potential in teratomas. Moreover, CRISPR/Cas9 nuclease, which was specific for the bovine NANOG locus, showed highly efficient editing of the bovine genome in bovine iPSCs and embryos. To conclude, CRISPR/Cas9 nuclease-mediated homologous recombination targeting in bovine pluripotent cells is an efficient gene editing method that can be used to generate transgenic livestock in the future.

  6. Global analysis of gene expression mediated by OX1 orexin receptor signaling in a hypothalamic cell line.

    Directory of Open Access Journals (Sweden)

    Eric Koesema

    Full Text Available The orexins and their cognate G-protein coupled receptors have been widely studied due to their associations with various behaviors and cellular processes. However, the detailed downstream signaling cascades that mediate these effects are not completely understood. We report the generation of a neuronal model cell line that stably expresses the OX1 orexin receptor (OX1 and an RNA-Seq analysis of changes in gene expression seen upon receptor activation. Upon treatment with orexin, several families of related transcription factors are transcriptionally regulated, including the early growth response genes (Egr, the Kruppel-like factors (Klf, and the Nr4a subgroup of nuclear hormone receptors. Furthermore, some of the transcriptional effects observed have also been seen in data from in vivo sleep deprivation microarray studies, supporting the physiological relevance of the data set. Additionally, inhibition of one of the most highly regulated genes, serum and glucocorticoid-regulated kinase 1 (Sgk1, resulted in the diminished orexin-dependent induction of a subset of genes. These results provide new insight into the molecular signaling events that occur during OX1 signaling and support a role for orexin signaling in the stimulation of wakefulness during sleep deprivation studies.

  7. Characterization of the ecological role of genes mediating acid resistance in Lactobacillus reuteri during colonization of the gastrointestinal tract.

    Science.gov (United States)

    Krumbeck, Janina A; Marsteller, Nathan L; Frese, Steven A; Peterson, Daniel A; Ramer-Tait, Amanda E; Hutkins, Robert W; Walter, Jens

    2016-07-01

    Rodent-derived strains of Lactobacillus reuteri densely colonize the forestomach of mice and possess several genes whose predicted functions constitute adaptations towards an acidic environment. The objective of this study was to systematically determine which genes of L. reuteri 100-23 contribute to tolerance towards host gastric acid secretion. Genes predicted to be involved in acid resistance were inactivated, and their contribution to survival under acidic conditions was confirmed in model gastric juice. Fitness of five mutants that showed impaired in vitro acid resistance were then compared through competition experiments in ex-germ-free mice that were either treated with omeprazole, a proton-pump inhibitor that suppresses acid secretion in the stomach, or left untreated. This analysis revealed that the urease cluster was the predominant factor in mediating resistance to gastric acid production. Population levels of the mutant, which were substantially decreased in untreated mice, were almost completely restored through omeprazole, demonstrating that urease production in L. reuteri is mainly devoted to overcome gastric acid. The findings provide novel information on the mechanisms by which L. reuteri colonizes its gastric niche and demonstrate that in silico gene predictions and in vitro tests have limitations for predicting the ecological functions of colonization factors in bacterial symbionts. © 2015 Society for Applied Microbiology and John Wiley & Sons Ltd.

  8. Activity and specificity of TRV-mediated gene editing in plants

    KAUST Repository

    Ali, Zahir

    2015-06-03

    © 2015 Taylor and Francis Group, LLC. Plant trait engineering requires efficient targeted genome-editing technologies. Clustered regularly interspaced palindromic repeats (CRISPRs)/ CRISPR associated (Cas) type II system is used for targeted genome-editing applications across eukaryotic species including plants. Delivery of genome engineering reagents and recovery of mutants remain challenging tasks for in planta applications. Recently, we reported the development of Tobacco rattle virus (TRV)-mediated genome editing in Nicotiana benthamiana. TRV infects the growing points and possesses small genome size; which facilitate cloning, multiplexing, and agroinfections. Here, we report on the persistent activity and specificity of the TRV-mediated CRISPR/Cas9 system for targeted modification of the Nicotiana benthamiana genome. Our data reveal the persistence of the TRVmediated Cas9 activity for up to 30 d post-agroinefection. Further, our data indicate that TRV-mediated genome editing exhibited no off-target activities at potential off-targets indicating the precision of the system for plant genome engineering. Taken together, our data establish the feasibility and exciting possibilities of using virus-mediated CRISPR/Cas9 for targeted engineering of plant genomes.

  9. Collective evolution of cyanobacteria and cyanophages mediated by horizontal gene transfer

    Science.gov (United States)

    Shih, Hong-Yan; Rogers, Tim; Goldenfeld, Nigel

    We describe a model for how antagonistic predator-prey coevolution can lead to mutualistic adaptation to an environment, as a result of horizontal gene transfer. Our model is a simple description of ecosystems such as marine cyanobacteria and their predator cyanophages, which carry photosynthesis genes. These genes evolve more rapidly in the virosphere than the bacterial pan-genome, and thus the bacterial population could potentially benefit from phage predation. By modeling both the barrier to predation and horizontal gene transfer, we study this balance between individual sacrifice and collective benefits. The outcome is an emergent mutualistic coevolution of improved photosynthesis capability, benefiting both bacteria and phage. This form of multi-level selection can contribute to niche stratification in the cyanobacteria-phage ecosystem. This work is supported in part by a cooperative agreement with NASA, Grant NNA13AA91A/A0018.

  10. Effects of RNAi-mediated cathepsin L gene silencing on bionomics ...

    African Journals Online (AJOL)

    USER

    2010-08-02

    Aug 2, 2010 ... melanoma, gastric cancer, and pancreatic cancer. The main function of ... successfully applied in various areas of biological research, and its main ... molecule, the corresponding target gene mRNA is cut under RNA-induced ...

  11. Perceived Parenting Mediates Serotonin Transporter Gene (5-HTTLPR) and Neural System Function during Facial Recognition: A Pilot Study

    Science.gov (United States)

    Nishikawa, Saori

    2015-01-01

    This study examined changes in prefrontal oxy-Hb levels measured by NIRS (Near-Infrared Spectroscopy) during a facial-emotion recognition task in healthy adults, testing a mediational/moderational model of these variables. Fifty-three healthy adults (male = 35, female = 18) aged between 22 to 37 years old (mean age = 24.05 years old) provided saliva samples, completed a EMBU questionnaire (Swedish acronym for Egna Minnen Beträffande Uppfostran [My memories of upbringing]), and participated in a facial-emotion recognition task during NIRS recording. There was a main effect of maternal rejection on RoxH (right frontal activation during an ambiguous task), and a gene × environment (G×E) interaction on RoxH, suggesting that individuals who carry the SL or LL genotype and who endorse greater perceived maternal rejection show less right frontal activation than SL/LL carriers with lower perceived maternal rejection. Finally, perceived parenting style played a mediating role in right frontal activation via the 5-HTTLPR genotype. Early-perceived parenting might influence neural activity in an uncertain situation i.e. rating ambiguous faces among individuals with certain genotypes. This preliminary study makes a small contribution to the mapping of an influence of gene and behaviour on the neural system. More such attempts should be made in order to clarify the links. PMID:26418317

  12. Substrate-mediated delivery of gene complex nanoparticles via polydopamine coating for enhancing competitiveness of endothelial cells.

    Science.gov (United States)

    Li, Bo-Chao; Chang, Hao; Ren, Ke-Feng; Ji, Jian

    2016-11-01

    Substrate-mediated delivery of functional plasmid DNA (pDNA) has been proven to be a promising strategy to promote competitiveness of endothelial cells (ECs) over smooth muscle cells (SMCs), which is beneficial to inducing fast endothelialization of implanted vascular devices. Thus, it is of great importance to develop universal approaches with simplicity and easiness to immobilize DNA complex nanoparticles on substrates. In this study, the bioinspired polydopamine (PDA) coating was employed in immobilization of DNA complex nanoparticles, which were composed of protamine (PrS) and plasmid DNA encoding with hepatocyte growth factor (HGF-pDNA) gene. We demonstrated that the DNA complex nanoparticles can be successfully immobilized onto the PDA surface. Consequently, the HGF expression of both ECs and SMCs were significantly improved when they cultured on the DNA complex nanoparticles-immobilized substrates. Furthermore, EC proliferation was specifically promoted due to bioactivity of HGF, leading to an enhancement of EC competitiveness over SMCs. Our findings demonstrated the substrate-mediated functional gene nanoparticle delivery through PDA coating as a simple and efficient approach. It may hold great potential in the field of interventional cardiovascular implants. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Perceived Parenting Mediates Serotonin Transporter Gene (5-HTTLPR and Neural System Function during Facial Recognition: A Pilot Study.

    Directory of Open Access Journals (Sweden)

    Saori Nishikawa

    Full Text Available This study examined changes in prefrontal oxy-Hb levels measured by NIRS (Near-Infrared Spectroscopy during a facial-emotion recognition task in healthy adults, testing a mediational/moderational model of these variables. Fifty-three healthy adults (male = 35, female = 18 aged between 22 to 37 years old (mean age = 24.05 years old provided saliva samples, completed a EMBU questionnaire (Swedish acronym for Egna Minnen Beträffande Uppfostran [My memories of upbringing], and participated in a facial-emotion recognition task during NIRS recording. There was a main effect of maternal rejection on RoxH (right frontal activation during an ambiguous task, and a gene × environment (G × E interaction on RoxH, suggesting that individuals who carry the SL or LL genotype and who endorse greater perceived maternal rejection show less right frontal activation than SL/LL carriers with lower perceived maternal rejection. Finally, perceived parenting style played a mediating role in right frontal activation via the 5-HTTLPR genotype. Early-perceived parenting might influence neural activity in an uncertain situation i.e. rating ambiguous faces among individuals with certain genotypes. This preliminary study makes a small contribution to the mapping of an influence of gene and behaviour on the neural system. More such attempts should be made in order to clarify the links.

  14. RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

    Science.gov (United States)

    Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

    2014-07-01

    Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

  15. TET-mediated oxidation of methylcytosine causes TDG or NEIL glycosylase dependent gene reactivation.

    Science.gov (United States)

    Müller, Udo; Bauer, Christina; Siegl, Michael; Rottach, Andrea; Leonhardt, Heinrich

    2014-07-01

    The discovery of hydroxymethyl-, formyl- and carboxylcytosine, generated through oxidation of methylcytosine by TET dioxygenases, raised the question how these modifications contribute to epigenetic regulation. As they are subjected to complex regulation in vivo, we dissected links to gene expression with in vitro modified reporter constructs. We used an Oct4 promoter-driven reporter gene and demonstrated that in vitro methylation causes gene silencing while subsequent oxidation with purified catalytic domain of TET1 leads to gene reactivation. To identify proteins involved in this pathway we screened for TET interacting factors and identified TDG, PARP1, XRCC1 and LIG3 that are involved in base-excision repair. Knockout and rescue experiments demonstrated that gene reactivation depended on the glycosylase TDG, but not MBD4, while NEIL1, 2 and 3 could partially rescue the loss of TDG. These results clearly show that oxidation of methylcytosine by TET dioxygenases and subsequent removal by TDG or NEIL glycosylases and the BER pathway results in reactivation of epigenetically silenced genes. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Gene Expression Changes in the Motor Cortex Mediating Motor Skill Learning

    Science.gov (United States)

    Cheung, Vincent C. K.; DeBoer, Caroline; Hanson, Elizabeth; Tunesi, Marta; D'Onofrio, Mara; Arisi, Ivan; Brandi, Rossella; Cattaneo, Antonino; Goosens, Ki A.

    2013-01-01

    The primary motor cortex (M1) supports motor skill learning, yet little is known about the genes that contribute to motor cortical plasticity. Such knowledge could identify candidate molecules whose targeting might enable a new understanding of motor cortical functions, and provide new drug targets for the treatment of diseases which impair motor function, such as ischemic stroke. Here, we assess changes in the motor-cortical transcriptome across different stages of motor skill acquisition. Adult rats were trained on a gradually acquired appetitive reach and grasp task that required different strategies for successful pellet retrieval, or a sham version of the task in which the rats received pellet reward without needing to develop the reach and grasp skill. Tissue was harvested from the forelimb motor-cortical area either before training commenced, prior to the initial rise in task performance, or at peak performance. Differential classes of gene expression were observed at the time point immediately preceding motor task improvement. Functional clustering revealed that gene expression changes were related to the synapse, development, intracellular signaling, and the fibroblast growth factor (FGF) family, with many modulated genes known to regulate synaptic plasticity, synaptogenesis, and cytoskeletal dynamics. The modulated expression of synaptic genes likely reflects ongoing network reorganization from commencement of training till the point of task improvement, suggesting that motor performance improves only after sufficient modifications in the cortical circuitry have accumulated. The regulated FGF-related genes may together contribute to M1 remodeling through their roles in synaptic growth and maturation. PMID:23637843

  17. The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex.

    Science.gov (United States)

    Gribble, Kristin E; Mark Welch, David B

    2012-08-01

    Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP), a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Isolates of the B. plicatilis species complex have 1-4 copies of mmr-b, each composed of 2-9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving rapidly, and novel alleles may be maintained and increase in

  18. The mate recognition protein gene mediates reproductive isolation and speciation in the Brachionus plicatilis cryptic species complex

    Directory of Open Access Journals (Sweden)

    Gribble Kristin E

    2012-08-01

    Full Text Available Abstract Background Chemically mediated prezygotic barriers to reproduction likely play an important role in speciation. In facultatively sexual monogonont rotifers from the Brachionus plicatilis cryptic species complex, mate recognition of females by males is mediated by the Mate Recognition Protein (MRP, a globular glycoprotein on the surface of females, encoded by the mmr-b gene family. In this study, we sequenced mmr-b copies from 27 isolates representing 11 phylotypes of the B. plicatilis species complex, examined the mode of evolution and selection of mmr-b, and determined the relationship between mmr-b genetic distance and mate recognition among isolates. Results Isolates of the B. plicatilis species complex have 1–4 copies of mmr-b, each composed of 2–9 nearly identical tandem repeats. The repeats within a gene copy are generally more similar than are gene copies among phylotypes, suggesting concerted evolution. Compared to housekeeping genes from the same isolates, mmr-b has accumulated only half as many synonymous differences but twice as many non-synonymous differences. Most of the amino acid differences between repeats appear to occur on the outer face of the protein, and these often result in changes in predicted patterns of phosphorylation. However, we found no evidence of positive selection driving these differences. Isolates with the most divergent copies were unable to mate with other isolates and rarely self-crossed. Overall the degree of mate recognition was significantly correlated with the genetic distance of mmr-b. Conclusions Discrimination of compatible mates in the B. plicatilis species complex is determined by proteins encoded by closely related copies of a single gene, mmr-b. While concerted evolution of the tandem repeats in mmr-b may function to maintain identity, it can also lead to the rapid spread of a mutation through all copies in the genome and thus to reproductive isolation. The mmr-b gene is evolving

  19. NR4A nuclear receptors mediate carnitine palmitoyltransferase 1A gene expression by the rexinoid HX600

    Energy Technology Data Exchange (ETDEWEB)

    Ishizawa, Michiyasu [Division of Biochemistry, Department of Biomedical Sciences, Nihon University School of Medicine, 30-1 Oyaguchi-kamicho, Itabashi-ku, Tokyo 173-8610 (Japan); Kagechika, Hiroyuki [Graduate School of Biomedical Science, Institute of Biomaterials and Bioengineering, Tokyo Medical and Dental University, 2-3-10 Kanda-Surugadai, Chiyoda-ku, Tokyo 101-0062 (Japan); Makishima, Makoto, E-mail: makishima.makoto@nihon-u.ac.jp [Division of Biochemistry, Department of Biomedical Sciences, Nihon University School of Medicine, 30-1 Oyaguchi-kamicho, Itabashi-ku, Tokyo 173-8610 (Japan)

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer The function of RXR heterodimers with NR4 receptors remains unknown. Black-Right-Pointing-Pointer The RXR ligand HX600 induces expression of carnitine palmitoyltransferase 1A (CPT1A). Black-Right-Pointing-Pointer HX600-induced CPT1A expression is mediated by the NR4 receptors, Nur77 and NURR1. Black-Right-Pointing-Pointer CPT1A induction by HX600 is not mediated by de novo protein synthesis. Black-Right-Pointing-Pointer CPT1A could be a target of the Nur77-RXR and NURR1-RXR heterodimers. -- Abstract: Retinoid X receptors (RXRs) are members of the nuclear receptor superfamily and can be activated by 9-cis retinoic acid (9CRA). RXRs form homodimers and heterodimers with other nuclear receptors such as the retinoic acid receptor and NR4 subfamily nuclear receptors, Nur77 and NURR1. Potential physiological roles of the Nur77-RXR and NURR1-RXR heterodimers have not been elucidated. In this study, we identified a gene regulated by these heterodimers utilizing HX600, a selective RXR agonist for Nur77-RXR and NURR1-RXR. While 9CRA induced many genes, including RAR-target genes, HX600 effectively induced only carnitine palmitoyltransferase 1A (CPT1A) in human teratocarcinoma NT2/D1 cells, which express RXR{alpha}, Nur77 and NURR1. HX600 also increased CPT1A expression in human embryonic kidney (HEK) 293 cells and hepatocyte-derived HepG2 cells. Although HX600 induced CPT1A less effectively than 9CRA, overexpression of Nur77 or NURR1 increased the HX600 response to levels similar to 9CRA in NT2/D1 and HEK293 cells. A dominant-negative form of Nur77 or NURR1 repressed the induction of CPT1A by HX600. A protein synthesis inhibitor did not alter HX600-dependent CPT1A induction. Thus, the rexinoid HX600 directly induces expression of CPT1A through a Nur77 or NURR1-mediated mechanism. CPT1A, a gene involved in fatty acid {beta}-oxidation, could be a target of RXR-NR4 receptor heterodimers.

  20. 'Molecular switch' vectors for hypoxia- and radiation-mediated gene therapy of cancer

    International Nuclear Information System (INIS)

    Greco, O.; Marples, B.; Joiner, M.C.; Scott, S.D.

    2003-01-01

    Intratumoral areas of low oxygen concentration are known to be refractive to radiotherapy treatment. However, this physiological condition can be exploited for selective cancer gene therapy. We have developed a series of synthetic promoters selectively responsive to both hypoxia and ionizing radiation (IR). These promoters contain hypoxia regulatory elements (HREs) from the erythropoietin (Epo), the phosphoglycerate kinase1(PGK1) and vascular endothelial growth factor (VEGF) genes, and/or IR-responsive CArG elements from the Early Growth Response 1 (Egr1) gene. The HRE and CArG promoters were able to regulate expression of reporter and suicide genes in human tumor cells, following corresponding stimulation with hypoxia (0.1% O2) or X-irradiation (5Gy) [Greco et al, 2002, Gene Therapy 9:1403]. Furthermore, the chimeric HRE + CArG promoters could be activated by these stimuli independently or even more significantly when given in combination, with the Epo HRE/CArG promoter proving to be the most responsive and robust. In order to amplify and maintain transgene expression even following withdrawal of the triggering stimuli, we have developed a 'molecular switch' system [Scott et al, 2000, Gene Therapy 7:1121]. This 'switch' system has now been engineered as a single vector molecule, containing HRE and CArG promoters. This new series of HRE/CArG switch vectors have been tested in a herpes simplex thymidine kinase (HSVtk)/ganciclovir (GCV) suicide gene assay. Results indicate that a) higher and more selective tumor cell kill is achieved with the switch when compared with the HRE and CArG promoters directly driving HSVtk expression and b) the Epo HRE/CArG switch vectors appear to function as efficiently as the strong constitutive cytomegalovirus (CMV) promoter construct

  1. Effects of gamma rays, ultraviolet radiation, sunlight, microwaves and electromagnetic fields on gene expression mediated by human immunodeficiency virus promoter

    International Nuclear Information System (INIS)

    Libertin, C.R.; Woloschak, G.E.; Panozzo, J.; Groh, K.R.; Chang-Liu, Chin-Mei; Schreck, S.

    1994-01-01

    Previous work by our group and others has shown the modulation of human immunodeficiency virus (HIV) promoter or long terminal repeat (LTR) after exposure to neutrons and ultraviolet radiations. Using HeLa cells stably transfected with a construct containing the chloramphenicol acetyl transferase (CAT) gene, the transcription of which is mediated by the HIV-LTR, we designed experiments to examine the effects of exposure to different types of radiation (such as γ rays, ultraviolet and sunlight irradiations, electromagnetic fields and microwaves) in HIV-LTR-driven expression of CAT. These results demonstrated ultraviolet-light-induced transcription from the HIV promoter, as has been shown by others. Exposure to other DNA-damaging agents such as γ rays and sunlight (with limited exposures) had no significant effect on transcription mediated by HIV-LTR, suggesting that induction of HIV is not mediated by just any type of DNA damage but rather may require specific types of DNA damage. Microwaves did not cause cell killing when cells in culture were exposed in high volumes of medium, and the same cells showed no changes in expression. When microwave exposure was carried out in low volumes of medium (so that excessive heat was generated) induction of HIV-LTR transcription (as assayed by CAT activity) was evident. Electromagnetic field exposures had no effect on expression of HIV-LTR. These results demonstrate that not all types of radiation and not all DNA-damaging agents are capable of inducing HIV. We hypothesize that induction of HIV transcription may be mediated by several different signals exposure to radiation. 22 refs., 8 figs

  2. Retroviral-mediated gene transfer and expression of human phenylalanine hydroxylase in primary mouse hepatocytes

    Energy Technology Data Exchange (ETDEWEB)

    Peng, H.; Armentano, D.; Mackenzie-Graham, L.; Shen, R.F.; Darlington, G.; Ledley, F.D.; Woo, S.L.C. (Baylor College of Medicine, Houston, TX (USA))

    1988-11-01

    Genetic therapy for phenylketonuria (severe phenylalanine hydroxylase deficiency) may require introduction of a normal phenylalanine hydroxylase gene into hepatic cells of patients. The authors report development of a recombinant retrovirus based on the N2 vector for gene transfer and expression of human phenylalanine hydroxylase cDNA in primary mouse hepatocytes. This construct contains an internal promoter of the human {alpha}{sub 1}-antitrypsin gene driving transcription of the phenylalanine hydroxylase cDNA. Primary mouse hepatocytes were isolated from newborn mice, infected with the recombinant virus, and selected for expression of the neomycin-resistance gene. Hepatocytes transformed with the recombinant virus contained high levels of human phenylalanine hydroxylase mRNA transcripts originating from the retroviral and internal promoters. These results demonstrate that the transcriptional regulatory elements of the {alpha}{sub 1} antitrypsin gene retain their tissue-specific function in the recombinant provirus and establish a method for efficient transfer and high-level expression of human phenylalanine hydroxylase in primary hepatocytes.

  3. Retroviral-mediated gene transfer and expression of human phenylalanine hydroxylase in primary mouse hepatocytes

    International Nuclear Information System (INIS)

    Peng, H.; Armentano, D.; Mackenzie-Graham, L.; Shen, R.F.; Darlington, G.; Ledley, F.D.; Woo, S.L.C.

    1988-01-01

    Genetic therapy for phenylketonuria (severe phenylalanine hydroxylase deficiency) may require introduction of a normal phenylalanine hydroxylase gene into hepatic cells of patients. The authors report development of a recombinant retrovirus based on the N2 vector for gene transfer and expression of human phenylalanine hydroxylase cDNA in primary mouse hepatocytes. This construct contains an internal promoter of the human α 1 -antitrypsin gene driving transcription of the phenylalanine hydroxylase cDNA. Primary mouse hepatocytes were isolated from newborn mice, infected with the recombinant virus, and selected for expression of the neomycin-resistance gene. Hepatocytes transformed with the recombinant virus contained high levels of human phenylalanine hydroxylase mRNA transcripts originating from the retroviral and internal promoters. These results demonstrate that the transcriptional regulatory elements of the α 1 antitrypsin gene retain their tissue-specific function in the recombinant provirus and establish a method for efficient transfer and high-level expression of human phenylalanine hydroxylase in primary hepatocytes

  4. Testosterone increases renal anti-aging klotho gene expression via the androgen receptor-mediated pathway.

    Science.gov (United States)

    Hsu, Shih-Che; Huang, Shih-Ming; Lin, Shih-Hua; Ka, Shuk-Man; Chen, Ann; Shih, Meng-Fu; Hsu, Yu-Juei

    2014-12-01

    Gender is known to be associated with longevity and oestrogen administration induced longevity-associated gene expression is one of the potential mechanisms underlying the benefits of oestrogen on lifespan, whereas the role of testosterone in the regulation of longevity-associated gene expressions remains largely unclear. The klotho gene, predominantly expressed in the kidney, has recently been discovered to be an aging suppressor gene. In the present study, we investigated the regulatory effects of testosterone on renal klotho gene expression in vivo and in vitro. In testosterone-administered mouse kidney and NRK-52E cells, increased klotho expression was accompanied by the up-regulation of the nuclear androgen receptor (AR). Overexpression of AR enhanced the expression of klotho mRNA and protein. Conversely, testosterone-induced klotho expression was attenuated in the presence of flutamide, an AR antagonist. A reporter assay and a chromatin immunoprecipitation (ChIP) assay demonstrated that AR directly binds to the klotho promoter via androgen response elements (AREs) which reconfirmed its importance for AR binding via the element mutation. In summary, our study demonstrates that testosterone up-regulates anti-aging klotho together with AR expression in the kidney in vivo and in vitro by recruiting AR on to the AREs of the klotho promoter.

  5. Effects of Microbubble Size on Ultrasound-Mediated Gene Transfection in Auditory Cells

    Directory of Open Access Journals (Sweden)

    Ai-Ho Liao

    2014-01-01

    Full Text Available Gene therapy for sensorineural hearing loss has recently been used to insert genes encoding functional proteins to preserve, protect, or even regenerate hair cells in the inner ear. Our previous study demonstrated a microbubble- (MB-facilitated ultrasound (US technique for delivering therapeutic medication to the inner ear. The present study investigated whether MB-US techniques help to enhance the efficiency of gene transfection by means of cationic liposomes on HEI-OC1 auditory cells and whether MBs of different sizes affect such efficiency. Our results demonstrated that the size of MBs was proportional to the concentration of albumin or dextrose. At a constant US power density, using 0.66, 1.32, and 2.83 μm albumin-shelled MBs increased the transfection rate as compared to the control by 30.6%, 54.1%, and 84.7%, respectively; likewise, using 1.39, 2.12, and 3.47 μm albumin-dextrose-shelled MBs increased the transfection rates by 15.9%, 34.3%, and 82.7%, respectively. The results indicate that MB-US is an effective technique to facilitate gene transfer on auditory cells in vitro. Such size-dependent MB oscillation behavior in the presence of US plays a role in enhancing gene transfer, and by manipulating the concentration of albumin or dextrose, MBs of different sizes can be produced.

  6. Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer’s disease model cell line

    International Nuclear Information System (INIS)

    Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck

    2011-01-01

    Highlights: ► Genome-wide DNA methylation pattern in Alzheimer’s disease model cell line. ► Integrated analysis of CpG methylation and mRNA expression profiles. ► Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. ► The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer’s disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the −435, −295, and −271 CpG sites of CTIF, and at the −505 to −341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at −432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.

  7. 3D Porous Chitosan-Alginate Scaffolds as an In Vitro Model for Evaluating Nanoparticle-Mediated Tumor Targeting and Gene Delivery to Prostate Cancer.

    Science.gov (United States)

    Wang, Kui; Kievit, Forrest M; Florczyk, Stephen J; Stephen, Zachary R; Zhang, Miqin

    2015-10-12

    Cationic nanoparticles (NPs) for targeted gene delivery are conventionally evaluated using 2D in vitro cultures. However, this does not translate well to corresponding in vivo studies because of the marked difference in NP behavior in the presence of the tumor microenvironment. In this study, we investigated whether prostate cancer (PCa) cells cultured in three-dimensional (3D) chitosan-alginate (CA) porous scaffolds could model cationic NP-mediated gene targeted delivery to tumors in vitro. We assessed in vitro tumor cell proliferation, formation of tumor spheroids, and expression of marker genes that promote tumor malignancy in CA scaffolds. The efficacy of NP-targeted gene delivery was evaluated in PCa cells in 2D cultures, PCa tumor spheroids grown in CA scaffolds, and PCa tumors in a mouse TRAMP-C2 flank tumor model. PCa cells cultured in CA scaffolds grew into tumor spheroids and displayed characteristics of higher malignancy as compared to those in 2D cultures. Significantly, targeted gene delivery was only observed in cells cultured in CA scaffolds, whereas cells cultured on 2D plates showed no difference in gene delivery between targeted and nontarget control NPs. In vivo NP evaluation confirmed targeted gene delivery, indicating that only CA scaffolds correctly modeled NP-mediated targeted delivery in vivo. These findings suggest that CA scaffolds serve as a better in vitro platform than 2D cultures for evaluation of NP-mediated targeted gene delivery to PCa.

  8. A comparison of CRISPR/Cas9 and siRNA-mediated ALDH2 gene silencing in human cell lines.

    Science.gov (United States)

    Wang, Fei; Guo, Tao; Jiang, Hongmei; Li, Ruobi; Wang, Ting; Zeng, Ni; Dong, Guanghui; Zeng, Xiaowen; Li, Daochuan; Xiao, Yongmei; Hu, Qiansheng; Chen, Wen; Xing, Xiumei; Wang, Qing

    2018-06-01

    Gene knockdown and knockout using RNAi and CRISPR/Cas9 allow for efficient evaluation of gene function, but it is unclear how the choice of technology can influence the results. To compare the phenotypes obtained using siRNA and CRISPR/Cas9 technologies, aldehyde dehydrogenase 2 (ALDH2) was selected as an example. In this study, we constructed one HepG2 cell line with a homozygous mutation in the fifth exon of ALDH2 (ALDH2-KO1 cell) using the eukaryotic CRISPR/Cas9 expression system followed by the limited dilution method and one HepG2 cell line with different mutations in the ALDH2 gene (ALDH2-KO2 cell) using the lentivirus CRISPR/Cas9 system. Additionally, one ALDH2-knockdown (KD) HepG2 cell line was created using siRNA. The reproducibility of these methods was further verified in the HEK293FT cell line. We found that the mRNA expression level of ALDH2 was significantly decreased and the protein expression level of ALDH2 was completely abolished in the ALDH2-KO cell lines, but not in ALDH2-KD cells. Furthermore, the functional activity of ALDH2 was also markedly disrupted in the two ALDH2-KO cell lines compared with ALDH2-KD and wild-type cells. The lack of ALDH2 expression mediated by CRIPSR/Cas9 resulted in a more dramatic increase in the cellular susceptibility to chemical-induced reactive oxygen species generation, cytotoxicity, apoptosis, and inflammation, especially at low concentrations compared with ALDH2-KD and WT cells. Therefore, we consider the gene knockout cell line created by CRISPR/Cas9 to be a more useful tool for identifying the function of a gene.

  9. Upregulation of the coagulation factor VII gene during glucose deprivation is mediated by activating transcription factor 4.

    Directory of Open Access Journals (Sweden)

    Katherine R Cronin

    Full Text Available BACKGROUND: Constitutive production of blood coagulation proteins by hepatocytes is necessary for hemostasis. Stressful conditions trigger adaptive cellular responses and delay processing of most proteins, potentially affecting plasma levels of proteins secreted exclusively by hepatocytes. We examined the effect of glucose deprivation on expression of coagulation proteins by the human hepatoma cell line, HepG2. METHODOLOGY/PRINCIPAL FINDINGS: Expression of coagulation factor VII, which is required for initiation of blood coagulation, was elevated by glucose deprivation, while expression of other coagulation proteins decreased. Realtime PCR and ELISA demonstrated that the relative percentage expression +/- SD of steady-state F7 mRNA and secreted factor VII antigen were significantly increased (from 100+/-15% to 188+/-27% and 100+/-8.8% to 176.3+/-17.3% respectively, p<0.001 at 24 hr of treatment. The integrated stress response was induced, as indicated by upregulation of transcription factor ATF4 and of additional stress-responsive genes. Small interfering RNAs directed against ATF4 potently reduced basal F7 expression, and prevented F7 upregulation by glucose deprivation. The response of the endogenous F7 gene was replicated in reporter gene assays, which further indicated that ATF4 effects were mediated via interaction with an amino acid response element in the F7 promoter. CONCLUSIONS/SIGNIFICANCE: Our data indicated that glucose deprivation enhanced F7 expression in a mechanism reliant on prior ATF4 upregulation primarily due to increased transcription from the ATF4 gene. Of five coagulation protein genes examined, only F7 was upregulated, suggesting that its functions may be important in a systemic response to glucose deprivation stress.

  10. CRISPR/Cas9 mediated chicken Stra8 gene knockout and inhibition of male germ cell differentiation.

    Directory of Open Access Journals (Sweden)

    Yani Zhang

    Full Text Available An efficient genome editing approach had been established to construct the stable transgenic cell lines in the domestic chicken (Gallus gallus domesticus at present. Our objectives were to investigate gene function in the differentiation process of chicken embryonic stem cells (ESCs into spermatogonial stem cells(SSCs. Three guides RNA (gRNAs were designed to knockout the Stra8 gene, and knockout efficiency was evaluated in domestic chicken cells using cleavage activity of in vitro transcription of gRNA, Luciferase-SSA assay, T7 endonuclease I assay(T7E1 and TA clone sequence. In addition, the Cas9/gRNA plasmid was transfected into ESCs to confirm the function of Stra8. SSA assay results showed that luciferase activity of the vector expressing gRNA-1 and gRNA- 2 was higher than that of gRNA-3. TA clone sequencing showed that the knockdown efficiency was 25% (10/40 in DF-1 cells, the knockdown efficiency was 23% (9/40 in chicken ESCs. T7E1 assay indicated that there were cleavage activity for three individuals, and the knockdown efficiency was 12% (3/25. Cell morphology, qRT-PCR, immunostaining and FCS indicated that Cas9/gRNA not only resulted in the knockout of Stra8 gene, but also suggested that the generation of SSCs was blocked by the Stra8 gene knockdown in vitro. Taken together, our results indicate that the CRISPR/Cas9 system could mediate stable Stra8 gene knockdown in domestic chicken's cells and inhibit ECSs differentiation into SSCs.

  11. Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Byrne, Susan M; Church, George M

    2015-01-01

    CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

  12. Postinduction represssion of the β-interferon gene is mediated through two positive regulatory domains

    International Nuclear Information System (INIS)

    Whittemore, L.A.; Maniatis, T.

    1990-01-01

    Virus induction of the human β-interferon (β-IFN) gene results in an increase in the rate of β-IFN mRNA synthesis, followed by a rapid postinduction decrease. In this paper, the authors show that two β-IFN promoter elements, positive regulatory domains I and II (PRDI and PRDII), which are required for virus induction of the β-IFN gene are also required for the postinduction turnoff. Although protein synthesis is not necessary for activation, it is necessary for repression of these promoter elements. Examination of nuclear extracts from cells infected with virus reveals the presence of virus-inducible, cycloheximide-sensitive, DNA-binding activities that interact specifically with PRDI or PRDII. They propose that the postinduction repression of β-IFN gene transcription involves virus inducible repressors that either bind directly to the positive regulatory elements of the β-IFN promoter or inactivate the positive regulatory factors bound to PRDI and PRDII

  13. Cholecystokinin-2 receptor mediated gene expression in neuronal PC12 cells

    DEFF Research Database (Denmark)

    Hansen, Thomas v O; Borup, Rehannah; Marstrand, Troels

    2007-01-01

    could be identified. Comparison with forskolin- and nerve growth factor (NGF)-treated PC12 cells showed that CCK induced a separate set of target genes. Taken together, we propose that neuronal CCK may have a role in the regulation of the circadian rhythm, the metabolism of cerebral cholesterol...... of neuronal CCK are incompletely understood. To identify genes regulated by neuronal CCK, we generated neuronal PC12 cells stably expressing the CCK-2 receptor (CCK-2R) and treated the cells with sulphated CCK-8 for 2-16 h, before the global expression profile was examined. The changes in gene expression...... peaked after 2 h, with 67 differentially expressed transcripts identified. A pathway analysis indicated that CCK was implicated in the regulation of the circadian clock system, the plasminogen system and cholesterol metabolism. But transcripts encoding proteins involved in dopamine signaling, ornithine...

  14. NGX6 gene mediated by promoter methylation as a potential molecular marker in colorectal cancer

    Directory of Open Access Journals (Sweden)

    Shen Shourong

    2010-04-01

    Full Text Available Abstract Background Nasopharyngeal carcinoma associated gene 6 (NGX6 is down-regulated in most colon cancer cell lines and tumor tissues when compared with their normal tissue samples. As a novel suppress tumor gene, it could inhibit colon cancer cell growth and cell cycle progression. However, little is known about the transcriptional mechanisms controlling NGX6 gene expression. Recent findings suggest that epigenetic inactivation of multiple tumor suppressor genes plays an important role in the tumorigenesis of colorectal carcinoma (CRC. In this study, we explored the role of DNA methylation in regulation of NGX6 transcription. Methods In the present study, we cloned the NGX6 promoter with characteristics of a CpG island by luciferase reporter assay. Then, the CpG methylation status around the NGX6 promoter region in colon cancer cell lines and colorectal tumor tissues was examined by methylation-specific PCR and bisulfite DNA sequencing. Finally, 5-Aza-2'-deoxycytidine (5-Aza-dC treatment was used to confirm the correlation between NGX6 promoter methylation and its gene inactivation. Results The sequence spanning positions -157 to +276 was identified as the NGX6 promoter, in which no canonical TATA boxes were found, while two CAAT boxes and GC boxes were discovered. Methylation status was observed more frequently in 40 colorectal cancer samples than in 40 adjacent normal mucosa samples (18/40 versus 7/40; P Conclusions Down-regulation of NGX6 gene is related to the promoter methylation. DNA methylation of NGX6 promoter might be a potential molecular marker for diagnosis or prognosis, or serve as a therapeutic target.

  15. Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans

    Science.gov (United States)

    Ow, Maria C.; Nichitean, Alexandra M.; Dorus, Steve; Hall, Sarah E.

    2018-01-01

    Environmental stress during early development in animals can have profound effects on adult phenotypes via programmed changes in gene expression. Using the nematode C. elegans, we demonstrated previously that adults retain a cellular memory of their developmental experience that is manifested by differences in gene expression and life history traits; however, the sophistication of this system in response to different environmental stresses, and how it dictates phenotypic plasticity in adults that contribute to increased fitness in response to distinct environmental challenges, was unknown. Using transcriptional profiling, we show here that C. elegans adults indeed retain distinct cellular memories of different environmental conditions. We identified approximately 500 genes in adults that entered dauer due to starvation that exhibit significant opposite (“seesaw”) transcriptional phenotypes compared to adults that entered dauer due to crowding, and are distinct from animals that bypassed dauer. Moreover, we show that two-thirds of the genes in the genome experience a 2-fold or greater seesaw trend in gene expression, and based upon the direction of change, are enriched in large, tightly linked regions on different chromosomes. Importantly, these transcriptional programs correspond to significant changes in brood size depending on the experienced stress. In addition, we demonstrate that while the observed seesaw gene expression changes occur in both somatic and germline tissue, only starvation-induced changes require a functional GLP-4 protein necessary for germline development, and both programs require the Argonaute CSR-1. Thus, our results suggest that signaling between the soma and the germ line can generate phenotypic plasticity as a result of early environmental experience, and likely contribute to increased fitness in adverse conditions and the evolution of the C. elegans genome. PMID:29447162

  16. Early experiences mediate distinct adult gene expression and reproductive programs in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Maria C Ow

    2018-02-01

    Full Text Available Environmental stress during early development in animals can have profound effects on adult phenotypes via programmed changes in gene expression. Using the nematode C. elegans, we demonstrated previously that adults retain a cellular memory of their developmental experience that is manifested by differences in gene expression and life history traits; however, the sophistication of this system in response to different environmental stresses, and how it dictates phenotypic plasticity in adults that contribute to increased fitness in response to distinct environmental challenges, was unknown. Using transcriptional profiling, we show here that C. elegans adults indeed retain distinct cellular memories of different environmental conditions. We identified approximately 500 genes in adults that entered dauer due to starvation that exhibit significant opposite ("seesaw" transcriptional phenotypes compared to adults that entered dauer due to crowding, and are distinct from animals that bypassed dauer. Moreover, we show that two-thirds of the genes in the genome experience a 2-fold or greater seesaw trend in gene expression, and based upon the direction of change, are enriched in large, tightly linked regions on different chromosomes. Importantly, these transcriptional programs correspond to significant changes in brood size depending on the experienced stress. In addition, we demonstrate that while the observed seesaw gene expression changes occur in both somatic and germline tissue, only starvation-induced changes require a functional GLP-4 protein necessary for germline development, and both programs require the Argonaute CSR-1. Thus, our results suggest that signaling between the soma and the germ line can generate phenotypic plasticity as a result of early environmental experience, and likely contribute to increased fitness in adverse conditions and the evolution of the C. elegans genome.

  17. Non-host Plant Resistance against Phytophthora capsici Is Mediated in Part by Members of the I2 R Gene Family in Nicotiana spp.

    Science.gov (United States)

    Vega-Arreguín, Julio C; Shimada-Beltrán, Harumi; Sevillano-Serrano, Jacobo; Moffett, Peter

    2017-01-01

    The identification of host genes associated with resistance to Phytophthora capsici is crucial to developing strategies of control against this oomycete pathogen. Since there are few sources of resistance to P. capsici in crop plants, non-host plants represent a promising source of resistance genes as well as excellent models to study P. capsici - plant interactions. We have previously shown that non-host resistance to P. capsici in Nicotiana spp. is mediated by the recognition of a specific P. capsici effector protein, PcAvr3a1 in a manner that suggests the involvement of a cognate disease resistance (R) genes. Here, we have used virus-induced gene silencing (VIGS) and transgenic tobacco plants expressing dsRNA in Nicotiana spp. to identify candidate R genes that mediate non-host resistance to P. capsici . Silencing of members of the I2 multigene family in the partially resistant plant N. edwardsonii and in the resistant N. tabacum resulted in compromised resistance to P. capsici . VIGS of two other components required for R gene-mediated resistance, EDS1 and SGT1 , also enhanced susceptibility to P. capsici in N. edwardsonii , as well as in the susceptible plants N. benthamiana and N. clevelandii . The silencing of I2 family members in N. tabacum also compromised the recognition of PcAvr3a1. These results indicate that in this case, non-host resistance is mediated by the same components normally associated with race-specific resistance.

  18. HvCKX2 gene silencing by biolistic or Agrobacterium-mediated transformation in barley leads to different phenotypes.

    Science.gov (United States)

    Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna

    2012-11-07

    CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively

  19. Imaging of human sodium-iodide symporter gene expression mediated by recombinant adenovirus in skeletal muscle of living rats

    International Nuclear Information System (INIS)

    Yang, Hyun Suk; Park, Seong-Wook; Lee, Heuiran; Kim, Sung Jin; Lee, Won Woo; Yang, You-Jung; Moon, Dae Hyuk

    2004-01-01

    We evaluated the feasibility of non-invasive imaging of recombinant adenovirus-mediated human sodium-iodide symporter (hNIS) gene expression by 99m TcO 4 - scintigraphy in skeletal muscle of rats. Replication-defective recombinant adenovirus encoding hNIS gene [Rad-CMV-hNIS 5 x 10 7 , 2 x 10 8 or 1 x 10 9 plaque forming units (pfu)] or β-galactosidase gene (Rad-CMV-LacZ 1 x 10 9 pfu) was injected into the right biceps femoris muscle of rats (n=5-6 for each group). Three days after gene transfer, scintigraphy was performed using a gamma camera 30 min after injection of 99m TcO 4 - (1.85 MBq). An additional two rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS underwent 99m TcO 4 - scintigraphy with sodium perchlorate. After the imaging studies, rats were sacrificed for assessment of the biodistribution of 99m TcO 4 - and measurement of hNIS mRNA expression. In all the rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS, hNIS expression was successfully imaged by 99m TcO 4 - scintigraphy, while rats injected with Rad-CMV-LacZ or lower doses of Rad-CMV-hNIS failed to show uptake. The biodistribution studies indicated that a significantly different amount of 99m TcO 4 - was retained in the liver (p 9 pfu of Rad-CMV-hNIS. The muscular hNIS mRNA level quantified by real-time reverse transcription-polymerase chain reaction was significantly higher in rats injected with 1 x 10 9 pfu of Rad-CMV-hNIS (p 9 pfu of Rad-CMV-hNIS were specifically inhibited by sodium perchlorate. This study illustrated that 99m TcO 4 - scintigraphy can monitor Rad-CMV-hNIS-mediated gene expression in skeletal muscle of rats, non-invasively and quantitatively. (orig.)

  20. Imaging of human sodium-iodide symporter gene expression mediated by recombinant adenovirus in skeletal muscle of living rats

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Hyun Suk; Park, Seong-Wook [Department of Internal Medicine (Cardiology), Asan Medical Center, University of Ulsan College of Medicine, 388-1 Pungnap-dong, Songpa-gu, 138-736, Seoul (Korea); Lee, Heuiran; Kim, Sung Jin [Department of Microbiology, University of Ulsan College of Medicine, Seoul (Korea); Lee, Won Woo [Department of Nuclear Medicine, Seoul National University Bundang Hospital, Seongnam (Korea); Department of Nuclear Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea); Yang, You-Jung; Moon, Dae Hyuk [Department of Nuclear Medicine, Asan Medical Center, University of Ulsan College of Medicine, Seoul (Korea)

    2004-09-01

    We evaluated the feasibility of non-invasive imaging of recombinant adenovirus-mediated human sodium-iodide symporter (hNIS) gene expression by {sup 99m}TcO{sub 4}{sup -} scintigraphy in skeletal muscle of rats. Replication-defective recombinant adenovirus encoding hNIS gene [Rad-CMV-hNIS 5 x 10{sup 7}, 2 x 10{sup 8} or 1 x 10{sup 9} plaque forming units (pfu)] or {beta}-galactosidase gene (Rad-CMV-LacZ 1 x 10{sup 9} pfu) was injected into the right biceps femoris muscle of rats (n=5-6 for each group). Three days after gene transfer, scintigraphy was performed using a gamma camera 30 min after injection of {sup 99m}TcO{sub 4}{sup -} (1.85 MBq). An additional two rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS underwent {sup 99m}TcO{sub 4}{sup -} scintigraphy with sodium perchlorate. After the imaging studies, rats were sacrificed for assessment of the biodistribution of {sup 99m}TcO{sub 4}{sup -} and measurement of hNIS mRNA expression. In all the rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS, hNIS expression was successfully imaged by {sup 99m}TcO{sub 4}{sup -} scintigraphy, while rats injected with Rad-CMV-LacZ or lower doses of Rad-CMV-hNIS failed to show uptake. The biodistribution studies indicated that a significantly different amount of {sup 99m}TcO{sub 4}{sup -} was retained in the liver (p<0.001) and the right muscle (p<0.05), with the highest uptake in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS. The muscular hNIS mRNA level quantified by real-time reverse transcription-polymerase chain reaction was significantly higher in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS (p<0.05), with a positive correlation with the imaging counts (r=0.810, p<0.05) and the biodistribution (r=0.847, p<0.001). Hot spots in rats injected with 1 x 10{sup 9} pfu of Rad-CMV-hNIS were specifically inhibited by sodium perchlorate. This study illustrated that {sup 99m}TcO{sub 4}{sup -} scintigraphy can monitor Rad-CMV-hNIS-mediated gene expression in

  1. Estrogen regulation of chicken riboflavin carrier protein gene is mediated by ERE half sites without direct binding of estrogen receptor.

    Science.gov (United States)

    Bahadur, Urvashi; Ganjam, Goutham K; Vasudevan, Nandini; Kondaiah, Paturu

    2005-02-28

    Estrogen is an important steroid hormone that mediates most of its effects on regulation of gene expression by binding to intracellular receptors. The consensus estrogen response element (ERE) is a 13bp palindromic inverted repeat with a three nucleotide spacer. However, several reports suggest that many estrogen target genes are regulated by diverse elements, such as imperfect EREs and ERE half sites (ERE 1/2), which are either the proximal or the distal half of the palindrome. To gain more insight into ERE half site-mediated gene regulation, we used a region from the estrogen-regulated chicken riboflavin carrier protein (RCP) gene promoter that contains ERE half sites. Using moxestrol, an analogue of estrogen and transient transfection of deletion and mutation containing RCP promoter/reporter constructs in chicken hepatoma (LMH2A) cells, we identified an estrogen response unit (ERU) composed of two consensus ERE 1/2 sites and one non-consensus ERE 1/2 site. Mutation of any of these sites within this ERU abolishes moxestrol response. Further, the ERU is able to confer moxestrol responsiveness to a heterologous promoter. Interestingly, RCP promoter is regulated by moxestrol in estrogen responsive human MCF-7 cells, but not in other cell lines such as NIH3T3 and HepG2 despite estrogen receptor-alpha (ER-alpha) co transfection. Electrophoretic mobility shift assays (EMSAs) with promoter regions encompassing the half sites and nuclear extracts from LMH2A cells show the presence of a moxestrol-induced complex that is abolished by a polyclonal anti-ERalpha antibody. Surprisingly, estrogen receptor cannot bind to these promoter elements in isolation. Thus, there appears to be a definite requirement for some other factor(s) in addition to estrogen receptor, for the generation of a suitable response of this promoter to estrogen. Our studies therefore suggest a novel mechanism of gene regulation by estrogen, involving ERE half sites without direct binding of ER to the

  2. Radiation and desiccation response motif mediates radiation induced gene expression in D. radiodurans

    International Nuclear Information System (INIS)

    Anaganti, Narasimha; Basu, Bhakti; Apte, Shree Kumar

    2015-01-01

    Deinococcus radiodurans is an extremophile that withstands lethal doses of several DNA damaging agents such as gamma irradiation, UV rays, desiccation and chemical mutagens. The organism responds to DNA damage by inducing expression of several DNA repair genes. At least 25 radiation inducible gene promoters harbour a 17 bp palindromic sequence known as radiation and desiccation response motif (RDRM) implicated in gamma radiation inducible gene expression. However, mechanistic details of gamma radiation-responsive up-regulation in gene expression remain enigmatic. The promoters of highly radiation induced genes ddrB (DR0070), gyrB (DR0906), gyrA (DR1913), a hypothetical gene (DR1143) and recA (DR2338) from D. radiodurans were cloned in a green fluorescence protein (GFP)-based promoter probe shuttle vector pKG and their promoter activity was assessed in both E. coli as well as in D. radiodurans. The gyrA, gyrB and DR1143 gene promoters were active in E. coli although ddrB and recA promoters showed very weak activity. In D. radiodurans, all the five promoters were induced several fold following 6 kGy gamma irradiation. Highest induction was observed for ddrB promoter (25 fold), followed by DR1143 promoter (15 fold). The induction in the activity of gyrB, gyrA and recA promoters was 5, 3 and 2 fold, respectively. To assess the role of RDRM, the 17 bp palindromic sequence was deleted from these promoters. The promoters devoid of RDRM sequence displayed increase in the basal expression activity, but the radiation-responsive induction in promoter activity was completely lost. The substitution of two conserved bases of RDRM sequence yielded decreased radiation induction of PDR0070 promoter. Deletion of 5 bases from 5'-end of PDR0070 RDRM increased basal promoter activity, but radiation induction was completely abolished. Replacement of RDRM with non specific sequence of PDR0070 resulted in loss of basal expression and radiation induction. The results demonstrate that

  3. Gene expression and stress response mediated by the epigenetic regulation of a transposable element small RNA.

    Directory of Open Access Journals (Sweden)

    Andrea D McCue

    2012-02-01

    Full Text Available The epigenetic activity of transposable elements (TEs can influence the regulation of genes; though, this regulation is confined to the genes, promoters, and enhancers that neighbor the TE. This local cis regulation of genes therefore limits the influence of the TE's epigenetic regulation on the genome. TE activity is suppressed by small RNAs, which also inhibit viruses and regulate the expression of genes. The production of TE heterochromatin-associated endogenous small interfering RNAs (siRNAs in the reference plant Arabidopsis thaliana is mechanistically distinct from gene-regulating small RNAs, such as microRNAs or trans-acting siRNAs (tasiRNAs. Previous research identified a TE small RNA that potentially regulates the UBP1b mRNA, which encodes an RNA-binding protein involved in stress granule formation. We demonstrate that this siRNA, siRNA854, is under the same trans-generational epigenetic control as the Athila family LTR retrotransposons from which it is produced. The epigenetic activation of Athila elements results in a shift in small RNA processing pathways, and new 21-22 nucleotide versions of Athila siRNAs are produced by protein components normally not responsible for processing TE siRNAs. This processing results in siRNA854's incorporation into ARGONAUTE1 protein complexes in a similar fashion to gene-regulating tasiRNAs. We have used reporter transgenes to demonstrate that the UPB1b 3' untranslated region directly responds to the epigenetic status of Athila TEs and the accumulation of siRNA854. The regulation of the UPB1b 3' untranslated region occurs both on the post-transcriptional and translational levels when Athila TEs are epigenetically activated, and this regulation results in the phenocopy of the ubp1b mutant stress-sensitive phenotype. This demonstrates that a TE's epigenetic activity can modulate the host organism's stress response. In addition, the ability of this TE siRNA to regulate a gene's expression in trans blurs

  4. Immunocytochemistry and fluorescence imaging efficiently identify individual neurons with CRISPR/Cas9-mediated gene disruption in primary cortical cultures.

    Science.gov (United States)

    Tsunematsu, Hiroto; Uyeda, Akiko; Yamamoto, Nobuhiko; Sugo, Noriyuki

    2017-08-01

    CRISPR/Cas9 system is a powerful method to investigate the role of genes by introducing a mutation selectively and efficiently to specific genome positions in cell and animal lines. However, in primary neuron cultures, this method is affected by the issue that the effectiveness of CRISPR/Cas9 is different in each neuron. Here, we report an easy, quick and reliable method to identify mutants induced by the CRISPR/Cas9 system at a single neuron level, using immunocytochemistry (ICC) and fluorescence imaging. Dissociated cortical cells were transfected with CRISPR/Cas9 plasmids targeting the transcription factor cAMP-response element binding protein (CREB). Fluorescence ICC with CREB antibody and quantitative analysis of fluorescence intensity demonstrated that CREB expression disappeared in a fraction of the transfected neurons. The downstream FOS expression was also decreased in accordance with suppressed CREB expression. Moreover, dendritic arborization was decreased in the transfected neurons which lacked CREB immunoreactivity. Detection of protein expression is efficient to identify individual postmitotic neurons with CRISPR/Cas9-mediated gene disruption in primary cortical cultures. The present method composed of CRISPR/Cas9 system, ICC and fluorescence imaging is applicable to study the function of various genes at a single-neuron level.

  5. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    Science.gov (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  6. Repeat-mediated epigenetic dysregulation of the FMR1 gene in the fragile X-related disorders.

    Science.gov (United States)

    Usdin, Karen; Kumari, Daman

    2015-01-01

    The fragile X-related disorders are members of the Repeat Expansion Diseases, a group of genetic conditions resulting from an expansion in the size of a tandem repeat tract at a specific genetic locus. The repeat responsible for disease pathology in the fragile X-related disorders is CGG/CCG and the repeat tract is located in the 5' UTR of the FMR1 gene, whose protein product FMRP, is important for the proper translation of dendritic mRNAs in response to synaptic activation. There are two different pathological FMR1 allele classes that are distinguished only by the number of repeats. Premutation alleles have 55-200 repeats and confer risk of fragile X-associated tremor/ataxia syndrome and fragile X-associated primary ovarian insufficiency. Full mutation alleles on the other hand have >200 repeats and result in fragile X syndrome, a disorder that affects learning and behavior. Different symptoms are seen in carriers of premutation and full mutation alleles because the repeat number has paradoxical effects on gene expression: Epigenetic changes increase transcription from premutation alleles and decrease transcription from full mutation alleles. This review will cover what is currently known about the mechanisms responsible for these changes in FMR1 expression and how they may relate to other Repeat Expansion Diseases that also show repeat-mediated changes in gene expression.

  7. CRISPR/Cas9-Mediated Correction of the FANCD1 Gene in Primary Patient Cells

    Directory of Open Access Journals (Sweden)

    Karolina Skvarova Kramarzova

    2017-06-01

    Full Text Available Fanconi anemia (FA is an inherited condition characterized by impaired DNA repair, physical anomalies, bone marrow failure, and increased incidence of malignancy. Gene editing holds great potential to precisely correct the underlying genetic cause such that gene expression remains under the endogenous control mechanisms. This has been accomplished to date only in transformed cells or their reprogrammed induced pluripotent stem cell counterparts; however, it has not yet been reported in primary patient cells. Here we show the ability to correct a mutation in Fanconi anemia D1 (FANCD1 primary patient fibroblasts. The clustered regularly interspaced short palindromic repeats (CRISPR/Cas9 system was employed to target and correct a FANCD1 gene deletion. Homologous recombination using an oligonucleotide donor was achieved and a pure population of modified cells was obtained by using inhibitors of poly adenosine diphosphate-ribose polymerase (poly ADP-ribose polymerase. FANCD1 function was restored and we did not observe any promiscuous cutting of the CRISPR/Cas9 at off target sites. This consideration is crucial in the context of the pre-malignant FA phenotype. Altogether we show the ability to correct a patient mutation in primary FANCD1 cells in a precise manner. These proof of principle studies support expanded application of gene editing for FA.

  8. Remodeling of cortical bone allografts mediated by adherent rAAV-RANKL and VEGF gene therapy

    DEFF Research Database (Denmark)

    Ito, H; Koefoed, M; Tiyapatanaputi, P

    2005-01-01

    Structural allograft healing is limited because of a lack of vascularization and remodeling. To study this we developed a mouse model that recapitulates the clinical aspects of live autograft and processed allograft healing. Gene expression analyses showed that there is a substantial decrease in ...

  9. Infectivity enhanced adenoviral-mediated mda-7/IL-24 gene therapy for ovarian carcinoma

    NARCIS (Netherlands)

    Leath, CA; Kataram, M; Bhagavatula, P; Gopalkrishnan, RV; Dent, P; Fisher, PB; Pereboev, A; Carey, D; Lebedeva, [No Value; Haisma, HJ; Alvarez, RD; Curiel, DT; Mahasreshti, PJ

    Objective. Melanoma differentiation associated gene-7 [mda-7/interleukin (IL)-24] has been identified as a novel anti-cancer agent, which specifically induces apoptosis in cancer cells but not in normal epithelial, endothelial and fibroblast cells. The objective of this study was to evaluate the

  10. CRISPR-cas-mediated phage resistance enhances horizontal gene transfer by transduction

    NARCIS (Netherlands)

    Watson, Bridget N.J.; Staals, Raymond H.J.; Fineran, Peter C.

    2018-01-01

    A powerful contributor to prokaryotic evolution is horizontal gene transfer (HGT) through transformation, conjugation, and transduction, which can be advantageous, neutral, or detrimental to fitness. Bacteria and archaea control HGT and phage infection through CRISPR-Cas (clustered regularly

  11. Improvement of oxytetracycline production mediated via cooperation of resistance genes in Streptomyces rimosus.

    Science.gov (United States)

    Yin, Shouliang; Wang, Xuefeng; Shi, Mingxin; Yuan, Fang; Wang, Huizhuan; Jia, Xiaole; Yuan, Fang; Sun, Jinliang; Liu, Tiejun; Yang, Keqian; Zhang, Yuxiu; Fan, Keqiang; Li, Zilong

    2017-09-01

    Increasing the self-resistance levels of Streptomyces is an effective strategy to improve the production of antibiotics. To increase the oxytetracycline (OTC) production in Streptomyces rimosus, we investigated the cooperative effect of three co-overexpressing OTC resistance genes: one gene encodes a ribosomal protection protein (otrA) and the other two express efflux proteins (otrB and otrC). Results indicated that combinational overexpression of otrA, otrB, and otrC (MKABC) exerted a synergetic effect. OTC production increased by 179% in the recombinant strain compared with that of the wild-type strain M4018. The resistance level to OTC was increased by approximately two-fold relative to the parental strain, thereby indicating that applying the cooperative effect of self-resistance genes is useful to improve OTC production. Furthermore, the previously identified cluster-situated activator OtcR was overexpressed in MKABC in constructing the recombinant strain MKRABC; such strain can produce OTC of approximately 7.49 g L -1 , which represents an increase of 19% in comparison with that of the OtcR-overexpressing strain alone. Our work showed that the cooperative overexpression of self-resistance genes is a promising strategy to enhance the antibiotics production in Streptomyces.

  12. Circadian rhythm genes mediate fenvalerate-induced inhibition of testosterone synthesis in mouse Leydig cells.

    Science.gov (United States)

    Guo, Yichen; Shen, Ouxi; Han, Jingjing; Duan, Hongyu; Yang, Siyuan; Zhu, Zhenghong; Tong, Jian; Zhang, Jie

    2017-01-01

    Fenvalerate (Fen), a widely used pesticide, is known to impair male reproductive functions by mechanisms that remain to be elucidated. Recent studies indicated that circadian clock genes may play an important role in successful male reproduction. The aim of this study was to determine the effects of Fen on circadian clock genes involved in the biosynthesis of testosterone using TM3 cells derived from mouse Leydig cells. Data demonstrated that the circadian rhythm of testosterone synthesis in TM3 cells was disturbed following Fen treatment as evidenced by changes in the circadian rhythmicity of core clock genes (Bmal1, Rev-erbα, Rorα). Further, the observed altered rhythms were accompanied by increased intracellular Ca 2+ levels and modified steroidogenic acute regulatory (StAR) mRNA expression. Thus, data suggested that Fen inhibits testosterone synthesis via pathways involving intracellular Ca 2+ and clock genes (Bmal1, Rev-Erbα, Rorα) as well as StAR mRNA expression in TM3 cells.

  13. Identification of a novel streptococcal gene cassette mediating SOS mutagenesis in Streptococcus uberis

    NARCIS (Netherlands)

    Varhimo, Emilia; Savijoki, Kirsi; Jalava, Jari; Kuipers, Oscar P.; Varmanen, Pekka

    Streptococci have been considered to lack the classical SOS response, defined by increased mutation after UV exposure and regulation by LexA. Here we report the identification of a potential self-regulated SOS mutagenesis gene cassette in the Streptococcaceae family. Exposure to UV light was found

  14. Learning Motivation Mediates Gene-by-Socioeconomic Status Interaction on Mathematics Achievement in Early Childhood

    Science.gov (United States)

    Tucker-Drob, Elliot M.; Harden, K. Paige

    2012-01-01

    There is accumulating evidence that genetic influences on achievement are more pronounced among children living in higher socioeconomic status homes, and that these gene-by-environment interactions occur prior to children's entry into formal schooling. We hypothesized that one pathway through which socioeconomic status promotes genetic influences…

  15. Pseudomonas sax genes overcome aliphatic isothiocyanate-mediated non-host resistance in Arabidopsis

    Science.gov (United States)

    Jun Fan; Casey Crooks; Gary Creissen; Lionel Hill; Shirley Fairhurst; Peter Doerner; Chris Lamb

    2011-01-01

    Most plant-microbe interactions do not result in disease; natural products restrict non-host pathogens. We found that sulforaphane (4-methylsulfinylbutyl isothiocyanate), a natural product derived from aliphatic glucosinolates, inhibits growth in Arabidopsis of non-host Pseudomonas bacteria in planta. Multiple sax genes (saxCAB/F/D/G) were identified in Pseudomonas...

  16. Construction and expression of secreting type human TRAIL gene vector mediated by hypoxia/radiation double sensitive promoter

    International Nuclear Information System (INIS)

    Yang Yanming; Jia Xiaojing; Qu Yaqin; Li Yanbo

    2009-01-01

    Objective: To construct secreting type human TRAIL (shTRAIL) gene vector pcDNA3.1-HRE/Egr1-shTRAIL mediated by hypoxia/radiation double sensitive promoter, and observe the effect of hypoxia and radiation on shTRAIL. Methods: HRE upper and lower strands were gotten by chemical synthesis, double strands HRE was gotten by PCR; pMD19T-Egr1 was digested by Sac I and Hind III, then Egr1 was obtained, pshuttle-shTRAIL was digested by Kpn I and BamH I, then shTRAIL was obtained; HRE/Egr1 double sensitive promoter mediated shTRAIL expression vector pcDNA3.1-HRE/Egr1-shTRAIL was constructed by gene recombination technique, it was identified correctly by enzyme digestion, PCR and sequencing. A549 cells were divided into normal, hypoxia (0.1%), irradiation (6 Gy) and hypoxia + irradiation groups. Results: After enzyme digestion by BamH I and Sma I, the fragments which lengths were 1284 bp and 4 998 bp, 2 292 bp and 3 990 bp were obtained; the vector was amplified by PCR with Egr1 and shTRAIL primer, the products which lengthens were 469 bp and 820 bp were obtained; pcDNA3.1-HRE/Egr1-shTRAIL was sequenced, the result was same to designed, this demonstrated that the construction was right. The vectors were transfected into A549 cells of adenocarcinoma of lung, the expression levels of shTRAIL mRNA and protein were increased after treated with hypoxia and radiation, it had statistically significant differences compared with normal group (P<0.05), and when they were combinated, the effect was more obvious. Conclusion: Secreting type human TRAIL gene vector pcDNA3.1-HRE/Egr1-shTRAIL mediated by hypoxia/radiation double sensitive promoter is constructed successfully, and hypoxia and radiation could increase the expression of TRAIL, and they have synergetic effect. (authors)

  17. Role of resveratrol in FOXO1-mediated gluconeogenic gene expression in the liver

    Energy Technology Data Exchange (ETDEWEB)

    Park, Joo-Man; Kim, Tae-Hyun [Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Brain Korea 21 Project for Medical Sciences, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Bae, Jin-Sik; Kim, Mi-Young [Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Kim, Kyung-Sup [Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Brain Korea 21 Project for Medical Sciences, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); The Institute of Genetic Science, Yonsei University College of Medicine, 134 Shinchon-dong, Seodaemoon-gu, Seoul 120-752 (Korea, Republic of); Ahn, Yong-Ho, E-mail: yha111@yuhs.ac [Department of Biochemistry and Molecular Biology, Center for Chronic Metabolic Disease Research, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of); Brain Korea 21 Project for Medical Sciences, Yonsei University College of Medicine, Seoul 120-752 (Korea, Republic of)

    2010-12-17

    Research highlights: {yields} Insulin-suppression of PEPCK and G6Pase gene expression is counteracted by resveratrol. {yields} Resveratrol upregulates hepatic gluconeogenic genes by attenuating insulin signaling and deacetylating FOXO1, which are SIRT1-independent in the cytosol and SIRT1-dependent in the nucleus, respectively. {yields} Resveratrol increases the binding activity of Foxo1 to the IRE of PEPCK and G6Pase. -- Abstract: During a state of fasting, the blood glucose level is maintained by hepatic gluconeogenesis. SIRT1 is an important metabolic regulator during nutrient deprivation and the liver-specific knockdown of SIRT1 resulted in decreased glucose production. We hypothesize that SIRT1 is responsible for the upregulation of insulin-suppressed gluconeogenic genes through the deacetylation of FOXO1. Treatment of primary cultured hepatocytes with resveratrol increased insulin-repressed PEPCK and G6Pase mRNA levels, which depend on SIRT1 activity. We found that the resveratrol treatment resulted in a decrease in the phosphorylation of Akt and FOXO1, which are independent of SIRT1 action. Fluorescence microscopy revealed that resveratrol caused the nuclear localization of FOXO1. In the nucleus, FOXO1 is deacetylated by SIRT1, which might make it more accessible to the IRE of the PEPCK and G6Pase promoter, causing an increase in their gene expression. Our results indicate that resveratrol upregulates the expression of gluconeogenic genes by attenuating insulin signaling and by deacetylating FOXO1, which are SIRT1-independent in the cytosol and SIRT1-dependent in the nucleus, respectively.

  18. Role of resveratrol in FOXO1-mediated gluconeogenic gene expression in the liver

    International Nuclear Information System (INIS)

    Park, Joo-Man; Kim, Tae-Hyun; Bae, Jin-Sik; Kim, Mi-Young; Kim, Kyung-Sup; Ahn, Yong-Ho

    2010-01-01

    Research highlights: → Insulin-suppression of PEPCK and G6Pase gene expression is counteracted by resveratrol. → Resveratrol upregulates hepatic gluconeogenic genes by attenuating insulin signaling and deacetylating FOXO1, which are SIRT1-independent in the cytosol and SIRT1-dependent in the nucleus, respectively. → Resveratrol increases the binding activity of Foxo1 to the IRE of PEPCK and G6Pase. -- Abstract: During a state of fasting, the blood glucose level is maintained by hepatic gluconeogenesis. SIRT1 is an important metabolic regulator during nutrient deprivation and the liver-specific knockdown of SIRT1 resulted in decreased glucose production. We hypothesize that SIRT1 is responsible for the upregulation of insulin-suppressed gluconeogenic genes through the deacetylation of FOXO1. Treatment of primary cultured hepatocytes with resveratrol increased insulin-repressed PEPCK and G6Pase mRNA levels, which depend on SIRT1 activity. We found that the resveratrol treatment resulted in a decrease in the phosphorylation of Akt and FOXO1, which are independent of SIRT1 action. Fluorescence microscopy revealed that resveratrol caused the nuclear localization of FOXO1. In the nucleus, FOXO1 is deacetylated by SIRT1, which might make it more accessible to the IRE of the PEPCK and G6Pase promoter, causing an increase in their gene expression. Our results indicate that resveratrol upregulates the expression of gluconeogenic genes by attenuating insulin signaling and by deacetylating FOXO1, which are SIRT1-independent in the cytosol and SIRT1-dependent in the nucleus, respectively.

  19. RNAi-mediated Gene Silencing of Mutant Myotilin Improves Myopathy in LGMD1A Mice

    Directory of Open Access Journals (Sweden)

    Jian Liu

    2014-01-01

    Full Text Available Recent progress suggests gene therapy may one day be an option for treating some forms of limb girdle muscular dystrophy (LGMD. Nevertheless, approaches targeting LGMD have so far focused on gene replacement strategies for recessive forms of the disease. In contrast, no attempts have been made to develop molecular therapies for any of the eight dominantly inherited forms of LGMD. Importantly, the emergence of RNA interference (RNAi therapeutics in the last decade provided new tools to combat dominantly inherited LGMDs with molecular therapy. In this study, we describe the first RNAi-based, preclinical gene therapy approach for silencing a gene associated with dominant LGMD. To do this, we developed adeno-associated viral vectors (AAV6 carrying designed therapeutic microRNAs targeting mutant myotilin (MYOT, which is the underlying cause of LGMD type 1A (LGMD1A. Our best MYOT-targeted microRNA vector (called miMYOT significantly reduced mutant myotilin mRNA and soluble protein expression in muscles of LGMD1A mice (the TgT57I model both 3 and 9 months after delivery, demonstrating short- and long-term silencing effects. This MYOT gene silencing subsequently decreased deposition of MYOT-seeded intramuscular protein aggregates, which is the hallmark feature of LGMD1A. Histological improvements were accompanied by significant functional correction, as miMYOT-treated animals showed increased muscle weight and improved specific force in the gastrocnemius, which is one of the most severely affected muscles in TgT57I mice and patients with dominant myotilin mutations. These promising results in a preclinical model of LGMD1A support the further development of RNAi-based molecular therapy as a prospective treatment for LGMD1A. Furthermore, this study sets a foundation that may be refined and adapted to treat other dominant LGMD and related disorders.

  20. The Polycomb group proteins bind throughout the INK4A-ARF locus and are disassociated in senescent cells

    DEFF Research Database (Denmark)

    Bracken, Adrian P; Kleine-Kohlbrecher, Daniela; Dietrich, Nikolaj

    2007-01-01

    The p16INK4A and p14ARF proteins, encoded by the INK4A-ARF locus, are key regulators of cellular senescence, yet the mechanisms triggering their up-regulation are not well understood. Here, we show that the ability of the oncogene BMI1 to repress the INK4A-ARF locus requires its direct association...... and is dependent on the continued presence of the EZH2-containing Polycomb-Repressive Complex 2 (PRC2) complex. Significantly, EZH2 is down-regulated in stressed and senescing populations of cells, coinciding with decreased levels of associated H3K27me3, displacement of BMI1, and activation of transcription...

  1. Real-time impedimetric monitoring of Poly(ethylenimine)s-mediated cytotoxicity during gene transfection

    DEFF Research Database (Denmark)

    Caviglia, Claudia; Carminati, Marco; Heiskanen, Arto

    Poly(ethylenimine)s (PEIs) are able to condense DNA and RNA into stable toroidal and globular nanostructures (polyplexes) and are among the most efficient and promising synthetic transfectants, but they induce severe cytotoxicity. The mechanisms of PEI-mediated cytotoxicity have not been fully...... delineated but PEI toxicity appears to predominantly depend on membrane perturbing effects in cellular compartments in which they accumulate. Electrochemical Impedance Spectroscopy (EIS) is used as a non-invasive biophysical approach for the investigation of the electrical properties of biological materials...