WorldWideScience

Sample records for policy primer descriptive

  1. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  2. A Web Policy Primer.

    Science.gov (United States)

    Levine, Elliott

    2001-01-01

    Sound technology policies can spell the difference between an effective website and an online nightmare. An effective web development policy addresses six key areas: roles and responsibilities, content/educational value, privacy and safety, adherence to copyright laws, technical standards, and use of commercial sites and services. (MLH)

  3. A Primer on Macroprudential Policy

    Science.gov (United States)

    Poutineau, Jean-Christophe; Vermandel, Gauthier

    2015-01-01

    This article introduces macroprudential policy using a static New Keynesian Macroeconomics model with financial frictions. The authors analyze two related questions: First, they show how the procyclicality of financial factors, captured by the financial accelerator, amplifies the transmission of supply and demand shocks and impacts the intuition…

  4. Vaccine supply, demand, and policy: a primer.

    Science.gov (United States)

    Muzumdar, Jagannath M; Cline, Richard R

    2009-01-01

    To provide an overview of supply and demand issues in the vaccine industry and the policy options that have been implemented to resolve these issues. Medline, Policy File, and International Pharmaceutical Abstracts were searched to locate academic journal articles. Other sources reviewed included texts on the topics of vaccine history and policy, government agency reports, and reports from independent think tanks. Keywords included vaccines, immunizations, supply, demand, and policy. Search criteria were limited to English language and human studies. Articles pertaining to vaccine demand, supply, and public policy were selected and reviewed for inclusion. By the authors. Vaccines are biologic medications, therefore making their development and production more difficult and costly compared with "small-molecule" drugs. Research and development costs for vaccines can exceed $800 million, and development may require 10 years or more. Strict manufacturing regulations and facility upgrades add to these costs. Policy options to increase and stabilize the supply of vaccines include those aimed at increasing supply, such as government subsidies for basic vaccine research, liability protection for manufacturers, and fast-track approval for new vaccines. Options to increase vaccine demand include advance purchase commitments, government stockpiles, and government financing for select populations. High development costs and multiple barriers to entry have led to a decline in the number of vaccine manufacturers. Although a number of vaccine policies have met with mixed success in increasing the supply of and demand for vaccines, a variety of concerns remain, including developing vaccines for complex pathogens and increasing immunization rates with available vaccines. New policy innovations such as advance market commitments and Medicare Part D vaccine coverage have been implemented and may aid in resolving some of the problems in the vaccine industry.

  5. Policy and System Approach (PSA: A primer

    Directory of Open Access Journals (Sweden)

    Chandrakant Lahariya

    2017-01-01

    Full Text Available A number of public health challenges have emerged at global and national level in the last two decades. The response to these challenges has rarely been swift and often “knee-jerk.” The national and state level program officials responsible for the activities often apportion the blame on weak health systems or fragmented health service delivery mechanisms, amongst other. In India, the viral illnesses (including those due to dengue and chikungunya are becoming the increasing realities. The Public health response of early identification, disease surveillance, reporting and the preventive and curative measures, remains suboptimal. The health challenges which require multidimensional interventions are usuallyattempted to be resolved through piece meal solutions. This article proposes “policy and system approach (PSA,” combining concepts of “Health in all policies” for intersectoral coordination and “health system approach” for intra-sectoral tackling of the emerging and existing health challenges.

  6. A Statistical Primer: Understanding Descriptive and Inferential Statistics

    OpenAIRE

    Gillian Byrne

    2007-01-01

    As libraries and librarians move more towards evidence‐based decision making, the data being generated in libraries is growing. Understanding the basics of statistical analysis is crucial for evidence‐based practice (EBP), in order to correctly design and analyze researchas well as to evaluate the research of others. This article covers the fundamentals of descriptive and inferential statistics, from hypothesis construction to sampling to common statistical techniques including chi‐square, co...

  7. THE SHEFFIELD ALCOHOL POLICY MODEL - A MATHEMATICAL DESCRIPTION.

    Science.gov (United States)

    Brennan, Alan; Meier, Petra; Purshouse, Robin; Rafia, Rachid; Meng, Yang; Hill-Macmanus, Daniel; Angus, Colin; Holmes, John

    2014-09-30

    This methodology paper sets out a mathematical description of the Sheffield Alcohol Policy Model version 2.0, a model to evaluate public health strategies for alcohol harm reduction in the UK. Policies that can be appraised include a minimum price per unit of alcohol, restrictions on price discounting, and broader public health measures. The model estimates the impact on consumers, health services, crime, employers, retailers and government tax revenues. The synthesis of public and commercial data sources to inform the model structure is described. A detailed algebraic description of the model is provided. This involves quantifying baseline levels of alcohol purchasing and consumption by age and gender subgroups, estimating the impact of policies on consumption, for example, using evidence on price elasticities of demand for alcohol, quantification of risk functions relating alcohol consumption to harms including 47 health conditions, crimes, absenteeism and unemployment, and finally monetary valuation of the consequences. The results framework, shown for a minimum price per unit of alcohol, has been used to provide policy appraisals for the UK government policy-makers. In discussion and online appendix, we explore issues around valuation and scope, limitations of evidence/data, how the framework can be adapted to other countries and decisions, and ongoing plans for further development. © 2014 The Authors. Health Economics published by John Wiley & Sons Ltd. © 2014 The Authors. Health Economics published by John Wiley & Sons Ltd.

  8. Analytical methodology and facility description spent fuel policy

    Energy Technology Data Exchange (ETDEWEB)

    1978-08-01

    Three generic environmental impact statements (GEISs) on domestic fuels, foreign fuels, and storage charges are being prepared to provide environmental input into decisions on whether, and if so how the 1977 Presidential policy on spent fuel storage should be implmented. This report provides background information for two of these environmental impact statements: Storage of U.S. Spent Power Reactor Fuel and Storage of Foreign Spent Power Reactor Fuel. It includes the analytical methodology used in GEISs to assess the environmental effects and a description of the facilities used in the two GEISs.

  9. Analytical methodology and facility description spent fuel policy

    International Nuclear Information System (INIS)

    1978-08-01

    Three generic environmental impact statements (GEISs) on domestic fuels, foreign fuels, and storage charges are being prepared to provide environmental input into decisions on whether, and if so how the 1977 Presidential policy on spent fuel storage should be implmented. This report provides background information for two of these environmental impact statements: Storage of U.S. Spent Power Reactor Fuel and Storage of Foreign Spent Power Reactor Fuel. It includes the analytical methodology used in GEISs to assess the environmental effects and a description of the facilities used in the two GEISs

  10. State and Local Clean Energy Policy Primer: Getting from Here to Clean Electricity with Policy (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2011-04-01

    This fact sheet proposes a framework for how states and localities can build policy portfolios by first setting the stage for clean energy in the market with low cost policies, and then growing the market with successive policies until the need for financial incentives can be reduced and eventually eliminated.

  11. A Descriptive Study of Music Teacher Educators' Beliefs about Policy

    Science.gov (United States)

    Aguilar, Carla E.; Richerme, Lauren Kapalka

    2016-01-01

    While policies at all levels affect music educators, and music education researchers have called for increased attention to policy issues, few have explored preservice music teacher educators' beliefs about policy. This study examined music teacher educators' (N = 81) familiarity with and attitudes toward contemporary education and music education…

  12. The Value of Qualitative Description in Health Services and Policy Research

    Science.gov (United States)

    2017-01-01

    Health services and policy (HSP) researchers have long used qualitative research methodologies to explore health system issues. However, the appropriateness of one approach, qualitative description, for HSP research is still often overlooked. In this article, I discuss the role that qualitative description can play in HSP research, and argue for its greater acceptance as a valid form of academic scholarship. PMID:28277201

  13. Towards "Thick Description" of Educational Transfer: Understanding a Japanese Institution's "Import" of European Language Policy

    Science.gov (United States)

    Rappleye, Jeremy; Imoto, Yuki; Horiguchi, Sachiko

    2011-01-01

    Globalisation and convergence in educational policy worldwide has reinvigorated, while rendering more complex, the classic theme of educational transfer. Framed by this wider pursuit of new understandings of a changing transfer/context puzzle, this paper explores how an ethnographic "thick description" might complement and extend recent…

  14. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  15. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  16. Telecommunications Primer

    OpenAIRE

    Joseph Becker

    2013-01-01

    A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  17. Telecommunications Primer

    Directory of Open Access Journals (Sweden)

    Joseph Becker

    2013-05-01

    Full Text Available A description of modern telecommunications devices which can be useful in inter-library communications, including their capacities, types of signals and carriers. Described are telephone lines, radio broadcasting, coaxial cable, microwave and communications satellites. This article, and the one following, were presented as tutorials by the author's to participants at the American Library Association's Atlantic City Convention on June 25, 1969.

  18. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  19. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  20. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  1. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  2. IALS and Essential Skills in Canadian Literacy Policy and Practice: A Descriptive Overview

    Science.gov (United States)

    Centre for Literacy, 2013

    2013-01-01

    This paper gathers descriptions on the use of the International Adult Literacy Survey (IALS) and essential skills cross Canada. IALS was developed as a population measure to lay out the distribution of skills and their relationship to other social and economic attributes. The information was taken from federal, provincial, and territorial…

  3. Knowledge Worker Perceptions of Telework Policy in the New York Metropolitan Area: A Qualitative Descriptive Study

    Science.gov (United States)

    Slaughter, Sandra Lorraine Hawks

    2013-01-01

    This qualitative descriptive case study, "Knowledge Worker Perceptions of Telework in the New York Metropolitan Area," was conducted to explore the perceptions of knowledge workers who commute to a physical workplace in the New York Metropolitan area (NYMA). In-depth interviews were conducted with fourteen NYMA commuters who are…

  4. Privacy Policies for Apps Targeted Toward Youth: Descriptive Analysis of Readability

    Science.gov (United States)

    Das, Gitanjali; Cheung, Cynthia; Nebeker, Camille; Bietz, Matthew

    2018-01-01

    Background Due to the growing availability of consumer information, the protection of personal data is of increasing concern. Objective We assessed readability metrics of privacy policies for apps that are either available to or targeted toward youth to inform strategies to educate and protect youth from unintentional sharing of personal data. Methods We reviewed the 1200 highest ranked apps from the Apple and Google Play Stores and systematically selected apps geared toward youth. After applying exclusion criteria, 99 highly ranked apps geared toward minors remained, 64 of which had a privacy policy. We obtained and analyzed these privacy policies using reading grade level (RGL) as a metric. Policies were further compared as a function of app category (free vs paid; entertainment vs social networking vs utility). Results Analysis of privacy policies for these 64 apps revealed an average RGL of 12.78, which is well above the average reading level (8.0) of adults in the United States. There was also a small but statistically significant difference in word count as a function of app category (entertainment: 2546 words, social networking: 3493 words, and utility: 1038 words; P=.02). Conclusions Although users must agree to privacy policies to access digital tools and products, readability analyses suggest that these agreements are not comprehensible to most adults, let alone youth. We propose that stakeholders, including pediatricians and other health care professionals, play a role in educating youth and their guardians about the use of Web-based services and potential privacy risks, including the unintentional sharing of personal data. PMID:29301737

  5. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  6. Corporal Punishment in the State of Louisiana: A Descriptive Study of Policies and Practices

    Science.gov (United States)

    Broussard, Mary R.

    2014-01-01

    Louisiana is currently one of the 19 states in the United States that still allow the use of corporal punishment in public schools. The research questions that drove this study explored Louisiana-published court cases involving corporal punishment in public schools, district policies regarding the use of corporal punishment, reported instances of…

  7. Characteristics of Teachers; A Survey Tool for Policy Making. A Descriptive Study in Liberia.

    Science.gov (United States)

    Reed, Rodney J.

    This study examines the usefulness of survey instruments in educational policy making in Liberia, a developing country. The chapter, "Liberia, an Overview," summarizes available background information about Liberian education and introduces the complex issues facing educational planners. "Procedures," discusses the general…

  8. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  9. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  10. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  11. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  12. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  13. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  14. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  15. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  16. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  17. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  18. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  19. First Year University Students' Use of Formulaic Sequences in Oral and Written Descriptions (El uso de secuencias formulaicas de estudiantes de primer año en descripciones orales y escritas)

    Science.gov (United States)

    Gómez Burgos, Eric

    2015-01-01

    The present article investigates the use of first year university students' formulaic sequences in written and oral texts in an English as a foreign language context. The corpus of the study consists of eight descriptive texts--four written and four oral--which were composed of four students of English Pedagogy at a university in Santiago, Chile.…

  20. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  1. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Biostatistics primer: part I.

    Science.gov (United States)

    Overholser, Brian R; Sowinski, Kevin M

    2007-12-01

    Biostatistics is the application of statistics to biologic data. The field of statistics can be broken down into 2 fundamental parts: descriptive and inferential. Descriptive statistics are commonly used to categorize, display, and summarize data. Inferential statistics can be used to make predictions based on a sample obtained from a population or some large body of information. It is these inferences that are used to test specific research hypotheses. This 2-part review will outline important features of descriptive and inferential statistics as they apply to commonly conducted research studies in the biomedical literature. Part 1 in this issue will discuss fundamental topics of statistics and data analysis. Additionally, some of the most commonly used statistical tests found in the biomedical literature will be reviewed in Part 2 in the February 2008 issue.

  3. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  4. A Brief Taxometrics Primer

    OpenAIRE

    Beauchaine, Theodore P.

    2007-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of s...

  5. Information Operations Primer

    Science.gov (United States)

    2011-11-01

    to the message, however…a fact not envisioned in 1948 when the act became effective. 9 David E. Kaplan "Hearts, Minds, and Dollars." U.S. News and...industrial turbine via commands sent through its SCADA system. 8 Clay Wilson, Botnets, Cybercrime, and Cyberterrorism: Vulnerabilities and Policy Issues for

  6. Defense Primer: Procurement

    Science.gov (United States)

    2017-02-10

    Usually, incremental funding is used to mitigate peaks and valleys in annual budgets caused by the cost of one item significantly changing the...base defense budget . DOD uses these funds to buy several different types of materiel, including  new items easily recognizable as military...pursues a policy of full funding for procurement, meaning that the total estimated cost of each unit must be funded in the year it is budgeted . In a

  7. Evidence-informed health policy 4 – Case descriptions of organizations that support the use of research evidence

    Directory of Open Access Journals (Sweden)

    Oxman Andrew D

    2008-12-01

    Full Text Available Abstract Background Previous efforts to produce case descriptions have typically not focused on the organizations that produce research evidence and support its use. External evaluations of such organizations have typically not been analyzed as a group to identify the lessons that have emerged across multiple evaluations. Case descriptions offer the potential for capturing the views and experiences of many individuals who are familiar with an organization, including staff, advocates, and critics. Methods We purposively sampled a subgroup of organizations from among those that participated in the second (interview phase of the study and (once from among other organizations with which we were familiar. We developed and pilot-tested a case description data collection protocol, and conducted site visits that included both interviews and documentary analyses. Themes were identified from among responses to semi-structured questions using a constant comparative method of analysis. We produced both a brief (one to two pages written description and a video documentary for each case. Results We conducted 51 interviews as part of the eight site visits. Two organizational strengths were repeatedly cited by individuals participating in the site visits: use of an evidence-based approach (which was identified as being very time-consuming and existence of a strong relationship between researchers and policymakers (which can be challenged by conflicts of interest. Two organizational weaknesses – a lack of resources and the presence of conflicts of interest – were repeatedly cited by individuals participating in the site visits. Participants offered two main suggestions for the World Health Organization (and other international organizations and networks: 1 mobilize one or more of government support, financial resources, and the participation of both policymakers and researchers; and 2 create knowledge-related global public goods. Conclusion The findings from

  8. Experiences with a novel policy for managing conflicts of interest of guideline developers: a descriptive qualitative study.

    Science.gov (United States)

    Neumann, Ignacio; Karl, Renee; Rajpal, Aman; Akl, Elie A; Guyatt, Gordon H

    2013-08-01

    The executive committee of the Antithrombotic Therapy and Prevention of Thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines (AT9) developed a novel policy for managing conflicts of interest (COIs): Methodologists bore primary responsibility for each chapter, there was equal emphasis on intellectual and financial COI, and content experts with COIs participated, but with restrictions for recommendations on which they had conflicts. The objective of this study was to explore the experiences of the methodologists and content experts with the COI policy after its implementation. One investigator conducted two rounds of semistructured interviews with the methodologist and the leading content expert of each chapter until data saturation was achieved. Two investigators analyzed the transcripts of the interviews in duplicate using an immersion-crystallization approach. We also conducted member checking. We interviewed 15 participants and presented the results to the remaining four for verification. In comparison with their views expressed prior to AT9 development, methodologists remained more positive about the policy than content experts. Six of 10 content experts expressed a more positive view than prior to participation in the AT9 process. The other four content experts remained skeptical, especially regarding the emphasis on intellectual COI. The restrictions of the policy on conflicted individuals were not fully implemented. After its implementation, some content experts were more favorable to the policy, but some retained major reservations. The influence of the policy on recommendations may have been more through the leading role of the methodologists than exclusion of conflicted participants in making recommendations.

  9. The New Policy on Higher Education of the Government of the Dominican Republic: Some Descriptive and Evaluative Aspects.

    Science.gov (United States)

    Escala, Miguel Jose

    The purpose of this report is to analyze a new higher education policy adoped by the Dominican Republic in Decree 1255 of 1983, "Regulations for Private Higher Education." Geographical, historical, and political characteristics of the Dominican Republic are described, and theoretical and methodological considerations in the study of…

  10. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    The Challenge—Most geological phenomena are extraordinarily complex in their interrelationships and vast in their geographical extension. Ordinarily, engineers and geoscientists are faced with corporate or scientific requirements to properly prepare geological models with measurements involving a small fraction of the entire area or volume of interest. Exact description of a system such as an oil reservoir is neither feasible nor economically possible. The results are necessarily uncertain. Note that the uncertainty is not an intrinsic property of the systems; it is the result of incomplete knowledge by the observer.The Aim of Geostatistics—The main objective of geostatistics is the characterization of spatial systems that are incompletely known, systems that are common in geology. A key difference from classical statistics is that geostatistics uses the sampling location of every measurement. Unless the measurements show spatial correlation, the application of geostatistics is pointless. Ordinarily the need for additional knowledge goes beyond a few points, which explains the display of results graphically as fishnet plots, block diagrams, and maps.Geostatistical Methods—Geostatistics is a collection of numerical techniques for the characterization of spatial attributes using primarily two tools: probabilistic models, which are used for spatial data in a manner similar to the way in which time-series analysis characterizes temporal data, or pattern recognition techniques. The probabilistic models are used as a way to handle uncertainty in results away from sampling locations, making a radical departure from alternative approaches like inverse distance estimation methods.Differences with Time Series—On dealing with time-series analysis, users frequently concentrate their attention on extrapolations for making forecasts. Although users of geostatistics may be interested in extrapolation, the methods work at their best interpolating. This simple difference

  11. Distraction by smartphone use during clinical practice and opinions about smartphone restriction policies: A cross-sectional descriptive study of nursing students.

    Science.gov (United States)

    Cho, Sumi; Lee, Eunjoo

    2016-05-01

    Smartphone use in healthcare settings may distract healthcare providers and disrupt patient care. Moreover, it may lead to adverse events, thereby threatening patient safety. This study assessed nursing students' smartphone use as a source of distraction in clinical practice and identified their opinions about policies restricting smartphone use during patient care. A cross-sectional descriptive design was used with convenience sampling. Third-year nursing students (n=312) from two nursing schools in the Republic of Korea completed the survey in 2012. A self-report questionnaire-based on addiction theories for problem behaviors and literature on the distraction caused by cellular phone use-was used to assess smartphone use, experiences of distraction caused by smartphone use, and opinions about restriction policies on smartphone use during clinical practice. Nearly half (46.2%) of the nursing students used smartphones at least sometimes during clinical practice and about a quarter of the respondents (24.7%) were at least sometimes distracted by smartphones during clinical practice. The majority of the respondents (83.7%) had witnessed nurses using smartphones at least sometimes during their work. A few respondents (15.7%) agreed or strongly agreed with the policy for restricting smartphone use in hospitals. Students who used smartphones more often tended to disagree with restriction policies for smartphone use in hospitals. Awareness about the risks of smartphone use, especially regarding patient safety, is necessary for nursing students in school and hospital settings. Educators and faculty of nursing schools need to develop policies that encourage intelligent and safe use of smartphones during clinical practice. Copyright © 2016. Published by Elsevier Ltd.

  12. Active noise control primer

    CERN Document Server

    Snyder, Scott D

    2000-01-01

    Active noise control - the reduction of noise by generating an acoustic signal that actively interferes with the noise - has become an active area of basic research and engineering applications. The aim of this book is to present all of the basic knowledge one needs for assessing how useful active noise control will be for a given problem and then to provide some guidance for designing, setting up, and tuning an active noise-control system. Written for students who have no prior knowledge of acoustics, signal processing, or noise control but who do have a reasonable grasp of basic physics and mathematics, the book is short and descriptive. It leaves for more advanced texts or research monographs all mathematical details and proofs concerning vibrations, signal processing and the like. The book can thus be used in independent study, in a classroom with laboratories, or in conjunction with a kit for experiment or demonstration. Topics covered include: basic acoustics; human perception and sound; sound intensity...

  13. Primer on bioproducts

    International Nuclear Information System (INIS)

    Christie, P.; Mitchell, H.; Holmes, R.; Ogilvie, K.B.; Layzell, D.

    2004-11-01

    This document provides a general introduction to biotechnology, bioproducts and alternatives to fossil fuels and petrochemicals. It includes an introduction to the concept of bioproducts, a description of common products that can be manufactured using biomass and an overview of the ways bioproducts are made. It also addresses issues such as risks and benefits of bioproduct technologies and the environmental, social and economic considerations of bioproducts. The possibilities of using biofuels and bioenergy for heat and power, to fuel vehicles and as a fuel for fuel cells were also discussed. Biogas from municipal and farm wastes is currently used to drive some gas turbines for power generation. The role of biochemicals and biomaterials in industrial processes and products was also reviewed along with some domestic and international bioproducts already developed and innovative products under development. The document also explains how plants, animals and other organisms can be used to replace or complement fossil fuels to help generate energy and make chemicals, plastics and other materials. While some reports suggest that bioproducts consume less energy and produce less greenhouse gases than conventional products, other reports suggest that they are rarely superior to conventional products and some may even contribute to the eutrophication of lakes, rivers and other surface waters. figs., 80 refs

  14. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  15. DISCLOSURE POLICY AND PRICE VOLATILITY: A THEORETICAL DESCRIPTION AND EMPIRICAL TESTS OF THE 'FILTER EFFECT'

    Institute of Scientific and Technical Information of China (English)

    XiangminChen; JianghuiLin

    2004-01-01

    In the context of a push towards full disclosure by the regulatory authorities of securities markets, we evaluate the effectiveness of corporate disclosure policy by examining the 'filter effect'. Controlling for firm size and earnings changes, we conduct an empirical test of various disclosure options. Our results shows that the recent increase in disclosure frequency in mainland China's securities markets has not yet achieved its anticipated objective. Disclosure quality remains low and small firms often manipulate their stock prices through selective release of information.

  16. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  17. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  18. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  19. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  20. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  1. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  2. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  3. Rapid review programs to support health care and policy decision making: a descriptive analysis of processes and methods.

    Science.gov (United States)

    Polisena, Julie; Garritty, Chantelle; Kamel, Chris; Stevens, Adrienne; Abou-Setta, Ahmed M

    2015-03-14

    Health care decision makers often need to make decisions in limited timeframes and cannot await the completion of a full evidence review. Rapid reviews (RRs), utilizing streamlined systematic review methods, are increasingly being used to synthesize the evidence with a shorter turnaround time. Our primary objective was to describe the processes and methods used internationally to produce RRs. In addition, we sought to understand the underlying themes associated with these programs. We contacted representatives of international RR programs from a broad realm in health care to gather information about the methods and processes used to produce RRs. The responses were summarized narratively to understand the characteristics associated with their processes and methods. The summaries were compared and contrasted to highlight potential themes and trends related to the different RR programs. Twenty-nine international RR programs were included in our sample with a broad organizational representation from academia, government, research institutions, and non-for-profit organizations. Responses revealed that the main objectives for RRs were to inform decision making with regards to funding health care technologies, services and policy, and program development. Central themes that influenced the methods used by RR programs, and report type and dissemination were the imposed turnaround time to complete a report, resources available, the complexity and sensitivity of the research topics, and permission from the requestor. Our study confirmed that there is no standard approach to conduct RRs. Differences in processes and methods across programs may be the result of the novelty of RR methods versus other types of evidence syntheses, customization of RRs for various decision makers, and definition of 'rapid' by organizations, since it impacts both the timelines and the evidence synthesis methods. Future research should investigate the impact of current RR methods and reporting to

  4. Descriptive Analysis on the Impacts of Universal Zero-Markup Drug Policy on a Chinese Urban Tertiary Hospital.

    Directory of Open Access Journals (Sweden)

    Wei Tian

    Full Text Available Universal Zero-Markup Drug Policy (UZMDP mandates no price mark-ups on any drug dispensed by a healthcare institution, and covers the medicines not included in the China's National Essential Medicine System. Five tertiary hospitals in Beijing, China implemented UZMDP in 2012. Its impacts on these hospitals are unknown. We described the effects of UZMDP on a participating hospital, Jishuitan Hospital, Beijing, China (JST.This retrospective longitudinal study examined the hospital-level data of JST and city-level data of tertiary hospitals of Beijing, China (BJT 2009-2015. Rank-sum tests and join-point regression analyses were used to assess absolute changes and differences in trends, respectively.In absolute terms, after the UZDMP implementation, there were increased annual patient-visits and decreased ratios of medicine-to-healthcare-charges (RMOH in JST outpatient and inpatient services; however, in outpatient service, physician work-days decreased and physician-workload and inflation-adjusted per-visit healthcare charges increased, while the inpatient physician work-days increased and inpatient mortality-rate reduced. Interestingly, the decreasing trend in inpatient mortality-rate was neutralized after UZDMP implementation. Compared with BJT and under influence of UZDMP, JST outpatient and inpatient services both had increasing trends in annual patient-visits (annual percentage changes[APC] = 8.1% and 6.5%, respectively and decreasing trends in RMOH (APC = -4.3% and -5.4%, respectively, while JST outpatient services had increasing trend in inflation-adjusted per-visit healthcare charges (APC = 3.4% and JST inpatient service had decreasing trend in inflation-adjusted per-visit medicine-charges (APC = -5.2%.Implementation of UZMDP seems to increase annual patient-visits, reduce RMOH and have different impacts on outpatient and inpatient services in a Chinese urban tertiary hospital.

  5. Descriptive Analysis on the Impacts of Universal Zero-Markup Drug Policy on a Chinese Urban Tertiary Hospital.

    Science.gov (United States)

    Tian, Wei; Yuan, Jiangfan; Yang, Dong; Zhang, Lanjing

    2016-01-01

    Universal Zero-Markup Drug Policy (UZMDP) mandates no price mark-ups on any drug dispensed by a healthcare institution, and covers the medicines not included in the China's National Essential Medicine System. Five tertiary hospitals in Beijing, China implemented UZMDP in 2012. Its impacts on these hospitals are unknown. We described the effects of UZMDP on a participating hospital, Jishuitan Hospital, Beijing, China (JST). This retrospective longitudinal study examined the hospital-level data of JST and city-level data of tertiary hospitals of Beijing, China (BJT) 2009-2015. Rank-sum tests and join-point regression analyses were used to assess absolute changes and differences in trends, respectively. In absolute terms, after the UZDMP implementation, there were increased annual patient-visits and decreased ratios of medicine-to-healthcare-charges (RMOH) in JST outpatient and inpatient services; however, in outpatient service, physician work-days decreased and physician-workload and inflation-adjusted per-visit healthcare charges increased, while the inpatient physician work-days increased and inpatient mortality-rate reduced. Interestingly, the decreasing trend in inpatient mortality-rate was neutralized after UZDMP implementation. Compared with BJT and under influence of UZDMP, JST outpatient and inpatient services both had increasing trends in annual patient-visits (annual percentage changes[APC] = 8.1% and 6.5%, respectively) and decreasing trends in RMOH (APC = -4.3% and -5.4%, respectively), while JST outpatient services had increasing trend in inflation-adjusted per-visit healthcare charges (APC = 3.4%) and JST inpatient service had decreasing trend in inflation-adjusted per-visit medicine-charges (APC = -5.2%). Implementation of UZMDP seems to increase annual patient-visits, reduce RMOH and have different impacts on outpatient and inpatient services in a Chinese urban tertiary hospital.

  6. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  7. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  8. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  9. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  10. A full description of the Three-ME model: Multi-sector macro-economic Model for the Evaluation of Environmental and Energy policy

    International Nuclear Information System (INIS)

    Callonnec, Gael; Landa, Gissela; Malliet, Paul; Yeddir-Tamsamani, Yasser; Reynes, Frederic

    2013-01-01

    Since 2008, the ADEME and the OFCE are involved in a research convention to develop the model Three-ME. This document provides a full description of new version of the model. Three-ME is a new model of the French economy especially designed to evaluate the medium and long term impact of environmental and energy policies at the macro-economic and sector levels. To do so Three-ME combines two important features. Firstly, it has the main characteristics of neo-Keynesian models by assuming a slow adjustment of effective quantities and prices to their notional level, an endogenous money supply, a Taylor rule and a Philips curve. Compared to standard multi-sector CGEM, this has the advantage to allow for the existence of under-optimum equilibria such as the presence of involuntary unemployment. Secondly, Three-ME is a hybrid model in the sense that it combines the top-down approach of general equilibrium macro-economic models with elements of bottom-up models of energy models developed by engineers. As in bottom-up models, the amount of energy consumed is related to their use, that is the number of buildings or cars, and the energy class to which they belong. This hypothesis is more realistic compared to the assumption made in the majority of top-down models where energy consumption is usually directly related to income through a nested structure of utility function. (authors)

  11. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  12. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  13. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  14. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  15. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  16. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  17. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  18. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  19. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  20. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  1. The Airlift System: A Primer

    National Research Council Canada - National Science Library

    Owen, Robert

    1997-01-01

    ... and disadvantages of making changes to the missions or composition of those components. The core concepts and interconnections of the airlift system-mission, the focus of airlift policy, component roles, and organization-are reasonably easy to describe...

  2. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  3. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  4. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  5. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  6. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  7. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  8. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  9. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  10. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  11. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  12. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  13. Policy instruments to decrease the climate impact of housing, personal transport and food. Detailed instrument descriptions; Ohjauskeinoja asumisen, henkiloeliikenteen ja ruoan ilmastovaikutusten hillintaeaen. Yksityiskohtaiset ohjauskeinokuvaukset

    Energy Technology Data Exchange (ETDEWEB)

    Heiskanen, E.; Perrels, A.; Nissinen, A.; Berghaell, E.; Liesimaa, V.; Mattinen, M. (eds.)

    2012-03-15

    Reducing consumption volumes or introducing climate conscious consumption patterns can be efficient ways to mitigate climate change. Twenty existing policy instruments affecting the greenhouse gas emissions of housing, passenger traffic and food are described in this report of the KUILU-project. The policy instruments and the possibilities to develop effective instrument packages were discussed in two expert workshops, the results of which are presented in annexes of this report. There are already several policy instruments that target on housing and passenger traffic. Their differences in estimated emission reductions are large, which can ease the prioritization and selection of the instruments for further development. So far, only one policy instrument exists that aims to reduce the climate impacts of food choices, namely a Council of State Decision of Principle on Promoting Sustainability in Public Purchasing. However, it includes several measures that can be used to influence private companies and citizens, and thus it opens the field of policy instrument for mitigation of climate impacts of food. According to the expert survey, the most effective policy instrument involved in the analysis was building regulations, and the four most effective instruments after this were the following: gradated procurement tax of cars based on emissions, gradation of car tax, taxation of transport fuels, energy taxes of housing, and the effect of ecodesign directive on appliances. The effectiveness of policy instruments related to food was assessed to be on average level. The five least effective instruments were: EU energy label, voluntary energy experts, the tax of beverage packing, energy certificates, and subsidies for energy efficiency reparation in buildings. However, the expert opinions on the effectiveness of the policy instruments varied significantly. After this report, the KUILU project continued with an analysis of the policy instrument packages and with suggestions

  14. Policy instruments to decrease the climate impact of housing, personal transport and food. Detailed instrument descriptions; Ohjauskeinoja asumisen, henkiloeliikenteen ja ruoan ilmastovaikutusten hillintaeaen. Yksityiskohtaiset ohjauskeinokuvaukset

    Energy Technology Data Exchange (ETDEWEB)

    Heiskanen, E.; Perrels, A.; Nissinen, A.; Berghaell, E.; Liesmaa, V.; Mattinen, M. (eds.)

    2012-07-01

    Reducing consumption volumes or introducing climate conscious consumption patterns can be efficient ways to mitigate climate change. Twenty existing policy instruments affecting the greenhouse gas emissions of housing, passenger traffic and food are described in this report of the KUILU-project. The policy instruments and the possibilities to develop effective instrument packages were discussed in two expert workshops, the results of which are presented in annexes of this report. There are already several policy instruments that target on housing and passenger traffic. Their differences in estimated emission reductions are large, which can ease the prioritization and selection of the instruments for further development. So far, only one policy instrument exists that aims to reduce the climate impacts of food choices, namely a Council of State Decision of Principle on Promoting Sustainability in Public Purchasing. However, it includes several measures that can be used to influence private companies and citizens, and thus it opens the field of policy instrument for mitigation of climate impacts of food. According to the expert survey, the most effective policy instrument involved in the analysis was building regulations, and the four most effective instruments after this were the following: gradated procurement tax of cars based on emissions, gradation of car tax, taxation of transport fuels, energy taxes of housing, and the effect of ecodesign directive on appliances. The effectiveness of policy instruments related to food was assessed to be on average level. The five least effective instruments were: EU energy label, voluntary energy experts, the tax of beverage packing, energy certificates, and subsidies for energy efficiency reparation in buildings. However, the expert opinions on the effectiveness of the policy instruments varied significantly. After this report, the KUILU project continued with an analysis of the policy instrument packages and with suggestions

  15. Policy options evaluation tool for managed lanes (POET-ML) users guide and methodology description : Federal Highway Administration HOV lane performance

    Science.gov (United States)

    2008-12-01

    Users guide for a sketch planning tool for exploring policy alternatives. It is intended for an audience of transportation professionals responsible for planning, designing, funding, operating, enforcing, monitoring, and managing HOV and HOT lanes...

  16. A primer of analytical mechanics

    CERN Document Server

    Strocchi, Franco

    2018-01-01

    This book presents the basic elements of Analytical Mechanics, starting from the physical motivations that favor it with respect to the Newtonian Mechanics in Cartesian coordinates. Rather than presenting Analytical Mechanics mainly as a formal development of Newtonian Mechanics, it highlights its effectiveness due to the following five important achievements: 1) the most economical description of time evolution in terms of the minimal set of coordinates, so that there are no constraint forces in their evolution equations; 2) the form invariance of the evolution equations, which automatically solves the problem of fictitious forces; 3) only one scalar function encodes the formulation of the dynamics, rather than the full set of vectors which describe the forces in Cartesian Newtonian Mechanics; 4) in the Hamiltonian formulation, the corresponding evolution equations are of first order in time and are fully governed by the Hamiltonian function (usually corresponding to the energy); 5) the emergence of the Hami...

  17. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  18. Descriptive Research

    DEFF Research Database (Denmark)

    Wigram, Anthony Lewis

    2003-01-01

    Descriptive research is described by Lathom-Radocy and Radocy (1995) to include Survey research, ex post facto research, case studies and developmental studies. Descriptive research also includes a review of the literature in order to provide both quantitative and qualitative evidence of the effect...... starts will allow effect size calculations to be made in order to evaluate effect over time. Given the difficulties in undertaking controlled experimental studies in the creative arts therapies, descriptive research methods offer a way of quantifying effect through descriptive statistical analysis...

  19. Statistics in Matlab a primer

    CERN Document Server

    Cho, MoonJung

    2014-01-01

    List of Tables Preface MATLAB BasicsDesktop Environment Getting Help and Other Documentation Data Import and Export Data I/O via the Command Line The Import Wizard Examples of Data I/O in MATLAB Data I/O with the Statistics Toolbox More Functions for Data I/O Data in MATLAB Data Objects in Base MATLAB Accessing Data Elements Examples of Joining Data Sets Data Types in the Statistics Toolbox Object-Oriented Programming Miscellaneous Topics File and Workspace Management Punctuation in MATLAB Arithmetic Operators Functions in MATLAB Summary and Further Reading Visualizing DataBasic Plot Functions Plotting 2-D Data Plotting 3-D Data Examples Scatter Plots Basic 2-D and 3-D Scatter Plots Scatter Plot Matrix Examples GUIs for Graphics Simple Plot Editing Plotting Tools Interface PLOTS Tab Summary and Further Reading Descriptive StatisticsMeasures of Location Means, Medians, and Modes Examples Measures of Dispersion Range Variance and Standard Deviation Covariance and Correlation Examples Describing the Distribution...

  20. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  1. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  2. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  3. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  4. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  5. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  6. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  7. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  8. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  9. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  10. A Descriptive Longitudinal Study of Changes in Vape Shop Characteristics and Store Policies in Anticipation of the 2016 FDA Regulations of Tobacco Products, Including E-Cigarettes

    Directory of Open Access Journals (Sweden)

    Sheila Yu

    2018-02-01

    Full Text Available After proposing the “Deeming Rule” in 2014, the U.S. Food and Drug Administration (FDA began regulating the manufacturing, marketing, and sales of electronic cigarette (e-cigarette products as tobacco products in 2016. The current study conducted vape shop store observations and surveyed Los Angeles–area shop employees (assessing their beliefs, awareness, and perceptions of e-cigarettes and related FDA regulations at two time points one year apart to better understand what vape shop retailers would do given FDA’s soon-to-be-enacted Deeming Rule. The study also compared retailer beliefs/awareness/actions and store characteristics immediately after the Deeming Rule proposal versus a year after the Rule had been proposed, right before its enactment. Two data collection waves occurred before the Deeming Rule enactment, with Year 1 surveying 77 shops (2014 and Year 2 surveying 61 shops (2015–2016. Between the data collection points, 16 shops had closed. Among the shops that were open at both time points, the majority (95% in Year 1; 74% in Year 2 were aware of some FDA regulations or other policies applying to vape shops. However, overall awareness of FDA regulations and state/local policies governing e-cigarettes significantly decreased from Year 1 to Year 2. At both time points, all shops offered customers free puffs of nicotine-containing e-liquids (prohibited by the then upcoming Deeming Rule. Perceptions of e-cigarette safety also significantly decreased between the years. Exploring vape shop retailer perceptions and store policies (i.e., free puffs/samples displays, perceptions of e-cigarette safety, etc. over time will help the FDA assess the needs of the vape shop community and develop more effective retailer education campaigns and materials targeted to increase compliance with the newly enacted regulations.

  11. A Descriptive Longitudinal Study of Changes in Vape Shop Characteristics and Store Policies in Anticipation of the 2016 FDA Regulations of Tobacco Products, Including E-Cigarettes.

    Science.gov (United States)

    Yu, Sheila; Escobedo, Patricia; Garcia, Robert; Cruz, Tess Boley; Unger, Jennifer B; Baezconde-Garbanati, Lourdes; Meza, Leah; Sussman, Steve

    2018-02-11

    After proposing the "Deeming Rule" in 2014, the U.S. Food and Drug Administration (FDA) began regulating the manufacturing, marketing, and sales of electronic cigarette (e-cigarette) products as tobacco products in 2016. The current study conducted vape shop store observations and surveyed Los Angeles-area shop employees (assessing their beliefs, awareness, and perceptions of e-cigarettes and related FDA regulations) at two time points one year apart to better understand what vape shop retailers would do given FDA's soon-to-be-enacted Deeming Rule. The study also compared retailer beliefs/awareness/actions and store characteristics immediately after the Deeming Rule proposal versus a year after the Rule had been proposed, right before its enactment. Two data collection waves occurred before the Deeming Rule enactment, with Year 1 surveying 77 shops (2014) and Year 2 surveying 61 shops (2015-2016). Between the data collection points, 16 shops had closed. Among the shops that were open at both time points, the majority (95% in Year 1; 74% in Year 2) were aware of some FDA regulations or other policies applying to vape shops. However, overall awareness of FDA regulations and state/local policies governing e-cigarettes significantly decreased from Year 1 to Year 2. At both time points, all shops offered customers free puffs of nicotine-containing e-liquids (prohibited by the then upcoming Deeming Rule). Perceptions of e-cigarette safety also significantly decreased between the years. Exploring vape shop retailer perceptions and store policies (i.e., free puffs/samples displays, perceptions of e-cigarette safety, etc.) over time will help the FDA assess the needs of the vape shop community and develop more effective retailer education campaigns and materials targeted to increase compliance with the newly enacted regulations.

  12. Description of relevant scenarios in the field of agricultural, environmental and climate policy and energy prices for the preliminary study on a Roadmap for the 'SuikerUnie'

    International Nuclear Information System (INIS)

    Plomp, A.J.

    2011-11-01

    In the Dutch Long Term Agreements on energy efficiency (MJA3 and MEE)the Dutch government and industry agreed to strive for a 30% energy efficiency improvement in 2020 compared to 2005. To reach more than 30%, it is not enough to optimize; instead larger process changes will be needed. An important instrument is the realization of preliminary studies and roadmaps, which are supported by the government. This memo offers an overview of relevant developments and scenarios from Agricultural, climate and environmental policy and energy prices for the Dutch sugar industry. This memo serves as input for the Preliminary study Roadmap SuikerUnie. [nl

  13. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  14. Descriptive statistics.

    Science.gov (United States)

    Nick, Todd G

    2007-01-01

    Statistics is defined by the Medical Subject Headings (MeSH) thesaurus as the science and art of collecting, summarizing, and analyzing data that are subject to random variation. The two broad categories of summarizing and analyzing data are referred to as descriptive and inferential statistics. This chapter considers the science and art of summarizing data where descriptive statistics and graphics are used to display data. In this chapter, we discuss the fundamentals of descriptive statistics, including describing qualitative and quantitative variables. For describing quantitative variables, measures of location and spread, for example the standard deviation, are presented along with graphical presentations. We also discuss distributions of statistics, for example the variance, as well as the use of transformations. The concepts in this chapter are useful for uncovering patterns within the data and for effectively presenting the results of a project.

  15. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  16. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  17. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  18. Failure of hospital employees to comply with smoke-free policy is associated with nicotine dependence and motives for smoking: a descriptive cross-sectional study at a teaching hospital in the United Kingdom

    Directory of Open Access Journals (Sweden)

    Turner Kenrick

    2009-07-01

    Full Text Available Abstract Background Smoke-free policy aims to protect the health of the population by reducing exposure to environmental tobacco smoke (ETS, and World Health Organisation (WHO guidance notes that these policies are only successful if there is full and proper enforcement. We aimed to investigate the problem of resistance to smoking restrictions and specifically compliance with smoke-free policy. We hypothesised that an explanation for non-compliance would lie in a measurable difference between the smoking behaviours of compliant and non-compliant smokers, specifically that non-compliance would be associated with nicotine dependence and different reasons for smoking. Methods We conducted a questionnaire-based, descriptive, cross-sectional study of hospital employees. Seven hundred and four members of staff at Addenbrooke's Hospital, Cambridge, UK, completed the questionnaire, of whom 101 were smokers. Comparison between compliant and non-compliant smokers was made based on calculated scores for the Fagerström test and the Horn-Waingrow scale, and level of agreement with questions about attitudes. For ordinal data we used a linear-by-linear association test. For non-parametric independent variables we used the Mann-Whitney test and for associations between categorical variables we used the chi-squared test. Results The demographic composition of respondents corresponded with the hospital's working population in gender, age, job profile and ethnicity. Sixty nine smokers reported they were compliant while 32 were non-compliant. Linear-by-linear association analysis of the compliant and non-compliant smokers' answers for the Fagerström test suggests association between compliance and nicotine dependence (p = 0.049. Mann-Whitney test analysis suggests there is a statistically significant difference between the reasons for smoking of the two groups: specifically that non-compliant smokers showed habitual smoking behaviour (p = 0.003. Overall

  19. Primer registro de megafloras y palinología en estratos de la Formación Tarija (Pennsylvaniano, Arroyo Aguas Blancas, Provincia de Salta, Argentina: Descripción de dos especies nuevas First record of megafloras and palynology in the Tarija Formation (Pennsylvanian, Aguas Blancas creek, Salta Province, Argentina: Description of two new species

    Directory of Open Access Journals (Sweden)

    Mercedes di Pasquo

    2009-01-01

    Full Text Available Se analiza e ilustra, por primera vez, una tafoflora hallada en estratos de la Formación Tarija que aflora en Arroyo Aguas Blancas, Provincia de Salta, Argentina. Se describen, también, dos especies nuevas: Malanzania starckii (licofita y Grumosisporites delpapae (espora trilete. Se reconocieron improntas de semillas platispérmicas (Sama-ropsis nunezii García emend. A. Archangelsky, Cordaicarpus cesariae Gutiérrez, Ganuza, Morel y Arrondo emend. A. Archangelsky, improntas de tallos articulados {Paracalamites australis Rigby emend. Zampirolli y Bernardes de Oliveira y compresiones/improntas de fragmentos foliares (Cordaites riojanus Archangelsky y Leguizamón, Ginkgo-phyllum sp. cf. G. diazii Archangelsky y Arrondo. Esta asociación es atribuida al Pennsylvaniano s.l. sobre la base de la distribución estratigráfica de las especies seminales. La asociación palinológica se compone de 101 especies, 53 de ellas reconocidas como autóctonas y 48 retrabajadas. El primer conjunto comprende 34 especies de esporas trilete, 11 granos de polen monosacado, un grano bisacado y siete especies de algas. El grupo retrabajado se compone de 27 esporas trilete y criptosporas, 20 especies de acritarcas, prasinofitas y otras algas y un quitinozoario. La presencia de especies exclusivas de la BiozonaD. bireticulatus-C. chacoparanensis (BC (e.g., Dictyotriletes bireticulatus (Ibrahim Potonié y Kremp emend. Smith y Butterworth, Crucisaccites latisulcatus Lele y Maithy, Verrucosisporites morulatus (Knox Potonié y Kremp emend. Smith y Butterworth, permite acotar su edad al Bashkiriano tardío-Moscoviano. La vegetación, compuesta principalmente por licofitas, esfenofitas, pteridofitas y gimnospermas, se habría desarrollado en diferentes ambientes continentales como lagos y ríos alimentados por glaciares de montaña.Fossil plant remains found in the Tarija Formation cropping out at the Aguas Blancas creek, Aguaragüe range, Salta Province, Argentina, are analy

  20. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  1. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  2. Cyber security policy guidebook

    CERN Document Server

    Bayuk, nifer L; Rohmeyer, l; Sachs, cus; Schmidt, frey; Weiss, eph

    2012-01-01

    This book is a taxonomy and thesaurus of current cybersecurity policy issues, including a thorough description of each issue and a corresponding list of pros and cons with respect to identified stances on each issue. It documents policy alternatives for the sake of clarity with respect to policy alone, and dives into organizational implementation issues. Without using technical jargon, the book emphasizes the importance of critical and analytical thinking when making policy decisions.  It also equips the reader with descriptions of the impact of specific policy ch

  3. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  4. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  5. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  6. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  7. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  8. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  9. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  10. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  11. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  12. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  13. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  14. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  15. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  16. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  17. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  18. Estudo descritivo sobre o primeiro mutirão no Brasil de cirurgias eletivas para tratamento de escoliose Estudio descriptivo sobre el primer esfuerzo conjunto en la cirugía electiva de Brasil para el tratamiento de la escoliosis Descriptive study about the first collective effort of elective surgeries for scoliosis treatment in Brazil

    Directory of Open Access Journals (Sweden)

    Ricardo da Vitória Mattedi

    2012-01-01

    Estado de Espírito Santo. MÉTODOS: Estudio descriptivo transversal, observacional, que evaluó a las personas de los alrededores de la ciudad de Vitória y del interior del Estado de Espírito Santo con deformidades o síntomas de dolor, en la región dorsal, de origen osteomuscular, clasificando a esas personas de acuerdo a la edad, el sexo y la patología, y cuando se diagnosticó la escoliosis, se fue posible, se la clasificó según King, Lenke, Winter et al. y Lounstein y Akbarnia, y se indicó el tratamiento. RESULTADOS: Se evaluó un total de 169 pacientes, 48 hombres y 121 mujeres, edad promedio de 39,7 años y 41,1 años, respectivamente. Del total de pacientes evaluados, 25,4% tenían enfermedades ortopédicas en general, 36,1% enfermedades específicas de la columna vertebral excepto escoliosis, y 38,5% escoliosis. De los pacientes con escoliosis, 81,5% fueron de idiopática del adolescente, con la mayoría clasificados por King como de tipo II y por Lenke como de tipo I. Entre otras etiologías de la escoliosis, la congénita más común fue la hemivértebra asociada a barra contralateral cuando se clasifica por Winter et al y, de las neuromusculares, el tipo 2B de la clasificación de Louenstein y Akbarnia. CONCLUSIÓN: Nuestros datos epidemiológicos corroboran la literatura actual. Logramos conseguir un número satisfactorio de pacientes con enfermedades de la columna vertebral, determinar un tratamiento y seguimiento, así como divulgar y orientar a la población sobre tales enfermedades.OBJECTIVE: Describe the statistical results of the first campaign for elective surgeries performed in Brazil, not only in order to make the initiative public, but more importantly, so that the knowledge of these actions will encourage other States and also other collaborative efforts in Espírito Santo. METHODS: Descriptive cross-sectional observational study, which evaluated people from Grande Vitória and from the State of Espirito Santo with deformities or dorsal

  19. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  20. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  1. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  2. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  3. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  4. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  5. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  6. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  7. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  8. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  9. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  10. Collateralised loan obligations (CLOs): A primer

    OpenAIRE

    Jobst, Andreas A.

    2002-01-01

    The following descriptive paper surveys the various types of loan securitisation and provides a working definition of so-called collateralised loan obligations (CLOs). Free of the common rhetoric and slogans, which sometimes substitute for understanding of the complex nature of structured finance, this paper describes the theoretical foundations of this specialised form of loan securitisation. Not only the distinctive properties of CLOs, but also the information economics inherent in the tran...

  11. Invalidating Policies using Structural Information

    DEFF Research Database (Denmark)

    Kammuller, Florian; Probst, Christian W.

    2013-01-01

    by invalidating policies using structural information of the organisational model. Based on this structural information and a description of the organisation's policies, our approach invalidates the policies and identifies exemplary sequences of actions that lead to a violation of the policy in question. Based...... on these examples, the organisation can identify real attack vectors that might result in an insider attack. This information can be used to refine access control system or policies....

  12. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  13. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  14. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  15. A Primer of Middle Eastern Leadership Culture

    Directory of Open Access Journals (Sweden)

    Sheldon Greaves

    2012-01-01

    Full Text Available It is natural for someone looking in on a foreign culture from the outside to interpret what they see and frame their reactions based on their own background and assumptions. With cultures as a different as those of the Middle East and the West, the potential for blunders increases dramatically, made worse by the high political, diplomatic, military, and commercial stakes involved. Leadership culture in this region has been shaped over centuries through a variety of factors, such as reputation, family, and religion, which continue to influence decision making. The present study posits that an understanding of these factors and how they work is crucial for intelligence analysts, policy and decision makers, strategists, and scholars who must find their way through a very unfamiliar cultural landscape in the Middle East. It is hoped that this discussion will in some way assist in the creation of more effective interaction, policies, and analysis associated with the Middle East.

  16. Primer on client-side web security

    CERN Document Server

    De Ryck, Philippe; Piessens, Frank; Johns, Martin

    2014-01-01

    This volume illustrates the continuous arms race between attackers and defenders of the Web ecosystem by discussing a wide variety of attacks. In the first part of the book, the foundation of the Web ecosystem is briefly recapped and discussed. Based on this model, the assets of the Web ecosystem are identified, and the set of capabilities an attacker may have are enumerated. In the second part, an overview of the web security vulnerability landscape is constructed. Included are selections of the most representative attack techniques reported in great detail. In addition to descriptions of the

  17. A política educacional do primeiro governo Petista de São Carlos-SP (2001-2004 La política educativa del primer gobierno del Partido de los Trabajadores de São Carlos - ciudad del interior de San Pablo (2001-2004 The educational policy of the Workers Party's first government in São Carlos - SP (2001-2004

    Directory of Open Access Journals (Sweden)

    Ana Paula Rodrigues da Silva

    2010-09-01

    Full Text Available O artigo propõe uma avaliação da política educacional implementada pelo primeiro governo do Partido dos Trabalhadores no município de São Carlos (SP, entre 2001 e 2004. Nesse período, o panorama educacional brasileiro já estava marcado, desde a ditadura militar (1964-1985, por uma ampla gama de experiências e reformas, as quais tiveram como um de seus resultados mais importantes a universalização do acesso à escolaridade obrigatória já no final da década de 90. Resolvida a questão quantitativa, o grande problema a ser enfrentado passou a ser o da qualidade do ensino ofertado na escola pública. Apesar da situação privilegiada da cidade de São Carlos, situada numa das regiões economicamente mais ricas do país e com forte tradição educacional, nossas pesquisas nos levam a afirmar que a primeira gestão petista do município deveria ter materializado uma política educacional mais efetiva do que aquela implementada, a fim de atingir a melhoria da qualidade do ensino ofertado à população.El artículo propone una evaluación de la política educativa implementada por el primer gobierno del Partido de los Trabajadores (PT en la ciudad de São Carlos (SP, entre 2001 y 2004. En este período, el panorama educativo brasileño ya estaba marcado, desde la dictadura militar (1964-1985, por una amplia variedad de experiencias y reformas, las cuales tuvieron como uno de sus resultados más importantes la universalización del acceso a la escolaridad obligatoria, a finales de la década de los años 90. Una vez resuelta la cuestión cuantitativa, el gran problema que quedaba fue el de la calidad de la enseñanza ofrecida en la escuela pública. A pesar de la situación privilegiada de São Carlos, situada en una de las regiones económicamente más ricas del país y con una fuerte tradición educativa, nuestras investigaciones nos llevan a afirmar que la primera gestión del PT en la ciudad debería haber materializado una pol

  18. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  19. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  20. Evaluating financing of forestry in Europe; country-level report - the Netherlands; a description of the Dutch forest policy framework and financial instruments for forestry in the period 1990-1999

    NARCIS (Netherlands)

    Wijk, van M.N.; Vliet, van C.J.M.; Klein, de J.P.G.; Lusink, M.; Blitterswijk, van H.; Aertsen, E.J.M.

    2005-01-01

    The main idea behind the EU-project Evaluating Financing of Forestry in Europe (EFFE) is to find out how forest sector related financial policy instruments are handled in different countries. This report describes the Dutch policy framework and financial instruments for forestry in the period

  1. 48 CFR 14.202-5 - Descriptive literature.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Descriptive literature. 14... CONTRACTING METHODS AND CONTRACT TYPES SEALED BIDDING Solicitation of Bids 14.202-5 Descriptive literature. (a) Policy. Contracting officers must not require bidders to furnish descriptive literature unless it is...

  2. Electronic medical devices: a primer for pathologists.

    Science.gov (United States)

    Weitzman, James B

    2003-07-01

    Electronic medical devices (EMDs) with downloadable memories, such as implantable cardiac pacemakers, defibrillators, drug pumps, insulin pumps, and glucose monitors, are now an integral part of routine medical practice in the United States, and functional organ replacements, such as the artificial heart, pancreas, and retina, will most likely become commonplace in the near future. Often, EMDs end up in the hands of the pathologist as a surgical specimen or at autopsy. No established guidelines for systematic examination and reporting or comprehensive reviews of EMDs currently exist for the pathologist. To provide pathologists with a general overview of EMDs, including a brief history; epidemiology; essential technical aspects, indications, contraindications, and complications of selected devices; potential applications in pathology; relevant government regulations; and suggested examination and reporting guidelines. Articles indexed on PubMed of the National Library of Medicine, various medical and history of medicine textbooks, US Food and Drug Administration publications and product information, and specifications provided by device manufacturers. Studies were selected on the basis of relevance to the study objectives. Descriptive data were selected by the author. Suggested examination and reporting guidelines for EMDs received as surgical specimens and retrieved at autopsy. Electronic medical devices received as surgical specimens and retrieved at autopsy are increasing in number and level of sophistication. They should be systematically examined and reported, should have electronic memories downloaded when indicated, will help pathologists answer more questions with greater certainty, and should become an integral part of the formal knowledge base, research focus, training, and practice of pathology.

  3. Hormonal emergency contraception: a clinical primer.

    Science.gov (United States)

    Ziebarth, Angela; Hansen, Keith A

    2007-03-01

    Unintended and teenage pregnancies are major public health concerns in the United States. Emergency contraception is used to prevent pregnancy after failure of a contraceptive method or after unprotected intercourse. Expanded use of emergency contraception has the potential to reduce unintended pregnancy and induced abortions, while reducing state and federal healthcare expenditures. The recent approval of Plan B as an over-the-counter medication for individuals over 18 years of age should improve access to this medication. However, there are still widespread misconceptions about the mechanisms and implications of emergency contraception. Expanded access to emergency contraception is associated with increased use, but not associated with decreased efficacy, increased sexual risk-taking behavior, or less consistent use of traditional birth control methods. This review is designed to provide clinicians with information regarding the use of emergency contraception for reproductive age patients. It includes a brief description of methods of use, mechanisms of action, and side effect profiles of the most commonly used methods of emergency contraception, levonorgestrel and the Yuzpe method.

  4. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  5. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  6. Descriptive analysis of immunization policy decision making in the Americas Análisis descriptivo de la toma de decisión sobre políticas de vacunación en las Américas

    OpenAIRE

    Julianne E. Burns; Rachel C. Mitrovich; Barbara Jauregui; Cuauhtémoc Ruiz Matus; Jon K. Andrus

    2009-01-01

    OBJECTIVES: Reducing and eliminating vaccine-preventable diseases requires evidence-based and informed policy decision making. Critical to determining the functionality of the decision-making process for introduction of a new vaccine is understanding the role of the national immunization technical advisory group (ITAG) in each country. The aim of this study is to document the current situation of national level immunization policy decision making for use in the Pan American Health Organizatio...

  7. Online social networking: a primer for radiology.

    Science.gov (United States)

    Prasanna, Prasanth M; Seagull, F Jacob; Nagy, Paul

    2011-10-01

    Online social networking is an immature, but rapidly evolving industry of web-based technologies that allow individuals to develop online relationships. News stories populate the headlines about various websites which can facilitate patient and doctor interaction. There remain questions about protecting patient confidentiality and defining etiquette in order to preserve the doctor/patient relationship and protect physicians. How much social networking-based communication or other forms of E-communication is effective? What are the potential benefits and pitfalls of this form of communication? Physicians are exploring how social networking might provide a forum for interacting with their patients, and advance collaborative patient care. Several organizations and institutions have set forth policies to address these questions and more. Though still in its infancy, this form of media has the power to revolutionize the way physicians interact with their patients and fellow health care workers. In the end, physicians must ask what value is added by engaging patients or other health care providers in a social networking format. Social networks may flourish in health care as a means of distributing information to patients or serve mainly as support groups among patients. Physicians must tread a narrow path to bring value to interactions in these networks while limiting their exposure to unwanted liability.

  8. Developing an Online Database of National and Sub-National Clean Energy Policies

    Energy Technology Data Exchange (ETDEWEB)

    Haynes, R.; Cross, S.; Heinemann, A.; Booth, S.

    2014-06-01

    The Database of State Incentives for Renewables and Efficiency (DSIRE) was established in 1995 to provide summaries of energy efficiency and renewable energy policies offered by the federal and state governments. This primer provides an overview of the major policy, research, and technical topics to be considered when creating a similar clean energy policy database and website.

  9. The New Science of Cybernetics: A Primer

    Directory of Open Access Journals (Sweden)

    Karl H. Müller

    2013-12-01

    Full Text Available Four years after the publication of the first volume on the new science of cybernetics (NSC (Müller, 2009 and after two more books on NSC (Müller, 2011, 2012 it is time to present and to summarize the main features and characteristics of the new science of cybernetics within a single article. - Historically, the new science of cybernetics can be viewed as a potential outline of Heinz von Foerster's vision of second-order cybernetics as the science of observing systems or, alternatively, of living systems by living systems for living systems. Heinz von Foerster introduced the concept of second-order cybernetics on several occasions, without specifying, however, its content and cognitive organization (Foerster, 1974, 2003 - Systematically, the new science of cybernetics operates on a new level which, not quite unexpectedly and surprisingly, can be characterized as second-order level. This second-order level is self-reflexive by nature and by design, because this level comes into play whenever a concept, a model or an academic field turns onto itself, like in understanding or in cybernetics of cybernetics. - Functionally, the new science of cybernetics can be viewed as a trans- or post-disciplinary second-order field for navigating through an ocean of first-order level science. NSC operates primarily with objects or with operations from first-order science and transforms them into new components which exhibit strong comparative advantages in terms of novelty and robustness. This list of historic, systemic and functional features of the new science of cybernetics(NSC may look strange or incomprehensible at first sight. It will become, thus, the main purpose of this article to transform these seemingly vague and unclear descriptions into concise ones which readers with only a weak familiarity with the old science of cybernetics can understand. Eventually, even the short set above of critical characteristics of the new science of cybernetics should

  10. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  11. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  12. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  13. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  14. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  15. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  16. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  17. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  18. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  19. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  20. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  1. Guidelines for Description

    NARCIS (Netherlands)

    Links, P.; Horsman, Peter; Kühnel, Karsten; Priddy, M.; Reijnhoudt, Linda; Merenmies, Mark

    2013-01-01

    The Guidelines follow the conceptual metadata model (deliverable 17.2). They include guidelines for description of collection-holding institutions, document collections, organisations, personalities, events, camps and ghettos. As much as possible the guidelines comply with the descriptive standards

  2. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  3. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  4. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  5. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  9. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  10. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  11. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  12. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  13. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  14. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  15. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  16. Invalidating Policies using Structural Information

    DEFF Research Database (Denmark)

    Kammuller, Florian; Probst, Christian W.

    2014-01-01

    by invalidating policies using structural information of the organisational model. Based on this structural information and a description of the organisation’s policies, our approach invalidates the policies and identifies exemplary sequences of actions that lead to a violation of the policy in question. Based...... on these examples, the organisation can identify real attack vectors that might result in an insider attack. This information can be used to refine access control systems or policies. We provide case studies showing how mechanical verification tools, i.e. modelchecking with MCMAS and interactive theorem proving...

  17. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  18. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  19. Descriptive set theory

    CERN Document Server

    Moschovakis, YN

    1987-01-01

    Now available in paperback, this monograph is a self-contained exposition of the main results and methods of descriptive set theory. It develops all the necessary background material from logic and recursion theory, and treats both classical descriptive set theory and the effective theory developed by logicians.

  20. Description logics of context

    CSIR Research Space (South Africa)

    Klarman, S

    2013-05-01

    Full Text Available We introduce Description Logics of Context (DLCs) - an extension of Description Logics (DLs) for context-based reasoning. Our approach descends from J. McCarthy's tradition of treating contexts as formal objects over which one can quantify...

  1. Physics 3204. Course Description.

    Science.gov (United States)

    Newfoundland and Labrador Dept. of Education.

    A description of the physics 3204 course in Newfoundland and Labrador is provided. The description includes: (1) statement of purpose, including general objectives of science education; (2) a list of six course objectives; (3) course content for units on sound, light, optical instruments, electrostatics, current electricity, Michael Faraday and…

  2. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  3. Database Description - PSCDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name PSCDB Alternative n...rial Science and Technology (AIST) Takayuki Amemiya E-mail: Database classification Structure Databases - Protein structure Database...554-D558. External Links: Original website information Database maintenance site Graduate School of Informat...available URL of Web services - Need for user registration Not available About This Database Database Descri...ption Download License Update History of This Database Site Policy | Contact Us Database Description - PSCDB | LSDB Archive ...

  4. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  5. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  6. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  8. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  9. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  10. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  11. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  12. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  13. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  14. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  15. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  16. GLOBAL POSITIONING SYSTEMS GPS TECHNOLOGY PRIMER, EPA POLICIES AND PROCEDURES, AND QA CONSIDERATION

    Science.gov (United States)

    Onsite analyses are critical to making timely decisions. The results of these decisions may not be realized for many years. in order to increase the value of onsite analyses and to create and utilize meaningful environmental models, the Environmental Protection Agency (EP...

  17. Primer on climate change and sustainable development: facts, policy analysis, and applications

    National Research Council Canada - National Science Library

    Munasinghe, Mohan; Swart, Rob

    2005-01-01

    ... between climate change and sustainable development. Building on the main findings of the last series of Intergovernmental Panel on Climate Change (IPCC) assessment reports, in which both authors were involved, the book summarizes the latest research linking the two. Our current knowledge of the basic science of climate change is described, be...

  18. Hardware description languages

    Science.gov (United States)

    Tucker, Jerry H.

    1994-01-01

    Hardware description languages are special purpose programming languages. They are primarily used to specify the behavior of digital systems and are rapidly replacing traditional digital system design techniques. This is because they allow the designer to concentrate on how the system should operate rather than on implementation details. Hardware description languages allow a digital system to be described with a wide range of abstraction, and they support top down design techniques. A key feature of any hardware description language environment is its ability to simulate the modeled system. The two most important hardware description languages are Verilog and VHDL. Verilog has been the dominant language for the design of application specific integrated circuits (ASIC's). However, VHDL is rapidly gaining in popularity.

  19. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  20. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  1. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  2. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  3. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  4. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  5. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  6. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  7. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  8. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  10. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  11. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  12. Sustainability Policy and Environmental Policy

    OpenAIRE

    John C. V. Pezzey

    2001-01-01

    A theoretical, representative agent economy with a depletable resource stock, polluting emissions and productive capital is used to contrast environmental policy, which internalises externalised environmental values, with sustainability policy, which achieves some form of intergenerational equity. The obvious environmental policy comprises an emissions tax and a resource stock subsidy, each equal to the respective external cost or benefit. Sustainability policy comprises an incentive affectin...

  13. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    Energy Technology Data Exchange (ETDEWEB)

    Naus, Dan J [ORNL

    2007-02-01

    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program.

  14. Primer on Durability of Nuclear Power Plant Reinforced Concrete Structures - A Review of Pertinent Factors

    International Nuclear Information System (INIS)

    Naus, Dan J.

    2007-01-01

    The objective of this study was to provide a primer on the environmental effects that can affect the durability of nuclear power plant concrete structures. As concrete ages, changes in its properties will occur as a result of continuing microstructural changes (i.e., slow hydration, crystallization of amorphous constituents, and reactions between cement paste and aggregates), as well as environmental influences. These changes do not have to be detrimental to the point that concrete will not be able to meet its performance requirements. Concrete, however, can suffer undesirable changes with time because of improper specifications, a violation of specifications, or adverse performance of its cement paste matrix or aggregate constituents under either physical or chemical attack. Contained in this report is a discussion on concrete durability and the relationship between durability and performance, a review of the historical perspective related to concrete and longevity, a description of the basic materials that comprise reinforced concrete, and information on the environmental factors that can affect the performance of nuclear power plant concrete structures. Commentary is provided on the importance of an aging management program

  15. Database Description - SAHG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name SAHG Alternative nam...h: Contact address Chie Motono Tel : +81-3-3599-8067 E-mail : Database classification Structure Databases - ...e databases - Protein properties Organism Taxonomy Name: Homo sapiens Taxonomy ID: 9606 Database description... Links: Original website information Database maintenance site The Molecular Profiling Research Center for D...stration Not available About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Database Description - SAHG | LSDB Archive ...

  16. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  17. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  18. CRAC2 model description

    International Nuclear Information System (INIS)

    Ritchie, L.T.; Alpert, D.J.; Burke, R.P.; Johnson, J.D.; Ostmeyer, R.M.; Aldrich, D.C.; Blond, R.M.

    1984-03-01

    The CRAC2 computer code is a revised version of CRAC (Calculation of Reactor Accident Consequences) which was developed for the Reactor Safety Study. This document provides an overview of the CRAC2 code and a description of each of the models used. Significant improvements incorporated into CRAC2 include an improved weather sequence sampling technique, a new evacuation model, and new output capabilities. In addition, refinements have been made to the atmospheric transport and deposition model. Details of the modeling differences between CRAC2 and CRAC are emphasized in the model descriptions

  19. Olkiluoto site description 2011

    International Nuclear Information System (INIS)

    2012-12-01

    This fourth version of the Olkiluoto Site Report, produced by the OMTF (Olkiluoto Modelling Task Force), updates the Olkiluoto Site Report 2008 with the data and knowledge obtained up to December 2010. A descriptive model of the site (the Site Descriptive Model, SDM), i.e. a model describing the geological and hydrogeological structure of the site, properties of the bedrock and the groundwater and its flow, and the associated interacting processes and mechanisms. The SDM is divided into six parts: surface system, geology, rock mechanics, hydrogeology, hydrogeochemistry and transport properties

  20. Olkiluoto site description 2011

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-12-15

    This fourth version of the Olkiluoto Site Report, produced by the OMTF (Olkiluoto Modelling Task Force), updates the Olkiluoto Site Report 2008 with the data and knowledge obtained up to December 2010. A descriptive model of the site (the Site Descriptive Model, SDM), i.e. a model describing the geological and hydrogeological structure of the site, properties of the bedrock and the groundwater and its flow, and the associated interacting processes and mechanisms. The SDM is divided into six parts: surface system, geology, rock mechanics, hydrogeology, hydrogeochemistry and transport properties.

  1. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  2. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  3. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  4. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  5. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  6. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  7. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  8. Sustainability Policy and the Law

    DEFF Research Database (Denmark)

    Karsten, Jens; Reisch, Lucia

    2008-01-01

    Growing awareness of environmental and social concern and the pressing issue of climate change have forcefully re-established sustainability policy as a part of consumer policy. The need for change in consumer behaviour and for more responsible lifestyles on the demand-side of the economy is chal...... of sustainability policy in European politics. Beyond this descriptive purpose the paper thereby purports to frame the debate on sustainability policy and the law on the eve of a new political cycle of the European Union.......Growing awareness of environmental and social concern and the pressing issue of climate change have forcefully re-established sustainability policy as a part of consumer policy. The need for change in consumer behaviour and for more responsible lifestyles on the demand-side of the economy...

  9. Privacy Policy

    Science.gov (United States)

    ... Home → NLM Privacy Policy URL of this page: https://medlineplus.gov/privacy.html NLM Privacy Policy To ... out of cookies in the most popular browsers, http://www.usa.gov/optout_instructions.shtml. Please note ...

  10. The policies

    International Nuclear Information System (INIS)

    Laruelle, Ph.; Snegaroff, Th.; Moreau, S.; Tellenne, C.; Brunel, S.

    2005-01-01

    Fourth chapter of the book on the geo-policy of the sustainable development, this chapter deal with the different and international policies concerned by the problem. The authors analyze the american energy attitude and policy, the economical equilibrium facing the environmental equilibrium for the european policy, the sanctified and sacrificed nature and the japanese attitude, India and China, the great fear of the 21 century and the sustainable development in Africa. (A.L.B.)

  11. Trade Policy

    OpenAIRE

    Murray Gibbs

    2007-01-01

    In an otherwise insightful and thoughtful article, Sebastian Pfotenhauer (Trade Policy Is Science Policy,” Issues, Fall 2013) might better have entitled his contribution “Trade Policy Needs to Be Reconciled with Science Policy.” The North American Free Trade Agreement (NAFTA) and the agreements administered by the World Trade Organization, particularly the General Agreement on Tariffs and Trade (GATT) and the Technical Barriers to Trade (TBT), were adopted to promote international trade and i...

  12. Descriptive data analysis.

    Science.gov (United States)

    Thompson, Cheryl Bagley

    2009-01-01

    This 13th article of the Basics of Research series is first in a short series on statistical analysis. These articles will discuss creating your statistical analysis plan, levels of measurement, descriptive statistics, probability theory, inferential statistics, and general considerations for interpretation of the results of a statistical analysis.

  13. Osiris reactor descriptive report

    International Nuclear Information System (INIS)

    1976-03-01

    OSIRIS is a swimming pool reactor of 70 MW thermal power. Its main purpose is the irradiation of reactor materials in high neutron flux. A description is given of the air conditioning, ventilation, and radioactive gas removal system. (R.L.)

  14. Plot Description (PD)

    Science.gov (United States)

    Robert E. Keane

    2006-01-01

    The Plot Description (PD) form is used to describe general characteristics of the FIREMON macroplot to provide ecological context for data analyses. The PD data characterize the topographical setting, geographic reference point, general plant composition and cover, ground cover, fuels, and soils information. This method provides the general ecological data that can be...

  15. Generalizing: The descriptive struggle

    Directory of Open Access Journals (Sweden)

    Barney G. Glaser, Ph.D.; Hon Ph.D.

    2006-11-01

    Full Text Available The literature is not kind to the use of descriptive generalizations. Authors struggle and struggle to find and rationalize a way to use them and then fail in spite of trying a myriad of work-arounds. And then we have Lincoln and Guba’s famous statement: “The only generalization is: there is no generalization” in referring to qualitative research. (op cit, p. 110 They are referring to routine QDA yielding extensive descriptions, but which tacitly include conceptual generalizations without any real thought of knowledge about them. In this chapter I wish to explore this struggle for the purpose of explaining that the various contra arguments to using descriptive generalizations DO NOT apply to the ease of using conceptual generalizations yielded in SGT and especially FGT. I will not argue for the use of descriptive generalization. I agree with Lincoln and Guba with respect to QDA, “the only generalization is: there is no generalization.” It is up to the QDA methodologists, of whom there are many; to continue the struggle and I wish them well.

  16. Fractal description of fractures

    International Nuclear Information System (INIS)

    Lung, C.W.

    1991-06-01

    Recent studies on the fractal description of fractures are reviewed. Some problems on this subject are discussed. It seems hopeful to use the fractal dimension as a parameter for quantitative fractography and to apply fractal structures to the development of high toughness materials. (author). 28 refs, 7 figs

  17. Tore Supra: technical description

    International Nuclear Information System (INIS)

    1985-08-01

    This report is aimed, after a brief recall of physics and technologic perspectives of Tore Supra, at giving a detailed description of the basic machine; details of each component are defined. Volume 1 is specifically concerned with the general aspects of Tore Supra and the toroidal field system [fr

  18. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  19. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  20. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  1. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  2. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  3. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  4. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  5. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  6. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  7. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  8. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  9. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  10. A comparative clinical study of the failure rate of orthodontic brackets bonded with two adhesive systems: conventional and self-etching primer (SEP).

    Science.gov (United States)

    Dominguez, Gladys Cristina; Tortamano, André; Lopes, Luiz Vicente de Moura; Catharino, Priscilla Campanatti Chibebe; Morea, Camillo

    2013-01-01

    This study compared the clinical performance of orthodontic brackets bonded with Transbond adhesive paste after two primer systems: a two-stage conventional system (acid etching + Transbond XT adhesive primer) and a single-stage self-etching primer (SEP) (Transbond Plus). The sample comprised 480 metal brackets bonded to the teeth of 24 consecutive patients treated for 36 to 48 months. A split-mouth design was used for bonding, and both systems were used in each patient. Bracket failure rates for each system were analyzed; and failure causes as reported by the patients and the quadrant of teeth for which brackets failed were recorded. The conventional system group had a failure rate of 5.41%, whereas the rate for SEP was 4.58%. In this group, there were 5 failures (38.4%) in the right maxillary quadrant, 2 (15.4%) in the left maxillary quadrant, 4 (30.8%) in the right mandibular quadrant, and 2 (15.4%) in the left mandibular quadrant. In the SEP group, there were 4 (36.4%) failures in the right maxillary quadrant, 1 (9%) in the left maxillary quadrant, 3 (27.3%) in the right mandibular quadrant, and 3 (27.3%) in the left mandibular quadrant. Results of descriptive statistical analysis and odds ratio did not show any significant differences between rates (p = 0.67). The clinical efficiency of SEP was similar to that of the conventional system.

  11. iRODS Primer Integrated Rule-Oriented Data System

    CERN Document Server

    Rajasekar, Arcot

    2010-01-01

    Policy-based data management enables the creation of community-specific collections. Every collection is created for a purpose. The purpose defines the set of properties that will be associated with the collection. The properties are enforced by management policies that control the execution of procedures that are applied whenever data are ingested or accessed. The procedures generate state information that defines the outcome of enforcing the management policy. The state information can be queried to validate assessment criteria and verify that the required collection properties have been con

  12. A legal primer for the obesity prevention movement.

    Science.gov (United States)

    Mermin, Seth E; Graff, Samantha K

    2009-10-01

    Public health advocates and scientists working on obesity prevention policy face challenges in balancing legal rights, individual freedom, and societal health goals. In particular, the US Constitution and the 50 state constitutions place limits on the ability of government to act, even in the best interests of the public. To help policymakers avoid crossing constitutional boundaries, we distilled the legal concepts most relevant to formulating policies aimed at preventing obesity: police power; allocation of power among federal, state, and local governments; freedom of speech; property rights; privacy; equal protection; and contract rights. The goal is to allow policymakers to avoid potential constitutional problems in the formation of obesity prevention policy.

  13. Waste Management Systems Requirements and Descriptions (SRD)

    International Nuclear Information System (INIS)

    Conner, C.W.

    1986-01-01

    The Department of Energy (DOE), Office of Civilian Radioactive Waste Management (OCRWM) is responsible for the development of a system for the management of high-level radioactive waste and spent fuel in accordance with the Nuclear Waste Policy Act of 1982. The Waste Management system requirements and description document is the program-level technical baseline document. The requirements include the functions that must be performed in order to achieve the system mission and performance criteria for those functions. This document covers only the functional requirements of the system; it does not cover programmatic or procedural requirements pertaining to the processes of designing, siting and licensing. The requirements are largely based on the Nuclear Waste Policy Act of 1982, Environmental Protection Agency standards, Nuclear Regulatory Commission regulations, and DOE orders and guidance. However, nothing in this document should be construed as to relieve the DOE or its contractors from their responsibilities to comply with applicable statutes, regulations, and standards. This document also provides a brief description of the system being developed to meet the requirements. In addition to the described ''authorized system,'' a system description is provided for an ''improved-performance system'' which would include a monitored retrievable storage (MRS) facility. In the event that an MRS facility is approved by Congress, the improved-performance system will become the reference system. Neither system description includes Federal Interim Storage (FIS) capabilities. Should the need for FIS be identified, it will be included as an additional system element. The descriptions are focused on the interfaces between the system elements, rather than on the detail of the system elements themselves

  14. Quality Assurance Program Description

    Energy Technology Data Exchange (ETDEWEB)

    Halford, Vaughn Edward [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ryder, Ann Marie [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-07-01

    Effective May 1, 2017, led by a new executive leadership team, Sandia began operating within a new organizational structure. National Technology and Engineering Solutions of Sandia (Sandia’s) Quality Assurance Program (QAP) was established to assign responsibilities and authorities, define workflow policies and requirements, and provide for the performance and assessment of work.

  15. Marketing Information Products and Services: A Primer for Librarians ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Today, just as businesses must compete for survival, growth, and market space ... for raising money, offers tips and techniques for better service management, and ... S. Sreenivas Rao has recently retired as Professor of business policy at IIMA.

  16. RETRIEVAL EQUIPMENT DESCRIPTIONS

    International Nuclear Information System (INIS)

    J. Steinhoff

    1997-01-01

    The objective and the scope of this document are to list and briefly describe the major mobile equipment necessary for waste package (WP) retrieval from the proposed subsurface nuclear waste repository at Yucca Mountain. Primary performance characteristics and some specialized design features of the equipment are explained and summarized in the individual subsections of this document. There are no quality assurance requirements or QA controls in this document. Retrieval under normal conditions is accomplished with the same fleet of equipment as is used for emplacement. Descriptions of equipment used for retrieval under normal conditions is found in Emplacement Equipment Descriptions, DI: BCAF00000-01717-5705-00002 (a document in progress). Equipment used for retrieval under abnormal conditions is addressed in this document and consists of the following: (1) Inclined Plane Hauler; (2) Bottom Lift Transporter; (3) Load Haul Dump (LHD) Loader; (4) Heavy Duty Forklift for Emplacement Drifts; (5) Covered Shuttle Car; (6) Multipurpose Vehicle; and (7) Scaler

  17. Multidimensional nonlinear descriptive analysis

    CERN Document Server

    Nishisato, Shizuhiko

    2006-01-01

    Quantification of categorical, or non-numerical, data is a problem that scientists face across a wide range of disciplines. Exploring data analysis in various areas of research, such as the social sciences and biology, Multidimensional Nonlinear Descriptive Analysis presents methods for analyzing categorical data that are not necessarily sampled randomly from a normal population and often involve nonlinear relations. This reference not only provides an overview of multidimensional nonlinear descriptive analysis (MUNDA) of discrete data, it also offers new results in a variety of fields. The first part of the book covers conceptual and technical preliminaries needed to understand the data analysis in subsequent chapters. The next two parts contain applications of MUNDA to diverse data types, with each chapter devoted to one type of categorical data, a brief historical comment, and basic skills peculiar to the data types. The final part examines several problems and then concludes with suggestions for futu...

  18. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  19. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  20. TMACS system description

    International Nuclear Information System (INIS)

    Scaief, C.C.

    1995-01-01

    This document provides a description of the Tank Monitor and Control System (TMACS). It is intended as an introduction for those persons unfamiliar with the system as well as a reference document for the users, maintenance personnel, and system designers. In addition to describing the system, the document outlines the associated drawing documentation, provides maintenance and spare parts information, and discusses other TMACS documents that provide additional detail

  1. Input description for BIOPATH

    International Nuclear Information System (INIS)

    Marklund, J.E.; Bergstroem, U.; Edlund, O.

    1980-01-01

    The computer program BIOPATH describes the flow of radioactivity within a given ecosystem after a postulated release of radioactive material and the resulting dose for specified population groups. The present report accounts for the input data necessary to run BIOPATH. The report also contains descriptions of possible control cards and an input example as well as a short summary of the basic theory.(author)

  2. The argument for pharmaceutical policy.

    Science.gov (United States)

    Traulsen, Janine Morgall; Almarsdóttir, Anna Birna

    2005-02-01

    Pharmaceutical policy is a global concern. It has become a hot political topic in most countries--developed as well as developing--and can be found on the agenda of international organizations such as WHO, OECD, EU, WTO and even the World Bank. Pharmaceutical policy affects everyone in the world of pharmacy and it is therefore imperative that it be understood, discussed and debated within the pharmacy profession and included in the curriculum of schools of pharmacy. This, the first article in a series, argues for the importance of the academic discipline of pharmaceutical policy analysis and the involvement of pharmacists in this endeavour. The aim of the authors is to stimulate an informed and critical appreciation of this field. The authors begin with an introduction to the field of pharmaceutical policy, introducing several important concepts and current trends including: medicines regulation; how pharmaceutical policy is made; pharmaceutical policy as a dynamic process; and the new public health as a global issue. The article ends with a short description of the remaining five articles in the series which will deal with important aspects of pharmaceutical policy. The topics include: economic pressures on health care systems; drug utilization from the clinical viewpoint (rational use of medicines); the impact of pharmaceutical policy on patients and the patient impact on pharmaceutical policy; the professional perspective; and finally the last article which deals with studying and evaluating pharmaceutical policy.

  3. XML Diagnostics Description Standard

    International Nuclear Information System (INIS)

    Neto, A.; Fernandes, H.; Varandas, C.; Lister, J.; Yonekawa, I.

    2006-01-01

    A standard for the self-description of fusion plasma diagnostics will be presented, based on the Extensible Markup Language (XML). The motivation is to maintain and organise the information on all the components of a laboratory experiment, from the hardware to the access security, to save time and money when problems arises. Since there is no existing standard to organise this kind of information, every Association stores and organises each experiment in different ways. This can lead to severe problems when the organisation schema is poorly documented or written in national languages. The exchange of scientists, researchers and engineers between laboratories is a common practice nowadays. Sometimes they have to install new diagnostics or to update existing ones and frequently they lose a great deal of time trying to understand the currently installed system. The most common problems are: no documentation available; the person who understands it has left; documentation written in the national language. Standardisation is the key to solving all the problems mentioned. From the commercial information on the diagnostic (component supplier; component price) to the hardware description (component specifications; drawings) to the operation of the equipment (finite state machines) through change control (who changed what and when) and internationalisation (information at least in the native language and in English), a common XML schema will be proposed. This paper will also discuss an extension of these ideas to the self-description of ITER plant systems, since the problems will be identical. (author)

  4. Olkiluoto site description 2006

    International Nuclear Information System (INIS)

    Andersson, J.; Ahokas, H.; Hudson, J.A.

    2007-03-01

    This second version of the Olkiluoto Site Report, produced by the OMTF (Olkiluoto Modelling Task Force), updates the Olkiluoto Site Report 2004 (Posiva 2005) with the data and knowledge obtained up to December 2005. The main product of the modelling has been to develop a descriptive model of the site (the Site Descriptive Model), i.e. a model describing the geometry, properties of the bedrock and the water and the associated interacting processes and mechanisms. For practical reasons, the Site Descriptive Model is divided into five parts: surface system, geology, rock mechanics, hydrogeology and hydrogeochemistry, which are presented in individual chapters. Four separated models are presented: the geological, rock mechanics, hydrogeological and hydrogeochemical models. The consistency between the hydrogeological and hydrogeochemical models is assessed in a joint chapter. Chapter 1 presents an outline of the report, explains the background to its development and sets out its objectives and scope. It is also introduces and explains the integrated modelling methodology, the nomenclature used in the descriptions of the models and the prediction/outcome studies. Chapter 2 provides a brief overview of the data used for producing the Site Description. Chapters 3 to 8 present the descriptive modelling, which involves interpreting data, interpolating or extrapolating between measurement points and calibrating the model against data, based on the various assumptions made about each conceptual model. Chapter 9 presents the results of the prediction/outcome studies performed during 2005 and Chapter 10 the overall consistency and confidence assessment. Overall conclusions are provided in Chapter 11. The main advances since Site Report 2004 are: A new geological model is presented in Chapter 4, representing a significant change from Bedrock Model 2003/1. There has been extensive use of geological data, whereas hydrogeological data have deliberately not been used and more

  5. Management control system description

    Energy Technology Data Exchange (ETDEWEB)

    Bence, P. J.

    1990-10-01

    This Management Control System (MCS) description describes the processes used to manage the cost and schedule of work performed by Westinghouse Hanford Company (Westinghouse Hanford) for the US Department of Energy, Richland Operations Office (DOE-RL), Richland, Washington. Westinghouse Hanford will maintain and use formal cost and schedule management control systems, as presented in this document, in performing work for the DOE-RL. This MCS description is a controlled document and will be modified or updated as required. This document must be approved by the DOE-RL; thereafter, any significant change will require DOE-RL concurrence. Westinghouse Hanford is the DOE-RL operations and engineering contractor at the Hanford Site. Activities associated with this contract (DE-AC06-87RL10930) include operating existing plant facilities, managing defined projects and programs, and planning future enhancements. This document is designed to comply with Section I-13 of the contract by providing a description of Westinghouse Hanford's cost and schedule control systems used in managing the above activities. 5 refs., 22 figs., 1 tab.

  6. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  7. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  8. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  9. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  10. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  11. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  12. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  13. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  14. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  15. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  16. Sex-Stereotypes in Israeli Primers: A Content Analysis Approach

    Science.gov (United States)

    Zak, Itai; Kaufman, Shlomit

    1977-01-01

    Primary reading textbooks used in Israel were examined for sexual stereotyping. It was determined that male and female descriptions in the textbooks differ from true life situations. High correlations were also found between particular personality traits and sex in the books, which do not also exist in reality. (Author/MV)

  17. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  18. ORIGAMI Automator Primer. Automated ORIGEN Source Terms and Spent Fuel Storage Pool Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Wieselquist, William A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Thompson, Adam B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bowman, Stephen M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Peterson, Joshua L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2016-04-01

    Source terms and spent nuclear fuel (SNF) storage pool decay heat load analyses for operating nuclear power plants require a large number of Oak Ridge Isotope Generation and Depletion (ORIGEN) calculations. SNF source term calculations also require a significant amount of bookkeeping to track quantities such as core and assembly operating histories, spent fuel pool (SFP) residence times, heavy metal masses, and enrichments. The ORIGEN Assembly Isotopics (ORIGAMI) module in the SCALE code system provides a simple scheme for entering these data. However, given the large scope of the analysis, extensive scripting is necessary to convert formats and process data to create thousands of ORIGAMI input files (one per assembly) and to process the results into formats readily usable by follow-on analysis tools. This primer describes a project within the SCALE Fulcrum graphical user interface (GUI) called ORIGAMI Automator that was developed to automate the scripting and bookkeeping in large-scale source term analyses. The ORIGAMI Automator enables the analyst to (1) easily create, view, and edit the reactor site and assembly information, (2) automatically create and run ORIGAMI inputs, and (3) analyze the results from ORIGAMI. ORIGAMI Automator uses the standard ORIGEN binary concentrations files produced by ORIGAMI, with concentrations available at all time points in each assembly’s life. The GUI plots results such as mass, concentration, activity, and decay heat using a powerful new ORIGEN Post-Processing Utility for SCALE (OPUS) GUI component. This document includes a description and user guide for the GUI, a step-by-step tutorial for a simplified scenario, and appendices that document the file structures used.

  19. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  20. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  1. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  2. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  3. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  4. The DART general equilibrium model: A technical description

    OpenAIRE

    Springer, Katrin

    1998-01-01

    This paper provides a technical description of the Dynamic Applied Regional Trade (DART) General Equilibrium Model. The DART model is a recursive dynamic, multi-region, multi-sector computable general equilibrium model. All regions are fully specified and linked by bilateral trade flows. The DART model can be used to project economic activities, energy use and trade flows for each of the specified regions to simulate various trade policy as well as environmental policy scenarios, and to analy...

  5. Description logic rules

    CERN Document Server

    Krötzsch, M

    2010-01-01

    Ontological modelling today is applied in many areas of science and technology,including the Semantic Web. The W3C standard OWL defines one of the most important ontology languages based on the semantics of description logics. An alternative is to use rule languages in knowledge modelling, as proposed in the W3C's RIF standard. So far, it has often been unclear how to combine both technologies without sacrificing essential computational properties. This book explains this problem and presents new solutions that have recently been proposed. Extensive introductory chapters provide the necessary

  6. MCO Monitoring activity description

    International Nuclear Information System (INIS)

    SEXTON, R.A.

    1998-01-01

    Spent Nuclear Fuel remaining from Hanford's N-Reactor operations in the 1970s has been stored under water in the K-Reactor Basins. This fuel will be repackaged, dried and stored in a new facility in the 200E Area. The safety basis for this process of retrieval, drying, and interim storage of the spent fuel has been established. The monitoring of MCOS in dry storage is a currently identified issue in the SNF Project. This plan outlines the key elements of the proposed monitoring activity. Other fuel stored in the K-Reactor Basins, including SPR fuel, will have other monitoring considerations and is not addressed by this activity description

  7. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  8. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  9. ENERGY POLICY

    OpenAIRE

    Avrupa Topluluğu Enstitüsü, Marmara Üniversitesi

    2015-01-01

    John Mitchell considers EU policies on energy supply security; Tera Allas on energy security of supply in the UK: the way forward; Peter Odell assesses public/private partnerships on the UKCS; Olivier Appert provides an overview of French energy policy.

  10. Energy policy

    International Nuclear Information System (INIS)

    Forrester, J.W.

    1979-01-01

    The author places the energy problem in the context of world economy. The various obstacles encountered in the United States to spell out a viable national energy policy are cited. A certain number of practical proposals is given to lead to an 'effective policy' which would allow energy economy at the same time as energy development, that is, including nuclear energy [fr

  11. Measuring reporting verifying. A primer on MRV for nationally appropriate mitigation actions

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (ed.); Luetken, S.; Holm Olsen, K. (Technical Univ. of Denmark. UNEP Risoe Centre, Roskilde (Denmark)); Aalders, E.; Pretlove, B.; Peters, N. (Det Norske Veritas, Hellerup (Denmark))

    2012-03-15

    The requirements for measurement, reporting and verification (MRV) of nationally appropriate mitigation actions (NAMAs) are one of the crucial topics on the agenda of international negotiations to address climate change mitigation. According to agreements so far, the general guidelines for domestic MRV are to be developed by Subsidiary Body for Scientific and Technological Advice (SBSTA)1. Further, the Subsidiary Body for Implementation (SBI) will be conducting international consultations and analysis (ICA) of biennial update reports (BUR) to improve transparency of mitigation actions, which should be measured, reported and verified. 2. What is clear from undergoing discussions both at SBSTA and at SBI is that MRV for NAMAs should not be a burden for controlling greenhouse gas (GHG) emissions connected to economic activities. Instead, the MRV process should facilitate mitigation actions; encourage the redirection of investments and address concerns regarding carbon content of emission intensive operations of private and public companies and enterprises worldwide. While MRV requirements are being shaped within the Convention, there are a number of initiatives supporting developing countries moving forward with NAMA development and demonstration activities. How these actions shall be measured, reported and verified, however, remain unanswered. MRV is not new. It is present in most existing policies and frameworks related to climate change mitigation. With an aim to contribute to international debate and capacity building on this crucial issue, the UNEP Risoe Centre in cooperation with UNDP, are pleased to present this publication that through the direct collaboration with Det Norske Veritas (DNV) builds on existing MRV practices in current carbon markets; provides insights on how MRV for NAMAs can be performed and identifies elements and drivers to be considered when designing adequate MRV systems for NAMAs in developing countries. This primer is the second

  12. Consumption Taxation in a Digital World : A Primer

    NARCIS (Netherlands)

    Ligthart, J.E.

    2004-01-01

    The paper reviews the economic and administrative issues that arise in the taxation of electronic commerce; addresses how best to meet the criteria of an ideal tax system; and examines recent policy developments.It is argued that destination-based taxation-is presently the norm for goods taxation is

  13. Defense Primer: The National Defense Budget Function (050)

    Science.gov (United States)

    2017-03-17

    individual policy activities. Subfunctions are assigned a numeric identifier (ending in a single digit ) related to the function to which they belong...operations, equipment repair, and maintenance of defense facilities, healthcare costs, and administration. 24% Military Personnel (MILPERS) Pay and

  14. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  15. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  16. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  17. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  18. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  19. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  20. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  1. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  2. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...

  3. Building a Foundation for Effective Technology Transfer through Integration with the Research Process : a Primer.

    Science.gov (United States)

    2016-03-01

    This primer aims to increase the effectiveness of T2 activity in transportation by describing how T2 practices can be successfully integrated into : the research process to capture the potential real-world benefits of our communitys research inves...

  4. Microsatellite Primers in the Foundation Tree Species Pinus edulis and P. monophylla (Pinaceae

    Directory of Open Access Journals (Sweden)

    Andrew L. Krohn

    2013-07-01

    Full Text Available Premise of the study: Microsatellite primers were developed in the foundational tree species Pinus edulis to investigate population differentiation of P. edulis and hybridization among closely related species. Methods and Results: Using a hybridization protocol, primer sets for 11 microsatellite loci were developed using megagametophyte tissue from P. edulis and scored for polymorphism in three populations of P. edulis and a single P. monophylla population. The primers amplified simple and compound di-, tri-, and pentanucleotide repeats with two to 18 alleles per locus. Conclusions: These results demonstrate the utility of the described primers for studies of population differentiation within and among P. edulis populations as well as across putative hybrid zones where P. edulis may coexist with sister species.

  5. Ares, Janus, Globalization: A Primer For The Military Leader in NATO

    National Research Council Canada - National Science Library

    Clemons, Dean

    2002-01-01

    ...: international military and commercial investment; dual-use technologies; and export control. As a primer on these stakes for the rising military leader within the North Atlantic Treaty, the study elucidates the issue of cooperation vs...

  6. Incorporating travel-time reliability into the congestion management process : a primer.

    Science.gov (United States)

    2015-02-01

    This primer explains the value of incorporating travel-time reliability into the Congestion Management Process (CMP) : and identifies the most current tools available to assist with this effort. It draws from applied research and best practices : fro...

  7. The UVM primer a step-by-step introduction to the universal verification methodology

    CERN Document Server

    Salemi, Ray

    2013-01-01

    The UVM Primer uses simple, runnable code examples, accessible analogies, and an easy-to-read style to introduce you to the foundation of the Universal Verification Methodology. You will learn the basics of object-oriented programming with SystemVerilog and build upon that foundation to learn how to design testbenches using the UVM. Use the UVM Primer to brush up on your UVM knowledge before a job interview to be able to confidently answer questions such as "What is a uvm_agent?" , "How do you use uvm_sequences?", and "When do you use the UVM's factory." The UVM Primer's downloadable code examples give you hands-on experience with real UVM code. Ray Salemi uses online videos (on www.uvmprimer.com) to walk through the code from each chapter and build your confidence. Read The UVM Primer today and start down the path to the UVM.

  8. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    Science.gov (United States)

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  9. Qualification and Flight Test of Non-Chrome Primers for C-130 Aircraft

    Science.gov (United States)

    2011-08-17

    system  Significant hexavalent chrome reduction in finish system  Potential exposure level of spray applied chromated conversion coating not as...Lockheed Martin Aeronautics Company Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft Scott Jones Lockheed Martin...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Qualification and Flight Test of Non- Chrome Primers for C-130 Aircraft 5a. CONTRACT NUMBER 5b. GRANT

  10. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    Science.gov (United States)

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  11. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.

    Science.gov (United States)

    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong

    2014-08-01

    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. THULE: A detailed description

    International Nuclear Information System (INIS)

    Terry, M.J.

    1964-07-01

    This report describes the THULE scheme of lattice physics calculation which has been developed in FORTRAN for the IBM 7090. This scheme predicts the neutron flux over energy and space, for many groups and regions, together with reactivity and reaction rate edits for both a single lattice cell and a reactor core. This report describes in detail the input requirements for the THULE programme which forms the main part of the scheme. Brief descriptions of the 7090 programmes TED 6 and NOAH are included as appendices. TED 6 will produce the THULE edits from a WDSN output tape and NOAH is a version of the METHUSELAH programme which contains many of the THULE edits and will also produce input cards for THULE. (author)

  13. Evalutive Descriptions of Art

    Directory of Open Access Journals (Sweden)

    Nataša Lah

    2016-01-01

    Full Text Available Taking into account the fact that, throughout history, certain artworks have been considered as “worth of watching” (according to the Greek etymon ἀξιοϑέατος / aksioteatos, preservation, or theorizing, while others were not, one is led to investigate the various types of evaluative descriptions. Those artworks that are more valuable than others, or simply valuable in themselves on the basis of rather specific features, have always represented the paradigmatic model for the evaluator, thus revealing the identitary nature of value as different from one epoch to another. Our aim has been to discern, with regard to this starting point, the way in which the process of evaluating artworks fits the general matrix of the universal theory of value, with its clearly distinguished levels of evaluation, beginning with value descriptions, continuing through the features of evaluation or abstract qualities of values extracted from these descriptions, and ending with value norms or systems of accepted generalizations in evaluation. Value standpoints in such an evaluation matrix represent dispositions or preferences in procedures, which reflect the norms or signifying concepts of the time. Corresponding procedures, or applications of the hierarchicized signification of artworks, are manifested in all known forms of artwork assessment: attribution, institutionalization, and setting of priorities in terms of exhibition, conservation, acquisition, restoration, and so on. Research in the history of European art-historical ideas has corroborated the hypothesis that, prior to the late 18th century, clear normative patterns were applied when it came to the evaluation of artworks. However, with the emergence of early Romanticism, this could no longer be done in the traditional way. Before the period in question, visual art was created (regardless of some stylistic discrepancies between individual authors and classified according to well-defined thematic

  14. Metaphorical descriptions of wrongdoers

    Directory of Open Access Journals (Sweden)

    Dryll Ewa Marta

    2017-10-01

    Full Text Available What is a metaphoric picture of an evil person made of? In a study devoted to the development of the ability to use metaphorical descriptions of humans, the semantic fields of four target metaphors - Human-Swamp, Human-Snake, Human-Knife, and Human-Nettle - were established and compared. Subjects (365 young adults were asked to decipher the metaphors’ meanings. The results were obtained mainly by qualitative analysis, with frequency analysis of clusters containing synonymous meanings. The results indicate that when creating imaginary characteristics of evil people, young adults seem to be more concerned about the possibility of suffering verbal harassment (most commonly: vulgarity, mockery, gossip, jeering than the threat of actual physical assault. The results may prove useful for developmental comparisons.

  15. Polemic and Descriptive Negations

    DEFF Research Database (Denmark)

    Horslund, Camilla Søballe

    2011-01-01

    to semantics and pragmatics, negations can be used in three different ways, which gives rise to a typology of three different types of negations: 1) the descriptive negation, 2) the polemic negation, and 3) the meta-linguistic negation (Nølke 1999, 4). This typology illuminates the fact that the negation...... common in certain social context or genres, while polemic negations are more likely to come up in other genres and social settings. Previous studies have shown a relation between articulatory prominence and register, which may further inform the analysis. Hence, the paper investigates how articulatory...... prominence and register may either work in concert or oppose each other with respect to the cues they provide for the interpretation....

  16. Descriptive sensory evaluations

    DEFF Research Database (Denmark)

    Dehlholm, Christian

    A recent trend in descriptive sensory evaluation methodology has been the application of rapid evaluation techniques. The ease in use makes the techniques extremely easy to implement by industry and university environments. Thus, one might not consider validity in the choice of method. The overall...... aim of this thesis is to compare and evaluate selected rapid evaluation techniques for sensory profiling. Method variations have been suggested for evaluations in product development and quality control, and method insight is provided. The thesis includes three original studies, designed...... as a consequence of the current practices and needs faced in the industry. Study I compared applicability and validity of rapid methods across several panels of trained assessors. Two rapid approaches were introduced for the evaluation of foods. The first method, ‘Free Multiple Sorting’, allows subjects to perform...

  17. Data Policy

    Directory of Open Access Journals (Sweden)

    Mark A Parsons

    2013-07-01

    Full Text Available The first purpose of data policy should be to serve the objectives of the organization or project sponsoring the collection of the data. With research data, data policy should also serve the broader goals of advancing scientific and scholarly inquiry and society at large. This is especially true with government-funded data, which likely comprise the vast majority of research data. Data policy should address multiple issues, depending on the nature and objectives of the data. These issues include data access requirements, data preservation and stewardship requirements, standards and compliance mechanisms, data security issues, privacy and ethical concerns, and potentially even specific collection protocols and defined data flows. The specifics of different policies can vary dramatically, but all data policies need to address data access and preservation. Research data gain value with use and must therefore be accessible and preserved for future access. This article focuses on data access. While policy might address multiple issues, at a first level it must address where the data stand on what Lyon (2009 calls the continuum of openness. Making data as openly accessible as possible provides the greatest societal benefit, and a central purpose of data policy is to work toward ethically open data access. An open data regime not only maximizes the benefit of the data, it also simplifies most of the other issues around effective research data stewardship and infrastructure development.

  18. YUCCA MOUNTAIN SITE DESCRIPTION

    International Nuclear Information System (INIS)

    Simmons, A.M.

    2004-01-01

    The ''Yucca Mountain Site Description'' summarizes, in a single document, the current state of knowledge and understanding of the natural system at Yucca Mountain. It describes the geology; geochemistry; past, present, and projected future climate; regional hydrologic system; and flow and transport within the unsaturated and saturated zones at the site. In addition, it discusses factors affecting radionuclide transport, the effect of thermal loading on the natural system, and tectonic hazards. The ''Yucca Mountain Site Description'' is broad in nature. It summarizes investigations carried out as part of the Yucca Mountain Project since 1988, but it also includes work done at the site in earlier years, as well as studies performed by others. The document has been prepared under the Office of Civilian Radioactive Waste Management quality assurance program for the Yucca Mountain Project. Yucca Mountain is located in Nye County in southern Nevada. The site lies in the north-central part of the Basin and Range physiographic province, within the northernmost subprovince commonly referred to as the Great Basin. The basin and range physiography reflects the extensional tectonic regime that has affected the region during the middle and late Cenozoic Era. Yucca Mountain was initially selected for characterization, in part, because of its thick unsaturated zone, its arid to semiarid climate, and the existence of a rock type that would support excavation of stable openings. In 1987, the United States Congress directed that Yucca Mountain be the only site characterized to evaluate its suitability for development of a geologic repository for high-level radioactive waste and spent nuclear fuel

  19. YUCCA MOUNTAIN SITE DESCRIPTION

    Energy Technology Data Exchange (ETDEWEB)

    A.M. Simmons

    2004-04-16

    The ''Yucca Mountain Site Description'' summarizes, in a single document, the current state of knowledge and understanding of the natural system at Yucca Mountain. It describes the geology; geochemistry; past, present, and projected future climate; regional hydrologic system; and flow and transport within the unsaturated and saturated zones at the site. In addition, it discusses factors affecting radionuclide transport, the effect of thermal loading on the natural system, and tectonic hazards. The ''Yucca Mountain Site Description'' is broad in nature. It summarizes investigations carried out as part of the Yucca Mountain Project since 1988, but it also includes work done at the site in earlier years, as well as studies performed by others. The document has been prepared under the Office of Civilian Radioactive Waste Management quality assurance program for the Yucca Mountain Project. Yucca Mountain is located in Nye County in southern Nevada. The site lies in the north-central part of the Basin and Range physiographic province, within the northernmost subprovince commonly referred to as the Great Basin. The basin and range physiography reflects the extensional tectonic regime that has affected the region during the middle and late Cenozoic Era. Yucca Mountain was initially selected for characterization, in part, because of its thick unsaturated zone, its arid to semiarid climate, and the existence of a rock type that would support excavation of stable openings. In 1987, the United States Congress directed that Yucca Mountain be the only site characterized to evaluate its suitability for development of a geologic repository for high-level radioactive waste and spent nuclear fuel.

  20. Adhesion and thermal stability enhancement of IZO films by adding a primer layer on polycarbonate substrate

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuan; Zhang, Xiaofeng; Yan, Yue; Zhong, Yanli; Li, Lei; Zhang, Guanli [Beijing Institute of Aeronautical Materials (BIAM), Haidian District, Beijing, 100095 (China)

    2015-04-01

    A silicone-based primer layer was developed to improve the adhesion and thermal stability of amorphous transparent indium zinc oxide (IZO) films on polycarbonate (PC). The IZO films deposited by direct current magnetron sputtering at room temperature on primer-treated and untreated PCs were evaluated ex situ in terms of surface morphology, adhesion, optical, and electrical properties during annealing at 120 C in air. Nano-scratch tests indicated the adhesion of IZO films on primer-treated substrates was superior to that on untreated PCs. This superior adhesion can be attributed to the strong Si-O-Si inorganic bonds abundant in the primer layer and better matches of the primer layer in the terms of thermal expansion to the IZO. Moreover, the electrical resistivity of IZO films prepared on primer-treated PCs remained stable during the annealing treatment, whereas those of IZO films on untreated PCs presented a continuously increasing trend, which was attributed to the decrease in carrier concentration that resulted from oxygen adsorption. (copyright 2015 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  1. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.

    Science.gov (United States)

    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong

    2015-01-01

    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website.

  2. UniPrime2: a web service providing easier Universal Primer design.

    Science.gov (United States)

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  3. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  4. A Descriptive Analysis of Instructional Coaches' Data Use in Science

    Science.gov (United States)

    Snodgrass Rangel, Virginia; Bell, Elizabeth R.; Monroy, Carlos

    2017-01-01

    A key assumption of accountability policies is that educators will use data to improve their instruction. In practice, however, data use is quite hard, and more districts are looking to instructional coaches to support their teachers. The purpose of this descriptive analysis is to examine how instructional coaches in elementary and middle school…

  5. 7 CFR 1737.80 - Description of characteristics letter.

    Science.gov (United States)

    2010-01-01

    ... the amount of the proposed loan, its purposes, rate of interest, loan security requirements, and other... SERVICE, DEPARTMENT OF AGRICULTURE PRE-LOAN POLICIES AND PROCEDURES COMMON TO INSURED AND GUARANTEED TELECOMMUNICATIONS LOANS Characteristics Letter § 1737.80 Description of characteristics letter. (a) After all of the...

  6. The sorption of iodine by an inorganic zinc primer

    Energy Technology Data Exchange (ETDEWEB)

    Evans, G J; Bekeris, P A [Toronto Univ., ON (Canada). Dept. of Chemical Engineering and Applied Chemistry

    1996-12-01

    The purpose of this work was to identify and evaluate significant parameters in the sorption of I{sub 2}(g) onto Carbo Zinc 11 inorganic primer, a paint used in the containment structure of some CANDU reactors. Air containing known amounts of {sup 131}I{sub 2}(g) was passed through 0.64 cm diameter glass tubing coated on the inner surface with paint. The accumulation of iodine on the surface was continuously monitored using two scintillation detectors. The test parameters covered were relative humidity, flow rate, I{sub 2} concentration and paint temperature. Adsorption was rapid at 23{sup o}C and predominantly gas phase mass transfer limited: the deposition velocity of 0.7{+-}0.4 cm/s was similar to the gas phase mass transfer coefficient of 1.2 cm/s estimated for the system. The deposition velocity observed at a higher paint surface temperature was an order of magnitude smaller. A similar deposition velocity was observed at 23{sup o}C for adsorption of I{sub 2}(g) from essentially dry air suggesting that the low deposition velocity observed for high surface temperature was limited by the amount of water on the paint surface. The rate of adsorption on the paint was directly proportional to the I{sub 2}(g) concentration over the range in concentration studied. The majority of the iodine retained by the paint could not be removed by washing with methanol or chloroform, but it was removed by water indicating that it was in an ionic form. Analysis of the speciation of the iodine in the wash water indicated that only a third of it was in the form of I{sup -}; the form of the remaining iodine could not be resolved. Desorption from the paint was negligible at room temperature but was detectable at higher temperatures. These low desorption rates and the ionic nature of the surface iodine indicated that adsorption occurred predominantly through a chemisorption process. A number of possible mechanisms were proposed. (author) 5 figs., 2 tabs., 6 refs.

  7. Konjungtivitis Viral: Diagnosis dan Terapi di Pelayanan Kesehatan Primer

    Directory of Open Access Journals (Sweden)

    Ratna Sitompul

    2017-04-01

    Full Text Available Konjungtiva adalah membran mukosa tipis transparan yang melapisi bagian anterior bola mata dan bagian dalam palpebral. Konjungtiva berfungsi sebagai salah satu komponen sistem perlindungan mata dari peradangan dan infeksi. Peradangan konjungtiva disebut konjungtivitis dan infeksi virus merupakan etiologi peradangan akut tersering pada konjungtiva. Virus yang menyebabkan konjungtivitis adalah adenovirus, herpes simpleks, herpes zoster, pox virus, myxovirus, paramyxovirus, dan arbovirus. Konjungtivitis sering terjadi bersama atau sesudah infeksi saluran napas dan umumnya terdapat riwayat kontak dengan pasien konjungtivitis viral. Gejala konjungtivitis viral berupa mata merah, sekret mata berair dan dapat disertai pembesaran kelenjar limfe. Gejala konjungtivitis viral biasanya ringan, dapat sembuh sendiri dan tidak disertai penurunan tajam penglihatan sehingga dapat ditatalaksana di pelayanan kesehatan primer. Meskipun demikian, terdapat kasus-kasus yang bersifat mengancam penglihatan sehingga perlu segera dirujuk ke rumah sakit atau dokter spesialis mata. Konjungtivitis viral sangat menular sehingga pasien perlu mendapat edukasi untuk mengurangi kontak langsung dan tidak langsung agar tidak menjadi sumber infeksi bagi lingkungannya. Konjungtivitis viral dapat sembuh sendiri, namun pemberian air mata buatan, antihistamin topikal, atau kompres dingin berguna untuk meredakan gejala. Terapi antiviral tidak diperlukan untuk konjungtivitis virus, kecuali untuk konjungtivitis herpetik. Kata kunci: epidemi, konjungtivitis, virus.     Viral Conjunctivitis: Diagnosis and Therapy in Primary Health Care   Abstract Conjunctivae is a transparent thin mucosal membrane covering the outer anterior eye and inner palpebrae. This structure is vital for eye defense from inflammation and infection. Inflammation occurring on the conjunctivae is called conjunctivitis and virus is one of the most common etiologic agent. Such viruses are adenovirus, herpes simplex virus

  8. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  9. Policy Innovation in Innovation Policy

    DEFF Research Database (Denmark)

    Borras, Susana

    During the past two decades Europe has experienced important changes and transformations in the way in which governments approach the issue of science, technology and innovation, and their relation to economic growth and competitiveness. This has to do with the European Union level as well...... as with national and sub-national governments in Europe, all of them introducing interesting novelties in their innovation policy. These changes refer to different aspects of policy, mainly the content of policy initiatives towards science, technology and innovation; the instruments governments are using...... at the EU level, and mentions similar trends taking place at national and sub-national levels. The questions that guide the contents here are essentially three, namely, what are the main traits of innovation policies in Europe since the 1990s and how have the EU and different national governments approached...

  10. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    Directory of Open Access Journals (Sweden)

    Christopher Ryan Penton

    2013-09-01

    Full Text Available Targeting sequencing to genes involved in key environmental processes, i.e. ecofunctional genes, provides an opportunity to sample nature’s gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in-silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature’s related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification.

  11. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  12. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  13. Olkiluoto biosphere description 2006

    International Nuclear Information System (INIS)

    Haapanen, R.; Aro, L.; Ilvesniemi, H.; Kareinen, T.; Kirkkala, T.; Mykrae, S.; Turkki, H.; Lahdenperae, A.-M.; Ikonen, A.T.K.

    2007-02-01

    This report summarises the current knowledge of the biosphere of Olkiluoto, and it is the first Biosphere Description Report. The elements considered were climate, topography, land use, overburden, terrestrial vegetation and fauna and sea flora, fauna and water. The principal aim was to present a synthesis of the present state (now to 2020) and the main features of past evolution of the biosphere at the site using currently available data. The lack of site specific parameters and their importance was discussed. Conceptual ecosystem models are presented for land and sea. Currently available data made it possible to calculate the biomass of the terrestrial vegetation and further convert it to carbon. In the case of terrestrial animals, preliminary figures are given for moose alone due to lack of sitespecific data. For the same reason, the sea ecosystem model was not quantified within this work. The ecosystems on Olkiluoto do not deviate from the surrounding areas. Since mires are few on Olkiluoto, forests are the most important land ecosystem. However, coastal areas are the transition zones between land and sea, and also potential sites for deep groundwater discharge. The major interest concerning aquatic ecosystems was laid on four future lakes potentially developing from the sea due to the land up-lift. Current sea sediments near Olkiluoto are future land areas, and thus very important. Spatially, the forest ecosystems of Olkiluoto are now most comprehensively covered, while the temporal coverage is highest in sea ecosystems. Lack of data is greatest in terrestrial fauna and sea sediments. During this work, the system boundaries were crossed and the use of data over disciplines was started. The data were mostly in agreement, but some discrepancies were detected. To solve these, and to supplement the existing data, some recommendations were given. (orig.)

  14. Description of nuclear properties

    International Nuclear Information System (INIS)

    Faessler, A.

    1991-01-01

    The lectures want to give a survey about new developments in the description of nuclei. In a first chapter we try to derive nuclear properties from the basis theory of quantum chromodynamics. This is not rigorously possible. There are still many cracks in the bridge between QCD and nuclear structure. The basic ingredient for nuclear structure calculations is the nucleon-nucleon interaction. We shall discuss the nucleon-nucleon interaction in a quark model. In a further chapter we discuss the way to come from a bare nucleon-nucleon interaction in free space to an effective nucleon-nucleon interaction in a limited model space for nuclear structure calculations. Such nuclear structure calculations can be done as shell model calculations. But they are due to the large number of configurations limited to light nuclei. We discuss possibilities (MONSTER and VAMPIR) to enlarge the model space for medium heavy and heavy nuclei. As the example of the low lying isovector 1 + states we discuss collective models (Bohr - Mottelson Model, interacting Boson Model) with proton and neutron degrees of freedom. The same states can also be described microscopically with the Quasi-Particle Random Phase Approximation (QRPA). We discuss the removal of spurious states in RPA. We also discuss the calculation of form factors and compare with inelastic electron scattering data. Finally we apply QRPA to the double-beta decay. Grand unified models predict, that the neutrino is identical with his antiparticle, that it has a finite mass and a weak right-handed interaction. If these properties are found the standard model of the strong and the electro-weak interaction can not be correct. Presently we can only derive from lower limits of the half lives of neutrinoless double-beta decays upper limits of the neutrino mass and of the right-handedness of the weak interaction and lower limits of the mass of the right handed heavy vector boson, if a specific grand unified model is given. (author)

  15. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    Directory of Open Access Journals (Sweden)

    Kartika Maharani

    2015-12-01

    Full Text Available Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP dan metastasis (TM menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek berusia 18-65 tahun yang didiagnosis TIP dan TM berdasarkan anamnesis, pemeriksaan fisik, CT scan atau MRI kepala, dan atau histopatologi. Terdapat 121 subjek, 79 TIP dan 27 TM; usia rerata TIP 43,7 tahun dan TM 50,9 tahun. Pada kelompok TM mayoritas (40,7% memiliki lesi di kedua hemisfer sedangkan TIP hanya di satu hemisfer. Lokasi tumor pada TM lebih dari 1 lobus (51,9%. Gangguan kognitif lebih banyak pada TM (81,5% dibandingkan TIK (52,5% dengan domain tersering gangguan visuospasial. Subjek TM mengalami gangguan kognitif lebih berat dibandingkan TIP (rerata MMSE 20,96 dan 22,61. Gangguan kognitif lebih banyak pada kelompok TM dibandingkan TIP dengan gangguan kognitif lebih berat karena mayoritas lesi tumor mengenai lebih dari 1 lobus. Kata kunci: gangguan kognitif, tumor intrakranial, neuro-onkologi.   Cognitve Impairment in Primary and Metastatic Brain Tumors Abstract Brain tumor patients are often accompanied by a wide range of cognitive impairment as a major cause of disablility. The different pathophysiology of primary and metastatic brain tumor influences patients’ clinical signs and symptoms, and also the severity of cognitive impairment. To determine the prevalence and profile of cognitive impairment in patients with primary and metastatic brain tumors, this cross-sectional study was done on subjects of 18 to 65 years old with the diagnosis of primary and metastatic brain tumors based on anamnesis, physical examination, imaging modalities, and

  16. Employing Picture Description to Assess the Students' Descriptive Paragraph Writing

    Directory of Open Access Journals (Sweden)

    Ida Ayu Mega Cahyani

    2018-03-01

    Full Text Available Writing is considered as an important skill in learning process which is needed to be mastered by the students. However, in teaching learning process at schools or universities, the assessment of writing skill is not becoming the focus of learning process and the assessment is administered inappropriately. In this present study, the researcher undertook the study which dealt with assessing descriptive paragraph writing ability of the students through picture description by employing an ex post facto as the research design. The present study was intended to answer the research problem dealing with the extent of the students’ achievement of descriptive paragraph writing ability which is assessed through picture description. The samples under the study were 40 students determined by means of random sampling technique with lottery system. The data were collected through administering picture description as the research instrument. The obtained data were analyzed by using norm-reference measure of five standard values. The results of the data analysis showed that there were 67.50% samples of the study were successful in writing descriptive paragraph, while there were 32.50% samples were unsuccessful in writing descriptive paragraph which was assessed by administering picture description test

  17. Evaluating primers for profiling anaerobic ammonia oxidizing bacteria within freshwater environments.

    Directory of Open Access Journals (Sweden)

    Puntipar Sonthiphand

    Full Text Available Anaerobic ammonia oxidizing (anammox bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library

  18. Policy stories

    DEFF Research Database (Denmark)

    Ren, Carina Bregnholm; Rasmussen, Rasmus Kjærgaard

    This article uses Arctic Winter 2016 as an exploration site of values and futures in Greenland. By taking a valuation approach where the creation and interpretation of event values are seen as an ongoing and taxing accomplishment, we firstly expand the understanding of events beyond their actual...... present three central policy stories from the field. The stories tell of how the event was first interested, then activated and finally evaluated. Besides adding a new understanding to policy-driven events as a locus of value creation, we also argue that the AWG 2016 offer speculative bets for new...... planning and execution and of event outcomes beyond the narrow confines of bed nights and legacies. Second, we introduce policies as an entry point to unlock discussions and manifestations of value and futures which connect to AWG. In order to exemplify the workings of the AWG event in these domains, we...

  19. No. 1669 French National Assembly, Constitution of the 4 october 1958 twelfth recorded legislature at the presidency of the French National Assembly the 11 june 2004. Law project modified by the Senate of energy policy, transmitted by the Primer Minister to the President of the French National Assembly. The Senate modified in first lecture, the law project adopted by the French National Assembly in first lecture after emergency declaration, about: see numbers: French National Assembly: 1586, 1597 and T.A. 302. Senate: 328, 330 and T.A. 93 (2003-2004)

    International Nuclear Information System (INIS)

    2004-01-01

    This law document of the french energy policy deals with the national energy strategy, the energy demand control, the renewable energies, the equilibrium and the quality of the electric power transport and distribution, fiscal measures. An appendix is devoted to the presentation of the government policy to implement its energy policy. (A.L.B.)

  20. Profil Rujukan Kasus Nonspesifik pada Fasilitas Kesehatan Tingkat Primer

    Directory of Open Access Journals (Sweden)

    Elda Nazriati

    2015-05-01

    arranged in primary healthcare facilities. In fact, there are many non-specialist cases referred to secondary health care facilities. This descriptive study using quantitative and qualitative method aimed to determine patterns and causes of non-specialist diseases referred to secondary primary health care in Pekanbaru City. Depiction of non-specialist disease cases was collected from data of the state health insurance scheme in Pekanbaru City on December 2014 - April 2015 period, meanwhile causes of referral were obtained from focus group discussion participated by 40 doctors based on types of primary healthcare facilities. This study showed 20 non-specialist cases oftenly referred including essential hypertension, mild myopia and diabetes mellitus. Causes of non-specialist disease referrals were code error as well as limited facilities, human resource, service management and competence of doctors. Such limitations need to be anticipated in order to minimalize act of referrals.

  1. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    Energy Technology Data Exchange (ETDEWEB)

    Lech, L.M. [DuPont, Parkersburg, WV (United States)

    1999-11-01

    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  2. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    Science.gov (United States)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  3. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    Science.gov (United States)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  4. The effect of various primers on shear bond strength of zirconia ceramic and resin composite.

    Science.gov (United States)

    Sanohkan, Sasiwimol; Kukiattrakoon, Boonlert; Larpboonphol, Narongrit; Sae-Yib, Taewalit; Jampa, Thibet; Manoppan, Satawat

    2013-11-01

    To determine the in vitro shear bond strengths (SBS) of zirconia ceramic to resin composite after various primer treatments. Forty zirconia ceramic (Zeno, Wieland Dental) specimens (10 mm in diameter and 2 mm thick) were prepared, sandblasted with 50 μm alumina, and divided into four groups (n = 10). Three experimental groups were surface treated with three primers; CP (RelyX Ceramic Primer, 3M ESPE), AP (Alloy Primer, Kuraray Medical), and MP (Monobond Plus, Ivoclar Vivadent AG). One group was not treated and served as the control. All specimens were bonded to a resin composite (Filtek Supreme XT, 3M ESPE) cylinder with an adhesive system (Adper Scotchbond Multi-Purpose Plus Adhesive, 3M ESPE) and then stored in 100% humidity at 37°C for 24 h before SBS testing in a universal testing machine. Mean SBS (MPa) were analyzed with one-way analysis of variance (ANOVA) and the Tukey's Honestly Significant Difference (HSD) test (α = 0.05). Group AP yielded the highest mean and standard deviation (SD) value of SBS (16.8 ± 2.5 MPa) and Group C presented the lowest mean and SD value (15.4 ± 1.6 MPa). The SBS did not differ significantly among the groups (P = 0.079). Within the limitations of this study, the SBS values between zirconia ceramic to resin composite using various primers and untreated surface were not significantly different.

  5. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  6. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Summary of the primer on tumor immunology and the biological therapy of cancer

    Directory of Open Access Journals (Sweden)

    Margolin Kim

    2009-01-01

    Full Text Available Abstract The International Society for Biological Therapy of Cancer (iSBTc is one of the "premier destinations for interaction and innovation in the cancer biologics community". It provides a primer course each year during the annual meeting to address the most important areas of tumor immunology and immunotherapy. The course has been given by prominent investigators in the area of interest, covering the core principles of cancer immunology and immunotherapy. The target audience for this program includes investigators from academic, regulatory, and biopharmaceutical venues. The program goal is to enable the attendees to learn the current status and the most recent advances in biologic therapies, and to leverage this knowledge towards the improvement of cancer therapy. The 2008 immunologic primer course was held on October 30 at the 23rd Annual meeting of iSBTc in San Diego, CA. Nine internationally renowned investigators gave excellent presentations on different topics. The topics covered in this primer included: (1 cytokines in cancer immunology; (2 anti-angiogenic therapy; (3 end stage: immune killing of tumors; (4 blocking T cell checkpoints; (5 approach to identification and therapeutic exploitation of tumor antigens; (6 T regulatory cells; (7 adoptive T cell therapy; (8 immune monitoring of cancer immunotherapy; and (9 immune adjuvants. We summarized the topics in this primer for public education. The related topic slides and schedule can be accessed online http://www.isbtc.org/meetings/am08/primer08.

  8. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  9. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  10. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  11. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    Directory of Open Access Journals (Sweden)

    Santoro Claudio

    2008-08-01

    Full Text Available Abstract Background Amplification and cloning of naïve T cell Receptor (TR repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  12. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    Science.gov (United States)

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  13. Population policy.

    Science.gov (United States)

    1987-03-01

    Participants in the Seminar on Population Policies for Top-level Policy Makers and Program Managers, meeting in Thailand during January 1987, examined the challenges now facing them regarding the implementation of fertility regulation programs in their respective countries -- Bangladesh, China, India, Indonesia, Malaysia, Nepal, Pakistan, the Philippines, the Republic of Korea, and Thailand. This Seminar was organized to coincide with the completion of an Economic and Social Commission for Asia and the Pacific (ESCAP) study investigating the impact and efficiency of family planning programs in the region. Country studies were reviewed at the Seminar along with policy issues about the status of women, incentive and disincentive programs, and socioeconomic factors affecting fertility. In Bangladesh the government recognizes population growth as its top priority problem related to the socioeconomic development of the country and is working to promote a reorientation strategy from the previous clinic-oriented to a multidimensional family welfare program. China's family planning program seeks to postpone marraige, space the births of children between 3-5 years, and promote the 1-child family. Its goal is to reduce the rate of natural increase from 12/1000 in 1978 to 5/1000 by 1985 and 0 by 2000. India's 7th Five-Year-Plan (1986-90) calls for establishing a 2-child family norm by 2000. In Indonesia the government's population policy includes reducing the rate of population growth, achieving a redistribution of the population, adjusting economic factors, and creating prosperous families. The government of Indonesia reversed its policy to reduce the population growth rate in 1984 and announced its goal of achieving a population of 70 million by 2100 in order to support mass consumption industries. It has created an income tax deduction system favoring large families and maternity benefits for women who have up to 5 children as incentives. Nepal's official policy is to

  14. Policy Reader

    International Nuclear Information System (INIS)

    1985-09-01

    This policy reader comprises: Correspondence; Memorandum of Understanding between the US Department of Transportation and the US Department of Energy for the Transportation of Radioactive Materials under the Nuclear Waste Policy Act; Internal Guidelines for Interactions with Communities and Local Governments; Statement by Ben C. Rusche before the Committee on Interior and Insular Affairs, Subcommittee on Energy and the Environment, US House of Representatives, September 13, 1985; Speech presented by Ben C. Rusche before the ANS/CNS/AESJ/ENS Topical Meeting, Pasco, Washington, September 24, 1985 - ''Status of the United States' High-Level Nuclear Waste Disposal Program''; and ''DOE Seeks Comments on Nuclear Transportation Planning,'' DOE News, September 30, 1985

  15. Language Policy

    DEFF Research Database (Denmark)

    Lauridsen, Karen M.

    2008-01-01

    Like any other text, instructive texts function within a given cultural and situational setting and may only be available in one language. However, the end users may not be familiar with that language and therefore unable to read and understand the instructions. This article therefore argues...... that instructive texts should always be available in a language that is understood by the end users, and that a corporate communication policy which includes a language policy should ensure that this is in fact the case for all instructive texts....

  16. Bajo peso al nacer, crecimiento y desarrollo en el primer año de vida

    Directory of Open Access Journals (Sweden)

    Elia Rosa Lemus Lago

    1997-04-01

    Full Text Available Se efectuó un estudio descriptivo, longitudinal y retrospectivo en el área de salud del Policlínico Docente "19 de Abril" con los niños nacidos con peso inferior a los 2 500 g, en el año 1994, y se siguió su evolución clínica durante el primer año de vida, que correspondió a una muestra de 23 infantes. Los datos fueron recogidos de las historias clínicas individuales de los niños y de la embarazada. Se analizaron los parámetros peso, talla, circunsferencia cefálica, valoración nutricional y desarrollo psicomotor. Predominó el bajo peso para la edad gestacional con un 65,2 y el 34,7 % correspondió a los nacidos antes del término de la gestación. El 100 % de los pretérmino al año de vida tuvieron una valoración nutricional normal. No se comportaron de igual forma los de bajo peso para la edad gestacional en los que el 20 % quedaron por debajo del 3er. percentil.A descriptive, longitudinal and retrospective study was conducted at the health area of the "19 de Abril" Teaching Polyclinic. 23 infants who were born in 1994 with a birth weight < 2 500 g were included in the sample. Their clinical evolution was followed during the first year of life. The data were obtained from the individual medical histories of the children and of the pregnant women. The following parameters were analyzed: weight, size, cephalic perimeter, nutritional assessment and psychomotor development. Low weight prevailed for the gestational age with 65.2 %, whereas 34.7 % corresponded to preterm deliveries. 100 % of the preterm infants had a normal nutritional assessment after the first year of life. However, 20 % of those with low weight at the gestational age remained under the third percentile.

  17. Etapa familiar que se inicia con el nacimiento del primer hijo

    Directory of Open Access Journals (Sweden)

    Clara Pérez Cárdenas

    2000-02-01

    Full Text Available Las etapas evolutivas de la familia como grupo, son un tema poco abordado en la literatura médica, de ahí que nos entusiasmara la idea de profundizar en aquella que se inicia con el nacimiento del primer hijo, por considerarla un período en la vida familiar y personal de muchas expectativas y tareas nuevas a afrontar. Con carácter descriptivo, longitudinal y retrospectivo evaluamos cuál es el conflicto fundamental que perciben los padres en esta etapa, sentimientos que genera el afrontar ese evento que la define y los intentos de solución, a los problemas de este período. Trabajamos con 2 grupos: 1 que tuviera a su descendiente matriculado en el Círculo Infantil, y otro con niños que se desarrollan únicamente en el ambiente familiar. Entre los resultados encontramos que además de ser hijos deseados, los padres refieren participación en la atención de éstos reconociéndose a la madre como figura fundamental en la toma de decisiones. La afectación económica es el conflicto principal percibido por ambos padres en los 2 grupos estudiados, no encontrándose diferencias importantes entre los 2 grupos de familias que participaron en el estudio, al menos en la mayoría de las variables exploradasAs the evolutive stages of the family as a group are little appoached by medical literature, we decided to deepen in that one that starts with the birth of the first child for considering it as a period of many expectations and new tasks to undertake in the family and personal life. A descriptive, longitudinal and retrospective evaluation of the fundamental conflict perceived by the parents in this stage, of the feelings resulting from facing that event that defines it and of the attempts to solve the problems arising during that period was made. We worked with 2 groups: one with the child enrolled in the day care center and the other with children that developed in the family environment only. Among the results, we found that besides being

  18. Temas de Física para Ingeniería: Primer principio de la termodinámica

    OpenAIRE

    Beléndez Vázquez, Augusto

    1992-01-01

    Acústica, fluidos y termodinámica: "Primer principio de la termodinámica". Objetivos y caracteres generales de la termodinámica. Conceptos fundamentales de la termodinámica. Capacidad calorífica, calor específico y calor latente. Trabajo. Primer principio de la termodinámica: energía interna. Algunas aplicaciones del primer principio.

  19. CEP energy policy : Policy 917

    International Nuclear Information System (INIS)

    2002-10-01

    Some of the environmental challenges facing the world in the twenty-first century are energy and global warming. Vital human needs such as warmth, light and transportation require energy, which is also required in the production of goods. Absent from the debate concerning the energy industry and its efforts to stop climate change is the voice of energy workers. Previous policies from the Communications, Energy and Paperworkers Union of Canada (CEP) were replaced by this policy document. After providing a brief introduction, the document tackled global challenge: climate change. The following section dealt with global challenge: corporate rule. Canada's energy industries were examined from the workers' perspective, and the state of Canada's energy reserves was discussed. From national policies to national betrayal was the title of the following section of the document. Energy de-regulation and privatization was discussed, and an argument was made for a Canadian energy policy. The industrial policy was explored, as was the environment. A transition to sustainability was examined. refs

  20. Employee assistance programs: a primer for buyer and seller.

    Science.gov (United States)

    Dixon, K

    1988-06-01

    A growing number of firms in private industry now sponsor or contract with groups of mental health professionals to provide employee assistance programs (EAPs). Factors that have influenced the increasing demand for EAPs include corporations' humanitarian concern for employees with mental health problems, a desire to contain rising health costs and reduce corporate losses, and the need for effective supervisory systems for managing troubled employees. To assist corporate consumers in judging the quality of EAP services and to guide mental health practitioners who wish to enter the EAP field, criteria are provided for evaluating the following aspects of EAP programs: policy development, employee orientation, supervisor training, availability during nonbusiness hours, assessment and diagnostic services, crisis counseling, referral, quality assurance, program evaluation, and cost.

  1. Dual descriptions of supersymmetry breaking

    International Nuclear Information System (INIS)

    Intrilligator, K.; Thomas, S.

    1996-08-01

    Dynamical supersymmetry breaking is considered in models which admit descriptions in terms of electric, confined, or magnetic degrees of freedom in various limits. In this way, a variety of seemingly different theories which break supersymmetry are actually interrelated by confinement or duality. Specific examples are given in which there are two dual descriptions of the supersymmetry breaking ground state

  2. Informed policies

    International Development Research Centre (IDRC) Digital Library (Canada)

    INTERNATIONAL DEVELOPMENT RESEARCH CENTRE. Informed ... more evidence-based policy on social ... Community involvement is key to the success of CBMS in reducing poverty. IDRC ... nationwide network of “telecentres” that ... and holidays for young people to use for ... National Conference on Youth led to the.

  3. Vaccination Policies

    NARCIS (Netherlands)

    Verweij, M.F.

    2013-01-01

    Vaccination involves priming the immune system with an antigenic agent that mimics a virus or bacterium, which results in immunity against the “real” microorganism. Collective vaccination policies have played an important role in the control of infectious disease worldwide. They can serve the

  4. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  5. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  6. Detection of gunshot primer residue on bone in an experimental setting-an unexpected finding.

    Science.gov (United States)

    Berryman, Hugh E; Kutyla, Alicja K; Russell Davis, J

    2010-03-01

    Pork ribs with intact muscle tissue were used in an experimental attempt to identify bullet wipe on bone at distances from 1 to 6 feet with 0.45 caliber, full metal jacket ammunition. This resulted in the unexpected finding of primer-derived gunshot residue (GSR) deep within the wound tract. Of significance is the fact that the GSR was deposited on the bone, under the periosteum, after the bullet passed through a Ziploc bag and c. 1 inch of muscle tissue. It is also important to note that the GSR persisted on the bone after the periosteum was forcibly removed. The presence of primer-derived GSR on bone provides the potential to differentiate gunshot trauma from blunt trauma when the bone presents an atypical gunshot wound. In this study, the presence of gunshot primer residue at a distance of 6 feet demonstrates the potential for establishing maximum gun-to-target distance for remote shootings.

  7. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae).

    Science.gov (United States)

    Glennon, Kelsey L; Cron, Glynis V

    2016-05-01

    Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species.

  8. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    Science.gov (United States)

    Glennon, Kelsey L.; Cron, Glynis V.

    2016-01-01

    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  9. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  10. La política ferroviaria del primer gobierno radical 1916-1922

    Directory of Open Access Journals (Sweden)

    MARIO JUSTO LÓPEZ

    2013-05-01

    Full Text Available El gobierno argentino adoptó a comienzos del siglo XX un modelo de explotación ferroviaria basado en la actuación de empresas extranjeras, que obtenían su capital en el mercado financiero y que, para ello, debían tener utilidades. Su actuación quedó sometida al control estatal que se ejerció a través de la Dirección General de Ferrocarriles. Con el triunfo electoral de la Unión Cívica Radical en las elecciones presidenciales de 1916 la situación no cambió. El primer presidente radical, Hipólito Yrigoyen, continuó con dicho modelo y en los años difíciles que siguieron a la Primera Guerra Mundial se preocupó en mantener las utilidades de las empresas dándoles sucesivos aumentos de tarifas. La Dirección General de Ferrocarriles continuó siendo el órgano específico de contralor pero ahora con menos autonomía respecto del Presidente de la Nación. El estudio detallado de lo hecho en estos años desmiente la creencia de que el presidente Yrigoyen fue contrario a las empresas ferroviarias extranjeras y llevó adelante acciones en su perjuicio. Abstract At the beginning of the XXth Century, the Argentine Government left the main sections of the railway system in the hands of foreign companies. Those companies managed to obtain their capital from the financial market under the condition of being profitable. All those companies were controlled by the National Railways Board. In 1916, when the Radical Civic Union won the presidential election, nothing changed. Even during the difficult years after the First World War, Hipólito Yrigoyen, the first Radical President allowed fares increases that kept the level of profitability. The National Railways Board went on with the surveillance of the foreign companies, but now under the direct power of the President. A careful study of the first Radical Government railway policy shows that the mythical idea about President Yrigoyen acting against foreign companies is not true.

  11. A comparative clinical study of the failure rate of orthodontic brackets bonded with two adhesive systems: conventional and self-etching primer (SEP

    Directory of Open Access Journals (Sweden)

    Gladys Cristina Dominguez

    2013-04-01

    Full Text Available OBJECTIVE: This study compared the clinical performance of orthodontic brackets bonded with Transbond adhesive paste after two priming systems: a two-stage conventional system (acid etching + Transbond XT adhesive primer and a singlestage self-etching primer (SEP (Transbond Plus. METHODS: The sample comprised 480 metal brackets bonded to the teeth of 24 consecutive patients treated for 36 to 48 months. A split-mouth design was used for bonding, and both systems were used in each patient. Bracket failure rates for each system were analyzed; and failure causes as reported by the patients and the quadrant of teeth for which brackets failed were recorded. RESULTS: The conventional system group had a failure rate of 5.41%, whereas the rate for SEP was 4.58%. In this group, there were 5 failures (38.4% in the right maxillary quadrant, 2 (15.4% in the left maxillary quadrant, 4 (30.8% in the right mandibular quadrant, and 2 (15.4% in the left mandibular quadrant. In the SEP group, there were 4 (36.4% failures in the right maxillary quadrant, 1 (9% in the left maxillary quadrant, 3 (27.3% in the right mandibular quadrant, and 3 (27.3% in the left mandibular quadrant. Results of descriptive statistical analysis and odds ratio did not show any significant differences between rates (p = 0.67. CONCLUSION: The clinical efficiency of SEP was similar to that of the conventional system.

  12. Transfer of primer binding site-mutated simian immunodeficiency virus vectors by genetically engineered artificial and hybrid tRNA-like primers

    DEFF Research Database (Denmark)

    Hansen, A C; Grunwald, T; Lund, Anders Henrik

    2001-01-01

    could be obtained by cotransfection of a gene for an engineered tRNA(Pro)-tRNA hybrid with a match to PBS-Pro. The importance of tRNA backbone identity was further analyzed by complementing the PBS-X2 vector with a gene for a matching x2 primer with a tRNA backbone, which led to three- to fourfold...

  13. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  14. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  15. Hubungan Stres dengan Kejadian Dismenore Primer pada Mahasiswi Pendidikan Dokter Fakultas Kedokteran Universitas Andalas

    Directory of Open Access Journals (Sweden)

    Diana Sari

    2015-05-01

    Full Text Available AbstrakDismenore primer merupakan nyeri menstruasi yang dijumpai tanpa kelainan yang nyata pada alat-alat genital. Lebih dari 50% wanita mengalami dismenore primer dan 15% diantaranya mengalami nyeri yang hebat.Tujuan penelitian ini adalah untuk menentukan hubungan tingkat stres dengan derajat dismenore primer. Penelitian dilakukan pada mahasiswi pendidikan dokter Fakultas Kedokteran Universitas Andalas angkatan 2009 dan 2010. Desain penelitian ini menggunakan cross sectional study dengan jumlah subjek 165 orang. Pengumpulan data dari responden dilakukan dengan wawancara terpimpin (pengisian kuesioner. Analisa statistik yang digunakan adalah uji chi-square dan uji koefisien korelasi sederhana. Uji chi-square menunjukan ada hubungan yang bermakna antara stres dengan kejadian dismenore primer dan uji statistik koefisien korelasi sederhana menunjukkan ada hubungan yang bermakna dengan korelasi agak lemah antara tingkat stres dengan derajat dismenore primer.Kata kunci: stres, dismenore primer, mahasiswi fakultas kedokteran AbstractPrimary dysmenorrhoea is menstrual pain founded without real abnormalities in genital organs. More than 50% woman experiance it and 15% had severe pain. The objective of this study was to determine relationship between stress and primary dysmenorrhoea. Research was executed to education medical female students medical faculty of Andalas University class of 2009 and 2010. This research use cross sectional study design with 165 subjects. Data was collected by guided interview. Statistic analysis use chi-square test and simple correlation test. Chi-square test show there is significant relationship between stress and primary dysmenorrhoea and simple coefficient test show there is weak correlation between stress levels and degree of primary dysmenorrhoea.Keywords: stress, primary dysmenorrhoea, female student of medical faculty

  16. Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia (DEVELOPMENt OF PRIMERS FOR REVERSE TRANSCRIPTASE POLYMERASE CHAIN REACTION TO DETECT AVIAN INFLUENZA VIRUS IN INDONESIA

    Directory of Open Access Journals (Sweden)

    Ni Luh Putu Indi Dharmayanti

    2016-07-01

    Full Text Available Until recently, two clades of of avian influenza viruses (AIVs designated as 2.3.2 and 2.2.3 havebeen circulating in Indonesia. Mutations of AIV genes have cretaed many more variants of the virus. It istherefore important to evaluate the appropriate methods used for the detection and diagnosis of AI virusin the field. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR have been used as a standardmethod for detection of AIV in many laboratories in Indonesia. The success of RT-PCR for detection ofAIV virus is dependent on the nucleotide sequences of primer that match with the circulating of AIVs. Theaims of this study was to develop RT-PCR by designing primers for H5 subtype specific to the circulatingAIVs in the field. The primers were designed using Primer Design software, and optimization andvalidation of the primer were conducted using AIVs that have been characterized in the previous study.The primers were then used RT-PCR using AIV isolates from field samples and their sensitivity andspecificity were then determined. The results showed that the H5 primers designed in this study, H5-IDand H5-NLP, was able to detect the AIVs in field samples better than the H5-specific primers have beenused previously. In conclusion, H5 primers designed based on recent viruses in the field showed betterresults in the detection of AI virus as compared to the previous primers. As AIV-H5N1 subtype in the fieldwill continue to change and evolve, the use of primers designed in this study is recommended for diagnosisof H5 AIV.

  17. Database Description - ConfC | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name ConfC Alternative name Database...amotsu Noguchi Tel: 042-495-8736 E-mail: Database classification Structure Database...s - Protein structure Structure Databases - Small molecules Structure Databases - Nucleic acid structure Database... services - Need for user registration - About This Database Database Description Download License Update History of This Database... Site Policy | Contact Us Database Description - ConfC | LSDB Archive ...

  18. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  19. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  20. Beneath sci-fi sound: primer, science fiction sound design, and American independent cinema

    OpenAIRE

    Johnston, Nessa

    2012-01-01

    Primer is a very low budget science-fiction film that deals with the subject of time travel; however, it looks and sounds quite distinctively different from other films associated with the genre. While Hollywood blockbuster sci-fi relies on “sound spectacle” as a key attraction, in contrast Primer sounds “lo-fi” and screen-centred, mixed to two channel stereo rather than the now industry-standard 5.1 surround sound. Although this is partly a consequence of the economics of its production, the...

  1. 15 CFR 200.115 - Description of services and list of fees, incorporation by reference.

    Science.gov (United States)

    2010-01-01

    ... COMMERCE MEASUREMENT SERVICES POLICIES, SERVICES, PROCEDURES, AND FEES § 200.115 Description of services.... Department of Commerce. (4) Federal Depository Libraries. (c) Revisions of SP 250 will be issued from time to... concerning policies, procedures, services, and fees may be obtained by writing the Office of Measurement...

  2. Security Issues for Mobile Medical Imaging: A Primer.

    Science.gov (United States)

    Choudhri, Asim F; Chatterjee, Arindam R; Javan, Ramin; Radvany, Martin G; Shih, George

    2015-10-01

    The end-user of mobile device apps in the practice of clinical radiology should be aware of security measures that prevent unauthorized use of the device, including passcode policies, methods for dealing with failed login attempts, network manager-controllable passcode enforcement, and passcode enforcement for the protection of the mobile device itself. Protection of patient data must be in place that complies with the Health Insurance Portability and Accountability Act and U.S. Federal Information Processing Standards. Device security measures for data protection include methods for locally stored data encryption, hardware encryption, and the ability to locally and remotely clear data from the device. As these devices transfer information over both local wireless networks and public cell phone networks, wireless network security protocols, including wired equivalent privacy and Wi-Fi protected access, are important components in the chain of security. Specific virtual private network protocols, Secure Sockets Layer and related protocols (especially in the setting of hypertext transfer protocols), native apps, virtual desktops, and nonmedical commercial off-the-shelf apps require consideration in the transmission of medical data over both private and public networks. Enterprise security and management of both personal and enterprise mobile devices are discussed. Finally, specific standards for hardware and software platform security, including prevention of hardware tampering, protection from malicious software, and application authentication methods, are vital components in establishing a secure platform for the use of mobile devices in the medical field. © RSNA, 2015.

  3. Energy and environment: a primer for scientists and engineers

    Energy Technology Data Exchange (ETDEWEB)

    Thorndike, E.H.

    1976-01-01

    The book is written for practicing scientists and engineers and for students to introduce them to the field of energy and the environment; it is concerned with energy and how it affects the Earth's environment and how it affects man. Natural processes (weather and climate and biological systems) and man-made energy processes (such as the generation and distribution of electricity) are discussed. Chapter titles following an introductory chapter are Global Energy Flows; Biological Energy and Ecosystems; Sources of Energy; The Technology of Energy Use; Energy-Related Environmental Problems with five parts (General Considerations, Thermal Pollution, Radioactivity, Air Pollution, and Other Energy-Related Environmental Problems); Energy Use--History and Projections; Energy Conservation and Growth Reduction; and Conclusions and Biased Opinions. Questions are posed at the end of each chapter. Appendixes are entitled: A Short Course in Thermodynamics; A Short Course in Nuclear Physics; Electromagnetic Radiation; Title I of the National Environmental Policy Act of 1969; Units, Conversion Factors, Physical Constants, and Useful Numerical Data; and Answers to Selected Problems. (MCW)

  4. Energy policy

    International Nuclear Information System (INIS)

    1992-09-01

    Gasoline consumption by passenger cars and light trucks is a major source of air pollution. It also adds to the economy's dependence on petroleum and vulnerability to oil price shocks. Despite these environmental and other costs, called external cost, the price of gasoline, adjusted for inflation, has generally been declining since 1985, encouraging increased consumption. This paper reports that with these concerns in mind, the Chairman, Subcommittee on Environment, House Committee on Science, Space, and Technology, requested that GAO assess policy options for addressing the external costs of gasoline consumption. To do this, GAO identified six major policy options and evaluated whether they addressed several relevant objectives, including economic growth, environmental quality, equity, petroleum conservation, visibility of costs, energy security, traffic congestion, competitiveness, and administrative feasibility

  5. Microbial proteomics: a mass spectrometry primer for biologists

    Directory of Open Access Journals (Sweden)

    Graham Ciaren

    2007-08-01

    Full Text Available Abstract It is now more than 10 years since the publication of the first microbial genome sequence and science is now moving towards a post genomic era with transcriptomics and proteomics offering insights into cellular processes and function. The ability to assess the entire protein network of a cell at a given spatial or temporal point will have a profound effect upon microbial science as the function of proteins is inextricably linked to phenotype. Whilst such a situation is still beyond current technologies rapid advances in mass spectrometry, bioinformatics and protein separation technologies have produced a step change in our current proteomic capabilities. Subsequently a small, but steadily growing, number of groups are taking advantage of this cutting edge technology to discover more about the physiology and metabolism of microorganisms. From this research it will be possible to move towards a systems biology understanding of a microorganism. Where upon researchers can build a comprehensive cellular map for each microorganism that links an accurately annotated genome sequence to gene expression data, at a transcriptomic and proteomic level. In order for microbiologists to embrace the potential that proteomics offers, an understanding of a variety of analytical tools is required. The aim of this review is to provide a basic overview of mass spectrometry (MS and its application to protein identification. In addition we will describe how the protein complexity of microbial samples can be reduced by gel-based and gel-free methodologies prior to analysis by MS. Finally in order to illustrate the power of microbial proteomics a case study of its current application within the Bacilliaceae is given together with a description of the emerging discipline of metaproteomics.

  6. Internet Policy

    Science.gov (United States)

    Lehr, William H.; Pupillo, Lorenzo Maria

    The Internet is now widely regarded as essential infrastructure for our global economy and society. It is in our homes and businesses. We use it to communicate and socialize, for research, and as a platform for E-commerce. In the late 1990s, much was predicted about what the Internet has become at present; but now, we have actual experience living with the Internet as a critical component of our everyday lives. Although the Internet has already had profound effects, there is much we have yet to realize. The present volume represents a third installment in a collaborative effort to highlight the all-encompassing, multidisciplinary implications of the Internet for public policy. The first installment was conceived in 1998, when we initiated plans to organize an international conference among academic, industry, and government officials to discuss the growing policy agenda posed by the Internet. The conference was hosted by the European Commission in Brussels in 1999 and brought together a diverse mix of perspectives on what the pressing policy issues would be confronting the Internet. All of the concerns identified remain with us today, including how to address the Digital Divide, how to modify intellectual property laws to accommodate the new realities of the Internet, what to do about Internet governance and name-space management, and how to evolve broadcast and telecommunications regulatory frameworks for a converged world.

  7. Understanding health policy leaders' training needs.

    Directory of Open Access Journals (Sweden)

    Carey Roth Bayer

    Full Text Available We assessed the training needs of health policy leaders and practitioners across career stages; identified areas of core content for health policy training programs; and, identified training modalities for health policy leaders.We convened a focus group of health policy leaders at varying career stages to inform the development of the Health Policy Leaders' Training Needs Assessment tool. We piloted and distributed the tool electronically. We used descriptive statistics and thematic coding for analysis.Seventy participants varying in age and stage of career completed the tool. "Cost implications of health policies" ranked highest for personal knowledge development and "intersection of policy and politics" ranked highest for health policy leaders in general. "Effective communication skills" ranked as the highest skill element and "integrity" as the highest attribute element. Format for training varied based on age and career stage.This study highlighted the training needs of health policy leaders personally as well as their perceptions of the needs for training health policy leaders in general. The findings are applicable for current health policy leadership training programs as well as those in development.

  8. A Primer on Recent Canadian Defence Budgeting Trends and Implications

    Directory of Open Access Journals (Sweden)

    David Perry

    2015-04-01

    Full Text Available Faced with a dangerous world, the federal government has made recapitalizing and updating Canada’s armed forces a priority. Unfortunately, fiscal pressures obliged the government to deviate from its Canada First Defence Strategy, cutting staff and delaying military hardware acquisitions. However, the introduction this year of the Defence Procurement Strategy should allow Ottawa to use improved approaches to buy equipment that would otherwise have been purchased already under the DND’s opaque capital expenditure system. At present, DND capital funds are mostly subject to accrual accounting. Capital costs are charged against the defence budget as annual amortization expenses over equipment lifecycles. While this enables multiple capital projects to go ahead simultaneously, not all of the money covering capital costs is treated this way. Traditional A-Base Vote 5 expenses are still charged to the budget the year the expenditure is made — and the DND consistently underspends the Vote 5 funds available by as much as 28 percent. Since 2007/8, an estimated $6.42 billion wasn’t used as intended. While some of this can be carried forward, there are limits. Leftover funds exceeding them are returned to the Treasury and are thereby lost. It’s up to the DND to make up losses out of future funding. Just as bad, the accrual method doesn’t fully account for inflation, so when schedules slip, project purchasing power diminishes by hundreds of millions of dollars. Ambitious initiatives like the Joint Support Ship and (likely the Canadian Surface Combatant end up taking hits to reflect harsh budgetary realities; the capabilities of Canada’s soldiers suffer. This policy brief draws on research and confidential interviews to highlight the pressing need for reform in Canadian defence procurement.

  9. Health Topic XML File Description

    Science.gov (United States)

    ... this page: https://medlineplus.gov/xmldescription.html Health Topic XML File Description: MedlinePlus To use the sharing ... information categories assigned. Example of a Full Health Topic Record A record for a MedlinePlus health topic ...

  10. Forced selection of a human immunodeficiency virus type 1 variant that uses a non-self tRNA primer for reverse transcription: Involvement of viral RNA sequences and the reverse transcriptase enzyme

    NARCIS (Netherlands)

    Abbink, Truus E. M.; Beerens, Nancy; Berkhout, Ben

    2004-01-01

    Human immunodeficiency virus type 1 uses the tRNA(3)(Lys) molecule as a selective primer for reverse transcription. This primer specificity is imposed by sequence complementarity between the tRNA primer and two motifs in the viral RNA genome: the primer-binding site (PBS) and the primer activation

  11. Microsatellite Primers for Parkia biglobosa (Fabaceae: Mimosoideae) Reveal that a Single Plant Sires All Seeds Per Pod

    DEFF Research Database (Denmark)

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa

    2014-01-01

    Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod.  Methods and Results: Microsatellite loci were enriched...

  12. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  13. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    Directory of Open Access Journals (Sweden)

    S Hamid Raji

    2011-01-01

    Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel.

  14. Marketing policy of different forms of small business in agriculture

    OpenAIRE

    JAVORSKA T.I.

    2011-01-01

    Essence and features of the agricultural marketing is considered. The conducted description of elements of marketing and instruments of marketing policy is in activity of subjects of small business in agriculture.

  15. Hemorragias obstétricas en el primer y segundo trimestre del embarazo

    OpenAIRE

    García Rodríguez, Blanca

    2013-01-01

    Se aborda el tema de las hemorragias obstétricas en el primer y segundo trimestre del embarazo. Diagnóstico precoz de las mismas, la identificación de factores de riesgo, las causas y el tratamiento terapéutico

  16. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  17. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  18. A primer on polymer nomenclature: Structure-based, sourced-based and trade names

    Science.gov (United States)

    Polymer nomenclature is important because it is part of the language of polymer science and is needed for polymer identification, reference, and documentation. A primer on polymer nomenclature is provided herein for people new to the field or for instructional use. Both structure-based and source-...

  19. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... We chose 37 genomic sequences that had high number of di, tri and tetra SSR motifs from ... primers failed to produce any amplification products and ... Sericulture is a cottage industry that employs 8.03 million people across ... The resolving power of the SSR markers ranged from 0.11 (MulSatG100717) to.

  20. Screening for residual disease in pediatric burkitt lymphoma using consensus primer pools.

    Science.gov (United States)

    Agsalda, Melissa; Kusao, Ian; Troelstrup, David; Shiramizu, Bruce

    2009-01-01

    Assessing molecular persistent or minimal residual disease (PD/MRD) in childhood Burkitt lymphoma (BL) is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs). Because BL is characterized by rearranged immunoglobulin heavy chain (IgV(H)) genes, IgV(H) primer pools from IgV(H1)-IgV(H7) regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgV(H) primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgV(H) primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  1. Primer registro de Serratospiculum tendo (Nematoda: Diplotriaenidae para el Perú

    Directory of Open Access Journals (Sweden)

    Luis A. Gomez-Puerta

    2014-05-01

    Full Text Available Reportamos por primera vez la presencia del nematodo, Serratospiculum tendo Nitzsch, 1819, parasitando los sacos aéreos de un halcón peregrino (Falco peregrinus Tunstall, 1771. Seis nematodos (2 machos y 4 hembras fueron colectados e identificados como S. tendo. El hallazgo de este nematodo constituye el primer registro en el Perú.

  2. Towards a global antibiotic resistance surveillance system : a primer for a roadmap

    NARCIS (Netherlands)

    Grundmann, Hajo

    The need for global data about the scale of antibiotic resistance (ABR) in a geographical explicit and timely manner has been identified by many stakeholders, including the World Health Organization. This primer should help defining the objectives, scale, scope, and structure of possible future

  3. Targeted reduction of highly abundant transcripts using pseudo-random primers.

    Science.gov (United States)

    Arnaud, Ophélie; Kato, Sachi; Poulain, Stéphane; Plessy, Charles

    2016-04-01

    Transcriptome studies based on quantitative sequencing can estimate levels of gene expression by measuring target RNA abundance in sequencing libraries. Sequencing costs are proportional to the total number of sequenced reads, and in order to cover rare RNAs, considerable quantities of abundant and identical reads are needed. This major limitation can be addressed by depleting a proportion of the most abundant sequences from the library. However, such depletion strategies involve either extra handling of the input RNA sample or use of a large number of reverse transcription primers, termed not-so-random (NSR) primers, which are costly to synthesize. Taking advantage of the high tolerance of reverse transcriptase to mis-prime, we found that it is possible to use as few as 40 pseudo-random (PS) reverse transcription primers to decrease the rate of undesirable abundant sequences within a library without affecting the overall transcriptome diversity. PS primers are simple to design and can be used to deplete several undesirable RNAs simultaneously, thus creating a flexible tool for enriching transcriptome libraries for rare transcript sequences.

  4. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  5. What Are the Odds of that? A Primer on Understanding Logistic Regression

    Science.gov (United States)

    Huang, Francis L.; Moon, Tonya R.

    2013-01-01

    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  6. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    Science.gov (United States)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  7. A web-based adaptive tutor to teach PCR primer design

    NARCIS (Netherlands)

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  8. A Web-based Adaptive Tutor to Teach PCR Primer Design

    NARCIS (Netherlands)

    Seters, van J.R.; Wellink, J.; Tramper, J.; Goedhart, M.J.; Ossevoort, M.A.

    2012-01-01

    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used

  9. Primer on theory and operation of linear accelerators in radiation therapy

    International Nuclear Information System (INIS)

    Karzmark, C.J.; Morton, R.J.

    1981-12-01

    This primer is part of an educational package that also includes a series of 3 videotapes entitled Theory and Operation of Linear Accelerators in Radiation Therapy, Parts I, II, and III. This publication provides an overview of the components of the linear accelerator and how they function and interrelate. The auxiliary systems necessary to maintain the operation of the linear accelerator are also described

  10. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    Science.gov (United States)

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  11. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  12. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  13. Screening for Residual Disease in Pediatric Burkitt Lymphoma Using Consensus Primer Pools

    Directory of Open Access Journals (Sweden)

    Melissa Agsalda

    2009-01-01

    Full Text Available Assessing molecular persistent or minimal residual disease (PD/MRD in childhood Burkitt lymphoma (BL is challenging because access to original tumor is usually needed to design patient-specific primers (PSPs. Because BL is characterized by rearranged immunoglobulin heavy chain (IgVH genes, IgVH primer pools from IgVH1–IgVH7 regions were tested to detect PD/MRD, thus eliminating the need for original tumor. The focus of the current study was to assess the feasibility of using IgVH primer pools to detect disease in clinical specimens. Fourteen children diagnosed with B-NHL had follow-up repository specimens available to assess PD/MRD. Of the 14 patients, 12 were PD/MRD negative after 2 months of therapy and remained in remission at the end of therapy; 2/14 patients were PD/MRD positive at 2-3 months and later relapsed. PSP-based assays from these 14 patients showed 100% concordance with the current assay. This feasibility study warrants further investigation to assess PD/MRD using IgVH primer pools, which could have clinical significance as a real-time assessment tool to monitor pediatric BL and possibly other B-cell non-Hodgkin lymphoma therapy.

  14. Magnesium-Based Sacrificial Anode Cathodic Protection Coatings (Mg-Rich Primers for Aluminum Alloys

    Directory of Open Access Journals (Sweden)

    Michael D. Blanton

    2012-09-01

    Full Text Available Magnesium is electrochemically the most active metal employed in common structural alloys of iron and aluminum. Mg is widely used as a sacrificial anode to provide cathodic protection of underground and undersea metallic structures, ships, submarines, bridges, decks, aircraft and ground transportation systems. Following the same principle of utilizing Mg characteristics in engineering advantages in a decade-long successful R&D effort, Mg powder is now employed in organic coatings (termed as Mg-rich primers as a sacrificial anode pigment to protect aerospace grade aluminum alloys against corrosion. Mg-rich primers have performed very well on aluminum alloys when compared against the current chromate standard, but the carcinogenic chromate-based coatings/pretreatments are being widely used by the Department of Defense (DoD to protect its infrastructure and fleets against corrosion damage. Factors such as reactivity of Mg particles in the coating matrix during exposure to aggressive corrosion environments, interaction of atmospheric gases with Mg particles and the impact of Mg dissolution, increases in pH and hydrogen gas liberation at coating-metal interface, and primer adhesion need to be considered for further development of Mg-rich primer technology.

  15. Optimisation of the PCR-invA primers for the detection of Salmonella ...

    African Journals Online (AJOL)

    A polymerase chain reaction (PCR)-based method for the detection of Salmonella species in water samples was optimised and evaluated for speed, specificity and sensitivity. Optimisation of Mg2+ and primer concentrations and cycling parameters increased the sensitivity and limit of detection of PCR to 2.6 x 104 cfu/m.

  16. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  17. Detection of three porcine vesicular viruses using multiplex real-time primer-probe energy transfer

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; Aguero, M.

    2006-01-01

    Rapid identification of the etiologic agent in infected animals is important for the control of an outbreak of vesicular disease in livestock. We have in the present study developed a multiplex real-time reverse transcription-PCR, based on primer-probe energy transfer (PriProET), for simultaneous...

  18. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  19. Improvement of fragment and primer selection for mutation detection by denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Wu, Y; Hayes, VM; Osinga, J; Mulder, IM; Looman, MWG; Buys, CHCM; Hofstra, RMW

    1998-01-01

    Denaturing gradient gel electrophoresis (DGGE) is one of the most powerful methods for mutation detection currently available. For successful application the appropriate selection of PCR fragments and PCR primers is crucial. The sequence of interest should always be within the domain with the lowest

  20. The astrobiology primer: an outline of general knowledge--version 1, 2006.

    Science.gov (United States)

    Billings, L; Cameron, V; Claire, M; Dick, G J; Domagal-Goldman, S D; Javaux, E J; Johnson, O J; Laws, C; Race, M S; Rask, J; Rummel, J D; Schelble, R T; Vance, S

    2006-10-01

    The Astrobiology Primer has been created as a reference tool for those who are interested in the interdisciplinary field of astrobiology. The field incorporates many diverse research endeavors, but it is our hope that this slim volume will present the reader with all he or she needs to know to become involved and to understand, at least at a fundamental level, the state of the art. Each section includes a brief overview of a topic and a short list of readable and important literature for those interested in deeper knowledge. Because of the great diversity of material, each section was written by a different author with a different expertise. Contributors, authors, and editors are listed at the beginning, along with a list of those chapters and sections for which they were responsible. We are deeply indebted to the NASA Astrobiology Institute (NAI), in particular to Estelle Dodson, David Morrison, Ed Goolish, Krisstina Wilmoth, and Rose Grymes for their continued enthusiasm and support. The Primer came about in large part because of NAI support for graduate student research, collaboration, and inclusion as well as direct funding. We have entitled the Primer version 1 in hope that it will be only the first in a series, whose future volumes will be produced every 3-5 years. This way we can insure that the Primer keeps up with the current state of research. We hope that it will be a great resource for anyone trying to stay abreast of an ever-changing field.

  1. POPULATION POLICY OR SOCIAL POLICY?

    Directory of Open Access Journals (Sweden)

    ANDREI STANOIU

    2011-04-01

    Full Text Available After 1989, the demographic situation of Romania population experienced a dramatic, very concerning and dangerous evolution trend. One of the first measures of the new political power was to abolish the very restrictive, anti-human and abusive legal regulation adopted in 1966 by the communist regime concerning abortion and the whole old demographic policy. As a result of this measure and of the worsening economic and social situation of the great majority of Romanian population, the birth rate declined sharply and, from 1992, the natural demographic growth rate became a negative one. The absolute number of Romanian population decreased more and more and, if nothing changes, in the next few decades it will be no bigger than 15 million people. At the same time, the process of demographic ageing of population will accentuate, generating serious problems from demographic and social-economic point of view, Taking into account the present demographic situation and, especially, the foreseen trend of evolution, it is more than clear that there should be taken some urgent, coherent and consistent measures in order to stop this dangerous demographic evolution, until it is not too late, and to avoid, as much as possible, a potential demographic disaster. The problem is: what kind of measures should be taken and what kind of policy should be adopted? Some social scientists believe that a new population policy should be adopted; some others believe that rather a social policy should be adopted. The purpose of my paper is to analyze this different opinions and to show that, behind the dispute on the terminology, should be taken consistent measures, at governmental level, in order to assure a substantial improvement of demographic situation, not only from a quantitative, but from a qualitative point of view as well, and to identify some of these kind of measures.

  2. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  3. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  4. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  5. In vivo effect of a self-etching primer on dentin.

    Science.gov (United States)

    Milia, E; Lallai, M R; García-Godoy, F

    1999-08-01

    To determine the ultrastructural aspects of the dentin collagen area in the cavity preparation floor produced in vivo after phosphoric acid acid-etching or after using Clearfil Liner Bond 2 self-etching primer (LB2 Primer). Twenty-four non-carious third molars scheduled for extraction from young adult patients (16-30 years old) were used. Conventional Class I cavities (+/- 2 mm deep) were prepared on the occlusal surfaces of all teeth using a cylindrical diamond bur on a high-speed handpiece with copious water spray. To avoid dehydration of the dentin, the smear layer-covered dentin was briefly air-dried for 2 seconds. Cavities were assigned at random to the following groups: Group A: Dentin etched for 15 seconds with 34% phosphoric acid, rinsed for 20 seconds and then briefly air-dried for 2 seconds with oil-free compressed air leaving the surfaces slightly moist. Group B: LB2 Primer was applied to the cavity surfaces for 30 seconds and then briefly air-dried to remove the solvent. Group C: The untreated dentin smear layer was used as a control. In all three groups, the cavities were filled incrementally with a resin-based composite (APX), light curing every increment for 40 seconds. After 30 minutes, the teeth were extracted atraumatically and the samples immediately prepared for evaluation with the transmission electron microscope. The use of a self-etching primer did not produce significant morphological changes in the moist dentin substrate. Adverse morphological conditions where observed when there was an excess water on the dentin surface. Phosphoric acid altered the collagen more severely than the self-etching primer.

  6. Legitimizing policies

    DEFF Research Database (Denmark)

    Jørgensen, Martin Bak

    2012-01-01

    The focus of this article is on representations of irregular migration in a Scandinavian context and how irregular migrants are constructed as a target group. A common feature in many (Western-)European states is the difficult attempt to navigate between an urge for control and respecting......, upholding and promoting humanitarian aspects of migration management. Legitimizing policies therefore become extremely important as governments have to appease national voters to remain in power and have to respect European regulations and international conventions. Doing so raises questions of social...

  7. OWNERSHIP POLICY

    Directory of Open Access Journals (Sweden)

    V. Branovitskiy

    2018-01-01

    Full Text Available The article examines the ownership policy in Ukraine. It makes a survey of the following: the current situation at state-run enterprises and their efficiency; the key criteria of the classification of state-run enterprises for the privatization for the period of 2017-2020. The article evaluates the institutional changes coming from a new law on the privatization of state-owned property in Ukraine. It reveals the stages of making the ownership policy as a state strategy. It describes the measures meant to raise efficiency in the area of the public property management. The article assesses the state of play of the stock market in Ukraine as a mechanism to attract money to the real economy. It recommends attracting foreign investment to the public sector of economy following the restructuring process via IPO or sale to a strategic investor (Private equity. It considers the positive aspects in the completion of active privatization and the scope of the main privatization risks.

  8. Schrodinger's scat: a critical review of the currently available tiger (Panthera Tigris) and leopard (Panthera pardus) specific primers in India, and a novel leopard specific primer.

    Science.gov (United States)

    Maroju, Pranay Amruth; Yadav, Sonu; Kolipakam, Vishnupriya; Singh, Shweta; Qureshi, Qamar; Jhala, Yadvendradev

    2016-02-09

    Non-invasive sampling has opened avenues for the genetic study of elusive species, which has contributed significantly to their conservation. Where field based identity of non-invasive sample is ambiguous (e.g. carnivore scats), it is essential to establish identity of the species through molecular approaches. A cost effective procedure to ascertain species identity is to use species specific primers (SSP) for PCR amplification and subsequent resolution through agarose gel electrophoresis. However, SSPs if ill designed can often cross amplify non-target sympatric species. Herein we report the problem of cross amplification with currently published SSPs, which have been used in several recent scientific articles on tigers (Panthera tigris) and leopards (Panthera pardus) in India. Since these papers form pioneering research on which future work will be based, an early rectification is required so as to not propagate this error further. We conclusively show cross amplification of three of the four SSPs, in sympatric non-target species like tiger SSP amplifying leopard and striped hyena (Hyaena hyaena), and leopard SSP amplifying tiger, lion (Panthera leo persica) and clouded leopard (Neofelis nebulosa), with the same product size. We develop and test a non-cross-amplifying leopard specific primer pair within the mitochondrial cytochrome b region. We also standardize a duplex PCR method to screen tiger and leopard samples simultaneously in one PCR reaction to reduce cost and time. These findings suggest the importance of an often overlooked preliminary protocol of conclusive identification of species from non-invasive samples. The cross amplification of published primers in conspecifics suggests the need to revisit inferences drawn by earlier work.

  9. Policies and interventions on employment relations and health inequalities.

    Science.gov (United States)

    Quinlan, Michael; Muntaner, Carles; Solar, Orielle; Vergara, Montserrat; Eijkemans, Gerry; Santana, Vilma; Chung, Haejoo; Castedo, Antía; Benach, Joan

    2010-01-01

    The association between certain increasingly pervasive employment conditions and serious health inequalities presents a significant policy challenge. A critical starting point is the recognition that these problems have not arisen in a policy vacuum. Rather, policy frameworks implemented by governments over the past 35 years, in conjunction with corporate globalization (itself facilitated by neoliberal policies), have undermined preexisting social protection policies and encouraged the growth of health-damaging forms of work organization. After a brief description of the context in which recent developments should be viewed, this article describes how policies can be reconfigured to address health-damaging employment conditions. A number of key policy objectives and entry points are identified, with a summary of policies for each entry point, relating to particular employment conditions relevant to rich and poor countries. Rather than trying to elaborate these policy interventions in detail, the authors point to several critical issues in relation to these interventions, linking these to illustrative examples.

  10. Standarized input for Hanford environmental impact statements. Part II: site description

    International Nuclear Information System (INIS)

    Jamison, J.D.

    1982-07-01

    Information is presented under the following section headings: summary description; location and physiography; geology; seismology; hydrology; meteorology; ecology; demography and land use; and radiological condition. Five appendixes are included on the 100N, 200 east, 200 west, 300, and 400 areas. This report is intended to provide a description of the Hanford Site against which the environmental impacts of new projects at Hanford can be assessed. It is expected that the summary description amplified with material from the appropriate appendix, will serve as the basic site description section of environmental impact statements prepared to address the requirements of the National Environmental Policy Act

  11. Standarized input for Hanford environmental impact statements. Part II: site description

    Energy Technology Data Exchange (ETDEWEB)

    Jamison, J.D.

    1982-07-01

    Information is presented under the following section headings: summary description; location and physiography; geology; seismology; hydrology; meteorology; ecology; demography and land use; and radiological condition. Five appendixes are included on the 100N, 200 east, 200 west, 300, and 400 areas. This report is intended to provide a description of the Hanford Site against which the environmental impacts of new projects at Hanford can be assessed. It is expected that the summary description amplified with material from the appropriate appendix, will serve as the basic site description section of environmental impact statements prepared to address the requirements of the National Environmental Policy Act (NEPA).

  12. Database Description - AcEST | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name AcEST Alternative n...hi, Tokyo-to 192-0397 Tel: +81-42-677-1111(ext.3654) E-mail: Database classificat...eneris Taxonomy ID: 13818 Database description This is a database of EST sequences of Adiantum capillus-vene...(3): 223-227. External Links: Original website information Database maintenance site Plant Environmental Res...base Database Description Download License Update History of This Database Site Policy | Contact Us Database Description - AcEST | LSDB Archive ...

  13. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  14. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    Science.gov (United States)

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  15. Policy Actors: Doing Policy Work in Schools

    Science.gov (United States)

    Ball, Stephen J.; Maguire, Meg; Braun, Annette; Hoskins, Kate

    2011-01-01

    This paper considers the "policy work" of teacher actors in schools. It focuses on the "problem of meaning" and offers a typology of roles and positions through which teachers engage with policy and with which policies get "enacted". It argues that "policy work" is made up of a set of complex and…

  16. Trade Union Participation in University Research Policies.

    Science.gov (United States)

    Leydesdorff, Loet

    1984-01-01

    The recent development of Dutch research coordination agencies, the Science Shops, forms the context for a description of the relationship between university research and policy at Amsterdam University and the national trade union organization. Management tools such as project financing and other elements of this system are discussed. (MSE)

  17. CANISTER HANDLING FACILITY DESCRIPTION DOCUMENT

    Energy Technology Data Exchange (ETDEWEB)

    J.F. Beesley

    2005-04-21

    The purpose of this facility description document (FDD) is to establish requirements and associated bases that drive the design of the Canister Handling Facility (CHF), which will allow the design effort to proceed to license application. This FDD will be revised at strategic points as the design matures. This FDD identifies the requirements and describes the facility design, as it currently exists, with emphasis on attributes of the design provided to meet the requirements. This FDD is an engineering tool for design control; accordingly, the primary audience and users are design engineers. This FDD is part of an iterative design process. It leads the design process with regard to the flowdown of upper tier requirements onto the facility. Knowledge of these requirements is essential in performing the design process. The FDD follows the design with regard to the description of the facility. The description provided in this FDD reflects the current results of the design process.

  18. CANISTER HANDLING FACILITY DESCRIPTION DOCUMENT

    International Nuclear Information System (INIS)

    Beesley. J.F.

    2005-01-01

    The purpose of this facility description document (FDD) is to establish requirements and associated bases that drive the design of the Canister Handling Facility (CHF), which will allow the design effort to proceed to license application. This FDD will be revised at strategic points as the design matures. This FDD identifies the requirements and describes the facility design, as it currently exists, with emphasis on attributes of the design provided to meet the requirements. This FDD is an engineering tool for design control; accordingly, the primary audience and users are design engineers. This FDD is part of an iterative design process. It leads the design process with regard to the flowdown of upper tier requirements onto the facility. Knowledge of these requirements is essential in performing the design process. The FDD follows the design with regard to the description of the facility. The description provided in this FDD reflects the current results of the design process

  19. Fuel Handling Facility Description Document

    International Nuclear Information System (INIS)

    M.A. LaFountain

    2005-01-01

    The purpose of the facility description document (FDD) is to establish the requirements and their bases that drive the design of the Fuel Handling Facility (FHF) to allow the design effort to proceed to license application. This FDD is a living document that will be revised at strategic points as the design matures. It identifies the requirements and describes the facility design as it currently exists, with emphasis on design attributes provided to meet the requirements. This FDD was developed as an engineering tool for design control. Accordingly, the primary audience and users are design engineers. It leads the design process with regard to the flow down of upper tier requirements onto the facility. Knowledge of these requirements is essential to performing the design process. It trails the design with regard to the description of the facility. This description is a reflection of the results of the design process to date

  20. Primer on Use of Multi-Spectral and Infra Red Imaging for On-Site Inspections

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, J R

    2010-10-26

    The purpose of an On-Site Inspection (OSI) is to determine whether a nuclear explosion has occurred in violation of the Comprehensive Nuclear Test Ban Treaty (CTBT), and to gather information which might assist in identifying the violator (CTBT, Article IV, Paragraph 35) Multi-Spectral and Infra Red Imaging (MSIR) is allowed by the treaty to detect observables which might help reduce the search area and thus expedite an OSI and make it more effective. MSIR is permitted from airborne measurements, and at and below the surface to search for anomalies and artifacts (CTBT, Protocol, Part II, Paragraph 69b). The three broad types of anomalies and artifacts MSIR is expected to be capable of observing are surface disturbances (disturbed earth, plant stress or anomalous surface materials), human artifacts (man-made roads, buildings and features), and thermal anomalies. The purpose of this Primer is to provide technical information on MSIR relevant to its use for OSI. It is expected that this information may be used for general background information, to inform decisions about the selection and testing of MSIR equipment, to develop operational guidance for MSIR use during an OSI, and to support the development of a training program for OSI Inspectors. References are provided so readers can pursue a topic in more detail than the summary information provided here. The following chapters will provide more information on how MSIR can support an OSI (Section 2), a short summary what Multi-Spectral Imaging and Infra Red Imaging is (Section 3), guidance from the CTBT regarding the use of MSIR (Section 4), and a description of several nuclear explosion scenarios (Section 5) and consequent observables (Section 6). The remaining sections focus on practical aspects of using MSIR for an OSI, such as specification and selection of MSIR equipment, operational considerations for deployment of MISR equipment from an aircraft, and the conduct of field exercises to mature MSIR for an OSI

  1. Nuclear policy

    International Nuclear Information System (INIS)

    Ford, G.R.

    1976-01-01

    Then-President Gerald Ford outlines the potential benefits of nuclear power as opposed to the danger of proliferation. He points out that not all nations have the same interest or views toward nuclear energy; but also he says that if a choice must be made, nonproliferation objectives must take precedence over economic and energy benefits. It is pointed out that the management of nuclear energy can be only partial and temporary by technical measures, and that full management can result only if nations realistically face the task prepared to forego preconceived short-term advantages in favor of long-term gains. Coordination of the policies of all nations toward the common goal of nonproliferation is predicted to lead to success

  2. indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.

    Science.gov (United States)

    Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J

    2017-01-01

    Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.

  3. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  4. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Copyright Policy and Practice in Electronic Reserves among ARL Libraries

    Science.gov (United States)

    Hansen, David R.; Cross, William M.; Edwards, Phillip M.

    2013-01-01

    This paper presents the results of a survey of 110 ARL institutions regarding their copyright policies for providing electronic reserves. It compiles descriptive statistics on library practice as well as coding responses to reveal trends and shared practices. Finally, it presents conclusions about policy making, decision making and risk aversion…

  6. Emended description of Pasteuria nishizawae.

    Science.gov (United States)

    Noel, Gregory R; Atibalentja, N; Domier, Leslie L

    2005-07-01

    The description of the Gram-positive, obligately parasitic, mycelial and endospore-forming bacterium, Pasteuria nishizawae, is emended to include additional observations on the life cycle, host specificity and endospore morphology. The nucleotide sequence of the 16S rRNA gene is also provided.

  7. Manufacturer Usage Description Specification Implementation

    OpenAIRE

    Srinivasan, Kaushik

    2017-01-01

    Manufacturer Usage Description Specification (MUDS) is aframework under RFC development that aims to automate Internet access control rules for IoT devices . These access controls prevent malicious IoT devices from attacking other devices and also protect the IoT devices from being attacked by other devices.We are implementing this framework and trying to improve its security.

  8. Epsilon. A System Description Language

    DEFF Research Database (Denmark)

    Jensen, Kurt; Kyng, Morten

    This paper discusses the use of Petri nets as a semantic tool in the design of languages and in the construction and analysis of system descriptions. The topics treated are: -- Languages based on nets. -- The problem of time in nets. -- Nets and related models. -- Nets and formal semantics...

  9. Microscopic description of nuclear reactions

    International Nuclear Information System (INIS)

    Gorbatov, A.M.

    1992-01-01

    The genealogical series method has been extended to the continuous spectrum of the many-body systems. New nonlinear integral equations have been formulated to perform the microscopical description of the nuclear reactions with arbitrary number of particles. The way to solve them numerically is demonstrated

  10. Improving Published Descriptions of Germplasm.

    Science.gov (United States)

    Published descriptions of new germplasm, such as in the Journal of Plant Registrations (JPR) and, prior to mid-2007, in Crop Science, are important vehicles for allowing researchers and other interested parties to learn about such germplasm and the methods used to generate them. Launched in 2007, JP...

  11. NOAA Weather Radio - EAS Description

    Science.gov (United States)

    Non-Zero All Hazards Logo Emergency Alert Description Event Codes Fact Sheet FAQ Organization Search Search For Go NWS All NOAA Emergency Alert System (EAS) List of EAS Event Codes NWS EAS fact sheet What Management Agency (FEMA) and the NWS, implements the EAS at the federal level. The EAS is the nation's public

  12. Natural Language Description of Emotion

    Science.gov (United States)

    Kazemzadeh, Abe

    2013-01-01

    This dissertation studies how people describe emotions with language and how computers can simulate this descriptive behavior. Although many non-human animals can express their current emotions as social signals, only humans can communicate about emotions symbolically. This symbolic communication of emotion allows us to talk about emotions that we…

  13. The geometry description markup language

    International Nuclear Information System (INIS)

    Chytracek, R.

    2001-01-01

    Currently, a lot of effort is being put on designing complex detectors. A number of simulation and reconstruction frameworks and applications have been developed with the aim to make this job easier. A very important role in this activity is played by the geometry description of the detector apparatus layout and its working environment. However, no real common approach to represent geometry data is available and such data can be found in various forms starting from custom semi-structured text files, source code (C/C++/FORTRAN), to XML and database solutions. The XML (Extensible Markup Language) has proven to provide an interesting approach for describing detector geometries, with several different but incompatible XML-based solutions existing. Therefore, interoperability and geometry data exchange among different frameworks is not possible at present. The author introduces a markup language for geometry descriptions. Its aim is to define a common approach for sharing and exchanging of geometry description data. Its requirements and design have been driven by experience and user feedback from existing projects which have their geometry description in XML

  14. Policy means of control in the climate policy

    International Nuclear Information System (INIS)

    2003-01-01

    Using the MARKAL simulation tool, different economic incentives in climate mitigation policy such as tradable emission permits, green certificates and carbon dioxide taxes have been analyzed. The analysis shows that there is an important advantage in applying the emission reductions internationally compared to a national policy, due to the varying marginal costs for the measures in different countries. The analysis also reveals at which price levels the Nordic countries as a whole become net sellers or net buyers of emission permits. The effects of combining emission permits with green certificates are analyzed, e.g. the inverse relation between permit and certificate prices. An appendix to the report gives a description of the Swedish energy system, emissions world-wide and examples of cost-effective mitigation measures for Sweden

  15. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  16. Book Review: The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics

    Directory of Open Access Journals (Sweden)

    Stephen Larson

    2014-03-01

    Full Text Available Sammons, John. (2012. The Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics. Waltham, MA: Syngress, 208 pages, Print Book ISBN: 9781597496612.eBook ISBN : 9781597496629. Print: US $29.95. eBook: US$20.97. Includes exercises, case studies, references, and index.Reviewed by Stephen Larson, PhD. Assistant Professor, Slippery Rock University of PAThe Basics of Digital Forensics: The Primer for Getting Started in Digital Forensics is well-named–it really is very basic. And it should be, as the book’s intended audience includes entry-level digital forensics professionals and complimentary fields such as law enforcement, legal, and general information security. Though the copyright is 2012, some of the data is from 2009, and there is mention of estimates for 2010.(see PDF for full review

  17. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  18. PRIMER REGISTRO DEL FLEBOTOMÍNEO BRUMPTOMYIA PINTOI (DIPTERA: PSYCHODIDAE) EN COLOMBIA

    OpenAIRE

    BEJARANO EDUAR ELÍAS; DUQUE PATRICIA; VÉLEZ IVÁN DARÍO

    2004-01-01

    Durante un estudio entomológico de la leishmaniosis realizado en La Macarena,Departamento del Meta, Colombia, se colectó un espécimen macho de Brumptomyiapintoi, el cual constituye el primer registro de la especie para el país. Este flebotomíneofue capturado con un aspirador bucal mientras reposaba en el interior de una cuevade armadillo.

  19. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers

    Czech Academy of Sciences Publication Activity Database

    Kotík, Michael; Faměrová, Veronika

    2012-01-01

    Roč. 88, č. 2 (2012), s. 212-217 ISSN 0167-7012 R&D Projects: GA ČR GAP504/10/0137; GA ČR GAP207/10/0135 Institutional research plan: CEZ:AV0Z50200510 Keywords : Dehalogenation * Consensus sequence * Degenerate PCR primer Subject RIV: EE - Microbiology, Virology Impact factor: 2.161, year: 2012

  20. PIPEMicroDB: microsatellite database and primer generation tool for pigeonpea genome.

    Science.gov (United States)

    Sarika; Arora, Vasu; Iquebal, M A; Rai, Anil; Kumar, Dinesh

    2013-01-01

    Molecular markers play a significant role for crop improvement in desirable characteristics, such as high yield, resistance to disease and others that will benefit the crop in long term. Pigeonpea (Cajanus cajan L.) is the recently sequenced legume by global consortium led by ICRISAT (Hyderabad, India) and been analysed for gene prediction, synteny maps, markers, etc. We present PIgeonPEa Microsatellite DataBase (PIPEMicroDB) with an automated primer designing tool for pigeonpea genome, based on chromosome wise as well as location wise search of primers. Total of 123 387 Short Tandem Repeats (STRs) were extracted from pigeonpea genome, available in public domain using MIcroSAtellite tool (MISA). The database is an online relational database based on 'three-tier architecture' that catalogues information of microsatellites in MySQL and user-friendly interface is developed using PHP. Search for STRs may be customized by limiting their location on chromosome as well as number of markers in that range. This is a novel approach and is not been implemented in any of the existing marker database. This database has been further appended with Primer3 for primer designing of selected markers with left and right flankings of size up to 500 bp. This will enable researchers to select markers of choice at desired interval over the chromosome. Furthermore, one can use individual STRs of a targeted region over chromosome to narrow down location of gene of interest or linked Quantitative Trait Loci (QTLs). Although it is an in silico approach, markers' search based on characteristics and location of STRs is expected to be beneficial for researchers. Database URL: http://cabindb.iasri.res.in/pigeonpea/

  1. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  2. Demonstration Of A Nanomaterial-Modified Primer For Use In Corrosion-Inhibiting Coating Systems

    Science.gov (United States)

    2011-11-01

    resin packages/binders, can cause a high-build coating thickness that can be prone to chipping and “mud cracking ” if not properly applied. The...for all non-magnetic coatings on a ferrous (magnetic) substrate, e.g. paint, plastic, enamel , powder, rubber, ceramic, galvanising, zinc, sprayed... cracking during the scribing process due to the brittle coating system on the intermediate primer coupons (16 and 22) as well as coupon 11. Mildew

  3. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    Science.gov (United States)

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming

    2013-01-01

    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  4. Recolectores, verificadores y reflexivos: perfiles de la competencia informacional en estudiantes universitarios de primer semestre

    OpenAIRE

    Harold Castañeda-Peña; Liliana González Niño; Gloria Marciales Vivas; Jorge Winston Barbosa Chacón; Juan Carlos Barbosa Herrera

    2010-01-01

    Artículo de investigación que explora perfiles de la competencia informacional en estudiantes universitarios de primer semestre, a partir de un concepto renovado de competencia informacional desde la perspectiva sociocultural, donde se entiende perfil como una práctica habitual que es situada y variada. Se analiza el caso de 285 estudiantes provenientes de dos universidades colombianas, por medio de un instrumento observacional (cuestionario de perfil, protocolos en voz alta y entrevistas). S...

  5. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  6. Facebook targeted advertisement for research recruitment: A primer for nurse researchers.

    Science.gov (United States)

    Carter-Harris, Lisa

    2016-11-01

    Recruiting participants for research studies can be challenging and costly. Innovative recruitment methods are needed. Facebook targeted advertisement offers a low-cost alternative to traditional methods that has been successfully used in research study recruitment. This primer offers nurse researchers a method utilizing social media as a recruitment tool and details Facebook targeted advertisement for research recruitment. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Policy options

    International Nuclear Information System (INIS)

    Miller, A.

    1990-01-01

    The obstacles to bringing about consumer response to environmental dangers are particularly challenging for global problems like ozone depletion and the greenhouse effect. In this situation, there is the danger of what is commonly termed the tragedy of the commons, the ecological destruction that can occur from uncontrolled use of shared resources like the atmosphere. There is probably no country for which reductions in global warming provide an adequate economic incentive to reduce greenhouse gas emissions unilaterally, even though such action could yield substantial global benefits. From any one country's viewpoint, the costs of controlling emissions may exceed the benefits since, without international agreement, reductions achieved by one nation may be offset by another. Therefore, even though the entire world may be better off as a result of efforts to lower emissions, new economic incentives are necessary to lead the market to a socially efficient outcome. This paper describes the range of domestic and international policies that could be adopted to reduce emissions of greenhouse gases, and also discusses the results of modeling analyses of government actions that could reduce or increase such emissions

  8. Transferability of microsatellite primers developed for stingless bees to four other species of the genus Melipona.

    Science.gov (United States)

    Viana, M V C; Miranda, E A; de Francisco, A K; Carvalho, C A L; Waldschmidt, A M

    2011-11-22

    Microsatellite markers are a useful tool for ecological monitoring of natural and managed populations. A technical limitation is the necessity for investment in the development of primers. Heterologous primers can provide an alternative to searching for new loci. In bees, these markers have been used in populational and intracolonial genetic analyses. The genus Melipona has the largest number of species among bee genera, about 70, occurring throughout the Neotropical region. However, only five species of the genus Melipona have specific microsatellite markers. Given the great diversity of this genus, this number is not representative. We analyzed the transferability of 49 microsatellite loci to four other species of the genus Melipona (M. scutellaris, M. mondury, M. mandacaia, and M. quadrifasciata). Four individuals of each species, from different localities, were used in amplification tests. Primer pairs described for five Melipona species and for Trigona carbonaria were tested. Among the 49 loci, 22 gave amplification products for all four species, while three gave nonspecific bands and five showed no amplification products. The remaining loci varied in the pattern of amplification, according to the species examined. The number of alleles ranged from 1 to 6. The results demonstrate the possibility of using these heterologous markers in other Melipona species, increasing the number of loci that can be analyzed and contributing to further genetic analyses of intra- and intercolonial structure, which is required for conservation measure planning, genetic improvement and resolution of taxonomic problems.

  9. Teaching Thermal Hydraulics and Numerical Methods: An Introductory Control Volume Primer

    International Nuclear Information System (INIS)

    D. S. Lucas

    2004-01-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com

  10. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

    Science.gov (United States)

    Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

    2015-01-01

    Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    Energy Technology Data Exchange (ETDEWEB)

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J. (Pharmasset); (Emerald)

    2012-08-01

    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  13. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    International Nuclear Information System (INIS)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang

    1994-01-01

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  14. Detection of HCV-RNA by Reverse Transcription Polymerase Chain Reaction Using Biotinylated and Radioiodinated Primers

    Energy Technology Data Exchange (ETDEWEB)

    Ryu, Jin Sook; Moon, Dae Hyuk; Cheon, Jun Hong; Chung, Yoon Young; Park, Hung Dong; Chung, Young Hwa; Lee, Young Sang [Asan Medical Center, University of Ulsan, Seoul (Korea, Republic of)

    1994-07-15

    This study was performed to evaluate the clinical applicability of the reverse transcription polymerase chain reaction (RT-PCR) kit of HCV-RNA using biotinylated and radioiodinated primers. Study subjects were 118 patients with positive anti-HCV. HCV-RNA in patients serum was extracted by guanidium thiocyanate method. After first amplification, the product was reamplified by primers labelled with biotin and I-125. The final amplification product was detected by counting the radioactivity after incubation in avidin coated tubes. In 51 samples, the test was repeated for evaluation of reproducibility. This new method was also compared with conventional RT-PCR methods in 34 samples from patients with chronic liver disease. The results were as follows, 1) HCV-RNA was positive in 85(97%)of 88 patients with chronic liver disease, and in 23 (73%) of 30 patients with normal liver function. 2) In comparison with conventional method, HCV-RNA was detected in 32(94%) of 34 patients with new method, whereas in 27(79% ) of the same group with conventional method 3) Repeated test with new method in 52 samples demonstrated 82% of concordant result. In conclusion, new method with biotinylated and radioiodinated primers was more sensitive than conventional method. However, great care must be taken for quality control because there were considerable interassay variation and possibility of false positivity and false negativity.

  15. Interpretation and Analysis of Privacy Policies of Websites in India

    DEFF Research Database (Denmark)

    Dhotre, Prashant Shantaram; Olesen, Henning; Khajuria, Samant

    2016-01-01

    the conditions specified in the policy document. So, ideally the privacy policies should be readable and provide sufficient information to empower users to make knowledgeable decisions. Thus, we have examined more than 50 privacy policies and discussed the content analysis in this paper. We discovered...... on information collection methods, purpose, sharing entities names and data transit. In this study, the 11 % privacy policies are compliance with privacy standards which denotes other privacy policies are less committed to support transparency, choice, and accountability in the process of information collection...... that the policies are not only unstructured but also described in complicated language. Our analysis shows that the user data security measures are nonspecific and unsatisfactory in 57% privacy policies. In spite of huge amount of information collection, the privacy policies does not have clear description...

  16. Conflictividad social y orden público en Toledo, durante el Primer Bienio republicano (1931-1933

    Directory of Open Access Journals (Sweden)

    Ángel Torrejón Hernández

    2008-01-01

    Full Text Available Entre 1931 y 1933, la provincia de Toledo se ve sacudida por una sucesión de conflictos de carácter político y social que, tomados en conjunto, adquieren la morfología de una auténtica lucha interclasista. En esta dinámica de enfrentamiento, las capas sociales menos favorecidas reafirmaron su conciencia de clase y asentaron su estructura institucional. Simultáneamente, el bloque de la derecha sentía la amenaza que, para su tradicional posición dominante en el campo toledano, representaba la legislación social de los gobiernos del primer bienio republicano. El coste en víctimas mortales de esta tensión social fue muy elevado, uno de los más elevados de las provincias españolas. A ello colaboró decisivamente la política de orden público del nuevo régimen republicano que se expresó a través de la cuestionable actuación de los diversos gobernadores civiles.Between 1931 and 1933, the province of Toledo was shaken by a sucession of political and social conflicts which as a whole took the shape of a real class struggle. In this system of confrontation, the less favoured social strata reasserted its class consciousness and laid down its institutional structure. At the same time the right wing-bloc perceived a threat from the social laws carried out by the republican governments during the first two-year period of its traditional dominant position in Toledan farming. The cost in mortal victims of this social tension was very high, one of the highest in all Spanish provinces. The public order policy applied by the new republican regime manifested by the questionable behaviour of the civil governors contributed in a decisive way to such tensions.

  17. Management Matters. Selection Policies

    Science.gov (United States)

    Pappas, Marjorie L.

    2003-01-01

    One of the most important policy documents for a school library media center is the selection policy or the collection development policy. A well-developed selection policy provides a rationale for the selection decisions made by the school library media specialist. A selection policy represents the criteria against which a challenged book is…

  18. Research for health policy

    National Research Council Canada - National Science Library

    Bell, Erica

    2010-01-01

    ... Explicit, implicit, and pragmatic dimensions of policy-maker's needs and context 31 Constraints on policy-makers 32 Deciphering trade-offs 33 The policy-problem: deciphering uncertainty and the problem of innovation 34 A tool for deciphering policy problems 35 The different components of the policy problem 37 Recommended reading 38 Case studies in...

  19. Comparison of commonly used primer sets for evaluating arbuscular mycorrhizal fungal communities: Is there a universal solution?

    Czech Academy of Sciences Publication Activity Database

    Kohout, P.; Sudová, R.; Janoušková, M.; Čtvrtlíková, Martina; Hejda, M.; Pánková, H.; Slavíková, R.; Štajerová, K.; Vosátka, M.; Sýkorová, Z.

    2014-01-01

    Roč. 68, January (2014), s. 482-493 ISSN 0038-0717 Institutional support: RVO:60077344 Keywords : arbuscular mycorrhizal fungi * primers * diversity Subject RIV: EF - Botanics Impact factor: 3.932, year: 2014

  20. Application of hierarchical oligonucleotide primer extension (HOPE) to assess relative abundances of ammonia- and nitrite-oxidizing bacteria

    KAUST Repository

    Scarascia, Giantommaso; Cheng, Hong; Harb, Moustapha; Hong, Pei-Ying

    2017-01-01

    for ensuring the efficiency of nitrification in water treatment systems. Hierarchical oligonucleotide primer extension (HOPE), previously developed to rapidly quantify relative abundances of specific microbial groups of interest, was applied in this study