WorldWideScience

Sample records for policy primer descriptive

  1. A Primer on Macroprudential Policy

    Science.gov (United States)

    Poutineau, Jean-Christophe; Vermandel, Gauthier

    2015-01-01

    This article introduces macroprudential policy using a static New Keynesian Macroeconomics model with financial frictions. The authors analyze two related questions: First, they show how the procyclicality of financial factors, captured by the financial accelerator, amplifies the transmission of supply and demand shocks and impacts the intuition…

  2. Vaccine supply, demand, and policy: a primer.

    Science.gov (United States)

    Muzumdar, Jagannath M; Cline, Richard R

    2009-01-01

    To provide an overview of supply and demand issues in the vaccine industry and the policy options that have been implemented to resolve these issues. Medline, Policy File, and International Pharmaceutical Abstracts were searched to locate academic journal articles. Other sources reviewed included texts on the topics of vaccine history and policy, government agency reports, and reports from independent think tanks. Keywords included vaccines, immunizations, supply, demand, and policy. Search criteria were limited to English language and human studies. Articles pertaining to vaccine demand, supply, and public policy were selected and reviewed for inclusion. By the authors. Vaccines are biologic medications, therefore making their development and production more difficult and costly compared with "small-molecule" drugs. Research and development costs for vaccines can exceed $800 million, and development may require 10 years or more. Strict manufacturing regulations and facility upgrades add to these costs. Policy options to increase and stabilize the supply of vaccines include those aimed at increasing supply, such as government subsidies for basic vaccine research, liability protection for manufacturers, and fast-track approval for new vaccines. Options to increase vaccine demand include advance purchase commitments, government stockpiles, and government financing for select populations. High development costs and multiple barriers to entry have led to a decline in the number of vaccine manufacturers. Although a number of vaccine policies have met with mixed success in increasing the supply of and demand for vaccines, a variety of concerns remain, including developing vaccines for complex pathogens and increasing immunization rates with available vaccines. New policy innovations such as advance market commitments and Medicare Part D vaccine coverage have been implemented and may aid in resolving some of the problems in the vaccine industry.

  3. Policy and System Approach (PSA: A primer

    Directory of Open Access Journals (Sweden)

    Chandrakant Lahariya

    2017-01-01

    Full Text Available A number of public health challenges have emerged at global and national level in the last two decades. The response to these challenges has rarely been swift and often “knee-jerk.” The national and state level program officials responsible for the activities often apportion the blame on weak health systems or fragmented health service delivery mechanisms, amongst other. In India, the viral illnesses (including those due to dengue and chikungunya are becoming the increasing realities. The Public health response of early identification, disease surveillance, reporting and the preventive and curative measures, remains suboptimal. The health challenges which require multidimensional interventions are usuallyattempted to be resolved through piece meal solutions. This article proposes “policy and system approach (PSA,” combining concepts of “Health in all policies” for intersectoral coordination and “health system approach” for intra-sectoral tackling of the emerging and existing health challenges.

  4. All creatures great and minute: a public policy primer for companion animal zoonoses.

    Science.gov (United States)

    Reaser, J K; Clark, E E; Meyers, N M

    2008-10-01

    Approximately 63% of US households have at least one pet, a large percentage of which are considered family members. Pet owners can derive substantial physical and psychological benefits from interaction with companion animals. However, pet ownership is not without risks; zoonotic diseases are increasingly drawing the attention of healthcare professionals, policy makers and the general public. While zoonoses of 'traditional' pets are widely recognized and their prevention and treatment factors are generally known, the growing popularity of 'non-traditional' pets has the potential to facilitate human exposure to novel zoonoses. However, the greatest risk of zoonoses probably arises from animals taken directly from the wild to serve as pets. Non-governmental organizations, state veterinary associations and others have been calling for increased regulation of animal imports, some proposing that all 'exotics' be banned from the pet trade. Because zoonotic diseases of companion animals are influenced by interacting factors of ecological, technical, socio-economic, and political origin, efforts to minimize their impact need be multi-dimensional, simultaneously addressing both the ecological and socio-political drivers of disease emergence and transmission. This study is intended to serve as a primer for animal care professionals seeking to engage with policy makers and the pet industry on the prevention of companion animal zoonoses. We provide background on the human-animal bond, risks of zoonoses associated with groups of companion animals, and the public policy context, as well as identify the factors needed to build a comprehensive approach to companion animal zoonoses risk management. Also included are examples of innovative, non-regulatory initiatives designed to limit the spread and impact of companion animal zoonoses, including a reptile salmonella poster, the National Reptile Improvement Plan, Habitattitude campaign, Pet Zoonoses Committee, and a wildlife disease

  5. THE SHEFFIELD ALCOHOL POLICY MODEL - A MATHEMATICAL DESCRIPTION.

    Science.gov (United States)

    Brennan, Alan; Meier, Petra; Purshouse, Robin; Rafia, Rachid; Meng, Yang; Hill-Macmanus, Daniel; Angus, Colin; Holmes, John

    2014-09-30

    This methodology paper sets out a mathematical description of the Sheffield Alcohol Policy Model version 2.0, a model to evaluate public health strategies for alcohol harm reduction in the UK. Policies that can be appraised include a minimum price per unit of alcohol, restrictions on price discounting, and broader public health measures. The model estimates the impact on consumers, health services, crime, employers, retailers and government tax revenues. The synthesis of public and commercial data sources to inform the model structure is described. A detailed algebraic description of the model is provided. This involves quantifying baseline levels of alcohol purchasing and consumption by age and gender subgroups, estimating the impact of policies on consumption, for example, using evidence on price elasticities of demand for alcohol, quantification of risk functions relating alcohol consumption to harms including 47 health conditions, crimes, absenteeism and unemployment, and finally monetary valuation of the consequences. The results framework, shown for a minimum price per unit of alcohol, has been used to provide policy appraisals for the UK government policy-makers. In discussion and online appendix, we explore issues around valuation and scope, limitations of evidence/data, how the framework can be adapted to other countries and decisions, and ongoing plans for further development. © 2014 The Authors. Health Economics published by John Wiley & Sons Ltd. © 2014 The Authors. Health Economics published by John Wiley & Sons Ltd.

  6. Analytical methodology and facility description spent fuel policy

    International Nuclear Information System (INIS)

    1978-08-01

    Three generic environmental impact statements (GEISs) on domestic fuels, foreign fuels, and storage charges are being prepared to provide environmental input into decisions on whether, and if so how the 1977 Presidential policy on spent fuel storage should be implmented. This report provides background information for two of these environmental impact statements: Storage of U.S. Spent Power Reactor Fuel and Storage of Foreign Spent Power Reactor Fuel. It includes the analytical methodology used in GEISs to assess the environmental effects and a description of the facilities used in the two GEISs

  7. Analytical methodology and facility description spent fuel policy

    Energy Technology Data Exchange (ETDEWEB)

    1978-08-01

    Three generic environmental impact statements (GEISs) on domestic fuels, foreign fuels, and storage charges are being prepared to provide environmental input into decisions on whether, and if so how the 1977 Presidential policy on spent fuel storage should be implmented. This report provides background information for two of these environmental impact statements: Storage of U.S. Spent Power Reactor Fuel and Storage of Foreign Spent Power Reactor Fuel. It includes the analytical methodology used in GEISs to assess the environmental effects and a description of the facilities used in the two GEISs.

  8. A Descriptive Study of Music Teacher Educators' Beliefs about Policy

    Science.gov (United States)

    Aguilar, Carla E.; Richerme, Lauren Kapalka

    2016-01-01

    While policies at all levels affect music educators, and music education researchers have called for increased attention to policy issues, few have explored preservice music teacher educators' beliefs about policy. This study examined music teacher educators' (N = 81) familiarity with and attitudes toward contemporary education and music education…

  9. A descriptive analysis of state legislation and policy addressing clinical trials participation.

    Science.gov (United States)

    Baquet, Claudia R; Mishra, Shiraz I; Weinberg, Armin D

    2009-05-01

    This report describes state policy and legislation related to clinical trials participation and Maryland's model to enhance clinical trial availability and participation. Descriptive review of state policy and legislation related to coverage for clinical trials costs based on data from the National Cancer Institute (NCI) State Cancer Legislative Database, the American Cancer Society, and NCI; additionally, discussion of Maryland's comprehensive multilevel clinical trial model comprising policy initiatives, community engagement, research, education, and infrastructure support. Twenty-four states have mandated clinical trial coverage through specific legislation or agreements since 1994. Covered benefits varied among the states. Besides cost and insurance barriers, there is a need to address important patient, physician and researcher, and structural barriers to clinical trial participation. Maryland provides a comprehensive model to address the multi-faceted clinical trial participation determinants as it tracks state and federal policy, documents trial barriers, and conducts community education.

  10. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  11. Salinas primer.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  12. Telecommunications Primer

    OpenAIRE

    Joseph Becker

    2013-01-01

    A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  13. Telecommunications Primer

    Directory of Open Access Journals (Sweden)

    Joseph Becker

    2013-05-01

    Full Text Available A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  14. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  15. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  16. IALS and Essential Skills in Canadian Literacy Policy and Practice: A Descriptive Overview

    Science.gov (United States)

    Centre for Literacy, 2013

    2013-01-01

    This paper gathers descriptions on the use of the International Adult Literacy Survey (IALS) and essential skills cross Canada. IALS was developed as a population measure to lay out the distribution of skills and their relationship to other social and economic attributes. The information was taken from federal, provincial, and territorial…

  17. Privacy Policies for Apps Targeted Toward Youth: Descriptive Analysis of Readability.

    Science.gov (United States)

    Das, Gitanjali; Cheung, Cynthia; Nebeker, Camille; Bietz, Matthew; Bloss, Cinnamon

    2018-01-04

    Due to the growing availability of consumer information, the protection of personal data is of increasing concern. We assessed readability metrics of privacy policies for apps that are either available to or targeted toward youth to inform strategies to educate and protect youth from unintentional sharing of personal data. We reviewed the 1200 highest ranked apps from the Apple and Google Play Stores and systematically selected apps geared toward youth. After applying exclusion criteria, 99 highly ranked apps geared toward minors remained, 64 of which had a privacy policy. We obtained and analyzed these privacy policies using reading grade level (RGL) as a metric. Policies were further compared as a function of app category (free vs paid; entertainment vs social networking vs utility). Analysis of privacy policies for these 64 apps revealed an average RGL of 12.78, which is well above the average reading level (8.0) of adults in the United States. There was also a small but statistically significant difference in word count as a function of app category (entertainment: 2546 words, social networking: 3493 words, and utility: 1038 words; P=.02). Although users must agree to privacy policies to access digital tools and products, readability analyses suggest that these agreements are not comprehensible to most adults, let alone youth. We propose that stakeholders, including pediatricians and other health care professionals, play a role in educating youth and their guardians about the use of Web-based services and potential privacy risks, including the unintentional sharing of personal data. ©Gitanjali Das, Cynthia Cheung, Camille Nebeker, Matthew Bietz, Cinnamon Bloss. Originally published in JMIR Mhealth and Uhealth (http://mhealth.jmir.org), 04.01.2018.

  18. Privacy Policies for Apps Targeted Toward Youth: Descriptive Analysis of Readability

    Science.gov (United States)

    Das, Gitanjali; Cheung, Cynthia; Nebeker, Camille; Bietz, Matthew

    2018-01-01

    Background Due to the growing availability of consumer information, the protection of personal data is of increasing concern. Objective We assessed readability metrics of privacy policies for apps that are either available to or targeted toward youth to inform strategies to educate and protect youth from unintentional sharing of personal data. Methods We reviewed the 1200 highest ranked apps from the Apple and Google Play Stores and systematically selected apps geared toward youth. After applying exclusion criteria, 99 highly ranked apps geared toward minors remained, 64 of which had a privacy policy. We obtained and analyzed these privacy policies using reading grade level (RGL) as a metric. Policies were further compared as a function of app category (free vs paid; entertainment vs social networking vs utility). Results Analysis of privacy policies for these 64 apps revealed an average RGL of 12.78, which is well above the average reading level (8.0) of adults in the United States. There was also a small but statistically significant difference in word count as a function of app category (entertainment: 2546 words, social networking: 3493 words, and utility: 1038 words; P=.02). Conclusions Although users must agree to privacy policies to access digital tools and products, readability analyses suggest that these agreements are not comprehensible to most adults, let alone youth. We propose that stakeholders, including pediatricians and other health care professionals, play a role in educating youth and their guardians about the use of Web-based services and potential privacy risks, including the unintentional sharing of personal data. PMID:29301737

  19. A Descriptive Analysis of Louisiana Public School Districts' Anti-Bullying Policies

    Science.gov (United States)

    Vaughn, Brandy Elise Robinson

    2013-01-01

    The researcher proposed to determine the expansiveness of Louisiana's public school districts' anti-bullying policies. Specifically, student codes of conduct and board polices were analyzed to determine the extent to which schools define, outline reporting procedures, keep written records of, investigate, and render disciplinary sanctions against…

  20. Corporal Punishment in the State of Louisiana: A Descriptive Study of Policies and Practices

    Science.gov (United States)

    Broussard, Mary R.

    2014-01-01

    Louisiana is currently one of the 19 states in the United States that still allow the use of corporal punishment in public schools. The research questions that drove this study explored Louisiana-published court cases involving corporal punishment in public schools, district policies regarding the use of corporal punishment, reported instances of…

  1. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  2. Compliance with smoke-free policies in korean bars and restaurants in california: a descriptive analysis.

    Science.gov (United States)

    Irvin, Veronica L; Hofstetter, C Richard; Nichols, Jeanne F; Chambers, Christina D; Usita, Paula M; Norman, Gregory J; Kang, Sunny; Hovell, Melbourne F

    2015-01-01

    Compliance with California's smoke-free restaurant and bar policies may be more a function of social contingencies and less a function of legal contingencies. The aims of this study were: 1) to report indications of compliance with smoke-free legislation in Korean bars and restaurants in California; 2) to examine the demographic, smoking status, and acculturation factors of who smoked indoors; and 3) to report social cues in opposition to smoking among a sample of Koreans in California. Data were collected by telephone surveys administered by bilingual interviewers between 2007-2009, and included California adults of Korean descent who visited a Korean bar or restaurant in a typical month (N=2,173, 55% female). 1% of restaurant-going participants smoked inside while 7% observed someone else smoke inside a Korean restaurant. Some 23% of bar-going participants smoked inside and 65% observed someone else smoke inside a Korean bar. Presence of ashtrays was related to indoor smoking in bars and restaurants. Among participants who observed smoking, a higher percentage observed someone ask a smoker to stop (17.6%) or gesture to a smoker (27.0%) inside Korean restaurants (N=169) than inside Korean bars (n=141, 17.0% observed verbal cue and 22.7% observed gesture). Participants who smoked inside were significantly younger and more acculturated than participants who did not. Less acculturated participants were significantly more to likely to be told to stop smoking. Ten years after implementation of ordinances, smoking appears to be common in Korean bars in California.

  3. Compliance with smoke-free policies in Korean bars and restaurants: A descriptive analysis in California

    Science.gov (United States)

    Irvin, Veronica L.; Hofstetter, C. Richard; Nichols, Jeanne F.; Chambers, Christina D.; Usita, Paula M.; Norman, Gregory J.; Kang, Sunny; Hovell, Melbourne F.

    2015-01-01

    Objective Compliance with California's smoke-free restaurant and bar policies may be more a function of social contingencies and less a function of legal contingencies. The aims of this study are: 1) to report indications of compliance with smoke-free legislation in Korean bars and restaurants in California; 2) to examine the demographic, smoking status, and acculturation factors of who smoked indoors; and 3) to report social cues in opposition to smoking among a sample of Koreans in California. Method Data were collected by telephone surveys administered by bilingual interviewers between 2007– 2009, and included California adults of Korean descent who visited a Korean bar or restaurant in a typical month (N=2,173, 55% female). Results 1% of restaurant-going participants smoked inside while 7% observed someone else smoke inside a Korean restaurant. 23% of bar-going participants smoked inside and 65% observed someone else smoke inside a Korean bar. Presence of ashtrays was related to indoor smoking in bars and restaurants. Among participants who observed smoking, a higher percentage observed someone ask a smoker to stop (17.6%) or gesture to a smoker (27.0%) inside Korean restaurants (N=169) than inside Korean bars (n=141, 17.0% observed verbal cue and 22.7% observed gesture). Participants who smoked inside were significantly younger and more acculturated than participants who did not. Less acculturated participants were significantly more to likely to be told to stop smoking. Conclusions Ten years after implementation of ordinances, smoking was common in Korean bars in California. PMID:25735336

  4. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  5. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  6. Primer on Water Quality

    Science.gov (United States)

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  7. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  8. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  9. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  10. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  11. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  12. First Year University Students' Use of Formulaic Sequences in Oral and Written Descriptions (El uso de secuencias formulaicas de estudiantes de primer año en descripciones orales y escritas)

    Science.gov (United States)

    Gómez Burgos, Eric

    2015-01-01

    The present article investigates the use of first year university students' formulaic sequences in written and oral texts in an English as a foreign language context. The corpus of the study consists of eight descriptive texts--four written and four oral--which were composed of four students of English Pedagogy at a university in Santiago, Chile.…

  13. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  14. Encapsulated Multifunction Corrosion Inhibitive Primer.

    Science.gov (United States)

    1983-11-01

    with the environment of the primer formu- lation. Thus, prior to spray application, the microcapsules would be combined with the epoxy- polyamide primer...loading was not possible. Problems were encountered when the toluene suspensions of microcapsules were blended 302 into the polyamide component. The low...the primer is an epoxy- polyamide , which is applied under the polyurethane top- coat. The polyurea microcapsules are more similar in their chemical pro

  15. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  16. Evidence-informed health policy 4 – Case descriptions of organizations that support the use of research evidence

    Directory of Open Access Journals (Sweden)

    Oxman Andrew D

    2008-12-01

    Full Text Available Abstract Background Previous efforts to produce case descriptions have typically not focused on the organizations that produce research evidence and support its use. External evaluations of such organizations have typically not been analyzed as a group to identify the lessons that have emerged across multiple evaluations. Case descriptions offer the potential for capturing the views and experiences of many individuals who are familiar with an organization, including staff, advocates, and critics. Methods We purposively sampled a subgroup of organizations from among those that participated in the second (interview phase of the study and (once from among other organizations with which we were familiar. We developed and pilot-tested a case description data collection protocol, and conducted site visits that included both interviews and documentary analyses. Themes were identified from among responses to semi-structured questions using a constant comparative method of analysis. We produced both a brief (one to two pages written description and a video documentary for each case. Results We conducted 51 interviews as part of the eight site visits. Two organizational strengths were repeatedly cited by individuals participating in the site visits: use of an evidence-based approach (which was identified as being very time-consuming and existence of a strong relationship between researchers and policymakers (which can be challenged by conflicts of interest. Two organizational weaknesses – a lack of resources and the presence of conflicts of interest – were repeatedly cited by individuals participating in the site visits. Participants offered two main suggestions for the World Health Organization (and other international organizations and networks: 1 mobilize one or more of government support, financial resources, and the participation of both policymakers and researchers; and 2 create knowledge-related global public goods. Conclusion The findings from

  17. Experiences with a novel policy for managing conflicts of interest of guideline developers: a descriptive qualitative study.

    Science.gov (United States)

    Neumann, Ignacio; Karl, Renee; Rajpal, Aman; Akl, Elie A; Guyatt, Gordon H

    2013-08-01

    The executive committee of the Antithrombotic Therapy and Prevention of Thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines (AT9) developed a novel policy for managing conflicts of interest (COIs): Methodologists bore primary responsibility for each chapter, there was equal emphasis on intellectual and financial COI, and content experts with COIs participated, but with restrictions for recommendations on which they had conflicts. The objective of this study was to explore the experiences of the methodologists and content experts with the COI policy after its implementation. One investigator conducted two rounds of semistructured interviews with the methodologist and the leading content expert of each chapter until data saturation was achieved. Two investigators analyzed the transcripts of the interviews in duplicate using an immersion-crystallization approach. We also conducted member checking. We interviewed 15 participants and presented the results to the remaining four for verification. In comparison with their views expressed prior to AT9 development, methodologists remained more positive about the policy than content experts. Six of 10 content experts expressed a more positive view than prior to participation in the AT9 process. The other four content experts remained skeptical, especially regarding the emphasis on intellectual COI. The restrictions of the policy on conflicted individuals were not fully implemented. After its implementation, some content experts were more favorable to the policy, but some retained major reservations. The influence of the policy on recommendations may have been more through the leading role of the methodologists than exclusion of conflicted participants in making recommendations.

  18. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  19. The New Policy on Higher Education of the Government of the Dominican Republic: Some Descriptive and Evaluative Aspects.

    Science.gov (United States)

    Escala, Miguel Jose

    The purpose of this report is to analyze a new higher education policy adoped by the Dominican Republic in Decree 1255 of 1983, "Regulations for Private Higher Education." Geographical, historical, and political characteristics of the Dominican Republic are described, and theoretical and methodological considerations in the study of…

  20. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Directory of Open Access Journals (Sweden)

    Ma Yaqin

    2008-05-01

    Full Text Available Abstract Background Microsatellite (simple sequence repeat – SSR and single nucleotide polymorphism (SNP markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR, as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated

  1. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    Science.gov (United States)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  2. Distraction by smartphone use during clinical practice and opinions about smartphone restriction policies: A cross-sectional descriptive study of nursing students.

    Science.gov (United States)

    Cho, Sumi; Lee, Eunjoo

    2016-05-01

    Smartphone use in healthcare settings may distract healthcare providers and disrupt patient care. Moreover, it may lead to adverse events, thereby threatening patient safety. This study assessed nursing students' smartphone use as a source of distraction in clinical practice and identified their opinions about policies restricting smartphone use during patient care. A cross-sectional descriptive design was used with convenience sampling. Third-year nursing students (n=312) from two nursing schools in the Republic of Korea completed the survey in 2012. A self-report questionnaire-based on addiction theories for problem behaviors and literature on the distraction caused by cellular phone use-was used to assess smartphone use, experiences of distraction caused by smartphone use, and opinions about restriction policies on smartphone use during clinical practice. Nearly half (46.2%) of the nursing students used smartphones at least sometimes during clinical practice and about a quarter of the respondents (24.7%) were at least sometimes distracted by smartphones during clinical practice. The majority of the respondents (83.7%) had witnessed nurses using smartphones at least sometimes during their work. A few respondents (15.7%) agreed or strongly agreed with the policy for restricting smartphone use in hospitals. Students who used smartphones more often tended to disagree with restriction policies for smartphone use in hospitals. Awareness about the risks of smartphone use, especially regarding patient safety, is necessary for nursing students in school and hospital settings. Educators and faculty of nursing schools need to develop policies that encourage intelligent and safe use of smartphones during clinical practice. Copyright © 2016. Published by Elsevier Ltd.

  3. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    The Challenge—Most geological phenomena are extraordinarily complex in their interrelationships and vast in their geographical extension. Ordinarily, engineers and geoscientists are faced with corporate or scientific requirements to properly prepare geological models with measurements involving a small fraction of the entire area or volume of interest. Exact description of a system such as an oil reservoir is neither feasible nor economically possible. The results are necessarily uncertain. Note that the uncertainty is not an intrinsic property of the systems; it is the result of incomplete knowledge by the observer.The Aim of Geostatistics—The main objective of geostatistics is the characterization of spatial systems that are incompletely known, systems that are common in geology. A key difference from classical statistics is that geostatistics uses the sampling location of every measurement. Unless the measurements show spatial correlation, the application of geostatistics is pointless. Ordinarily the need for additional knowledge goes beyond a few points, which explains the display of results graphically as fishnet plots, block diagrams, and maps.Geostatistical Methods—Geostatistics is a collection of numerical techniques for the characterization of spatial attributes using primarily two tools: probabilistic models, which are used for spatial data in a manner similar to the way in which time-series analysis characterizes temporal data, or pattern recognition techniques. The probabilistic models are used as a way to handle uncertainty in results away from sampling locations, making a radical departure from alternative approaches like inverse distance estimation methods.Differences with Time Series—On dealing with time-series analysis, users frequently concentrate their attention on extrapolations for making forecasts. Although users of geostatistics may be interested in extrapolation, the methods work at their best interpolating. This simple difference

  4. Promoting Policy and Environmental Change in Faith-Based Organizations: Description and Findings From a Mini-Grants Program.

    Science.gov (United States)

    Arriola, Kimberly R Jacob; Hermstad, April; Flemming, Shauna St Clair; Honeycutt, Sally; Carvalho, Michelle L; Cherry, Sabrina T; Davis, Tamara; Frazier, Sheritta; Escoffery, Cam; Kegler, Michelle C

    2017-05-01

    The Emory Prevention Research Center's Cancer Prevention and Control Research Network mini-grant program funded faith-based organizations to implement policy and environmental change to promote healthy eating and physical activity in rural South Georgia. This study describes the existing health promotion environment and its relationship to church member behavior. Cross-sectional. Data were obtained from parishioners of six churches in predominantly rural South Georgia. Participants were 319 church members with average age of 48 years, of whom 80% were female and 84% were black/African-American. Questionnaires assessed perceptions of the existing church health promotion environment relative to nutrition and physical activity, eating behavior and intention to use physical activity facilities at church, and eating and physical activity behaviors outside of church. Multiple regression and ordinal logistic regression using generalized estimating equations were used to account for clustered data. Results indicate that delivering messages via sermons and church bulletins, having healthy eating programs, and serving healthy foods are associated with participants' self-reported consumption of healthy foods at church (all p values ≤ .001). Serving more healthy food and less unhealthy food was associated with healthier eating in general but not to physical activity in general (p values ≤ .001). The church environment may play an important role in supporting healthy eating in this setting and more generally.

  5. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  6. Primer on bioproducts

    International Nuclear Information System (INIS)

    Christie, P.; Mitchell, H.; Holmes, R.; Ogilvie, K.B.; Layzell, D.

    2004-11-01

    This document provides a general introduction to biotechnology, bioproducts and alternatives to fossil fuels and petrochemicals. It includes an introduction to the concept of bioproducts, a description of common products that can be manufactured using biomass and an overview of the ways bioproducts are made. It also addresses issues such as risks and benefits of bioproduct technologies and the environmental, social and economic considerations of bioproducts. The possibilities of using biofuels and bioenergy for heat and power, to fuel vehicles and as a fuel for fuel cells were also discussed. Biogas from municipal and farm wastes is currently used to drive some gas turbines for power generation. The role of biochemicals and biomaterials in industrial processes and products was also reviewed along with some domestic and international bioproducts already developed and innovative products under development. The document also explains how plants, animals and other organisms can be used to replace or complement fossil fuels to help generate energy and make chemicals, plastics and other materials. While some reports suggest that bioproducts consume less energy and produce less greenhouse gases than conventional products, other reports suggest that they are rarely superior to conventional products and some may even contribute to the eutrophication of lakes, rivers and other surface waters. figs., 80 refs

  7. The acid rain primer

    International Nuclear Information System (INIS)

    Nugent, O.

    2006-10-01

    Acid rain continues to be a major problem in North America, and particularly in eastern Canada. This report introduced the topic of acid rain and discussed its formation, measurement, sources, and geographic distribution. The major sources of sulphur dioxide in Canada are smelting metals, burning coal for electrical power generation, industrial emissions (e.g., pulp and paper, petroleum and aluminum industry), and oil and gas extraction and refining. In Canada, the largest source of nitrogen oxide is the burning of fossil fuels by the transportation sector. Problem areas for acid rain in Canada were identified. The effects of acid rain were examined on lakes and aquatic ecosystems, forests and soils, human-made structures and materials, human health, and on visibility. Acid rain policies and programs were then presented from a historical and current context. Ecosystem recovery from acid rain was discussed with reference to acid rain monitoring, atmospheric response to reductions in acid-causing emissions, and ecosystem recovery of lakes, forests, and aquatic ecosystems. Challenges affecting ecosystem recovery were also presented. These challenges include drought and dry weather, decrease of base cations in precipitation, release of sulphate previously stored in soil, mineralization and immobilization of sulphur/sulphates. Last, the report discussed what still needs to be done to improve the problem of acid rain as well as future concerns. These concerns include loss of base cations from forested watersheds and nitrogen deposition and saturation. 21 refs., 2 tabs., 17 figs

  8. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  9. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omi...

  10. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  11. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  12. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  13. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  14. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  15. El Primer Ferrocarril En Colombia

    Directory of Open Access Journals (Sweden)

    Gabriel Poveda

    2002-01-01

    Full Text Available Se presenta la historia de los preparativos, la construcción y el funcionamiento del primer ferrocarril que existió en el territorio de la actual Colombia (sin incluir a Panamá que unió a Barranquilla con el mar Caribe. Se muestra la importancia tecnológica y económica que esta obra tuvo para el país mientras existió (de 1869 a 1941

  16. A full description of the Three-ME model: Multi-sector macro-economic Model for the Evaluation of Environmental and Energy policy

    International Nuclear Information System (INIS)

    Callonnec, Gael; Landa, Gissela; Malliet, Paul; Yeddir-Tamsamani, Yasser; Reynes, Frederic

    2013-01-01

    Since 2008, the ADEME and the OFCE are involved in a research convention to develop the model Three-ME. This document provides a full description of new version of the model. Three-ME is a new model of the French economy especially designed to evaluate the medium and long term impact of environmental and energy policies at the macro-economic and sector levels. To do so Three-ME combines two important features. Firstly, it has the main characteristics of neo-Keynesian models by assuming a slow adjustment of effective quantities and prices to their notional level, an endogenous money supply, a Taylor rule and a Philips curve. Compared to standard multi-sector CGEM, this has the advantage to allow for the existence of under-optimum equilibria such as the presence of involuntary unemployment. Secondly, Three-ME is a hybrid model in the sense that it combines the top-down approach of general equilibrium macro-economic models with elements of bottom-up models of energy models developed by engineers. As in bottom-up models, the amount of energy consumed is related to their use, that is the number of buildings or cars, and the energy class to which they belong. This hypothesis is more realistic compared to the assumption made in the majority of top-down models where energy consumption is usually directly related to income through a nested structure of utility function. (authors)

  17. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  18. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  19. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  20. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  1. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  2. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  3. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  4. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  5. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  6. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  7. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  8. Food policy an ethics

    DEFF Research Database (Denmark)

    Coff, Christian Eyde; Kemp, Peter

    2014-01-01

    makes of food policy a highly complex and diverse area. The entry opens with at description of the concept of policy and food policy and how it relates to ethical principles and values. The fourth section discusses some influental definitions of food policy. The final section contains a description......This entry gives an overview of food policy and major ethical principles that in the last decades have been proposed and advocated for in debates on food policy. Food policies touch upon a vast area of interrelated policies (like health, transport, environment, poverty, animal welfare etc.) which...... of ethical principles and ideas of relevance to food policy....

  9. Food policy an ethics

    DEFF Research Database (Denmark)

    Coff, Christian Eyde; Kemp, Peter

    2014-01-01

    This entry gives an overview of food policy and major ethical principles that in the last decades have been proposed and advocated for in debates on food policy. Food policies touch upon a vast area of interrelated policies (like health, transport, environment, poverty, animal welfare etc.) which...... makes of food policy a highly complex and diverse area. The entry opens with at description of the concept of policy and food policy and how it relates to ethical principles and values. The fourth section discusses some influental definitions of food policy. The final section contains a description...... of ethical principles and ideas of relevance to food policy....

  10. The Airlift System: A Primer

    National Research Council Canada - National Science Library

    Owen, Robert

    1997-01-01

    ... and disadvantages of making changes to the missions or composition of those components. The core concepts and interconnections of the airlift system-mission, the focus of airlift policy, component roles, and organization-are reasonably easy to describe...

  11. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  12. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  13. Portable microsatellite primers for Ficus (Moraceae).

    Science.gov (United States)

    Garcia, Marjorie; Bain, Anthony; Tzeng, Hsy-Yu; Peng, Yan-Qiong; Chou, Lien-Siang; Kjellberg, Finn

    2012-05-01

    Highly portable microsatellite primers were developed for Ficus to facilitate investigation of genetic structure of complete regional floras using a single set of markers. Pyrosequencing of five species of Ficus produced a library of 5723 potential primers. Potential primers found in at least two species and presenting identical annealing temperatures were tested on a set of five additional Ficus species. A set of 20 primer pairs producing well-defined and easily readable peaks was retained and tests showed their potential utility for analyzing population genetic structure of 24 Ficus species from Taiwan. Numbers of alleles per locus ranged from one to six in the least variable species and from one to 17 in the most variable species. The results indicate that our set of primers can be used to analyze polymorphism and compare levels of polymorphism among Ficus species.

  14. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  15. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  16. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  17. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  18. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  19. Document image analysis: A primer

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    Abstract. Document image analysis refers to algorithms and techniques that are applied to images of documents to obtain a computer-readable description from pixel data. A well-known document image analysis product is the Optical Character. Recognition (OCR) software that recognizes characters in a scanned document ...

  20. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  1. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  2. Air Pollution Primer. Revised Education.

    Science.gov (United States)

    Corman, Rena

    This revised and updated book is written to inform the citizens on the nature, causes, and effects of air pollution. It is written in terms familiar to the layman with the purpose of providing knowledge and motivation to spur community action on clean air policies. Numerous charts and drawings are provided to support discussion of air pollution…

  3. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  4. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  5. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  6. Descriptive Research

    DEFF Research Database (Denmark)

    Wigram, Anthony Lewis

    2003-01-01

    Descriptive research is described by Lathom-Radocy and Radocy (1995) to include Survey research, ex post facto research, case studies and developmental studies. Descriptive research also includes a review of the literature in order to provide both quantitative and qualitative evidence of the effect...... starts will allow effect size calculations to be made in order to evaluate effect over time. Given the difficulties in undertaking controlled experimental studies in the creative arts therapies, descriptive research methods offer a way of quantifying effect through descriptive statistical analysis...

  7. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  8. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  9. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  10. A primer of analytical mechanics

    CERN Document Server

    Strocchi, Franco

    2018-01-01

    This book presents the basic elements of Analytical Mechanics, starting from the physical motivations that favor it with respect to the Newtonian Mechanics in Cartesian coordinates. Rather than presenting Analytical Mechanics mainly as a formal development of Newtonian Mechanics, it highlights its effectiveness due to the following five important achievements: 1) the most economical description of time evolution in terms of the minimal set of coordinates, so that there are no constraint forces in their evolution equations; 2) the form invariance of the evolution equations, which automatically solves the problem of fictitious forces; 3) only one scalar function encodes the formulation of the dynamics, rather than the full set of vectors which describe the forces in Cartesian Newtonian Mechanics; 4) in the Hamiltonian formulation, the corresponding evolution equations are of first order in time and are fully governed by the Hamiltonian function (usually corresponding to the energy); 5) the emergence of the Hami...

  11. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  12. Statistics in Matlab a primer

    CERN Document Server

    Cho, MoonJung

    2014-01-01

    List of Tables Preface MATLAB BasicsDesktop Environment Getting Help and Other Documentation Data Import and Export Data I/O via the Command Line The Import Wizard Examples of Data I/O in MATLAB Data I/O with the Statistics Toolbox More Functions for Data I/O Data in MATLAB Data Objects in Base MATLAB Accessing Data Elements Examples of Joining Data Sets Data Types in the Statistics Toolbox Object-Oriented Programming Miscellaneous Topics File and Workspace Management Punctuation in MATLAB Arithmetic Operators Functions in MATLAB Summary and Further Reading Visualizing DataBasic Plot Functions Plotting 2-D Data Plotting 3-D Data Examples Scatter Plots Basic 2-D and 3-D Scatter Plots Scatter Plot Matrix Examples GUIs for Graphics Simple Plot Editing Plotting Tools Interface PLOTS Tab Summary and Further Reading Descriptive StatisticsMeasures of Location Means, Medians, and Modes Examples Measures of Dispersion Range Variance and Standard Deviation Covariance and Correlation Examples Describing the Distribution...

  13. Geographic exchange standard and primer

    Energy Technology Data Exchange (ETDEWEB)

    1978-10-01

    The ANSI Draft Proposal Specifications for an Information Interchange Data Descriptive File, X3L5.SEP, contains some Guidelines for Implementation (Appendix D). However, some additional guidelines should be provided specifically for the more commonly used systems of coding locational data, and referring thematic data to those codes. While there is no consensus that a single, preferred representation of geographical files can be specified as a standard for exchange, there is agreement on the generic form of record structures for commonly used, two-dimensional files. This report surveys by example common practice and illustrates the use of geocodes as thematic data pointers. It defines the elements of the structures as a subsystem within the interchange standard. An implementation within the Levels of Implementation of the basic IWGDE Standard is proposed and examples for some of the defined file types are presented in numerical form to aid in understanding. The problem of referring thematic data to a geographic file when these data reside in a physically distinct exchange file is discussed. 14 figures, 1 table. (RWR)

  14. A Descriptive Longitudinal Study of Changes in Vape Shop Characteristics and Store Policies in Anticipation of the 2016 FDA Regulations of Tobacco Products, Including E-Cigarettes.

    Science.gov (United States)

    Yu, Sheila; Escobedo, Patricia; Garcia, Robert; Cruz, Tess Boley; Unger, Jennifer B; Baezconde-Garbanati, Lourdes; Meza, Leah; Sussman, Steve

    2018-02-11

    After proposing the "Deeming Rule" in 2014, the U.S. Food and Drug Administration (FDA) began regulating the manufacturing, marketing, and sales of electronic cigarette (e-cigarette) products as tobacco products in 2016. The current study conducted vape shop store observations and surveyed Los Angeles-area shop employees (assessing their beliefs, awareness, and perceptions of e-cigarettes and related FDA regulations) at two time points one year apart to better understand what vape shop retailers would do given FDA's soon-to-be-enacted Deeming Rule. The study also compared retailer beliefs/awareness/actions and store characteristics immediately after the Deeming Rule proposal versus a year after the Rule had been proposed, right before its enactment. Two data collection waves occurred before the Deeming Rule enactment, with Year 1 surveying 77 shops (2014) and Year 2 surveying 61 shops (2015-2016). Between the data collection points, 16 shops had closed. Among the shops that were open at both time points, the majority (95% in Year 1; 74% in Year 2) were aware of some FDA regulations or other policies applying to vape shops. However, overall awareness of FDA regulations and state/local policies governing e-cigarettes significantly decreased from Year 1 to Year 2. At both time points, all shops offered customers free puffs of nicotine-containing e-liquids (prohibited by the then upcoming Deeming Rule). Perceptions of e-cigarette safety also significantly decreased between the years. Exploring vape shop retailer perceptions and store policies (i.e., free puffs/samples displays, perceptions of e-cigarette safety, etc.) over time will help the FDA assess the needs of the vape shop community and develop more effective retailer education campaigns and materials targeted to increase compliance with the newly enacted regulations.

  15. A Descriptive Longitudinal Study of Changes in Vape Shop Characteristics and Store Policies in Anticipation of the 2016 FDA Regulations of Tobacco Products, Including E-Cigarettes

    Directory of Open Access Journals (Sweden)

    Sheila Yu

    2018-02-01

    Full Text Available After proposing the “Deeming Rule” in 2014, the U.S. Food and Drug Administration (FDA began regulating the manufacturing, marketing, and sales of electronic cigarette (e-cigarette products as tobacco products in 2016. The current study conducted vape shop store observations and surveyed Los Angeles–area shop employees (assessing their beliefs, awareness, and perceptions of e-cigarettes and related FDA regulations at two time points one year apart to better understand what vape shop retailers would do given FDA’s soon-to-be-enacted Deeming Rule. The study also compared retailer beliefs/awareness/actions and store characteristics immediately after the Deeming Rule proposal versus a year after the Rule had been proposed, right before its enactment. Two data collection waves occurred before the Deeming Rule enactment, with Year 1 surveying 77 shops (2014 and Year 2 surveying 61 shops (2015–2016. Between the data collection points, 16 shops had closed. Among the shops that were open at both time points, the majority (95% in Year 1; 74% in Year 2 were aware of some FDA regulations or other policies applying to vape shops. However, overall awareness of FDA regulations and state/local policies governing e-cigarettes significantly decreased from Year 1 to Year 2. At both time points, all shops offered customers free puffs of nicotine-containing e-liquids (prohibited by the then upcoming Deeming Rule. Perceptions of e-cigarette safety also significantly decreased between the years. Exploring vape shop retailer perceptions and store policies (i.e., free puffs/samples displays, perceptions of e-cigarette safety, etc. over time will help the FDA assess the needs of the vape shop community and develop more effective retailer education campaigns and materials targeted to increase compliance with the newly enacted regulations.

  16. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  17. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  18. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  19. Soft solids a primer to the theoretical mechanics of materials

    CERN Document Server

    Freed, Alan D

    2014-01-01

    This textbook presents the physical principles pertinent to the mathematical modeling of soft materials used in engineering practice, including both man-made materials and biological tissues. It is intended for seniors and masters-level graduate students in engineering, physics, or applied mathematics. It will also be a valuable resource for researchers working in mechanics, biomechanics, and other fields where the mechanical response of soft solids is relevant.   Soft Solids: A Primer to the Theoretical Mechanics of Materials is divided into two parts. Part I introduces the basic concepts needed to give both Eulerian and Lagrangian descriptions of the mechanical response of soft solids. Part II presents two distinct theories of elasticity and their associated theories of viscoelasticity. Seven boundary-value problems are studied over the course of the book, each pertaining to an experiment used to characterize materials. These problems are discussed at the end of each chapter, giving students the opportunit...

  20. Microsatellite primers in the native perennial cycad Cycas taitungensis (Cycadaceae).

    Science.gov (United States)

    Ju, Li-Ping; Kuo, Chia-Chi; Chao, Yi-Shan; Cheng, Yu-Pin; Gong, Xun; Chiang, Yu-Chung

    2011-04-01

    Microsatellite primers were developed for the native perennial cycad Cycas taitungensis to evaluate the genetic variation of this endangered insular species. Using a magnetic bead enrichment method and EST data, 16 primer sets were developed and identified for the native Taiwan cycad C. taitungensis. The primers amplified dinucleotide, trinucleotide, and complex repeats with 1-9 alleles per locus. Most primers also amplified DNA from C. revoluta and C. debaoensis. These results indicate the utility of primers for future studies of the genetic structure of C. taitungensis. In addition, the primers are useful for further phylogeographic studies between C. taitungensis and C. revoluta, which is a closely related species.

  1. Defense Primer: A Guide for New Members

    Science.gov (United States)

    2017-03-03

    2 Regular Military Compensation ...Military Compensation CRS In Focus IF10532, Defense Primer: Regular Military Compensation , by Lawrence Kapp Military Pay Raise CRS In Focus...Specialist on Congress and the Legislative Process vheitshusen@crs.loc.gov, 7-8635 Kristy N. Kamarck Analyst in Military Manpower kkamarck@crs.loc.gov

  2. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  3. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  4. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  5. Insights following change in drug policy: a descriptive study for antimalarial prescription practices in children of public sector health facilities in Jharkhand state of India.

    Science.gov (United States)

    Mishra, Neelima; Gupta, Ruchi; Singh, Sagya; Rana, Roma; Shahi, Bhartendu; Das, Manoj Kumar; Anvikar, Anupkumar R; Valecha, Neena

    2013-12-01

    Widespread resistance to chloroquine was the mainstay to implement artemisinin-based combination therapy (ACT) in the year 2007 in few malaria endemic states in India including Jharkhand as the first line of treatment for uncomplicated Plasmodium falciparum malaria. This study was conducted in Jharkhand state of the country just after the implementation of ACT to assess the prevailing antimalarial drug prescribing practices, availability of antimalarial drugs and the acceptability of the new policy by the health professionals for the treatment of uncomplicated P. falciparum malaria patients particularly in children ≤ 15 yr of age. This is a cross-sectional study in children aged ≤ 15 yr with malaria or to whom antimalarial drug was prescribed. Main outcome measure was prescription of recommended ACT in children aged ≤ 15 yr with malaria in the selected areas of Jharkhand. In the year 2008, artemisinin-based combination therapy (ACT) was implemented in 12 districts of the studied state; however, the availability of ACT was confirmed only in five districts. Antimalarial prescription was prevalent amongst the undiagnosed (8.4%), malaria negative (64.3%) and unknown blood test result (1.2%) suggesting the prevalence of irrational treatment practices. ACT prescription was very low with only 3.2% of confirmed falciparum malaria patients receiving it while others received either non-artesunate (NA) treatment (88.1%) including chloroquine (CQ) alone, CQ + Primaquine (PQ)/other drugs, sulphadoxine-pyrimethamine (SP) alone, SP + other drugs or artemisinin monotherapy (AM) treatment (6.3%). Still others were given non-antimalarial treatment (NM) in both malaria positive (0.3%) and malaria negative (2.1%) cases. Despite the change in drug policy in the studied state the availability and implementation of ACT was a major concern. Nevertheless, the non-availability of blister packs for children aged ≤ 15 yr was the main hindrance in the implementation of the recommended

  6. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  7. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  8. Failure of hospital employees to comply with smoke-free policy is associated with nicotine dependence and motives for smoking: a descriptive cross-sectional study at a teaching hospital in the United Kingdom

    Directory of Open Access Journals (Sweden)

    Turner Kenrick

    2009-07-01

    Full Text Available Abstract Background Smoke-free policy aims to protect the health of the population by reducing exposure to environmental tobacco smoke (ETS, and World Health Organisation (WHO guidance notes that these policies are only successful if there is full and proper enforcement. We aimed to investigate the problem of resistance to smoking restrictions and specifically compliance with smoke-free policy. We hypothesised that an explanation for non-compliance would lie in a measurable difference between the smoking behaviours of compliant and non-compliant smokers, specifically that non-compliance would be associated with nicotine dependence and different reasons for smoking. Methods We conducted a questionnaire-based, descriptive, cross-sectional study of hospital employees. Seven hundred and four members of staff at Addenbrooke's Hospital, Cambridge, UK, completed the questionnaire, of whom 101 were smokers. Comparison between compliant and non-compliant smokers was made based on calculated scores for the Fagerström test and the Horn-Waingrow scale, and level of agreement with questions about attitudes. For ordinal data we used a linear-by-linear association test. For non-parametric independent variables we used the Mann-Whitney test and for associations between categorical variables we used the chi-squared test. Results The demographic composition of respondents corresponded with the hospital's working population in gender, age, job profile and ethnicity. Sixty nine smokers reported they were compliant while 32 were non-compliant. Linear-by-linear association analysis of the compliant and non-compliant smokers' answers for the Fagerström test suggests association between compliance and nicotine dependence (p = 0.049. Mann-Whitney test analysis suggests there is a statistically significant difference between the reasons for smoking of the two groups: specifically that non-compliant smokers showed habitual smoking behaviour (p = 0.003. Overall

  9. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  10. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  11. Descriptive research

    NARCIS (Netherlands)

    Lans, W; van der Voordt, Theo; de Jong, T.M.; van der Voordt, D.J.M.

    2002-01-01

    A lot of knowledge is needed for a good design; one that is functional, affordable, with architectonic interest etc. The same applies to a wealth of other activities within the architectural discipline; as there are policy development, spatial planning, formulating programmes of requirement,

  12. Cyber security policy guidebook

    CERN Document Server

    Bayuk, nifer L; Rohmeyer, l; Sachs, cus; Schmidt, frey; Weiss, eph

    2012-01-01

    This book is a taxonomy and thesaurus of current cybersecurity policy issues, including a thorough description of each issue and a corresponding list of pros and cons with respect to identified stances on each issue. It documents policy alternatives for the sake of clarity with respect to policy alone, and dives into organizational implementation issues. Without using technical jargon, the book emphasizes the importance of critical and analytical thinking when making policy decisions.  It also equips the reader with descriptions of the impact of specific policy ch

  13. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  14. Descripción de una huella de terópodo de la Formación Misiones: primer fósil mesozoico fidedigno de Paraguay Description of a theropod footprint from the Misiones Formation: first reliable fossil from the Mesozoic of Paraguay

    Directory of Open Access Journals (Sweden)

    Silvina de Valais

    2012-09-01

    Full Text Available El registro fosilífero del Mesozoico de Paraguay es prácticamente nulo, siendo la única excepción hasta la fecha, la mención de dos rastrilladas de vertebrados -actualmente desaparecidas- en lajas de las explanadas de la Iglesia de la Catedral y de la Iglesia María Auxiliadora. Se considera que las mismas habrían procedido de la cantera San Cristóbal del Departamento de Misiones, al Suroeste de Asunción, perteneciente a la Formación Misiones (probablemente Cretácico Inferior. Recientemente, en una nueva laja de la explanada de la Iglesia María Auxiliadora, proveniente de la misma cantera que los especímenes desaparecidos, fue hallada una huella tridáctila de mediano tamaño, presentada y estudiada en el presente trabajo. La icnita exhibe características propias de las huellas de dinosaurios terópodos. La traza constituye la única prueba fidedigna no solo de la presencia de dinosaurios en Paraguay, sino también del primer fósil mesozoico del país.The Mesozoic fossil record from Paraguay is almost non-existent, being the only exception the mention of two currently missing vertebrate trackways, found in slabs of the sidewalks of the Church de la Catedral and of the Church María Auxiliadora. It is thought that the slabs would have proceeded from the quarry San Cristóbal from the Misiones Department, Southwest of Asunción, from the Misiones Formation (probably Lower Cretaceous. Recently, in a new slab of the sidewalk of the Church María Auxiliadora, coming from the same quarry as the lost specimens, a medium-sized tridactyl footprint was found and studied in this contribution. The track exhibits characteristics belonging to theropod footprints. The footprint is not just the unique reliable evidence for the presence of dinosaurs in Paraguay, but also the first Mesozoic fossil of the country.

  15. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc-rich primers – General: internal funding in place through at least 2019 to...Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K... Resistance (Skydrol) 7. Color Matching 8. Solvent Resistance 9. Thickness Tolerance 10. Application Method 11. Packaging 31 Questions?

  16. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  17. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  18. Primer registro de megafloras y palinología en estratos de la Formación Tarija (Pennsylvaniano, Arroyo Aguas Blancas, Provincia de Salta, Argentina: Descripción de dos especies nuevas First record of megafloras and palynology in the Tarija Formation (Pennsylvanian, Aguas Blancas creek, Salta Province, Argentina: Description of two new species

    Directory of Open Access Journals (Sweden)

    Mercedes di Pasquo

    2009-01-01

    Full Text Available Se analiza e ilustra, por primera vez, una tafoflora hallada en estratos de la Formación Tarija que aflora en Arroyo Aguas Blancas, Provincia de Salta, Argentina. Se describen, también, dos especies nuevas: Malanzania starckii (licofita y Grumosisporites delpapae (espora trilete. Se reconocieron improntas de semillas platispérmicas (Sama-ropsis nunezii García emend. A. Archangelsky, Cordaicarpus cesariae Gutiérrez, Ganuza, Morel y Arrondo emend. A. Archangelsky, improntas de tallos articulados {Paracalamites australis Rigby emend. Zampirolli y Bernardes de Oliveira y compresiones/improntas de fragmentos foliares (Cordaites riojanus Archangelsky y Leguizamón, Ginkgo-phyllum sp. cf. G. diazii Archangelsky y Arrondo. Esta asociación es atribuida al Pennsylvaniano s.l. sobre la base de la distribución estratigráfica de las especies seminales. La asociación palinológica se compone de 101 especies, 53 de ellas reconocidas como autóctonas y 48 retrabajadas. El primer conjunto comprende 34 especies de esporas trilete, 11 granos de polen monosacado, un grano bisacado y siete especies de algas. El grupo retrabajado se compone de 27 esporas trilete y criptosporas, 20 especies de acritarcas, prasinofitas y otras algas y un quitinozoario. La presencia de especies exclusivas de la BiozonaD. bireticulatus-C. chacoparanensis (BC (e.g., Dictyotriletes bireticulatus (Ibrahim Potonié y Kremp emend. Smith y Butterworth, Crucisaccites latisulcatus Lele y Maithy, Verrucosisporites morulatus (Knox Potonié y Kremp emend. Smith y Butterworth, permite acotar su edad al Bashkiriano tardío-Moscoviano. La vegetación, compuesta principalmente por licofitas, esfenofitas, pteridofitas y gimnospermas, se habría desarrollado en diferentes ambientes continentales como lagos y ríos alimentados por glaciares de montaña.Fossil plant remains found in the Tarija Formation cropping out at the Aguas Blancas creek, Aguaragüe range, Salta Province, Argentina, are analy

  19. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  20. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers

    NARCIS (Netherlands)

    Tieben, L. M.; ter Schegget, J.; Minnaar, R. P.; Bouwes Bavinck, J. N.; Berkhout, R. J.; Vermeer, B. J.; Jebbink, M. F.; Smits, H. L.

    1993-01-01

    Two sets of consensus PCR primers consisting of a common 3' primer CP-I and two 5'-primers, CP-IIG (primer set A) and CP-IIS (primer set B), in the E1 open reading frame of the human papillomavirus (HPV) genome are presented. These two primer sets enabled the detection of a 188 base pair (bp)

  1. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  2. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  3. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  4. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  5. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  6. An ASIC Low Power Primer Analysis, Techniques and Specification

    CERN Document Server

    Chadha, Rakesh

    2013-01-01

    This book provides an invaluable primer on the techniques utilized in the design of low power digital semiconductor devices.  Readers will benefit from the hands-on approach which starts form the ground-up, explaining with basic examples what power is, how it is measured and how it impacts on the design process of application-specific integrated circuits (ASICs).  The authors use both the Unified Power Format (UPF) and Common Power Format (CPF) to describe in detail the power intent for an ASIC and then guide readers through a variety of architectural and implementation techniques that will help meet the power intent.  From analyzing system power consumption, to techniques that can employed in a low power design, to a detailed description of two alternate standards for capturing the power directives at various phases of the design, this book is filled with information that will give ASIC designers a competitive edge in low-power design. Starts from the ground-up and explains what power is, how it is measur...

  7. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  8. Estudo descritivo sobre o primeiro mutirão no Brasil de cirurgias eletivas para tratamento de escoliose Estudio descriptivo sobre el primer esfuerzo conjunto en la cirugía electiva de Brasil para el tratamiento de la escoliosis Descriptive study about the first collective effort of elective surgeries for scoliosis treatment in Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo da Vitória Mattedi

    2012-01-01

    Estado de Espírito Santo. MÉTODOS: Estudio descriptivo transversal, observacional, que evaluó a las personas de los alrededores de la ciudad de Vitória y del interior del Estado de Espírito Santo con deformidades o síntomas de dolor, en la región dorsal, de origen osteomuscular, clasificando a esas personas de acuerdo a la edad, el sexo y la patología, y cuando se diagnosticó la escoliosis, se fue posible, se la clasificó según King, Lenke, Winter et al. y Lounstein y Akbarnia, y se indicó el tratamiento. RESULTADOS: Se evaluó un total de 169 pacientes, 48 hombres y 121 mujeres, edad promedio de 39,7 años y 41,1 años, respectivamente. Del total de pacientes evaluados, 25,4% tenían enfermedades ortopédicas en general, 36,1% enfermedades específicas de la columna vertebral excepto escoliosis, y 38,5% escoliosis. De los pacientes con escoliosis, 81,5% fueron de idiopática del adolescente, con la mayoría clasificados por King como de tipo II y por Lenke como de tipo I. Entre otras etiologías de la escoliosis, la congénita más común fue la hemivértebra asociada a barra contralateral cuando se clasifica por Winter et al y, de las neuromusculares, el tipo 2B de la clasificación de Louenstein y Akbarnia. CONCLUSIÓN: Nuestros datos epidemiológicos corroboran la literatura actual. Logramos conseguir un número satisfactorio de pacientes con enfermedades de la columna vertebral, determinar un tratamiento y seguimiento, así como divulgar y orientar a la población sobre tales enfermedades.OBJECTIVE: Describe the statistical results of the first campaign for elective surgeries performed in Brazil, not only in order to make the initiative public, but more importantly, so that the knowledge of these actions will encourage other States and also other collaborative efforts in Espírito Santo. METHODS: Descriptive cross-sectional observational study, which evaluated people from Grande Vitória and from the State of Espirito Santo with deformities or dorsal

  9. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  10. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  11. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  12. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  13. A Practical Primer on Prion Pathology.

    Science.gov (United States)

    Appleby, Brian S; Rhoads, Daniel D; Mente, Karin; Cohen, Mark L

    2018-03-28

    Prion diseases comprise a group of transmissible degenerative encephalopathies resulting from propagation of a misfolded cellular protein of uncertain function. As is generally the case with rare diseases, lack of institutional experience compromises individual familiarity with the varying, and apparently protean, manifestations of prion diseases, both clinically and pathologically. Coupled with the documented transmissibility of these diseases both within and between species, the Centers for Disease Control and Prevention (CDC) has established the National Prion Disease Pathology Surveillance Center to both aid with diagnosis of prion disease and to survey the United States for evidence of zoonotic transmission. We have assembled this primer with the hope that our accumulated experience will enable the neuropathological community to help the CDC "save lives and protect people."

  14. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  15. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  16. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  17. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  18. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  19. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  20. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  1. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  2. Composite Overwrapped Pressure Vessels, A Primer

    Science.gov (United States)

    McLaughlan, Pat B.; Forth, Scott C.; Grimes-Ledesma, Lorie R.

    2011-01-01

    Due to the extensive amount of detailed information that has been published on composite overwrapped pressure vessels (COPVs), this document has been written to serve as a primer for those who desire an elementary knowledge of COPVs and the factors affecting composite safety. In this application, the word "composite" simply refers to a matrix of continuous fibers contained within a resin and wrapped over a pressure barrier to form a vessel for gas or liquid containment. COPVs are currently used at NASA to contain high pressure fluids in propulsion, science experiments, and life support applications. They have a significant weight advantage over all metal vessels but require unique design, manufacturing, and test requirements. COPVs also involve a much more complex mechanical understanding due to the interplay between the composite overwrap and the inner liner. A metallic liner is typically used in a COPV as a fluid permeation barrier. The liner design concepts and requirements have been borrowed from all-metal vessels. However, application of metallic vessel design standards to a very thin liner is not straightforward. Different failure modes exist for COPVs than for all-metal vessels, and understanding of these failure modes is at a much more rudimentary level than for metal vessels.

  3. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  4. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  5. Subjective wellbeing: a primer for poverty analysts

    Science.gov (United States)

    Venkatapuram, Sridhar

    2013-01-01

    The article reviews the current theory and measurement of subjective wellbeing (SWB). The first two sections discuss growing efforts in many countries to measure and monitor national wellbeing, particularly in the United Kingdom. The third and fourth sections discuss the novelty and controversies about SWB research. It concludes that a critical approach is essential in evaluating SWB research but dismissing it offhand or framing it as antithetical to objective wellbeing is misconceived. The pressing issue for poverty research and public policy is to determine which insights about SWB are worth using, and how much space within conceptions of wellbeing used in public policy should be given to SWB. PMID:24382984

  6. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  7. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  8. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  9. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  10. Relativistic Astrophysics and Cosmology: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, Marek A [Department of Astronomy and Astrophysics, Chalmers University of Technology, 41296 Goeteborg (Sweden)

    2007-10-21

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as

  11. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  12. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  13. 48 CFR 14.202-5 - Descriptive literature.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Descriptive literature. 14... CONTRACTING METHODS AND CONTRACT TYPES SEALED BIDDING Solicitation of Bids 14.202-5 Descriptive literature. (a) Policy. Contracting officers must not require bidders to furnish descriptive literature unless it is...

  14. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  15. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Mapping of randomly amplified polymorphic DNA primer (RAPD) on chromosome 2A of common wheat. Khamsa Parveen, Inamullah Inamullah, Habib Ahmad, Muhammad Sajjad Iqbal, Fida Muhammad Abbassi, Aziz ud-Din, Abdullah Khan, Imtiaz Ahmad Khan ...

  16. A Primer of Easy Pieces: Teaching through Typical Narrative.

    Science.gov (United States)

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  17. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  18. A Primer of Middle Eastern Leadership Culture

    Directory of Open Access Journals (Sweden)

    Sheldon Greaves

    2012-01-01

    Full Text Available It is natural for someone looking in on a foreign culture from the outside to interpret what they see and frame their reactions based on their own background and assumptions. With cultures as a different as those of the Middle East and the West, the potential for blunders increases dramatically, made worse by the high political, diplomatic, military, and commercial stakes involved. Leadership culture in this region has been shaped over centuries through a variety of factors, such as reputation, family, and religion, which continue to influence decision making. The present study posits that an understanding of these factors and how they work is crucial for intelligence analysts, policy and decision makers, strategists, and scholars who must find their way through a very unfamiliar cultural landscape in the Middle East. It is hoped that this discussion will in some way assist in the creation of more effective interaction, policies, and analysis associated with the Middle East.

  19. A Primer on Population Health Management and Its Perioperative Application.

    Science.gov (United States)

    Boudreaux, Arthur M; Vetter, Thomas R

    2016-07-01

    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  20. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    additive since it was not commercially available. A replacement was needed. 2) Kel-F, a Polychorotrifluoro ethylene (PCTFE) polymer , which was...primer mixes where scraps fall onto wet floors and by the chemical production of the primer mix. In addition, workers clothing can be easily...preparation of the LFEP are recyclable without re-purification. A second general advantage is the ease of de-militarization of ENC based LFEP. These

  1. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  2. A política educacional do primeiro governo Petista de São Carlos-SP (2001-2004 La política educativa del primer gobierno del Partido de los Trabajadores de São Carlos - ciudad del interior de San Pablo (2001-2004 The educational policy of the Workers Party's first government in São Carlos - SP (2001-2004

    Directory of Open Access Journals (Sweden)

    Ana Paula Rodrigues da Silva

    2010-09-01

    Full Text Available O artigo propõe uma avaliação da política educacional implementada pelo primeiro governo do Partido dos Trabalhadores no município de São Carlos (SP, entre 2001 e 2004. Nesse período, o panorama educacional brasileiro já estava marcado, desde a ditadura militar (1964-1985, por uma ampla gama de experiências e reformas, as quais tiveram como um de seus resultados mais importantes a universalização do acesso à escolaridade obrigatória já no final da década de 90. Resolvida a questão quantitativa, o grande problema a ser enfrentado passou a ser o da qualidade do ensino ofertado na escola pública. Apesar da situação privilegiada da cidade de São Carlos, situada numa das regiões economicamente mais ricas do país e com forte tradição educacional, nossas pesquisas nos levam a afirmar que a primeira gestão petista do município deveria ter materializado uma política educacional mais efetiva do que aquela implementada, a fim de atingir a melhoria da qualidade do ensino ofertado à população.El artículo propone una evaluación de la política educativa implementada por el primer gobierno del Partido de los Trabajadores (PT en la ciudad de São Carlos (SP, entre 2001 y 2004. En este período, el panorama educativo brasileño ya estaba marcado, desde la dictadura militar (1964-1985, por una amplia variedad de experiencias y reformas, las cuales tuvieron como uno de sus resultados más importantes la universalización del acceso a la escolaridad obligatoria, a finales de la década de los años 90. Una vez resuelta la cuestión cuantitativa, el gran problema que quedaba fue el de la calidad de la enseñanza ofrecida en la escuela pública. A pesar de la situación privilegiada de São Carlos, situada en una de las regiones económicamente más ricas del país y con una fuerte tradición educativa, nuestras investigaciones nos llevan a afirmar que la primera gestión del PT en la ciudad debería haber materializado una pol

  3. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin

    2014-01-01

    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  4. Implementing a Description Grammar Interpreter : A Notation for Descriptions and Description Rules

    NARCIS (Netherlands)

    Stouffs, R.M.F.

    2015-01-01

    Description grammars represent a formalism for generating verbal descriptions of designs, used in conjunction with shape grammars. A description grammar constitutes a set of description rules that define a language of descriptions. A description grammar interpreter implements the mechanisms to

  5. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  6. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  7. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  8. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  9. The effect of ceramic primer on shear bond strength of resin composite cement to zirconia: a function of water storage and thermal cycling.

    Science.gov (United States)

    Keul, Christine; Liebermann, Anja; Roos, Malgorzata; Uhrenbacher, Julia; Stawarczyk, Bogna; Ing, Dipl

    2013-11-01

    The authors investigated the use of ceramic primers combined with self-adhesive resin composite cements on the shear bond strength (SBS) to zirconia and compared them with one conventional resin composite cement. The authors divided zirconia substrates (N = 550) into three groups: RelyX Unicem Aplicap self-adhesive universal resin composite cement (3M ESPE, St. Paul, Minn.) (group A) (n = 220); G-CEM Capsule self-adhesive resin composite cement (GC Europe, Leuven, Belgium) (group B) (n = 220); and Panavia 21 with Clearfil Porcelain Bond Activator and Clearfil SE Bond primer (n = 110) (Kuraray Dental, Tokyo) used as a standard comparison (SC). The authors examined the self-adhesive resin composite cements without (0) and with (1) the use of a ceramic primer. They measured SBS initially (37°C for three hours), after water storage (37°C for one, four, nine, 16 or 25 days) and after thermal cycling (5°C and 55°C for 1,500, 6,000, 13,500, 24,000 or 37,500 cycles). The authors analyzed data by using descriptive statistics, the Mann-Whitney test, the Kruskal-Wallis test and a χ(2) test. Application of a ceramic primer did not result in a negative impact on SBS. Specimens in the A1 group (that is, RelyX Unicem Aplicap with ceramic primer) exhibited significantly higher SBS before and after water storage and thermal cycling compared with specimens that were not treated with a primer. The self-adhesive resin composite cements combined with ceramic primer exhibited similar or higher SBS values compared with those in the SC group at each aging duration (that is, water storage and thermal cycling). With respect to G-CEM Capsule, the authors observed a significantly positive effect of the primer after nine and 16 days' water storage and after one and four days' thermal cycling. They observed predominantly adhesive failures. Ceramic primer in combination with self-adhesive resin composite cement demonstrated a positive effect on SBS to zirconia and should be used for

  10. Hormonal emergency contraception: a clinical primer.

    Science.gov (United States)

    Ziebarth, Angela; Hansen, Keith A

    2007-03-01

    Unintended and teenage pregnancies are major public health concerns in the United States. Emergency contraception is used to prevent pregnancy after failure of a contraceptive method or after unprotected intercourse. Expanded use of emergency contraception has the potential to reduce unintended pregnancy and induced abortions, while reducing state and federal healthcare expenditures. The recent approval of Plan B as an over-the-counter medication for individuals over 18 years of age should improve access to this medication. However, there are still widespread misconceptions about the mechanisms and implications of emergency contraception. Expanded access to emergency contraception is associated with increased use, but not associated with decreased efficacy, increased sexual risk-taking behavior, or less consistent use of traditional birth control methods. This review is designed to provide clinicians with information regarding the use of emergency contraception for reproductive age patients. It includes a brief description of methods of use, mechanisms of action, and side effect profiles of the most commonly used methods of emergency contraception, levonorgestrel and the Yuzpe method.

  11. Developing an Online Database of National and Sub-National Clean Energy Policies

    Energy Technology Data Exchange (ETDEWEB)

    Haynes, R.; Cross, S.; Heinemann, A.; Booth, S.

    2014-06-01

    The Database of State Incentives for Renewables and Efficiency (DSIRE) was established in 1995 to provide summaries of energy efficiency and renewable energy policies offered by the federal and state governments. This primer provides an overview of the major policy, research, and technical topics to be considered when creating a similar clean energy policy database and website.

  12. Online social networking: a primer for radiology.

    Science.gov (United States)

    Prasanna, Prasanth M; Seagull, F Jacob; Nagy, Paul

    2011-10-01

    Online social networking is an immature, but rapidly evolving industry of web-based technologies that allow individuals to develop online relationships. News stories populate the headlines about various websites which can facilitate patient and doctor interaction. There remain questions about protecting patient confidentiality and defining etiquette in order to preserve the doctor/patient relationship and protect physicians. How much social networking-based communication or other forms of E-communication is effective? What are the potential benefits and pitfalls of this form of communication? Physicians are exploring how social networking might provide a forum for interacting with their patients, and advance collaborative patient care. Several organizations and institutions have set forth policies to address these questions and more. Though still in its infancy, this form of media has the power to revolutionize the way physicians interact with their patients and fellow health care workers. In the end, physicians must ask what value is added by engaging patients or other health care providers in a social networking format. Social networks may flourish in health care as a means of distributing information to patients or serve mainly as support groups among patients. Physicians must tread a narrow path to bring value to interactions in these networks while limiting their exposure to unwanted liability.

  13. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  14. A primer on the statistical modelling of learning curves in health professions education.

    Science.gov (United States)

    Pusic, Martin V; Boutis, Kathy; Pecaric, Martin R; Savenkov, Oleksander; Beckstead, Jason W; Jaber, Mohamad Y

    2017-08-01

    Learning curves are a useful way of representing the rate of learning over time. Features include an index of baseline performance (y-intercept), the efficiency of learning over time (slope parameter) and the maximal theoretical performance achievable (upper asymptote). Each of these parameters can be statistically modelled on an individual and group basis with the resulting estimates being useful to both learners and educators for feedback and educational quality improvement. In this primer, we review various descriptive and modelling techniques appropriate to learning curves including smoothing, regression modelling and application of the Thurstone model. Using an example dataset we demonstrate each technique as it specifically applies to learning curves and point out limitations.

  15. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  17. Invalidating Policies using Structural Information

    DEFF Research Database (Denmark)

    Kammuller, Florian; Probst, Christian W.

    2014-01-01

    by invalidating policies using structural information of the organisational model. Based on this structural information and a description of the organisation’s policies, our approach invalidates the policies and identifies exemplary sequences of actions that lead to a violation of the policy in question. Based...... on these examples, the organisation can identify real attack vectors that might result in an insider attack. This information can be used to refine access control systems or policies. We provide case studies showing how mechanical verification tools, i.e. modelchecking with MCMAS and interactive theorem proving...

  18. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  19. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  20. Onchocercal DNA amplification using beta actin gene primers ...

    African Journals Online (AJOL)

    Onchocercal DNA amplification using beta actin gene primers compared with first internal transcribed spacer sequences for monitoring onchocerciasis eradication strategy. ... Out of the 12 amplicons in agarose gel, there were 6 sharp and 6 faint bands of 100bp molecular weight as documented. The sharp bands included 3 ...

  1. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  2. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  3. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545–549. Table 1.

  4. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... 500. Figure 1. PCR amplification profile of the two genetic stocks of common wheat,. NT2A2B and NT1D1B using RAPD primer GLC-07. M = Molecular size marker (100 bp DNA ladder, Gene Link, USA). important crops species including wheat (T. aestivum L.). Among the DNA markers, randomly amplified.

  5. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  6. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  7. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  8. Description logics of context

    CSIR Research Space (South Africa)

    Klarman, S

    2013-05-01

    Full Text Available We introduce Description Logics of Context (DLCs) - an extension of Description Logics (DLs) for context-based reasoning. Our approach descends from J. McCarthy's tradition of treating contexts as formal objects over which one can quantify...

  9. Physics 3204. Course Description.

    Science.gov (United States)

    Newfoundland and Labrador Dept. of Education.

    A description of the physics 3204 course in Newfoundland and Labrador is provided. The description includes: (1) statement of purpose, including general objectives of science education; (2) a list of six course objectives; (3) course content for units on sound, light, optical instruments, electrostatics, current electricity, Michael Faraday and…

  10. Descriptive set theory

    CERN Document Server

    Moschovakis, YN

    1987-01-01

    Now available in paperback, this monograph is a self-contained exposition of the main results and methods of descriptive set theory. It develops all the necessary background material from logic and recursion theory, and treats both classical descriptive set theory and the effective theory developed by logicians.

  11. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Science.gov (United States)

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  12. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  13. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  15. On Meanings and Descriptions

    Directory of Open Access Journals (Sweden)

    Mieke Bal

    1981-09-01

    Full Text Available Although descriptive passages would appear to be of marginal importance in narrative texts, they are, in fact, of both logical and semantic necessity. Narratology, therefore, must take these segments into account. In this article, I shall survey the present situation in this field and compare rival points of view. I shall also offer several suggestions for analyzing descriptions. The following topics will be discussed: the nature of description as a specific type of discourse which makes it recognizable as such; the internal structure of description; the place and function of descriptions in the text as a whole. In the latter section, the semantic impact of descriptions in the overall meaning of narrative texts will be accounted for. This article is intended as a contribution to the theory of description as a part of narratology. It also has a didactic purpose, since it proposes a model for the analysis of texts which can be used for systematic text-study, both in a historical and a comparative perspective.

  16. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    Science.gov (United States)

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  17. Detection of mutated primers and impact on targeted metagenomics results

    OpenAIRE

    Antoine-Lorquin, Aymeric; Mahé, Frédéric; Dunthorn, Micah; Belleannée, Catherine

    2016-01-01

    International audience; High-throughout sequencing platforms are widely used in metabarcoding studies of environmental microbial diversity as they can quickly produce millions of reads. Resulting reads in these studies are clustered into molecular operational taxonomic units (OTUs) and compared statistically. In order to limit the number of spurious OTUs retrieved from samples, eliminating the reads with mutated primers has become the norm. This process has the advantage of not requiring the ...

  18. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  19. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  20. Defense Primer: The National Defense Budget Function (050)

    Science.gov (United States)

    2017-03-17

    provides a framework for examining spending patterns of the federal government by category of activity, rather than by agency or type of financing ...federal spending. Since federal agencies often have diverse, overlapping responsibilities , it is not uncommon for them to be associated with multiple...agency responsible for approximately 96% of spending within the National Defense Budget (050). Defense Primer: The National Defense Budget Function

  1. Tough Policies, Incredible Policies?

    OpenAIRE

    Andres Velasco; Alejandro Neut

    2003-01-01

    We revisit the question of what determines the credibility of macroeconomic policies here, of promises to repay public debt. Almost all thinking on the issue has focused on governments' strategic decision to default (or erode the value of outstanding debt via inflation/devaluation). But sometimes governments default not because they want to, but because they cannot avoid it: adverse shocks leave them no option. We build a model in which default/devaluation can occur deliberately (for strategi...

  2. The Use of Degenerate Primers in qPCR Analysis of Functional Genes Can Cause Dramatic Quantification Bias as Revealed by Investigation of nifH Primer Performance.

    Science.gov (United States)

    Gaby, John Christian; Buckley, Daniel H

    2017-10-01

    The measurement of functional gene abundance in diverse microbial communities often employs quantitative PCR (qPCR) with highly degenerate oligonucleotide primers. While degenerate PCR primers have been demonstrated to cause template-specific bias in PCR applications, the effect of such bias on qPCR has been less well explored. We used a set of diverse, full-length nifH gene standards to test the performance of several universal nifH primer sets in qPCR. We found significant template-specific bias in all but the PolF/PolR primer set. Template-specific bias caused more than 1000-fold mis-estimation of nifH gene copy number for three of the primer sets and one primer set resulted in more than 10,000-fold mis-estimation. Furthermore, such template-specific bias will cause qPCR estimates to vary in response to beta-diversity, thereby causing mis-estimation of changes in gene copy number. A reduction in bias was achieved by increasing the primer concentration. We conclude that degenerate primers should be evaluated across a range of templates, annealing temperatures, and primer concentrations to evaluate the potential for template-specific bias prior to their use in qPCR.

  3. Heterologous microsatellite primer pairs informative for the whole genus Arachis

    Directory of Open Access Journals (Sweden)

    Andrea Akemi Hoshino

    2006-01-01

    Full Text Available The genus Arachis currently comprises 69 described species, some of which have potential and real value as human and animal foods. These Arachis species have been collected and maintained in germplasm banks to provide material that can be used as sources of genes in breeding programs and for the selection of new cultivars. One of the principal objectives of germplasm conservation is the evaluation of genetic variability, which is best conducted using molecular markers. We investigated the use of heterologous primers to amplify microsatellite loci that could be used to evaluate genetic variability in Arachis germplasm. Fifteen microsatellite primer pairs were tested in 76 accessions of 34 species from the nine Arachis sections. The data indicated that heterologous primers were very useful in Arachis since they had high transferability among the species (91% and allowed the amplification of very polymorphic putative loci, which allowed both the characterization of most accessions and to make inferences about the mating systems of some species analyzed. Our data also revealed that the germplasm analyzed showed high variability, even when represented by few accessions.

  4. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  5. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  6. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  7. The argument for pharmaceutical policy

    DEFF Research Database (Denmark)

    Traulsen, Janine Morgall; Almarsdóttir, Anna Birna

    2005-01-01

    of pharmacy and it is therefore imperative that it be understood, discussed and debated within the pharmacy profession and included in the curriculum of schools of pharmacy. This, the first article in a series, argues for the importance of the academic discipline of pharmaceutical policy analysis...... pharmaceutical policy is made; pharmaceutical policy as a dynamic process; and the new public health as a global issue. The article ends with a short description of the remaining five articles in the series which will deal with important aspects of pharmaceutical policy. The topics include: economic pressures...

  8. Descriptive analysis of immunization policy decision making in the Americas Análisis descriptivo de la toma de decisión sobre políticas de vacunación en las Américas

    Directory of Open Access Journals (Sweden)

    Julianne E. Burns

    2009-11-01

    Full Text Available OBJECTIVES: Reducing and eliminating vaccine-preventable diseases requires evidence-based and informed policy decision making. Critical to determining the functionality of the decision-making process for introduction of a new vaccine is understanding the role of the national immunization technical advisory group (ITAG in each country. The aim of this study is to document the current situation of national level immunization policy decision making for use in the Pan American Health Organization (PAHO ProVac Initiative. METHODS: A structured 66-variable questionnaire developed by the World Health Organization (WHO in collaboration with the University of Ottawa was distributed to all WHO regions; it was composed of dichotomous, multiple-choice, and open-ended questions. Questionnaires were e-mailed or faxed to the six WHO regional offices and the offices distributed them to all member states. This paper analyzes surveys from the Americas as part of PAHO's ProVac Initiative. RESULTS: Twenty-nine countries of the Americas answered the survey. They conveyed that immunization policy making needed to be improved and further supported by organizations such as PAHO. Areas of improvement ranged from organization and technical support to strengthening capacity and infrastructure to improved coordination among stakeholders. This survey also highlighted a variety of ITAG processes that need further investigation. CONCLUSION: This survey supports the efforts of PAHO's ProVac Initiative to disseminate knowledge and best practices for an immunization policy decision-making framework through the development of clear definitions and guidelines. By highlighting each problem noted in this study, ProVac will assist countries in Latin America and the Caribbean to build national capacity for making evidence-based decisions about introduction of new vaccines.OBJETIVOS: Para reducir y eliminar las enfermedades prevenibles por vacunación se requiere tomar decisiones

  9. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    Directory of Open Access Journals (Sweden)

    Caty Martínez B

    2009-04-01

    Full Text Available Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC y primer intervalo de parto (PIDP en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de variación. En el análisis se consideraron los efectos de año de parto, época de parto, edad al primer parto (no se consideró para EPP, sexo de la cría, grupo racial y peso a los 24 meses. Resultados. La media para la EPP y PIDP fue de 38.9 ± 3.9 meses y 469.2 ± 9 días, respectivamente, donde el efecto época de parto, fue significativo para la duración del PIDP. Los efectos sexo de la cría, peso a los 24 meses y época, no fueron significativos sobre la EPP. Los efectos año de parto, edad al primer parto, sexo de la cría, peso a los 24 meses no fueron significativos sobre el PIDP. Conclusiones. La EPP y PIDP fueron afectados por el año y la época de parto, respectivamente.

  10. Museum audio description

    OpenAIRE

    Martins, Cláudia Susana Nunes

    2011-01-01

    Audio description for the blind and visually impaired has been around since people have described what is seen. Throughout time, it has evolved and developed within different media, starting with reality and daily life, moving into the cinema and television, then across other performing arts, museums and art galleries, and public places. Thus, academics and entertainment providers have developed a growing interest for audio description, especially in what concerns the best methods and strateg...

  11. GLOBAL POSITIONING SYSTEMS GPS TECHNOLOGY PRIMER, EPA POLICIES AND PROCEDURES, AND QA CONSIDERATION

    Science.gov (United States)

    Onsite analyses are critical to making timely decisions. The results of these decisions may not be realized for many years. in order to increase the value of onsite analyses and to create and utilize meaningful environmental models, the Environmental Protection Agency (EP...

  12. Primer on climate change and sustainable development: facts, policy analysis, and applications

    National Research Council Canada - National Science Library

    Munasinghe, Mohan; Swart, Rob

    2005-01-01

    ... between climate change and sustainable development. Building on the main findings of the last series of Intergovernmental Panel on Climate Change (IPCC) assessment reports, in which both authors were involved, the book summarizes the latest research linking the two. Our current knowledge of the basic science of climate change is described, be...

  13. Reliability of semiology description.

    Science.gov (United States)

    Heo, Jae-Hyeok; Kim, Dong Wook; Lee, Seo-Young; Cho, Jinwhan; Lee, Sang-Kun; Nam, Hyunwoo

    2008-01-01

    Seizure semiology is important for classifying patients' epilepsy. Physicians usually get most of the seizure information from observers though there have been few reports on the reliability of the observers' description. This study aims at determining the reliability of observers' description of the semiology. We included 92 patients who had their habitual seizures recorded during video-EEG monitoring. We compared the semiology described by the observers with that recorded on the videotape, and reviewed which characteristics of the observers affected the reliability of their reported data. The classification of seizures and the individual components of the semiology based only on the observer-description was somewhat discordant compared with the findings from the videotape (correct classification, 85%). The descriptions of some ictal behaviors such as oroalimentary automatism, tonic/dystonic limb posturing, and head versions were relatively accurate, but those of motionless staring and hand automatism were less accurate. The specified directions by the observers were relatively correct. The accuracy of the description was related to the educational level of the observers. Much of the information described by well-educated observers is reliable. However, every physician should keep in mind the limitations of this information and use this information cautiously.

  14. Rapid identification of Zygosaccharomyces with genus-specific primers.

    Science.gov (United States)

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Status of corrosions protection primers for the automotive industry

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann-Loeser, P. [Adam Opel AG, Ruesselsheim (Germany); Schnell, A. [DaimlerChrysler, Werk Sindelfingen (Germany); Stellnberger, K.H.; Androsch, F.M. [voestalpine Stahl, Linz (Austria); Reier, T. [SZMF, Salzgitter (Germany); Lewandowski, J. [ThyssenKrupp Stahl, Duisburg (Germany); Filthaut, C. [DOC Dortmunder OberflaechenCentrum, Dortmund (Germany); Besseyrias, A. [Arcelor / R and D LEDEPP, Florange (France); Dane, C. [Corus, Ijmuiden (Netherlands); Steinbeck, G. [Steel Institute VDEh, Duesseldorf (Germany)

    2005-07-01

    In Europe, 2.5 - 4 {mu}m Zn-pigmented corrosion protection primers (CPP) are being used by the automotive industry. A short introduction describing the development steps leading up to the state of the art will be given and also the reasons for using it in practice. For some applications it became necessary to try to achieve a significantly higher level of corrosion resistance than this ''first generation'' type coating can offer. It was also important to lower the curing temperature of the paint considerably in order to be able to supply bake-hardening grade steels. This type of corrosion protection primer is now called the ''second generation''. The Opel-production of the Astra-family started using 2{sup nd} generation CPP (4-6 {mu}m) on chromate-free pre-treatment and EG for hood and crash box in 2004. The newest developments show a high potential to lower the coating thickness even further and thus make cost savings possible. The development process is still ongoing and for effective progress, a good mutual basis for laboratory evaluation of properties is of valuable support. In a Steel Institute VDEh working group (Arcelor, Corus, Salzgitter, ThyssenKrupp, voestalpine), test procedures are being generated in order to be able to correctly assess properties such as corrosion resistance, adhesion, peeling-off behavior, etc. An overview of the procedures will be given together with correlations between laboratory results and reality. To round up the paper, corrosion protection primers have a number of potentials which can be utilized by the automotive industry to justify the additional cost. Examples highlighted with results giving evidence of these potentials will be shown. (orig.)

  16. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  17. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    Science.gov (United States)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.

    2009-01-01

    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  18. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  19. Shining On: A primer on solar radiation data

    Energy Technology Data Exchange (ETDEWEB)

    Dunlap, M.A.; Cook, G. [eds.; Marion, B.; Riordan, C.; Renne, D.

    1992-05-01

    This document is a primer on solar radiation data. General uses of solar energy are presented. The manner in which solar radiation data is used to aid engineers in optimizing the use of solar thermal conversion and photovoltaic conversion is discussed. Methods for acquiring and assimilating the solar radiation data are illustrated. This would include the design and use of pyranometers and pyrheliometers. Seasonal and geographical variations in solar flux reaching the earth are evaluated. Other uses of compiled data include the determination of meteorological impacts of atmospheric disturbances such as volcano eruptions.

  20. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  1. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  2. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  3. Primer reporte de la familia Cheiridiidae (Arachnida: Pseudoscorpionida en Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alexander Quirós-Rodríguez

    2015-09-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  4. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  5. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  6. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  8. Olkiluoto site description 2011

    International Nuclear Information System (INIS)

    2012-12-01

    This fourth version of the Olkiluoto Site Report, produced by the OMTF (Olkiluoto Modelling Task Force), updates the Olkiluoto Site Report 2008 with the data and knowledge obtained up to December 2010. A descriptive model of the site (the Site Descriptive Model, SDM), i.e. a model describing the geological and hydrogeological structure of the site, properties of the bedrock and the groundwater and its flow, and the associated interacting processes and mechanisms. The SDM is divided into six parts: surface system, geology, rock mechanics, hydrogeology, hydrogeochemistry and transport properties

  9. CRAC2 model description

    International Nuclear Information System (INIS)

    Ritchie, L.T.; Alpert, D.J.; Burke, R.P.; Johnson, J.D.; Ostmeyer, R.M.; Aldrich, D.C.; Blond, R.M.

    1984-03-01

    The CRAC2 computer code is a revised version of CRAC (Calculation of Reactor Accident Consequences) which was developed for the Reactor Safety Study. This document provides an overview of the CRAC2 code and a description of each of the models used. Significant improvements incorporated into CRAC2 include an improved weather sequence sampling technique, a new evacuation model, and new output capabilities. In addition, refinements have been made to the atmospheric transport and deposition model. Details of the modeling differences between CRAC2 and CRAC are emphasized in the model descriptions

  10. Olkiluoto site description 2011

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-12-15

    This fourth version of the Olkiluoto Site Report, produced by the OMTF (Olkiluoto Modelling Task Force), updates the Olkiluoto Site Report 2008 with the data and knowledge obtained up to December 2010. A descriptive model of the site (the Site Descriptive Model, SDM), i.e. a model describing the geological and hydrogeological structure of the site, properties of the bedrock and the groundwater and its flow, and the associated interacting processes and mechanisms. The SDM is divided into six parts: surface system, geology, rock mechanics, hydrogeology, hydrogeochemistry and transport properties.

  11. The policies

    International Nuclear Information System (INIS)

    Laruelle, Ph.; Snegaroff, Th.; Moreau, S.; Tellenne, C.; Brunel, S.

    2005-01-01

    Fourth chapter of the book on the geo-policy of the sustainable development, this chapter deal with the different and international policies concerned by the problem. The authors analyze the american energy attitude and policy, the economical equilibrium facing the environmental equilibrium for the european policy, the sanctified and sacrificed nature and the japanese attitude, India and China, the great fear of the 21 century and the sustainable development in Africa. (A.L.B.)

  12. Generalizing: The descriptive struggle

    Directory of Open Access Journals (Sweden)

    Barney G. Glaser, Ph.D.; Hon Ph.D.

    2006-11-01

    Full Text Available The literature is not kind to the use of descriptive generalizations. Authors struggle and struggle to find and rationalize a way to use them and then fail in spite of trying a myriad of work-arounds. And then we have Lincoln and Guba’s famous statement: “The only generalization is: there is no generalization” in referring to qualitative research. (op cit, p. 110 They are referring to routine QDA yielding extensive descriptions, but which tacitly include conceptual generalizations without any real thought of knowledge about them. In this chapter I wish to explore this struggle for the purpose of explaining that the various contra arguments to using descriptive generalizations DO NOT apply to the ease of using conceptual generalizations yielded in SGT and especially FGT. I will not argue for the use of descriptive generalization. I agree with Lincoln and Guba with respect to QDA, “the only generalization is: there is no generalization.” It is up to the QDA methodologists, of whom there are many; to continue the struggle and I wish them well.

  13. Tore Supra: technical description

    International Nuclear Information System (INIS)

    1985-08-01

    This report is aimed, after a brief recall of physics and technologic perspectives of Tore Supra, at giving a detailed description of the basic machine; details of each component are defined. Volume 1 is specifically concerned with the general aspects of Tore Supra and the toroidal field system [fr

  14. Systematic Description of Sensors

    NARCIS (Netherlands)

    Regtien, Paulus P.L.; Sydenham, Peter H.; Thorn, Richard

    A sensor performs the exchange of information (thus energy) from one domain to another and therefore it operates on the interface between different physical domains. Several frameworks have been developed for a systematic description of sensors. Basically, they are based on either of two different

  15. Fractal description of fractures

    International Nuclear Information System (INIS)

    Lung, C.W.

    1991-06-01

    Recent studies on the fractal description of fractures are reviewed. Some problems on this subject are discussed. It seems hopeful to use the fractal dimension as a parameter for quantitative fractography and to apply fractal structures to the development of high toughness materials. (author). 28 refs, 7 figs

  16. MCFire model technical description

    Science.gov (United States)

    David R. Conklin; James M. Lenihan; Dominique Bachelet; Ronald P. Neilson; John B. Kim

    2016-01-01

    MCFire is a computer program that simulates the occurrence and effects of wildfire on natural vegetation, as a submodel within the MC1 dynamic global vegetation model. This report is a technical description of the algorithms and parameter values used in MCFire, intended to encapsulate its design and features a higher level that is more conceptual than the level...

  17. Dry Cleaning, Course Description.

    Science.gov (United States)

    Briscoe, Albert J.; Anderson, Floyd L.

    This course description was developed by educators for use at the Work Opportunity Center which was established to teach high school dropouts and/or hard-core unemployed youth. The ultimate objectives of this course are to prepare students for employment in dry cleaning occupations and to assist them in completing their high school graduation…

  18. Business Education, Course Description.

    Science.gov (United States)

    O'Neill, Robert; Anderson, Floyd L.

    This course description was developed by educators for use at the Work Opportunity Center in teaching high school dropouts and hard-core unemployed youth. The ultimate objectives of the business education curriculum at the Center are to prepare students for employment in clerical occupations and to assist them in completing their high school…

  19. Communications, Course Description.

    Science.gov (United States)

    Vickstrom, Sandra E.; Anderson, Floyd L.

    This course description was developed by educators for use at the Work Opportunity Center which was established to teach high school dropouts and/or hardcore unemployed youth. The ultimate objectives of this curriculum are to develop communicative skills necessary for social interaction and to help the student complete high school graduation…

  20. Reading, Course Description.

    Science.gov (United States)

    Decker, George; Anderson, Floyd L.

    This course description was developed by educators for use at the Work Opportunity Center which was established to teach high school dropouts and hard-core unemployed youth. The objectives of this reading curriculum are to develop skills of retarded readers, further develop skills of adequate readers, and develop an appreciation for reading.…

  1. Updating action domain descriptions.

    Science.gov (United States)

    Eiter, Thomas; Erdem, Esra; Fink, Michael; Senko, Ján

    2010-10-01

    Incorporating new information into a knowledge base is an important problem which has been widely investigated. In this paper, we study this problem in a formal framework for reasoning about actions and change. In this framework, action domains are described in an action language whose semantics is based on the notion of causality. Unlike the formalisms considered in the related work, this language allows straightforward representation of non-deterministic effects and indirect effects of (possibly concurrent) actions, as well as state constraints; therefore, the updates can be more general than elementary statements. The expressivity of this formalism allows us to study the update of an action domain description with a more general approach compared to related work. First of all, we consider the update of an action description with respect to further criteria, for instance, by ensuring that the updated description entails some observations, assertions, or general domain properties that constitute further constraints that are not expressible in an action description in general. Moreover, our framework allows us to discriminate amongst alternative updates of action domain descriptions and to single out a most preferable one, based on a given preference relation possibly dependent on the specified criteria. We study semantic and computational aspects of the update problem, and establish basic properties of updates as well as a decomposition theorem that gives rise to a divide and conquer approach to updating action descriptions under certain conditions. Furthermore, we study the computational complexity of decision problems around computing solutions, both for the generic setting and for two particular preference relations, viz. set-inclusion and weight-based preference. While deciding the existence of solutions and recognizing solutions are PSPACE-complete problems in general, the problems fall back into the polynomial hierarchy under restrictions on the additional

  2. Primer for evaluating ecological risk at petroleum release sites.

    Science.gov (United States)

    Claff, R

    1999-02-01

    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response.

  3. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  4. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  5. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  6. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  7. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  8. Effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers.

    Science.gov (United States)

    Chen, Liang; Shen, Hong; Suh, Byoung In

    2013-11-01

    Some silane primers and some zirconia primers contain extra resins such as bisphenol A glycol dimethacrylate (BisGMA) in their formulations for better wetting. No studies exist on the bonding properties of zirconia and silane primers, which contain extra resins. The purpose of this study was to investigate the effect of incorporating BisGMA resin on the bonding properties of silane and zirconia primers. Silica-base lithium disilicate was etched and treated with BisGMA-incorporated Porcelain Primer, unmodified Porcelain Primer, or resin-containing Kerr Silane. Zirconia ceramic was airborne-particle abraded and treated with BisGMA-incorporated Monobond Plus, unmodified Monobond Plus, or BisGMA-containing ZPrime Plus. After primer treatment and cleaning with ethanol, the contact angles were measured to determine surface change (n=10). Shear bond strength tests were also performed to measure the adhesion strength between resin cements and ceramic surfaces (n=10). Data were statistically analyzed by 1-way ANOVA followed by the Tukey multiple comparison as a post hoc test (significance level .05). The incorporation of BisGMA resin did not significantly influence the bond strength or contact angle of the zirconia primer (P>.05), but it did significantly reduce those of the silane primer (PSilane (22 degrees, 23 MPa) had a similar contact angle and higher bond strength than the control (21 degrees, 18 MPa), but lower than Porcelain Primer (88 degrees, 34 MPa). Resin-containing ZPrime Plus (75 degrees, 29 MPa) had a similar contact angle and higher bond strength than both Monobond Plus (74 degrees, 18 MPa) and the control (15 degrees, 4 MPa). The addition of BisGMA resin significantly inhibited the efficacy of silane-containing porcelain primers but did not affect that of phosphate-containing zirconia primers. Copyright © 2013 Editorial Council for the Journal of Prosthetic Dentistry. Published by Mosby, Inc. All rights reserved.

  9. Studi Operasi Resin Penukar Ion Dalam Sistem Purifikasi Air Primer Pwr

    OpenAIRE

    Biyantoro, Dwi; Basuki, Kris Tri; Subagiono, Subagiono

    2006-01-01

    STUDI OPERASI RESIN PENUKAR ION DALAM SISTEM PURIFIKASI AIR PRIMER PWR. Telah dilakukan studioperasi resin penukar ion dalam sistem purifikasi air primer PWR. Air pendingin reaktor yang pada awalnya sesuaidengan persyaratan setelah pengoperasian reaktor sering kualitasnya berubah, sehingga harus dimurnikan. Unsurunsurpengotor dalam air primer PWR diidentifikasi sebagai penyebab pengotor seperti korosi, pelepasan produk fisi(Cs137, Sr90, Co60,C14, Tc99), dan pelepasan kembali unsur oleh resin ...

  10. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    -chain, the immunoglobulin kappa light chain, and the c-myc locus. Whereas none of the mutants were found to revert to tRNAPro primer utilization, in two tumors resulting from the injection of the SL3-3 Lys3 mutant the primer binding site was altered to match that of a new primer species, tRNA1,2Lys. In addition...

  11. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    Energy Technology Data Exchange (ETDEWEB)

    Naus, Dan J [ORNL

    2007-02-01

    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program.

  12. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    International Nuclear Information System (INIS)

    Naus, Dan J.

    2007-01-01

    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program

  13. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  14. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    Protection of steel structures, using so-called intumescent coatings, is an efficient and space saving way to prolong the time before a building, with load bearing steel constructions, collapses in the event of a fire. In addition to the intumescent coating, application of a primer may be required....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  15. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  16. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Quality Assurance Program Description

    Energy Technology Data Exchange (ETDEWEB)

    Halford, Vaughn Edward [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ryder, Ann Marie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-07-01

    Effective May 1, 2017, led by a new executive leadership team, Sandia began operating within a new organizational structure. National Technology and Engineering Solutions of Sandia (Sandia’s) Quality Assurance Program (QAP) was established to assign responsibilities and authorities, define workflow policies and requirements, and provide for the performance and assessment of work.

  18. Excursions in technology policy

    Science.gov (United States)

    Archibald, Robert B.

    1995-01-01

    This technical report presents a summary of three distinct projects: (1) Measuring economic benefits; (2) Evaluating the SBIR program; and (3) A model for evaluating changes in support for science and technology. the first project deals with the Technology Applications Group (TAG) at NASA Langley Research Center. The mission of TAG is to assist firms interested in commercializing technologies. TAG is a relatively new group as is the emphasis on technology commercialization for NASA. One problem faced by TAG and similar groups at other centers is measuring their effectiveness. The first project this summer, a paper entitled, 'Measuring the Economic Benefits of Technology Transfer from a National Laboratory: A Primer,' focused on this measurement problem. We found that the existing studies of the impact of technology transfer on the economy were conceptually flawed. The 'primer' outlines the appropriate theoretical framework for measuring the economic benefits of technology transfer. The second project discusses, one of the programs of TAG, the Small Business Innovation Research (SBIR) program. This program has led to over 400 contracts with Small Business since its inception in 1985. The program has never been evaluated. Crucial questions such as those about the extent of commercial successes from the contracts need to be answered. This summer we designed and implemented a performance evaluation survey instrument. The analysis of the data will take place in the fall. The discussion of the third project focuses on a model for evaluating changes in support for science and technology. At present several powerful forces are combining to change the environment for science and technology policy. The end of the cold war eliminated the rationale for federal support for many projects. The new- found Congressional conviction to balance the budget without tax increases combined with demographic changes which automatically increase spending for some politically popular programs

  19. Use of force in private security: a primer.

    Science.gov (United States)

    Mains, Paul

    2006-01-01

    The need for private security to provide an effective response to physical threats has become more important, according to the author. Both the security director and administrator, he states, must determine an effective policy in advance. The article outlines such a use of force policy as well as discussing other considerations that are involved in carrying it out.

  20. Multidimensional nonlinear descriptive analysis

    CERN Document Server

    Nishisato, Shizuhiko

    2006-01-01

    Quantification of categorical, or non-numerical, data is a problem that scientists face across a wide range of disciplines. Exploring data analysis in various areas of research, such as the social sciences and biology, Multidimensional Nonlinear Descriptive Analysis presents methods for analyzing categorical data that are not necessarily sampled randomly from a normal population and often involve nonlinear relations. This reference not only provides an overview of multidimensional nonlinear descriptive analysis (MUNDA) of discrete data, it also offers new results in a variety of fields. The first part of the book covers conceptual and technical preliminaries needed to understand the data analysis in subsequent chapters. The next two parts contain applications of MUNDA to diverse data types, with each chapter devoted to one type of categorical data, a brief historical comment, and basic skills peculiar to the data types. The final part examines several problems and then concludes with suggestions for futu...

  1. Descriptive sensory evaluations

    DEFF Research Database (Denmark)

    Dehlholm, Christian

    in projective mapping frame geometry and restrictions on the reported semantics. Two rapid descriptive evaluation techniques were proposed to represent a consensus evaluation. One of the approaches, ‘consensus attribute rating’ (CAR), allows a group of assessors to rate products on a list of pre......-selected attributes. The other approach, ‘consensus Napping’, allows a group of assessors to project products according to an agreed consensus placement on a paper sheet. Evaluations were performed either by groups of experienced sensory assessors or by product experts. Compared with conventional profiling techniques......, the evaluations showed significant correlations between some product configurations, but no consistent and systematic similarities. On average, product expert groups had less in common with the reference profiles than the trained panellist groups and the semantic descriptions of products varied to a large degree...

  2. Descriptive sensory evaluations

    DEFF Research Database (Denmark)

    Dehlholm, Christian

    A recent trend in descriptive sensory evaluation methodology has been the application of rapid evaluation techniques. The ease in use makes the techniques extremely easy to implement by industry and university environments. Thus, one might not consider validity in the choice of method. The overall...... in projective mapping frame geometry and restrictions on the reported semantics. Two rapid descriptive evaluation techniques were proposed to represent a consensus evaluation. One of the approaches, ‘consensus attribute rating’ (CAR), allows a group of assessors to rate products on a list of pre...... for all groups. Hence, consensus profiling with untrained assessors should not be used for the purpose of considering consistency between panels, while assessors trained in the product may perform more reliably. As for projective mapping variations of frame geometry, evaluations in a rectangular...

  3. Resource Description Framework (RDF)

    OpenAIRE

    Gibbins, Nicholas; Shadbolt, Nigel

    2009-01-01

    The Resource Description Framework (RDF) is the standard knowledge representation language for the Semantic Web, an evolution of the World Wide Web that aims to provide a well-founded infrastructure for publishing, sharing and querying structured data. This article provides an introduction to RDF and its related vocabulary definition language RDF Schema, and explains its relationship with the OWL Web Ontology Language. Finally, it provides an overview of the historical development of RDF and ...

  4. TMACS system description

    International Nuclear Information System (INIS)

    Scaief, C.C.

    1995-01-01

    This document provides a description of the Tank Monitor and Control System (TMACS). It is intended as an introduction for those persons unfamiliar with the system as well as a reference document for the users, maintenance personnel, and system designers. In addition to describing the system, the document outlines the associated drawing documentation, provides maintenance and spare parts information, and discusses other TMACS documents that provide additional detail

  5. XML Diagnostics Description Standard

    International Nuclear Information System (INIS)

    Neto, A.; Fernandes, H.; Varandas, C.; Lister, J.; Yonekawa, I.

    2006-01-01

    A standard for the self-description of fusion plasma diagnostics will be presented, based on the Extensible Markup Language (XML). The motivation is to maintain and organise the information on all the components of a laboratory experiment, from the hardware to the access security, to save time and money when problems arises. Since there is no existing standard to organise this kind of information, every Association stores and organises each experiment in different ways. This can lead to severe problems when the organisation schema is poorly documented or written in national languages. The exchange of scientists, researchers and engineers between laboratories is a common practice nowadays. Sometimes they have to install new diagnostics or to update existing ones and frequently they lose a great deal of time trying to understand the currently installed system. The most common problems are: no documentation available; the person who understands it has left; documentation written in the national language. Standardisation is the key to solving all the problems mentioned. From the commercial information on the diagnostic (component supplier; component price) to the hardware description (component specifications; drawings) to the operation of the equipment (finite state machines) through change control (who changed what and when) and internationalisation (information at least in the native language and in English), a common XML schema will be proposed. This paper will also discuss an extension of these ideas to the self-description of ITER plant systems, since the problems will be identical. (author)

  6. Ab Initio Atomistic Thermodynamics for Surfaces: A Primer

    National Research Council Canada - National Science Library

    Rogal, Jutta; Reuter, Karsten

    2006-01-01

    .... Modern electronic structure theory methods like density-functional theory (DFT) have matured, allowing a description that is often already accurate enough to allow for a modeling with predictive character...

  7. Invalidating Policies using Structural Information

    DEFF Research Database (Denmark)

    Kammuller, Florian; Probst, Christian W.

    2013-01-01

    Insider threats are a major threat to many organisations. Even worse, insider attacks are usually hard to detect, especially if an attack is based on actions that the attacker has the right to perform. In this paper we present a step towards detecting the risk for this kind of attacks by invalida...... on these examples, the organisation can identify real attack vectors that might result in an insider attack. This information can be used to refine access control system or policies....... by invalidating policies using structural information of the organisational model. Based on this structural information and a description of the organisation's policies, our approach invalidates the policies and identifies exemplary sequences of actions that lead to a violation of the policy in question. Based...

  8. Discussing harm-causing errors with patients: an ethics primer for plastic surgeons.

    Science.gov (United States)

    Vercler, Christian J; Buchman, Steven R; Chung, Kevin C

    2015-02-01

    Plastic surgery is a field that demands perfection, yet despite our best efforts errors occur every day. Most errors are minor, but occasionally patients are harmed by our mistakes. Although there is a strong ethical requirement for full disclosure of medical errors, data suggest that surgeons have a difficult time disclosing errors and apologizing. "Conventional wisdom" has been to avoid frank discussion of errors with patients. This concept is fueled by the fear of litigation and the notion that any expression of apology leads to malpractice suits. Recently, there has been an increase in the literature pointing to the inadequacy of this approach. Policies that require disclosure of harm-causing medical errors to the patient and the family, apology, and an offer of compensation cultivate the transparency necessary for quality improvement efforts as well as the positive moral development of trainees. There is little published in the plastic surgery literature regarding error disclosure to provide guidance to practitioners. In this article, we will review the ethical, therapeutic, and practical issues involved in discussing the error with the patient and apologizing by presenting a representative case. This primer will provide an understanding of the definition of medical error, the ethical support of error disclosure, the barriers to disclosure, and how to overcome those barriers.

  9. A Primer on Concepts and Applications of Proteomics in Neuroscience.

    Science.gov (United States)

    Hosp, Fabian; Mann, Matthias

    2017-11-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS)-based proteomics, focusing on the analysis of whole proteomes, protein-based interactions, and post-translational modifications. We also discuss how advanced workflows help to unravel spatial, regulatory, and temporal aspects of neuronal systems. These tools and approaches have already led to detailed and quantitative proteomic maps of the brain and its signaling architecture, generating new insights into health and disease. We predict that these new approaches will also accelerate biomarker discovery and contribute to novel therapeutics for neurodegenerative and other brain-related diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  11. El Primer Congreso de la Cultura del Olivo

    Directory of Open Access Journals (Sweden)

    Criado Costa, Joaquín

    2008-06-01

    Full Text Available It is studied the notification, the organization and the development of the First Conference on the Olive Culture as an activity shared by the CECEL, the Institute of Jaen Studies, the Institute of La Mancha Studies and the Royal Academy of Science, Fine Literature and Noble Arts of Cordoba with the support of Jaen Provincial Council.Se estudia la convocatoria, organización y desarrollo del Primer Congreso de la Cultura del Olivo como actividad conjunta de la CECEL, el Instituto de Estudios Jiennenses, el Instituto de Estudios Manchegos y la Real Academia de Ciencias, Bellas Letras y Nobles Artes de Córdoba, con el patrocinio de la Diputación Provincial de Jaén.

  12. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, L.S.; Garcia, G. [UASLP, San Luis Potosi (Mexico). Inst. of Metallurgy]|[UNLP, La Plata (Argentina); Lopez, C. [Univ. Autonoma de Campeche (Mexico)

    1998-12-31

    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  13. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  14. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  15. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  16. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  17. [Influence of primers ' chemical composition on shear bond strength of resin cement to zirconia ceramic].

    Science.gov (United States)

    Łagodzińska, Paulina; Bociong, Kinga; Dejak, Beata

    2014-01-01

    Resin cements establish a strong durable bond between zirconia ceramic and hard tissues of teeth. It is essential to use primers with proper chemical composition before cementation. The aim of this study was to assess the influence of primer's chemical composition on the shear bond strength of zirconia ceramic to resin cements. 132 zirconia specimens were randomly assigned to four groups. There were four resin systems used. They included resin cement and respective primer, dedicated to zirconia: Clearfil Ceramic Primer/Panavia F2.0, Monobond Plus/Multilink Automix, AZ - Primer/ResiCem, Z - Prime Plus/Duo-Link. In each group the protocol of cementation was as follows: application of primer to the zirconia surface and application of the respective resin cement in cylindric mold (dimensions: 3.0 mm height and 3.0 mm diameter). Then, the shear bond strength was evaluated and the failure type was assessed in lupes (×2.5 magnification), also random specimens under SEM. The Wilcoxon test was used to analyze the data, the level of significance was α = 0.05. Finally, the known chemical composition of each primer was analysed in reference to probable chemical bonds, which may occure between primers and zirconia. The mean shear bond strength between resin cements and zirconia was the highest for Z-Prime Plus/Duo-Link (8.24 ± 3,21 MPa) and lowest for Clearfil Ceramic Primer/Panavia F 2.0 (4.60 ± 2.21 MPa). The analysis revealed significant difference between all groups, except pair Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem. The failure type in groups of Clearfil Ceramic Primer/Panavia F 2.0 and AZ-Primer/ResiCem was mainly adhesive, in groups Monobond Plus/ /Multilink Automix and Z-Prime Plus/Duo-Link mainly mixed. The chemical composition of primers affects different bond mechanisms between resin cements and zirconia. The highest shear bond strength of resin cement to zirconia can be obtained for the primer composed of 10-Methacryloyloxydecyl dihydrogen

  18. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  19. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  20. From Description to prescription

    DEFF Research Database (Denmark)

    Müller, Anders Riel; Doucette, Jamie

    the Weberian foundations on which much developmental state theory is based, the policy version of the developmental state promoted by the KSP and cognate initiatives risks conflating Korea’s developmental expertise to a value-based mentalité that obscures social-spatial processes of authoritarian social...... produced and applied in problematic and decontextualized fashion that raises questions about just how ‘alternative’ Korea’s developmental expertise might be compared to other, market-oriented forms of development....

  1. Addition of Na2CO3 Improves the Shelf Life of Experimental 4-META Self-etch Primer.

    Science.gov (United States)

    Matsumoto, Hiro; Yamamoto, Takatsugu; Hanabusa, Masao; Momoi, Yasuko; Hayakawa, Tohru

    2017-01-01

    The objective of this study was to assess the influence of the addition of Na2CO3 on the shelf life and bond strength of 4-META self-etch primer. Two 4-META self-etch primers were experimentally formulated with and without the addition of Na2CO3 (primer A and primer B, respectively). The primers were stored at 37°C for several periods of time after formulation. Clearfil SE Bond Primer (Kuraray Noritake Dental) was used as a control. A composite was bonded to bovine dentin using a combination of the primer and a bonding agent (Clearfil SE Bond), and the shear bond strengths were measured. Changes in the pH of the experimental primers were monitored and macroscopic observations were made as a function of the storage periods. With 0-day storage, the bond strength of primer A was equivalent to that of primer B and significantly lower than that of Clearfil SE Primer. The bond strengths of primer A were stable during 90-day storage; by contrast, the bond strengths of primer B significantly decreased during 7-day storage. primer A exhibited stable pH values during 180-day storage; primer B exhibited significantly lower pH than primer A with 0-day storage and discolored gelation during 7-day storage. By adding Na2CO3, the shelf life of the 4-META self-etch primer was obviously improved without significant deterioration in dentin bond strength. Adjusting the pH to around 4.5 was effective for obtaining sufficient bond strength and hydrolytic stability of the primer.

  2. A legal primer for the obesity prevention movement.

    Science.gov (United States)

    Mermin, Seth E; Graff, Samantha K

    2009-10-01

    Public health advocates and scientists working on obesity prevention policy face challenges in balancing legal rights, individual freedom, and societal health goals. In particular, the US Constitution and the 50 state constitutions place limits on the ability of government to act, even in the best interests of the public. To help policymakers avoid crossing constitutional boundaries, we distilled the legal concepts most relevant to formulating policies aimed at preventing obesity: police power; allocation of power among federal, state, and local governments; freedom of speech; property rights; privacy; equal protection; and contract rights. The goal is to allow policymakers to avoid potential constitutional problems in the formation of obesity prevention policy.

  3. iRODS Primer Integrated Rule-Oriented Data System

    CERN Document Server

    Rajasekar, Arcot

    2010-01-01

    Policy-based data management enables the creation of community-specific collections. Every collection is created for a purpose. The purpose defines the set of properties that will be associated with the collection. The properties are enforced by management policies that control the execution of procedures that are applied whenever data are ingested or accessed. The procedures generate state information that defines the outcome of enforcing the management policy. The state information can be queried to validate assessment criteria and verify that the required collection properties have been con

  4. Policy Innovation in Innovation Policy

    DEFF Research Database (Denmark)

    Borras, Susana

    as with national and sub-national governments in Europe, all of them introducing interesting novelties in their innovation policy. These changes refer to different aspects of policy, mainly the content of policy initiatives towards science, technology and innovation; the instruments governments are using...... to achieve their goals; and the actors in the policy system that are being mobilised in pursuing these goals. This paper deals with these policy changes, paying special attention to the novelties introduced since the early 1990s in Europe. The perspective of this paper deals mainly on the changes introduced...... at the EU level, and mentions similar trends taking place at national and sub-national levels. The questions that guide the contents here are essentially three, namely, what are the main traits of innovation policies in Europe since the 1990s and how have the EU and different national governments approached...

  5. MCO Monitoring activity description

    International Nuclear Information System (INIS)

    SEXTON, R.A.

    1998-01-01

    Spent Nuclear Fuel remaining from Hanford's N-Reactor operations in the 1970s has been stored under water in the K-Reactor Basins. This fuel will be repackaged, dried and stored in a new facility in the 200E Area. The safety basis for this process of retrieval, drying, and interim storage of the spent fuel has been established. The monitoring of MCOS in dry storage is a currently identified issue in the SNF Project. This plan outlines the key elements of the proposed monitoring activity. Other fuel stored in the K-Reactor Basins, including SPR fuel, will have other monitoring considerations and is not addressed by this activity description

  6. Description logic rules

    CERN Document Server

    Krötzsch, M

    2010-01-01

    Ontological modelling today is applied in many areas of science and technology,including the Semantic Web. The W3C standard OWL defines one of the most important ontology languages based on the semantics of description logics. An alternative is to use rule languages in knowledge modelling, as proposed in the W3C's RIF standard. So far, it has often been unclear how to combine both technologies without sacrificing essential computational properties. This book explains this problem and presents new solutions that have recently been proposed. Extensive introductory chapters provide the necessary

  7. Informed policies

    International Development Research Centre (IDRC) Digital Library (Canada)

    cation technology (ICT) and now. Minister of Science and Technology, was one of the architects of Mozam- bique's ICT policy in 2000 — the first in Africa. Nationwide access to these technologies is one of the pillars of the government's science and technology policy. “We don't believe in politicians, but we believe in politics.

  8. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Science.gov (United States)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  9. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  10. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  11. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  12. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  13. Supplementary table 6. Primers used in real-time PCR for relative ...

    Indian Academy of Sciences (India)

    pushpa

    Supplementary table 6. Primers used in real-time PCR for relative expression analysis of osa-miR399i and osa-miR530 and their predicted target genes. Gene Locus. Primer sequence. TTGTTGGACATGCTCGTGACA. LOC_Os05g48390. TGGTGACAAGCTTCGGCAA. CGTGTGGAGGATTGTATGCATG. LOC_Os01g54480.

  14. Comparing the Accuracy Rate of Two Different Universal Primers in Enteric Pathogen Diagnosis From Blood

    Directory of Open Access Journals (Sweden)

    Esmaeil Soleimani

    2014-02-01

    Full Text Available Background: Detecting enteric bacteria in blood by culture is a slow assay with low accuracy rate. PCR might be a suitable alternative assay but as several species can cause bacteremia, it is necessary to use universal primers. Objectives: In this study we evaluated and compared two pairs of universal primers in detecting four enteric bacteria in blood, which are common causes of bacteremia in human. Materials and Methods: Standard strains of E. faecalis, S. typhi, E. coli, and S. Aeruginosa, were used in this study. A serially diluted bacterial suspension of all strains was made for inoculation to four sets of defibrinated sheep blood which were used to prepare blood specimens with different bacterial contents for performing routine assay and PCR. PCR was performed using two different universal primers designed from two ribosomal genes, 16sr RNA and 23sr RNA. Results: PCR with 16sr RNA universal primer showed more accuracy rate than both blood culture and PCR with 23sr RNA universal primer. Mean time for performing PCR assay and blood culture was eight and 48 hours, respectively. Conclusions: Both PCR with 16sr RNA and 23sr RNA universal primers have more accuracy rate than blood culture and are faster in detection of bacteremia. PCR with 16sr RNA universal primer is more accurate than both PCR with 16sr RNA universal primer and blood culture for diagnosis of bacteremia.

  15. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... were used, for the screening of the transformed plants (Pietsch et al., 1997). To verify the amplification of extracted DNAs, a pair of primers CDC(a).F/CDC(a).R targeting the cell division control gene was used (Gimenez et al., 2011). The primers were synthetized using Polyplex machine (Gene machine, ...

  16. New primers for methylation-specific polymerase chain reaction enhance specificity of detecting STAT1 methylation

    Directory of Open Access Journals (Sweden)

    Ming-Cheng Chang

    2012-03-01

    Conclusion: Specific primers for methylation-specific PCR are mandatory for the accurate detection of STAT1 gene methylation. Besides, specific primers can generate correct interpretation of STAT1 gene methylation, and its correlation with the clinicopathological characteristics and outcome of cancer patients.

  17. Effects of metal primers on bonding of adhesive resin cement to noble alloys for porcelain fusing.

    Science.gov (United States)

    Okuya, Nobuhiro; Minami, Hiroyuki; Kurashige, Hisanori; Murahara, Sadaaki; Suzuki, Shiro; Tanaka, Takuo

    2010-03-01

    This study evaluated the effects of metal primers on the bonding of adhesive resin to four pure metals (Au, Pd, Ag, Cu) and two noble alloys for porcelain fusing (high-gold and high-palladium content alloys). Bonding surface was polished with 600-grit silicon carbide paper and primed with one of the three metal primers (V-Primer, Metaltite, and M.L. Primer). Bonded specimens were fabricated by applying adhesive resin (Super-Bond C&B) on the primed surface. Shear bond strength (SBS) was determined both before and after thermocycling (4-60 degrees C for 2,000 cycles). The highest SBS values to each pure metal after thermocycling were 33.5 MPa for Au by M.L. Primer, 35.0 MPa for Ag by V-Primer, and 34.4 MPa for Cu by Metaltite. SBS to high-gold content alloy after thermocycling was 33.3 MPa by M.L. Primer. None of the primers was effective for pure Pd and high-palladium content alloy after thermocycling.

  18. A comparative clinical study of the failure rate of orthodontic brackets bonded with two adhesive systems: conventional and self-etching primer (SEP).

    Science.gov (United States)

    Dominguez, Gladys Cristina; Tortamano, André; Lopes, Luiz Vicente de Moura; Catharino, Priscilla Campanatti Chibebe; Morea, Camillo

    2013-01-01

    This study compared the clinical performance of orthodontic brackets bonded with Transbond adhesive paste after two primer systems: a two-stage conventional system (acid etching + Transbond XT adhesive primer) and a single-stage self-etching primer (SEP) (Transbond Plus). The sample comprised 480 metal brackets bonded to the teeth of 24 consecutive patients treated for 36 to 48 months. A split-mouth design was used for bonding, and both systems were used in each patient. Bracket failure rates for each system were analyzed; and failure causes as reported by the patients and the quadrant of teeth for which brackets failed were recorded. The conventional system group had a failure rate of 5.41%, whereas the rate for SEP was 4.58%. In this group, there were 5 failures (38.4%) in the right maxillary quadrant, 2 (15.4%) in the left maxillary quadrant, 4 (30.8%) in the right mandibular quadrant, and 2 (15.4%) in the left mandibular quadrant. In the SEP group, there were 4 (36.4%) failures in the right maxillary quadrant, 1 (9%) in the left maxillary quadrant, 3 (27.3%) in the right mandibular quadrant, and 3 (27.3%) in the left mandibular quadrant. Results of descriptive statistical analysis and odds ratio did not show any significant differences between rates (p = 0.67). The clinical efficiency of SEP was similar to that of the conventional system.

  19. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  20. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... RNA, no direct evidence of interactions with the U-rich anticodon loop of tRNALys3 has been described to date. Here we address the question of the potential role of the interactions between these highly structured regions in the initiation of viral DNA synthesis. To evaluate this we used an antisense...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...

  1. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  2. From policy to reality

    DEFF Research Database (Denmark)

    Ditlevsen, Kia; Reventlow, Susanne; Nielsen, Annemette Ljungdalh

    2016-01-01

    visitors and which complicate implementation of the policies of the Danish health authorities. Findings show that the current system is not well equipped to treat early overweight. A gap in primary preventive health care for children at age 3–5, indistinct lines of responsibility, inadequate cooperation......, and lack of resources together make it difficult for health care professionals to initiate interventions and reach the children in need of support. By analyzing the policy implementation process in a theoretical framework that discloses the discursive allocation of responsibilities, the study is able...... to provide a deeper description and analysis of the problem. The study makes it clear how preventive health care for overweight children rests on the negotiation of formal and performed responsibilities among health practitioners within a framework of scarce resources and communication deficit....

  3. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    Science.gov (United States)

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  4. Multiple Descriptions Using Sparse Decompositions

    DEFF Research Database (Denmark)

    Jensen, Tobias Lindstrøm; Østergaard, Jan; Dahl, Joachim

    2010-01-01

    In this paper, we consider the design of multiple descriptions (MDs) using sparse decompositions. In a description erasure channel only a subset of the transmitted descriptions is received. The MD problem concerns the design of the descriptions such that they individually approximate the source...... first-order method to the proposed convex problem such that we can solve large-scale instances for image sequences....

  5. Policy stories

    DEFF Research Database (Denmark)

    Ren, Carina Bregnholm; Rasmussen, Rasmus Kjærgaard

    planning and execution and of event outcomes beyond the narrow confines of bed nights and legacies. Second, we introduce policies as an entry point to unlock discussions and manifestations of value and futures which connect to AWG. In order to exemplify the workings of the AWG event in these domains, we...... present three central policy stories from the field. The stories tell of how the event was first interested, then activated and finally evaluated. Besides adding a new understanding to policy-driven events as a locus of value creation, we also argue that the AWG 2016 offer speculative bets for new...

  6. Evalutive Descriptions of Art

    Directory of Open Access Journals (Sweden)

    Nataša Lah

    2016-01-01

    Full Text Available Taking into account the fact that, throughout history, certain artworks have been considered as “worth of watching” (according to the Greek etymon ἀξιοϑέατος / aksioteatos, preservation, or theorizing, while others were not, one is led to investigate the various types of evaluative descriptions. Those artworks that are more valuable than others, or simply valuable in themselves on the basis of rather specific features, have always represented the paradigmatic model for the evaluator, thus revealing the identitary nature of value as different from one epoch to another. Our aim has been to discern, with regard to this starting point, the way in which the process of evaluating artworks fits the general matrix of the universal theory of value, with its clearly distinguished levels of evaluation, beginning with value descriptions, continuing through the features of evaluation or abstract qualities of values extracted from these descriptions, and ending with value norms or systems of accepted generalizations in evaluation. Value standpoints in such an evaluation matrix represent dispositions or preferences in procedures, which reflect the norms or signifying concepts of the time. Corresponding procedures, or applications of the hierarchicized signification of artworks, are manifested in all known forms of artwork assessment: attribution, institutionalization, and setting of priorities in terms of exhibition, conservation, acquisition, restoration, and so on. Research in the history of European art-historical ideas has corroborated the hypothesis that, prior to the late 18th century, clear normative patterns were applied when it came to the evaluation of artworks. However, with the emergence of early Romanticism, this could no longer be done in the traditional way. Before the period in question, visual art was created (regardless of some stylistic discrepancies between individual authors and classified according to well-defined thematic

  7. Polemic and Descriptive Negations

    DEFF Research Database (Denmark)

    Horslund, Camilla Søballe

    2011-01-01

    as such may be more or less central to the meaning of the utterance. The present paper investigates the role of morphosyntactic and prosodic prominence as well as register and social setting on the interpretation of negations. It seems plausible to expect that if the negation as such is central to the meaning...... of the utterance (as in polemic negations), the negation will be articulated prominently in order to emphasise this importance. Likewise, if the negation is not central to the meaning of the utterance, it should not be articulated prominently. Moreover, it is plausible to expect descriptive negations to be more...... common in certain social context or genres, while polemic negations are more likely to come up in other genres and social settings. Previous studies have shown a relation between articulatory prominence and register, which may further inform the analysis. Hence, the paper investigates how articulatory...

  8. Task Description Language

    Science.gov (United States)

    Simmons, Reid; Apfelbaum, David

    2005-01-01

    Task Description Language (TDL) is an extension of the C++ programming language that enables programmers to quickly and easily write complex, concurrent computer programs for controlling real-time autonomous systems, including robots and spacecraft. TDL is based on earlier work (circa 1984 through 1989) on the Task Control Architecture (TCA). TDL provides syntactic support for hierarchical task-level control functions, including task decomposition, synchronization, execution monitoring, and exception handling. A Java-language-based compiler transforms TDL programs into pure C++ code that includes calls to a platform-independent task-control-management (TCM) library. TDL has been used to control and coordinate multiple heterogeneous robots in projects sponsored by NASA and the Defense Advanced Research Projects Agency (DARPA). It has also been used in Brazil to control an autonomous airship and in Canada to control a robotic manipulator.

  9. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples.

    Science.gov (United States)

    Alonso, Gabriela C; Pavarina, Ana C; Sousa, Tábata V; Klein, Marlise I

    2018-04-01

    Biofilm production contributes to several human diseases, including oral candidiasis. Among the Candida species, Candida albicans is the most prevalent. The expression of virulence genes is implicated in the pathogenic potential of Candida biofilms. However, the evaluation of microbial gene expression from in vivo biofilm samples is not trivial, specifically, assessment via quantitative PCR (qPCR) can be a challenge because of several species present in clinical samples. Hence, the necessity of primers specificity. The aim of this study was to evaluate through in silico and in vitro analyses the specificity of published primers and newly designed primers for C. albicans virulence genes: ALS1, CAP1, CAT1, EFG1, HWP1, LIP3, PLB1, SAP1, SAP4, SOD1, SOD5 and ACT1 (normalizing gene). In silico analysis was performed through a PubMed search of articles with primer sequences that evaluated gene expression of C. albicans. Then, the sequence similarity of twenty-eight primers was checked through BLASTn and ClustalW2. The analysis of secondary structures was performed using mfold. When the primers did not present satisfactory characteristics (absence of secondary structures, not discrepant Tm of forward and reverse sequences and specificity) following in vitro analysis (i.e., end point PCR), new primers were designed using Beacon Designer™ and sequences obtained from the "Candida Genome Database". The selected primers were tested in vitro by end point PCR using a panel of genomic DNA from five different Candida species (C. albicans, Candida glabrata, Candida dubliniensis, Candida krusei, and Candida tropicalis). The resulting PCR products were visualized on agarose gel. qPCR reactions were performed to determine primers' optimal concentration and PCR efficiency. End point PCR demonstrated that published primers for the SAP1 and HWP1 were specific for C. albicans and the one for SOD1 reacted with C. albicans and C. dubliniensis. The sequence of primers designed for ACT1

  10. YUCCA MOUNTAIN SITE DESCRIPTION

    Energy Technology Data Exchange (ETDEWEB)

    A.M. Simmons

    2004-04-16

    The ''Yucca Mountain Site Description'' summarizes, in a single document, the current state of knowledge and understanding of the natural system at Yucca Mountain. It describes the geology; geochemistry; past, present, and projected future climate; regional hydrologic system; and flow and transport within the unsaturated and saturated zones at the site. In addition, it discusses factors affecting radionuclide transport, the effect of thermal loading on the natural system, and tectonic hazards. The ''Yucca Mountain Site Description'' is broad in nature. It summarizes investigations carried out as part of the Yucca Mountain Project since 1988, but it also includes work done at the site in earlier years, as well as studies performed by others. The document has been prepared under the Office of Civilian Radioactive Waste Management quality assurance program for the Yucca Mountain Project. Yucca Mountain is located in Nye County in southern Nevada. The site lies in the north-central part of the Basin and Range physiographic province, within the northernmost subprovince commonly referred to as the Great Basin. The basin and range physiography reflects the extensional tectonic regime that has affected the region during the middle and late Cenozoic Era. Yucca Mountain was initially selected for characterization, in part, because of its thick unsaturated zone, its arid to semiarid climate, and the existence of a rock type that would support excavation of stable openings. In 1987, the United States Congress directed that Yucca Mountain be the only site characterized to evaluate its suitability for development of a geologic repository for high-level radioactive waste and spent nuclear fuel.

  11. YUCCA MOUNTAIN SITE DESCRIPTION

    International Nuclear Information System (INIS)

    Simmons, A.M.

    2004-01-01

    The ''Yucca Mountain Site Description'' summarizes, in a single document, the current state of knowledge and understanding of the natural system at Yucca Mountain. It describes the geology; geochemistry; past, present, and projected future climate; regional hydrologic system; and flow and transport within the unsaturated and saturated zones at the site. In addition, it discusses factors affecting radionuclide transport, the effect of thermal loading on the natural system, and tectonic hazards. The ''Yucca Mountain Site Description'' is broad in nature. It summarizes investigations carried out as part of the Yucca Mountain Project since 1988, but it also includes work done at the site in earlier years, as well as studies performed by others. The document has been prepared under the Office of Civilian Radioactive Waste Management quality assurance program for the Yucca Mountain Project. Yucca Mountain is located in Nye County in southern Nevada. The site lies in the north-central part of the Basin and Range physiographic province, within the northernmost subprovince commonly referred to as the Great Basin. The basin and range physiography reflects the extensional tectonic regime that has affected the region during the middle and late Cenozoic Era. Yucca Mountain was initially selected for characterization, in part, because of its thick unsaturated zone, its arid to semiarid climate, and the existence of a rock type that would support excavation of stable openings. In 1987, the United States Congress directed that Yucca Mountain be the only site characterized to evaluate its suitability for development of a geologic repository for high-level radioactive waste and spent nuclear fuel

  12. Olkiluoto site description 2004

    International Nuclear Information System (INIS)

    2005-05-01

    This Olkiluoto Site Description 2004 is a description of the Olkiluoto site, in which the various disciplines have been integrated to produce a coherent picture, and is based on the data available prior to the start of the underground excavation of the ONKALO facility. This report is the first version of such a Site Report and supplements the site syntheses that have already been published. Further Site Reports will be produced on a regular basis and it is planned that the Site Report should form the geoscientific basis of the Safety Case in a future licence application. The report updates the Baseline report published in 2003 and is designed to produce an integrated site model, by focusing on interdisciplinary interactions, and also by including new data obtained during 2003 and 2004. The report has been produced by the OMTF (Olkiluoto Modelling Task Force), which covers the areas of geology, rock mechanics, hydrogeology and hydrogeochemistry. In addition to discussing the input from these four disciplines, the Site Report also includes a description of the surface conditions. Formally, the surface conditions are not within the remit of the OMTF, which is concentrating on modelling the bedrock around the ONKALO and the future repository. The influence of the surface conditions to the overall system and to the conditions at depth is recognised, however, and thus a summary of climate, ecosystems and overburden properties is also included in this report. Chapter 1 sets out the methodology to be used in the modelling, describes the various discipline-specific models which are developed and the modelled areas which are used, and also describes two important processes - the prediction/outcome studies and the uncertainty and confidence assessment. The difference between the estimate (the prediction) and the result (the outcome) indicates the level of knowledge and the prevailing uncertainties in the models. Chapter 2 presents the applied investigation data, which are

  13. A Descriptive Analysis of Instructional Coaches' Data Use in Science

    Science.gov (United States)

    Snodgrass Rangel, Virginia; Bell, Elizabeth R.; Monroy, Carlos

    2017-01-01

    A key assumption of accountability policies is that educators will use data to improve their instruction. In practice, however, data use is quite hard, and more districts are looking to instructional coaches to support their teachers. The purpose of this descriptive analysis is to examine how instructional coaches in elementary and middle school…

  14. servicom policy intervention: improving service quality in nigerian ...

    African Journals Online (AJOL)

    Admin

    SERVICOM policy, in which we examine descriptively the nature and implementation process of the policy, against a theoretical background depicting the nature of public services, quality and quality improvement, problems in the. Nigerian public sector, earlier policy prescriptions for an efficiently functioning service, and an.

  15. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    Science.gov (United States)

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin

    2015-01-01

    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  16. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  17. Elektronsko izobraževanje v praksi. Primer programa LOLA

    Directory of Open Access Journals (Sweden)

    Lea Bregar

    2003-12-01

    Full Text Available Slovenija je bila vkljucena v program Phare za studij na da!javo v obdobju od I995 do konca I999 kot ena izmed 11 srednje- in vzhodnoevropskih drzav. Eden od najpomembnejsih cil jev programa Phare je bit razviti človeške vire na podrocju studija na dal javo in odprtega ucenja. v okviru podprojekta Phare Train the Trainers so na Harriot Watt University iz Velike Britanije razvili izobrazevalni program LOLA (ucenje o odprtem ucenju. Leta I999 je bilo organizirano usposab!janje za 400 udeležencev iz 11 drzav Phare. Program LOLAje bit uspdna novost v evropskem izobrazevalnem prostoru ne le zaradi svojih vsebin, temvee tudi zaradi inovativne didaktike, sa} je bit celoten program oblikovan in izvajan kot 'on-line' program. V Clanku je na kratko predstavljen izobrazevalni program LOLA in izkusnje z njegovim izvajanjem kot primer e-izobrazevanja v praksi. Clanek avtorici zakljucujeta s predstavitvijo svojih pogledov na nadaljnje izvajanje programa LOLA in razvoj e-izobrazevanja v Sloveniji ter poudarjata potrebo po kakovostno doloceni in jasni strategiji na podrocju studija na daljavo, odprtega ucenja in e-izobrazevanja v Sloveniji.

  18. Review of Attachment, play, and authenticity: A Winnicott primer.

    Science.gov (United States)

    Penn, Linda S

    2009-12-01

    Reviews the book, Attachment, play, and authenticity: A Winnicott primer by Steven Tuber (see record 2008-04633-000). In this book, Tuber does not attempt to offer a comprehensive review of Winnicott's work. Rather, he focuses on what he sees as Winnicott's most central concepts, offering close examination of a few articles that he feels best represent each of these concepts, and frames each with the noting of a central dilemma or paradox. Tuber describes the book as an attempt to teach through "playing" with Winnicott (play being central to Winnicott's ideas) and engaging the reader to join in the play. The book is based on a series of lectures from a course on Winnicott he has given to his clinical psychology doctoral students at the City University of New York. The reviewer noted that the author omitted some information that she considered to be important. However, she concludes that this book is a compelling read that captures what she sees as the essence of Winnicott's work, and as Winnicott would have loved, presents it without jargon or pretense in the simple terms that best elucidate Winnicott's view of the human experience. (PsycINFO Database Record (c) 2010 APA, all rights reserved).

  19. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  20. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  1. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  2. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  3. From Description to prescription

    DEFF Research Database (Denmark)

    Müller, Anders Riel; Doucette, Jamie

    the 2008 global economic downturn. From Africa to Latin American, and from Central to Southeast Asia, the developmental state is increasingly seen as an alternative to the Washington Consensus and there is deliberate effort to learn from the Korean development experience as a hallmark example...... of a developmental state. Thus, Korea has attempted to both stimulate and satisfy demand for knowledge of its developmental history through a range of initiatives including its Knowledge Sharing Project: a program overseen by the Korean Development Institute and Ministry of Strategy and Finance...... regimentation, labour subordination, and state-led mobilization that have accompanied Korean development. This problem is apparent in the KSP and affiliated policy literature that promotes several ‘hallmarks’ of the Korean developmental experience such as Park Chung-hee’s New Village Movement (Saemaul Undong...

  4. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  5. UNIVERSAL PRIMERS FOR THE AMPLIFICATION AND SEQUENCE ANALYSIS OF ACTIN-1 FROM DIVERSE MOSQUITO SPECIES

    Science.gov (United States)

    STALEY, MOLLY; DORMAN, KARIN S.; BARTHOLOMAY, LYRIC C.; FERNÁNDEZ-SALAS, ILDEFONSO; FARFAN-ALE, JOSE A.; LOROÑO-PINO, MARIA A.; GARCIA-REJON, JULIAN E.; IBARRA-JUAREZ, LUIS

    2010-01-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5′-ATGGTCGGYATGGGNCAGAAGGACTC-3′) and Act-8R (5′-GATTCCATACCCAGGAAG-GADGG-3′), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  6. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  7. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  8. RNA Primer Extension Hinders DNA Synthesis byEscherichia coliMutagenic DNA Polymerase IV.

    Science.gov (United States)

    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  9. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  10. Primique: automatic design of specific PCR primers for each sequence in a family

    Directory of Open Access Journals (Sweden)

    Lange Mette

    2007-10-01

    Full Text Available Abstract Background In many contexts, researchers need specific primers for all sequences in a family such that each primer set amplifies only its target sequence and none of the others, e.g. to detect which transcription factor out of a family of very similar proteins that is present in a sample, or to design diagnostic assays for the identification of pathogen strains. Results This paper presents primique, a new graphical, user-friendly, fast, web-based tool which solves the problem: It designs specific primers for each sequence in an uploaded set. Further, a secondary set of sequences not to be amplified by any primer pair may be uploaded. Primers with high sequence similarity to non-target sequences are selected against. Lastly, the suggested primers may be checked against the National Center for Biotechnology Information databases for possible mis-priming. Conclusion Results are presented in interactive tables, and various primer properties are listed and displayed graphically. Any close match alignments can be displayed. Given 30 sequences, the running time of primique is about 20 seconds. primique can be reached via this web address: http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py

  11. ORIGAMI Automator Primer. Automated ORIGEN Source Terms and Spent Fuel Storage Pool Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Wieselquist, William A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Thompson, Adam B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bowman, Stephen M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Peterson, Joshua L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-04-01

    Source terms and spent nuclear fuel (SNF) storage pool decay heat load analyses for operating nuclear power plants require a large number of Oak Ridge Isotope Generation and Depletion (ORIGEN) calculations. SNF source term calculations also require a significant amount of bookkeeping to track quantities such as core and assembly operating histories, spent fuel pool (SFP) residence times, heavy metal masses, and enrichments. The ORIGEN Assembly Isotopics (ORIGAMI) module in the SCALE code system provides a simple scheme for entering these data. However, given the large scope of the analysis, extensive scripting is necessary to convert formats and process data to create thousands of ORIGAMI input files (one per assembly) and to process the results into formats readily usable by follow-on analysis tools. This primer describes a project within the SCALE Fulcrum graphical user interface (GUI) called ORIGAMI Automator that was developed to automate the scripting and bookkeeping in large-scale source term analyses. The ORIGAMI Automator enables the analyst to (1) easily create, view, and edit the reactor site and assembly information, (2) automatically create and run ORIGAMI inputs, and (3) analyze the results from ORIGAMI. ORIGAMI Automator uses the standard ORIGEN binary concentrations files produced by ORIGAMI, with concentrations available at all time points in each assembly’s life. The GUI plots results such as mass, concentration, activity, and decay heat using a powerful new ORIGEN Post-Processing Utility for SCALE (OPUS) GUI component. This document includes a description and user guide for the GUI, a step-by-step tutorial for a simplified scenario, and appendices that document the file structures used.

  12. Effects of primers containing thiouracil and phosphate monomers on bonding of resin to Ag-Pd-Au alloy.

    Science.gov (United States)

    Taira, Yohsuke; Kamada, Kohji; Atsuta, Mitsuru

    2008-01-01

    The purpose of the present study was to evaluate the effects of four experimental primers on bond strength between a self-curing luting agent and silver-palladium-gold alloy. The experimental primers were in mixed solutions of a thiouracil primer (Metaltite) and a phosphate primer (Epricord, PM, PE, or PP), which were designated as Metaltite/Epricord, Metaltite/PM, Metaltite/PE, and Metaltite/PP respectively. Three primers (Metal Primer II, V-Primer, and Alloy Primer) were also prepared as controls. Alumina-blasted metal alloys were bonded with acrylic rods. After 5,000 thermocycles, the maximum shear bond strength was obtained with Metaltite/PE (27.8+/-2.4 MPa) and Metaltite/Epricord (27.6+/-5.9 MPa), followed by Metaltite/PP, Alloy Primer, Metaltite, Metaltite/PM, Metal Primer II, V-Primer, and Epricord. PE, PM, and PP showed the lowest bond strength. Results of this study revealed that the combined use of a thiouracil monomer and a phosphate monomer improved adhesive bonding. In this light, clinicians should pay attention to the types of functional monomers dissolved in a primer when fabricating resin-bonded prostheses.

  13. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  14. Evaluation of several RT-PCR primer pairs for the detection of Apple stem pitting virus.

    Science.gov (United States)

    Komorowska, B; Malinowski, T; Michalczuk, L

    2010-09-01

    Detection of Apple stem pitting virus (ASPV) using RT-PCR based methods was studied in infected apple and pear trees. Three virus-specific primers (ASPF1CP, ASPF2CP, ASPR3CP) were designed to target the most conservative regions of the coat protein gene of 10 virus isolates in Poland and 7 other ASPV sequences available in GenBank. The suitability of the primer pairs ASPF1CP-ASPR3CP and ASPF2CP-ASPR3CP for detection of 19 virus isolates was checked. Both new primer pairs initiated amplification of a specific product from all sources tested. From 1 to 11 isolates were not detected with the primer sets published previously. Detection of the virus in the samples collected in March, using ASPF1CP-ASPR3CP primer pair, was possible up to 512 times dilution. For the samples collected in July, virus was detected in the extracts from infected plants diluted eight times. More than 100-fold increase of sensitivity could be obtained by semi-nested PCR with primers ASPF2CP-ASPR3CP following the first round with ASPF1CP-ASPR3CP. Identification of virus isolates with different number of deletions in the coat protein gene was possible using RT-PCR with newly designed reverse primer ASPDEL in combination with the published primer ASPV7956. Besides, the comparative analysis of silicacapture-RT-PCR (SC-RT-PCR) versus immunocapture-RT-PCR (IC-RT-PCR) assays was carried out. Few ASPV isolates escaped detection by IC-RT-PCR, while all isolates tested were detected using the SC-RT-PCR with the new primers. Copyright 2010 Elsevier B.V. All rights reserved.

  15. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  16. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  17. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  18. Consumption Taxation in a Digital World : A Primer

    NARCIS (Netherlands)

    Ligthart, J.E.

    2004-01-01

    The paper reviews the economic and administrative issues that arise in the taxation of electronic commerce; addresses how best to meet the criteria of an ideal tax system; and examines recent policy developments.It is argued that destination-based taxation-is presently the norm for goods taxation is

  19. Measuring reporting verifying. A primer on MRV for nationally appropriate mitigation actions

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (ed.); Luetken, S.; Holm Olsen, K. (Technical Univ. of Denmark. UNEP Risoe Centre, Roskilde (Denmark)); Aalders, E.; Pretlove, B.; Peters, N. (Det Norske Veritas, Hellerup (Denmark))

    2012-03-15

    The requirements for measurement, reporting and verification (MRV) of nationally appropriate mitigation actions (NAMAs) are one of the crucial topics on the agenda of international negotiations to address climate change mitigation. According to agreements so far, the general guidelines for domestic MRV are to be developed by Subsidiary Body for Scientific and Technological Advice (SBSTA)1. Further, the Subsidiary Body for Implementation (SBI) will be conducting international consultations and analysis (ICA) of biennial update reports (BUR) to improve transparency of mitigation actions, which should be measured, reported and verified. 2. What is clear from undergoing discussions both at SBSTA and at SBI is that MRV for NAMAs should not be a burden for controlling greenhouse gas (GHG) emissions connected to economic activities. Instead, the MRV process should facilitate mitigation actions; encourage the redirection of investments and address concerns regarding carbon content of emission intensive operations of private and public companies and enterprises worldwide. While MRV requirements are being shaped within the Convention, there are a number of initiatives supporting developing countries moving forward with NAMA development and demonstration activities. How these actions shall be measured, reported and verified, however, remain unanswered. MRV is not new. It is present in most existing policies and frameworks related to climate change mitigation. With an aim to contribute to international debate and capacity building on this crucial issue, the UNEP Risoe Centre in cooperation with UNDP, are pleased to present this publication that through the direct collaboration with Det Norske Veritas (DNV) builds on existing MRV practices in current carbon markets; provides insights on how MRV for NAMAs can be performed and identifies elements and drivers to be considered when designing adequate MRV systems for NAMAs in developing countries. This primer is the second

  20. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    Science.gov (United States)

    Blackman, Eric G.

    2015-05-01

    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  1. A primer on trace metal-sediment chemistry

    Science.gov (United States)

    Horowitz, Arthur J.

    1985-01-01

    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  2. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  3. Política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi

    OpenAIRE

    Mario Antolinez

    2013-01-01

    El artículo examina la política exterior de Japón durante el primer año de gobierno del primer ministro Junichiro Koizumi. Para tal fin utiliza como marco conceptual los modelos de análisis de política exterior formulados por Robert Putnam y Kenneth Waltz. La premisa principal es que al inicio de su gobierno Koizumi intentó revitalizar las relaciones exteriores de su país imprimiendo una nueva dinámica en la toma de decisiones que se ajustaba a su estilo personal de hacer política y que, al m...

  4. Descriptive assessment for physical education

    OpenAIRE

    Pirih Tavčar, Ksenija

    2016-01-01

    Descriptive grading is a type of grading in which opinions about children’s knowledge or products are expressed in sentences. This opinion highlights what individual children know or have mastered, what they have not mastered, and what they should do to improve. In descriptive grading, the pupil’s work is assessed in terms of learning objectives. In their descriptive grades, physical education (PE) teachers write down everything that they have taught and reviewed with their pupils during t...

  5. Olkiluoto biosphere description 2006

    International Nuclear Information System (INIS)

    Haapanen, R.; Aro, L.; Ilvesniemi, H.; Kareinen, T.; Kirkkala, T.; Mykrae, S.; Turkki, H.; Lahdenperae, A.-M.; Ikonen, A.T.K.

    2007-02-01

    This report summarises the current knowledge of the biosphere of Olkiluoto, and it is the first Biosphere Description Report. The elements considered were climate, topography, land use, overburden, terrestrial vegetation and fauna and sea flora, fauna and water. The principal aim was to present a synthesis of the present state (now to 2020) and the main features of past evolution of the biosphere at the site using currently available data. The lack of site specific parameters and their importance was discussed. Conceptual ecosystem models are presented for land and sea. Currently available data made it possible to calculate the biomass of the terrestrial vegetation and further convert it to carbon. In the case of terrestrial animals, preliminary figures are given for moose alone due to lack of sitespecific data. For the same reason, the sea ecosystem model was not quantified within this work. The ecosystems on Olkiluoto do not deviate from the surrounding areas. Since mires are few on Olkiluoto, forests are the most important land ecosystem. However, coastal areas are the transition zones between land and sea, and also potential sites for deep groundwater discharge. The major interest concerning aquatic ecosystems was laid on four future lakes potentially developing from the sea due to the land up-lift. Current sea sediments near Olkiluoto are future land areas, and thus very important. Spatially, the forest ecosystems of Olkiluoto are now most comprehensively covered, while the temporal coverage is highest in sea ecosystems. Lack of data is greatest in terrestrial fauna and sea sediments. During this work, the system boundaries were crossed and the use of data over disciplines was started. The data were mostly in agreement, but some discrepancies were detected. To solve these, and to supplement the existing data, some recommendations were given. (orig.)

  6. Policy Reader

    International Nuclear Information System (INIS)

    1985-09-01

    This policy reader comprises: Correspondence; Memorandum of Understanding between the US Department of Transportation and the US Department of Energy for the Transportation of Radioactive Materials under the Nuclear Waste Policy Act; Internal Guidelines for Interactions with Communities and Local Governments; Statement by Ben C. Rusche before the Committee on Interior and Insular Affairs, Subcommittee on Energy and the Environment, US House of Representatives, September 13, 1985; Speech presented by Ben C. Rusche before the ANS/CNS/AESJ/ENS Topical Meeting, Pasco, Washington, September 24, 1985 - ''Status of the United States' High-Level Nuclear Waste Disposal Program''; and ''DOE Seeks Comments on Nuclear Transportation Planning,'' DOE News, September 30, 1985

  7. Population policy.

    Science.gov (United States)

    1987-03-01

    Participants in the Seminar on Population Policies for Top-level Policy Makers and Program Managers, meeting in Thailand during January 1987, examined the challenges now facing them regarding the implementation of fertility regulation programs in their respective countries -- Bangladesh, China, India, Indonesia, Malaysia, Nepal, Pakistan, the Philippines, the Republic of Korea, and Thailand. This Seminar was organized to coincide with the completion of an Economic and Social Commission for Asia and the Pacific (ESCAP) study investigating the impact and efficiency of family planning programs in the region. Country studies were reviewed at the Seminar along with policy issues about the status of women, incentive and disincentive programs, and socioeconomic factors affecting fertility. In Bangladesh the government recognizes population growth as its top priority problem related to the socioeconomic development of the country and is working to promote a reorientation strategy from the previous clinic-oriented to a multidimensional family welfare program. China's family planning program seeks to postpone marraige, space the births of children between 3-5 years, and promote the 1-child family. Its goal is to reduce the rate of natural increase from 12/1000 in 1978 to 5/1000 by 1985 and 0 by 2000. India's 7th Five-Year-Plan (1986-90) calls for establishing a 2-child family norm by 2000. In Indonesia the government's population policy includes reducing the rate of population growth, achieving a redistribution of the population, adjusting economic factors, and creating prosperous families. The government of Indonesia reversed its policy to reduce the population growth rate in 1984 and announced its goal of achieving a population of 70 million by 2100 in order to support mass consumption industries. It has created an income tax deduction system favoring large families and maternity benefits for women who have up to 5 children as incentives. Nepal's official policy is to

  8. Language Policy

    DEFF Research Database (Denmark)

    Lauridsen, Karen M.

    2008-01-01

    Like any other text, instructive texts function within a given cultural and situational setting and may only be available in one language. However, the end users may not be familiar with that language and therefore unable to read and understand the instructions. This article therefore argues...... that instructive texts should always be available in a language that is understood by the end users, and that a corporate communication policy which includes a language policy should ensure that this is in fact the case for all instructive texts....

  9. Oligonucleotide primers for specific detection of actinobacterial laccases from superfamilies I and K.

    Science.gov (United States)

    Fernandes, Tatiana Alves Rigamonte; da Silveira, Wendel Batista; Passos, Flávia Maria Lopes; Zucchi, Tiago Domingues

    2014-08-01

    Although many putative laccase-like genes have been assigned to members of the phylum Actinobacteria, few of the related enzymes have been characterized so far. It is noteworthy, however, that this small number of enzymes has presented properties with industrial relevance. This observation, combined with the recognized biotechnological potential and the capability of this phylum to degrade recalcitrant soil polymers, has attracted attention for bioprospective approaches. In the present work, we have designed and tested primers that were specific for detection of sub-groups of laccase-like genes within actinomycetes, which corresponded to the superfamilies I and K from the classification presented by the laccase and multicopper oxidase engineering database. The designed primers have amplified laccase-like gene fragments from actinomycete isolates that were undetectable by primers available from the literature. Furthermore, phylogenetic alignments suggest that some of these fragments may belong to new laccases-like proteins, and thus emphasize the benefits of designing subgroup-specific primers.

  10. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  11. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  12. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  13. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    Directory of Open Access Journals (Sweden)

    Fernando Bastida-González

    2016-01-01

    Full Text Available Nucleoprotein (N gene from rabies virus (RABV is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs via indirect fluorescent antibody (IFA test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers, for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  14. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  15. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  16. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  17. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  18. Self-Etch Environmentally Acceptable Primer Testing (SEEAPT) Deliver Order 0001

    National Research Council Canada - National Science Library

    Joseph, Christopher

    2001-01-01

    .... The focus of the testing was on primer properties. Filiform corrosion, salt fog exposure, pencil hardness, crosshatch adhesion, impact testing, and wet tape adhesion testing were conducted on the 12 candidate systems, along with 4 control systems...

  19. Trusting Description: Authenticity, Accountability, and Archival Description Standards

    Science.gov (United States)

    MacNeil, Heather

    2009-01-01

    It has been suggested that one of the purposes of archival description is to establish grounds for presuming the authenticity of the records being described. The article examines the implications of this statement by examining the relationship between and among authenticity, archival description, and archival accountability, assessing how this…

  20. Ceramic bond durability and degradation mechanism of commercial gamma-methacryloxypropyl trimethoxysilane-based ceramic primers.

    Science.gov (United States)

    Aida, Masahiro; Tabei, Naoko; Kimoto, Suguru; Tanimura, Hideki; Takahashi, Haruyoshi; Yaguchi, Takehiro; Nishiyama, Norihiro

    2012-08-01

    To investigate the bond durability and degradation mechanism of various commercial ceramic primers that are based on gamma-methacryloxypropyl trimethoxysilane (gamma-MPTS) and contain various organic additives. The null hypotheses tested were that (1) the type of ceramic primer had no effect on the bond strength after thermocycling and (2) the type of ceramic primer had no effect on the water contact angle after rinsing with THF. The adherent was a silica-based ceramic block used for computer-aided design/computer-aided manufacturing (CAD-CAM). Four commercial ceramic primers, Clearfil Mega Bond Porcelain Bonding kit (CM), Tokuso ceramic primer (TC), GC ceramic primer (CP), and Porcelain Liner M (PL), were compared with a simplified experimental ceramic primer (EP) that comprised gamma-MPTS and an inorganic acid (hydrochloric acid) but no other organic additives. The specimens for the adhesion test were prepared after a dual-curing type resin cement (Link Max) had adhered to the ceramic surfaces treated with each ceramic primer. The bonded specimens were then stored in water at 37 degrees C for 1 day. Then, the bonded specimens were thermocycled between 5 degrees C and 55 degrees C in water baths for 5000 or 10,000 cycles. The dwell time in each water bath and the transfer time were 60 and 7 seconds, respectively. The shear bond strength of resin to the ceramic surface was measured under a crosshead speed of 1.0 mm/minute by a conventional testing machine. Thereafter, the fracture mode for each specimen was determined. In addition, the water contact angle on the treated ceramic surfaces was measured before and after THF using a cotton pellet. As a control, the contact angle on the ground ceramic surface was measured without any ceramic primer. For all samples, thermocycling led to an increase in the frequency of interfacial failure, reflecting reduced mean bond strength of the resin to the treated ceramic surfaces. However, the bond degradation behavior differed

  1. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...... by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  2. Primer Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition

    Science.gov (United States)

    2015-09-01

    Output and Initial Projectile Motion for 5.56- and 7.62-mm Ammunition by John J Ritter and Richard A Beyer Weapons and Materials Research...primer alone launches the bullet with a shower of hot particles and gases. Similar attempts with a rifled barrel resulted in just enough force being...performance with novel measurement techniques. Journal of Energetic Materials and Chemical Propulsion. 2013;12(4):361–370. 4. Cup, primer (No. 34

  3. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  4. Characterization of RNA primers synthesized by the human breast cancer cell DNA synthesome.

    Science.gov (United States)

    Dai, Heqiao; Liu, Jianying; Malkas, Linda H; Hickey, Robert J

    2009-04-01

    We previously reported on the purification and characterization of a functional multi-protein DNA replication complex (the DNA synthesome) from human cells and tissues. The synthesome is fully competent to carry-out all phases of the DNA replication process in vitro. In this study, DNA primase, a component of the synthesome, is examined to determine its activity and processivity in the in vitro synthesis and extension of RNA primers. Our results show that primase activity in the P4 fraction of the synthesome is 30-fold higher than that of crude cell extracts. The synthesome synthesizes RNA primers that are 7-10 ribonucleotides long and DNA primers that are 20-40 deoxyribonucleotides long using a poly(dT) template of exogenous single-stranded DNA. The synthesome-catalyzed RNA primers can be elongated by E. coli DNA polymerase I to form the complementary DNA strands on the poly(dT) template. In addition, the synthesome also supports the synthesis of native RNA primers in vitro using an endogenous supercoiled double-stranded DNA template. Gel analysis demonstrates that native RNA primers are oligoribonucleotides of 10-20 nt in length and the primers are covalently link to DNA to form RNA-primed nascent DNA of 100-200 nt. Our study reveals that the synthesome model is capable of priming and continuing DNA replication. The ability of the synthesome to synthesize and extend RNA primers in vitro elucidates the organizational and functional properties of the synthesome as a potentially useful replication apparatus to study the function of primase and the interaction of primase with other replication proteins.

  5. Consumption taxation in a digital world : A primer

    OpenAIRE

    Ligthart, J.E.

    2004-01-01

    The paper reviews the economic and administrative issues that arise in the taxation of electronic commerce; addresses how best to meet the criteria of an ideal tax system; and examines recent policy developments.It is argued that destination-based taxation-is presently the norm for goods taxation is technically more complex for digital products and intangible services sold over the Internet, reflecting the difficulty of determining the location of the buyer and seller.Most of the potential so...

  6. Detection of Mycobacterium ulcerans by real-time PCR with improved primers.

    Science.gov (United States)

    Shinoda, Noriko; Nakamura, Hajime; Watanabe, Mineo

    2016-01-01

    Buruli ulcer is a severe skin disease caused by Mycobacterium ulcerans. Real-time PCR targeting the IS2404 sequence has been used as a reliable and rapid method for the diagnosis of Buruli ulcer and detection of M. ulcerans in the environment. The genome of M. ulcerans contains hundreds of IS2404 copies, which have variability in certain sequences. Therefore, the design of new primers specific to conserved IS2404 regions may potentially improve the sensitivity of M. ulcerans detection and, consequently, the diagnosis of Buruli ulcer, thus ensuring timely treatment of the disease. In silico analysis indicates that DNA sequences of the IS2404 elements are highly variable within a single strain. As the binding sites of conventional IS2404-specific primers used for M. ulcerans detection contain polymorphic sequences, we designed new primers, which enabled the detection of M. ulcerans by real-time PCR with higher sensitivity and similar specificity with respect to that of conventional primers. However, the increase in sensitivity with the new primers depended on the M. ulcerans strain. The results suggest that real-time PCR based on the new primers could improve Buruli ulcer diagnosis and M. ulcerans detection in environmental samples.

  7. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  8. PCR primers that amplify fungal rRNA genes from environmental samples.

    Science.gov (United States)

    Borneman, J; Hartin, R J

    2000-10-01

    Two PCR primer pairs were designed to amplify rRNA genes (rDNA) from all four major phyla of fungi: Ascomycota, Basidiomycota, Chytridomycota, and Zygomycota. PCRs performed with these primers showed that both pairs amplify DNA from organisms representing the major taxonomic groups of fungi but not from nonfungal sources. To test the ability of the primers to amplify fungal rDNA from environment samples, clone libraries from two avocado grove soils were constructed and analyzed. These soils possess different abilities to inhibit avocado root rot caused by Phythophthora cinnamomi. Analysis of the two rDNA clone libraries revealed differences in the two fungal communities. It also revealed a markedly different depiction of the soil fungal community than that generated by a culture-based analysis, confirming the value of rDNA-based approaches for identifying organisms that may not readily grow on agar media. Additional evidence of the usefulness of the primers was obtained by identifying fungi associated with avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA sequences were identified, illustrating the selectivity of these PCR primers. This work demonstrates the ability of two newly developed PCR primer sets to amplify fungal rDNA from soil and plant tissue, thereby providing unique tools to examine this vast and mostly undescribed community of organisms.

  9. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  10. GSP: a web-based platform for designing genome-specific primers in polyploids.

    Science.gov (United States)

    Wang, Yi; Tiwari, Vijay K; Rawat, Nidhi; Gill, Bikram S; Huo, Naxin; You, Frank M; Coleman-Derr, Devin; Gu, Yong Q

    2016-08-01

    The sequences among subgenomes in a polyploid species have high similarity, making it difficult to design genome-specific primers for sequence analysis. We present GSP, a web-based platform to design genome-specific primers that distinguish subgenome sequences in a polyploid genome. GSP uses BLAST to extract homeologous sequences of the subgenomes in existing databases, performs a multiple sequence alignment, and design primers based on sequence variants in the alignment. An interactive primers diagram, a sequence alignment viewer and a virtual electrophoresis are displayed as parts of the primer design result. GSP also designs specific primers from multiple sequences uploaded by users. GSP is a user-friendly and efficient web platform freely accessible at http://probes.pw.usda.gov/GSP Source code and command-line application are available at https://github.com/bioinfogenome/GSP CONTACTS: yong.gu@ars.usda.gov or devin.coleman-derr@ars.usda.gov Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  12. Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

    Science.gov (United States)

    Goñi, Sandra Elizabeth; Lozano, Mario Enrique

    2013-01-01

    Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members. PMID:23533783

  13. Association of different primers and resin cements for adhesive bonding to zirconia ceramics.

    Science.gov (United States)

    Maeda, Fernando Akio; Bello-Silva, Marina Stella; de Paula Eduardo, Carlos; Miranda Junior, Walter Gomes; Cesar, Paulo Francisco

    2014-06-01

    To evaluate the shear bond strength (SBS) to zirconia ceramics using different associations of primers and resin cements. Two blocks of LAVA zirconia (3Y-TZP) were randomly submitted to an application of three different commercially available primers: Alloy Primer (AP), Z-Prime Plus (ZP), and Signum Zirconia Bond (SZB). Nonprimed specimens were considered controls. After treatment, the 80 specimens (5 mm × 5 mm × 2 mm) were randomly cemented with one of the resin cements: Panavia F, Multilink, seT, and NX3. For cementation, cylinders of resin cement were built on the ceramic surfaces using the SDI SBS apparatus. The specimens were submitted to the SBS test. Fractured surfaces were observed under stereomicroscopy to determine the failure mode, and mean bond strength values were analyzed using the Kruskal-Wallis and Mann-Whitney tests (α = 0.05). Signum Zirconia Bond had the highest SBS compared to all other primers and the control group, regardless of the resin cement used. The highest values were obtained when associating Panavia F with Signum Zirconia Bond. Alloy Primer increased bonding values when associated with seT cement only. When no primer was used, no statistical difference was observed among resin cements. All specimens fractured due to adhesive failure. Signum Zirconia Bond is capable of increasing bonding values of resin cements to zirconia ceramics. Its association with Panavia F shows enhanced results when considering short-term adhesion to zirconia.

  14. Effects of primer containing silane and thiophosphate monomers on bonding resin to a leucite-reinforced ceramic.

    Science.gov (United States)

    Taira, Yohsuke; Sakai, Miyuki; Sawase, Takashi

    2012-05-01

    Silane primers are commonly used for bonding between resin-based luting agents and ceramic restorations. The purpose of the present study was to evaluate the effects of nine silane primers on the bond strength of resin to a leucite-reinforced ceramic. The commercially available dental primers used were five silane primers (GC Ceramic Primer, GP; Clearfil Ceramic Primer, CP; Tokuso Ceramic Primer, TP; Porcelain Liner M, PM; and Monobond Plus, MB). Four experimental primers (MDS, MTS, MDS/MPII, and MTS/MPII) and two control primers (MMA and MMA/MPII) were also prepared. The ceramic specimen was ground with silicon carbide paper, primed, and then bonded to a resin composite disc using a dual-curing luting agent. After a 24-h immersion in water, the shear bond strengths were determined. Shear bond testing revealed that the bond strength was significantly improved with the use of a MTS/MPII primer when compared to MDS, MTS, MMA, MDS/MPII and MMA/MPII. Although no significant differences were detected between GP, CP, PM, and MB, the primers CP, TP, PM, and MTS/MPII exhibited the highest bond strengths, followed by GP and MB, whilst the no-primer control resulted in the lowest values. The maximum bond strengths were obtained with CP, TP, PM, and MTS/MPII. It was suggested that the thiophosphate monomer accelerated the role of the silane monomer. When selecting a primer to bond ceramic restorations, clinicians should be aware that not only the silane monomer but also additional components of the primer considerably affect the bond strength. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. No. 1669 French National Assembly, Constitution of the 4 october 1958 twelfth recorded legislature at the presidency of the French National Assembly the 11 june 2004. Law project modified by the Senate of energy policy, transmitted by the Primer Minister to the President of the French National Assembly. The Senate modified in first lecture, the law project adopted by the French National Assembly in first lecture after emergency declaration, about: see numbers: French National Assembly: 1586, 1597 and T.A. 302. Senate: 328, 330 and T.A. 93 (2003-2004)

    International Nuclear Information System (INIS)

    2004-01-01

    This law document of the french energy policy deals with the national energy strategy, the energy demand control, the renewable energies, the equilibrium and the quality of the electric power transport and distribution, fiscal measures. An appendix is devoted to the presentation of the government policy to implement its energy policy. (A.L.B.)

  16. Health Policy and Cost Containment Laws: Lessons for Public Health Education in Social and Behavioral Change.

    Science.gov (United States)

    Garcia, Jose Joel

    1986-01-01

    From a descriptive model of policy in health care delivery, the author theorizes that government has effectively attained economic and budgetary goals, but policy is creating displacements and attacking the national commitment to social welfare policy. Asserts that public health disciplines must collaborate to strengthen policy and empower…

  17. Understanding health policy leaders' training needs.

    Directory of Open Access Journals (Sweden)

    Carey Roth Bayer

    Full Text Available We assessed the training needs of health policy leaders and practitioners across career stages; identified areas of core content for health policy training programs; and, identified training modalities for health policy leaders.We convened a focus group of health policy leaders at varying career stages to inform the development of the Health Policy Leaders' Training Needs Assessment tool. We piloted and distributed the tool electronically. We used descriptive statistics and thematic coding for analysis.Seventy participants varying in age and stage of career completed the tool. "Cost implications of health policies" ranked highest for personal knowledge development and "intersection of policy and politics" ranked highest for health policy leaders in general. "Effective communication skills" ranked as the highest skill element and "integrity" as the highest attribute element. Format for training varied based on age and career stage.This study highlighted the training needs of health policy leaders personally as well as their perceptions of the needs for training health policy leaders in general. The findings are applicable for current health policy leadership training programs as well as those in development.

  18. Antibiotic policy

    OpenAIRE

    Gyssens, Inge

    2011-01-01

    There is a clear association between antibiotic use and resistance both on individual and population levels. In the European Union, countries with large antibiotic consumption have higher resistance rates. Antibiotic resistance leads to failed treatments, prolonged hospitalisations, increased costs and deaths. With few new antibiotics in the Research & Development pipeline, prudent antibiotic use is the only option to delay the development of resistance. Antibiotic policy consists of prescrib...

  19. Modelling object typicality in description logics - [Workshop on Description Logics

    CSIR Research Space (South Africa)

    Britz, K

    2009-07-01

    Full Text Available The authors presents a semantic model of typicality of concept members in description logics that accords well with a binary, globalist cognitive model of class membership and typicality. The authors define a general preferential semantic framework...

  20. Internet Policy

    Science.gov (United States)

    Lehr, William H.; Pupillo, Lorenzo Maria

    The Internet is now widely regarded as essential infrastructure for our global economy and society. It is in our homes and businesses. We use it to communicate and socialize, for research, and as a platform for E-commerce. In the late 1990s, much was predicted about what the Internet has become at present; but now, we have actual experience living with the Internet as a critical component of our everyday lives. Although the Internet has already had profound effects, there is much we have yet to realize. The present volume represents a third installment in a collaborative effort to highlight the all-encompassing, multidisciplinary implications of the Internet for public policy. The first installment was conceived in 1998, when we initiated plans to organize an international conference among academic, industry, and government officials to discuss the growing policy agenda posed by the Internet. The conference was hosted by the European Commission in Brussels in 1999 and brought together a diverse mix of perspectives on what the pressing policy issues would be confronting the Internet. All of the concerns identified remain with us today, including how to address the Digital Divide, how to modify intellectual property laws to accommodate the new realities of the Internet, what to do about Internet governance and name-space management, and how to evolve broadcast and telecommunications regulatory frameworks for a converged world.

  1. Homelessness in Lithuania : policy and research

    OpenAIRE

    Snieškienė, Dalija; Dulinskienė, Inga

    2014-01-01

    This paper reviews developments in social policy and services related to homelessness in Lithuania over the last 20 years. Using the form of a descriptive case study, it provides an overview of how homelessness is conceptualised, the organisation of homelessness services, the development of social policy related to homelessness, and the support services available within the provision and maintenance of housing, as well as a review of relevant research on homelessness in Lithuania. The paper d...

  2. A randomised trial comparing the antibacterial effects of dentine primers against bacteria in natural root caries.

    Science.gov (United States)

    Rolland, S L; McCabe, J F; Imazato, S; Walls, A W G

    2011-01-01

    As people are living longer and retaining their teeth into old age, root caries is an increasingly significant problem. A minimally invasive treatment strategy, involving sealing the root caries lesion with an antibacterial resin sealant, could be highly beneficial. The aim of this study was to compare the antibacterial properties of the primers of two proprietary dentine bonding agents, Clearfil SE Bond (SE; Kuraray Medical, Japan) and Clearfil Protect Bond (PB; Kuraray Medical), which contains the antibacterial monomer methacryloyloxydodecylpyridinium bromide. Fifty-two root caries lesions were identified and randomly assigned to a primer. The lesion was cleaned, isolated, sampled with a sharp spoon excavator, a primer applied and a second sample taken. Samples were transported in fastidious anaerobe broth, vortex-dispersed and serial dilutions inoculated onto selective agars. Reduction in colony-forming units (CFU, %) after primer application was calculated for both primers for bacterial growth on each selective agar and compared to a hypothesised mean of 100% (one-sample t test, p < 0.05). No significant differences between primers were seen, indicating efficient bacterial elimination by both materials. Comparing percent reduction between SE and PB for each agar (Mann-Whitney test, p < 0.05), a significantly greater CFU reduction by PB was seen for streptococci but not other bacteria. More lesions exhibited bacterial growth and several lesions demonstrated marked bacterial growth after treatment with SE compared with PB. Therefore, PB appears to exhibit superior antimicrobial properties, particularly against streptococci. Both primers are highly antibacterial towards root caries bacteria and may therefore be suitable for minimally invasive treatment. Copyright © 2011 S. Karger AG, Basel.

  3. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  4. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  5. Profil Rujukan Kasus Nonspesifik pada Fasilitas Kesehatan Tingkat Primer

    Directory of Open Access Journals (Sweden)

    Elda Nazriati

    2015-05-01

    arranged in primary healthcare facilities. In fact, there are many non-specialist cases referred to secondary health care facilities. This descriptive study using quantitative and qualitative method aimed to determine patterns and causes of non-specialist diseases referred to secondary primary health care in Pekanbaru City. Depiction of non-specialist disease cases was collected from data of the state health insurance scheme in Pekanbaru City on December 2014 - April 2015 period, meanwhile causes of referral were obtained from focus group discussion participated by 40 doctors based on types of primary healthcare facilities. This study showed 20 non-specialist cases oftenly referred including essential hypertension, mild myopia and diabetes mellitus. Causes of non-specialist disease referrals were code error as well as limited facilities, human resource, service management and competence of doctors. Such limitations need to be anticipated in order to minimalize act of referrals.

  6. Bajo peso al nacer, crecimiento y desarrollo en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Elia Rosa Lemus Lago

    1997-04-01

    Full Text Available Se efectuó un estudio descriptivo, longitudinal y retrospectivo en el área de salud del Policlínico Docente "19 de Abril" con los niños nacidos con peso inferior a los 2 500 g, en el año 1994, y se siguió su evolución clínica durante el primer año de vida, que correspondió a una muestra de 23 infantes. Los datos fueron recogidos de las historias clínicas individuales de los niños y de la embarazada. Se analizaron los parámetros peso, talla, circunsferencia cefálica, valoración nutricional y desarrollo psicomotor. Predominó el bajo peso para la edad gestacional con un 65,2 y el 34,7 % correspondió a los nacidos antes del término de la gestación. El 100 % de los pretérmino al año de vida tuvieron una valoración nutricional normal. No se comportaron de igual forma los de bajo peso para la edad gestacional en los que el 20 % quedaron por debajo del 3er. percentil.A descriptive, longitudinal and retrospective study was conducted at the health area of the "19 de Abril" Teaching Polyclinic. 23 infants who were born in 1994 with a birth weight < 2 500 g were included in the sample. Their clinical evolution was followed during the first year of life. The data were obtained from the individual medical histories of the children and of the pregnant women. The following parameters were analyzed: weight, size, cephalic perimeter, nutritional assessment and psychomotor development. Low weight prevailed for the gestational age with 65.2 %, whereas 34.7 % corresponded to preterm deliveries. 100 % of the preterm infants had a normal nutritional assessment after the first year of life. However, 20 % of those with low weight at the gestational age remained under the third percentile.

  7. Detector Description Framework in LHCb

    CERN Document Server

    Ponce, Sébastien

    2003-01-01

    The Gaudi architecture and framework are designed to provide a common infrastructure and environment for simulation, filtering, reconstruction and analysis applications. In this context, a Detector Description Service was developed in LHCb in order to also provide easy and coherent access to the description of the experimental apparatus. This service centralizes every information about the detector, including geometry, materials, alignment, calibration, structure and controls. From the proof of concept given by the first functional implementation of this service late 2000, the Detector Description Service has grown and has become one of the major components of the LHCb software, shared among all applications, including simulation, reconstruction, analysis and visualization. We describe here the full and functional implementation of the service. We stress the easiness of customization and extension of the detector description by the user, on the seamless integration with condition databases in order to handle ...

  8. Cloning flanking sequence by single-primer PCR in transgenic plants.

    Science.gov (United States)

    Ma, J; Wang, Y P; Ren, S; Zhang, Z; Lu, S; Wang, P W

    2014-10-20

    The insertion position of exogenous genes in plant genomes is usually identified by adapter ligation-mediated polymerase chain reaction (PCR), thermal asymmetric interlaced PCR, and restriction site extension PCR in transgenic plant research. However, these methods have various limitations, such as the complexity of designing primers and time-consuming and multiple-step procedures. The goal of this study was to establish an easier, more rapid, and more accurate method to clone flanking sequence using single-primer PCR in transgenic plants. Unknown flanking genome sequences in transgenic plants, including those in tobacco, soybean, rice, and maize, were cloned using the single-primer PCR method established in this study, with the Bar gene as the anchor gene. The primer 1 (P1), P2, and P3 PCRs obtained 4 sequences, and the completely correct flanking sequence of 508 bp that was obtained in the P3 PCR was verified by sequencing analysis. The single-primer PCR is more rapid and accurate than conventional methods, justifying its application widely in cloning flanking sequences in transgenic plants.

  9. Microleakage under metallic and ceramic brackets bonded with orthodontic self-etching primer systems.

    Science.gov (United States)

    Uysal, Tancan; Ulker, Mustafa; Ramoglu, Sabri Ilhan; Ertas, Huseyin

    2008-11-01

    To compare the in vitro microleakage of orthodontic brackets (metal and ceramic) between enamel-adhesive and adhesive-bracket interfaces at the occlusal and gingival sides produced by self-etching primer system with that of conventional acid etching and bonding. Sixty freshly extracted human mandibular premolar teeth were used in this study. The teeth were separated into four groups of 15 teeth each and received the following treatments: Group 1, 37% phosphoric acid gel + Transbond XT liquid primer + stainless steel bracket; Group 2, Transbond Plus Self-Etching Primer (TSEP) + stainless steel bracket; Group 3, 37% phosphoric acid gel + Transbond XT liquid primer + ceramic bracket; Group 4, TSEP + ceramic bracket. After curing, specimens were further sealed with nail varnish, stained with 0.5% basic fuchsine for 24 hours, sectioned and examined under a stereomicroscope, and scored for microleakage for the enamel-adhesive and bracket-adhesive interfaces from both occlusal and gingival margins. Statistical analyses were performed using Kruskal-Wallis and Mann-Whitney U tests. The gingival sides in all groups exhibited higher microleakage scores compared with those observed in occlusal sides for both adhesive interfaces. Enamel-adhesive interfaces exhibited more microleakage than did the adhesive-bracket interfaces. Brackets bonded with self-etching primer system showed significantly higher microleakage at the enamel-adhesive interface of the gingival side. TSEP causes more microleakage between enamel-adhesive interfaces, which may lead to lower bond strength and/or white-spot lesions.

  10. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2017-12-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  11. Genus-specific PCR primers targeting intracellular parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2017-12-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  12. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    Science.gov (United States)

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua

    2014-01-01

    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (pzirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  13. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  14. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  15. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin.

    Science.gov (United States)

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra; Park, Chan-Jin

    2015-10-01

    The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (PAg-Pd alloy surfaces presented significantly decreased shear bond strength. Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys.

  16. Evaluation of genotypic diversity of Streptococcus mutans using distinct arbitrary primers

    Directory of Open Access Journals (Sweden)

    Cínthia Pereira Machado Tabchoury

    2008-12-01

    Full Text Available Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11 presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers.

  17. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  18. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  19. Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection.

    Science.gov (United States)

    Sangdee, Aphidech; Natphosuk, Sitakan; Srisathan, Adunwit; Sangdee, Kusavadee

    2013-02-01

    The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 10(0) CFU/ml of genomic DNA and cells of E. coli, respectively.

  20. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    Science.gov (United States)

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (pcontrol. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  1. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  2. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  3. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  4. An alternative suite of universal primers for genotyping in multiplex PCR.

    Directory of Open Access Journals (Sweden)

    Cheng Ge

    Full Text Available The universal primer three-primer approach can dramatically reduce the cost when genotyping the microsatellites. One former research reported four universal primers that can be used in singleplex and multiplex genotyping. In this study, we proposed an alternative suite of universal primers with four dyes for genotyping 8-12 loci in one single run. This multiplex method was tested on Tetranychus truncatus. Published microsatellite loci of T. kanzawai, Frankliniella occidentalis and Nilaparvata lugens were modified as needed and also tested. The robustness of the method was confirmed by comparing with singleplex using multiple fluorophores and genotyping two populations of T. truncatus. This method showed lower signal strength than the singleplex three-primer system, but it was still sufficient to determine the fragment length. The cost of such a project can be reduced dramatically when many loci of different species are involved. In this way, laboratories performing population genetic analyses or studying several different species may benefit from the use of this cost-effective protocol.

  5. Nuclear Microsatellite Primers for the Endangered Relict Fir, Abies pinsapo (Pinaceae) and Cross-Amplification in Related Mediterranean Species

    OpenAIRE

    Sánchez Robles, José Manuel; Talavera Lozano, Salvador; García Castaño, Juan Luis; Terrab Benjelloun, Anass; Navarro Sampedro, Laura; Balao Robles, Francisco J.

    2012-01-01

    Twelve nuclear microsatellite primers (nSSR) were developed for the endangered species Abies pinsapo Boiss. to enable the study of gene flow and genetic structure in the remaining distribution areas. Microsatellite primers were developed using next-generation sequencing (454) data from a single Abies pinsapo individual. Primers were applied to thirty individuals from the three extant localities. The number of alleles per locus ranged from one to four. Cross-amplification was tested for other ...

  6. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  7. La política ferroviaria del primer gobierno radical 1916-1922

    Directory of Open Access Journals (Sweden)

    MARIO JUSTO LÓPEZ

    2013-05-01

    Full Text Available El gobierno argentino adoptó a comienzos del siglo XX un modelo de explotación ferroviaria basado en la actuación de empresas extranjeras, que obtenían su capital en el mercado financiero y que, para ello, debían tener utilidades. Su actuación quedó sometida al control estatal que se ejerció a través de la Dirección General de Ferrocarriles. Con el triunfo electoral de la Unión Cívica Radical en las elecciones presidenciales de 1916 la situación no cambió. El primer presidente radical, Hipólito Yrigoyen, continuó con dicho modelo y en los años difíciles que siguieron a la Primera Guerra Mundial se preocupó en mantener las utilidades de las empresas dándoles sucesivos aumentos de tarifas. La Dirección General de Ferrocarriles continuó siendo el órgano específico de contralor pero ahora con menos autonomía respecto del Presidente de la Nación. El estudio detallado de lo hecho en estos años desmiente la creencia de que el presidente Yrigoyen fue contrario a las empresas ferroviarias extranjeras y llevó adelante acciones en su perjuicio. Abstract At the beginning of the XXth Century, the Argentine Government left the main sections of the railway system in the hands of foreign companies. Those companies managed to obtain their capital from the financial market under the condition of being profitable. All those companies were controlled by the National Railways Board. In 1916, when the Radical Civic Union won the presidential election, nothing changed. Even during the difficult years after the First World War, Hipólito Yrigoyen, the first Radical President allowed fares increases that kept the level of profitability. The National Railways Board went on with the surveillance of the foreign companies, but now under the direct power of the President. A careful study of the first Radical Government railway policy shows that the mythical idea about President Yrigoyen acting against foreign companies is not true.

  8. A comparative clinical study of the failure rate of orthodontic brackets bonded with two adhesive systems: conventional and self-etching primer (SEP

    Directory of Open Access Journals (Sweden)

    Gladys Cristina Dominguez

    2013-04-01

    Full Text Available OBJECTIVE: This study compared the clinical performance of orthodontic brackets bonded with Transbond adhesive paste after two priming systems: a two-stage conventional system (acid etching + Transbond XT adhesive primer and a singlestage self-etching primer (SEP (Transbond Plus. METHODS: The sample comprised 480 metal brackets bonded to the teeth of 24 consecutive patients treated for 36 to 48 months. A split-mouth design was used for bonding, and both systems were used in each patient. Bracket failure rates for each system were analyzed; and failure causes as reported by the patients and the quadrant of teeth for which brackets failed were recorded. RESULTS: The conventional system group had a failure rate of 5.41%, whereas the rate for SEP was 4.58%. In this group, there were 5 failures (38.4% in the right maxillary quadrant, 2 (15.4% in the left maxillary quadrant, 4 (30.8% in the right mandibular quadrant, and 2 (15.4% in the left mandibular quadrant. In the SEP group, there were 4 (36.4% failures in the right maxillary quadrant, 1 (9% in the left maxillary quadrant, 3 (27.3% in the right mandibular quadrant, and 3 (27.3% in the left mandibular quadrant. Results of descriptive statistical analysis and odds ratio did not show any significant differences between rates (p = 0.67. CONCLUSION: The clinical efficiency of SEP was similar to that of the conventional system.

  9. Primer fármaco antiepiléptico : patrón de uso y efectividad

    OpenAIRE

    Martínez Domeño, Alejandro

    2013-01-01

    Estudiem el primer fàrmac antiepileptic utlitzat en 430 pacients amb epilèpsia, per valorar la seva taxa de retenció, efectivitat i tolerabilitat en el primer any de tractament. El 81% van rebre àcid valproic, carbamazepina o feintoina com primer tractament, tot i que l'ús de la fenitoina ha disminuit significativamen en els últims anys. La taxa de retenció annual és del 87%, sent més altes amb levetiracetam i lamotrigina. Un 40% van presentar recurrències en el primer any, sent major el risc...

  10. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  11. Analytical comparison of nine PCR primer sets designed to detect the presence of Escherichia coli/Shigella in water samples.

    Science.gov (United States)

    Maheux, Andrée F; Picard, François J; Boissinot, Maurice; Bissonnette, Luc; Paradis, Sonia; Bergeron, Michel G

    2009-07-01

    The analytical performance of 9 different PCR primer sets designed to detect Escherichia coli and Shigella in water has been evaluated in terms of ubiquity, specificity, and analytical detection limit. Of the 9 PCR primer sets tested, only 3 of the 5 primer sets targeting uidA gene and the primer set targeting tuf gene amplified DNA from all E. coli strains tested. However, of those 4 primer sets, only the primer set targeting the tuf gene also amplified DNA from all Shigella strains tested. For the specificity, only the primer sets targeting the uidA gene were 100% specific although the primer sets targeting 16S rRNA, phoE, and tuf genes only amplified Escherichia fergusonii as non-specific target. Finally, the primer set targeting the 16S-ITS-23S gene region, was not specific as it amplified DNA from many other Enterobacteriaceae species. In summary, only the assay targeting the tuf gene detected all E. coli/Shigella strains tested in this study. However, if it becomes important to discriminate between E. coli and E. fergusonii, assays targeting the uidA gene would represent a good choice although none of them were totally ubiquitous to detect of the presence of Shigella strains.

  12. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...

  13. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...... designed that can act as a forward primer in PCRs for any Perna species. Four reverse primers have also been designed, based on nad4 and intergenic spacer sequences, which yield species-specific products of different lengths when paired with the conserved forward primer. A further pair of primers has been...

  14. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  15. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  16. Standarized input for Hanford environmental impact statements. Part II: site description

    Energy Technology Data Exchange (ETDEWEB)

    Jamison, J.D.

    1982-07-01

    Information is presented under the following section headings: summary description; location and physiography; geology; seismology; hydrology; meteorology; ecology; demography and land use; and radiological condition. Five appendixes are included on the 100N, 200 east, 200 west, 300, and 400 areas. This report is intended to provide a description of the Hanford Site against which the environmental impacts of new projects at Hanford can be assessed. It is expected that the summary description amplified with material from the appropriate appendix, will serve as the basic site description section of environmental impact statements prepared to address the requirements of the National Environmental Policy Act (NEPA).

  17. [Aging effect of one bottle-type ceramic primer on bonding efficacy of resin cement].

    Science.gov (United States)

    Goto, Haruhiko

    2008-04-01

    To understand the degradation mechanisms of commercially available one bottle-type ceramic primer, we prepared one bottle-type experimental ceramic primer consisting of gamma-methacryloxy-propyl-trimethoxysilane, gamma-MPTS, and 90% ethanol solution. The effects of aging of the experimental primer on the hydrolysis and condensation behavior of gamma -MPTS and on the bonding efficacy of gamma-MPTS at the interface between cement and ceramic were studied. We used two lamina bond porcelain primers (LB), that had been aged for 20 months and newly purchased. Experimental primer was aged at 20 degrees C. After aging, we measured 29Si NMR spectrum of the gamma-MPTS and the shear bond strength of the cement to silane-treated ceramic by varying aging periods. When the LB was aged for 20 months, the mean bond strength decreased from 26 to 11 MPa. To understand the degradation mechanism in the bond strength, the effects of aging of experimental primer on molecular species of gamma-MPTS were examined. With prolonging its aging period, the methoxy group of the silicone functional portion in the gamma-MPTS hydrolyzed and the hydrolyzed gamma-MPTS species condensed together. The molecular weight of condensed gamma-MPTS species increased. On the other hand, when the dimer species of gamma-MPTS were produced, a maximum mean bond strength of 28 MPa was observed. Thereafter, the bond strength dropped down and leveled off at 16 MPa. When the LB was aged for 20 months, the bond strength dramatically decreased. This decrease in the mean bond strength was probably attributed to ester exchange reaction of the methoxyl group in the gamma-MPTS by the ethanol used as diluent solvent.

  18. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  19. Security Issues for Mobile Medical Imaging: A Primer.

    Science.gov (United States)

    Choudhri, Asim F; Chatterjee, Arindam R; Javan, Ramin; Radvany, Martin G; Shih, George

    2015-10-01

    The end-user of mobile device apps in the practice of clinical radiology should be aware of security measures that prevent unauthorized use of the device, including passcode policies, methods for dealing with failed login attempts, network manager-controllable passcode enforcement, and passcode enforcement for the protection of the mobile device itself. Protection of patient data must be in place that complies with the Health Insurance Portability and Accountability Act and U.S. Federal Information Processing Standards. Device security measures for data protection include methods for locally stored data encryption, hardware encryption, and the ability to locally and remotely clear data from the device. As these devices transfer information over both local wireless networks and public cell phone networks, wireless network security protocols, including wired equivalent privacy and Wi-Fi protected access, are important components in the chain of security. Specific virtual private network protocols, Secure Sockets Layer and related protocols (especially in the setting of hypertext transfer protocols), native apps, virtual desktops, and nonmedical commercial off-the-shelf apps require consideration in the transmission of medical data over both private and public networks. Enterprise security and management of both personal and enterprise mobile devices are discussed. Finally, specific standards for hardware and software platform security, including prevention of hardware tampering, protection from malicious software, and application authentication methods, are vital components in establishing a secure platform for the use of mobile devices in the medical field. © RSNA, 2015.

  20. Energy and environment: a primer for scientists and engineers

    Energy Technology Data Exchange (ETDEWEB)

    Thorndike, E.H.

    1976-01-01

    The book is written for practicing scientists and engineers and for students to introduce them to the field of energy and the environment; it is concerned with energy and how it affects the Earth's environment and how it affects man. Natural processes (weather and climate and biological systems) and man-made energy processes (such as the generation and distribution of electricity) are discussed. Chapter titles following an introductory chapter are Global Energy Flows; Biological Energy and Ecosystems; Sources of Energy; The Technology of Energy Use; Energy-Related Environmental Problems with five parts (General Considerations, Thermal Pollution, Radioactivity, Air Pollution, and Other Energy-Related Environmental Problems); Energy Use--History and Projections; Energy Conservation and Growth Reduction; and Conclusions and Biased Opinions. Questions are posed at the end of each chapter. Appendixes are entitled: A Short Course in Thermodynamics; A Short Course in Nuclear Physics; Electromagnetic Radiation; Title I of the National Environmental Policy Act of 1969; Units, Conversion Factors, Physical Constants, and Useful Numerical Data; and Answers to Selected Problems. (MCW)

  1. MALDI-TOF mass spectrometric detection of multiplex single base extended primers

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2004-01-01

    of multiple SNPs in a single reaction. Biotin-labeled ddNTPs were used in the SBE reaction and solid phase-bound monomeric avidin was used as capturing/purification scheme allowing the exclusive release of the SBE products under gentle conditions using 5% triethylamine. We dubbed this method monomeric avidin...... triethylamine purification. The biotin-labeled ddNTPs contained linkers with different masses ensuring a clear separation of the alleles even for SBE primers with a mass of 10 300 Da. Furthermore, only 25-350 fmol of SBE primers were necessary in order to obtain reproducible MALDI-TOF spectra. Similar signal...

  2. Microbial proteomics: a mass spectrometry primer for biologists

    Directory of Open Access Journals (Sweden)

    Graham Ciaren

    2007-08-01

    Full Text Available Abstract It is now more than 10 years since the publication of the first microbial genome sequence and science is now moving towards a post genomic era with transcriptomics and proteomics offering insights into cellular processes and function. The ability to assess the entire protein network of a cell at a given spatial or temporal point will have a profound effect upon microbial science as the function of proteins is inextricably linked to phenotype. Whilst such a situation is still beyond current technologies rapid advances in mass spectrometry, bioinformatics and protein separation technologies have produced a step change in our current proteomic capabilities. Subsequently a small, but steadily growing, number of groups are taking advantage of this cutting edge technology to discover more about the physiology and metabolism of microorganisms. From this research it will be possible to move towards a systems biology understanding of a microorganism. Where upon researchers can build a comprehensive cellular map for each microorganism that links an accurately annotated genome sequence to gene expression data, at a transcriptomic and proteomic level. In order for microbiologists to embrace the potential that proteomics offers, an understanding of a variety of analytical tools is required. The aim of this review is to provide a basic overview of mass spectrometry (MS and its application to protein identification. In addition we will describe how the protein complexity of microbial samples can be reduced by gel-based and gel-free methodologies prior to analysis by MS. Finally in order to illustrate the power of microbial proteomics a case study of its current application within the Bacilliaceae is given together with a description of the emerging discipline of metaproteomics.

  3. Fiscal policy under alternative monetary policy regimes

    OpenAIRE

    Diaz-Roldan; Carmelo Monteagudo-Cuerva

    2013-01-01

    In the particular policy framework of a monetary union, the management of fiscal policy becomes an issue of special relevance, because the fiscal discipline imposed by the monetary agreements could limit the scope of stabilization fiscal policies, and its implications on economic growth. Therefore, is not trivial to manage fiscal policy in such particular economic framework. In this paper we will review the implications of fiscal policy in open economies. But we will pay special attention to ...

  4. CANISTER HANDLING FACILITY DESCRIPTION DOCUMENT

    International Nuclear Information System (INIS)

    Beesley. J.F.

    2005-01-01

    The purpose of this facility description document (FDD) is to establish requirements and associated bases that drive the design of the Canister Handling Facility (CHF), which will allow the design effort to proceed to license application. This FDD will be revised at strategic points as the design matures. This FDD identifies the requirements and describes the facility design, as it currently exists, with emphasis on attributes of the design provided to meet the requirements. This FDD is an engineering tool for design control; accordingly, the primary audience and users are design engineers. This FDD is part of an iterative design process. It leads the design process with regard to the flowdown of upper tier requirements onto the facility. Knowledge of these requirements is essential in performing the design process. The FDD follows the design with regard to the description of the facility. The description provided in this FDD reflects the current results of the design process

  5. CANISTER HANDLING FACILITY DESCRIPTION DOCUMENT

    Energy Technology Data Exchange (ETDEWEB)

    J.F. Beesley

    2005-04-21

    The purpose of this facility description document (FDD) is to establish requirements and associated bases that drive the design of the Canister Handling Facility (CHF), which will allow the design effort to proceed to license application. This FDD will be revised at strategic points as the design matures. This FDD identifies the requirements and describes the facility design, as it currently exists, with emphasis on attributes of the design provided to meet the requirements. This FDD is an engineering tool for design control; accordingly, the primary audience and users are design engineers. This FDD is part of an iterative design process. It leads the design process with regard to the flowdown of upper tier requirements onto the facility. Knowledge of these requirements is essential in performing the design process. The FDD follows the design with regard to the description of the facility. The description provided in this FDD reflects the current results of the design process.

  6. Fuel Handling Facility Description Document

    International Nuclear Information System (INIS)

    M.A. LaFountain

    2005-01-01

    The purpose of the facility description document (FDD) is to establish the requirements and their bases that drive the design of the Fuel Handling Facility (FHF) to allow the design effort to proceed to license application. This FDD is a living document that will be revised at strategic points as the design matures. It identifies the requirements and describes the facility design as it currently exists, with emphasis on design attributes provided to meet the requirements. This FDD was developed as an engineering tool for design control. Accordingly, the primary audience and users are design engineers. It leads the design process with regard to the flow down of upper tier requirements onto the facility. Knowledge of these requirements is essential to performing the design process. It trails the design with regard to the description of the facility. This description is a reflection of the results of the design process to date

  7. Description du langage scientifique (Description of Scientific Language)

    Science.gov (United States)

    Widdowson, H. G.

    1977-01-01

    A description of scientific language using three approaches: text, textualization, and discourse. Scientific discourse is analogous to universal deep structure; text, to surface variations in diverse languages; and textualization, to transformational processes. The relationship of the primary and secondary (scientific) cultures and their languages…

  8. Auteur Description: From the Director's Creative Vision to Audio Description

    Science.gov (United States)

    Szarkowska, Agnieszka

    2013-01-01

    In this report, the author follows the suggestion that a film director's creative vision should be incorporated into Audio description (AD), a major technique for making films, theater performances, operas, and other events accessible to people who are blind or have low vision. The author presents a new type of AD for auteur and artistic films:…

  9. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    Science.gov (United States)

    Wright, K. E.; Domagal-Goldman, S. D.

    2011-12-01

    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  10. Examples of Consistency and Variability: Rural Policy Reviews of OECD Countries

    OpenAIRE

    Freshwater, David; Trapasso, Raffaele

    2012-01-01

    Between 2006 and 2009, the OECD undertook a series of reviews of national rural development policy. The reviews largely followed a consistent approach and used the OECD's New Rural Paradigm (NRP) as a common metric for assessing various national approaches. Although the reviews cannot be considered a formal evaluation of these rural policies, they do provide: a fairly uniform description of the policies being followed, a critique of the policies, and recommendations on how policies might be m...

  11. Examples of Consistency and Variability: Rural Policy Reviews of OECD Countries January 2012

    OpenAIRE

    Freshwater, David; Trapasso, Raffaele

    2012-01-01

    Between 2006 and 2009, the OECD undertook a series of reviews of national rural development policy. The reviews largely followed a consistent approach and used the OECD’s New Rural Paradigm (NRP) as a common metric for assessing various national approaches. Although the reviews cannot be considered a formal evaluation of these rural policies, they do provide: a fairly uniform description of the policies being followed, a critique of the policies, and recommendations on how policies might be m...

  12. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  13. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... A set of ten diverse mulberry accessions was used for screening the primers and standardizing PCR conditions. The PCR amplifications were carried out in 10 µl reaction volume, containing 10 ng template DNA, 1X DreamTaqTM Green Buffer (ThermoFisher. Scientific, Lithuania), 0.1 mM of each dNTPs, ...

  14. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  15. Universal primers for plasmid detection and method for their relative quantification in phytoplasma-infected plants

    Czech Academy of Sciences Publication Activity Database

    Petrzik, Karel; Sarkisova, Tatiana; Čurnová, L.

    2011-01-01

    Roč. 64, Suppl. (2011), s. 25-26 ISSN 1721-8861 R&D Projects: GA MZe QH91224 Institutional research plan: CEZ:AV0Z50510513 Keywords : Plasmid * universal primers * rep gene Subject RIV: EE - Microbiology, Virology Impact factor: 0.592, year: 2011

  16. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    Science.gov (United States)

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  17. A Primer on Polymer Nomenclature: Structure-Based, Sourced- Based, and Trade Names

    Science.gov (United States)

    Cheng, H. N.; Howell, Bob A.

    2017-01-01

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structurebased and source-based nomenclatures, together with trivial and trade…

  18. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  19. Multiply-primed rolling circle amplification of human papillomavirus using sequence-specific primers.

    Science.gov (United States)

    Marincevic-Zuniga, Yanara; Gustavsson, Inger; Gyllensten, Ulf

    2012-10-10

    Multiply-primed rolling circle amplification (RCA) is a suitable technique for amplification of circular templates and has been used to identify novel human papillomaviruses (HPV). In this study we develop an efficient RCA for whole genome amplification of HPV using HPV-specific primers in clinical samples and establish a protocol for whole genome sequencing using the Sanger method. Amplification of cloned HPV-genomes by RCA was compared using specific primers against random hexamers. Using HPV-specific primers increased the effectiveness on average 15.2 times and the enrichment of HPV relative to human gDNA on average 62.2 times, as compared to using random hexamer. RCA products were sequenced without need for cloning, even when using low-input amounts. The technique was successfully used on 4 patient samples from FTA cards, to generate whole HPV-genome sequences. Degenerated HPV-specific primers for RCA produce DNA of sufficient quality and quantity suitable for sequencing and other potential downstream analyses. Copyright © 2012. Published by Elsevier Inc.

  20. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  1. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  2. ANALISIS PRODUCT MAPPING DAYA SAING EKSPOR PRODUK PRIMER INDONESIA DAN CHINA

    Directory of Open Access Journals (Sweden)

    Sulthon Sjahril Sabaruddin

    2015-11-01

    Full Text Available This research attempts to analyze the mapping competition of the Indonesian and Chinese primary products in order to identify and map the strengths and weaknesses of Indonesian products vis-à-vis China. To examine this, the study uses tools such as the SMART Model (Software for Market Analysis and Restrictions on Trade, Social Accounting Matrix 2008 (SAM 2008, Normalized Revealed Comparative Advantage (NRCA and the Product Mapping. The results of the competition analysis found that Indonesia which rely on the export of primary products, in overall it is predicted to win the competition against China as the Indonesian primary products have better competitiveness than China. However, in the future, the competition will be fiercer, therefore, Indonesia should make efforts to improve further the competitiveness of Indonesian exports. Penelitian ini dimaksudkan untuk mengevaluasi peta persaingan produk primer Indonesia dan China guna mengidentifikasi dan memetakan kekuatan dan kelemahan produk Indonesia dalam persaingan dengan produk-produk primer asal China. Guna menelaah studi ini, beberapa perangkat dimanfaatkan yakni SMART Model (Software for Market Analysis and Restrictions on Trade, Sistem Neraca Sosial Ekonomi 2008 (SNSE 2008, Normalized Revealed Comparative Advantage (NRCA dan Product Mapping. Hasil analisis peta persaingan kedua negara, Indonesia yang mengandalkan ekspor produk primer diperkirakan secara keseluruhan unggul dibandingkan produk primer dari China karena Indonesia memiliki daya saing yang lebih baik dibandingkan China. Namun demikian, perlu diperhatikan bahwa persaingan ke depan akan berlangsung semakin ketat, oleh karena itu Indonesia perlu melakukan upaya untuk meningkatkan daya saing ekspor Indonesia.

  3. Book review: Estimation of parameters for animal populations: A primer for the rest of us

    Science.gov (United States)

    Post van der Burg, Max

    2016-01-01

    No abstract available.Estimation of Parameters for Animal Populations: A Primer for the Rest of Us. Larkin A. Powell and George A. Gale. 2015. Caught Napping Publications, Lincoln, Nebraska, USA. 239 pages. (http://larkinpowell.wixsite.com/larkinpowell/estimationof-parameters-for-animal-pop). ISBN: 978-329-06151-4.

  4. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  5. Application of nonsense-mediated primer exclusion (NOPE) for preparation of unique molecular barcoded libraries.

    Science.gov (United States)

    Shagin, Dmitriy A; Turchaninova, Maria A; Shagina, Irina A; Shugay, Mikhail; Zaretsky, Andrew R; Zueva, Olga I; Bolotin, Dmitriy A; Lukyanov, Sergey; Chudakov, Dmitriy M

    2017-06-05

    Recently we proposed efficient method to exclude undesirable primers at any stage of amplification reaction, here termed NOPE (NOnsense-mediated Primer Exclusion). According to this method, added oligonucleotide overlapping with the 3'-end of unwanted amplification primer (NOPE oligo) simultaneously provides a template for its elongation. This elongation disrupts specificity of unwanted primer, preventing its further participation in PCR. The suggested approach allows to rationally manage the course of PCR reactions in order to facilitate analysis of complex DNA mixtures as well as to perform multistage PCR bypassing intermediate purification steps. Here we apply NOPE method to DNA library preparation for the high-throughput sequencing (HTS) with the PCR-based introduction of unique molecular identifiers (UMI). We show that NOPE oligo efficiently neutralizes UMI-containing oligonucleotides after introduction of UMI into sample DNA molecules, thus allowing to proceed with further amplification steps without purification and associated loss of starting material. At the same time, NOPE oligo does not affect the efficiency of target PCR amplification. We describe a simple, robust and cheap modification of UMI-labeled HTS libraries preparation procedure, that allows to bypass purification step and thus to preserve starting material which may be limited, e.g. circulating tumor DNA, circulating fetal DNA, or small amounts of isolated cells of interest. Furthermore, demonstrated simplicity and robustness of NOPE method should make it popular in various PCR protocols.

  6. [Respiratory symptoms after the use of a painting primer product spray].

    Science.gov (United States)

    Ebbehøj, Niels E; Bang, John

    2008-09-22

    The use of waterproofing spray has been associated with the development of respiratory symptoms, but the pathogenetic mechanisms are unclear. We describe a case of acute respiratory disease with impaired diffusion developed after the use of a painting primer product spray (stain stop). Further investigation in aerosol-toxicology is needed.

  7. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  8. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    Science.gov (United States)

    Bill, R. C.; Sovey, J.; Allen, G. P.

    1981-01-01

    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.

  9. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  10. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  11. Replication and pathogenicity of primer binding site mutants of SL3-3 murine leukemia viruses

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Schmidt, J; Luz, A

    1999-01-01

    ) in undifferentiated embryonic cells. In this study we test whether SL3-3 MLV can replicate stably using tRNA primers other than the cognate tRNAPro and analyze the effect of altering the primer binding site sequence to match the 3' end of tRNA1Gln, tRNA3Lys, or tRNA1,2Arg in a mouse pathogenicity model. Contrary...... delayed relative to that of the wild-type virus, molecular tumor analysis indicated that all the primer binding site-modified viruses induce T-cell lymphomas similar to those induced by the wild-type virus in terms of frequencies of genomic rearrangements within the T-cell receptor beta......, recombination with endogenous viruses resulting in the generation of recombinant viruses carrying a glutamine primer binding site was detected in the majority of the tumors induced by the SL3-3 Lys3 mutant as well as in two tumors induced by wild-type SL3-3 and the SL3-3 Arg1,2 mutant....

  12. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  13. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  14. Historia del primer templo mayor de Tunja, nombrado de Nuestra Señora de Guadalupe

    Directory of Open Access Journals (Sweden)

    Ernesto Porras Collantes

    2004-01-01

    Full Text Available Gonzalo Suárez Rendón Sarmiento, fundador de Tunja, bautizó con el nombrede Nuestra Señora de Guadalupe al primer templo mayor de la ciudad. Elcarpintero Gregorio López estuvo a cargo de la construcción de la obra, desdefebrero hasta la navidad del año de

  15. Ronda: nuevas noticias sobre el primer y antiguo puente del Tajo

    Directory of Open Access Journals (Sweden)

    Inocencio Cadiñanos Bardeci

    2014-01-01

    Full Text Available Sobre este bello y famoso puente ya se ha escrito su proceso de construcción. Sin embargo, al hablar del primer intento de levantarlo, se exponen unas muy breves noticias que pretendo completar con otras halladas recientemente...

  16. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  17. Comparison of primers for the detection of pathogenic Escherichia coli using real-time PCR.

    Science.gov (United States)

    Barak, J D; Sananikone, K; Delwiche, M J

    2005-01-01

    To evaluate PCR primers for the detection of pathogenic Escherichia coli in a real-time PCR assay and determine their utility in produce irrigation water testing. Three previously published PCR primer sets and one set designed for this study were tested for their ability to produce amplification products for several pathogenic E. coli serotypes from whole cells as template. Two of the previously published primer sets were chosen for real-time PCR detection limit determination. The coneaeA and PEH detection limit of E. coli O157:H7 was 10(0) and 10(1) CFU rxn(-1) in sterile water respectively. To detect E. coli O157:H7 in sprout irrigation water, the water required dilution due to PCR inhibitors. The detection limit of the coneaeA and PEH was 10(1) and between 10(2) and 10(3) CFU rxn(-1) in diluted sprout irrigation water respectively. The primer set coneaeA was able to produce an amplification product from each E. coli serotype, except O128:H7 and most sensitive for real-time PCR detection of pathogenic E. coli in diluted sprout irrigation water. The necessity of a dissociation analysis to distinguish positive samples from those with fluorescence of random dsDNA generation for real-time PCR in a complex background was established.

  18. SDM-Assist software to design site-directed mutagenesis primers introducing "silent" restriction sites.

    Science.gov (United States)

    Karnik, Abhijit; Karnik, Rucha; Grefen, Christopher

    2013-03-22

    Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. We have developed a program - 'SDM-Assist' which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of 'mutated clones' by a simple restriction digest. The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs.

  19. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  20. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  1. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2017-06-01

    Full Text Available Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata that are processed into one of the most valued traditional Chinese medicines (TCM. The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

  2. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  3. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  4. Initiation of HIV-1 reverse transcription is regulated by a primer activation signal

    NARCIS (Netherlands)

    Beerens, N.; Groot, F.; Berkhout, B.

    2001-01-01

    Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome appears to be strictly regulated at the level of initiation. The primer binding site (PBS), at which the tRNA(3)(Lys) molecule anneals and reverse transcription is initiated, is present in a highly structured region

  5. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

    1998-01-01

    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  6. MICB Allele Genotyping on Microarrays by Improving the Specificity of Extension Primers.

    Directory of Open Access Journals (Sweden)

    In-Cheol Baek

    Full Text Available Major histocompatibility complex (MHC class I chain-related gene B (MICB encodes a ligand for activating NKG2D that expressed in natural killer cells, γδ T cells, and αβ CD8+ T cells, which is associated with autoimmune diseases, cancer, and infectious diseases. Here, we have established a system for genotyping MICB alleles using allele-specific primer extension (ASPE on microarrays. Thirty-six high quality, allele-specific extension primers were evaluated using strict and reliable cut-off values using mean fluorescence intensity (MFI, whereby an MFI >30,000 represented a positive signal and an MFI <10,000 represented a negative signal. Eight allele-specific extension primers were found to be false positives, five of which were improved by adjusting their length, and three of which were optimized by refractory modification. The MICB alleles (*002:01, *003, *005:02/*010, *005:03, *008, *009N, *018, and *024 present in the quality control panel could be exactly defined by 22 allele-specific extension primers. MICB genotypes that were identified by ASPE on microarrays were in full concordance with those identified by PCR-sequence-based typing. In conclusion, we have developed a method for genotyping MICB alleles using ASPE on microarrays; which can be applicable for large-scale single nucleotide polymorphism typing studies of population and disease associations.

  7. Primer system for single cell detection of double mutation for Tay-Sachs disease.

    Science.gov (United States)

    Liu, M C; Drury, K C; Kipersztok, S; Zheng, W; Williams, R S

    2000-02-01

    Nearly 100% of infantile Tay-Sachs disease is produced by two mutations occurring in the alpha chain of the lysosomal enzyme beta-N-acetylhexosaminidase (HEXA) in the Ashkenazi Jewish population. Although others have described primer systems used to amplify both sites simultaneously, few discuss the allele dropout problems inherent in this test. Our goal was to construct a more robust test enabling stronger signal generation for single cell preimplantation genetic diagnosis and to investigate the occurrence of allele dropout. New nested primers were designed to optimize detection of both major Tay-Sachs mutations. Four hundred fifty-seven single cells, including normal cells and those carrying mutations of either the 4bp insertion exon 11 or splice-site intron 12 defects, were used to screen a new primer system. Based on PCR amplified product analysis, total efficiency of amplification was 85.3%, (390/457). The allele dropout rate for the 4bp insertion mutation in exon 11 and splice-site mutation in intron 12 was 4.8% and 5.8%, respectively. Multiple mutation detection and analysis within the Tay-Sachs disease gene (HEXA) is possible using single cells for clinical preimplantation genetic diagnosis. Alternative PCR primers and conditions offer various methods for developing systems compatible to specific program requirements.

  8. Geotechnical Description of Mineral Deposits

    Directory of Open Access Journals (Sweden)

    Sasvári Tibor

    1996-06-01

    Full Text Available Performing various mineral deposits extraction methods requires thorough knowledge of the rock masses` geomechanical parameters. In the geotechnical description of mineral deposits there is proposed a methodical approarch at the collection, registration, and evaluation of rock masses` geological properties for geotechnics being applied within the mining industry.

  9. Natural Language Description of Emotion

    Science.gov (United States)

    Kazemzadeh, Abe

    2013-01-01

    This dissertation studies how people describe emotions with language and how computers can simulate this descriptive behavior. Although many non-human animals can express their current emotions as social signals, only humans can communicate about emotions symbolically. This symbolic communication of emotion allows us to talk about emotions that we…

  10. Task descriptions versus use cases

    DEFF Research Database (Denmark)

    Lauesen, Søren; Kuhail, Mohammad Amin

    2011-01-01

    project: Acquire a new system to support a hotline. Among the 15 replies, eight used traditional use cases that specified a dialog between user and system. Seven used a related technique, task description, which specified the customer’s needs without specifying a dialog. It also allowed the analyst...

  11. The geometry description markup language

    International Nuclear Information System (INIS)

    Chytracek, R.

    2001-01-01

    Currently, a lot of effort is being put on designing complex detectors. A number of simulation and reconstruction frameworks and applications have been developed with the aim to make this job easier. A very important role in this activity is played by the geometry description of the detector apparatus layout and its working environment. However, no real common approach to represent geometry data is available and such data can be found in various forms starting from custom semi-structured text files, source code (C/C++/FORTRAN), to XML and database solutions. The XML (Extensible Markup Language) has proven to provide an interesting approach for describing detector geometries, with several different but incompatible XML-based solutions existing. Therefore, interoperability and geometry data exchange among different frameworks is not possible at present. The author introduces a markup language for geometry descriptions. Its aim is to define a common approach for sharing and exchanging of geometry description data. Its requirements and design have been driven by experience and user feedback from existing projects which have their geometry description in XML

  12. Marketing and Merchandising, Course Description.

    Science.gov (United States)

    Boyer, Jerome L.; Anderson, Floyd L.

    This course description was developed by educators for use at the Work Opportunity Center which was established to teach high school dropouts and/or hard-core unemployed youth. The ultimate objectives of the marketing and merchandising curriculum are to prepare students for careers in distribution and to assist them in graduating from high school.…

  13. Use cases versus task descriptions

    DEFF Research Database (Denmark)

    Lauesen, Søren; Kuhail, Mohammad Amin

    2011-01-01

    to specify require-ments for the same project: Acquire a new system to support a hotline. [Princi-pal ideas/results] Among the 15 replies, eight used traditional use cases that specified a dialog between users and system. Seven used a related technique, task description, which specified the customer's needs...

  14. Epsilon. A System Description Language

    DEFF Research Database (Denmark)

    Jensen, Kurt; Kyng, Morten

    This paper discusses the use of Petri nets as a semantic tool in the design of languages and in the construction and analysis of system descriptions. The topics treated are: -- Languages based on nets. -- The problem of time in nets. -- Nets and related models. -- Nets and formal semantics...

  15. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  16. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  17. Evaluation of 16S rRNA gene primer pairs for monitoring microbial community structures showed high reproducibility within and low comparability between datasets generated with multiple archaeal and bacterial primer pairs

    Directory of Open Access Journals (Sweden)

    Martin Alexander Fischer

    2016-08-01

    Full Text Available The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community

  18. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  19. Use of allele-specific sequencing primers is an efficient alternative to PCR subcloning of low-copy nuclear genes.

    Science.gov (United States)

    Scheen, Anne-Cathrine; Pfeil, Bernard E; Petri, Anna; Heidari, Nahid; Nylinder, Stephan; Oxelman, Bengt

    2012-01-01

    Direct Sanger sequencing of polymerase chain reaction (PCR)-amplified nuclear genes leads to polymorphic sequences when allelic variation is present. To overcome this problem, most researchers subclone the PCR products to separate alleles. An alternative is to directly sequence the separate alleles using allele-specific primers. We tested two methods to enhance the specificity of allele-specific primers for use in direct sequencing: using short primers and amplification refractory mutation system (ARMS) technique. By shortening the allele-specific primer to 15-13 nucleotides, the single mismatch in the ultimate base of the primer is enough to hinder the amplification of the nontarget allele in direct sequencing and recover only the targeted allele at high accuracy. The deliberate addition of a second mismatch, as implemented in the ARMS technique, was less successful and seems better suited for allele-specific amplification in regular PCR rather than in direct sequencing. © 2011 Blackwell Publishing Ltd.

  20. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    Science.gov (United States)

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  1. Bond strength of primer/cement systems to zirconia subjected to artificial aging.

    Science.gov (United States)

    Zhao, Li; Jian, Yu-Tao; Wang, Xiao-Dong; Zhao, Ke

    2016-11-01

    Creating reliable and durable adhesion to the nonactive zirconia surface is difficult and has limited zirconia use. The introduction of functional monomers such as 10-methacryloyloxydecyl dihydrogen phosphate (MDP) appears to have enhanced bond strength to zirconia. The purpose of this in vitro study was to evaluate the long-term bond strength of several MDP-containing primer/cement systems to zirconia. Zirconia blocks were divided into 6 groups (n=24) according to the 3 primers/cements to be bonded, as follows: Scotchbond Universal/RelyX Ultimate (SU/RU; consisting of MDP-containing primer/MDP-free cement); Clearfil ceramic primer/Panavia F (CCP/PAN; consisting ofMDP-containing/MDP-containing); and Z-Prime Plus/Duo-Link (ZP/DUO; consisting ofMDP-containing/MDP-free), which were compared with 3 nonprimed groups, RU, PAN, and DUO. After bonding, each group was further divided into 3 subgroups (n=8) according to the level of aging: 24-hour storage in water at 37°C (24H); 30-day storage at 37°C (30D); and 30-day storage at 37°C followed by 3000 thermal cycles (30D/TC). After aging, a shear bond strength test and failure mode analysis were performed. The data were analyzed using 2-way ANOVA (α=.05). After aging, nearly all primer/cement groups presented significantly higher bond strength than the related nonprimed groups for each level of aging (Pzirconia. Copyright © 2016 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  2. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  3. A degenerate pair of primers for simultaneous detection of four alpha- and betanecroviruses.

    Science.gov (United States)

    Varanda, C M R; Cardoso, J M S; Oliveira, M D M; Oliveira, S; Clara, M I E; Félix, M R F

    2014-11-01

    The high infection levels due to Olive latent virus 1 (OLV-1), Olive mild mosaic virus (OMMV) (alphanecrovirus) and Tobacco necrosis virus D (TNV-D) (betanecrovirus) in Portuguese olive orchards prompted us to develop a rapid PCR-based assay for the simultaneous detection of these viruses aimed at the sanitary selection and marketing of plant material in compliance with European Union regulations. A pair of degenerate oligonucleotide primers, parRdRp5' and parCoat3' was designed based on conserved regions located in the RNA-dependent RNA polymerase (RdRp) and coat protein (CP) genes of these viruses and one other alphanecrovirus, Tobacco necrosis virus A. Its use in RT-PCR assays generated a product of ca. 2000 bp for the 4 viral species tested. These primers were compared with virus specific primers in multiplex RT-PCR, and identical results were obtained. Its application to dsRNA extracted from 54 olive field growing trees originated the expected ca. 2000 bp amplicon in 17 trees. The virus identity was determined by sequencing the cloned RT-PCR products. No TNV-A was found. The RT-PCR assay using the degenerate primers described in this study were shown to be reliable in detecting any of the above-mentioned alpha- and betanecroviruses, and it is as sensitive as that which uses virus specific primers in multiplex assays. Therefore, this assay is well suited for the rapid screen of virus-free plant material in selection and improvement crop programmes. Additionally, it has the potential to reveal virus diversity and the presence of new viruses, provided the RT-PCR generated amplicon is further sequenced. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Effect of dentin primers containing N-methylolacrylamide or N-methylolmethacrylamide on dentin pretreatment.

    Science.gov (United States)

    Fukushima, T; Itoh, T; Inoue, Y; Kawaguchi, M; Miyazaki, K

    1999-07-01

    The effect of experimental dentin primers containing N-methylolacrylamide (MEAA) or N-methylolmethacrylamide (MEMA) on the bonding of three commercial light-cured resin composite systems [Restorative Z 100 (Scotchbond), Palfique Estelite (Macbond) and Photo Clearfil A (Clearfil Photobond)] to etched dentin was investigated. Water solutions of 35% hydroxyethyl methacrylate (HEMA). 50% MEAA or 30% MEMA were used as dentin primers. The dentin etched with 10% phosphoric acid solution was pretreated with dentin primers for 30 s. The resin composite systems were applied in a Teflon tube positioned onto pretreated dentin surfaces. After water immersion for 1 day, the shear bond strengths were measured. The thicknesses of hybrid layers at dentin-resin interfaces treated with 6 mol/l HCl and 1% NaOCl were measured by scanning electron microscopy. The dentin primer pretreatment increased the bond strengths of all resin composite systems. For Macbond and Clearfil Photobond, the bond strengths (14.2-26.5 MPa) with MEAA and MEMA were higher than those (10.5 and 17.8 MPa) with HEMA. All hybrid layer thicknesses were 1-1.5 microns after HCl immersion. The hybrid layers after NaOCl immersion become narrower. The main fracture pattern of specimens exhibiting high bond strengths (more than 14.2 MPa) was dentin cohesive fracture after bond test. For Macbond and Clearfil Photobond, the layers of specimens pretreated with MEAA and MEMA were clearly thicker than those pretreated with HEMA after NaOCl immersion. MEAA and MEMA solutions were more effective in improving the bond strength of Macbond and Clearfil Photobond to etched dentin than was HEMA. Macbond and Clearfil Photobond created good hybrid dentin layers which could resist NaOCl-attack when MEAA and MEMA solutions were used as dentin primers.

  5. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  6. Research for health policy

    National Research Council Canada - National Science Library

    Bell, Erica

    2010-01-01

    ... Explicit, implicit, and pragmatic dimensions of policy-maker's needs and context 31 Constraints on policy-makers 32 Deciphering trade-offs 33 The policy-problem: deciphering uncertainty and the problem of innovation 34 A tool for deciphering policy problems 35 The different components of the policy problem 37 Recommended reading 38 Case studies in...

  7. CRACUK model description (appendices to the CRAC2 model description)

    International Nuclear Information System (INIS)

    Nixon, W.; Egan, M.J.

    1986-08-01

    The CRACUK computer code is a revised version of the US consequence modelling code CRAC2, adapted to suit UK requirements. The revisions include modifications to the models for spatial interval representation, weather sequence sampling, atmospheric dispersion, dosimetry and countermeasures. This document describes, in the form of appendices to the CRAC2 model description, each of the revisions made to the original model which collectively distinguish CRACUK from CRAC2. (author)

  8. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  9. An Examination of Two Policy Networks Involved in Advancing Smokefree Policy Initiatives

    Directory of Open Access Journals (Sweden)

    Sarah Moreland-Russell

    2015-09-01

    Full Text Available This study examines smokefree policy networks in two cities—Kansas City and St. Louis, Missouri—one that was successful in achieving widespread policy success, and one that was not. Descriptive social network analyses and visual network mapping were used to compare importance and contact relationships among actors involved in the smokefree policy initiatives. In Kansas City, where policy adoption was achieved, there was a higher level of connectivity among members, with network members being in contact with an average of more than five people, compared to just over two people for the St. Louis network. For both cities, despite being recognized as important, politicians were in contact with the fewest number of people. Results highlight the critical need to actively engage a variety of stakeholders when attempting city wide public health policy change. As evident by the success in smokefree policy adoption throughout Kansas City compared to St. Louis, closer linkages and continued communication among stakeholders including the media, coalitions, public health agencies, policymakers, and other partners are essential if we are to advance and broaden the impact of public health policy. Results indicate that the presence of champions, or those that play leadership roles in actively promoting policy by linking individuals and organizations, play an important role in advancing public health policy. Those working in public health should examine their level of engagement with the policy process and implement strategies for improving that engagement through relationship building and ongoing interactions with a variety of stakeholders, including policymakers.

  10. An Examination of Two Policy Networks Involved in Advancing Smokefree Policy Initiatives.

    Science.gov (United States)

    Moreland-Russell, Sarah; Carothers, Bobbi J

    2015-09-08

    This study examines smokefree policy networks in two cities—Kansas City and St. Louis, Missouri—one that was successful in achieving widespread policy success, and one that was not. Descriptive social network analyses and visual network mapping were used to compare importance and contact relationships among actors involved in the smokefree policy initiatives. In Kansas City, where policy adoption was achieved, there was a higher level of connectivity among members, with network members being in contact with an average of more than five people, compared to just over two people for the St. Louis network. For both cities, despite being recognized as important, politicians were in contact with the fewest number of people. Results highlight the critical need to actively engage a variety of stakeholders when attempting city wide public health policy change. As evident by the success in smokefree policy adoption throughout Kansas City compared to St. Louis, closer linkages and continued communication among stakeholders including the media, coalitions, public health agencies, policymakers, and other partners are essential if we are to advance and broaden the impact of public health policy. Results indicate that the presence of champions, or those that play leadership roles in actively promoting policy by linking individuals and organizations, play an important role in advancing public health policy. Those working in public health should examine their level of engagement with the policy process and implement strategies for improving that engagement through relationship building and ongoing interactions with a variety of stakeholders, including policymakers.

  11. FACTORES QUE AFECTAN EL INTERVALO PARTO-PRIMER SERVICIO Y PRIMER SERVICIO-CONCEPCIÓN EN VACAS LECHERAS DEL VALLE DEL MANTARO DURANTE LA ÉPOCA LLUVIOSA.

    OpenAIRE

    Arana D., Carlos; Estación Experimental IVITA-El Mantaro, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima Perú.; Echevarría C., Luisa; Laboratorio de Reproducción Animal, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima Perú.; Segura C., Julia; Facultad de Veterinaria y Zootecnia, Universidad Peruana Cayetano Heredia

    2012-01-01

    Se realizó un seguimiento reproductivo en 40 vacas lecheras del valle delMantaro (Junín, Perú), pertenecientes a 6 establos, durante la época lluviosa. Se determinó el intervalo parto-primera ovulación (IPPO), el intervalo parto-primer servicio (IPPS), y el intervalo parto-concepción (IPC), midiendo el efecto de raza, número de parto, producción de leche, establo y nivel tecnológico. El IPPO se determinó a través de niveles de progesterona mediante radioinmunoensayo en muestras de leche descr...

  12. Primer on Use of Multi-Spectral and Infra Red Imaging for On-Site Inspections

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, J R

    2010-10-26

    The purpose of an On-Site Inspection (OSI) is to determine whether a nuclear explosion has occurred in violation of the Comprehensive Nuclear Test Ban Treaty (CTBT), and to gather information which might assist in identifying the violator (CTBT, Article IV, Paragraph 35) Multi-Spectral and Infra Red Imaging (MSIR) is allowed by the treaty to detect observables which might help reduce the search area and thus expedite an OSI and make it more effective. MSIR is permitted from airborne measurements, and at and below the surface to search for anomalies and artifacts (CTBT, Protocol, Part II, Paragraph 69b). The three broad types of anomalies and artifacts MSIR is expected to be capable of observing are surface disturbances (disturbed earth, plant stress or anomalous surface materials), human artifacts (man-made roads, buildings and features), and thermal anomalies. The purpose of this Primer is to provide technical information on MSIR relevant to its use for OSI. It is expected that this information may be used for general background information, to inform decisions about the selection and testing of MSIR equipment, to develop operational guidance for MSIR use during an OSI, and to support the development of a training program for OSI Inspectors. References are provided so readers can pursue a topic in more detail than the summary information provided here. The following chapters will provide more information on how MSIR can support an OSI (Section 2), a short summary what Multi-Spectral Imaging and Infra Red Imaging is (Section 3), guidance from the CTBT regarding the use of MSIR (Section 4), and a description of several nuclear explosion scenarios (Section 5) and consequent observables (Section 6). The remaining sections focus on practical aspects of using MSIR for an OSI, such as specification and selection of MSIR equipment, operational considerations for deployment of MISR equipment from an aircraft, and the conduct of field exercises to mature MSIR for an OSI

  13. Policy Archaeology: A New Policy Studies Methodology.

    Science.gov (United States)

    Scheurich, James Joseph

    1994-01-01

    Discusses policy archaeology, a radically different approach to policy studies in education drawn from the poststructuralist work of Foucault. Policy archaeology examines the social construction of problems before they become visible, focusing on five social regularities (race, gender, class, governmentality, and professionalization) comprising…

  14. Continuum description for jointed media

    International Nuclear Information System (INIS)

    Thomas, R.K.

    1982-04-01

    A general three-dimensional continuum description is presented for a material containing regularly spaced and approximately parallel jointing planes within a representative elementary volume. Constitutive relationships are introduced for linear behavior of the base material and nonlinear normal and shear behavior across jointing planes. Furthermore, a fracture permeability tensor is calculated so that deformation induced alterations to the in-situ values can be measured. Examples for several strain-controlled loading paths are presented

  15. GROUNDWATER PROTECTION MANAGEMENT PROGRAM DESCRIPTION.

    Energy Technology Data Exchange (ETDEWEB)

    PAQUETTE,D.E.; BENNETT,D.B.; DORSCH,W.R.; GOODE,G.A.; LEE,R.J.; KLAUS,K.; HOWE,R.F.; GEIGER,K.

    2002-05-31

    THE DEPARTMENT OF ENERGY ORDER 5400.1, GENERAL ENVIRONMENTAL PROTECTION PROGRAM, REQUIRES THE DEVELOPMENT AND IMPLEMENTATION OF A GROUNDWATER PROTECTION PROGRAM. THE BNL GROUNDWATER PROTECTION MANAGEMENT PROGRAM DESCRIPTION PROVIDES AN OVERVIEW OF HOW THE LABORATORY ENSURES THAT PLANS FOR GROUNDWATER PROTECTION, MONITORING, AND RESTORATION ARE FULLY DEFINED, INTEGRATED, AND MANAGED IN A COST EFFECTIVE MANNER THAT IS CONSISTENT WITH FEDERAL, STATE, AND LOCAL REGULATIONS.

  16. Personality: Description, Classification and Evaluation

    Directory of Open Access Journals (Sweden)

    Ibrahim Taymur

    2012-06-01

    Full Text Available Many descriptions and classifications of personality have been made to understand and acknowledge human being through out the history. During the developmental process of psychiatry, almost every school defined and assessed personality regarding to their own perspective. As DSM (Diagnostical and Statistical Manual of Mental Disorders and ICD (International Classification of Diseases being available to common usage, scientists conducted studies to set a common terminology for personality. Categorical and dimensional approaches are the most fundamentally different assessment strategies in the research and clinical aspects about personality. While categorical approach views the personality as dichotomies which consists of different groups, dimensional approach aims to describe the personality on the basis of dimensions, thus suggests that the personality is a structure formed by definite dimensions. Several advantages and disadvantages can be noticed when descriptions of personality and tools for the evaluation of personality are reviewed. When the section making suggestions about personality disorder in DSM-5 is evaluated, it is seen that it aims to restructure the personality disorder diagnostic group according to new findings and critiques. In this article, the description of personality throughout the history, dimensional, categorical and cognitive approaches to personality, the features of the tools that are used to assess and measure the personality are reviewed.

  17. Description of fiction in Wikipedia

    Directory of Open Access Journals (Sweden)

    Alenka Šauperl

    2010-01-01

    Full Text Available Subject description of fiction in the Slovenian Cooperative On-line Bibliographic Database (COBIB is still inadequate. Participation in COBIB is granted to librarians who have successfully passed the exam. As a consequence, the number of contributing librarians is limited. However, all Slovenian librarians can collaborate in the Slovenian Wikipedia. Slovenian and foreign library science researchers have proposed the structure of subject description of fiction. An analysis of articles describing nine works of fiction in five wikipedias (English, French, Spanish, Croatian and Slovenian has shown new characteristics. Drawing on these findings, a suggestion of an optimal structure is made. An article describing a work of fiction should begin with a general introductory statement comprising the name of the author, his/her nationality and genre.Translators and original title should be written if a translation is presented. Illustrators and other contributors, the background and other specific information on the work should be added if relevant. The main body of the text should be structured in the following chapters: 1 contents, 2 collection, 3 reviews and awards, 4 editions and translations, 5 adaptations, 6 see also, 7 links and 8 sources. An "infobox: book" with Slovenian adaptation and relevant categories should be inserted. Copying these Wikipedia articles into the library catalogue would enhance subject description and provide better subject access to fiction.

  18. School Sun-Protection Policies: Measure Development and Assessments in 2 Regions of the United States

    Science.gov (United States)

    Reynolds, Kim D.; Buller, David B.; French, Simone A.; Buller, Mary K.; Ashley, Jeff L.

    2012-01-01

    Background: In 2002, the US Centers for Disease Control and Prevention recommended that schools adopt policies that reduce exposure of children to ultraviolet radiation to prevent skin cancer. We report here the development of a school sun-safety policy measure and baseline descriptive statistics from the assessment of written policies collected…

  19. Policy Windows, Public Opinion, and Policy Ideas: The Evolution of No Child Left Behind

    Science.gov (United States)

    Jaiani, Vasil; Whitford, Andrew B.

    2011-01-01

    Purpose: The purpose of this paper is to examine the policy process that led to the passage of the No Child Left Behind (NCLB) Act in the United States and the Bush Administration's role in this process. Design/methodology/approach: The research design is historical and archival. A description of the NCLB Act is given and the major provisions and…

  20. Policy-dependent determinants of several important health problems and related actors in policy-making

    NARCIS (Netherlands)

    Lucht F van der; Jansen J; NsPh; VTV

    2002-01-01

    The exploratory study reported on here investigated the possibilities offered by intersectoral (health) policy. The study consisted of two parts. First, a broad description was given of determinants of five health problems (cancer, Chronic non specific lung disease (CNSLD), heart disease, injury due