Characterization of a Madin-Darby canine kidney cell line stably expressing TRPV5.
Dekker, E. den; Schoeber, J.P.H.; Topala, C.N.; Graaf, S.F.J. van de; Hoenderop, J.G.J.; Bindels, R.J.M.
2005-01-01
To provide a cell model for studying specifically the regulation of Ca2+ entry by the epithelial calcium channel transient receptor potential-vanilloid-5 (TRPV5), green fluorescent protein (GFP)-tagged TRPV5 was expressed stably in Madin-Darby canine kidney type I (MDCK) cells. The localization of
Cyclooxygenase expression in canine platelets and Madin-Darby canine kidney cells.
Kay-Mugford, P A; Benn, S J; LaMarre, J; Conlon, P D
2000-12-01
To examine cyclooxygenase (COX) expression in canine platelets and Madin-Darby canine kidney (MDCK) cells in culture. Canine platelets and MDCK cells. Total RNA was recovered from isolated canine platelets and MDCK cells. Northern blot analysis and reverse transcription-polymerase chain reaction (RT-PCR), using complementary DNA probes and primers designed from the human COX sequences, were used to determine COX-1 and -2 (cyclooxygenase isoforms 1 and 2) messenger RNA (mRNA) expression. Following northern blot analysis, canine platelets were found to express only the 2.8-kb COX-1 transcript; COX-2 was not detected. Canine MDCK cells expressed the 4.5-kb COX-2 transcript, in addition to the 2.8-kb COX-1 transcript. A single DNA band of 270 base pairs was identified following gel electrophoresis of the product obtained from RT-PCR of mRNA from canine platelets. Sequencing revealed that this PCR product was 90% homologous to a portion of the human COX-1 gene (Genbank M59979). Detection of COX-1 by RT-PCR of RNA obtained from canine platelets is a novel finding. The 90% homology of the PCR product with the human sequence suggests strong conservation between the canine and human COX-1 gene. Cloning and sequencing of the canine gene will be required to fully characterize homologous regions. Because of the importance of COX in the inflammatory process and as a potential target of currently available nonsteroidal anti-inflammatory drugs (NSAID), a better understanding of canine COX may improve our ability to use NSAID appropriately, achieve efficacy, and avoid potential adverse drug effects in dogs.
International Nuclear Information System (INIS)
Cho, M.J.; Adson, A.; Kezdy, F.J.
1990-01-01
Transport of 14C-labeled acetic, propionic (PA), butyric, valeric, heptanoic (HA), and octanoic (OA) acids across the Madin Darby canine kidney (MDCK) epithelial cell monolayer grown on a porous polycarbonate membrane was studied in Hanks' balanced salt solution (HBSS) at 37 degrees C in both apical-to-basolateral and basolateral-to-apical directions. At micromolar concentrations of solutes, metabolic decomposition was significant as evidenced by [14C]CO2 production during the OA transport. The apparent permeability (Pe) indicates that as lipophilicity increases, diffusion across the unstirred boundary layer becomes rate limiting. In support of this notion, transport of OA and HA was enhanced by agitation, showed an activation energy of 3.7 kcal/mol for OA, and resulted in identical Pe values for both transport directions. Analysis of Pe changes with varying alkyl chain length resulted in a delta G of -0.68 +/- 0.09 kcal/mol for -CH2-group transfer from an aqueous phase to the MDCK cells. When the intercellular tight junctions were opened by the divalent chelator EGTA in Ca2+/Mg2(+)-free HBSS, transport of the fluid-phase marker Lucifer yellow greatly increased because of paracellular leakage. PA transport also showed a significant increase, but OA transport was independent of EGTA. Although albumin also undergoes paracellular transport in the presence of EGTA and OA binds strongly to albumin, OA transport in EGTA solution was unchanged by albumin. These observations indicate that transmembrane transport is the major mechanism for lipophilic substances. The present study, together with earlier work on the transport of polar substances, shows that the MDCK cell monolayer is an excellent model of the transepithelial transport barrier
Changes in ceramide metabolism are essential in Madin-Darby canine kidney cell differentiation.
Pescio, Lucila Gisele; Santacreu, Bruno Jaime; Lopez, Vanina Gisela; Paván, Carlos Humberto; Romero, Daniela Judith; Favale, Nicolás Octavio; Sterin-Speziale, Norma Beatriz
2017-07-01
Ceramides (Cers) and complex sphingolipids with defined acyl chain lengths play important roles in numerous cell processes. Six Cer synthase (CerS) isoenzymes (CerS1-6) are the key enzymes responsible for the production of the diversity of molecular species. In this study, we investigated the changes in sphingolipid metabolism during the differentiation of Madin-Darby canine kidney (MDCK) cells. By MALDI TOF TOF MS, we analyzed the molecular species of Cer, glucosylceramide (GlcCer), lactosylceramide (LacCer), and SM in nondifferentiated and differentiated cells (cultured under hypertonicity). The molecular species detected were the same, but cells subjected to hypertonicity presented higher levels of C24:1 Cer, C24:1 GlcCer, C24:1 SM, and C16:0 LacCer. Consistently with the molecular species, MDCK cells expressed CerS2, CerS4, and CerS6, but with no differences during cell differentiation. We next evaluated the different synthesis pathways with sphingolipid inhibitors and found that cells subjected to hypertonicity in the presence of amitriptyline, an inhibitor of acid sphingomyelinase, showed decreased radiolabeled incorporation in LacCer and cells did not develop a mature apical membrane. These results suggest that hypertonicity induces the endolysosomal degradation of SM, generating the Cer used as substrate for the synthesis of specific molecular species of glycosphingolipids that are essential for MDCK cell differentiation. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.
Brinster, Lauren R; Omeir, Romelda L; Foseh, Gideon S; Macauley, Juliete N; Snoy, Philip J; Beren, Joel J; Teferedegne, Belete; Peden, Keith; Lewis, Andrew M
2013-08-01
Tumors that formed in newborn nude mice that were inoculated with 10(7) Madin-Darby canine kidney (MDCK) cells were associated with a failure-to-thrive (FTT) syndrome consisting of growth retardation, lethargy, weakness, and dehydration. Scoliosis developed in 41% of affected pups. Pups were symptomatic by week 2; severely affected pups became moribund and required euthanasia within 3 to 4 wk. Mice with FTT were classified into categories of mild, moderate, and severe disease by comparing their weight with that of age-matched normal nude mice. The MDCK-induced tumors were adenocarcinomas that invaded adjacent muscle, connective tissue, and bone; 6 of the 26 pups examined had lung metastases. The induction of FTT did not correlate with cell-line aggressiveness as estimated by histopathology or the efficiency of tumor formation (tumor-forming dose 50% endpoint range = 10(2.8) to 10(7.5)); however, tumor invasion of the paravertebral muscles likely contributed to the scoliosis noted. In contrast to the effect of MDCK cells, tumor formation observed in newborn mice inoculated with highly tumorigenic, human-tumor-derived cell lines was not associated with FTT development. We suggest that tumor formation and FTT are characteristics of these MDCK cell inocula and that FTT represents a new syndrome that may be similar to the cachexia that develops in humans with cancer or other diseases.
Directory of Open Access Journals (Sweden)
Balvinder S. Vig
2012-06-01
Full Text Available The expression levels of genes involved in drug and nutrient absorption were evaluated in the Madin-Darby Canine Kidney (MDCK in vitro drug absorption model. MDCK cells were grown on plastic surfaces (for 3 days or on Transwell® membranes (for 3, 5, 7, and 9 days. The expression profile of genes including ABC transporters, SLC transporters, and cytochrome P450 (CYP enzymes was determined using the Affymetrix® Canine GeneChip®. Expression of genes whose probe sets passed a stringent confirmation process was examined. Expression of a few transporter (MDR1, PEPT1 and PEPT2 genes in MDCK cells was confirmed by RT-PCR. The overall gene expression profile was strongly influenced by the type of support the cells were grown on. After 3 days of growth, expression of 28% of the genes was statistically different (1.5-fold cutoff, p < 0.05 between the cells grown on plastic and Transwell® membranes. When cells were differentiated on Transwell® membranes, large changes in gene expression profile were observed during the early stages, which then stabilized after 5–7 days. Only a small number of genes encoding drug absorption related SLC, ABC, and CYP were detected in MDCK cells, and most of them exhibited low hybridization signals. Results from this study provide valuable reference information on endogenous gene expression in MDCK cells that could assist in design of drug-transporter and/or drug-enzyme interaction studies, and help interpret the contributions of various transporters and metabolic enzymes in studies with MDCK cells.
Targeting of SNAP-23 and SNAP-25 in polarized epithelial cells
Low, SH; Roche, PA; Anderson, HA; van Ijzendoorn, SCD; Zhang, M; Mostov, KE; Weimbs, T
1998-01-01
SNAP-23 is the ubiquitously expressed homologue of the neuronal SNAP-25, which functions in synaptic vesicle fusion, We have investigated the subcellular localization of SNAP-23 in polarized epithelial cells, In hepatocyte-derived HepG2 cells and in Madin-Darby canine kidney (MDCK) cells, the
Replacement of the cytoplasmic domain alters sorting of a viral glycoprotein in polarized cells.
Puddington, L; Woodgett, C; Rose, J K
1987-01-01
The envelope glycoprotein (G protein) of vesicular stomatitis virus (VSV) is transported to the basolateral plasma membrane of polarized epithelial cells, whereas the hemagglutinin glycoprotein (HA protein) of influenza virus is transported to the apical plasma membrane. To determine if the cytoplasmic domain of VSV G protein might be important in directing G protein to the basolateral membrane, we derived polarized Madin-Darby canine kidney cell lines expressing G protein or G protein with i...
Pan, Sung-Ching; Kung, Hsiang-Chi; Kao, Tsui-Mai; Wu, Hsio; Dong, Shao-Xing; Hu, Mei-Hua; Chou, Ai-Hsiang; Chong, Pele; Hsieh, Szu-Min; Chang, Shan-Chwen
2013-12-01
Avian H5N1 influenza has caused human infections globally and has a high mortality rate. Rapid production of effective vaccines is needed. A phase 1, randomized, observer-blinded clinical trial was conducted to examine the safety and immunogenicity of an inactivated whole virion vaccine against the influenza A/H5N1 virus produced from the Madin-Darby canine kidney (MDCK) cell line. Participants were randomized to four groups and administered two intramuscular doses of vaccine containing 3 μg hemagglutinin (HA), 3 μg HA with 300 μg aluminum phosphate (AlPO4), 6 μg HA, and 6 μg HA with 300 μg AlPO4, respectively, at two visits, 21 days apart. Serum hemagglutination inhibition (HAI) and neutralizing antibody levels were determined at baseline and on Days 21 and 42. Sixty healthy individuals were enrolled. The neutralization assay showed a significant immune response in the 6 μg with ALPO4 group on Day 42 compared to pre-vaccination levels (11.32±9.77 vs. 4.00±0, p=0.02). The adjuvant effect in neutralization assay was also significant on Day 42 in the 6 μg group (4.52±1.94 without adjuvant vs. 11.32±9.77 with adjuvant, p=0.02). HAI assay also showed an aluminum adjuvant-induced increasing trend in HAI geometric mean titer on Day 42 in the 3 μg and 6 μg groups (6.02 versus 8.20, p=0.05 and 5.74 versus 8.21, p=0.14). The most frequent adverse event was local pain (20% to 60%). There were no vaccine-related severe adverse effects. MDCK cell line-derived H5N1 vaccine was well tolerated. It is necessary to investigate further the immunogenicity of higher antigen doses and the role of aluminum adjuvant in augmenting the effect of the vaccine. Copyright © 2012. Published by Elsevier B.V.
International Nuclear Information System (INIS)
Slivka, S.R.; Insel, P.A.
1987-01-01
alpha 1-Adrenergic receptors mediate two effects on phospholipid metabolism in Madin-Darby canine kidney (MDCK-D1) cells: hydrolysis of phosphoinositides and arachidonic acid release with generation of prostaglandin E2 (PGE2). The similarity in concentration dependence for the agonist (-)-epinephrine in eliciting these two responses implies that they are mediated by a single population of alpha 1-adrenergic receptors. However, we find that the kinetics of the two responses are quite different, PGE2 production occurring more rapidly and transiently than the hydrolysis of phosphoinositides. The antibiotic neomycin selectively decreases alpha 1-receptor-mediated phosphatidylinositol 4,5-bisphosphate hydrolysis without decreasing alpha 1-receptor-mediated arachidonic acid release and PGE2 generation. In addition, receptor-mediated inositol trisphosphate formation is independent of extracellular calcium, whereas release of labeled arachidonic acid is largely calcium-dependent. Moreover, based on studies obtained with labeled arachidonic acid, receptor-mediated generation of arachidonic acid cannot be accounted for by breakdown of phosphatidylinositol monophosphate, phosphatidylinositol bisphosphate, or phosphatidic acid. Further studies indicate that epinephrine produces changes in formation or turnover of several classes of membrane phospholipids in MDCK cells. We conclude that alpha 1-adrenergic receptors in MDCK cells appear to regulate phospholipid metabolism by the parallel activation of phospholipase C and phospholipase A2. This parallel activation of phospholipases contrasts with models described in other systems which imply sequential activation of phospholipase C and diacylglycerol lipase or phospholipase A2
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production
Nuno Carinhas; Daniel A. M. Pais; Alexey Koshkin; Paulo Fernandes; Ana S. Coroadinha; Manuel J. T. Carrondo; Paula M. Alves; Ana P. Teixeira
2016-01-01
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-13C]glucose and [U-13C]glutamine, we apply for the first time 13C-Metabolic flux analysis (13C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells meta...
Kv7.1 surface expression is regulated by epithelial cell polarization
DEFF Research Database (Denmark)
Andersen, Martin N; Olesen, Søren-Peter; Rasmussen, Hanne Borger
2011-01-01
The potassium channel K(V)7.1 is expressed in the heart where it contributes to the repolarization of the cardiac action potential. In addition, K(V)7.1 is expressed in epithelial tissues where it plays a role in salt and water transport. Mutations in the kcnq1 gene can lead to long QT syndrome...... and deafness, and several mutations have been described as trafficking mutations. To learn more about the basic mechanisms that regulate K(V)7.1 surface expression, we have investigated the trafficking of K(V)7.1 during the polarization process of the epithelial cell line Madin-Darby Canine Kidney (MDCK) using...... is regulated by signaling mechanisms involved in epithelial cell polarization in particular signaling cascades involving protein kinase C and PI3K....
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh
DEFF Research Database (Denmark)
Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh
2016-01-01
AIM: The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. MATERIALS AND METHODS: A total of 102 fecal...... for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. RESULTS: No sample was found...
Directory of Open Access Journals (Sweden)
Ding Zhang
Full Text Available Cadmium ions (Cd2+ have been reported to accumulate in bovine tissues, although Cd2+ cytotoxicity has not been investigated thoroughly in this species. Zinc ions (Zn2+ have been shown to antagonize the toxic effects of heavy metals such as Cd2+ in some systems. The present study investigated Cd2+ cytotoxicity in Madin-Darby bovine kidney (MDBK epithelial cells, and explored whether this was modified by Zn2+. Exposure to Cd2+ led to a dose- and time-dependent increase in apoptotic cell death, with increased intracellular levels of reactive oxygen species and mitochondrial damage. Zn2+ supplementation alleviated Cd2+-induced cytotoxicity and this protective effect was more obvious when cells were exposed to a lower concentration of Cd2+ (10 μM, as compared to 50 μM Cd2+. This indicated that high levels of Cd2+ accumulation might induce irreversible damage in bovine kidney cells. Metallothioneins (MTs are metal-binding proteins that play an essential role in heavy metal ion detoxification. We found that co-exposure to Zn2+ and Cd2+ synergistically enhanced RNA and protein expression of MT-1, MT-2, and the metal-regulatory transcription factor 1 in MDBK cells. Notably, addition of Zn2+ reduced the amounts of cytosolic Cd2+ detected following MDBK exposure to 10 μM Cd2+. These findings revealed a protective role of Zn2+ in counteracting Cd2+ uptake and toxicity in MDBK cells, indicating that this approach may provide a means to protect livestock from excessive Cd2+ accumulation.
AMP-activated protein kinase downregulates Kv7.1 cell surface expression
DEFF Research Database (Denmark)
Andersen, Martin N; Krzystanek, Katarzyna; Jespersen, Thomas
2012-01-01
in response to polarization of the epithelial Madin-Darby canine kidney (MDCK) cell line and that this was mediated by activation of protein kinase C (PKC). In this study, the pathway downstream of PKC, which leads to internalization of Kv7.1 upon cell polarization, is elucidated. We show by confocal...... microscopy that Kv7.1 is endocytosed upon initiation of the polarization process and sent for degradation by the lysosomal pathway. The internalization could be mimicked by pharmacological activation of the AMP-activated protein kinase (AMPK) using three different AMPK activators. We demonstrate...
The Functional Effect of an Amphiregulin Autocrine Loop on Inflammatory Breast Cancer Progression
2008-03-01
Darby canine kidney cells (15). Also, using targeted knockout mice, Luetteke et al. reported that specific loss of AR, but not EGF or TGF-a, severely...due to relocalization of E-cadherin in Madin-Darby canine kidney cells (15). Our laboratory has also discovered that AR signaling differs from EGF...growth factor induction of matrix metalloproteinases and their inhibitors in osteosarcoma cells is modulated by the metastasis associated protein CAPL
Drug-permeability and transporter assays in Caco-2 and MDCK cell lines.
Volpe, Donna A
2011-12-01
The human colon adenocarcinoma Caco-2 and Madin-Darby canine kidney epithelial cell lines provide in vitro tools to assess a drug's permeability and transporter interactions during discovery and development. The cells, when cultured on semiporous filters, form confluent monolayers that model the intestinal epithelial barrier for permeability, transporter and drug-interaction assays. The applications of these assays in pharmaceutical research include qualitative prediction and ranking of absorption, determining mechanism(s) of permeability, formulation effects on drug permeability, and the potential for transporter-mediated drug-drug interactions. This review focuses on recent examples of Caco-2 and Madin-Darby canine kidney cells assays for drug permeability including transfected and knock-down cells, miniaturization and automation, and assay combinations to better understand and predict intestinal drug absorption.
Zhang, Kao; Jin, Huijun; Zhong, Fei; Li, Xiujin; Neng, Changai; Chen, Huihui; Li, Wenyan; Wen, Jiexia
2012-11-04
To construct recombinant adenovirus containing canine interferon-gamma (cIFN-gamma) gene and to investigate its antiviral activity against canine parvovirus in Madin-Darby canine kidney cells (MDCK). [Methods] The cIFN-gamma gene was inserted into adenovirus shuttle plasmid to construct pShuttle3-cIFN-gamma expression vector, from which the cIFN-gamma expression cassette was transferred into the adenovirus genomic plasmid pAdeno-X by specific restriction sites to generate recombinant adenovirus genomic plasmid pAd-cIFN-gamma. The pAd-cIFN-gamma plasmid was linearized by digestion and transfected into human embryonic kidney (HEK) 293T cells to generate the replication-defective cIFN-gamma recombinant adenovirus (Ad-cIFN-gamma). To analyze its anti-canine parvovirus activity, the MDCK cells were pre-infected by Ad-cIFN-gamma recombinant adenovirus, and then infected by canine parvovirus. The antiviral activity of the Ad-cIFN-gamma recombinant adenovirus against parvovirus was analyzed. The recombinant adenovirus containing cIFN-gamma gene was constructed by the ligation method. The recombinant adenovirus could mediates recombinant cIFN-gamma secretory expression in MDCK cells. The Ad-cIFN-gamma recombinant adenovirus could significantly inhibit canine parvovirus replication in MDCK cells pre-infected with the recombinant adenovirus. These results indicate that the Ad-cIFN-gamma recombinant adenovirus has the potent antiviral activity against canine parvovirus. The Ad-cIFN-gamma recombinant adenovirus was successfully constructed by the ligation method and possessed a powerful antiviral activity against canine parvovirus.
Directory of Open Access Journals (Sweden)
Jizong Li
2018-03-01
Full Text Available Caprine parainfluenza virus type 3 (CPIV3 is a newly emerging pathogenic respiratory agent infecting both young and adult goats, and it was identified in eastern China in 2013. Cellular microRNAs (miRNAs have been reported to be important modulators of the intricate virus-host interactions. In order to elucidate the role of miRNAs in madin-darby bovine kidney (MDBK cells during CPIV3 infection. In this study, we performed high-throughput sequencing technology to analyze small RNA libraries in CPIV3-infected and mock-infected MDBK cells. The results showed that a total of 249 known and 152 novel candidate miRNAs were differentially expressed in MDBK cells after CPIV3 infection, and 22,981 and 22,572 target genes were predicted, respectively. In addition, RT-qPCR assay was used to further confirm the expression patterns of 13 of these differentially expressed miRNAs and their mRNA targets. Functional annotation analysis showed these up- and downregulated target genes were mainly involved in MAPK signaling pathway, Jak-STAT signaling pathway, Toll-like receptor signaling pathway, p53 signaling pathway, focal adhesion, NF-kappa B signaling pathway, and apoptosis, et al. To our knowledge, this is the first report of the comparative expression of miRNAs in MDBK cells after CPIV3 infection. Our finding provides information concerning miRNAs expression profile in response to CPIV3 infection, and offers clues for identifying potential candidates for antiviral therapies against CPIV3.
A rapid method for immunotitration of influenza viruses using flow cytometry
Lonsdale, R.; Pau, M. G.; Oerlemans, M.; Ophorst, C.; Vooys, A.; Havenga, M.; Goudsmit, J.; Uytdehaag, F.; Marzio, G.
2003-01-01
Reliable assays for accurate titration of influenza virus in infectious samples are pivotal to both influenza research and vaccine development. A titration assay adopted commonly for this purpose is the plaque assay on Madin-Darby canine kidney (MDCK) cells, despite it being time and labour
Directory of Open Access Journals (Sweden)
Lushan Yu
2013-03-01
Full Text Available Three series of 3-(2-aminoheterocycle-4-benzyloxyphenylbenzamide derivatives, 2-aminooxazoles, 2-aminothiazoles, and 2-amino-6H-1,3,4-thiadizines were designed, synthesized and evaluated as β-secretase (BACE-1 inhibitors. Preliminary structure-activity relationships revealed that the existence of a 2-amino-6H-1,3,4-thiadizine moiety and α-naphthyl group were favorable for BACE-1 inhibition. Among the synthesized compounds, 5e exhibited the most potent BACE-1 inhibitory activity, with an IC50 value of 9.9 μΜ and it exhibited high brain uptake potential in Madin-Darby anine kidney cell lines (MDCK and a Madin-Darby canine kidney-multidrug resistance 1 (MDCK-MDR1 model.
Shangguan, Shihao; Wang, Fei; Liao, Yong; Yu, Haiping; Li, Jia; Huang, Wenhai; Hu, Haihong; Yu, Lushan; Hu, Yongzhou; Sheng, Rong
2013-03-20
Three series of 3-(2-aminoheterocycle)-4-benzyloxyphenylbenzamide derivatives, 2-aminooxazoles, 2-aminothiazoles, and 2-amino-6H-1,3,4-thiadizines were designed, synthesized and evaluated as β-secretase (BACE-1) inhibitors. Preliminary structure-activity relationships revealed that the existence of a 2-amino-6H-1,3,4-thiadizine moiety and α-naphthyl group were favorable for BACE-1 inhibition. Among the synthesized compounds, 5e exhibited the most potent BACE-1 inhibitory activity, with an IC50 value of 9.9 μΜ and it exhibited high brain uptake potential in Madin-Darby anine kidney cell lines (MDCK) and a Madin-Darby canine kidney-multidrug resistance 1 (MDCK-MDR1) model.
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.
Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P
2016-03-23
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.
Cytoplasmic Dynein Regulation by Subunit Heterogeneity and Its Role in Apical Transport
Tai, Andrew W.; Chuang, Jen-Zen; Sung, Ching-Hwa
2001-01-01
Despite the existence of multiple subunit isoforms for the microtubule motor cytoplasmic dynein, it has not yet been directly shown that dynein complexes with different compositions exhibit different properties. The 14-kD dynein light chain Tctex-1, but not its homologue RP3, binds directly to rhodopsin's cytoplasmic COOH-terminal tail, which encodes an apical targeting determinant in polarized epithelial Madin-Darby canine kidney (MDCK) cells. We demonstrate that Tctex-1 and RP3 compete for binding to dynein intermediate chain and that overexpressed RP3 displaces endogenous Tctex-1 from dynein complexes in MDCK cells. Furthermore, replacement of Tctex-1 by RP3 selectively disrupts the translocation of rhodopsin to the MDCK apical surface. These results directly show that cytoplasmic dynein function can be regulated by its subunit composition and that cytoplasmic dynein is essential for at least one mode of apical transport in polarized epithelia. PMID:11425878
cfa-miR-143 Promotes Apoptosis via the p53 Pathway in Canine Influenza Virus H3N2-Infected Cells.
Zhou, Pei; Tu, Liqing; Lin, Xi; Hao, Xiangqi; Zheng, Qingxu; Zeng, Weijie; Zhang, Xin; Zheng, Yun; Wang, Lifang; Li, Shoujun
2017-11-25
MicroRNAs regulate multiple aspects of the host response to viral infection. This study verified that the expression of cfa-miR-143 was upregulated in vivo and in vitro by canine influenza virus (CIV) H3N2 infection. To understand the role of cfa-miR-143 in CIV-infected cells, the target gene of cfa-miR-143 was identified and assessed for correlations with proteins involved in the apoptosis pathway. A dual luciferase reporter assay showed that cfa-miR-143 targets insulin-like growth factor binding protein 5 (Igfbp5). Furthermore, a miRNA agomir and antagomir of cfa-miR-143 caused the downregulation and upregulation of Igfbp5, respectively, in CIV-infected madin-darby canine kidney (MDCK) cells. This study demonstrated that cfa-miR-143 stimulated p53 and caspase3 activation and induced apoptosis via the p53 pathway in CIV H3N2-infected cells. In conclusion, CIV H3N2 induced the upregulation of cfa-miR-143, which contributes to apoptosis via indirectly activating the p53-caspase3 pathway.
Directory of Open Access Journals (Sweden)
Kristina Thamm
Full Text Available The pentaspan membrane glycoprotein prominin-1 (CD133 is widely used in medicine as a cell surface marker of stem and cancer stem cells. It has opened new avenues in stem cell-based regenerative therapy and oncology. This molecule is largely used with human samples or the mouse model, and consequently most biological tools including antibodies are directed against human and murine prominin-1. Although the general structure of prominin-1 including its membrane topology is conserved throughout the animal kingdom, its primary sequence is poorly conserved. Thus, it is unclear if anti-human and -mouse prominin-1 antibodies cross-react with their orthologs in other species, especially dog. Answering this issue is imperative in light of the growing number of studies using canine prominin-1 as an antigenic marker. Here, we address this issue by cloning the canine prominin-1 and use its overexpression as a green fluorescent protein fusion protein in Madin-Darby canine kidney cells to determine its immunoreactivity with antibodies against human or mouse prominin-1. We used immunocytochemistry, flow cytometry and immunoblotting techniques and surprisingly found no cross-species immunoreactivity. These results raise some caution in data interpretation when anti-prominin-1 antibodies are used in interspecies studies.
DEFF Research Database (Denmark)
Erickson, A C; Couchman, J R
2001-01-01
Multiple proteoglycans (PGs) are present in all basement membranes (BM) and may contribute to their structure and function, but their effects on cell behavior are not well understood. Their postulated functions include: a structural role in maintaining tissue histoarchitecture, or aid in selective...... filtration processes; sequestration of growth factors; and regulation of cellular differentiation. Furthermore, expression PGs has been found to vary in several disease states. In order to elucidate the role of PGs in the BM, a well-characterized model of polarized epithelium, Madin-Darby canine kidney (MDCK...... core proteins or CS stubs generated by cABC treatment, revealed that both basement membrane and interstitial PGs are secreted by MDCK cells. HSPGs expressed by MDCK cells are perlecan, agrin, and collagen XVIII. Various CSPG core proteins are made by MDCK cells and have been identified as biglycan...
Antiviral activity of maca (Lepidium meyenii) against human influenza virus
Del Valle Mendoza, Juana; Pumarola, Tomas; Alzamora Gonzales, Libertad; Valle Mendoza, Luis Javier del
2014-01-01
Objective To investigate antiviral activity of maca to reduce viral load in Madin-Darby canine kidney (MDCK) cells infected with influenza type A and B viruses (Flu-A and Flu-B, respectively). Methods Maca were extracted with methanol (1:2, v/v). The cell viability and toxicity of the extracts were evaluated on MDCK cells using method MTT assay. Antiviral activity of compounds against Flu-A and Flu-B viruses was assayed using a test for determining the inhibition of the cytopathic ...
Directory of Open Access Journals (Sweden)
Ossa Juan C
2009-08-01
Full Text Available Abstract Background Although bacteria are implicated in the pathogenesis of chronic inflammatory bowel diseases (IBD, mechanisms of intestinal injury and immune activation remain unclear. Identification of adherent-invasive Escherichia coli (AIEC strains in IBD patients offers an opportunity to characterize the pathogenesis of microbial-induced intestinal inflammation in IBD. Previous studies have focused on the invasive phenotype of AIEC and the ability to replicate and survive in phagocytes. However, the precise mechanisms by which these newly identified microbes penetrate the epithelial lining remain to be clarified. Therefore, the aim of this study was to delineate the effects of AIEC, strain LF82 (serotype O83:H1 on model polarized epithelial monolayers as a contributor to intestinal injury in IBD. Results Infection of T84 and Madin-Darby Canine Kidney-I polarized epithelial cell monolayers with AIEC, strain LF82 led to a reduction in transepithelial electrical resistance and increased macromolecular (10 kilodalton dextran flux. Basolateral AIEC infection resulted in more severe disruption of the epithelial barrier. Increased permeability was accompanied by a redistribution of the tight junction adaptor protein, zonula occludens-1, demonstrated by confocal microscopy and formation of gaps between cells, as shown by transmission electron microscopy. After 4 h of infection of intestine 407 cells, bacteria replicated in the cell cytoplasm and were enclosed in membrane-bound vesicles positive for the late endosomal marker, LAMP1. Conclusion These findings indicate that AIEC, strain LF82 disrupts the integrity of the polarized epithelial cell barrier. This disruption enables bacteria to penetrate into the epithelium and replicate in the host cell cytoplasm. These findings provide important links between microbes related to IBD, the intestinal epithelial cell barrier and disease pathogenesis.
Rosenbaek, Lena L; Rizzo, Federica; MacAulay, Nanna; Staub, Olivier; Fenton, Robert A
2017-08-01
The thiazide-sensitive sodium chloride cotransporter NCC is important for maintaining serum sodium (Na + ) and, indirectly, serum potassium (K + ) levels. Functional studies on NCC have used cell lines with native NCC expression, transiently transfected nonpolarized cell lines, or Xenopus laevis oocytes. Here, we developed the use of polarized Madin-Darby canine kidney type I (MDCKI) mammalian epithelial cell lines with tetracycline-inducible human NCC expression to study NCC activity and membrane abundance in the same system. In radiotracer assays, induced cells grown on filters had robust thiazide-sensitive and chloride dependent sodium-22 ( 22 Na) uptake from the apical side. To minimize cost and maximize throughput, assays were modified to use cells grown on plastic. On plastic, cells had similar thiazide-sensitive 22 Na uptakes that increased following preincubation of cells in chloride-free solutions. NCC was detected in the plasma membrane, and both membrane abundance and phosphorylation of NCC were increased by incubation in chloride-free solutions. Furthermore, in cells exposed for 15 min to low or high extracellular K + , the levels of phosphorylated NCC increased and decreased, respectively. To demonstrate that the system allows rapid and systematic assessment of mutated NCC, three phosphorylation sites in NCC were mutated, and NCC activity was examined. 22 Na fluxes in phosphorylation-deficient mutants were reduced to baseline levels, whereas phosphorylation-mimicking mutants were constitutively active, even without chloride-free stimulation. In conclusion, this system allows the activity, cellular localization, and abundance of wild-type or mutant NCC to be examined in the same polarized mammalian expression system in a rapid, easy, and low-cost fashion. Copyright © 2017 the American Physiological Society.
The Use of Orthogonal Polarizations in Microwave Imagery of Isolated Canine Kidney
Larsen, L. E.; Jacobi, J. H.
1980-06-01
A method of imaging biological targets using microwave radiation at a frequency of 4 GHz is presented. Linearly polarized radiation is transmitted through an isolated canine kidney and received with co-polarized and cross-polarized antennas. Images are displayed as the spatial variation of the magnitude of the transmission scattering parameter S21 for each mode of polarization. The relationship between the spatial variation of the magnitude of S21 and canine renal anatomy is discussed. It is shown that within the kidney the cross-polarized image tends to emphasize linear or piecewise linear structures, whereas the co-polarized image balances renal cortical lobulations.
Receptor for advanced glycation end-products is a marker of type I lung alveolar cells.
Shirasawa, Madoka; Fujiwara, Naoyuki; Hirabayashi, Susumu; Ohno, Hideki; Iida, Junko; Makita, Koshi; Hata, Yutaka
2004-02-01
Lung alveolar epithelial cells are comprised of type I (ATI) and type II (ATII) cells. ATI cells are polarized, although they have very flat morphology. The identification of marker proteins for apical and basolateral membranes of ATI cells is important to investigate into the differentiation of ATI cells. In this paper, we characterized receptor for advanced glycation end-products (RAGE) as a marker for ATI cells. RAGE was localized on basolateral membranes of ATI cells in the immunoelectron microscopy and its expression was enhanced in a parallel manner to the differentiation of ATI cells in vivo and in primary cultures of ATII cells. RAGE and T1 alpha, a well-known ATI marker protein, were targeted to basolateral and apical membranes, respectively, when expressed in polarized Madine Darby canine kidney cells. Moreover, RAGE was expressed in ATI cells after T1 alpha in vivo and in ex in vivo organ cultures. In conclusion, RAGE is a marker for basolateral membranes of well-differentiated ATI cells. ATI cells require some signal provided by the in vivo environment to express RAGE.
Gartzke, Dominik; Delzer, Jürgen; Laplanche, Loic; Uchida, Yasuo; Hoshi, Yutaro; Tachikawa, Masanori; Terasaki, Tetsuya; Sydor, Jens; Fricker, Gert
2015-06-01
To investigate whether it is possible to specifically suppress the expression and function of endogenous canine P-glycoprotein (cPgp) in Madin-Darby canine kidney type II cells (MDCKII) transfected with hPGP and breast cancer resistance protein (hBCRP) by zinc finger nuclease (ZFN) producing sequence specific DNA double strand breaks. Wild-type, hPGP-transfected, and hBCRP-transfected MDCKII cells were transfected with ZFN targeting for cPgp. Net efflux ratios (NER) of Pgp and Bcrp substrates were determined by dividing efflux ratios (basal-to-apical / apical-to-basal) in over-expressing cell monolayers by those in wild-type ones. From ZFN-transfected cells, cell populations (ko-cells) showing knockout of cPgp were selected based on genotyping by PCR. qRT-PCR analysis showed the significant knock-downs of cPgp and interestingly also cMrp2 expressions. Specific knock-downs of protein expression for cPgp were shown by western blotting and quantitative targeted absolute proteomics. Endogenous canine Bcrp proteins were not detected. For PGP-transfected cells, NERs of 5 Pgp substrates in ko-cells were significantly greater than those in parental cells not transfected with ZFN. Similar result was obtained for BCRP-transfected cells with a dual Pgp and Bcrp substrate. Specific efflux mediated by hPGP or hBCRP can be determined with MDCKII cells where cPgp has been knocked out by ZFN.
Membrane lipidome of an epithelial cell line
DEFF Research Database (Denmark)
Sampaio, Julio L; Gerl, Mathias J; Klose, Christian
2011-01-01
Tissue differentiation is an important process that involves major cellular membrane remodeling. We used Madin-Darby canine kidney cells as a model for epithelium formation and investigated the remodeling of the total cell membrane lipidome during the transition from a nonpolarized morphology...... to an epithelial morphology and vice versa. To achieve this, we developed a shotgun-based lipidomics workflow that enabled the absolute quantification of mammalian membrane lipidomes with minimal sample processing from low sample amounts. Epithelial morphogenesis was accompanied by a major shift from sphingomyelin...... to generate an apical membrane domain that serves as a protective barrier for the epithelial sheet....
Antiviral potential of a diterpenoid compound sugiol from Metasequoia glyptostroboides.
Bajpai, Vivek K; Kim, Na-Hyung; Kim, Kangmin; Kang, Sun Chul
2016-05-01
This research reports first time antiviral activity of sugiol, a diterpenoid isolated from Metasequoia glyptostroboides in terms of its ability to inhibit in vitro growth of H1N1 influenza virus. Antiviral potential of sugiol was evaluated through hcytopathogenic reduction assay using Madin-Darby canine kidney (MDCK) cell line. Sugiol (500 μg/ml) was found to exhibit considerable anti-cytopathic effect on MDCK cell line confirming its antiviral efficacy against H1N1 influenza virus. These findings strongly reinforce the suggestion that sugiol could be a candidate of choice in combinational regimen with potential antiviral efficacy.
Kaur, Gurpreet; Chandra, Mudit; Dwivedi, P N; Sharma, N S
2015-01-01
The aim of this study was to isolate Canine parvovirus (CPV) from suspected dogs on madin darby canine kidney (MDCK) cell line and its confirmation by polymerase chain reaction (PCR) and nested PCR (NPCR). Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE) were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.
Directory of Open Access Journals (Sweden)
Gurpreet Kaur
2015-01-01
Full Text Available Aim: The aim of this study was to isolate Canine parvovirus (CPV from suspected dogs on madin darby canine kidney (MDCK cell line and its confirmation by polymerase chain reaction (PCR and nested PCR (NPCR. Further, VP2 gene of the CPV isolates was amplified and sequenced to determine prevailing antigenic type. Materials and Methods: A total of 60 rectal swabs were collected from dogs showing signs of gastroenteritis, processed and subjected to isolation in MDCK cell line. The samples showing cytopathic effects (CPE were confirmed by PCR and NPCR. These samples were subjected to PCR for amplification of VP2 gene of CPV, sequenced and analyzed to study the prevailing antigenic types of CPV. Results: Out of the 60 samples subjected to isolation in MDCK cell line five samples showed CPE in the form of rounding of cells, clumping of cells and finally detachment of the cells. When these samples and the two commercially available vaccines were subjected to PCR for amplification of VP2 gene, a 1710 bp product was amplified. The sequence analysis revealed that the vaccines belonged to the CPV-2 type and the samples were of CPV-2b type. Conclusion: It can be concluded from the present study that out of a total of 60 samples 5 samples exhibited CPE as observed in MDCK cell line. Sequence analysis of the VP2 gene among the samples and vaccine strains revealed that samples belonged to CPV-2b type and vaccines belonging to CPV-2.
Li, Xiu-Zhen; Lv, Lin; Zhang, Xu; Anchang, Kenneth Yongabi; Abdullahi, Auwalu Yusuf; Tu, Liqing; Wang, Xiaohu; Xia, Lijun; Zhang, Xiu-Xiang; Feng, Weili; Lu, Chunxia; Li, Shoujun; Yuan, Zi-Guo
2016-11-01
We previously demonstrated that the survival time of BALB/c mice challenged with Toxoplasma gondii RH strain was prolonged by immunising the mice with a eukaryotic vector expressing the protein ROP16 of T. gondii. Building upon previous findings, we are exploring improved vaccination strategies to enhance protection. In this work, a novel recombinant canine adenovirus type 2 expressing ROP16 (CAV-2-ROP16) of T. gondii was constructed and identified to express ROP16 in Madin-Darby canine kidney cells (MDCK) cells by western blot (WB) and indirect immunofluorescence (IFA) assays. Intramuscular immunisation of BALB/c mice with CAV-2-ROP16 was performed to evaluate the humoral and cellular immune responses. This vaccination triggered significant humoral and cellular responses, including ROP16-stimulated lymphoproliferation (P0.05), revealing that a predominant Th1-type response had developed. The cell-mediated cytotoxic activity with high levels of IFN-γ and TNF-α was significantly increased in both CD4 + and CD8 + T-cell compartments in the mice immunised with CAV-2-ROP16 (Pdays post infection compared with control mice that all died within seven days (Pvaccination until now. Our work presents the successful use of recombinant virus CAV-2-ROP16 in vaccination protocols to protect against intraperitoneal challenge with the virulent RH strain of T. gondii. This system was shown to be extremely efficient in eliciting humoral and cellular immune responses that led to a significant improvement in survival time in mice. Copyright © 2016 Elsevier B.V. All rights reserved.
Pretranslational regulation of Na-K-ATPase in cultured canine kidney cells by low K
Energy Technology Data Exchange (ETDEWEB)
Bowen, J.W.; McDonough, A.
1987-02-01
Long-term upregulation of the sodium pump (Na-K-adenosine triphosphatase (Na-K-ATPase)) entails an increase in the number of enzyme molecules. The authors incubated Madin-Darby canine kidney (MDCK) cells in low K medium and studied the time course and magnitude of change in the relative abundance of the two Na-K-ATPase subunits ( and US ), in the synthesis rate of the subunits, and in the relative abundance of - and US -mRNA. When cells were incubated in medium containing 0.25 mM K , intracellular Na increased. The relative abundance of Na-K-ATPase subunits, measured with ( SVI)-labelled immunoblots of cell homogenates, increases such that after 24 h was 1.71 +/- 0.33 and US was 1.67 +/- 0.22 times control. After 8 h of K depletion, -synthesis rate, measured by immunoprecipitation of pulse-labelled cells, increased to 2.30 +/- 0.50 and beta increased to 2.07 +/- 0.42 times control. The - and US -subunit mRNA abundance, measured by hybridizing - and US -cDNA probes to total RNA, increased within 30 min to 1.93 +/- 0.24 and 2.29 +/- 0.64 times control, respectively. They conclude that regulatory adjustments of Na-K-ATPase abundance involve an increase in translation after a rapid and coordinate increase in the concentrations of - and US -subunit mRNA.
AMP-activated protein kinase induces actin cytoskeleton reorganization in epithelial cells
International Nuclear Information System (INIS)
Miranda, Lisa; Carpentier, Sarah; Platek, Anna; Hussain, Nusrat; Gueuning, Marie-Agnes; Vertommen, Didier; Ozkan, Yurda; Sid, Brice; Hue, Louis; Courtoy, Pierre J.; Rider, Mark H.; Horman, Sandrine
2010-01-01
AMP-activated protein kinase (AMPK), a known regulator of cellular and systemic energy balance, is now recognized to control cell division, cell polarity and cell migration, all of which depend on the actin cytoskeleton. Here we report the effects of A769662, a pharmacological activator of AMPK, on cytoskeletal organization and signalling in epithelial Madin-Darby canine kidney (MDCK) cells. We show that AMPK activation induced shortening or radiation of stress fibers, uncoupling from paxillin and predominance of cortical F-actin. In parallel, Rho-kinase downstream targets, namely myosin regulatory light chain and cofilin, were phosphorylated. These effects resembled the morphological changes in MDCK cells exposed to hyperosmotic shock, which led to Ca 2+ -dependent AMPK activation via calmodulin-dependent protein kinase kinase-β(CaMKKβ), a known upstream kinase of AMPK. Indeed, hypertonicity-induced AMPK activation was markedly reduced by the STO-609 CaMKKβ inhibitor, as was the increase in MLC and cofilin phosphorylation. We suggest that AMPK links osmotic stress to the reorganization of the actin cytoskeleton.
Imjeti, Naga Salaija; Lebreton, Stéphanie; Paladino, Simona; de la Fuente, Erwin; Gonzalez, Alfonso; Zurzolo, Chiara
2011-12-01
Sorting of glycosylphosphatidyl-inositol--anchored proteins (GPI-APs) in polarized epithelial cells is not fully understood. Oligomerization in the Golgi complex has emerged as the crucial event driving apical segregation of GPI-APs in two different kind of epithelial cells, Madin-Darby canine kidney (MDCK) and Fisher rat thyroid (FRT) cells, but whether the mechanism is conserved is unknown. In MDCK cells cholesterol promotes GPI-AP oligomerization, as well as apical sorting of GPI-APs. Here we show that FRT cells lack this cholesterol-driven oligomerization as apical sorting mechanism. In these cells both apical and basolateral GPI-APs display restricted diffusion in the Golgi likely due to a cholesterol-enriched membrane environment. It is striking that N-glycosylation is the critical event for oligomerization and apical sorting of GPI-APs in FRT cells but not in MDCK cells. Our data indicate that at least two mechanisms exist to determine oligomerization in the Golgi leading to apical sorting of GPI-APs. One depends on cholesterol, and the other depends on N-glycosylation and is insensitive to cholesterol addition or depletion.
Trivalent MDCK cell culture-derived influenza vaccine Optaflu (Novartis Vaccines).
Doroshenko, Alexander; Halperin, Scott A
2009-06-01
Annual influenza epidemics continue to have a considerable impact in both developed and developing countries. Vaccination remains the principal measure to prevent seasonal influenza and reduce associated morbidity and mortality. The WHO recommends using established mammalian cell culture lines as an alternative to egg-based substrates in the manufacture of influenza vaccine. In June 2007, the EMEA approved Optaflu, a Madin Darby canine kidney cell culture-derived influenza vaccine manufactured by Novartis Vaccines. This review examines the advantages and disadvantages of cell culture-based technology for influenza vaccine production, compares immunogenicity and safety data for Optaflu with that of currently marketed conventional egg-based influenza vaccines, and considers the prospects for wider use of cell culture-based influenza vaccines.
John Nelson Darby: His Contributions to Evangelical Christian Higher Education
Sutherland, Winston Terrance
2010-01-01
The study reported in this article focused on the contributions of John Nelson Derby to biblical hermeneutics and contemporary eschatological thought. Darby continues to exert a great influence on Christianity, particularly conservative evangelical Christianity. This research provides a discussion of Darby's contributions to contemporary…
Sun, Xiaoou; Wiesner, Burkhard; Lorenz, Dorothea; Papsdorf, Gisela; Pankow, Kristin; Wang, Po; Dietrich, Nils; Siems, Wolf-Eberhard; Maul, Björn
2008-12-01
Angiotensin-converting enzyme (ACE) demonstrates, besides its typical dipeptidyl-carboxypeptidase activity, several unusual functions. Here, we demonstrate with molecular, biochemical, and cellular techniques that the somatic wild-type murine ACE (mACE), stably transfected in Chinese Hamster Ovary (CHO) or Madin-Darby Canine Kidney (MDCK) cells, interacts with endogenous membranal co-localized carboxypeptidase M (CPM). CPM belongs to the group of glycosylphosphatidylinositol (GPI)-anchored proteins. Here we report that ACE, completely independent of its known dipeptidase activities, has GPI-targeted properties. Our results indicate that the spatial proximity between mACE and the endogenous CPM enables an ACE-evoked release of CPM. These results are discussed with respect to the recently proposed GPI-ase activity and function of sperm-bound ACE.
John Nelson Darby: Scholarship that Influenced the Bible College Movement
Sutherland, Winston Terrance
2010-01-01
The study reported in this article focused on the scholastic life of John Nelson Darby and his contributions to the Bible college movement. Darby continues to exert a great influence on Christianity, particularly conservative evangelical Christianity. This research provides a discussion of the forces that conspired to shape the direction of…
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh
Directory of Open Access Journals (Sweden)
Shalini Sharma
2016-09-01
Full Text Available Aim: The present study was conducted to detect the presence of canine parvovirus (CPV among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. Materials and Methods: A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. Results: No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102 of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610 used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. Conclusion: This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.
First detection of canine parvovirus type 2b from diarrheic dogs in Himachal Pradesh.
Sharma, Shalini; Dhar, Prasenjit; Thakur, Aneesh; Sharma, Vivek; Sharma, Mandeep
2016-09-01
The present study was conducted to detect the presence of canine parvovirus (CPV) among diarrheic dogs in Himachal Pradesh and to identify the most prevalent antigenic variant of CPV based on molecular typing and sequence analysis of VP2 gene. A total of 102 fecal samples were collected from clinical cases of diarrhea or hemorrhagic gastroenteritis from CPV vaccinated or non-vaccinated dogs. Samples were tested using CPV-specific polymerase chain reaction (PCR) targeting VP2 gene, multiplex PCR for detection of CPV-2a and CPV-2b antigenic variants, and a PCR for the detection of CPV-2c. CPV-2b isolate was cultured on Madin-Darby canine kidney (MDCK) cell lines and sequenced using VP2 structural protein gene. Multiple alignment and phylogenetic analysis was done using ClustalW and MEGA6 and inferred using the Neighbor-Joining method. No sample was found positive for the original CPV strain usually present in the vaccine. However, about 50% (52 out of 102) of the samples were found to be positive with CPV-2ab PCR assay that detects newer variants of CPV circulating in the field. In addition, multiplex PCR assay that identifies both CPV-2ab and CPV-2b revealed that CPV-2b was the major antigenic variant present in the affected dogs. A PCR positive isolate of CPV-2b was adapted to grow in MDCK cells and produced characteristic cytopathic effect after 5 th passage. Multiple sequence alignment of VP2 structural gene of CPV-2b isolate (Accession number HG004610) used in the study was found to be similar to other sequenced isolates in NCBI sequence database and showed 98-99% homology. This study reports the first detection of CPV-2b in dogs with hemorrhagic gastroenteritis in Himachal Pradesh and absence of other antigenic types of CPV. Further, CPV-specific PCR assay can be used for rapid confirmation of circulating virus strains under field conditions.
International Nuclear Information System (INIS)
Gordon, J.A.; Spector, A.A.
1986-01-01
To determine if 12-HETE, a lipoxygenase product that mediates inflammation and tissue injury, can interact with RTEC, confluent Madin Darby Canine Kidney (MDCK) cells were incubated for 2-16 hr with 1.0 μM [ 3 H]-12-HETE. Initial uptake of 12-HETE was rapid; at 16 hrs. 70% of the 12-HETE uptake was incorporated into phospholipids (PL). The distribution among the choline, ethanolamine, inositol, and serine PL was 36, 36, 20 and 8%, respectively. Incubation of MDCK cells with 0.5 to 5.0 μM [ 3 H]-12-HETE for 1 hr indicated linear uptake without evidence of saturation. Incubation with 1.0 μM 12-HETE and 0.25-10.0 μM arachidonic acid for 1 hr revealed no competition for uptake at the lower concentrations but a 40% reduction in 12-HETE uptake at 10.0 μM. Polarity of 12-HETE uptake was indicated by a preference of the basolateral surface over the apical surface by 1.4. After 2 hr, analysis of the medium by reverse phase HPLC revealed that 12-HETE was converted to three polar metabolites which eluted at 25.9, 29.4 and 31.3 min respectively; 12-HETE eluted at 37.5 min. The appearance of these polar metabolites was not prevented by ibuprofen (50 μM) nordihydroguaiaretic acid (30 μM), allopurinol (15 mM), or butylated hydroxytoluene (20 μM). These findings suggest that the lipoxygenase product 12-HETE may affect RTEC through incorporation into membrane PL and/or conversion to polar metabolites
Directory of Open Access Journals (Sweden)
Sheng-Nan Wu
2015-01-01
Full Text Available The nitrogen-containing bisphosphonates used for management of the patients with osteoporosis were reported to influence the function of renal tubular cells. However, how nitrogen-containing bisphosphates exert any effects on ion currents remains controversial. The effects of ibandronate (Iban, a nitrogen-containing bisphosphonate, on ionic channels, including two types of Ca2+-activated K+ (KCa channels, namely, large-conductance KCa (BKCa and intermediate-conductance KCa (IKCa channels, were investigated in Madin–Darby canine kidney (MDCK cells. In whole-cell current recordings, Iban suppressed the amplitude of voltage-gated K+ current elicited by long ramp pulse. Addition of Iban caused a reduction of BKCa channels accompanied by a right shift in the activation curve of BKCa channels, despite no change in single-channel conductance. Ca2+ sensitivity of these channels was modified in the presence of this compound; however, the magnitude of Iban-mediated decrease in BKCa-channel activity under membrane stretch with different negative pressure remained unchanged. Iban suppressed the probability of BKCa-channel openings linked primarily to a shortening in the slow component of mean open time in these channels. The dissociation constant needed for Iban-mediated suppression of mean open time in MDCK cells was 12.2 μM. Additionally, cell exposure to Iban suppressed the activity of IKCa channels, and DC-EBIO or 9-phenanthrol effectively reversed its suppression. Under current-clamp configuration, Iban depolarized the cells and DC-EBIO or PF573228 reversed its depolarizing effect. Taken together, the inhibitory action of Iban on KCa-channel activity may contribute to the underlying mechanism of pharmacological or toxicological actions of Iban and its structurally similar bisphosphonates on renal tubular cells occurring in vivo.
Moderate plasma activated media suppresses proliferation and migration of MDCK epithelial cells
International Nuclear Information System (INIS)
Mohades, Soheila; Laroussi, Mounir; Maruthamuthu, Venkat
2017-01-01
Low-temperature plasma has been shown to have diverse biomedical uses, including its applications in cancer and wound healing. One recent approach in treating mammalian cells with plasma is through the use of plasma activated media (PAM), which is produced by exposing cell culture media to plasma. While the adverse effects of PAM treatment on cancerous epithelial cell lines have been recently studied, much less is known about the interaction of PAM with normal epithelial cells. In this paper, non-cancerous canine kidney MDCK (Madin-Darby Canine Kidney) epithelial cells were treated by PAM and time-lapse microscopy was used to directly monitor their proliferation and random migration upon treatment. While longer durations of PAM treatment led to cell death, we found that moderate levels of PAM treatment inhibited proliferation in these epithelial cells. We also found that PAM treatment reduced random cell migration within epithelial islands. Immunofluorescence staining showed that while there were no major changes in the actin/adhesion apparatus, there was a significant change in the nuclear localization of proliferation marker Ki-67, consistent with our time-lapse results. (paper)
78 FR 38287 - Bitterroot National Forest, Darby Ranger District, Como Forest Health Project
2013-06-26
... DEPARTMENT OF AGRICULTURE Forest Service Bitterroot National Forest, Darby Ranger District, Como Forest Health Project AGENCY: Forest Service. ACTION: Notice; Correction. SUMMARY: The Department of Agriculture (USDA), Forest Service, Bitterroot National Forest, Darby Ranger District published a document in...
Moreira, Étori Aguiar; Locher, Samira; Kolesnikova, Larissa; Bolte, Hardin; Aydillo, Teresa; García-Sastre, Adolfo; Schwemmle, Martin; Zimmer, Gert
2016-10-24
Two novel influenza A-like viral genome sequences have recently been identified in Central and South American fruit bats and provisionally designated "HL17NL10" and "HL18NL11." All efforts to isolate infectious virus from bats or to generate these viruses by reverse genetics have failed to date. Recombinant vesicular stomatitis virus (VSV) encoding the hemagglutinin-like envelope glycoproteins HL17 or HL18 in place of the VSV glycoprotein were generated to identify cell lines that are susceptible to bat influenza A-like virus entry. More than 30 cell lines derived from various species were screened but only a few cell lines were found to be susceptible, including Madin-Darby canine kidney type II (MDCK II) cells. The identification of cell lines susceptible to VSV chimeras allowed us to recover recombinant HL17NL10 and HL18NL11 viruses from synthetic DNA. Both influenza A-like viruses established a productive infection in MDCK II cells; however, HL18NL11 replicated more efficiently than HL17NL10 in this cell line. Unlike conventional influenza A viruses, bat influenza A-like viruses started the infection preferentially at the basolateral membrane of polarized MDCK II cells; however, similar to conventional influenza A viruses, bat influenza A-like viruses were released primarily from the apical site. The ability of HL18NL11 or HL17NL10 viruses to infect canine and human cells might reflect a zoonotic potential of these recently identified bat viruses.
Regulation of Kv1.4 potassium channels by PKC and AMPK kinases
DEFF Research Database (Denmark)
Andersen, Martin Nybo; Skibsbye, Lasse; Saljic, Arnela
2018-01-01
around the ubiquitin ligase Nedd4-2. In the present study we examined whether Kv1.4, constituting the cardiac Ito,s current, is subject to similar regulation. In the epithelial Madin-Darby Canine Kidney (MDCK) cell line, which constitutes a highly reproducible model system for addressing membrane...... targeting, we find, by confocal microscopy, that Kv1.4 cell surface expression is downregulated by activation of protein kinase C (PKC) and AMP-activated protein kinase (AMPK). In contrast, manipulating the activities of phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K) and serum and glucocorticoid......-regulated kinase 1 (SGK1) were without effect on channel localization. The PKC and AMPK-mediated downregulation of Kv1.4 membrane surface localization was confirmed by two-electrode voltage clamp in Xenopus laevis oocytes, where pharmacological activation of PKC and AMPK reduced Kv1.4 current levels. We further...
To further investigate the potential role of '-tocopherol in maintaining immuno-homeostasis in bovine cells (Madin-Darby bovine kidney epithelial cell line), we undertook in vitro experiments using recombinant TNF-a as an immuno-stimulant to simulate inflammation response in cells with and without '...
Identification of reassortant pandemic H1N1 influenza virus in Korean pigs.
Han, Jae Yeon; Park, Sung Jun; Kim, Hye Kwon; Rho, Semi; Nguyen, Giap Van; Song, Daesub; Kang, Bo Kyu; Moon, Hyung Jun; Yeom, Min Joo; Park, Bong Kyun
2012-05-01
Since the 2009 pandemic human H1N1 influenza A virus emerged in April 2009, novel reassortant strains have been identified throughout the world. This paper describes the detection and isolation of reassortant strains associated with human pandemic influenza H1N1 and swine influenza H1N2 (SIV) viruses in swine populations in South Korea. Two influenza H1N2 reassortants were detected, and subtyped by PCR. The strains were isolated using Madin- Darby canine kidney (MDCK) cells, and genetically characterized by phylogenetic analysis for genetic diversity. They consisted of human, avian, and swine virus genes that were originated from the 2009 pandemic H1N1 virus and a neuraminidase (NA) gene from H1N2 SIV previously isolated in North America. This identification of reassortment events in swine farms raises concern that reassortant strains may continuously circulate within swine populations, calling for the further study and surveillance of pandemic H1N1 among swine.
Overview of measles and mumps vaccine: origin, present, and future of vaccine production.
Betáková, T; Svetlíková, D; Gocník, M
2013-01-01
Measles and mumps are common viral childhood diseases that can cause serious complications. Vaccination remains the most efficient way to control the spread of these viruses. The manufacturing capability for viral vaccines produced in embryonated hen eggs and conventional/classical cell substrates, such as chicken embryo fibroblast or primary dog kidney cell substrates, is no longer sufficient. This limitation can be overcome by utilizing other recognized cell substrates such as Madin Darby Canine Kidney (MDCK), Chinese Hamster Ovary (CHO), Vero (monkey origin) cells, MRC-5 (human diploid) or as an alternative, introducing new cell substrates of human or avian origin. A very important factor in vaccine production is the safety and immunogenicity of the final vaccine, where the proper choice of cell substrate used for virus propagation is made. All substrates used in vaccine production must be fully characterized to avoid the contamination of hidden unknown pathogens which is difficult to achieve in primary cell substrates.
DEFF Research Database (Denmark)
Andersen, Martin Nybo; Hefting, Louise Leth; Steffensen, Annette Buur
2015-01-01
The potassium channel Kv7.1 plays critical physiological roles in both heart and epithelial tissues. In heart, Kv7.1 and the accessory subunit KCNE1 forms the IKs current, which is enhanced by PKA mediated phosphorylation. The observed current increase requires both phosphorylation of Kv7.......1 and the presence of KCNE1. However, PKA also stimulates Kv7.1 currents in epithelial tissues, such as colon, where the channel does not co-assemble with KCNE1. Here, we demonstrate that PKA activity significantly impacts the subcellular localization of Kv7.1 in Madin Darby Canine Kidney cells. While PKA inhibition...... reduced the fraction of channels at the cell surface, PKA activation increased it. We show that PKA inhibition lead to intracellular accumulation of Kv7.1 in late endosomes/lysosomes. By mass spectroscopy we identified eight phosphorylated residues on Kv7.1, however, none appeared to play a role...
Directory of Open Access Journals (Sweden)
Tatsuru Togo
2017-12-01
Full Text Available Disruption of cellular plasma membranes is a common event in many animal tissues, and the membranes are usually rapidly resealed. Moreover, repeated membrane disruptions within a single cell reseal faster than the initial wound in a protein kinase A (PKA- and protein kinase C (PKC-dependent manner. In addition to wounded cells, recent studies have demonstrated that wounding of Madin-Darby canine kidney (MDCK cells potentiates membrane resealing in neighboring cells in the short-term by purinergic signaling, and in the long-term by nitric oxide/protein kinase G signaling. In the present study, real-time imaging showed that cell membrane disruption stimulated cAMP synthesis and Ca2+ mobilization from intracellular stores by purinergic signaling in neighboring MDCK cells. Furthermore, inhibition of PKA and PKC suppressed the ATP-mediated short-term potentiation of membrane resealing in neighboring cells. These results suggest that cell membrane disruption stimulates PKA and PKC via purinergic signaling to potentiate cell membrane resealing in neighboring MDCK cells.
The hypertonic environment differentially regulates wild-type CFTR and TNR-CFTR chloride channels.
Lassance-Soares, Roberta M; Cheng, Jie; Krasnov, Kristina; Cebotaru, Liudmila; Cutting, Garry R; Souza-Menezes, Jackson; Morales, Marcelo M; Guggino, William B
2010-01-01
This study tested the hypotheses that the hypertonic environment of the renal medulla regulates the expression of cystic fibrosis transmembrane conductance regulator protein (CFTR) and its natural splice variant, TNR-CFTR. To accomplish this, Madin-Darby canine kidney (MDCK) stable cell lines expressing TNR-CFTR or CFTR were used. The cells were treated with hypertonic medium made with either NaCl or urea or sucrose (480 mOsm/kg or 560 mOsm/kg) to mimic the tonicity of the renal medulla environment. Western blot data showed that CFTR and TNR-CFTR total cell protein is increased by hypertonic medium, but using the surface biotinylation technique, only CFTR was found to be increased in cell plasma membrane. Confocal microscopy showed TNR-CFTR localization primarily at the endoplasmic reticulum and plasma membrane. In conclusion, CFTR and TNR-CFTR have different patterns of distribution in MDCK cells and they are modulated by a hypertonic environment, suggesting their physiological importance in renal medulla. Copyright © 2010 S. Karger AG, Basel.
A Transporter of Ibuprofen is Upregulated in MDCK I Cells under Hyperosmotic Culture Conditions
DEFF Research Database (Denmark)
Nielsen, Carsten Uhd; Rasmussen, Rune N; Mo, Junying
2016-01-01
Ibuprofen is a widely used drug. It has been identified as an inhibitor of several transporters, but it is not clear if ibuprofen is a substrate of any transporter itself. In the present work, we have characterized a transporter of ibuprofen, which is upregulated by hyperosmotic culture conditions...... in Madin-Darby canine kidney I (MDCK I) renal cells. [(3)H]-Ibuprofen uptake rate was measured in MDCK I cell cultured under normal (300 mOsm) and hyperosmotic (500 mOsm) conditions. Hyperosmotic conditions were obtained by supplementing urea, NaCl, mannitol, or raffinose to culture medium. The effect...... of increased osmolarity was investigated for different incubation times. [(3)H]-Ibuprofen uptake in MDCK I cells was upregulated by hyperosmotic culture condition, and was saturable with a Km value of 0.37 ± 0.08 μM and a Vmax of 233.1 ± 17.2 pmol· cm(-2)· min(-1). Racemic [(3)H]-ibuprofen uptake could...
DEFF Research Database (Denmark)
Kristensen, Torsten; Sarin, C J; Hunter, T
1986-01-01
An amplified Okayama-Berg plasmid cDNA library was constructed from total poly(A)+ RNA isolated from the Madin-Darby bovine kidney cell line MDBK. This library was screened with a partial murine calpactin I heavy chain (p36) cDNA clone, the identification of which was based on bovine p36 tryptic ...
Altered dynamics of a lipid raft associated protein in a kidney model of Fabry disease.
Labilloy, Anatália; Youker, Robert T; Bruns, Jennifer R; Kukic, Ira; Kiselyov, Kirill; Halfter, Willi; Finegold, David; do Monte, Semiramis Jamil Hadad; Weisz, Ora A
2014-02-01
Accumulation of globotriaosylceramide (Gb3) and other neutral glycosphingolipids with galactosyl residues is the hallmark of Fabry disease, a lysosomal storage disorder caused by deficiency of the enzyme alpha-galactosidase A (α-gal A). These lipids are incorporated into the plasma membrane and intracellular membranes, with a preference for lipid rafts. Disruption of raft mediated cell processes is implicated in the pathogenesis of several human diseases, but little is known about the effects of the accumulation of glycosphingolipids on raft dynamics in the context of Fabry disease. Using siRNA technology, we have generated a polarized renal epithelial cell model of Fabry disease in Madin-Darby canine kidney cells. These cells present increased levels of Gb3 and enlarged lysosomes, and progressively accumulate zebra bodies. The polarized delivery of both raft-associated and raft-independent proteins was unaffected by α-gal A knockdown, suggesting that accumulation of Gb3 does not disrupt biosynthetic trafficking pathways. To assess the effect of α-gal A silencing on lipid raft dynamics, we employed number and brightness (N&B) analysis to measure the oligomeric status and mobility of the model glycosylphosphatidylinositol (GPI)-anchored protein GFP-GPI. We observed a significant increase in the oligomeric size of antibody-induced clusters of GFP-GPI at the plasma membrane of α-gal A silenced cells compared with control cells. Our results suggest that the interaction of GFP-GPI with lipid rafts may be altered in the presence of accumulated Gb3. The implications of our results with respect to the pathogenesis of Fabry disease are discussed. © 2013 Elsevier Inc. All rights reserved.
Veleva, Ralitsa; Petkova, Bela; Moskova-Doumanova, Veselina; Doumanov, Jordan; Dimitrova, Milena; Koleva, Petya; Mladenova, Kirilka; Petrova, Svetla; Yordanova, Zhenya; Kapchina-Toteva, Veneta; Topouzova-Hristova, Tanya
2015-01-02
Lamium album L. is a perennial herb widely used in folk medicine. It possesses a wide spectrum of therapeutic activities (anti-inflammatory, astringent, antiseptic, antibiotic, antispasmodic, antioxidant and anti-proliferative). Preservation of medicinal plant could be done by in vitro propagation to avoid depletion from their natural habitat. It is important to know whether extracts from L. album plants grown in vitro possess similar properties as extracts from plants grown in vivo . For these reasons, it is important to examine changes in the composition of secondary metabolites during in vitro cultivation of the plant and how they affect the biological activity. We used A549 human cancer cell line and normal kidney epithelial cells MDCKII (Madin-Darby canine kidney cells II) as controls in assessing the anti-cancer effect of plant extracts. To elucidate changes in some key functional characteristics, adhesion test, MTT (3-(4,5-dimethylthiazol-2-yl)-2-5-diphenyl tetrazolium bromide), transepithelial resistance (TER), immunofluorescence staining and trypan blue exclusion test were performed. Methanol and chloroform extracts of in vivo and in vitro propagated plants affected differently cancerous and non-cancerous cells. The most pronounced differences were observed in the morphological analysis and in the cell adhesive properties. We also detected suppressed epithelial transmembrane electrical resistance of MDCK II cells, by treatment with plant extracts, compared to non-treated MDCK II cells. A549 cells did not polarize under the same conditions. Altered organization of actin filaments in both cell types were noticed suggesting that extracts from L. album L. change TER and actin filaments, and somehow may block cell mechanisms, leading to the polarization of MDCK II cells.
International Nuclear Information System (INIS)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma
2010-01-01
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Hashimoto, Ayako; Ohkura, Katsuma; Takahashi, Masakazu; Kizu, Kumiko; Narita, Hiroshi; Enomoto, Shuichi; Miyamae, Yusaku; Masuda, Seiji; Nagao, Masaya; Irie, Kazuhiro; Ohigashi, Hajime; Andrews, Glen K; Kambe, Taiho
2015-12-01
Dietary zinc deficiency puts human health at risk, so we explored strategies for enhancing zinc absorption. In the small intestine, the zinc transporter ZIP4 functions as an essential component of zinc absorption. Overexpression of ZIP4 protein increases zinc uptake and thereby cellular zinc levels, suggesting that food components with the ability to increase ZIP4 could potentially enhance zinc absorption via the intestine. In the present study, we used mouse Hepa cells, which regulate mouse Zip4 (mZip4) in a manner indistinguishable from that in intestinal enterocytes, to screen for suitable food components that can increase the abundance of ZIP4. Using this ZIP4-targeting strategy, two such soybean extracts were identified that were specifically able to decrease mZip4 endocytosis in response to zinc. These soybean extracts also effectively increased the abundance of apically localized mZip4 in transfected polarized Caco2 and Madin-Darby canine kidney cells and, moreover, two apically localized mZip4 acrodermatitis enteropathica mutants. Soybean components were purified from one extract and soyasaponin Bb was identified as an active component that increased both mZip4 protein abundance and zinc levels in Hepa cells. Finally, we confirmed that soyasaponin Bb is capable of enhancing cell surface endogenous human ZIP4 in human cells. Our results suggest that ZIP4 targeting may represent a new strategy to improve zinc absorption in humans. © 2015 Authors; published by Portland Press Limited.
Energy Technology Data Exchange (ETDEWEB)
Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)
2010-07-02
The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.
Isotropic actomyosin dynamics promote organization of the apical cell cortex in epithelial cells.
Klingner, Christoph; Cherian, Anoop V; Fels, Johannes; Diesinger, Philipp M; Aufschnaiter, Roland; Maghelli, Nicola; Keil, Thomas; Beck, Gisela; Tolić-Nørrelykke, Iva M; Bathe, Mark; Wedlich-Soldner, Roland
2014-10-13
Although cortical actin plays an important role in cellular mechanics and morphogenesis, there is surprisingly little information on cortex organization at the apical surface of cells. In this paper, we characterize organization and dynamics of microvilli (MV) and a previously unappreciated actomyosin network at the apical surface of Madin-Darby canine kidney cells. In contrast to short and static MV in confluent cells, the apical surfaces of nonconfluent epithelial cells (ECs) form highly dynamic protrusions, which are often oriented along the plane of the membrane. These dynamic MV exhibit complex and spatially correlated reorganization, which is dependent on myosin II activity. Surprisingly, myosin II is organized into an extensive network of filaments spanning the entire apical membrane in nonconfluent ECs. Dynamic MV, myosin filaments, and their associated actin filaments form an interconnected, prestressed network. Interestingly, this network regulates lateral mobility of apical membrane probes such as integrins or epidermal growth factor receptors, suggesting that coordinated actomyosin dynamics contributes to apical cell membrane organization. © 2014 Klingner et al.
Manni, Marco M; Sot, Jesús; Goñi, Félix M
2015-03-01
Epsilon-toxin (ETX) is a powerful toxin produced by some strains of Clostridium perfringens (classified as types B and D) that is responsible for enterotoxemia in animals. ETX forms pores through the plasma membrane of eukaryotic cells, consisting of a β-barrel of 14 amphipathic β-strands. ETX shows a high specificity for certain cell lines, of which Madin-Darby canine kidney (MDCK) is the first sensitive cell line identified and the most studied one. The aim of this study was to establish the role of lipids in the toxicity caused by ETX and the correlation of its activity in model and biological membranes. In MDCK cells, using cell counting and confocal microscopy, we have observed that the toxin causes cell death mediated by toxin binding to plasma membrane. Moreover, ETX binds and permeabilizes the membranes of giant plasma membrane vesicles (GPMV). However, little effect is observed on protein-free vesicles. The data suggest the essential role of a protein receptor for the toxin in cell membranes. Copyright © 2014 Elsevier B.V. All rights reserved.
Glycolysis is governed by growth regime and simple enzyme regulation in adherent MDCK cells.
Rehberg, Markus; Ritter, Joachim B; Reichl, Udo
2014-10-01
Due to its vital importance in the supply of cellular pathways with energy and precursors, glycolysis has been studied for several decades regarding its capacity and regulation. For a systems-level understanding of the Madin-Darby canine kidney (MDCK) cell metabolism, we couple a segregated cell growth model published earlier with a structured model of glycolysis, which is based on relatively simple kinetics for enzymatic reactions of glycolysis, to explain the pathway dynamics under various cultivation conditions. The structured model takes into account in vitro enzyme activities, and links glycolysis with pentose phosphate pathway and glycogenesis. Using a single parameterization, metabolite pool dynamics during cell cultivation, glucose limitation and glucose pulse experiments can be consistently reproduced by considering the cultivation history of the cells. Growth phase-dependent glucose uptake together with cell-specific volume changes generate high intracellular metabolite pools and flux rates to satisfy the cellular demand during growth. Under glucose limitation, the coordinated control of glycolytic enzymes re-adjusts the glycolytic flux to prevent the depletion of glycolytic intermediates. Finally, the model's predictive power supports the design of more efficient bioprocesses.
The effect of isochoric freezing on mammalian cells in an extracellular phosphate buffered solution.
Preciado, J; Rubinsky, B
2018-04-20
Isochoric (constant volume) freezing has been recently suggested as a new method for cell and organ preservation. As a first step in studying the effect of isochoric freezing on mammalian cells, Madin-Darby canine kidney epithelial cells (MDCK), were frozen in an isochoric system, in a simple extracellular phosphate buffered solution to -10 °C (96.5 MPa), - 15 °C (162 MPa) and -20 °C (205 MPa) for 60 and 120 min. Cell membrane integrity and cell metabolism were studied with a Live/Dead cell vitality assay and flow cytometry. We found that cell survival decreases with an increase in pressure (lower temperatures) and time of exposure. For example, 60% of cells survived 60 min at - 10 °C and only 18% survived 120 min at this temperature. Negligible survival was measured at - 20 °C. This study may serve as the baseline towards further research on techniques to optimize the effects of isochoric freezing on living biological matter. Copyright © 2018. Published by Elsevier Inc.
Synthetic generation of influenza vaccine viruses for rapid response to pandemics.
Dormitzer, Philip R; Suphaphiphat, Pirada; Gibson, Daniel G; Wentworth, David E; Stockwell, Timothy B; Algire, Mikkel A; Alperovich, Nina; Barro, Mario; Brown, David M; Craig, Stewart; Dattilo, Brian M; Denisova, Evgeniya A; De Souza, Ivna; Eickmann, Markus; Dugan, Vivien G; Ferrari, Annette; Gomila, Raul C; Han, Liqun; Judge, Casey; Mane, Sarthak; Matrosovich, Mikhail; Merryman, Chuck; Palladino, Giuseppe; Palmer, Gene A; Spencer, Terika; Strecker, Thomas; Trusheim, Heidi; Uhlendorff, Jennifer; Wen, Yingxia; Yee, Anthony C; Zaveri, Jayshree; Zhou, Bin; Becker, Stephan; Donabedian, Armen; Mason, Peter W; Glass, John I; Rappuoli, Rino; Venter, J Craig
2013-05-15
During the 2009 H1N1 influenza pandemic, vaccines for the virus became available in large quantities only after human infections peaked. To accelerate vaccine availability for future pandemics, we developed a synthetic approach that very rapidly generated vaccine viruses from sequence data. Beginning with hemagglutinin (HA) and neuraminidase (NA) gene sequences, we combined an enzymatic, cell-free gene assembly technique with enzymatic error correction to allow rapid, accurate gene synthesis. We then used these synthetic HA and NA genes to transfect Madin-Darby canine kidney (MDCK) cells that were qualified for vaccine manufacture with viral RNA expression constructs encoding HA and NA and plasmid DNAs encoding viral backbone genes. Viruses for use in vaccines were rescued from these MDCK cells. We performed this rescue with improved vaccine virus backbones, increasing the yield of the essential vaccine antigen, HA. Generation of synthetic vaccine seeds, together with more efficient vaccine release assays, would accelerate responses to influenza pandemics through a system of instantaneous electronic data exchange followed by real-time, geographically dispersed vaccine production.
Alves, Daiane S; Farr, Glen A; Seo-Mayer, Patricia; Caplan, Michael J
2010-12-01
The Na(+),K(+)-ATPase is the major active transport protein found in the plasma membranes of most epithelial cell types. The regulation of Na(+),K(+)-ATPase activity involves a variety of mechanisms, including regulated endocytosis and recycling. Our efforts to identify novel Na(+),K(+)-ATPase binding partners revealed a direct association between the Na(+),K(+)-ATPase and AS160, a Rab-GTPase-activating protein. In COS cells, coexpression of AS160 and Na(+),K(+)-ATPase led to the intracellular retention of the sodium pump. We find that AS160 interacts with the large cytoplasmic NP domain of the α-subunit of the Na(+),K(+)-ATPase. Inhibition of the activity of the adenosine monophosphate-stimulated protein kinase (AMPK) in Madin-Darby canine kidney cells through treatment with Compound C induces Na(+),K(+)-ATPase endocytosis. This effect of Compound C is prevented through the short hairpin RNA-mediated knockdown of AS160, demonstrating that AMPK and AS160 participate in a common pathway to modulate the cell surface expression of the Na(+),K(+)-ATPase.
MEMS-based dynamic cell-to-cell culture platforms using electrochemical surface modifications
International Nuclear Information System (INIS)
Chang, Jiyoung; Lin, Liwei; Yoon, Sang-Hee; Mofrad, Mohammad R K
2011-01-01
MEMS-based biological platforms with the capability of both spatial placements and time releases of living cells for cell-to-cell culture experiments have been designed and demonstrated utilizing electrochemical surface modification effects. The spatial placement is accomplished by electrochemical surface modification of substrate surfaces to be either adhesive or non-adhesive for living cells. The time control is achieved by the electrical activation of the selective indium tin oxide co-culture electrode to allow the migration of living cells onto the electrode to start the cell-to-cell culture studies. Prototype devices have a three-electrode design with an electrode size of 50 × 50 µm 2 and the separation gaps of 2 µm between them. An electrical voltage of −1.5 V has been used to activate the electrodes independently and sequentially to demonstrate the dynamic cell-to-cell culture experiments of NIH 3T3 fibroblast and Madin Darby canine kidney cells. As such, this MEMS platform could be a basic yet versatile tool to characterize transient cell-to-cell interactions
Risk and performances: financial performance of sime darby berhad
W.Hussin, Wan Nur Imani
2017-01-01
The aim of this study are used to investigate the relationship between company performance and the profitability of the company. Firm organisation that used to identify this relationship is Sime Darby Berhad. In this study, the factors that indicate to profitability such as return on asset (ROA), return on equity (ROE), return on investment (ROI), average collection period (ACP), leverage, remuneration, liquidity, operational etc. Financial instrument merely related to financial performance o...
Directory of Open Access Journals (Sweden)
Sarah J Fletcher
Full Text Available Tight junctions (TJs link adjacent cells and are critical for maintenance of apical-basolateral polarity in epithelial monolayers. The TJ protein occludin functions in disparate processes, including wound healing and Hepatitis C Virus infection. Little is known about steady-state occludin trafficking into and out of the plasma membrane. Therefore, we determined the mechanisms responsible for occludin turnover in confluent Madin-Darby canine kidney (MDCK epithelial monolayers. Using various biotin-based trafficking assays we observed continuous and rapid endocytosis of plasma membrane localised occludin (the majority internalised within 30 minutes. By 120 minutes a significant reduction in internalised occludin was observed. Inhibition of lysosomal function attenuated the reduction in occludin signal post-endocytosis and promoted co-localisation with the late endocytic system. Using a similar method we demonstrated that ∼20% of internalised occludin was transported back to the cell surface. Consistent with these findings, significant co-localisation between internalised occludin and recycling endosomal compartments was observed. We then quantified the extent to which occludin synthesis and transport to the plasma membrane contributes to plasma membrane occludin homeostasis, identifying inhibition of protein synthesis led to decreased plasma membrane localised occludin. Significant co-localisation between occludin and the biosynthetic secretory pathway was demonstrated. Thus, under steady-state conditions occludin undergoes turnover via a continuous cycle of endocytosis, recycling and degradation, with degradation compensated for by biosynthetic exocytic trafficking. We developed a mathematical model to describe the endocytosis, recycling and degradation of occludin, utilising experimental data to provide quantitative estimates for the rates of these processes.
Devkar, Santosh T; Kandhare, Amit D; Sloley, Brian D; Jagtap, Suresh D; Lin, James; Tam, Yun K; Katyare, Surendra S; Bodhankar, Subhash L; Hegde, Mahabaleshwar V
2015-01-01
Withania somnifera (L.) Dunal, shows several pharmacological properties which are attributed mainly to the withanolides present in the root. The efficacy of medicinally active withanolides constituents depends on the absorption and transportation through the intestinal epithelium. We examined these characteristics by employing the Sino-Veda Madin-Darby canine kidney cells culture system, which under in vitro condition shows the absorption characteristics similar to the human intestinal epithelium. Thus, the aim of the present investigation was to assess the bioavailability of individual withanolides. Withanolides were diluted in Hank's buffered saline at a concentration of 2 μg/ml were tested for permeability studies carried out for 1 h duration. Permeability was measured in terms of efflux pump (P eff) in cm/s. P eff values of withanolide A (WN A), withanone (WNN), 1,2-deoxywithastramonolide (1,2 DWM), withanolide B (WN B), withanoside IV-V (WS IV-V), and withaferin A were 4.05 × 10(-5), 2.06 × 10(-5), 1.97 × 10(-5), 1.80 × 10(-5), 3.19 × 10(-6), 3.03 × 10(-6) and 3.30 × 10(-7) respectively. In conclusion, the nonpolar and low molecular weight compounds (WN A, WNN, 1,2 DWM, and WN B) were highly permeable. As against this, the glycosylated and polar WS IV and WS V showed low permeability. Surprisingly and paradoxically, the highly biologically active withaferin A was completely impermeable, suggesting that further studies possibly using human epithelial colorectal adenocarcinoma (Caco-2) cells may be needed to delineate the absorption characteristics of withanolides, especially withaferin A.
Mita, Sachiko; Suzuki, Hiroshi; Akita, Hidetaka; Stieger, Bruno; Meier, Peter J; Hofmann, Alan F; Sugiyama, Yuichi
2005-01-01
Bile salts are predominantly taken up by hepatocytes via the basolateral Na(+)-taurocholate cotransporting polypeptide (NTCP/SLC10A1) and secreted into the bile by the bile salt export pump (BSEP/ABCB11). In the present study, we transfected rat Ntcp and rat Bsep into polarized Madin-Darby canine kidney cells and characterized the transport properties of these cells for eight bile salts. Immunohistochemical staining demonstrated that Ntcp was expressed at the basolateral domains, whereas Bsep was expressed at the apical domains. Basal-to-apical transport of taurocholate across the monolayer expressing only Ntcp and that coexpressing Ntcp/Bsep was observed, whereas the flux across the monolayer of control and Bsep-expressing cells was symmetrical. Basal-to-apical transport of taurocholate across Ntcp/Bsep-coexpressing monolayers was significantly higher than that across monolayers expressing only Ntcp. Kinetic analysis of this vectorial transport of taurocholate gave an apparent K(m) value of 13.9 +/- 4.7 microM for cells expressing Ntcp alone, which is comparable with 22.2 +/- 4.5 microM for cells expressing both Ntcp and Bsep and V(max) values of 15.8 +/- 4.2 and 60.8 +/- 9.0 pmol.min(-1).mg protein(-1) for Ntcp alone and Ntcp and Bsep-coexpressing cells, respectively. Transcellular transport of cholate, glycocholate, taurochenodeoxycholate, chenodeoxycholate, glycochenodeoxycholate, tauroursodeoxycholate, ursodeoxycholate, and glycoursodeoxycholate, but not that of lithocholate was also observed across the double transfectant. This double-expressing system can be used as a model to clarify vectorial transport of bile salts across hepatocytes under physiological conditions.
Ahmad Rizal Mohd Yusof; Zarina Othman; A.B. Shamsul; Mohamed Abu Bakar Kassim
2014-01-01
Liberia has initiated a paradigm shift to develop its agriculture sector through Foreign Direct Investment (FDI). An investment from Sime Darby Plantations has created social impact towards the local, culture and land use. Center for International Conflict Resolution or CICR has seen these problems as a threat to social development in Liberia. Eleven recommendations have been delivered to Sime Darby as a solution to cater all problems that should conserve the local, culture and the land use. ...
Antiviral activity of maca (Lepidium meyenii) against human influenza virus.
Del Valle Mendoza, Juana; Pumarola, Tomàs; Gonzales, Libertad Alzamora; Del Valle, Luis J
2014-09-01
To investigate antiviral activity of maca to reduce viral load in Madin-Darby canine kidney (MDCK) cells infected with influenza type A and B viruses (Flu-A and Flu-B, respectively). Maca were extracted with methanol (1:2, v/v). The cell viability and toxicity of the extracts were evaluated on MDCK cells using method MTT assay. Antiviral activity of compounds against Flu-A and Flu-B viruses was assayed using a test for determining the inhibition of the cytopathic effect on cell culture and multiplex RT-PCR. The methanol extract of maca showed low cytotoxicity and inhibited influenza-induced cytopathic effect significantly, while viral load was reduced via inhibition of viral growth in MDCK infected cells. Maca contains potent inhibitors of Flu-A and Flu-B with a selectivity index [cytotoxic concentration 50%/IC50] of 157.4 and 110.5, respectively. In vitro assays demonstrated that maca has antiviral activity not only against Flu-A (like most antiviral agents) but also Flu-B viruses, providing remarkable therapeutic benefits. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Investigate The Role Of Cells To Cell Adhesion During Wound Healing
Montes, D. R.; Rodriguez, A. J.; Uyoh, E.; Antwi, P.; Olusegun, S.; Murray, P.
2017-12-01
Improvements in wound healing can save living organism and cut misery in health care centers and on the military battlefield. Microscopic examination of how Madin-Darby Canine Kidney (MDCK) epithelial cells respond to wounds under various treatments that block general calcium absorption and e-cadherin mechanics may yield novel wound treatment insights. We used MDCK cells as our tissue model for this experiment.Each tissue was grown on mattek dishes at high, middle, and low densities. Next, we incubated the tissue at 37 degrees celsius overnight. The next day, we wounded the MDCK tissue by scratching them with a 21G1 ½(38.1 mm) syringe needle. Before the scratch we took an image of the tissues. With the tissue wound we made a time-lapse movie of about 3 hours long with a interval of 1 min. Afterward, we compared each MDCK tissue by adding a calcium chelator named EGTA. As so, this will sequester calcium use as well to block e-cadherin mechanics. We then looked at the relationship between a wounded tissue and a healthy tissue. As such, wound dynamics can be observed. We asked ourselves, will EGTA prevent wound closure?
Amiloride interacts with renal α- and β-adrenergic receptors
International Nuclear Information System (INIS)
Howard, M.J.; Mullen, M.D.; Insel, P.A.
1987-01-01
The authors have used radioligand binding techniques to assess whether amiloride and certain analogues of amiloride (ethylisopropyl amiloride and benzamil) can bind to adrenergic receptors in the kidney. They found that amiloride could compete for [ 3 H]rauwolscine (α 2 -adrenergic receptors), [ 3 H]prazosin (α 1 -adrenergic receptors), and [ 125 I]iodocyanopindolol (β-adrenergic receptors) binding in rat renal cortical membranes with inhibitor constants of 13.6 /plus minus/ 5.7, 24.4 /plus minus/ 7.4, and 8.36 /plus minus/ 13.5 μM, respectively. Ethylisopropyl amiloride and benzamil were from 2- to 25-fold more potent than amiloride in competing for radioligand binding sites in studies with these membranes. In addition, amiloride and the two analogues competed for [ 3 H]prazosin sites on intact Madin-Darby canine kidney cells and amiloride blocked epinephrine-stimulated prostaglandin E 2 production in these cells. They conclude that amiloride competes for binding to several classes of renal adrenergic receptors with a rank order of potency of α 2 > α 1 > β. Binding to, and antagonism of, adrenergic receptors occurs at concentrations of amiloride that are lower than previously observed nonspecific interactions of this agent
Interactions of pharmacologically active snake venom sPLA2 with different cell lines
Doumanov, Jordan; Mladenova, Kirilka; Aleksandrov, Radoslav; Danovski, Georgi; Petrova, Svetla
2014-01-01
Secreted Phospholipases A2 (sPLA2s) represent a large family of structurally related enzymes, which target different tissues and organs and induce numerous pharmacological effects based on their catalytic specificity – hydrolysis of the sn-2 ester bond of glycerophospholipids. The neurotoxin vipoxin, isolated from the venom of Vipera ammodytes meriodionalis, is a heterodimeric postsynaptic ionic complex composed of two protein subunits – a basic and toxic His48 sPLA2 enzyme and an acidic, enzymatically inactive and non-toxic component. In this paper, for the first time, we demonstrate that vipoxin sPLA2 enzyme affects cell integrity and viability of four cell types and causes different cell responses. The most dramatic local tissue effects were observed with RPE-1 (retinal pigment epithelial) cells followed by A549 (adenocarcinomic human alveolar epithelial) cells and MDCK (Madin-Darby Canine Kidney epithelial) cells. Products of the enzymatic reaction, lysophospholipids and unsaturated free fatty acids, act as lipid mediators that can induce membrane damaging or can stimulate cell proliferation. Our preliminary results on the cytotoxic effect of vipoxin sPLA2 on A549 cells are promising in searching of its eventual anticancer potential. PMID:26019578
Preparation of Single Cells for Imaging Mass Spectrometry
Energy Technology Data Exchange (ETDEWEB)
Berman, E S; Fortson, S L; Kulp, K S; Checchi, K D; Wu, L; Felton, J S; Wu, K J
2007-10-24
Characterizing chemical changes within single cells is important for determining fundamental mechanisms of biological processes that will lead to new biological insights and improved disease understanding. Imaging biological systems with mass spectrometry (MS) has gained popularity in recent years as a method for creating precise chemical maps of biological samples. In order to obtain high-quality mass spectral images that provide relevant molecular information about individual cells, samples must be prepared so that salts and other cell-culture components are removed from the cell surface and the cell contents are rendered accessible to the desorption beam. We have designed a cellular preparation protocol for imaging MS that preserves the cellular contents for investigation and removes the majority of the interfering species from the extracellular matrix. Using this method, we obtain excellent imaging results and reproducibility in three diverse cell types: MCF7 human breast cancer cells, Madin-Darby canine kidney (MDCK) cells, and NIH/3T3 mouse fibroblasts. This preparation technique allows routine imaging MS analysis of cultured cells, allowing for any number of experiments aimed at furthering scientific understanding of molecular processes within individual cells.
Susceptibility of influenza viruses circulating in Western Saudi Arabia to neuraminidase inhibitors
Directory of Open Access Journals (Sweden)
Ahmed M. Tolah
2016-04-01
Full Text Available Objectives: To investigate the sensitivity of circulating influenza viruses in Western Saudi Arabia to neuraminidase inhibitors (NAIs; mainly, zanamivir and oseltamivir. Methods: Respiratory samples were collected from patients presenting with respiratory symptoms to King Abdulaziz University Hospital, Jeddah, Kingdom of Saudi Arabia (KSA between September 2013 and October 2014. All samples were tested prospectively by real-time reverse-transcription polymerase chain reaction for influenza A and B viruses. Positive samples were then inoculated on Madin-Darby Canine Kidney (MDCK cells and isolated viruses were examined for their sensitivity to NAIs using fluorescent neuraminidase inhibition assay. Results: Out of 406 tested samples, 25 samples (6.2% were positive for influenza A/pdmH1N1 virus, one sample (0.25% was positive for influenza A/H3N2 virus, and 7 samples (1.7% were positive for influenza B Yamagata-like virus. Screening of isolated influenza A and B viruses (9 out of 33 for their sensitivity to NAIs showed no significant resistance to available NAIs. Conclusion: Our results show that circulating influenza viruses in Jeddah are still sensitive to NAIs.
Yamaguchi, Naoya; Mizutani, Takeomi; Kawabata, Kazushige; Haga, Hisashi
2015-01-07
Collective cell migration plays a crucial role in several biological processes, such as embryonic development, wound healing, and cancer metastasis. Here, we focused on collectively migrating Madin-Darby Canine Kidney (MDCK) epithelial cells that follow a leader cell on a collagen gel to clarify the mechanism of collective cell migration. First, we removed a leader cell from the migrating collective with a micromanipulator. This then caused disruption of the cohesive migration of cells that followed in movement, called "follower" cells, which showed the importance of leader cells. Next, we observed localization of active Rac, integrin β1, and PI3K. These molecules were clearly localized in the leading edge of leader cells, but not in follower cells. Live cell imaging using active Rac and active PI3K indicators was performed to elucidate the relationship between Rac, integrin β1, and PI3K. Finally, we demonstrated that the inhibition of these molecules resulted in the disruption of collective migration. Our findings not only demonstrated the significance of a leader cell in collective cell migration, but also showed that Rac, integrin β1, and PI3K are upregulated in leader cells and drive collective cell migration.
Effects of Hydrostatic Pressure on Carcinogenic Properties of Epithelia.
Tokuda, Shinsaku; Kim, Young Hak; Matsumoto, Hisako; Muro, Shigeo; Hirai, Toyohiro; Mishima, Michiaki; Furuse, Mikio
2015-01-01
The relationship between chronic inflammation and cancer is well known. The inflammation increases the permeability of blood vessels and consequently elevates pressure in the interstitial tissues. However, there have been only a few reports on the effects of hydrostatic pressure on cultured cells, and the relationship between elevated hydrostatic pressure and cell properties related to malignant tumors is less well understood. Therefore, we investigated the effects of hydrostatic pressure on the cultured epithelial cells seeded on permeable filters. Surprisingly, hydrostatic pressure from basal to apical side induced epithelial stratification in Madin-Darby canine kidney (MDCK) I and Caco-2 cells, and cavities with microvilli and tight junctions around their surfaces were formed within the multi-layered epithelia. The hydrostatic pressure gradient also promoted cell proliferation, suppressed cell apoptosis, and increased transepithelial ion permeability. The inhibition of protein kinase A (PKA) promoted epithelial stratification by the hydrostatic pressure whereas the activation of PKA led to suppressed epithelial stratification. These results indicate the role of the hydrostatic pressure gradient in the regulation of various epithelial cell functions. The findings in this study may provide clues for the development of a novel strategy for the treatment of the carcinoma.
Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich
2013-11-22
Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.
Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells
Directory of Open Access Journals (Sweden)
Michelle G. Ritt
2015-04-01
Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.
JOB BEHAVIORAL FACTORS AND TURNOVER INTENTION: EVIDENCE FROM SIME DARBY PROPERTY LIMITED
Amran Awang; Abdul Razak Amir; Wirda Osman
2013-01-01
Some job behavioral factors are utilized to examine their relationship with turnover intention among 201 employees in Sime Darby Property (Malaysia) Limited. Job satisfaction, job stress, organizational commitment, job enrichment and person-organization fit are the job behavioral factors selected for the study. The variables used in the study justify the reliability scores consistent with indicators in previous studies. Research methodology justifies the quantitative requirements ...
Directory of Open Access Journals (Sweden)
Xiao Xiao Tang
2010-08-01
Full Text Available The tight junctions (TJs, characteristically located at the apicolateral borders of adjacent epithelial cells, are required for the proper formation of epithelial cell polarity as well as for sustaining the mucosal barrier to the external environment. The observation that lymphocytes are recruited by epithelial cells to the sites of infection [1] suggests that they may play a role in the modulation of epithelial barrier function and thus contribute to host defense. To test the ability of lymphocytes to modulate tight junction assembly in epithelial cells, we set up a lymphocyte-epithelial cell co-culture system, in which Madin-Darby canine kidney (MDCK cells, a well-established model cell line for studying epithelial TJ assembly [2], were co-cultured with mouse lymphocytes to mimic an infection state. In a typical calcium switch experiment, the TJ assembly in co-culture was found to be accelerated compared to that in MDCK cells alone. This accelaration was found to be mediated by AMP-activated protein kinase (AMPK. AMPK activation was independent of changes in cellular ATP levels but it was found to be activated by the pro-inflammatory cytokine TNF-alpha. Forced suppression of AMPK, either with a chemical inhibitor or by knockdown, abrogated the accelerating effect of lymphocytes on TJ formation. Similar results were also observed in a co-culture with lymphocytes and Calu-3 human airway epithelial cells, suggesting that the activation of AMPK may be a general mechanism underlying lymphocyte-accelerated TJ assembly in different epithelia. These results suggest that signals from lymphocytes, such as cytokines, facilitate TJ assembly in epithelial cells via the activation of AMPK.
VAMP7 modulates ciliary biogenesis in kidney cells.
Directory of Open Access Journals (Sweden)
Christina M Szalinski
Full Text Available Epithelial cells elaborate specialized domains that have distinct protein and lipid compositions, including the apical and basolateral surfaces and primary cilia. Maintaining the identity of these domains is required for proper cell function, and requires the efficient and selective SNARE-mediated fusion of vesicles containing newly synthesized and recycling proteins with the proper target membrane. Multiple pathways exist to deliver newly synthesized proteins to the apical surface of kidney cells, and the post-Golgi SNAREs, or VAMPs, involved in these distinct pathways have not been identified. VAMP7 has been implicated in apical protein delivery in other cell types, and we hypothesized that this SNARE would have differential effects on the trafficking of apical proteins known to take distinct routes to the apical surface in kidney cells. VAMP7 expressed in polarized Madin Darby canine kidney cells colocalized primarily with LAMP2-positive compartments, and siRNA-mediated knockdown modulated lysosome size, consistent with the known function of VAMP7 in lysosomal delivery. Surprisingly, VAMP7 knockdown had no effect on apical delivery of numerous cargoes tested, but did decrease the length and frequency of primary cilia. Additionally, VAMP7 knockdown disrupted cystogenesis in cells grown in a three-dimensional basement membrane matrix. The effects of VAMP7 depletion on ciliogenesis and cystogenesis are not directly linked to the disruption of lysosomal function, as cilia lengths and cyst morphology were unaffected in an MDCK lysosomal storage disorder model. Together, our data suggest that VAMP7 plays an essential role in ciliogenesis and lumen formation. To our knowledge, this is the first study implicating an R-SNARE in ciliogenesis and cystogenesis.
Yu, Lei; Gan, Xiuguo; Liu, Xukun; An, Ruihua
2017-11-01
Tight junction plays important roles in regulating paracellular transports and maintaining cell polarity. Calcium oxalate monohydrate (COM) crystals, the major crystalline composition of kidney stones, have been demonstrated to be able to cause tight junction disruption to accelerate renal cell injury. However, the cellular signaling involved in COM crystal-induced tight junction disruption remains largely to be investigated. In the present study, we proved that COM crystals induced tight junction disruption by activating ROS/Akt/p38 MAPK pathway. Treating Madin-Darby canine kidney (MDCK) cells with COM crystals induced a substantial increasing of ROS generation and activation of Akt that triggered subsequential activation of ASK1 and p38 mitogen-activated protein kinase (MAPK). Western blot revealed a significantly decreased expression of ZO-1 and occludin, two important structural proteins of tight junction. Besides, redistribution and dissociation of ZO-1 were observed by COM crystals treatment. Inhibition of ROS by N-acetyl-l-cysteine (NAC) attenuated the activation of Akt, ASK1, p38 MAPK, and down-regulation of ZO-1 and occludin. The redistribution and dissociation of ZO-1 were also alleviated by NAC treatment. These results indicated that ROS were involved in the regulation of tight junction disruption induced by COM crystals. In addition, the down-regulation of ZO-1 and occludin, the phosphorylation of ASK1 and p38 MAPK were also attenuated by MK-2206, an inhibitor of Akt kinase, implying Akt was involved in the disruption of tight junction upstream of p38 MAPK. Thus, these results suggested that ROS-Akt-p38 MAPK signaling pathway was activated in COM crystal-induced disruption of tight junction in MDCK cells.
Shedding of the immunodominant P20 surface antigen of Eimeria bovis sporozoites.
Speer, C A; Whitmire, W M
1989-01-01
P20 is an immunodominant surface antigen of Eimeria bovis sporozoites. As parasites underwent merogony within cultured bovine monocytes and Madin-Darby bovine kidney (MDBK) cells, P20 appeared to be shed gradually by meronts and was absent in type 1 and 2 first-generation merozoites. Meronts of E. bovis appeared to shed P20 into the parasitophorous vacuole of bovine monocytes, whereas MDBK cells evidently released P20 into the culture medium or destroyed its antigenic determinant.
Establishment of optimized MDCK cell lines for reliable efflux transport studies.
Gartzke, Dominik; Fricker, Gert
2014-04-01
Madin-Darby canine kidney (MDCK) cells transfected with human MDR1 gene (MDCK-MDR1) encoding for P-glycoprotein (hPgp, ABCB1) are widely used for transport studies to identify drug candidates as substrates of this efflux protein. Therefore, it is necessary to rely on constant and comparable expression levels of Pgp to avoid false negative or positive results. We generated a cell line with homogenously high and stable expression of hPgp through sorting single clones from a MDCK-MDR1 cell pool using fluorescence-activated cell sorting (FACS). To obtain control cell lines for evaluation of cross-interactions with endogenous canine Pgp (cPgp) wild-type cells were sorted with a low expression pattern of cPgp in comparison with the MDCK-MDR1. Expression of other transporters was also characterized in both cell lines by quantitative real-time PCR and Western blot. Pgp function was investigated applying the Calcein-AM assay as well as bidirectional transport assays using (3) H-Digoxin, (3) H-Vinblastine, and (3) H-Quinidine as substrates. Generated MDCK-MDR1 cell lines showed high expression of hPgp. Control MDCK-WT cells were optimized in showing a comparable expression level of cPgp in comparison with MDCK-MDR1 cell lines. Generated cell lines showed higher and more selective Pgp transport compared with parental cells. Therefore, they provide a significant improvement in the performance of efflux studies yielding more reliable results. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
Upadhyay, B P; Ghimire, P; Tashiro, M; Banjara, M R
Background Seasonal influenza is one of the increasing public health burdens in Nepal. Objective The objective of this study was to isolate and characterize the influenza virus type and subtypes of Nepal. Method A total of 1536 throat swab specimens were collected from January to December 2012. Total ribonucleic acid was extracted using Qiagen viral nucleic acid extraction kit and polymerase chain reaction assay was performed following the US; CDC Real-time PCR protocol. Ten percent of positive specimens were inoculated onto Madin-Darby Canine Kidney cells. Isolates were characterized by using reference ferret antisera. Result Of the total specimens (n=1536), influenza virus type A was detected in 196 (22%) cases; of which 194 (99%) were influenza A (H1N1) pdm09 and 2 (1 %) were influenza A/H3 subtype. Influenza B was detected in 684 (76.9%) cases. Influenza A (H1N1) pdm09, A/H3 and influenza B virus were antigenically similar to the recommended influenza virus vaccine candidate of the year 2012. Although sporadic cases of influenza were observed throughout the year, peak was observed during July to November. Conclusion Similar to other tropical countries, A (H1N1) pdm09, A/H3 and influenza B viruses were co-circulated in Nepal.
Urra, Javier; Sandoval, Moisés; Cornejo, Isabel; Barros, L Felipe; Sepúlveda, Francisco V; Cid, L Pablo
2008-10-01
Extracellular pH, especially in relatively inaccessible microdomains between cells, affects transport membrane protein activity and might have an intercellular signaling role. We have developed a genetically encoded extracellular pH sensor capable of detecting pH changes in basolateral spaces of epithelial cells. It consists of a chimerical membrane protein displaying concatenated enhanced variants of cyan fluorescence protein (ECFP) and yellow fluorescence protein (EYFP) at the external aspect of the cell surface. The construct, termed pHCECSensor01, was targeted to basolateral membranes of Madin-Darby canine kidney (MDCK) cells by means of a sequence derived from the aquaporin AQP4. The fusion of pH-sensitive EYFP with pH-insensitive ECFP allows ratiometric pH measurements. The titration curve of pHCECSensor01 in vivo had a pK (a) value of 6.5 +/- 0.04. Only minor effects of extracellular chloride on pHCECSensor01 were observed around the physiological concentrations of this anion. In MDCK cells, the sensor was able to detect changes in pH secondary to H(+) efflux into the basolateral spaces elicited by an ammonium prepulse or lactate load. This genetically encoded sensor has the potential to serve as a noninvasive tool for monitoring changes in extracellular pH microdomains in epithelial and other tissues in vivo.
Radiolabelling and PET brain imaging of the α1-adrenoceptor antagonist Lu AE43936
International Nuclear Information System (INIS)
Risgaard, Rune; Ettrup, Anders; Balle, Thomas; Dyssegaard, Agnete; Hansen, Hanne Demant; Lehel, Szabolcs; Madsen, Jacob; Pedersen, Henrik; Püschl, Ask; Badolo, Lassina; Bang-Andersen, Benny; Knudsen, Gitte Moos; Kristensen, Jesper Langgaard
2013-01-01
Cerebral α 1 -adrenoceptors are a common target for many antipsychotic drugs. Thus, access to positron emission tomography (PET) brain imaging of α 1 -adrenoceptors could make important contributions to the understanding of psychotic disorders as well as to the pharmacokinetics and occupancy of drugs targeting the α 1 -adrenoceptors. However, so far no suitable PET radioligand has been developed for brain imaging of α 1 -adrenoceptors. Here, we report the synthesis of both enantiomers of the desmethyl precursors of the high affinity α 1 -adrenoceptor ligand Lu AE43936 (). The two enantiomers of were subsequently [ 11 C] radiolabelled and evaluated for brain uptake and binding by PET imaging in Danish Landrace pigs. (S)-[ 11 C]- and (R)-[ 11 C]- showed very limited brain uptake. Pre-treatment with cyclosporine A (CsA) resulted in a large increase in brain uptake, indicating that (R)-[ 11 C]- is a substrate for active efflux-transporters. This was confirmed in Madin Darby canine kidney (MDCK) cells overexpressing permeability glycoprotein (Pgp). In conclusion, the limited brain uptake of both (S)-[ 11 C]- and (R)-[ 11 C]- in the pig brain necessitates the search for alternative radioligands for in vivo PET brain imaging of α 1 -adrenoceptors.
Martello, Federico; Tocchio, Alessandro; Tamplenizza, Margherita; Gerges, Irini; Pistis, Valentina; Recenti, Rossella; Bortolin, Monica; Del Fabbro, Massimo; Argentiere, Simona; Milani, Paolo; Lenardi, Cristina
2014-03-01
Poly(amido-amine) (PAA) hydrogels containing the 2,2-bisacrylamidoacetic acid-4-amminobutyl guanidine monomeric unit have a known ability to enhance cellular adhesion by interacting with the arginin-glycin-aspartic acid (RGD)-binding αVβ3 integrin, expressed by a wide number of cell types. Scientific interest in this class of materials has traditionally been hampered by their poor mechanical properties and restricted range of degradation rate. Here we present the design of novel biocompatible, RGD-mimic PAA-based hydrogels with wide and tunable degradation rates as well as improved mechanical and biological properties for biomedical applications. This is achieved by radical polymerization of acrylamide-terminated PAA oligomers in both the presence and absence of 2-hydroxyethylmethacrylate. The degradation rate is found to be precisely tunable by adjusting the PAA oligomer molecular weight and acrylic co-monomer concentration in the starting reaction mixture. Cell adhesion and proliferation tests on Madin-Darby canine kidney epithelial cells show that PAA-based hydrogels have the capacity to promote cell adhesion up to 200% compared to the control. Mechanical tests show higher compressive strength of acrylic chain containing hydrogels compared to traditional PAA hydrogels. Copyright © 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Ladino, C.A.
1988-01-01
The antitumor agent Hadacidin (H), N-formyl-hydroxyamino-acetic acid, reversibly inhibited the multiplication of clone 4 Madin-Darby canine kidney (MDCK) cells at a 4 mM concentration within 24-48 hours. Treated cells were arrested in the S phase of the cell cycle. Accompanying this action was a 16-fold increase in the area occupied b the cells and a refractoriness to trypsin treatment. To test whether this effect was due to an increase in tight junction integrity, electrical resistance (TER) was measured across H-treated monolayers. Addition of H at the onset of junction formation reversibly prevented the development of TER. ATP and cAMP levels were decreased by H, as well as the rate of [ 3 H]-leucine incorporation into protein. When 1 mM dibutyryl-cAMP (d.cAMP) and theophylline were added, H had no effect on cell division or protein synthesis, and TER was partially restored. The addition of 1 mM d.cAMP and 1 mM theophylline to control cultures decreased TER, indicating a biphasic effect on TER development/maintenance. In a separate study, the effect of sterol depletion on tight junctions formation/maintenance in wild-type MDCK cells was investigated
Castillon, Guillaume Alain; Michon, Laetitia; Watanabe, Reika
2013-06-01
Most glycosylphosphatidylinositol-anchored proteins (GPI-APs) are located at the apical surface of epithelial cells. The apical delivery of GPI-APs is believed to result from their association with lipid rafts. We find that overexpression of C-terminally tagged PGAP3 caused predominant production of lysoGPI-APs, an intermediate precursor in the GPI lipid remodeling process in Madin-Darby canine kidney cells. In these cells, produced lysoGPI-APs are not incorporated into detergent-resistant membranes (DRMs) but still are delivered apically, suggesting that GPI-AP association with DRMs is not necessary for apical targeting. In contrast, apical transport of both fully remodeled and lyso forms of GPI-APs is dependent on N-glycosylation, confirming a general role of N-glycans in apical protein transport. We also find that depletion of cholesterol causes apical-to-basolateral retargeting not only of fully remodeled GPI-APs, but also of lysoGPI-APs, as well as endogenous soluble and transmembrane proteins that would normally be targeted to the apical membrane. These findings confirm the essential role for cholesterol in the apical protein targeting and further demonstrate that the mechanism of cholesterol-dependent apical sorting is not related to DRM association of GPI-APs.
Morris, Brian J; Wamai, Richard G; Krieger, John N; Banerjee, Joya; Klausner, Jeffrey D
2017-10-01
An article by Darby disparaging male circumcision (MC) for syphilis prevention in Victorian times (1837-1901) and voluntary medical MC programs for HIV prevention in recent times ignores contemporary scientific evidence. It is one-sided and cites outlier studies as well as claims by MC opponents that support the author's thesis, but ignores high quality randomised controlled trials and meta-analyses. While we agree with Darby that risky behaviours contribute to syphilis and HIV epidemics, there is now compelling evidence that MC helps reduce both syphilis and HIV infections. Although some motivations for MC in Victorian times were misguided, others, such as protection against syphilis, penile cancer, phimosis, balanitis and poor hygiene have stood the test of time. In the absence of a cure or effective prophylactic vaccine for HIV, MC should help lower heterosexually acquired HIV, especially when coupled with other interventions such as condoms and behaviour. This should save lives, as well as reducing costs and suffering. In contrast to Darby, our evaluation of the evidence leads us to conclude that MC would likely have helped reduce syphilis in Victorian times and, in the current era, will help lower both syphilis and HIV, so improving global public health.
DEFF Research Database (Denmark)
Koffman, Jennifer Skaarup; Christensen, Eva Arnspang; Marlar, Saw
2015-01-01
Aquaporin-5 (AQP5) facilitates passive water transport in glandular epithelia in response to secretory stimuli via intracellular pathways involving calcium release, cAMP and protein kinase A (PKA). In epithelial plasma membranes, AQP5 may be acutely regulated to facilitate water transport...... in the plasma membrane diffusion coefficient of AQP5. We aimed to test the short-term regulatory effects of the above pathways, by measuring lateral diffusion of AQP5 and an AQP5 phospho-mutant, T259A, using k-space Image Correlation Spectroscopy of quantum dot- and EGFP-labeled AQP5. Elevated cAMP and PKA...... inhibition significantly decreased lateral diffusion of AQP5, whereas T259A mutation showed opposing effects; slowing diffusion without stimulation and increasing diffusion to basal levels after cAMP elevation. Thus, lateral diffusion of AQP5 is significantly regulated by cAMP, PKA, and T259 phosphorylation...
Directory of Open Access Journals (Sweden)
Susann Kummer
Full Text Available We studied the dynamics of the proteome of influenza virus A/PR/8/34 (H1N1 infected Madin-Darby canine kidney cells up to 12 hours post infection by mass spectrometry based quantitative proteomics using the approach of stable isotope labeling by amino acids in cell culture (SILAC. We identified 1311 cell proteins and, apart from the proton channel M2, all major virus proteins. Based on their abundance two groups of virus proteins could be distinguished being in line with the function of the proteins in genesis and formation of new virions. Further, the data indicate a correlation between the amount of proteins synthesized and their previously determined copy number inside the viral particle. We employed bioinformatic approaches such as functional clustering, gene ontology, and pathway (KEGG enrichment tests to uncover co-regulated cellular protein sets, assigned the individual subsets to their biological function, and determined their interrelation within the progression of viral infection. For the first time we are able to describe dynamic changes of the cellular and, of note, the viral proteome in a time dependent manner simultaneously. Through cluster analysis, time dependent patterns of protein abundances revealed highly dynamic up- and/or down-regulation processes. Taken together our study provides strong evidence that virus infection has a major impact on the cell status at the protein level.
Genetic Characterization of Influenza A (H1N1) Pandemic 2009 Virus Isolates from Mumbai.
Gohil, Devanshi; Kothari, Sweta; Shinde, Pramod; Meharunkar, Rhuta; Warke, Rajas; Chowdhary, Abhay; Deshmukh, Ranjana
2017-08-01
Pandemic influenza A (H1N1) 2009 virus was first detected in India in May 2009 which subsequently became endemic in many parts of the country. Influenza A viruses have the ability to evade the immune response through its ability of antigenic variations. The study aims to characterize influenza A (H1N1) pdm 09 viruses circulating in Mumbai during the pandemic and post-pandemic period. Nasopharyngeal swabs positive for influenza A (H1N1) pdm 09 viruses were inoculated on Madin-Darby canine kidney cell line for virus isolation. Molecular and phylogenetic analysis of influenza A (H1N1) pdm 09 isolates was conducted to understand the evolution and genetic diversity of the strains. Nucleotide and amino acid sequences of the HA gene of Mumbai isolates when compared to A/California/07/2009-vaccine strain revealed 14 specific amino acid differences located at the antigenic sites. Amino acid variations in HA and NA gene resulted in changes in the N-linked glycosylation motif which may lead to immune evasion. Phylogenetic analysis of the isolates revealed their evolutionary position with vaccine strain A/California/07/2009 but had undergone changes gradually. The findings in the present study confirm genetic variability of influenza viruses and highlight the importance of continuous surveillance during influenza outbreaks.
Guo, Tingting; Huang, Jinhu; Zhang, Hongyu; Dong, Lingling; Guo, Dawei; Guo, Li; He, Fang; Bhutto, Zohaib Ahmed; Wang, Liping
2016-01-01
P-glycoprotein (P-gp) is one of the best-known ATP-dependent efflux transporters, contributing to differences in pharmacokinetics and drug-drug interactions. Until now, studies on pig P-gp have been scarce. In our studies, the full-length porcine P-gp cDNA was cloned and expressed in a Madin-Darby Canine Kidney (MDCK) cell line. P-gp expression was then determined in tissues and its role in the pharmacokinetics of oral enrofloxacin in pigs was studied. The coding region of pig Abcb1 gene was 3,861 bp, encoding 1,286 amino acid residues (Mw = 141,966). Phylogenetic analysis indicated a close evolutionary relationship between porcine P-gp and those of cow and sheep. Pig P-gp was successfully stably overexpressed in MDCK cells and had efflux activity for rhodamine 123, a substrate of P-gp. Tissue distribution analysis indicated that P-gp was highly expressed in brain capillaries, small intestine, and liver. In MDCK-pAbcb1 cells, enrofloxacin was transported by P-gp with net efflux ratio of 2.48 and the efflux function was blocked by P-gp inhibitor verapamil. High expression of P-gp in the small intestine could modify the pharmacokinetics of orally administrated enrofloxacin by increasing the Cmax, AUC and Ka, which was demonstrated using verapamil, an inhibitor of P-gp. PMID:27572343
Baatartsogt, Tugsbaatar; Bui, Vuong N; Trinh, Dai Q; Yamaguchi, Emi; Gronsang, Dulyatad; Thampaisarn, Rapeewan; Ogawa, Haruko; Imai, Kunitoshi
2016-10-01
Viral neuraminidase inhibitors are widely used as synthetic anti-influenza drugs for the prevention and treatment of influenza. However, drug-resistant influenza A virus variants, including H5N1 highly pathogenic avian influenza viruses (HPAIVs), have been reported. Therefore, the discovery of novel and effective antiviral agents is warranted. We screened the antiviral effects of 11 herbal tea extracts (hibiscus, black tea, tencha, rosehip tea, burdock tea, green tea, jasmine tea, ginger tea, lavender tea, rose tea and oak tea) against the H5N1 HPAIV in vitro. Among the tested extracts, only the hibiscus extract and its fractionated extract (frHibis) highly and rapidly reduced the titers of all H5 HPAIVs and low pathogenic AIVs (LPAIVs) used in the pre-treatment tests of Madin-Darby canine kidney (MDCK) cells that were inoculated with a mixture of the virus and the extract. Immunogold electron microscopy showed that anti-H5 monoclonal antibodies could not bind to the deformed H5 virus particles pretreated with frHibis. In post-treatment tests of MDCK cells cultured in the presence of frHibis after infection with H5N1 HPAIV, the frHibis inhibited viral replication and the expression of viral antigens and genes. Among the plants tested, hibiscus showed the most prominent antiviral effects against both H5 HPAIV and LPAIV.
NHS-A isoform of the NHS gene is a novel interactor of ZO-1.
Sharma, Shiwani; Koh, Katrina S Y; Collin, Caitlin; Dave, Alpana; McMellon, Amy; Sugiyama, Yuki; McAvoy, John W; Voss, Anne K; Gécz, Jozef; Craig, Jamie E
2009-08-15
Mutations in the NHS (Nance-Horan Syndrome) gene lead to severe congenital cataracts, dental defects and sometimes mental retardation. NHS encodes two protein isoforms, NHS-A and -1A that display cell-type dependent differential expression and localization. Here we demonstrate that of these two isoforms, the NHS-A isoform associates with the cell membrane in the presence of intercellular contacts and it immunoprecipitates with the tight junction protein ZO-1 in MDCK (Madin Darby Canine Kidney) epithelial cells and in neonatal rat lens. The NHS-1A isoform however is a cytoplasmic protein. Both Nhs isoforms are expressed during mouse development. Immunolabelling of developing mouse with the anti-NHS antibody that detects both isoforms revealed the protein in the developing head including the eye and brain. It was primarily expressed in epithelium including neural epithelium and certain vascular endothelium but only weakly expressed in mesenchymal cells. In the epithelium and vascular endothelium the protein associated with the cell membrane and co-localized with ZO-1, which indirectly indicates expression of the Nhs-A isoform in these structures. Membrane localization of the protein in the lens vesicle similarly supports Nhs-A expression. In conclusion, the NHS-A isoform of NHS is a novel interactor of ZO-1 and may have a role at tight junctions. This isoform is important in mammalian development especially of the organs in the head.
Pyhälä, R; Kleemola, M; Kumpulainen, V; Vartiainen, E; Lappi, S; Pönkä, A; Cantell, K
1992-01-01
Vaccination of adults (healthy female employees potentially capable of transmitting influenza to high-risk persons; n = 104) in autumn 1990 with a trivalent influenza virus vaccine containing B/Yamagata/16/88 induced a low antibody response to B/Finland/150/90, a recent variant of B/Victoria/2/87-like viruses, as compared with the antibody response to B/Finland/172/91, a current variant in the lineage of B/Yamagata/16/88-like viruses. Up to the end of the epidemic season, the antibody status declined but was still significantly better than before the vaccination. The results suggest that the vaccine strain was appropriate for the outbreak of 1990 to 1991 in Finland, but may provide unsatisfactory protection against B/Victoria/2/87-like viruses. Evidence is given that use of Madin-Darby canine kidney (MDCK)-grown virus as an antigen in the haemagglutination inhibition test (HI) may provide more reliable information about the protective antibodies than use of untreated or ether-treated egg-grown viruses. Significantly higher postvaccination and postepidemic antibody titres were recorded among subjects who exhibited the antibody before vaccination than among seronegative subjects. A significantly higher response rate among initially seronegative people than among seropositive people was recorded for antibody to B/Finland/150/90, but no clear evidence was obtained that the pre-existing antibody could have had a negative effect on the antibody production.
A novel, colorimetric neutralization assay for measuring antibodies to influenza viruses.
Lehtoranta, Liisa; Villberg, Anja; Santanen, Riitta; Ziegler, Thedi
2009-08-01
A colorimetric cell proliferation assay for measuring neutralizing antibodies to influenza viruses in human sera is described. Following a 90-min incubation, the serum-virus mixture was transferred to Madin-Darby canine kidney cells cultured in 96-well plates. After further incubation for three days, a tetrazolium salt was added to the wells. Cellular mitochondrial dehydrogenases cleave the tetrazolium salt to formazan, and the resulting color change is read by a spectrophotometer. The absorbance values correlate directly to the number of viable cells in the assay well and thus also to the neutralizing activity of influenza-specific antibodies present in the serum. With the few hands-on manipulations required, this assay allows simultaneous testing of a considerable number of sera, offers opportunities for automation, and is suitable for use under biosafety level-3 conditions. The test was used to study the antibody response after the administration of seasonal, inactivated, trivalent influenza vaccine. Antibody titers determined by the neutralization test in pre- and post-vaccination serum pairs were compared with those obtained by the hemagglutination inhibition assay. The neutralization test yielded higher pre- and post-vaccination titers and a larger number of significant increases in post-vaccination antibody titer than the hemagglutination inhibition test. This new test format could serve as a valuable laboratory tool for influenza vaccine studies.
Gregersen, Jens-Peter
2008-06-19
A risk-assessment model has demonstrated the ability of a new cell culture-based vaccine manufacturing process to reduce the level of any adventitious agent to a million-fold below infectious levels. The cell culture-derived subunit influenza vaccine (OPTAFLU), Novartis Vaccines and Diagnostics) is produced using Madin-Darby canine kidney (MDCK) cells to propagate seasonal viral strains, as an alternative to embryonated chicken-eggs. As only a limited range of mammalian viruses can grow in MDCK cells, similar to embryonated eggs, MDCK cells can act as an effective filter for a wide range of adventitious agents that might be introduced during vaccine production. However, the introduction of an alternative cell substrate (for example, MDCK cells) into a vaccine manufacturing process requires thorough investigations to assess the potential for adventitious agent risk in the final product, in the unlikely event that contamination should occur. The risk assessment takes into account the entire manufacturing process, from initial influenza virus isolation, through to blending of the trivalent subunit vaccine and worst-case residual titres for the final vaccine formulation have been calculated for >20 viruses or virus families. Maximum residual titres for all viruses tested were in the range of 10(-6) to 10(-16) infectious units per vaccine dose. Thus, the new cell culture-based vaccine manufacturing process can reduce any adventitious agent to a level that is unable to cause infection.
Suspension culture process for H9N2 avian influenza virus (strain Re-2).
Wang, Honglin; Guo, Suying; Li, Zhenguang; Xu, Xiaoqin; Shao, Zexiang; Song, Guicai
2017-10-01
H9N2 avian influenza virus has caused huge economic loss for the Chinese poultry industry since it was first identified. Vaccination is frequently used as a control method for the disease. Meanwhile suspension culture has become an important tool for the development of influenza vaccines. To optimize the suspension culture conditions for the avian influenza H9N2 virus (Re-2 strain) in Madin-Darby Canine Kidney (MDCK) cells, we studied the culture conditions for cell growth and proliferation parameters for H9N2 virus replication. MDCK cells were successfully cultured in suspension, from a small scale to industrial levels of production, with passage time and initial cell density being optimized. The influence of pH on the culture process in the reactor has been discussed and the process parameters for industrial production were explored via amplification of the 650L reactor. Subsequently, we cultivated cells at high cell density and harvested high amounts of virus, reaching 10log2 (1:1024). Furthermore an animal experiment was conducted to detect antibody. Compared to the chicken embryo virus vaccine, virus cultured from MDCK suspension cells can produce a higher amount of antibodies. The suspension culture process is simple and cost efficient, thus providing a solid foundation for the realization of large-scale avian influenza vaccine production.
Hessel, Stefanie; Gottschalk, Christoph; Schumann, Dania; These, Anja; Preiss-Weigert, Angelika; Lampen, Alfonso
2014-05-01
1,2-Unsaturated pyrrolizidine alkaloids (PA) are found in plants such as Asteraceae and Boraginaceae families. Acute PA poisoning via contaminated food or feed causes severe damage to liver depending on species-specific oral bioavailability. For assessing PA bioavailability, their passage across the intestinal barrier was investigated using Caco-2 cells. Differentiated Caco-2 cells were exposed in transport chambers to the PA heliotrine (Hn), echimidine (Em), senecionine (Sc), and senkirkine (Sk). Cell supernatants were analyzed by LC-MS/MS. PA pass Caco-2 monolayer from the apical into basolateral compartment depending on their chemical structure. Compared to the cyclic diesters Sc and Sk with a passage rate of 47% ± 4 and 40% ± 3, respectively, the transferred amount of the monoester Hn (32% ± 3) and open-chained diester Em (13% ± 2) was substantially lower. This suggested an active transport of Hn and Em. Using Madin-Darby canine kidney II/P-glycoprotein (ABCB1)-overexpressing cells, the active excretion of Hn and Em by ABCB1 from the gastrointestinal epithelium into the gut lumen was shown. PA cross the intestinal barrier structure-dependently. The passage of the noncyclic PA Hn and Em is reduced by an ABCB1-driven efflux into the gastrointestinal lumen resulting in a decreased oral bioavailability. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Leonardo Pisani
2016-03-01
Full Text Available The need for developing real disease-modifying drugs against neurodegenerative syndromes, particularly Alzheimer’s disease (AD, shifted research towards reliable drug discovery strategies to unveil clinical candidates with higher therapeutic efficacy than single-targeting drugs. By following the multi-target approach, we designed and synthesized a novel class of dual acetylcholinesterase (AChE-monoamine oxidase B (MAO-B inhibitors through the decoration of the 2H-chromen-2-one skeleton. Compounds bearing a propargylamine moiety at position 3 displayed the highest in vitro inhibitory activities against MAO-B. Within this series, derivative 3h emerged as the most interesting hit compound, being a moderate AChE inhibitor (IC50 = 8.99 µM and a potent and selective MAO-B inhibitor (IC50 = 2.8 nM. Preliminary studies in human neuroblastoma SH-SY5Y cell lines demonstrated its low cytotoxicity and disclosed a promising neuroprotective effect at low doses (0.1 µM under oxidative stress conditions promoted by two mitochondrial toxins (oligomycin-A and rotenone. In a Madin-Darby canine kidney (MDCKII-MDR1 cell-based transport study, Compound 3h was able to permeate the BBB-mimicking monolayer and did not result in a glycoprotein-p (P-gp substrate, showing an efflux ratio = 0.96, close to that of diazepam.
Low Prevalence of Enzootic Equine Influenza Virus among Horses in Mongolia
Directory of Open Access Journals (Sweden)
Alexandra Sack
2017-11-01
Full Text Available Horses are critically important for Mongolian herders’ livelihoods, providing transportation and food products, and playing important cultural roles. Equine influenza virus (EIV epizootics have been frequent among Mongolia’s horses, with five occurring since 1970. We sought to estimate the prevalence for EIV infection among horses and Bactrian camels with influenza-like illness between national epizootics. In 2016–2017, active surveillance for EIV was periodically performed in four aimags (provinces. Nasal swabs were collected from 680 horses and 131 camels. Seven of the horse swabs were “positive” for qRT-PCR evidence of influenza A (Ct value ≤ 38. Two more were “suspect positive” (Ct value > 38 and ≤ 40. These nine specimens were collected from four aimags. None of the camel specimens had molecular evidence of infection. Despite serial blind passage in Madin-Darby Canine Kidney cells (MDCK cells, none of the nine horse specimens yielded an influenza A virus. None of the 131 herder households surveyed had recently vaccinated their horses against EIV. It seems likely that sporadic EIV is enzootic in multiple Mongolian aimags. This finding, the infrequent use of EIV vaccination, periodic prevalence of highly pathogenic avian influenza, and the mixing of domestic and wild equid herds suggest that Mongolia may be a hot spot for novel EIV emergence.
Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo
2018-01-23
To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.
Directory of Open Access Journals (Sweden)
Mostfa Shahabi
2017-09-01
Full Text Available Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planmeca Romexis Viewer 4.0. Furthermore, crown shape as well as root length and anatomy of the lateral incisors adjacent to impacted canines were investigated and compared with the other side on the dental arch, where canine eruption was normal. Results: Root length of impacted canines was significantly lower than that of normal canines (P=0.011. There were no significant differences between root length of lateral incisors adjacent to impacted canines and root length of lateral incisors adjacent to normal canines (P=0.221. Moreover, the resorption intensity of the adjacent lateral incisors was higher than that of the impacted canines. No significant differences were noted in root resorption intensity between the lateral incisors adjacent to the imacted canines and the lateral incisors adjacent to normal canines (P=0.36. In addition, resorption intensity was significantly higher in impacted canines than in normal canines (P=0.024. Root anatomy of impacted canines was not significantly different from that of normal canines (P=0.055. The crown shape of the lateral incisors adjacent to impacted canines was not significantly different from that of the lateral incisors adjacent to normal canines (P=0.052. Conclusion: Impaction can probably affect root length and canine resorption severity. However, root and crown shape of lateral incisors cannot always be associated with canine impaction.
Xiao, Ruyue; Yuan, Lan; He, Weijiang; Yang, Xiaoda
2018-01-24
Zinc is an essential trace element presenting in particularly high concentration in the brain. In some regions, e.g. lateral amygdala, subiculum and hippocampus, rapidly-exchangeable zinc may transiently reach even up to 600 μM. To explore the possible roles of high-concentration Zn 2+ in regulating the blood-brain barrier (BBB), we investigated the effects of Zn 2+ on the functions and structures of the tight junction (TJ) with an in vitro model of a Madin-Darby canine kidney (MDCK) cell monolayer. The experimental results indicated that high concentrations (>200 μM) of Zn 2+ can affect the TJ integrity in a polarized manner. Basolateral addition of Zn 2+ led to reversible TJ opening with pore paths of r ∼ 2 nm or more depending on Zn 2+ concentration. The efflux/influx ratios of different sized probes were found to be ∼4.6 for FD4 (M W 4000) and ∼1.8 for Eu-DTPA (M W 560), suggesting that the Zn 2+ -induced paracelluar channels favour efflux especially for macromolecules. Further mechanistic studies revealed that the elevated intracellular Zn 2+ taken from the basolateral side can increase phosphorylation of glycogen synthase kinase (GSK) 3β, primarily due to the inhibition of calcineurin (CaN), thus resulting in the elevation of the snail transcriptional repressors. Subsequently, Zn 2+ can cause the down-regulation of claudin-1, breakage of occludin and ZO-1 rings, and collapse of basolateral F-actin structures. These overall factors result in the formation of a trumpet-like paracellular channel, which allows asymmetric solute permeation. The ERK1/2 and JNK1/2 pathways may also be involved in the Zn 2+ -induced TJ opening process, while the activation of matrix metalloproteinase was not observed. Our results may suggest a potential role of zinc in regulation of BBB permeability associated with brain clearance of metabolites through the glymphatic system.
Dietzel, Erik; Anderson, Danielle E; Castan, Alexandre; von Messling, Veronika; Maisner, Andrea
2011-07-01
In paramyxoviruses, the matrix (M) protein mediates the interaction between the envelope and internal proteins during particle assembly and egress. In measles virus (MeV), M mutations, such as those found in subacute sclerosing panencephalitis (SSPE) strains, and differences in vaccine and wild-type M proteins can affect the strength of interaction with the envelope glycoproteins, assembly efficiency, and spread. However, the contribution of the M protein to the replication and pathogenesis of the closely related canine distemper virus (CDV) has not been characterized. To this end this, we generated a recombinant wild-type CDV carrying a vaccine strain M protein. The recombinant virus retained the parental growth phenotype in VerodogSLAMtag cells, but displayed an increased particle-to-infectivity ratio very similar to that of the vaccine strain, likely due to inefficient H protein incorporation. Even though infectious virus was released only from the apical surface, consistent with the release polarity of the wild-type CDV strain, envelope protein distribution in polarized epithelial cells reproduced the bipolar pattern seen in vaccine strain-infected cells. Most notably, the chimeric virus was completely attenuated in ferrets and caused only a mild and transient leukopenia, indicating that the differences in particle infectivity and envelope protein sorting mediated by the vaccine M protein contribute importantly to vaccine strain attenuation.
Prosser, C; Stelwagen, K; Cummins, R; Guerin, P; Gill, N; Milne, C
2004-02-01
Male Sprague-Dawley rats were assigned to one of three dietary groups [standard diet (Cont; n = 8), standard diet plus bovine colostrum powder (BColost 1.7 g/kg; n = 8), or goat milk powder (GMilk 1.7 g/kg; n = 8)] to determine the ability of these supplements to reduce gastrointestinal hyperpermeability induced by heat. Raising core body temperature of rats to 41.5 degrees C increased transfer of (51)Cr-EDTA from gut into blood 34-fold relative to the ambient temperature value (P transferred into the blood of rats in either the BColost (27% of Cont) or GMilk group (10% of Cont) after heating, showing that prior supplementation with either bovine colostrum or goat milk powder significantly reduced the impact of heat stress on gastrointestinal permeability. The changes in the BColost group were not significantly different than those of the GMilk group. The potential mechanism of the protective effect of bovine colostrum and goat milk powders may involve modulation of tight junction permeability, because both powders were able to maintain transepithelial resistance in Madin Darby canine kidney cells challenged with EGTA compared with cells maintained in media only. The results show that bovine colostrum powder can partially alleviate the effects of hyperthermia on gastrointestinal permeability in the intact animal. Moreover, goat milk powder was equally as effective as bovine colostrum powder, and both may be of benefit in other situations where gastrointestinal barrier function is compromised.
Khurana, Surender; Loving, Crystal L; Manischewitz, Jody; King, Lisa R; Gauger, Phillip C; Henningson, Jamie; Vincent, Amy L; Golding, Hana
2013-08-28
Vaccine-induced disease enhancement has been described in connection with several viral vaccines in animal models and in humans. We investigated a swine model to evaluate mismatched influenza vaccine-associated enhanced respiratory disease (VAERD) after pH1N1 infection. Vaccinating pigs with whole inactivated H1N2 (human-like) virus vaccine (WIV-H1N2) resulted in enhanced pneumonia and disease after pH1N1 infection. WIV-H1N2 immune sera contained high titers of cross-reactive anti-pH1N1 hemagglutinin (HA) antibodies that bound exclusively to the HA2 domain but not to the HA1 globular head. No hemagglutination inhibition titers against pH1N1 (challenge virus) were measured. Epitope mapping using phage display library identified the immunodominant epitope recognized by WIV-H1N2 immune sera as amino acids 32 to 77 of pH1N1-HA2 domain, close to the fusion peptide. These cross-reactive anti-HA2 antibodies enhanced pH1N1 infection of Madin-Darby canine kidney cells by promoting virus membrane fusion activity. The enhanced fusion activity correlated with lung pathology in pigs. This study suggests a role for fusion-enhancing anti-HA2 antibodies in VAERD, in the absence of receptor-blocking virus-neutralizing antibodies. These findings should be considered during the evaluation of universal influenza vaccines designed to elicit HA2 stem-targeting antibodies.
Matsui, Ryutaro; Hattori, Ryutaro; Usami, Youhei; Koyama, Masumi; Hirayama, Yuki; Matsuba, Emi; Hashimoto, Yukiya
2018-02-01
We have recently found an H + /quinidine (a lipophilic cation, QND) antiport system in Madin-Darby canine kidney (MDCK) cells. The primary aim of the present study was to evaluate whether the H + /lipophilic cation antiport system is expressed in porcine LLC-PK 1 cells. That is, we investigated uptake and/or efflux of QND and another cation, bisoprolol, in LLC-PK 1 cells. In addition, we studied the renal clearance of bisoprolol in rats. Uptake of QND into LLC-PK 1 cells was decreased by acidification of the extracellular pH or alkalization of the intracellular pH. Cellular uptake of QND from the apical side was much greater than from the basolateral side. In addition, apical efflux of QND from LLC-PK 1 cells was increased by acidification of the extracellular pH. Furthermore, lipophilic cationic drugs significantly reduced uptake of bisoprolol in LLC-PK 1 cells. Renal clearance of bisoprolol in rats was approximately 7-fold higher than that of creatinine, and was markedly decreased by alkalization of the urine pH. The present study suggests that the H + /lipophilic cation antiport system is expressed in the apical membrane of LLC-PK 1 cells. Moreover, the H + /lipophilic cation antiport system may be responsible for renal tubular secretion of bisoprolol in rats. Copyright © 2017 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.
Antiviral Protein of Momordica charantia L. Inhibits Different Subtypes of Influenza A
Directory of Open Access Journals (Sweden)
Viroj Pongthanapisith
2013-01-01
Full Text Available The new antiviral activity of the protein extracted from Momordica charantia was determined with different subtypes of influenza A. The protein was purified from the seed of M. charantia using an anion exchanger and a Fast Protein Liquid Chromatography (FPLC system. At the concentration of 1.401 mg/mL, the protein did not exhibit cytotoxicity in Madin-Darby canine kidney cells (MDCK but inhibited FFU influenza A/PR/8/34 H1N1 virus at 56.50%, 65.72%, and 100% inhibition by the protein treated before the virus (pretreated, the protein treated alongside with the virus (simultaneously treated, and the protein treated after the virus (posttreated during incubation, respectively. Using 5, 25, and 100 TCID50 of influenza A/New Caledonia/20/99 H1N1, A/Fujian/411/01 H3N2 and A/Thailand/1(KAN-1/2004 H5N1, the IC50 was calculated to be 100, 150, and 200; 75, 175, and 300; and 40, 75, and 200 μg/mL, respectively. Our present finding indicated that the plant protein inhibited not only H1N1 and H3N2 but also H5N1 subtype. As a result of the broad spectrum of its antiviral activity, this edible plant can be developed as an effective therapeutic agent against various and even new emerging subtypes of influenza A.
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, Anne-Marie; Renkema, Alianne; Bronkhorst, Ewald; Katsaros, Christos
Introduction: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Long-term effectiveness of canine-to-canine bonded flexible spiral wire lingual retainers
Renkema, A.M.; Bronkhorst, E.M.; Katsaros, C.
2011-01-01
INTRODUCTION: The flexible spiral wire (FSW) canine-to-canine lingual retainer bonded to all 6 anterior teeth is a frequently used type of mandibular fixed retainer. This study aimed to assess the long-term effectiveness of FSW canine-to-canine lingual retainers in maintaining the alignment of the
Mouse Model for Aerosol Infection of Influenza (Postprint)
2011-12-01
quantified by cell culture end- point–dilution assays performed using Madin–Darby canine kidney (MDCK) cells and calculated using the Spearman–Kärber...viduals with underlying conditions such as obesity and or diabetes (Jhung et al. 2011). Influenza A (H1N1) virus selected for this study was chosen based on
Mostfa Shahabi; Maryam Omidkhoda; Seyedeh Haniyeh Omidi; Seyed Hosein Hoseini Zarch
2017-01-01
Introduction: Canine impaction is a common occurrence. In this study, we sought to investigate the root anatomy and length of impacted canines and lateral incisor adjacent to impacted maxillary canine. Materials and Methods: In this retrospective study, three-dimensional tomographic imaging was performed on 26 patients with unilateral maxillary canine impaction. In this study, we evaluated root length and anatomy of impacted canines, in terms of resorption intensity and curvature, with Planme...
Eimeria tenella: in vitro development in irradiated bovine kidney cells
Energy Technology Data Exchange (ETDEWEB)
Crane, M.St.J.; Schmatz, D.M.; Stevens, S.; Habbersett, M.C.; Murray, P.K. (Merck Sharp and Dohme Research Labs., Rahway, NJ (USA))
1984-06-01
The initial infection and first-generation development of Eimeria tenella was quantified using a cloned MDBK (Madin-Darby Bovine Kidney) cell line, irradiated with gamma radiation prior to infection, as the host cell. Irradiated cell cultures were found to be more susceptible to infection and had a greater capacity to support parasite development than non-irradiated cultures. It was suggested that the larger proportion of cells in the G/sub 2/ phase of the cell cycle, the larger individual cell size and the inhibition of cell division in the irradiated cultures were all factors contributing to the increased susceptibility to infection and capacity to support parasite growth and development. The application of this technique (host cell irradiation) to the cultivation of other intracellular, protozoan parasites is discussed.
Eimeria tenella: in vitro development in irradiated bovine kidney cells
International Nuclear Information System (INIS)
Crane, M. St.J.; Schmatz, D.M.; Stevens, S.; Habbersett, M.C.; Murray, P.K.
1984-01-01
The initial infection and first-generation development of Eimeria tenella was quantified using a cloned MDBK (Madin-Darby Bovine Kidney) cell line, irradiated with gamma radiation prior to infection, as the host cell. Irradiated cell cultures were found to be more susceptible to infection and had a greater capacity to support parasite development than non-irradiated cultures. It was suggested that the larger proportion of cells in the G 2 phase of the cell cycle, the larger individual cell size and the inhibition of cell division in the irradiated cultures were all factors contributing to the increased susceptibility to infection and capacity to support parasite growth and development. The application of this technique (host cell irradiation) to the cultivation of other intracellular, protozoan parasites is discussed. (author)
Upadhyay, B P; Ghimire, P; Tashiro, M; Banjara, M R
2017-01-01
Influenza is one of the public health burdens in Nepal and its epidemiology is not clearly understood. The objective of this study was to explore the molecular epidemiology and the antigenic characteristics of the circulating influenza viruses in Nepal. A total of 1495 throat swab specimens were collected from January to December, 2014. Real time PCR assay was used for identification of influenza virus types and subtypes. Ten percent of the positive specimens were randomly selected and inoculated onto Madin-Darby Canine Kidney Epithelial cells (MDCK) for influenza virus isolation. All viruses were characterized by the hemagglutination inhibition (HI) assay. Influenza viruses were detected in 421/1495 (28.2%) specimens. Among positive cases, influenza A virus was detected in 301/421 (71.5%); of which 120 (39.9%) were influenza A/H1N1 pdm09 and 181 (60.1%) were influenza A/H3 subtype. Influenza B viruses were detected in 119/421 (28.3%) specimens. Influenza A/H1N1 pdm09, A/H3 and B viruses isolated in Nepal were antigenically similar to the vaccine strain influenza A/California/07/2009(H1N1pdm09), A/Texas/50/2012(H3N2), A/New York/39/2012(H3N2) and B/Massachusetts/2/2012, respectively. Influenza viruses were reported year-round in different geographical regions of Nepal which was similar to other tropical countries. The circulating influenza virus type and subtypes of Nepal were similar to vaccine candidate virus which could be prevented by currently used influenza vaccine.
International Nuclear Information System (INIS)
Wu, C.-C.; Su, H.-W.; Lee, C.-C.; Tang, M.-J.; Su, F.-C.
2005-01-01
Focal adhesion kinase (FAK) is a critical protein for the regulation of integrin-mediated cellular functions and it can enhance cell motility in Madin-Darby canine kidney (MDCK) cells by hepatocyte growth factor (HGF) induction. We utilized optical trapping and cytodetachment techniques to measure the adhesion force between pico-Newton and nano-Newton (nN) for quantitatively investigating the effects of FAK on adhesion force during initial binding (5 s), beginning of spreading (30 min), spreadout (12 h), and migration (induced by HGF) in MDCK cells with overexpressed FAK (FAK-WT), FAK-related non-kinase (FRNK), as well as normal control cells. Optical tweezers was used to measure the initial binding force between a trapped cell and glass coverslide or between a trapped bead and a seeded cell. In cytodetachment, the commercial atomic force microscope probe with an appropriate spring constant was used as a cyto-detacher to evaluate the change of adhesion force between different FAK expression levels of cells in spreading, spreadout, and migrating status. The results demonstrated that FAK-WT significantly increased the adhesion forces as compared to FRNK cells throughout all the different stages of cell adhesion. For cells in HGF-induced migration, the adhesion force decreased to almost the same level (∼600 nN) regardless of FAK levels indicating that FAK facilitates cells to undergo migration by reducing the adhesion force. Our results suggest FAK plays a role of enhancing cell adhesive ability in the binding and spreading, but an appropriate level of adhesion force is required for HGF-induced cell migration
Slater, Tessa; Eckerle, Isabella; Chang, Kin-Chow
2018-04-10
With the recent discovery of novel H17N10 and H18N11 influenza viral RNA in bats and report on high frequency of avian H9 seroconversion in a species of free ranging bats, an important issue to address is the extent bats are susceptible to conventional avian and human influenza A viruses. To this end, three bat species (Eidolon helvum, Carollia perspicillata and Tadarida brasiliensis) of lung epithelial cells were separately infected with two avian and two human influenza viruses to determine their relative host innate immune resistance to infection. All three species of bat cells were more resistant than positive control Madin-Darby canine kidney (MDCK) cells to all four influenza viruses. TB1-Lu cells lacked sialic acid α2,6-Gal receptors and were most resistant among the three bat species. Interestingly, avian viruses were relatively more replication permissive in all three bat species of cells than with the use of human viruses which suggest that bats could potentially play a role in the ecology of avian influenza viruses. Chemical inhibition of the JAK-STAT pathway in bat cells had no effect on virus production suggesting that type I interferon signalling is not a major factor in resisting influenza virus infection. Although all three species of bat cells are relatively more resistant to influenza virus infection than control MDCK cells, they are more permissive to avian than human viruses which suggest that bats could have a contributory role in the ecology of avian influenza viruses.
DEFF Research Database (Denmark)
Hillström, Anna; Hagman, Ragnvi; Tvedten, Harold
2014-01-01
BACKGROUND: Measurement of C-reactive protein (CRP) is used for diagnosing and monitoring systemic inflammatory disease in canine patients. An automated human immunoturbidimetric assay has been validated for measuring canine CRP, but cross-reactivity with canine CRP is unpredictable. OBJECTIVE......: The purpose of the study was to validate a new automated canine-specific immunoturbidimetric CRP method (Gentian cCRP). METHODS: Studies of imprecision, accuracy, prozone effect, interference, limit of quantification, and stability under different storage conditions were performed. The new method was compared...... with a human CRP assay previously validated for canine CRP determination. Samples from 40 healthy dogs were analyzed to establish a reference interval. RESULTS: Total imprecision was
Directory of Open Access Journals (Sweden)
Ahmad, S.Z.
2008-01-01
Full Text Available There is limited empirical research on the internationalisation processes, strategies and operations of Asian multinational corporations (MNCs, particularly MNC’s based in Malaysia. The emergence and development of an MNC from this developing country represents a significant addition to the literature on this topic which augments and supplements the information already available with regard to nascent MNCs from Asian Newly Industrialised Countries (NIC’s. Drawing on primary data from in-depth interviews with 12 key executives from Sime Darby Berhad (SDB, a developing Malaysian-based MNC, this paper will examine and investigate the firm’s internationalisation process, its characteristics and strategies, including motivations, patterns, and sources of competitive advantage. The empirical findings, limitations and areas for further research are discussed.
Larson, L J; Schultz, R D
2007-01-01
A group of client-owned dogs and a group of dogs at a commercial kennel were evaluated for duration of antibody responses against canine parvovirus type 2 (CPV-2) and canine adenovirus type 1 (CAV-1) after receiving a combination vaccine containing recombinant canarypox-vectored canine distemper virus (CDV) and modified-live CPV-2, CAV-2, and canine parainfluenza virus, with (C6) or without (C4) two serovars of Leptospira (Recombitek C4 or C6, Merial). Duration of antibody, which correlates with protective immunity, was found to be at least 36 months in both groups. Recombitek combination vaccines can confidently be given every 3 years with assurance of protection in immunocompetent dogs against CPV-2 and CAV-1 as well as CDV. This allows this combination vaccine, like other, similar modified- live virus combination products containing CDV, CAV-2, and CPV-2, to be administered in accordance with the recommendations of the American Animal Hospital Association Canine Vaccine Task Force.
Directory of Open Access Journals (Sweden)
Anna McRee
2014-09-01
Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A
2014-09-05
Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.
Webb, Craig; Twedt, David C
2003-09-01
Gastritis--inflammation of the stomach--is a frequently cited differential yet rarely characterized diagnosis in cases of canine anorexia and vomiting. Although the list of rule-outs for acute or chronic gastritis is extensive, a review of the veterinary literature reveals fewer than 15 articles that have focused on clinical cases of canine gastritis over the last 25 years. The dog frequently appears in the human literature as an experimentally manipulated model for the study of endoscopic techniques or the effect of medications on gastric mucosa. In the veterinary patient, cases of acute gastritis are rarely pursued with the complete diagnostic armamentarium, and cases of chronic gastritis are rarely found to occur as an entity isolated from the rest of the gastrointestinal tract. This article focuses on those findings most clinically relevant to cases of canine gastritis in veterinary medicine.
Varied clinico-radiological presentations of transmigrated canines
Directory of Open Access Journals (Sweden)
Ishita Gupta
2015-01-01
Full Text Available Canine is one of the most commonly impacted teeth in the dental arch. An unerupted permanent canine crossing the midline is called transmigration and is an unusual event. We report nine cases of impacted canine transmigration. Maxillary canine transmigration, bilateral transmigration, and transmigration associated with odontoma are rare presentations. This article discusses the varied clinico-radiologic presentations, etiology, and treatment options of transmigration. It also emphasizes the importance of panoramic radiographs for evaluation of over-retained deciduous canines or missing permanent canines.
Development of the canine tooth in the beagle
International Nuclear Information System (INIS)
Amimoto, A.; Iwamoto, S.; Hachimura, H.; Miyamoto, T.; Murata, T.; Taura, Y.; Nakama, S.; Hayashi, K.
1993-01-01
The growth of the crown and root in the canine tooth of beagle dogs were observed macroscopically and radiographically, and changes of occlusion with age were investigated. Completion of growth in the crown of the canine tooth was observed in both mandible and maxilla, and its eruption was accompanied by development of the dental root. The permanent canine erupted on the lingual side of deciduous canine in the mandible, and on the mesial side of the deciduous canine in the maxilla. Movement of the permanent canine to normal occlusal position(buccal direction in mandibular canine, and distal direction in maxillary canine)was followed by the loss of the deciduous canine. Coexistence of the permanent and deciduous canines occurred for about 2.4 weeks in the maxilla and about 1.4 weeks in the mandible, on average. Macroscopically, the growth of the permanent canine was completed by 33 weeks of age in the mandible and about 34 weeks of age in the maxilla. The mature root of the permanent canine was recognized radiographically at about 43 weeks of age in the mandible and 47 weeks of age in the maxilla
Ontogeny of canine dimorphism in extant hominoids.
Schwartz, G T; Dean, C
2001-07-01
Many behavioral and ecological factors influence the degree of expression of canine dimorphism for different reasons. Regardless of its socioecological importance, we know virtually nothing about the processes responsible for the development of canine dimorphism. Our aim here is to describe the developmental process(es) regulating canine dimorphism in extant hominoids, using histological markers of tooth growth. Teeth preserve a permanent record of their ontogeny in the form of short- and long-period incremental markings in both enamel and dentine. We selected 52 histological sections of sexed hominoid canine teeth from a total sample of 115, from which we calculated the time and rate of cuspal enamel formation and the rate at which ameloblasts differentiate along the future enamel-dentine junction (EDJ) to the end of crown formation. Thus, we were able to reconstruct longitudinal growth curves for height attainment in male and female hominoid canines. Male hominoids consistently take longer to form canine crowns than do females (although not significantly so for our sample of Homo). Male orangutans and gorillas occasionally take up to twice as long as females to complete enamel formation. The mean ranges of female canine crown formation times are similar in Pan, Gorilla, and Pongo. Interspecific differences between female Pan canine crown heights and those of Gorilla and Pongo, which are taller, result from differences in rates of growth. Differences in canine crown heights between male Pan and the taller, more dimorphic male Gorilla and Pongo canines result both from differences in total time taken to form enamel and from faster rates of growth in Gorilla and Pongo. Although modern human canines do not emerge as significantly dimorphic in this study, it is well-known that sexual dimorphism in canine crown height exists. Larger samples of sexed modern human canines are therefore needed to identify clearly what underlies this. Copyright 2001 Wiley-Liss, Inc.
Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2005-01-01
A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki
2012-08-01
Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Bilateral supernumerary primary maxillary canines
Directory of Open Access Journals (Sweden)
Santanu Mukhopadhyay
2018-01-01
Full Text Available Supernumerary teeth are more common in the permanent than in primary dentition. In the primary dentition, the anomaly is most frequently observed in the maxillary lateral incisor region, followed by the maxillary midline where they are termed as mesiodens. Supernumerary teeth in the primary canine region are rare. This paper describes a rare case of nonsyndromic supernumerary primary maxillary canine distributed bilaterally in a 4-year-old boy. Both the supernumeraries resembled size and shape of normal primary canine. The right supplemental canine is high labially placed, whereas the left one is seen normally aligned in the dental arch distal to lateral incisor. One of the most significant sequelae of primary supernumerary teeth is their duplication in the permanent series. Radiographic examination of supernumerary primary canine did not indicate any such anomaly in the permanent dentition. The patient was kept under observation.
9 CFR 113.306 - Canine Distemper Vaccine.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...
J. Van Heerden; J. Bingham; M. Van Vuuren; R.E.J. Burroughs; E. Stylianides
2002-01-01
Wild dogs Lycaon pictus (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use ...
Characterization of the canine urinary proteome.
Brandt, Laura E; Ehrhart, E J; Scherman, Hataichanok; Olver, Christine S; Bohn, Andrea A; Prenni, Jessica E
2014-06-01
Urine is an attractive biofluid for biomarker discovery as it is easy and minimally invasive to obtain. While numerous studies have focused on the characterization of human urine, much less research has focused on canine urine. The objectives of this study were to characterize the universal canine urinary proteome (both soluble and exosomal), to determine the overlap between the canine proteome and a representative human urinary proteome study, to generate a resource for future canine studies, and to determine the suitability of the dog as a large animal model for human diseases. The soluble and exosomal fractions of normal canine urine were characterized using liquid chromatography tandem mass spectrometry (LC-MS/MS). Biological Networks Gene Ontology (BiNGO) software was utilized to assign the canine urinary proteome to respective Gene Ontology categories, such as Cellular Component, Molecular Function, and Biological Process. Over 500 proteins were confidently identified in normal canine urine. Gene Ontology analysis revealed that exosomal proteins were largely derived from an intracellular location, while soluble proteins included both extracellular and membrane proteins. Exosome proteins were assigned to metabolic processes and localization, while soluble proteins were primarily annotated to specific localization processes. Several proteins identified in normal canine urine have previously been identified in human urine where these proteins are related to various extrarenal and renal diseases. The results of this study illustrate the potential of the dog as an animal model for human disease states and provide the framework for future studies of canine renal diseases. © 2014 American Society for Veterinary Clinical Pathology and European Society for Veterinary Clinical Pathology.
Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J
2012-12-01
To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki
2011-09-01
Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.
Directory of Open Access Journals (Sweden)
Chaowalit Yuajit
Full Text Available Cyst enlargement in polycystic kidney disease (PKD involves cAMP-activated proliferation of cyst-lining epithelial cells and transepithelial fluid secretion into the cyst lumen via cystic fibrosis transmembrane conductance regulator (CFTR chloride channel. This study aimed to investigate an inhibitory effect and detailed mechanisms of steviol and its derivatives on cyst growth using a cyst model in Madin-Darby canine kidney (MDCK cells. Among 4 steviol-related compounds tested, steviol was found to be the most potent at inhibiting MDCK cyst growth. Steviol inhibition of cyst growth was dose-dependent; steviol (100 microM reversibly inhibited cyst formation and cyst growth by 72.53.6% and 38.2±8.5%, respectively. Steviol at doses up to 200 microM had no effect on MDCK cell viability, proliferation and apoptosis. However, steviol acutely inhibited forskolin-stimulated apical chloride current in MDCK epithelia, measured with the Ussing chamber technique, in a dose-dependent manner. Prolonged treatment (24 h with steviol (100 microM also strongly inhibited forskolin-stimulated apical chloride current, in part by reducing CFTR protein expression in MDCK cells. Interestingly, proteasome inhibitor, MG-132, abolished the effect of steviol on CFTR protein expression. Immunofluorescence studies demonstrated that prolonged treatment (24 h with steviol (100 microM markedly reduced CFTR expression at the plasma membrane. Taken together, the data suggest that steviol retards MDCK cyst progression in two ways: first by directly inhibiting CFTR chloride channel activity and second by reducing CFTR expression, in part, by promoting proteasomal degradation of CFTR. Steviol and related compounds therefore represent drug candidates for treatment of polycystic kidney disease.
Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells
International Nuclear Information System (INIS)
Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.
1986-01-01
The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/
Halperin, Scott A; Smith, Bruce; Mabrouk, Taoufik; Germain, Marc; Trépanier, Pierre; Hassell, Thomas; Treanor, John; Gauthier, Richard; Mills, Elaine L
2002-01-15
We performed randomized, double-blind, controlled trials to assess the safety and immunogenicity of an inactivated, Madin Darby Canine Kidney (MDCK)-derived cell line produced influenza vaccine in healthy adults (19-50 years), children (3-12 years) and the elderly (> or =65 years). We studied three lots of cell culture-derived vaccine and one lot of licensed egg-derived vaccine in healthy adults (n=462), two lots of cell culture-derived vaccine and one lot of egg-derived vaccine in seniors (n=269), and one lot of each vaccine in children (n=209). Adverse events were collected during the first 3 days post-immunization; serum was collected before and 1 month after immunization. Rates of local and systemic adverse reactions were similar with both vaccines. An injection site adverse event rated at least moderate severity was reported by 21.9% of children who received the egg-derived vaccine and 25.0% of those who received the cell culture-derived vaccine. In healthy adults the proportions were 12.1 and 15.3%, respectively and 6.7 and 6.3%, respectively in seniors. Systemic events of at least moderate severity were 12.4 and 12.5% in children, 19.8 and 13.6% in healthy adults, and 14.1 and 9.7% in seniors; none of these differences were statistically significant. The antibody response against all three viruses was similar between the two vaccines. From 83 to 100% of children, healthy adults and seniors achieved hemagglutination inhibition titers in excess of 40 post-immunization. We conclude that the cell culture-derived vaccine was safe and immunogenic in children, healthy adults and seniors.
Abolition of peroxiredoxin-5 mitochondrial targeting during canid evolution.
Directory of Open Access Journals (Sweden)
Valérie Van der Eecken
Full Text Available In human, the subcellular targeting of peroxiredoxin-5 (PRDX5, a thioredoxin peroxidase, is dependent on the use of multiple alternative transcription start sites and two alternative in-frame translation initiation sites, which determine whether or not the region encoding a mitochondrial targeting sequence (MTS is translated. In the present study, the abolition of PRDX5 mitochondrial targeting in dog is highlighted and the molecular mechanism underlying the loss of mitochondrial PRDX5 during evolution is examined. Here, we show that the absence of mitochondrial PRDX5 is generalized among the extant canids and that the first events leading to PRDX5 MTS abolition in canids involve a mutation in the more 5' translation initiation codon as well as the appearance of a STOP codon. Furthermore, we found that PRDX5 MTS functionality is maintained in giant panda and northern elephant seal, which are phylogenetically closely related to canids. Also, the functional consequences of the restoration of mitochondrial PRDX5 in dog Madin-Darby canine kidney (MDCK cells were investigated. The restoration of PRDX5 mitochondrial targeting in MDCK cells, instead of protecting, provokes deleterious effects following peroxide exposure independently of its peroxidase activity, indicating that mitochondrial PRDX5 gains cytotoxic properties under acute oxidative stress in MDCK cells. Altogether our results show that, although mitochondrial PRDX5 cytoprotective function against oxidative stress has been clearly demonstrated in human and rodents, PRDX5 targeting to mitochondria has been evolutionary lost in canids. Moreover, restoration of mitochondrial PRDX5 in dog MDCK cells, instead of conferring protection against peroxide exposure, makes them more vulnerable.
International Nuclear Information System (INIS)
Mochalova, Larisa; Gambaryan, Alexandra; Romanova, Julia; Tuzikov, Alexander; Chinarev, Alexander; Katinger, Dietmar; Katinger, Herman; Egorov, Andrej; Bovin, Nicolai
2003-01-01
To study the receptor specificity of modern human influenza H1N1 and H3N2 viruses, the analogs of natural receptors, namely sialyloligosaccharides conjugated with high molecular weight (about 1500 kDa) polyacrylamide as biotinylated and label-free probes, have been used. Viruses isolated from clinical specimens were grown in African green monkey kidney (Vero) or Madin-Darby canine kidney (MDCK) cells and chicken embryonated eggs. All Vero-derived viruses had hemagglutinin (HA) sequences indistinguishable from original viruses present in clinical samples, but HAs of three of seven tested MDCK-derived isolates had one or two amino acid substitutions. Despite these host-dependent mutations and differences in the structure of HA molecules of individual strains, all studied Vero- and MDCK-isolated viruses bound to Neu5Ac α2-6Galβ1-4GlcNAc (6'SLN) essentially stronger than to Neu5Acα2-6Galβ1-4Glc (6'SL). Such receptor-binding specificity has been typical for earlier isolated H1N1 human influenza viruses, but there is a new property of H3N2 viruses that has been circulating in the human population during recent years. Propagation of human viruses in chicken embryonated eggs resulted in a selection of variants with amino acid substitutions near the HA receptor-binding site, namely Gln226Arg or Asp225Gly for H1N1 viruses and Leu194Ile and Arg220Ser for H3N2 viruses. These HA mutations disturb the observed strict 6'SLN specificity of recent human influenza viruses
Tracking cholesterol/sphingomyelin-rich membrane domains with the ostreolysin A-mCherry protein.
Directory of Open Access Journals (Sweden)
Matej Skočaj
Full Text Available Ostreolysin A (OlyA is an ∼15-kDa protein that has been shown to bind selectively to membranes rich in cholesterol and sphingomyelin. In this study, we investigated whether OlyA fluorescently tagged at the C-terminal with mCherry (OlyA-mCherry labels cholesterol/sphingomyelin domains in artificial membrane systems and in membranes of Madin-Darby canine kidney (MDCK epithelial cells. OlyA-mCherry showed similar lipid binding characteristics to non-tagged OlyA. OlyA-mCherry also stained cholesterol/sphingomyelin domains in the plasma membranes of both fixed and living MDCK cells, and in the living cells, this staining was abolished by pretreatment with either methyl-β-cyclodextrin or sphingomyelinase. Double labelling of MDCK cells with OlyA-mCherry and the sphingomyelin-specific markers equinatoxin II-Alexa488 and GST-lysenin, the cholera toxin B subunit as a probe that binds to the ganglioside GM1, or the cholesterol-specific D4 domain of perfringolysin O fused with EGFP, showed different patterns of binding and distribution of OlyA-mCherry in comparison with these other proteins. Furthermore, we show that OlyA-mCherry is internalised in living MDCK cells, and within 90 min it reaches the juxtanuclear region via caveolin-1-positive structures. No binding to membranes could be seen when OlyA-mCherry was expressed in MDCK cells. Altogether, these data clearly indicate that OlyA-mCherry is a promising tool for labelling a distinct pool of cholesterol/sphingomyelin membrane domains in living and fixed cells, and for following these domains when they are apparently internalised by the cell.
Activation of ERK mitogen-activated protein kinase in human cells by the mycotoxin patulin
International Nuclear Information System (INIS)
Wu, T.-S.; Yu, F.-Y.; Su, C.-C.; Kan, J.-C.; Chung, C.-P.; Liu, B.-H.
2005-01-01
Patulin (PAT), a mycotoxin produced by certain species of Penicillium and Aspergillus, is often detectable in moldy fruits and their derivative products. PAT led to a concentration-dependent and time-dependent increase in phosphorylation of extracellular signal-regulated protein kinases 1 and 2 (ERK1/2) in human embryonic kidney (HEK293) cells, human peripheral blood mononuclear cells (PBMCs), and Madin-Darby canine kidney (MDCK) cells. Exposure of HEK293 cells to concentrations above 5 μM PAT for 30 min induced ERK1/2 phosphorylation; activation of ERK1/2 was also observed after 24 h incubation with 0.05 μM of PAT. Treatment of human PBMCs for 30 min with 30 μM PAT dramatically increased the phosphorylated ERK1/2 levels. Both MEK1/2 inhibitors, U0126 and PD98059, suppressed ERK1/2 activation in either HEK293 or MDCK cells. In HEK293 cells, U0126-mediated inhibition of PAT-induced ERK1/2 phosphorylation resulted in a significant decrease in levels of DNA damage, expressed as tail moment values, in the single cell gel electrophoresis assay. Conversely, U0126 did not affect cell viability, lactate dehydrogenase release, and the DNA synthesis rate in PAT-treated cultures. Exposure of HEK293 cells for 90 min to 15 μM PAT elevated the levels of early growth response gene-1 (egr-1) mRNA, but not of c-fos, fosB, and junB mRNAs. These results indicate that in human cells, PAT causes a rapid and persistent activation of ERK1/2 and this signaling pathway plays an important role in mediating PAT-induced DNA damage and egr-1 gene expression
New and emerging pathogens in canine infectious respiratory disease.
Priestnall, S L; Mitchell, J A; Walker, C A; Erles, K; Brownlie, J
2014-03-01
Canine infectious respiratory disease is a common, worldwide disease syndrome of multifactorial etiology. This review presents a summary of 6 viruses (canine respiratory coronavirus, canine pneumovirus, canine influenza virus, pantropic canine coronavirus, canine bocavirus, and canine hepacivirus) and 2 bacteria (Streptococcus zooepidemicus and Mycoplasma cynos) that have been associated with respiratory disease in dogs. For some pathogens a causal role is clear, whereas for others, ongoing research aims to uncover their pathogenesis and contribution to this complex syndrome. Etiology, clinical disease, pathogenesis, and epidemiology are described for each pathogen, with an emphasis on recent discoveries or novel findings.
Genetics of Human and Canine Dilated Cardiomyopathy.
Simpson, Siobhan; Edwards, Jennifer; Ferguson-Mignan, Thomas F N; Cobb, Malcolm; Mongan, Nigel P; Rutland, Catrin S
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
9 CFR 113.202 - Canine Hepatitis and Canine Adenovirus Type 2 Vaccine, Killed Virus.
2010-01-01
... Type 2 Vaccine, Killed Virus. 113.202 Section 113.202 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS STANDARD REQUIREMENTS Killed Virus Vaccines § 113.202 Canine Hepatitis and Canine...
Papīra darbi ka domāšanas veicinātāji pirmsskolā
Jevdokimova, Jūlija
2017-01-01
Jūlija J. (2017.) “Papīra darbi kā domāšanas veicinātāji pirmsskolā”. Kvalifikācijas darbs. Rīga: Latvijas Universitātes Pedagoģijas, psiholoģijas un mākslas fakultāte, 90 lpp, 16 att., 4 tab., bibl. 18 nos., latviešu, angļu val. Darbs sastāv no ievada, 5 nodaļām, secinājumiem un 16 pielikumiem. Autors ir vairākus mēnešus izgājis praksi pirmsskolas pedagoga amatā. Darbā ir veikts pētījums par domāšanas attīstību rokdarbu nodarbībās, veicot papīra darbus Darba mērķis ir izzināt un atklāt bēr...
Proteomic Analysis of Bovine Nucleolus
Institute of Scientific and Technical Information of China (English)
Amrutlal K.Patel; Doug Olson; Suresh K. Tikoo
2010-01-01
Nucleolus is the most prominent subnuclear structure, which performs a wide variety of functions in the eu-karyotic cellular processes. In order to understand the structural and functional role of the nucleoli in bovine cells,we analyzed the proteomie composition of the bovine nueleoli. The nucleoli were isolated from Madin Darby bo-vine kidney cells and subjected to proteomie analysis by LC-MS/MS after fractionation by SDS-PAGE and strongcation exchange chromatography. Analysis of the data using the Mascot database search and the GPM databasesearch identified 311 proteins in the bovine nucleoli, which contained 22 proteins previously not identified in theproteomic analysis of human nucleoli. Analysis of the identified proteins using the GoMiner software suggestedthat the bovine nueleoli contained proteins involved in ribosomal biogenesis, cell cycle control, transcriptional,translational and post-translational regulation, transport, and structural organization.
Adherence of Moraxella bovis to cell cultures of bovine origin.
Annuar, B O; Wilcox, G E
1985-09-01
The adherence of five strains of Moraxella bovis to cell cultures was investigated. M bovis adhered to cultures of bovine corneal epithelial and Madin-Darby bovine kidney cells but not to cell types of non-bovine origin. Both piliated and unpiliated strains adhered but piliated strains adhered to a greater extent than unpiliated strains. Antiserum against pili of one strain inhibited adherence of piliated strains but caused only slight inhibition of adherence to the unpiliated strains. Treatment of bacteria with magnesium chloride caused detachment of pili from the bacterial cell and markedly inhibited adherence of piliated strains but caused only slight inhibition of adherence by the unpiliated strains. The results suggested that adhesion of piliated strains to cell cultures was mediated via pili but that adhesins other than pili may be involved in the attachment of unpiliated strains of M bovis to cells.
Directory of Open Access Journals (Sweden)
Indrawati Sendow
2002-03-01
Full Text Available Serological survey was conducted to obtain the prevalence of Parainfluenza type 3 (PI-3 reactor as one of the causative agent of pneumonia in sheep and goats in abatoir at Jakarta and some small holder farms in Indonesia. Serological test using serum neutralization from 724 goat sera and 109 sheep sera indicated that only 1% of goats were serologically reactors and none of sheep sera had antibodies against PI-3 virus. Isolation of the virus from 56 bronchus and trachea swab and 345 lungs indicated that only one sampel from lung showed cythopathic effect (CPE in Madin Darby Bovine Kidney (MDBK cell lines identification of the virus using serum neutralization test indicated that the virus neutralized reference PI-3 antisera. The isolate came from one lung (7% of 24 that showed histopathologically pneumonia intertitialis that usually caused by viral infection.
Directory of Open Access Journals (Sweden)
J. Van Heerden
2002-07-01
Full Text Available Wild dogs Lycaon pictus (n = 8 were vaccinated 4 times against canine distemper (n = 8 (initially with inactivated and subsequently with live attenuated strains of canine distemper and canine parvovirus infection (n = 8 over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
van Heerden, J; Bingham, J; van Vuuren, M; Burroughs, R E J; Stylianides, E
2002-03-01
Wild dogs Lycaon pictuis (n = 8) were vaccinated 4 times against canine distemper (n = 8) (initially with inactivated and subsequently with live attenuated strains of canine distemper) and canine parvovirus infection (n = 8) over a period of 360 days. Four of the wild dogs were also vaccinated 3 times against rabies using a live oral vaccine and 4 with an inactivated parenteral vaccine. Commercially-available canine distemper, canine parvovirus and parenteral rabies vaccines, intended for use in domestic dogs, were used. None of the vaccinated dogs showed any untoward clinical signs. The inactivated canine distemper vaccine did not result in seroconversion whereas the attenuated live vaccine resulted in seroconversion in all wild dogs. Presumably protective concentrations of antibodies to canine distemper virus were present in all wild dogs for at least 451 days. Canine parvovirus haemagglutination inhibition titres were present in all wild dogs prior to the administration of vaccine and protective concentrations persisted for at least 451 days. Vaccination against parvovirus infection resulted in a temporary increase in canine parvovirus haemagglutination inhibition titres in most dogs. Administration of both inactivated parenteral and live oral rabies vaccine initially resulted in seroconversion in 7 of 8 dogs. These titres, however, dropped to very low concentrations within 100 days. Booster administrations resulted in increased antibody concentrations in all dogs. It was concluded that the vaccines were safe to use in healthy subadult wild dogs and that a vaccination protocol in free-ranging wild dogs should at least incorporate booster vaccinations against rabies 3-6 months after the first inoculation.
9 CFR 113.317 - Parvovirus Vaccine (Canine).
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Parvovirus Vaccine (Canine). 113.317... Virus Vaccines § 113.317 Parvovirus Vaccine (Canine). Parvovirus Vaccine recommended for use in dogs... from each dog shall be individually tested for neutralizing antibody against canine parvovirus to...
Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L
2016-11-01
The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.
Genetics of Human and Canine Dilated Cardiomyopathy
Directory of Open Access Journals (Sweden)
Siobhan Simpson
2015-01-01
Full Text Available Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In this review the aetiology, epidemiology, and clinical characteristics of canine DCM are examined, along with highlighting possible different subtypes of canine DCM and their potential relevance to human DCM. Finally the current position of genetic research into canine and human DCM, including the genetic loci, is identified and the reasons many studies may have failed to find a genetic association with canine DCM are reviewed.
Borah, Ballav M; Halter, Timothy J; Xie, Baoquan; Henneman, Zachary J; Siudzinski, Thomas R; Harris, Stephen; Elliott, Matthew; Nancollas, George H
2014-07-01
This work identifies carbonated hydroxyapatite (CAP) as the primary component of canine dental calculus, and corrects the long held belief that canine dental calculus is primarily CaCO3 (calcite). CAP is known to be the principal crystalline component of human dental calculus, suggesting that there are previously unknown similarities in the calcification that occurs in these two unique oral environments. In vitro kinetic experiments mimicking the inorganic components of canine saliva have examined the mechanisms of dental calculus formation. The solutions were prepared so as to mimic the inorganic components of canine saliva; phosphate, carbonate, and magnesium ion concentrations were varied individually to investigate the roll of these ions in controlling the nature of the phases that is nucleated. To date, the inorganic components of the canine oral systems have not been investigated at concentrations that mimic those in vivo. The mineral composition of the synthetic calculi grown under these conditions closely resembled samples excised from canines. This finding adds new information about calculus formation in humans and canines, and their sensitivity to chemicals used to treat these conditions. Copyright © 2014 Elsevier Inc. All rights reserved.
Role of canine circovirus in dogs with acute haemorrhagic diarrhoea.
Anderson, A; Hartmann, K; Leutenegger, C M; Proksch, A L; Mueller, R S; Unterer, S
2017-06-03
Canine circovirus (CanineCV) has been detected in some dogs with severe haemorrhagic diarrhoea, but its pathogenic role is unclear. This study evaluated a suspected association between the presence of CanineCV and acute haemorrhagic diarrhoea syndrome (AHDS) in dogs. The prevalence of CanineCV in dogs with AHDS was compared with that in healthy dogs and those infected with canine parvovirus (CPV). Additionally, time to recovery and mortality rate were compared between CanineCV-positive and CanineCV-negative dogs. Faecal samples of dogs with AHDS (n=55), healthy dogs (n=66) and dogs infected with CPV (n=54) were examined by two real-time TaqMan PCR assays targeting the replicase and capsid genes of CanineCV. CanineCV was detected in faecal samples of two dogs with AHDS, three healthy controls and seven dogs infected with CPV. Among the three groups, there was no significant difference in prevalence of CanineCV. CPV-infected animals that were coinfected with CanineCV had a significantly higher mortality rate compared with those negative for CanineCV. CanineCV does not appear to be the primary causative agent of AHDS in dogs, but might play a role as a negative co-factor in disease outcome in dogs with CPV infection. British Veterinary Association.
Reliability of mandibular canines as indicators for sexual dichotomy.
Hosmani, Jagadish V; Nayak, Ramakant S; Kotrashetti, Vijayalakshmi S; S, Pradeep; Babji, Deepa
2013-02-01
Amongst the various calcified structures in the human body, teeth have gained lot of popularity in estimating the sex of an individual as they are highly resistant to destruction and decomposition. Using permanent mandibular canines many researchers have predicted a high level of accuracy in identifying the sex correctly. The purpose of our study was to gauge the effectiveness of mandibular canines in discerning sex. Fifty dental casts each of males and females were utilized for the study. Mesio-distal dimension and inter-canine distance of mandibular right and left canine was recorded using digital vernier caliper and mandibular canine index was calculated. The mean value of mesio-distal dimensions of right and left mandibular canine was slightly greater in males compared to females. The mandibular canine index was equal in both sexes. Inter-canine distance was marginally higher in males compared to females. Despite of higher values in males none of the parameters were statistically significant. The results herein bolster contemporary studies that mesio-distal dimensions of mandibular canines and mandibular canine index do not reflect sexual dimorphism and that its application should be discontinued in sex prediction among Indian populations. How to cite this article: Hosmani J V, Nayak R S, Kotrashetti V S, Pradeep S, Babji D. Reliability of Mandibular Canines as Indicators for Sexual Dichotomy. J Int Oral Health 2013; 5(1):1-7.
Approaches to canine health surveillance.
O'Neill, Dan G; Church, David B; McGreevy, Paul D; Thomson, Peter C; Brodbelt, Dave C
2014-01-01
Effective canine health surveillance systems can be used to monitor disease in the general population, prioritise disorders for strategic control and focus clinical research, and to evaluate the success of these measures. The key attributes for optimal data collection systems that support canine disease surveillance are representativeness of the general population, validity of disorder data and sustainability. Limitations in these areas present as selection bias, misclassification bias and discontinuation of the system respectively. Canine health data sources are reviewed to identify their strengths and weaknesses for supporting effective canine health surveillance. Insurance data benefit from large and well-defined denominator populations but are limited by selection bias relating to the clinical events claimed and animals covered. Veterinary referral clinical data offer good reliability for diagnoses but are limited by referral bias for the disorders and animals included. Primary-care practice data have the advantage of excellent representation of the general dog population and recording at the point of care by veterinary professionals but may encounter misclassification problems and technical difficulties related to management and analysis of large datasets. Questionnaire surveys offer speed and low cost but may suffer from low response rates, poor data validation, recall bias and ill-defined denominator population information. Canine health scheme data benefit from well-characterised disorder and animal data but reflect selection bias during the voluntary submissions process. Formal UK passive surveillance systems are limited by chronic under-reporting and selection bias. It is concluded that active collection systems using secondary health data provide the optimal resource for canine health surveillance.
Directory of Open Access Journals (Sweden)
Jonna Nykky
2010-06-01
Full Text Available Jonna Nykky, Jenni E Tuusa, Sanna Kirjavainen, Matti Vuento, Leona GilbertNanoscience Center and Department of Biological and Environmental Science, University of Jyväskylä, FinlandAbstract: Viruses have great potential as nanotools in medicine for gene transfer, targeted gene delivery, and oncolytic cancer virotherapy. Here we have studied cell death mechanisms of canine parvovirus (CPV to increase the knowledge on the CPV life cycle in order to facilitate the development of better parvovirus vectors. Morphological studies of CPV-infected Norden laboratory feline kidney (NLFK cells and canine fibroma cells (A72 displayed characteristic apoptotic events. Apoptosis was further confirmed by activation of caspases and cellular DNA damage. However, results from annexin V-propidium iodide (PI labeling and membrane polarization assays indicated disruption of the plasma membrane uncommon to apoptosis. These results provide evidence that secondary necrosis followed apoptosis. In addition, two human cancer cell lines were found to be infected by CPV. This necrotic event over apoptotic cell death and infection in human cells provide insightful information when developing CPV as a nanotool for cancer treatments.Keywords: canine parvovirus, apoptosis, necrosis, nanoparticle, virotherapy
Al-Ainawi, Khaled I; Al-Mdalal, Yaser; Hajeer, Mohammad Y
2016-01-01
New studies have been published and aimed to retract canines by means of distraction osteogenesis to reduce treatment time. Although a great care has been given to achieve a bodily movement of the canines, a significant amount of tipping of the canines has been observed. This trial aimed to assess the effect of applying a modified distractor on canine angulation. The sample of the study consisted of 14 canines in seven patients (16-25 years). After the osteotomy procedure, two distractors were applied (one distractor on each side). After 5 days of a latency period, the two distractors were activated at a rate of 1 mm/day. There was a significant difference between the two distractors regarding the time required to retract the canines (p = 0.008) and the observed change in canine angulation following retraction (p = 0.028). The change in the overjet and the mandibular plane angle was statistically insignificant. Eight out of 14 distracted canines reacted positively to the pulp vitality tester after 3 months of completion of distraction. There was no clinical sign of discoloration or pulpal pain in any canine. Within the limits of this study, the modified distractor caused a bodily movement of the canine with a minimal tipping. Further research is required on a long-term basis on a larger group of patients to gain more insight on the observed changes.
International Nuclear Information System (INIS)
Gallart-Ayala, H.; Courant, F.; Severe, S.; Antignac, J.-P.; Morio, F.; Abadie, J.; Le Bizec, B.
2013-01-01
Graphical abstract: -- Highlights: •Lipidomics, high resolution mass spectrometry, polarity switching, serum, canine mammary cancer. -- Abstract: Lipids represent an extended class of substances characterized by such high variety and complexity that makes their unified analyses by liquid chromatography coupled to either high resolution or tandem mass spectrometry (LC–HRMS or LC–MS/MS) a real challenge. In the present study, a new versatile methodology associating ultra high performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC–HRMS/MS) have been developed for a comprehensive analysis of lipids. The use of polarity switching and “all ion fragmentation” (AIF) have been two action levels particularly exploited to finally permit the detection and identification of a multi-class and multi-analyte extended range of lipids in a single run. For identification purposes, both higher energy collision dissociation (HCD) and in-source CID (collision induced dissociation) fragmentation were evaluated in order to obtain information about the precursor and product ions in the same spectra. This approach provides both class-specific and lipid-specific fragments, enhancing lipid identification. Finally, the developed method was applied for differential phenotyping of serum samples collected from pet dogs developing spontaneous malignant mammary tumors and health controls. A biological signature associated with the presence of cancer was then successfully revealed from this lipidome analysis, which required to be further investigated and confirmed at larger scale
Energy Technology Data Exchange (ETDEWEB)
Gallart-Ayala, H., E-mail: laberca@oniris-nantes.fr [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France); Courant, F.; Severe, S.; Antignac, J.-P. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France); Morio, F.; Abadie, J. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), Cancers Animaux, Modèles pour la Recherche en Oncologie Comparée (AMaROC), Site de la Chantrerie–CS50707, 44307 Nantes cedex 3 (France); Le Bizec, B. [LUNAM, Ecole Nationale Vétérinaire, Agroalimentaire et de l’Alimentation Nantes Atlantique (Oniris), USC 1329 INRA Laboratoire d’Etude des résidus et Contaminants dans les Aliments (LABERCA), Site de la Chantrerie – CS50707, 44307 Nantes cedex 3 (France)
2013-09-24
Graphical abstract: -- Highlights: •Lipidomics, high resolution mass spectrometry, polarity switching, serum, canine mammary cancer. -- Abstract: Lipids represent an extended class of substances characterized by such high variety and complexity that makes their unified analyses by liquid chromatography coupled to either high resolution or tandem mass spectrometry (LC–HRMS or LC–MS/MS) a real challenge. In the present study, a new versatile methodology associating ultra high performance liquid chromatography coupled to high resolution tandem mass spectrometry (UHPLC–HRMS/MS) have been developed for a comprehensive analysis of lipids. The use of polarity switching and “all ion fragmentation” (AIF) have been two action levels particularly exploited to finally permit the detection and identification of a multi-class and multi-analyte extended range of lipids in a single run. For identification purposes, both higher energy collision dissociation (HCD) and in-source CID (collision induced dissociation) fragmentation were evaluated in order to obtain information about the precursor and product ions in the same spectra. This approach provides both class-specific and lipid-specific fragments, enhancing lipid identification. Finally, the developed method was applied for differential phenotyping of serum samples collected from pet dogs developing spontaneous malignant mammary tumors and health controls. A biological signature associated with the presence of cancer was then successfully revealed from this lipidome analysis, which required to be further investigated and confirmed at larger scale.
Platelets Inhibit Migration of Canine Osteosarcoma Cells.
Bulla, S C; Badial, P R; Silva, R C; Lunsford, K; Bulla, C
2017-01-01
The interaction between platelets and tumour cells is important for tumour growth and metastasis. Thrombocytopenia or antiplatelet treatment negatively impact on cancer metastasis, demonstrating potentially important roles for platelets in tumour progression. To our knowledge, there is no information regarding the role of platelets in cancer progression in dogs. This study was designed to test whether canine platelets affected the migratory behaviour of three canine osteosarcoma cell lines and to give insights of molecular mechanisms. Intact platelets, platelet lysate and platelet releasate inhibited the migration of canine osteosarcoma cell lines. Addition of blood leucocytes to the platelet samples did not alter the inhibitory effect on migration. Platelet treatment also significantly downregulated the transcriptional levels of SNAI2 and TWIST1 genes. The interaction between canine platelets or molecules released during platelet activation and these tumour cell lines inhibits their migration, which suggests that canine platelets might antagonize metastasis of canine osteosarcoma. This effect is probably due to, at least in part, downregulation of genes related to epithelial-mesenchymal transition. Copyright © 2016. Published by Elsevier Ltd.
9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...
Wang, Xijun; Feng, Na; Ge, Jinying; Shuai, Lei; Peng, Liyan; Gao, Yuwei; Yang, Songtao; Xia, Xianzhu; Bu, Zhigao
2012-07-20
Effective, safe, and affordable rabies vaccines are still being sought. Attenuated live vaccine has been widely used to protect carnivores from canine distemper. In this study, we generated a recombinant canine distemper virus (CDV) vaccine strain, rCDV-RVG, expressing the rabies virus glycoprotein (RVG) by using reverse genetics. The recombinant virus rCDV-RVG retained growth properties similar to those of vector CDV in Vero cell culture. Animal studies demonstrated that rCDV-RVG was safe in mice and dogs. Mice inoculated intracerebrally or intramuscularly with rCDV-RVG showed no apparent signs of disease and developed a strong rabies virus (RABV) neutralizing antibody response, which completely protected mice from challenge with a lethal dose of street virus. Canine studies showed that vaccination with rCDV-RVG induced strong and long-lasting virus neutralizing antibody responses to RABV and CDV. This is the first study demonstrating that recombinant CDV has the potential to serve as bivalent live vaccine against rabies and canine distemper in animals. Copyright © 2012 Elsevier Ltd. All rights reserved.
Military Working Dogs and Canine Ehrlichiosis (Tropical Canine Pancytopenia) in the Vietnam War
1981-06-05
anemia, dermatitis, edema of the limbs and scrotum, and petechial hemorrhages on the penis (116). Hematologic findings included a leucopenia with...idiopathic hemorrhagic disease, and canine hemorrhagic fever (116). Attempts to identity the cause of tropical canine pancytopenia continued in 1969...Following inoculation with infective blood, signs of acute disease appear within 7-10 days and consfst of fever , serous nasal and ocular discharges
Headley, Selwyn Arlington; Alfieri, Amauri Alcindo; Fritzen, Juliana Torres Tomazi; Garcia, João Luis; Weissenböck, Herbert; da Silva, Ana Paula; Bodnar, Livia; Okano, Werner; Alfieri, Alice Fernandes
2013-01-01
The concomitant infections of Canine distemper virus (CDV), Canine adenovirus A types 1 (CAdV-1) and 2 (CAdV-2), Canine parvovirus type 2 (CPV-2), and Toxoplasma gondii are described in a 43-day-old mixed-breed puppy. Clinically, there were convulsions and blindness with spontaneous death; 14 siblings of this puppy, born to a 10-month-old dam, which was seropositive (titer: 1,024) for T. gondii, also died. Necropsy revealed unilateral corneal edema (blue eye), depletion of intestinal lymphoid tissue, non-collapsible lungs, congestion of meningeal vessels, and a pale area in the myocardium. Histopathology demonstrated necrotizing myocarditis associated with intralesional apicomplexan protozoa; necrotizing and chronic hepatitis associated with rare intranuclear inclusion bodies within hepatocytes; necrotizing bronchitis and bronchiolitis; interstitial pneumonia associated with eosinophilic intracytoplasmic inclusion bodies within epithelial cells; atrophy and fusion of intestinal villi with cryptal necrosis; and white matter demyelination of the cerebrum and cerebellum associated with intranuclear inclusion bodies within astrocytes. Polymerase chain reaction (PCR) amplified the partial fragments (bp) of the CDV N gene (290 bp), CPV-2c VP2 capsid protein gene (583 bp), and CAdV-1 (508 bp) and CAdV-2 (1,030 bp) E gene from urine and tissue samples. The PCR assays demonstrated that the apicomplexan protozoa observed within several organs contained DNA specific for T. gondii; genotyping revealed T. gondii type III. The findings support the characterization of concomitant infections of CDV, CAdV-1, CAdV-2, CPV-2, and T. gondii in this puppy. Further, seroreactivity to T. gondii of the dam in association with the systemic disease observed in the puppy described herein is suggestive of congenital toxoplasmosis.
Directory of Open Access Journals (Sweden)
Mehdi Mohebali
2016-10-01
Full Text Available Background: Although many studies had been conducted on various aspects of canine visceral leishmaniasis (CVL in domestic dogs in the endemic areas of Iran, investigations on CVL in wild canines are rare.Methods: This is a cross-sectional study was conducted from December 2012 to 2013 in northeast of Iran where human VL is endemic. Wild canines were trapped around the areas where human VL cases had been previously identified. Wild canines were collected and examined both clinically and serologically using direct agglutination test (DAT. Microscopically examinations were performed in all the seropositive wild canines for the presence of the amastigote form of Leishmania spp. Some Leishmania sp. which had been isolated from the spleens of wild canines, were examined analyzed by conventional PCR and sequencing techniques using α-tubulin and GAPDH genes.Results: Altogether, 84 wild canines including foxes (Vulpes vulpes, n=21, Jackals (Canis aureus, n=60 and wolves (Canis lupus, n=3 were collected. Four foxes and seven jackals showed anti-Leishmania infantum antibodies with titers of 1:320–1:20480 in DAT. Furthermore, one fox and one jackal were parasitologically (microscopy and culture positive and L. infantum was confirmed by sequence analysis.Conclusion: The present study showed that sylvatic cycle of L. infantum had been established in the studied endemic areas of VL in northeastern Iran.
Clinical and Statistical Study on Canine Impaction
Directory of Open Access Journals (Sweden)
Adina-Simona Coșarcă
2013-08-01
Full Text Available Aim: The aim of this study was to perform a clinical and statistical research on permanent impacted canine patients among those with dental impaction referred to and treated at the Oral and Maxillo-Facial Surgery Clinic of Tîrgu Mureș, over a four years period (2009-2012. Materials and methods: The study included 858 patients having dental impaction, and upon clinical records, different parameters, like frequency, gender, age, quadrant involvement, patient residence, associated complications, referring specialist and type of treatment, related to canine impaction, were assessed. Results: The study revealed: about 10% frequency of canine impaction among dental impactions; more frequent in women, in the first quadrant (tooth 13; most cases diagnosed between the age of 10-19 years; patients under 20 were referred by an orthodontist, those over 20 by a dentist; surgical exposure was more often performed than odontectomy. Conclusions: Canine impaction is the second-most frequent dental impaction in dental arch after third molars; it occurs especially in women. Due to its important role, canine recovery within dental arch is a goal to be achieved, whenever possible. Therefore, diagnose and treatment of canine impaction requires an interdisciplinary approach (surgical and orthodontic
Podoplanin Expression in Canine Melanoma.
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-12-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistry. Of interest, PMab-38 stained the lymphatic endothelial cells and cancer-associated fibroblasts in melanoma tissues, although it did not stain any lymphatic endothelial cells in normal tissues. PMab-38 could be useful for uncovering the function of PDPN in canine melanomas.
2009-12-01
Madin–Darby canine kidney (MDCK) cells to measure a median tissue culture infectious dose (TCID50). Finally, the availability of a human vaccine ...of the Ft live vaccine strain (LVS) is much milder and LVS produces symptoms of infection in mice, so this organism appeared at the outset to provide...MS2 at t = 30 minutes. Accordingly, we tripled the rate of delivery and increased the flowrate through the test rig to 11.3 LPM. The validation test
Comazzi, S; Avery, P R; Garden, O A; Riondato, F; Rütgen, B; Vernau, W
2017-09-01
Flow cytometry (FC) is assuming increasing importance in diagnosis in veterinary oncology. The European Canine Lymphoma Network (ECLN) is an international cooperation of different institutions working on canine lymphoma diagnosis and therapy. The ECLN panel of experts on FC has defined the issue of reporting FC on canine lymphoma and leukemia as their first hot topic, since a standardized report that includes all the important information is still lacking in veterinary medicine. The flow cytometry panel of the ECLN started a consensus initiative using the Delphi approach. Clinicians were considered the main target of FC reports. A panel of experts in FC was interrogated about the important information needed from a report. Using the feedback from clinicians and subsequent discussion, a list of information to be included in the report was made, with four different levels of recommendation. The final report should include both a quantitative part and a qualitative or descriptive part with interpretation of the salient results. Other items discussed included the necessity of reporting data regarding the quality of samples, use of absolute numbers of positive cells, cutoff values, the intensity of fluorescence, and possible aberrant patterns of antigen expression useful from a clinical point of view. The consensus initiative is a first step toward standardization of diagnostic approach to canine hematopoietic neoplasms among different institutions and countries. This harmonization will improve communication and patient care and also facilitate the multicenter studies necessary to further our knowledge of canine hematopoietic neoplasms. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Canine adenovirus type 1 in a fennec fox (Vulpes zerda).
Choi, Jeong-Won; Lee, Hyun-Kyoung; Kim, Seong-Hee; Kim, Yeon-Hee; Lee, Kyoung-Ki; Lee, Myoung-Heon; Oem, Jae-Ku
2014-12-01
A 10-mo-old female fennec fox (Vulpes zerda) with drooling suddenly died and was examined postmortem. Histologic examination of different tissue samples was performed. Vacuolar degeneration and diffuse fatty change were observed in the liver. Several diagnostic methods were used to screen for canine parvovirus, canine distemper virus, canine influenza virus, canine coronavirus, canine parainfluenza virus, and canine adenovirus (CAdV). Only CAdV type 1 (CAdV-1) was detected in several organs (liver, lung, brain, kidney, spleen, and heart), and other viruses were not found. CAdV-1 was confirmed by virus isolation and nucleotide sequencing.
Noguchi, S; Mori, T; Hoshino, Y; Yamada, N; Maruo, K; Akao, Y
2013-06-01
Malignant melanoma (MM) is one of the most aggressive cancers in dogs and in humans. However, the molecular mechanisms of its development and progression remain unclear. Presently, we examined the expression profile of microRNAs (miRs) in canine oral MM tissues and paired normal oral mucosa tissues by using the microRNA-microarray assay and quantitative RT-PCR. Importantly, a decreased expression of miR-203 was significantly associated with a shorter survival time. Also, miR-203 and -205 were markedly down-regulated in canine and human MM cell lines tested. Furthermore, the ectopic expression of miR-205 had a significant inhibitory effect on the cell growth of canine and human melanoma cells tested by targeting erbb3. Our data suggest that miR-203 is a new prognostic factor in canine oral MMs and that miR-205 functions as a tumour suppressor by targeting erbb3 in both canine and human MM cells. © 2011 John Wiley & Sons Ltd.
Hobi-like pestivirus: both biotypes isolated from a diseased animal.
Decaro, Nicola; Mari, Viviana; Pinto, Pierfrancesco; Lucente, Maria Stella; Sciarretta, Rossana; Cirone, Francesco; Colaianni, Maria Loredana; Elia, Gabriella; Thiel, Heinz-Jürgen; Buonavoglia, Canio
2012-09-01
A Hobi-like pestivirus pair consisting of cytopathogenic (cp) and non-cytopathogenic (noncp) strains, Italy 83/10cp and Italy 83/10ncp, was isolated from the lung of a heifer that died of respiratory disease. The noncp and cp viruses were isolated on Madin-Darby bovine kidney cells and separated by plaque purification and end point dilution. Analysis of the nearly full-length genomes revealed that the two viruses were very closely related to each other and to the noncp Hobi-like strain Italy 1/10-1, which had been isolated a few weeks earlier from the same herd. One major difference between noncp and cp viruses concerned the presence of a cellular Jiv sequence in the 3' domain of the NS2-encoding region of the cp strain. This is the first study, to our knowledge, reporting the isolation and molecular characterization of a Hobi-like virus pair.
Flow cytometric monitoring of influenza A virus infection in MDCK cells during vaccine production
Directory of Open Access Journals (Sweden)
Reichl Udo
2008-04-01
Full Text Available Abstract Background In cell culture-based influenza vaccine production the monitoring of virus titres and cell physiology during infection is of great importance for process characterisation and optimisation. While conventional virus quantification methods give only virus titres in the culture broth, data obtained by fluorescence labelling of intracellular virus proteins provide additional information on infection dynamics. Flow cytometry represents a valuable tool to investigate the influences of cultivation conditions and process variations on virus replication and virus yields. Results In this study, fluorescein-labelled monoclonal antibodies against influenza A virus matrix protein 1 and nucleoprotein were used for monitoring the infection status of adherent Madin-Darby canine kidney cells from bioreactor samples. Monoclonal antibody binding was shown for influenza A virus strains of different subtypes (H1N1, H1N2, H3N8 and host specificity (human, equine, swine. At high multiplicity of infection in a bioreactor, the onset of viral protein accumulation in adherent cells on microcarriers was detected at about 2 to 4 h post infection by flow cytometry. In contrast, a significant increase in titre by hemagglutination assay was detected at the earliest 4 to 6 h post infection. Conclusion It is shown that flow cytometry is a sensitive and robust method for the monitoring of viral infection in fixed cells from bioreactor samples. Therefore, it is a valuable addition to other detection methods of influenza virus infection such as immunotitration and RNA hybridisation. Thousands of individual cells are measured per sample. Thus, the presented method is believed to be quite independent of the concentration of infected cells (multiplicity of infection and total cell concentration in bioreactors. This allows to perform detailed studies on factors relevant for optimization of virus yields in cell cultures. The method could also be used for process
Directory of Open Access Journals (Sweden)
Juliana Martins da Costa-Pessoa
2014-02-01
Full Text Available Aims: In models of diabetes, distal nephron cells contribute to glucose uptake and oxidation. How these cells contribute to the use of glucose for the regulation of H+ extrusion remains unknown. We used Madin-Darby Canine Kidney (MDCK cells to investigate the effect of acute or chronic high glucose concentration on the abundance and activity of the Na+/H+ exchanger (NHE-1. Methods: Using RT-PCR, we also evaluated the mRNA expression for sodium glucose co-transporters SGLT1 and SGLT2. Protein abundance was analyzed using immunoblotting, and intracellular pH (pHi recovery was evaluated using microscopy in conjunction with the fluorescent probe BCECF/AM. The Na+-dependent pHi recovery rate was monitored with HOE-694 (50 µM and/or S3226 (10 µM, specific NHE-1 and NHE-3 inhibitors. Results: MDCK cells did not express the mRNA for SGLT1 or SGLT2 but did express the GLUT2, NHE-1 and NHE-3 proteins. Under control conditions, we observed a greater contribution of NHE-1 to pHi recovery relative to the other H+ transporters. Acute high glucose treatment increased the HOE-694-sensitive pHi recovery rate and p-Erk1/2 and p90RSK abundance. These parameters were reduced by PD-98059, a Mek inhibitor (1 µM. Chronic high glucose treatment also increased the HOE-694-sensitive pHi recovery rate and p-p38MAPK abundance. Both parameters were reduced by SB-203580, a p38MAPK inhibitor (10 µM. Conclusion: These results suggested that extracellular high glucose stimulated NHE-1 acutely and chronically through Mek/Erk1/2/p90RSK and p38MAPK pathways, respectively.
Gohil, Devanshi J; Kothari, Sweta T; Shinde, Pramod S; Chintakrindi, Anand S; Meharunkar, Rhuta; Warke, Rajas V; Kanyalkar, Meena A; Chowdhary, Abhay S; Deshmukh, Ranjana A
2015-01-01
From its first instance in 1977, resistance to amantadine, a matrix (M2) inhibitor has been increasing among influenza A/H3N2, thus propelling the use of oseltamivir, a neuraminidase (NA) inhibitor as a next line drug. Information on drug susceptibility to amantadine and neuraminidase inhibitors for influenza A/H3N2 viruses in India is limited with no published data from Mumbai. This study aimed at examining the sensitivity to M2 and NA inhibitors of influenza A/H3N2 strains isolated from 2009 to 2011 in Mumbai. Nasopharyngeal swabs positive for influenza A/H3N2 virus were inoculated on Madin-Darby canine kidney (MDCK) cell line for virus isolation. Molecular analysis of NA and M2 genes was used to detect known mutations contributing to resistance. Resistance to neuraminidase was assayed using a commercially available chemiluminescence based NA-Star assay kit. Genotypically, all isolates were observed to harbor mutations known to confer resistance to amantadine. However, no know mutations conferring resistance to NA inhibitors were detected. The mean IC50 value for oseltamivir was 0.25 nM. One strain with reduced susceptibility to the neuraminidase inhibitor (IC₅₀=4.08 nM) was isolated from a patient who had received oseltamivir treatment. Phylogenetic analysis postulate the emergence of amantadine resistance in Mumbai may be due to genetic reassortment with the strains circulating in Asia and North America. Surveillance of drug susceptibility helped us to identify an isolate with reduced sensitivity to oseltamivir. Therefore, we infer that such surveillance would help in understanding possible trends underlying the emergence of resistant variants in humans. Copyright © 2014 Elsevier B.V. All rights reserved.
Acidosis-mediated regulation of the NHE1 isoform of the Na⁺/H⁺ exchanger in renal cells.
Odunewu, Ayodeji; Fliegel, Larry
2013-08-01
The mammalian Na⁺/H⁺ exchanger isoform 1 (NHE1) is a ubiquitous plasma membrane protein that regulates intracellular pH by removing a proton in exchange for extracellular sodium. Renal tissues are subject to metabolic and respiratory acidosis, and acidosis has been shown to acutely activate NHE1 activity in other cell types. We examined if NHE1 is activated by acute acidosis in HEK293 and Madin-Darby canine kidney (MDCK) cells. Acute sustained intracellular acidosis (SIA) activated NHE1 in both cell types. We expressed wild-type and mutant NHE1 cDNAs in MDCK cells. All the cDNAs had a L163F/G174S mutation, which conferred a 100-fold resistance to EMD87580, an NHE1-specific inhibitor. We assayed exogenous NHE1 activity while inhibiting endogenous activity with EMD87580 and while inhibiting the NHE3 isoform of the Na⁺/H⁺ exchanger using the isoform-specific inhibitor S3226. We examined the activation and phosphorylation of the wild-type and mutant NHE1 proteins in response to SIA. In MDCK cells we demonstrated that the amino acids Ser⁷⁷¹, Ser⁷⁷⁶, Thr⁷⁷⁹, and Ser⁷⁸⁵ are important for NHE1 phosphorylation and activation after acute SIA. SIA activated ERK-dependent pathways in MDCK cells, and this was blocked by treatment with the MEK inhibitor U0126. Treatment with U0126 also blocked activation of NHE1 by SIA. These results suggest that acute acidosis activates NHE1 in mammalian kidney cells and that in MDCK cells this activation occurs through an ERK-dependent pathway affecting phosphorylation of a distinct set of amino acids in the cytosolic regulatory tail of NHE1.
Yang, Chen; Skiena, Steven; Futcher, Bruce; Mueller, Steffen; Wimmer, Eckard
2013-06-04
A long-held dogma posits that strong presentation to the immune system of the dominant influenza virus glycoprotein antigens neuraminidase (NA) and hemagglutinin (HA) is paramount for inducing protective immunity against influenza virus infection. We have deliberately violated this dogma by constructing a recombinant influenza virus strain of A/PR8/34 (H1N1) in which expression of NA and HA genes was suppressed. We down-regulated NA and HA expression by recoding the respective genes with suboptimal codon pair bias, thereby introducing hundreds of nucleotide changes while preserving their codon use and protein sequence. The variants PR8-NA(Min), PR8-HA(Min), and PR8-(NA+HA)(Min) (Min, minimal expression) were used to assess the contribution of reduced glycoprotein expression to growth in tissue culture and pathogenesis in BALB/c mice. All three variants proliferated in Madin-Darby canine kidney cells to nearly the degree as WT PR8. In mice, however, they expressed explicit attenuation phenotypes, as revealed by their LD50 values: PR8, 32 plaque-forming units (PFU); HA(Min), 1.7 × 10(3) PFU; NA(Min), 2.4 × 10(5) PFU; (NA+HA)(Min), ≥3.16 × 10(6) PFU. Remarkably, (NA+HA)(Min) was attenuated >100,000-fold, with NA(Min) the major contributor to attenuation. In vaccinated mice (NA+HA)(Min) was highly effective in providing long-lasting protective immunity against lethal WT challenge at a median protective dose (PD50) of 2.4 PFU. Moreover, at a PD50 of only 147 or 237, (NA+HA)(Min) conferred protection against heterologous lethal challenges with two mouse-adapted H3N2 viruses. We conclude that the suppression of HA and NA is a unique strategy in live vaccine development.
Stoppani, Elena; Bassi, Ivan; Dotti, Silvia; Lizier, Michela; Ferrari, Maura; Lucchini, Franco
2015-08-01
Influenza A virus is the principal agent responsible of the respiratory tract's infections in humans. Every year, highly pathogenic and infectious strains with new antigenic assets appear, making ineffective vaccines so far developed. The discovery of RNA interference (RNAi) opened the way to the progress of new promising drugs against Influenza A virus and also to the introduction of disease resistance traits in genetically modified animals. In this paper, we show that Madin-Darby Canine Kidney (MDCK) cell line expressing short hairpin RNAs (shRNAs) cassette, designed on a specific conserved region of the nucleoprotein (NP) viral genome, can strongly inhibit the viral replication of four viral strains sharing the target sequence, reducing the viral mRNA respectively to 2.5×10(-4), 7.5×10(-5), 1.7×10(-3), 1.9×10(-4) compared to the control, as assessed by real-time PCR. Moreover, we demonstrate that during the challenge with a viral strain bearing a single mismatch on the target sequence, although a weaker inhibition is observed, viral mRNA is still lowered down to 1.2×10(-3) folds in the shRNA-expressing clone compared to the control, indicating a broad potential use of this approach. In addition, we developed a highly predictive and fast screening test of siRNA sequences based on dual-luciferase assay, useful for the in vitro prediction of the potential effect of viral inhibition. In conclusion, these findings reveal new siRNA sequences able to inhibit Influenza A virus replication and provide a basis for the development of siRNAs as prophylaxis and therapy for influenza infection both in humans and animals. Copyright © 2015 Elsevier B.V. All rights reserved.
Hedgehog Pathway Inhibitor HhAntag691 Is a Potent Inhibitor of ABCG2/BCRP and ABCB1/Pgp
Directory of Open Access Journals (Sweden)
Yimao Zhang
2009-01-01
Full Text Available HhAntag691 (GDC-0449, a low-molecular weight inhibitor of the tumor-promoting hedgehog (Hh signaling pathway, has been used to treat medulloblastoma in animal models and has recently entered clinical trials for a variety of solid tumors. Here, we show that HhAntag691 inhibits multiple ATP-binding cassette (ABC transporters. ATP-binding cassette transporters are within a family of membrane proteins, the overexpression of which is associated with multidrug resistance, a major impediment to successful cancer treatment. HhAntag691 is a potent inhibitor of two ABC transporters, ABCG2/BCRP and ABCB1/Pgp, and is a mild inhibitor of ABCC1/MRP1. In ABCG2-overexpressing HEK293 cells, HhAntag691 increased retention of the fluorescent ABCG2 substrate BODIPY-prazosin and resensitized these cells to mitoxantrone, an antineoplastic ABCG2 substrate. In Madin-Darby canine kidney II cells engineered to overexpress Pgp or MRP1, HhAntag691 increased the retention of calcein-AM and resensitized them to colchicine. HhAntag691 also resensitized human non-small cell lung carcinoma cells NCI-H460/par and NCI-H460/MX20, which overexpress ABCG2 in response to mitoxantrone, to mitoxantrone, and to topotecan or SN-38. The IC50 values of HhAntag691 for inhibition of ABCG2 and Pgp were ∼1.4 and ∼3.0 µM, respectively. Because ABC transporters are highly expressed at the blood-brain barrier and on many tumor cells, they contribute significantly to treatment failure of many types of cancer, particularly of those within the neuraxis. In addition to its effect on Hh signaling, the ability of HhAntag691 and related compounds to inhibit two key ABC transporters could contribute to their effectiveness in treating malignancies.
Digitalis-like activity in human plasma: Relation to blood pressure and sodium balance
Energy Technology Data Exchange (ETDEWEB)
Goto, A.; Yamada, K.; Ishii, M.; Sugimoto, T. (Univ. of Tokyo (Japan))
1990-10-01
PURPOSE: On the assumption that renal tubular cells are more important as the target cells for a natriuretic factor than blood cells, we used a well-characterized cultured renal tubular cell line, Madin-Darby canine kidney (MDCK), cells to monitor the circulating digitalis-like factor in human plasma and examine its role in the regulation of blood pressure and sodium balance. SUBJECTS AND METHODS: We investigated the effects of plasma on binding of radioactive ouabain to monolayered MDCK cells in order to determine the level of a circulating digitalis-like factor. First, we measured specific 3H-ouabain binding to MDCK cells in the presence of plasma from 71 outpatients (34 normotensive subjects and 37 hypertensive patients) after incubation for 4 hours. Second, we measured specific 3H-ouabain binding after incubation of cells with plasma from 16 hospitalized subjects (eight normotensive subjects and eight hypertensive patients) receiving low and high sodium diets. RESULTS: In Study 1, ouabain binding was lower by 30% with plasma from hypertensive patients than with plasma from normotensive subjects (p less than 0.01). There was a significant negative correlation between individual subject's systolic or mean blood pressure and ouabain binding (r = -0.34, p less than 0.01 or r = -0.29, p less than 0.01). In Study 2, ouabain binding was also significantly reduced by 25% in the presence of plasma from hypertensive subjects as compared with plasma from normotensive subjects irrespective of sodium intake (p less than 0.01). A significant negative correlation was also found for all subjects between either systolic, diastolic, or mean blood pressure and ouabain binding (r = -0.58, p less than 0.01, r = -0.51, p less than 0.01, or r = -0.55, p less than 0.01, respectively).
Zeng, J Q; Wu, J Q; Li, M H; Wang, P J
2017-11-07
Objective: To construct magnetic nanoparticles targeting β-amyloid (Aβ) plaques, the pathological biomarker of Alzheimer's disease (AD) and to study their binding capability in vitro . Methods: Superparamagnetic nanoparticles Mn(0.6)Zn(0.4)Fe(2)O(4) (MZF) were coated with amphiphilic star-block copolymeric micelles and modified with Aβ-specific probe Pittsburgh compound B (PiB) to construct a novel magnetic nanoparticle MZF-PiB, which specifically targeted amyloid plaques. Transmission electron microscope was used to study the morphological features of MZF-PiB. Superparamagnetism of MZF-PiB was assessed by its r(2) relaxation rate by using 3.0 T MRI scanner. Cytotoxic test was applied to determine biosafety of MZF-PiB nanoparticles in differentiated human neuroblastoma cells (SH-SY5Y) and Madin-Darby canine kidney (MDCK). In vitro binding tests were conducted via immunohistochemistry on 6-month old AD mice brain sections. Differences of cell viability between groups were compared with one-way analysis of variance. Results: MZF-PiB nanoparticles were successfully constructed. Transmission electron microscope images showed that the nanoparticles were about 100 nm in size. The r(2) relaxation rate was 163.11 mMS(-1). No differences were found in cell viability of SH-SY5Y and MDCK incubated with MZF-PiB suspension for 24 h or 48 h when compared with those of untreated cells ( F =2.336, 2.539, 0.293, 1.493, all P >0.05). In vitro binding tests indicated that the MZF-PiB were specifically bound to amyloid plaques. The smallest size of detected plaques was 27 μm. Conclusion: PiB-modified nanoparticles targeting Aβ are biologically safe and highly superparamagnetic, possessing the capability to detect amyloid plaques early in vitro and the potential for early diagnosis of AD.
Relative bioefficacy of RRR-α-tocopherol versus all-rac-α-tocopherol in in vitro models
Directory of Open Access Journals (Sweden)
Antonella Baldi
2015-11-01
Full Text Available The aim of this study was to evaluate the in vitro relative bioefficacy of RRR-α-tocopherol (RRR- α-T versus all-rac-α-tocopherol (all-rac-α-T in counteracting the cytotoxic effect induced by H2O2 in Bovine Mammary Epithelium – University of Vermont (BME-UV1 and Madin-Darby Canine Kidney (MDCK cells. The range of RRR- α-T and all-rac- α-T concentrations selected for the oxidative challenge experiments was 100µM - 1nM. To study the bioefficacy of RRR- α-T and all-rac- α-T, MTT and LDH tests were performed. Cells were pre-incubated for 3 h with selected a-tocopherol concentrations and then exposed to increasing H2O2 concentrations ranging from 125 to 750µM for the following 24h. Concerning the cell viability, the pre-treatments with 100µM of RRR- α-T and 100µM all-rac-α-T were able to significantly (P<0.05 counteract the effect induced by 750 µM of H2O2 in BME-UV1. In MDCK the pre-treatment with 1nM of all-rac-α-T was able to significantly (P<0.05 reduce the effect of 125 and 150 mM H2O2. In MDCK cells, the pre-incubation with all-rac-α-T determines a significant reduction of the membrane damage, induced by 175 µM of H2O2. In conclusion, RRR-α-T and all-rac-α-T have shown the ability to counteract the oxidative effects of H2O2, however further investigation will help to better understand their specific mechanism of action in vitro.
Broselid, Stefan; Berg, Kelly A; Chavera, Teresa A; Kahn, Robin; Clarke, William P; Olde, Björn; Leeb-Lundberg, L M Fredrik
2014-08-08
GPR30, or G protein-coupled estrogen receptor, is a G protein-coupled receptor reported to bind 17β-estradiol (E2), couple to the G proteins Gs and Gi/o, and mediate non-genomic estrogenic responses. However, controversies exist regarding the receptor pharmacological profile, effector coupling, and subcellular localization. We addressed the role of the type I PDZ motif at the receptor C terminus in receptor trafficking and coupling to cAMP production in HEK293 cells and CHO cells ectopically expressing the receptor and in Madin-Darby canine kidney cells expressing the native receptor. GPR30 was localized both intracellularly and in the plasma membrane and subject to limited basal endocytosis. E2 and G-1, reported GPR30 agonists, neither stimulated nor inhibited cAMP production through GPR30, nor did they influence receptor localization. Instead, GPR30 constitutively inhibited cAMP production stimulated by a heterologous agonist independently of Gi/o. Moreover, siRNA knockdown of native GPR30 increased cAMP production. Deletion of the receptor PDZ motif interfered with inhibition of cAMP production and increased basal receptor endocytosis. GPR30 interacted with membrane-associated guanylate kinases, including SAP97 and PSD-95, and protein kinase A-anchoring protein (AKAP) 5 in the plasma membrane in a PDZ-dependent manner. Knockdown of AKAP5 or St-Ht31 treatment, to disrupt AKAP interaction with the PKA RIIβ regulatory subunit, decreased inhibition of cAMP production, and St-Ht31 increased basal receptor endocytosis. Therefore, GPR30 forms a plasma membrane complex with a membrane-associated guanylate kinase and AKAP5, which constitutively attenuates cAMP production in response to heterologous agonists independently of Gi/o and retains receptors in the plasma membrane. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Gong, Xin; Yin, He; Shi, Yuhua; He, Xiaoqiu; Yu, Yongjiao; Guan, Shanshan; Kuai, Ziyu; Haji, Nasteha M; Haji, Nafisa M; Kong, Wei; Shan, Yaming
2016-05-25
The ectodomain of the influenza A virus (IAV) hemagglutinin (HA) stem is highly conserved across strains and has shown promise as a universal influenza vaccine in a mouse model. In this study, potential B-cell epitopes were found through sequence alignment and epitope prediction in a stem fragment, HA2:90-105, which is highly conserved among virus subtypes H1, H3 and B. A norovirus (NoV) P particle platform was used to express the HA2:90-105 sequences from subtypes H1, H3 and B in loops 1, 2 and 3 of the protrusion (P) domain, respectively. Through mouse immunization and microneutralization assays, the immunogenicity and protective efficacy of the chimeric NoV P particle (trivalent HA2-PP) were tested against infection with three subtypes (H1N1, H3N2 and B) of IAV in Madin-Darby canine kidney cells. The protective efficacy of the trivalent HA2-PP was also evaluated preliminarily in vivo by virus challenge in the mouse model. The trivalent HA2-PP immunogen induced significant IgG antibody responses, which could be enhanced by a virus booster vaccination. Moreover, the trivalent HA2-PP immunogen also demonstrated in vitro neutralization of the H3 and B viruses, and in vivo protection against the H3 virus. Our results support the notion that a broadly protective vaccine approach using an HA2-based NoV P particle platform can provide cross-protection against challenge viruses of different IAV subtypes. The efficacy of the immunogen should be further enhanced for practicality, and a better understanding of the protective immune mechanism will be critical for the development of HA2-based multivalent vaccines.
Caveolin-1 influences human influenza A virus (H1N1 multiplication in cell culture
Directory of Open Access Journals (Sweden)
Hemgård Gun-Viol
2010-05-01
Full Text Available Abstract Background The threat of recurring influenza pandemics caused by new viral strains and the occurrence of escape mutants necessitate the search for potent therapeutic targets. The dependence of viruses on cellular factors provides a weak-spot in the viral multiplication strategy and a means to interfere with viral multiplication. Results Using a motif-based search strategy for antiviral targets we identified caveolin-1 (Cav-1 as a putative cellular interaction partner of human influenza A viruses, including the pandemic influenza A virus (H1N1 strains of swine origin circulating from spring 2009 on. The influence of Cav-1 on human influenza A/PR/8/34 (H1N1 virus replication was determined in inhibition and competition experiments. RNAi-mediated Cav-1 knock-down as well as transfection of a dominant-negative Cav-1 mutant results in a decrease in virus titre in infected Madin-Darby canine kidney cells (MDCK, a cell line commonly used in basic influenza research as well as in virus vaccine production. To understand the molecular basis of the phenomenon we focussed on the putative caveolin-1 binding domain (CBD located in the lumenal, juxtamembranal portion of the M2 matrix protein which has been identified in the motif-based search. Pull-down assays and co-immunoprecipitation experiments showed that caveolin-1 binds to M2. The data suggest, that Cav-1 modulates influenza virus A replication presumably based on M2/Cav-1 interaction. Conclusion As Cav-1 is involved in the human influenza A virus life cycle, the multifunctional protein and its interaction with M2 protein of human influenza A viruses represent a promising starting point for the search for antiviral agents.
George, Meena; Farooq, Masiha; Dang, Thi; Cortes, Bernadette; Liu, Jonathan; Maranga, Luis
2010-08-15
The majority of influenza vaccines are manufactured using embryonated hens' eggs. The potential occurrence of a pandemic outbreak of avian influenza might reduce or even eliminate the supply of eggs, leaving the human population at risk. Also, the egg-based production technology is intrinsically cumbersome and not easily scalable to provide a rapid worldwide supply of vaccine. In this communication, the production of a cell culture (Madin-Darby canine kidney (MDCK)) derived live attenuated influenza vaccine (LAIV) in a fully disposable platform process using a novel Single Use Bioreactor (SUB) is presented. The cell culture and virus infection was maintained in a disposable stirred tank reactor with PID control of pH, DO, agitation, and temperature, similar to traditional glass or stainless steel bioreactors. The application of this technology was tested using MDCK cells grown on microcarriers in proprietary serum free medium and infection with 2006/2007 seasonal LAIV strains at 25-30 L scale. The MDCK cell growth was optimal at the agitation rate of 100 rpm. Optimization of this parameter allowed the cells to grow at a rate similar to that achieved in the conventional 3 L glass stirred tank bioreactors. Influenza vaccine virus strains, A/New Caledonia/20/99 (H1N1 strain), A/Wisconsin/67/05 (H3N2 strain), and B/Malaysia/2506/04 (B strain) were all successfully produced in SUB with peak virus titers > or =8.6 log(10) FFU/mL. This result demonstrated that more than 1 million doses of vaccine can be produced through one single run of a small bioreactor at the scale of 30 L and thus provided an alternative to the current vaccine production platform with fast turn-around and low upfront facility investment, features that are particularly useful for emerging and developing countries and clinical trial material production.
Directory of Open Access Journals (Sweden)
Shinsaku Tokuda
Full Text Available Tight junctions (TJs regulate the movements of substances through the paracellular pathway, and claudins are major determinants of TJ permeability. Claudin-2 forms high conductive cation pores in TJs. The suppression of claudin-2 expression by RNA interference in Madin-Darby canine kidney (MDCK II cells (a low-resistance strain of MDCK cells was shown to induce a three-fold increase in transepithelial electrical resistance (TER, which, however, was still lower than in high-resistance strains of MDCK cells. Because RNA interference-mediated knockdown is not complete and only reduces gene function, we considered the possibility that the remaining claudin-2 expression in the knockdown study caused the lower TER in claudin-2 knockdown cells. Therefore, we investigated the effects of claudin-2 knockout in MDCK II cells by establishing claudin-2 knockout clones using transcription activator-like effector nucleases (TALENs, a recently developed genome editing method for gene knockout. Surprisingly, claudin-2 knockout increased TER by more than 50-fold in MDCK II cells, and TER values in these cells (3000-4000 Ω·cm2 were comparable to those in the high-resistance strains of MDCK cells. Claudin-2 re-expression restored the TER of claudin-2 knockout cells dependent upon claudin-2 protein levels. In addition, we investigated the localization of claudin-1, -2, -3, -4, and -7 at TJs between control MDCK cells and their respective knockout cells using their TALENs. Claudin-2 and -7 were less efficiently localized at TJs between control and their knockout cells. Our results indicate that claudin-2 independently determines the 'leaky' property of TJs in MDCK II cells and suggest the importance of knockout analysis in cultured cells.
Pieler, Michael M; Frentzel, Sarah; Bruder, Dunja; Wolff, Michael W; Reichl, Udo
2016-12-07
Downstream processing and formulation of viral vaccines employs a large number of different unit operations to achieve the desired product qualities. The complexity of individual process steps involved, the need for time consuming studies towards the optimization of virus yields, and very high requirements regarding potency and safety of vaccines results typically in long lead times for the establishment of new processes. To overcome such obstacles, to enable fast screening of potential vaccine candidates, and to explore options for production of low cost veterinary vaccines a new platform for whole virus particle purification and formulation based on magnetic particles has been established. Proof of concept was carried out with influenza A virus particles produced in suspension Madin Darby canine kidney (MDCK) cells. The clarified, inactivated, concentrated, and diafiltered virus particles were bound to magnetic sulfated cellulose particles (MSCP), and directly injected into mice for immunization including positive and negative controls. We show here, that in contrast to the mock-immunized group, vaccination of mice with antigen-loaded MSCP (aMSCP) resulted in high anti-influenza A antibody responses and full protection against a lethal challenge with replication competent influenza A virus. Antiviral protection correlated with a 400-fold reduced number of influenza nucleoprotein gene copies in the lungs of aMSCP immunized mice compared to mock-treated animals, indicating the efficient induction of antiviral immunity by this novel approach. Thus, our data proved the use of MSCP for purification and formulation of the influenza vaccine to be fast and efficient, and to confer protection of mice against influenza A virus infection. Furthermore, the method proposed has the potential for fast purification of virus particles directly from bioreactor harvests with a minimum number of process steps towards formulation of low-cost veterinary vaccines, and for screening
Chrysin-piperazine conjugates as antioxidant and anticancer agents.
Patel, Rahul V; Mistry, Bhupendra; Syed, Riyaz; Rathi, Anuj K; Lee, Yoo-Jung; Sung, Jung-Suk; Shinf, Han-Seung; Keum, Young-Soo
2016-06-10
Synthesis of 7-(4-bromobutoxy)-5-hydroxy-2-phenyl-4H-chromen-4-one intermediate treating chrysin with 1,4-dibromobutane facilitated combination of chrysin with a wide range of piperazine moieties which were equipped via reacting the corresponding amines with bis(2-chloroethyl)amine hydrochloride in diethylene glycol monomethyl ether solvent. Free radical scavenging potential of prepared products was analyzed in vitro adopting DPPH and ABTS bioassay in addition to the evaluation of in vitro anticancer efficacies against cervical cancer cell lines (HeLa and CaSki) and an ovarian cancer cell line SK-OV-3 using SRB assay. Bearable toxicity of 7a-w was examined employing Madin-Darby canine kidney (MDCK) cell line. In addition, cytotoxic nature of the presented compounds was inspected utilizing Human bone marrow derived mesenchymal stem cells (hBM-MSCs). Overall, 7a-w indicated remarkable antioxidant power in scavenging DPPH(·) and ABTS(·+), particularly analogs 7f, 7j, 7k, 7l, 7n, 7q, 7v, 7w have shown promising free radical scavenging activity. Analogs 7j and 7o are identified to be highly active candidates against HeLa and CaSki cell lines, whereas 7h and 7l along with 7j proved to be very sensitive towards ovarian cancer cell line SKOV-3. None of the newly prepared scaffolds showed cytotoxic nature toward hBM-MSCs cells. From the structure-activity point of view, nature and position of the electron withdrawing and electron donating functional groups on the piperazine core may contribute to the anticipated antioxidant and anticancer action. Different spectroscopic techniques (FT-IR, (1)H NMR, (13)C NMR, Mass) and elemental analysis (CHN) were utilized to confirm the desired structure of final compounds. Copyright © 2016 Elsevier B.V. All rights reserved.
Surgical Procedures and Clinical Considerations for Impacted Canines: A Literature Review
Directory of Open Access Journals (Sweden)
Parviz Torkzaban
2016-09-01
Full Text Available Impaction of canine teeth is a clinical problem whose treatment usually requires an interdisciplinary approach. After the maxillary third molar, the maxillary canine is the second-most commonly impacted tooth, with an incidence of 1% - 2.5%. Maxillary canines are more common in females than males. This study reviews the surgical treatments and orthodontic considerations for impacted canines exposure reported in previous studies. The clinician should be aware of variations in the surgical management of labially and palatally impacted canines, as well as the most common methods of canine in orthodontic application, and the implications of canine extraction. The different factors that affect these decisions are discussed.
9 CFR 113.214 - Parvovirus Vaccine, Killed Virus (Canine).
2010-01-01
... REQUIREMENTS Killed Virus Vaccines § 113.214 Parvovirus Vaccine, Killed Virus (Canine). Parvovirus Vaccine... antibody against canine parvovirus to determine susceptibility. A constant virus-varying serum... vaccinates and the controls shall be challenged with virulent canine parvovirus furnished or approved by...
Orthodontic Traction of Impacted Canine Using Cantilever
Directory of Open Access Journals (Sweden)
Cláudia Nakandakari
2016-01-01
Full Text Available The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever on the Segmented Arch Technique (SAT concept. A 14.7-year-old female patient appeared at clinic complaining about the absence of the upper right permanent canine. The proposed treatment prioritized the traction of the upper right canine without changing the occlusion and aesthetics. For this, it only installed the upper fixed appliance (Roth with slot 0.018, opting for SAT in order to minimize unwanted side effects. The use of cantilever to the traction of the upper right canine has enabled an efficient and predictable outcome, because it is of statically determined mechanics.
Transmigration of mandibular canine – case report
International Nuclear Information System (INIS)
Gruszka, Katarzyna; Różyło, T. Katarzyna; Różyło-Kalinowska, Ingrid; Denkiewicz, Katarzyna; Masłowska, Klaudia
2014-01-01
Transmigration is a phenomenon of movement of an unerupted tooth in the bone across the midline. This anomaly is not often found. Transmigration is more prevalent in females than in males, and more often encountered in the mandible than maxilla, it affects mostly canines. The aim of this study was to present a case report of a mandibular canine transmigration in a patient aged 12. Intraoral examination determined hypodontia of right second premolar and delayed eruption of left second premolar in maxilla, as well as persistent deciduous teeth: right second molar, left canine and second molar. The patient was referred for a Cone-Beam CT examination, which allowed precise visualization of the transmigrating canine as well as ruled out resorption of roots of mandibular incisors. The treatment with a maxillary fixed orthodontic appliance was finished after obtaining a satisfactory result. Proper alignment of the incisors in the anterior-posterior plane and correct midline position were accepted by the patient. Transmigrating canine after consultation with the surgeon was designed to further radiological observation
Canine Parvovirus: Current Perspective
Nandi, S.; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs—the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with...
Evaluation of P16 expression in canine appendicular osteosarcoma.
Murphy, B G; Mok, M Y; York, D; Rebhun, R; Woolard, K D; Hillman, C; Dickinson, P; Skorupski, K
2017-06-20
Osteosarcoma (OSA) is a common malignant bone tumor of large breed dogs that occurs at predictable anatomic sites. At the time of initial diagnosis, most affected dogs have occult pulmonary metastases. Even with aggressive surgical treatment combined with chemotherapy, the majority of dogs diagnosed with OSA live less than 1 year from the time of diagnosis. The ability to identify canine OSA cases most responsive to treatment is needed. In humans, OSA is also an aggressive tumor that is histologically and molecularly similar to canine OSA. The expression of the tumor suppressor gene product P16 by human OSA tissue has been linked to a favorable response to chemotherapy. We identified an antibody that binds canine P16 and developed a canine OSA tissue microarray in order to test the hypothesis that P16 expression by canine OSA tissue is predictive of clinical outcome following amputation and chemotherapy. Although statistical significance was not reached, a trend was identified between the lack of canine OSA P16 expression and a shorter disease free interval. The identification of a molecular marker for canine OSA is an important goal and the results reported here justify a larger study.
Cone beam computed tomography findings of impacted upper canines
Energy Technology Data Exchange (ETDEWEB)
Da Silva Santos, Ludmilla Mota [Dept. of Endodontics, Aracatuba Dental School, Paulista State University, Aracatuba(Brazil); Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores [School of Dentistry, Federal University of Bahia, Salvador (Brazil); Oliveira Santos, Christiano [Dept. of Stomatology, Oral Public Health, and Forensic Dentistry, School of Dentistry, University of Sao Paulo, Ribeirao Preto (Brazil); Neves, Frederico Sampaio [Dept. of Oral Diagnosis, Piracicaba Dental School, State University of Campinas, Piracicaba (Brazil)
2014-12-15
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
Cone beam computed tomography findings of impacted upper canines
International Nuclear Information System (INIS)
Da Silva Santos, Ludmilla Mota; Bastos, Luana Costa; Da Silva, Silvio Jose Albergaria; Campos, Paulo Sergio Flores; Oliveira Santos, Christiano; Neves, Frederico Sampaio
2014-01-01
To describe the features of impacted upper canines and their relationship with adjacent structures through three-dimensional cone-beam computed tomography (CBCT) images. Using the CBCT scans of 79 upper impacted canines, we evaluated the following parameters: gender, unilateral/bilateral occurrence, location, presence and degree of root resorption of adjacent teeth (mild, moderate, or severe), root dilaceration, dental follicle width, and presence of other associated local conditions. Most of the impacted canines were observed in females (56 cases), unilaterally (51 cases), and at a palatine location (53 cases). Root resorption in adjacent teeth and root dilaceration were observed in 55 and 47 impacted canines, respectively. In most of the cases, the width of the dental follicle of the canine was normal; it was abnormally wide in 20 cases. A statistically significant association was observed for all variables, except for root dilaceration (p=0.115) and the side of impaction (p=0.260). Root resorption of adjacent teeth was present in most cases of canine impaction, mostly affecting adjacent lateral incisors to a mild degree. A wide dental follicle of impacted canines was not associated with a higher incidence of external root resorption of adjacent teeth.
International Nuclear Information System (INIS)
Rohaya Megat Abdul Wahab; Albira Sintian; Zaidah Zainal Arifin; Zaidah Zainal Ariffin; Shahrul Hisham Zainal Ariffin
2015-01-01
Alkaline phosphatase (ALP), tartrate-resistant acid phosphatase (TRAP) and aspartate aminotransferase (AST) activities were studied as bio markers of canine movement. Root resorption was also evaluated in canines subjected to the orthodontic forces. Nineteen subjects randomly received 100 and 150 g force using self-ligating brackets (SLB) either on the right or left site of maxillary arch. Gingival crevicular fluid samples were collected at distal sites of canines for five consecutive weeks. The activities of ALP, TRAP and AST were assayed and measured spectrophotometrically. Canine movement was measured for five consecutive weeks while root resorption was monitored at baseline, week 0 and week 5 using periapical radiographs. In 100 g group, TRAP activity significantly increased in week 3-5 when compared to TRAP baseline activity. However, ALP and AST activities slightly increased. In 150 g group, ALP and TRAP activities slightly increased when compared with their baseline activities. However, AST significantly increased in week 5. Canine movement and root resorption were not significantly different (p<0.05) in both groups. A force of 100 and 150 g slightly increased the bone modeling process and resulted in similar canine movement and root resorption. Therefore, 100 g force could be an optimum force for canine retraction and is preferable (compared with 150 g force) in canine retraction using SLB. (author)
Two interceptive approaches to palatally displaced canines: a prospective longitudinal study.
Leonardi, Maria; Armi, Pamela; Franchi, Lorenzo; Baccetti, Tiziano
2004-10-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDCs), ie, extraction of the deciduous canines alone and in association with the use of a cervical pull headgear. The prospective longitudinal design of the investigation included 46 subjects with PDC (62 maxillary canines) who were randomly assigned to one of three groups (1) a group that underwent the extraction of the deciduous canine only, (2) a group that received in addition the use of a cervical pull headgear, and (3) an untreated control group. Panoramic radiographs were evaluated at initial observation (T1) and after an average period of 18 months (T2). Cervical vertebral maturation was assessed on lateral cephalograms at T1. Successful or unsuccessful canine eruption was assessed 48 months after T1. The between-group statistical comparisons were performed on the T1-T2 changes in the diagnostic parameters on panoramic radiographs, the prevalence rates of successful canine eruption, and the amount of time for canine eruption. The removal of the deciduous canine as an isolated measure to intercept palatal displacement of maxillary canines showed a prevalence rate of 50% success, which was not significantly greater than the success rate in untreated controls. The use of a headgear in addition to the extraction of the deciduous canine induced successful eruption in 80% of the cases, with a significant improvement in the measures for intraosseous canine position. There was no significant difference between the two interceptive approaches in the time required for canine eruption.
Skeletal maturity assessment using mandibular canine calcification stages
Directory of Open Access Journals (Sweden)
Vildana Džemidžić
2016-11-01
Full Text Available Objective. The aims of this study were: to investigate the relationship between mandibular canine calcification stages and skeletal maturity; and to evaluate whether the mandibular canine calcification stages may be used as a reliable diagnostic tool for skeletal maturity assessment. Materials and methods. This study included 151 subjects: 81 females and 70 males, with ages ranging from 9 to 16 years (mean age: 12.29±1.86 years. The inclusion criteria for subjects were as follows: age between 9 and 16 years; good general health without any hormonal, nutritional, growth or dental development problems. Subjects who were undergoing or had previously received orthodontic treatment were not included in this study. The calcification stages of the left permanent mandibular canine were assessed according to the method of Demirjian, on panoramic radiographs. Assessment of skeletal maturity was carried out using the cervical vertebral maturation index (CVMI, as proposed by the Hassel-Farman method, on lateral cephalograms. The correlation between the calcification stages of mandibular canine and skeletal maturity was estimated separately for male and female subjects. Results. Correlation coefficients between calcification stages of mandibular canine and skeletal maturity were 0.895 for male and 0.701 for female subjects. Conclusions. A significant correlation was found between the calcification stages of the mandibular canine and skeletal maturity. The calcification stages of the mandibular canine show a satisfactory diagnostic performance only for assessment of pre-pubertal growth phase.
A new method for rapid Canine retraction
Directory of Open Access Journals (Sweden)
"Khavari A
2001-06-01
Full Text Available Distraction osteogenesis method (Do in bone lengthening and rapid midpalatal expansion have shown the great ability of osteognic tissues for rapid bone formation under distraction force and special protocol with optimum rate of one millimeter per day. Periodontal membrane of teeth (PDM is the extension of periostium in the alveolar socked. Orthodontic force distracts PDM fibers in the tension side and then bone formation will begin.Objects: Rapid retraction of canine tooth into extraction space of first premolar by DO protocol in order to show the ability of the PDM in rapid bone formation. The other objective was reducing total orthodontic treatment time of extraction cases.Patients and Methods: Tweleve maxillary canines in six patients were retracted rapidly in three weeks by a custom-made tooth-born appliance. Radiographic records were taken to evaluate the effects of heavy applied force on canine and anchorage teeth.Results: Average retraction was 7.05 mm in three weeks (2.35 mm/week. Canines rotated distal- in by mean 3.5 degrees.Anchorage loss was from 0 to 0.8 mm with average of 0.3 mm.Root resorption of canines was negligible, and was not significant clinically. Periodontium was normal after rapid retraction. No hazard for pulp vitality was observed.Discussion: PDM responded well to heavy distraction force by Do protocol. Rapid canine retraction seems to be a safe method and can considerabely reduce orthodontic time.
Headley,Selwyn Arlington; Saito,Taís Berelli
2003-01-01
Simultaneous infection of canine distemper virus and canine parvovirus associated with distemper myocardial degeneration and necrosis is described in a pup. The dog demonstrated myoclonus, nystagmus, enamel hypoplasia, abdominal pustules, and bilateral corneal ulceration clinically. Demyelinating encephalitis, myocardial degeneration and necrosis with mineralization, and necrosis, hemorrhage and fusion of intestinal villi were observed. The lesions observed in this dog are characteristic of a...
Novel canine circovirus strains from Thailand: Evidence for genetic recombination.
Piewbang, Chutchai; Jo, Wendy K; Puff, Christina; van der Vries, Erhard; Kesdangsakonwut, Sawang; Rungsipipat, Anudep; Kruppa, Jochen; Jung, Klaus; Baumgärtner, Wolfgang; Techangamsuwan, Somporn; Ludlow, Martin; Osterhaus, Albert D M E
2018-05-14
Canine circoviruses (CanineCV's), belonging to the genus Circovirus of the Circoviridae family, were detected by next generation sequencing in samples from Thai dogs with respiratory symptoms. Genetic characterization and phylogenetic analysis of nearly complete CanineCV genomes suggested that natural recombination had occurred among different lineages of CanineCV's. Similarity plot and bootscaning analyses indicated that American and Chinese viruses had served as major and minor parental viruses, respectively. Positions of recombination breakpoints were estimated using maximum-likelihood frameworks with statistical significant testing. The putative recombination event was located in the Replicase gene, intersecting with open reading frame-3. Analysis of nucleotide changes confirmed the origin of the recombination event. This is the first description of naturally occurring recombinant CanineCV's that have resulted in the circulation of newly emerging CanineCV lineages.
Podoplanin Expression in Canine Melanoma
Ogasawara, Satoshi; Honma, Ryusuke; Kaneko, Mika K.; Fujii, Yuki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-01-01
A type I transmembrane protein, podoplanin (PDPN), is expressed in several normal cells such as lymphatic endothelial cells or pulmonary type I alveolar cells. We recently demonstrated that anticanine PDPN monoclonal antibody (mAb), PMab-38, recognizes canine PDPN of squamous cell carcinomas, but does not react with lymphatic endothelial cells. Herein, we investigated whether PMab-38 reacts with canine melanoma. PMab-38 reacted with 90% of melanoma cells (9/10 cases) using immunohistochemistr...
Finite element analysis of rapid canine retraction through reducing resistance and distraction
Directory of Open Access Journals (Sweden)
Junjie XUE
2014-01-01
Full Text Available Objective: The aims of this study were to compare different surgical approaches to rapid canine retraction by designing and selecting the most effective method of reducing resistance by a three-dimensional finite element analysis. Material and Methods: Three-dimensional finite element models of different approaches to rapid canine retraction by reducing resistance and distraction were established, including maxillary teeth, periodontal ligament, and alveolar. The models were designed to dissect the periodontal ligament, root, and alveolar separately. A 1.5 N force vector was loaded bilaterally to the center of the crown between first molar and canine, to retract the canine distally. The value of total deformation was used to assess the initial displacement of the canine and molar at the beginning of force loading. Stress intensity and force distribution were analyzed and evaluated by Ansys 13.0 through comparison of equivalent (von Mises stress and maximum shear stress. Results: The maximum value of total deformation with the three kinds of models occurred in the distal part of the canine crown and gradually reduced from the crown to the apex of the canine; compared with the canines in model 3 and model 1, the canine in model 2 had the maximum value of displacement, up to 1.9812 mm. The lowest equivalent (von Mises stress and the lowest maximum shear stress were concentrated mainly on the distal side of the canine root in model 2. The distribution of equivalent (von Mises stress and maximum shear stress on the PDL of the canine in the three models was highly concentrated on the distal edge of the canine cervix. . Conclusions: Removal of the bone in the pathway of canine retraction results in low stress intensity for canine movement. Periodontal distraction aided by surgical undermining of the interseptal bone would reduce resistance and effectively accelerate the speed of canine retraction.
Canine scent detection of canine cancer: a feasibility study
Directory of Open Access Journals (Sweden)
Dorman DC
2017-10-01
Full Text Available David C Dorman,1 Melanie L Foster,2 Katherine E Fernhoff,1 Paul R Hess2 1Department of Molecular and Biomedical Sciences, 2Department of Clinical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC, USA Abstract: The scent detection prowess of dogs has prompted interest in their ability to detect cancer. The purpose of this study was to determine whether dogs could use olfactory cues to discriminate urine samples collected from dogs that did or did not have urinary tract transitional cell carcinoma (TCC, at a rate greater than chance. Dogs with previous scent training (n=4 were initially trained to distinguish between a single control and a single TCC-positive urine sample. All dogs acquired this task (mean =15±7.9 sessions; 20 trials/session. The next training phase used four additional control urine samples (n=5 while maintaining the one original TCC-positive urine sample. All dogs quickly acquired this task (mean =5.3±1.5 sessions. The last training phase used multiple control (n=4 and TCC-positive (n=6 urine samples to promote categorical training by the dogs. Only one dog was able to correctly distinguish multiple combinations of TCC-positive and control urine samples suggesting that it mastered categorical learning. The final study phase evaluated whether this dog would generalize this behavior to novel urine samples. However, during double-blind tests using two novel TCC-positive and six novel TCC-negative urine samples, this dog did not indicate canine TCC-positive cancer samples more frequently than expected by chance. Our study illustrates the need to consider canine olfactory memory and the use of double-blind methods to avoid erroneous conclusions regarding the ability of dogs to alert on specimens from canine cancer patients. Our results also suggest that sample storage, confounding odors, and other factors need to be considered in the design of future studies that evaluate the detection of
Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G
2006-11-25
The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.
Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald
2004-01-01
The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.
A rare case of canine anomaly - a possible algorithm for treating it.
Vaida, Ligia; Todor, Bianca Ioana; Corega, Claudia; Băciuţ, Mihaela; Băciuţ, Grigore
2014-01-01
Canine transmigration is a very rare dental anomaly in which an unerupted mandibular canine migrates, crossing the mandibular midline. This unusual condition is most often diagnosed by chance during a routine X-ray examination. The most common clinical signs announcing the presence of this anomaly are over-retention of the deciduous canine and the absence of permanent canine from the dental arch after its physiological period of eruption. In this paper, we present a clinical case, 10-year-old boy, who was diagnosed with mandibular right canine transmigration at three years after the start of orthodontic treatment, during which we were expecting the eruption of mandibular canines. The orthopantomograph revealed the mandibular right canine to be in a horizontal position under the apices of the incisors - type 2 transmigration pattern classified by Mupparapu (2002). Based on cone-beam computer tomography examination, we recommended a surgical exposure of the canine and orthodontic alignment. Due to the risk of root resorption of the mandibular right lateral incisor during orthodontic movement phase of canine transmigrated to the dental arch, we decided to align the mandibular right canine in a transposition, between the two mandibular right incisors. Then we resorted to adapting the mandibular right lateral incisor coronary morphology to simulate a canine and also to reshaping the canine coronary morphology to resemble a lateral incisor. This therapeutic approach allowed us to restore morphologically and functionally the mandibular dento-alveolar arch, preserving the entire dental system.
Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.
Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong
2017-06-01
Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.
Gümüşderelioğlu, Menemşe; Kaya, F Betül; Beşkardeş, Işıl Gerçek
2011-06-15
In this study, the relationship between the cellular morphology and the material surface topography was investigated. Poly(ε-caprolactone) (PCL) membranes were prepared in a wide range of surface wettabilities by means of crystallinity-controlled solvent casting process. Membrane surfaces were characterized by atomic force microscope (AFM), scanning electron microscope (SEM), and static/dynamic water contact angle measurements. It was found that solvent evaporation and non-solvent (methanol) addition to the solvent (THF) are the most decisive parameters to change the surface topography. The non-solvent addition and the decrease in solvent evaporation temperature from room temperature to -20 °C caused increased polymeric chain mobility and crystallization time. Such changes in crystallization parameters led to the formation of micro/nano-sized features on the membrane. Cell culture studies indicated that in contrast to Madin Darby kidney (MDBK) epithelial cells, L929 mouse fibroblast preferred rough and porous surfaces. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Dongseob Tark
Full Text Available Bovine spongiform encephalopathy (BSE is a zoonotic transmissible spongiform encephalopathy (TSE thought to be caused by the same prion strain as variant Creutzfeldt-Jakob disease (vCJD. Unlike scrapie and chronic wasting disease there is no cell culture model allowing the replication of proteinase K resistant BSE (PrPBSE and the further in vitro study of this disease. We have generated a cell line based on the Madin-Darby Bovine Kidney (MDBK cell line over-expressing the bovine prion protein. After exposure to naturally BSE-infected bovine brain homogenate this cell line has shown to replicate and accumulate PrPBSE and maintain infection up to passage 83 after initial challenge. Collectively, we demonstrate, for the first time, that the BSE agent can infect cell lines over-expressing the bovine prion protein similar to other prion diseases. These BSE infected cells will provide a useful tool to facilitate the study of potential therapeutic agents and the diagnosis of BSE.
Surgical considerations and management of bilateral labially impacted canines
Directory of Open Access Journals (Sweden)
Yu-Shan Huang
2016-06-01
Full Text Available Canines are among the most commonly impacted teeth. When a canine is positioned labially, the untoward soft-tissue responses following surgical exposure may cause unfavorable esthetic outcomes. Therefore, decision making as to the choice of a proper surgical technique to uncover labially impacted teeth is critical. This case presentation describes two different surgical approaches for two maxillary impacted canines in a 12-year-old girl. A sequential approach included a first stage of surgical exposure using apically positioned flaps and orthodontic extrusion of both impacted teeth. A successive laterally positioned flap was used for the left maxillary canine to achieve a harmonious soft-tissue contour. In this case, close monitoring and cooperation during the various treatment phases led to proper canine positioning and a successful esthetic result, with good periodontal health and functional occlusion.
Immunohistochemical Characterization of Canine Lymphomas
Directory of Open Access Journals (Sweden)
Roxana CORA
2017-11-01
Full Text Available Lymphomas occur by clonal expansion of lymphoid cells and have distinctive morphological and immunophenotypic features. Determination of canine lymphoma immunophenotype is useful for accurate prognosis and further therapy. In the suggested study, we performed an immunohistochemical evaluation of some cases with canine lymphoma diagnosed in the Department of Pathology (Faculty of Veterinary Medicine, Cluj-Napoca, Romania, in order to characterize them. The investigation included 39 dogs diagnosed with different anatomical forms of lymphoma, following necropsy analysis or assessment of biopsies. The diagnosis of lymphoma was confirmed by necropsy and histopathology (Hematoxylin-eosin stain examinations. The collected specimens were analyzed by immunohistochemistry technique (automatic method using the following antibodies: CD3, CD20, CD21 and CD79a. The analyzed neoplasms were characterized as follows: about 64.10% of cases were diagnosed as B-cell lymphomas, 33.34% of cases as T-cell lymphomas, whereas 2.56% of cases were null cell type lymphomas (neither B nor T. Most of multicentric (80%, mediastinal (60% and primary central nervous system lymphomas (100% had B immunophenotype, while the majority of cutaneous (80% and digestive (100% lymphomas had T immunophenotype. Immunohistochemical description of canine lymphomas can deliver some major details concerning their behavior and malignancy. Additionally, vital prognosis and efficacy of some therapeutic protocols are relying on the immunohistochemical features of canine lymphoma.
Stem Cell-Associated Marker Expression in Canine Hair Follicles.
Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J
2016-03-01
Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.
Chlamydia in canine or feline coronary arteriosclerotic lesions
Directory of Open Access Journals (Sweden)
Grabarevic Zeljko
2011-09-01
Full Text Available Abstract Background There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16 and cats (n = 13 with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Results Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. Conclusions These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
Chlamydia in canine or feline coronary arteriosclerotic lesions.
Sostaric-Zuckermann, Ivan C; Borel, Nicole; Kaiser, Carmen; Grabarevic, Zeljko; Pospischil, Andreas
2011-09-09
There are numerous reports linking Chlamydia infection to human coronary atherosclerosis. However, there is a lack of data regarding this correlation in dogs and cats, and there are no reports investigating coronary arteriosclerosis and Chlamydia in these species. The aim of the present study was to examine whether there is a correlation between canine and feline spontaneous atherosclerosis or arteriosclerosis and the presence of Chlamydia. Archived histopathological samples of dogs (n = 16) and cats (n = 13) with findings of atherosclerosis or arteriosclerosis in heart tissue were examined for the presence of Chlamydiaceae using real-time PCR, ArrayTube Microarray and immunohistochemistry. Additionally, arteriosclerotic lesions of all cases were histologically classified and graded. Both canine atherosclerotic cases, and all 14 canine arteriosclerotic cases were negative for Chlamydia. Only one of the 13 arteriosclerotic feline cases was positive for Chlamydia by real-time PCR, revealing C. abortus by ArrayTube Microarray. To our knowledge, this is the first description of C. abortus in a cat. Overall, the type and grade of canine and feline arteriosclerotic lesions revealed similarities, and were predominantly moderate and hyperplastic. These findings suggest that there is no obvious correlation between canine and feline coronary arteriosclerosis and the presence of Chlamydia. In order to draw final conclusions about the correlation between Chlamydia and canine atherosclerosis, examination of more samples is required.
A novel bocavirus in canine liver
Directory of Open Access Journals (Sweden)
Li Linlin
2013-02-01
Full Text Available Abstract Background Bocaviruses are classified as a genus within the Parvoviridae family of single-stranded DNA viruses and are pathogenic in some mammalian species. Two species have been previously reported in dogs, minute virus of canines (MVC, associated with neonatal diseases and fertility disorders; and Canine bocavirus (CBoV, associated with respiratory disease. Findings In this study using deep sequencing of enriched viral particles from the liver of a dog with severe hemorrhagic gastroenteritis, necrotizing vasculitis, granulomatous lymphadenitis and anuric renal failure, we identified and characterized a novel bocavirus we named Canine bocavirus 3 (CnBoV3. The three major ORFs of CnBoV3 (NS1, NP1 and VP1 shared less than 60% aa identity with those of other bocaviruses qualifying it as a novel species based on ICTV criteria. Inverse PCR showed the presence of concatemerized or circular forms of the genome in liver. Conclusions We genetically characterized a bocavirus in a dog liver that is highly distinct from prior canine bocaviruses found in respiratory and fecal samples. Its role in this animal’s complex disease remains to be determined.
A compendium of canine normal tissue gene expression.
Directory of Open Access Journals (Sweden)
Joseph Briggs
Full Text Available BACKGROUND: Our understanding of disease is increasingly informed by changes in gene expression between normal and abnormal tissues. The release of the canine genome sequence in 2005 provided an opportunity to better understand human health and disease using the dog as clinically relevant model. Accordingly, we now present the first genome-wide, canine normal tissue gene expression compendium with corresponding human cross-species analysis. METHODOLOGY/PRINCIPAL FINDINGS: The Affymetrix platform was utilized to catalogue gene expression signatures of 10 normal canine tissues including: liver, kidney, heart, lung, cerebrum, lymph node, spleen, jejunum, pancreas and skeletal muscle. The quality of the database was assessed in several ways. Organ defining gene sets were identified for each tissue and functional enrichment analysis revealed themes consistent with known physio-anatomic functions for each organ. In addition, a comparison of orthologous gene expression between matched canine and human normal tissues uncovered remarkable similarity. To demonstrate the utility of this dataset, novel canine gene annotations were established based on comparative analysis of dog and human tissue selective gene expression and manual curation of canine probeset mapping. Public access, using infrastructure identical to that currently in use for human normal tissues, has been established and allows for additional comparisons across species. CONCLUSIONS/SIGNIFICANCE: These data advance our understanding of the canine genome through a comprehensive analysis of gene expression in a diverse set of tissues, contributing to improved functional annotation that has been lacking. Importantly, it will be used to inform future studies of disease in the dog as a model for human translational research and provides a novel resource to the community at large.
Genomic instability and telomere fusion of canine osteosarcoma cells.
Directory of Open Access Journals (Sweden)
Junko Maeda
Full Text Available Canine osteosarcoma (OSA is known to present with highly variable and chaotic karyotypes, including hypodiploidy, hyperdiploidy, and increased numbers of metacentric chromosomes. The spectrum of genomic instabilities in canine OSA has significantly augmented the difficulty in clearly defining the biological and clinical significance of the observed cytogenetic abnormalities. In this study, eight canine OSA cell lines were used to investigate telomere fusions by fluorescence in situ hybridization (FISH using a peptide nucleotide acid probe. We characterized each cell line by classical cytogenetic studies and cellular phenotypes including telomere associated factors and then evaluated correlations from this data. All eight canine OSA cell lines displayed increased abnormal metacentric chromosomes and exhibited numerous telomere fusions and interstitial telomeric signals. Also, as evidence of unstable telomeres, colocalization of γ-H2AX and telomere signals in interphase cells was observed. Each cell line was characterized by a combination of data representing cellular doubling time, DNA content, chromosome number, metacentric chromosome frequency, telomere signal level, cellular radiosensitivity, and DNA-PKcs protein expression level. We have also studied primary cultures from 10 spontaneous canine OSAs. Based on the observation of telomere aberrations in those primary cell cultures, we are reasonably certain that our observations in cell lines are not an artifact of prolonged culture. A correlation between telomere fusions and the other characteristics analyzed in our study could not be identified. However, it is important to note that all of the canine OSA samples exhibiting telomere fusion utilized in our study were telomerase positive. Pending further research regarding telomerase negative canine OSA cell lines, our findings may suggest telomere fusions can potentially serve as a novel marker for canine OSA.
Survivin inhibition via EZN-3042 in canine lymphoma and osteosarcoma.
Shoeneman, J K; Ehrhart, E J; Charles, J B; Thamm, D H
2016-06-01
Canine lymphoma (LSA) and osteosarcoma (OS) have high mortality rates and remain in need of more effective therapeutic approaches. Survivin, an inhibitor of apoptosis (IAP) family member protein that inhibits apoptosis and drives cell proliferation, is commonly elevated in human and canine cancer. Survivin expression is a negative prognostic factor in dogs with LSA and OS, and canine LSA and OS cell lines express high levels of survivin. In this study, we demonstrate that survivin downregulation in canine LSA and OS cells using a clinically applicable locked nucleic acid antisense oligonucleotide (EZN-3042, Enzon Pharmaceuticals, Piscataway Township, NJ, USA) inhibits growth, induces apoptosis and enhances chemosensitivity in vitro, and inhibits survivin transcription and protein production in orthotopic canine OS xenografts. Our findings strongly suggest that survivin-directed therapies might be effective in treatment of canine LSA and OS and support evaluation of EZN-3042 in dogs with cancer. © 2014 John Wiley & Sons Ltd.
Canine index – A tool for sex determination
Directory of Open Access Journals (Sweden)
Shankar M. Bakkannavar
2015-12-01
Full Text Available Teeth are most useful tools in victim identification in the living as well as the dead in the field of forensic investigations. Their ability to survive in situations like mass disasters makes them constructive devices. Many authors have measured crowns of teeth in both males and females and found certain variations. Canines, reported to survive in air crash and hurricane disasters, are perhaps the most stable teeth in the oral cavity because of the labiolingual thickness of the crown and the root anchorage in the alveolar process of jaws. Measurement of mesiodistal width of the mandibular canines and inter-canine distance of the mandible provides good evidence of sex identification due to dimorphism. This study was undertaken to evaluate the effectiveness of canine index (CI in the determination of sex.
Immunohistochemical Expression of FXR1 in Canine Normal Tissues and Melanomas.
Nordio, Laura; Marques, Andreia T; Lecchi, Cristina; Luciano, Alberto M; Stefanello, Damiano; Giudice, Chiara
2018-04-01
Fragile X mental retardation-related protein 1 (FXR1) is a cytoplasmic RNA-binding protein highly conserved among vertebrates. It has been studied for its role in muscle development, inflammation, and tumorigenesis, being related, for example, to metastasizing behavior in human and canine uveal melanoma. Anti-FXR1 antibodies have never been validated in the canine species. To investigate FXR1 expression in canine melanocytic tumors, the present study tested two commercially available polyclonal anti-human FXR1 antibodies, raised in goat and rabbit, respectively. The cross-reactivity of the anti-FXR1 antibodies was assessed by Western blot analysis, and the protein was localized by IHC in a set of normal canine tissues and in canine melanocytic tumors (10 uveal and 10 oral). Western blot results demonstrated that the antibody raised in rabbit specifically recognized the canine FXR1, while the antibody raised in goat did not cross-react with this canine protein. FXR1 protein was immunodetected using rabbit anti-FXR1 antibody, in canine normal tissues with different levels of intensity and distribution. It was also detected in 10/10 uveal and 9/10 oral melanocytic tumors. The present study validated for the first time the use of anti-FXR1 antibody in dogs and highlighted different FXR1 protein expression in canine melanocytic tumors, the significance of which is undergoing further investigations.
Rate of retraction of anterior teeth after canine distraction
Directory of Open Access Journals (Sweden)
Litesh Singla
2017-01-01
Full Text Available Background and Objectives: Orthodontists have always strived to develop a new technique to reduce the treatment time with minimal patient cooperation. Canine distraction was introduced as an alternative technique for canine retraction in a minimum possible period of 3 weeks, thus avoiding taxing the anchorage by molars since the canines are retracted within the lag phase of molars. It has been proved by numerous studies that the bone mesial to canine after rapid canine distraction through the extraction socket is a new and immature. The objectives of this study were to evaluate the rate of retraction of anterior teeth, the time taken, and anchorage loss during the retraction of anterior teeth into this newly organized bone. Methods: Six orthodontic patients who required first premolar extractions were selected. Undermining of the interseptal bone distal to the canine was done, and canines were retracted into the extraction space of the first premolar, using a custom-made tooth borne intraoral distraction screw, following which the incisors were retracted into the newly formed bone using closing loops. The patients were called at weekly intervals to measure the amount of space left between canine and lateral incisor, and the rate of retraction was calculated after space was closed. Results: The present study showed that the rate of retraction of mandibular and maxillary teeth was 0.74 ± 0.39 mm and 0.73 ± 0.15 mm/week, respectively. The anchorage loss was found to be 1.83 ± 0.29 mm and 2.08 ± 0.38 mm in mandibular and maxillary arches, respectively. The time taken to retract the incisors was found to be 40.3 ± 1.5 and 41.7 ± 0.6 days for mandibular and maxillary arches, respectively. Interpretation and Conclusion: Retraction of incisors is faster in both maxillary and mandibular arches when the incisors are retracted immediately into the immature bone created after canine distraction.
Canine tooth size and fitness in male mandrills (Mandrillus sphinx).
Leigh, Steven R; Setchell, Joanna M; Charpentier, Marie; Knapp, Leslie A; Wickings, E Jean
2008-07-01
Sexual selection theory explains the evolution of exaggerated male morphologies and weaponry, but the fitness consequences of developmental and age-related changes in these features remain poorly understood. This long-term study of mandrill monkeys (Mandrillus sphinx) demonstrates how age-related changes in canine tooth weaponry and adult canine size correlate closely with male lifetime reproductive success. Combining long-term demographic and morphometric data reveals that male fitness covaries simply and directly with canine ontogeny, adult maximum size, and wear. However, fitness is largely independent of other somatometrics. Male mandrills sire offspring almost exclusively when their canines exceed approximately 30 mm, or two-thirds of average adult value (45 mm). Moreover, sires have larger canines than nonsires. The tooth diminishes through wear as animals age, corresponding with, and perhaps influencing, reproductive senescence. These factors combine to constrain male reproductive opportunities to a brief timespan, defined by the period of maximum canine length. Sexually-selected weaponry, especially when it is nonrenewable like the primate canine tooth, is intimately tied to the male life course. Our analyses of this extremely dimorphic species indicate that sexual selection is closely intertwined with growth, development, and aging, pointing to new directions for sexual selection theory. Moreover, the primate canine tooth has potential as a simple mammalian system for testing genetically-based models of aging. Finally, the tooth may record details of life histories in fossil primates, especially when sexual selection has played a role in the evolution of dimorphism.
Transmigration of Mandibular Canine: Report of Four Cases and Review of Literature
Directory of Open Access Journals (Sweden)
Gaurav Sharma
2011-01-01
Full Text Available Transmigration of canine is a rare phenomenon. The prevalence of transmigration of mandibular canine has been found to be only 0.14%–0.31%. The treatment of impacted transmigrated canine is very complicated if it is diagnosed at a later stage. We report 4 cases of transmigration of mandibular canine and review the literature regarding the etiology and treatment. Panoramic radiograph should be taken during the mixed dentition period if the mandibular canine has not erupted from more than one year from its normal chronological age of eruption as intraoral periapical radiograph examination will not always detect an impacted or transmigrated canine.
Asymmetry in development (mineralisation of permanent mandibular canine roots
Directory of Open Access Journals (Sweden)
Burić Mirjana V.
2012-01-01
Full Text Available Introduction. The development of the teeth is closely associated with the proper and unobstructed physical and psychological development of the child. Aim. To determine the existence of asymmetry in the development of the roots of the lower permanent canine teeth in different age groups of children of both sexes. Material and methods. The study was conducted on 523 ortopantomograms (253 boys and 270 girls of orthodontic patients aged 6 to 14 years of the Dental Clinic in Niš. We analyzed the development of asymmetry in the lower permanent canine root, using the method of Gleiser and Hunt, or the modification by Tijanić (1981. Results. It was found that asymmetry in the development of the root in both sexes of the lower canine teeth was present in 20 patients (3.82%, 10 boys (3.95% and 10 girls (3.70%. The difference is in the range of one stage. Asymmetric development of the roots of the lower incisors in girls and boys usually present in the 7th and 8th stages (60% in girls and in 50% in boys. In 90% of girls in developing asymmetry the root of the lower canine is present in a single stage, and in 10% of girls it presents within three stages. Asymmetric development of the root of the lower canine is the most common in the 7th and 8th stages of development (55%. Conclusion. Asymmetric root development of permanent lower canines was found in 3.82% of patients. More than half of respondents (55% had asymmetrical canine root development stage in half and three quarters of the total root length. The results of this study indicate that the canine is the tooth with very little variations in its development.
Orthodontic management of buccally erupted ectopic canine with two case reports
Directory of Open Access Journals (Sweden)
Avesh Sachan
2012-01-01
Full Text Available Ectopic canine teeth develop displaced from their normal position. Any permanent tooth can be ectopic, and the cause may be both genetic and environmental. Orthodontic treatment is justified because ectopic canine teeth can migrate in the jaw bone and may damage the adjacent teeth roots and bone. Orthodontic treatment is also justifiable for aesthetic reasons. Diagnosis and treatment of ectopically erupting permanent maxillary canines requires timely management by the orthodontist. Internal or external root resorption of teeth adjacent to the ectopic canine is the most common sequel. Malocclusion with severe crowding is difficult to treat without extraction. Non-extraction treatment of ectopic canines can compromise the patient′s profile. This article represents two cases of extraction treatment approach for buccally displaced or ectopic canine in a patient with severe crowding in the mandibular arch.
Retrospective radiation dosimetry using electron paramagnetic resonance in canine dental enamel
International Nuclear Information System (INIS)
Khan, Rao F.H.; Pekar, J.; Rink, W.J.; Boreham, D.R.
2005-01-01
Electron paramagnetic resonance (EPR) biodosimetry of human tooth enamel has been widely used for measuring radiation doses in various scenarios. We have now developed EPR dosimetry in tooth enamel extracted from canines. Molars and incisors from canines were cleaned by processing in supersaturated aqueous potassium hydroxide solution. The dosimetric signal in canine tooth enamel was found to increase linearly as a function of laboratory added dose from 0.44±0.02 to 4.42±0.22 Gy. The gamma radiation sensitivity of the canine molar enamel was found to be comparable to that of human tooth enamel. The dosimetric signal in canine enamel has been found to be stable up to at least 6 weeks after in vitro irradiation. A dosimetric signal variation of 10-25% was observed for canines ranging from in age 3 years to 16 year old
Canine parvovirus: current perspective.
Nandi, S; Kumar, Manoj
2010-06-01
Canine parvovirus 2 (CPV-2) has been considered to be an important pathogen of domestic and wild canids and has spread worldwide since its emergence in 1978. It has been reported from Asia, Australia, New Zealand, the Americas and Europe. Two distinct parvoviruses are now known to infect dogs-the pathogenic CPV-2 and CPV-1 or the minute virus of canine (MVC). CPV-2, the causative agent of acute hemorrhagic enteritis and myocarditis in dogs, is one of the most important pathogenic viruses with high morbidity (100%) and frequent mortality up to 10% in adult dogs and 91% in pups. The disease condition has been complicated further due to emergence of a number of variants namely CPV-2a, CPV-2b and CPV-2c over the years and involvement of domestic and wild canines. There are a number of different serological and molecular tests available for prompt, specific and accurate diagnosis of the disease. Further, both live attenuated and inactivated vaccines are available to control the disease in animals. Besides, new generation vaccines namely recombinant vaccine, peptide vaccine and DNA vaccine are in different stages of development and offer hope for better management of the disease in canines. However, new generation vaccines have not been issued license to be used in the field condition. Again, the presence of maternal antibodies often interferes with the active immunization with live attenuated vaccine and there always exists a window of susceptibility in spite of following proper immunization regimen. Lastly, judicious use of the vaccines in pet dogs, stray dogs and wild canids keeping in mind the new variants of the CPV-2 along with the proper sanitation and disinfection practices must be implemented for the successful control the disease.
Consequences of crown shortening canine teeth in Greenland sled dogs
DEFF Research Database (Denmark)
Kortegaard, H E; Anthony Knudsen, T; Dahl, S
2015-01-01
OBJECTIVES: To evaluate the consequences of crown shortening, focusing on the prevalence of pulp exposure and periapical pathology in Greenland sled dogs that had had their canine crowns shortened at an early age. METHODS: Five cadaver heads and 54 sled dogs underwent an oral examination for dental...... fractures and pulp exposure of canines. All canines were radiographed and evaluated for periapical pathology. RESULTS: The prevalence of canine pulp exposure in 12 (5 heads and 7 dogs) crown shortened dogs was 91 · 7%, and 21 · 3% in 47 not-crown shortened dogs. A significant (P pulp...... exposure of the canines in the crown shortened group compared to the not-crown shortened group was seen with a relative risk of 4 · 3 on a dog basis and a relative risk of 12 · 2 on a tooth basis. In dogs with pulp exposure of canines (n = 51) the prevalence of periapical pathology was 82 · 4%, but only 0...
Dental anomalies associated with buccally- and palatally-impacted maxillary canines.
Sajnani, Anand K; King, Nigel M
2014-08-01
The aim of the present study was to determine the association of both buccally- and palatally-impacted canines with other dental anomalies. This retrospective study was conducted on a population of 533 southern Chinese children and adolescents who had impacted maxillary canines that had been treated in the Paediatric Dentistry and Orthodontics Clinic, Prince Philip Dental Hospital, The University of Hong Kong, Hong Kong. Descriptions of the impacted canine and other associated anomalies were obtained from the case notes and radiographs. Clinical photographs and study casts were used, where available. A total of 253 (47.5%) patients with impacted maxillary canines were diagnosed with other dental anomalies. Microdontia was the most frequently-occurring anomaly reported in these patients, with the maxillary lateral incisor the most commonly affected tooth. Other odontogenic anomalies that were associated with both buccally- and palatally-impacted canines included hypodontia, supernumerary teeth, transposition of other teeth, enamel hypoplasia, other impacted teeth, and dens invaginatus. Both buccally- and palatally-impacted canines were found to be associated with other odontogenic anomalies. © 2013 Wiley Publishing Asia Pty Ltd.
SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.
Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi
2017-10-01
Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.
Overexpression of vimentin in canine prostatic carcinoma
DEFF Research Database (Denmark)
Rodrigues, M M P; Rema, A; Gärtner, F
2011-01-01
Canine prostatic tumours exhibit similarities to those of man and may represent a useful model system to explore the mechanisms of cancer progression. Tumour progression to malignancy requires a change from an epithelial phenotype to a fibroblastic or mesenchymal phenotype. Vimentin expression...... is associated with the invasive phenotype of human prostate cancer cells. The aim of the present study was to characterize immunohistochemically the expression of vimentin by canine prostatic carcinomas. Primary carcinomas and metastatic tumour foci both showed vimentin expression. This finding suggests...... that the acquisition of the epithelial-mesenchymal transition phenotype in canine prostatic carcinoma may be characterized by the presence of mesenchymal intermediate filament (vimentin) that could lead to a higher likelihood of metastasis....
Vaccines for Canine Leishmaniasis
Directory of Open Access Journals (Sweden)
Faeze Foroughi-Parvar
2014-01-01
Full Text Available Leishmania infantum is the obligatory intracellular parasite of mammalian macrophages and causes zoonotic visceral leishmaniasis (ZVL. The presence of infected dogs as the main reservoir host of ZVL is regarded as the most important potential risk for human infection. Thus the prevention of canine visceral leishmaniasis (CVL is essential to stop the current increase of the Mediterranean visceral leishmaniasis. Recently considerable advances in achieving protective immunization of dogs and several important attempts for achieving an effective vaccine against CVL lead to attracting the scientists trust in its important role for eradication of ZVL. This paper highlights the recent advances in vaccination against canine visceral leishmaniasis from 2007 until now.
Upper canine inclination influences the aesthetics of a smile.
Bothung, C; Fischer, K; Schiffer, H; Springer, I; Wolfart, S
2015-02-01
This current study investigated which angle of canine inclination (angle between canine tooth axis (CA-line) and the line between the lateral canthus and the ipsilateral labial angle (EM-line)) is perceived to be most attractive in a smile. The second objective was to determine whether laymen and dental experts share the same opinion. A Q-sort assessment was performed with 48 posed smile photographs to obtain two models of neutral facial attractiveness. Two sets of images (1 male model set, 1 female model set), each containing seven images with incrementally altered canine and posterior teeth inclinations, were generated. The images were ranked for attractiveness by three groups (61 laymen, 59 orthodontists, 60 dentists). The images with 0° inclination, that is CA-line (maxillary canine axis) parallel to EM-line (the line formed by the lateral canthus and the ipsilateral corner of the mouth) (male model set: 54·4%; female model set: 38·9%), or -5° (inward) inclination (male model set: 20%; female model set: 29·4%) were perceived to be most attractive within each set. Images showing inward canine inclinations were regarded to be more attractive than those with outward inclinations. Dental experts and laymen were in accordance with the aesthetics. Smiles were perceived to be most attractive when the upper canine tooth axis was parallel to the EM-line. In reconstructive or orthodontic therapy, it is thus important to incline canines more inwardly than outwardly. © 2014 John Wiley & Sons Ltd.
Treatment modalities of palatal impacted canines
Dimova, Cena; Papakoca, Kiro; Ristoska, Sonja; Kovacevska, Ivona
2012-01-01
Introduction: The orthodontic treatment of impacted maxillary canine remains a challenge to today’s clinicians. The treatment of this clinical entity usually involves surgical exposure of the impacted tooth, followed by orthodontic traction to guide and align it into the dental arch. The impacted palatal canine requires a combination of both treatment modalities: orthodontic management and oral surgical treatment. Two types of approach are commonly used: simple exposure, or exposure with brac...
Oz, A Z; Ciger, S
2018-03-01
The aim of the present study was to evaluate the changes of incisor root resorption associated with impacted maxillary canines and health of periodontal tissues around maxillary canines erupted with orthodontic treatment. Twenty patients with a unilateral palatally impacted maxillary canine were included in the study. Cone-beam computed tomography images taken before and after orthodontic treatment were compared with the contralateral canines serving as control teeth. Root resorption was present in 10% of central and 40% of lateral incisors before treatment. After treatment, the incidence of resorption decreased. The thickness of the buccal bone surrounding the impacted canines was similar to that surrounding the contralateral canines, except in the apical area. Periodontal pocket depth and alveolar bone loss were greater for the impacted canine teeth than for the contralateral canines. Incisor root resorption associated with impacted canine teeth showed signs of repair after orthodontic treatment. Slight differences related to periodontal health were found between the previously impacted teeth and contralateral canine teeth.
Comprehensive characterization of commercially available canine training aids.
Tipple, Christopher A; Caldwell, Patricia T; Kile, Brian M; Beussman, Douglas J; Rushing, Blake; Mitchell, Natalie J; Whitchurch, Christian J; Grime, Martin; Stockham, Rex; Eckenrode, Brian A
2014-09-01
Effective and reliable training aids for victim recovery canine teams is essential for law enforcement and investigative purposes. Without adequate training aids, the rate of recovery for sub surface or surface human remains deposition using canine teams may be adversely affected and result in confusing information. The composition of three commercially available canine training aids that purportedly generate volatile components responsible for the odor of human decomposition is relatively simple and not closely related to those compounds experimentally determined to be present at the site of surface or sub-surface human remains. In this study, these different commercial formulations were chemically characterized using six different sampling approaches, including two applications of direct liquid injection, solid-phase microextraction (SPME), purge and trap, ambient preconcentration/thermal desorption, and cryogenic preconcentration/thermal desorption. Direct liquid injections resulted in the fewest number of detected compounds, while a cryogen based thermal desorption method detected the greatest number of compounds in each formulation. Based solely upon the direct liquid injection analysis, Pseudo™ Scent I was composed of approximately 29±4% and 71±5% of 2-pyrrolidinone and 4-aminobutanoic acid, respectively. This same analysis showed that Pseudo™ Scent II was composed of approximately 11±1, 11±1, 24±5, and 54±7% of putrescine, cadaverine, 2-pyrrolidinone, and 4-aminobutanoic acid, respectively. Headspace analysis was conducted to more closely simulate the process whereby a canine's nose would capture a volatiles profile. More compounds were detected using the headspace sampling method; however, the vast majority was not consistent with current data on human decomposition. Additionally, the three formulations were tested in outdoor and indoor scenarios by a double-blinded canine team, using a certified and specifically trained victim recovery canine
Mājas darbi angļu valodas stundās profesionālās vidusskolas skolēnu leksikas pilveidei
Zemskova, Nataļja
2010-01-01
Diplomdarbs tika izstrādāts, lai noskaidrotu, kā dažādi mājas darbi var pilnveidot studentu vārdu krājumu angļu valodas stundās profesionālajās vidusskolās. Mājasdarbi ir skolotāju un skolēnu ikdienas rutīna. Skolotājiem ir dažāda attieksme pret mājasdarbiem, bet skolēni sūdzas, ka mājasdarbi ir garlaicīgi un bezjēdzīgi. Diplomdarba mērķis bija izpētīt, kā skolēni var bagātināt savu profesionālo vārdu krājumu, pildot angļu valodas mājasdarbu profesionālajā vidusskolā. La...
Rika-Heke, Tamara; Kelman, Mark; Ward, Michael P
2015-07-01
The aim of this study was to describe the association between climate, weather and the occurrence of canine tick paralysis, feline tick paralysis and canine parvovirus in Australia. The Southern Oscillation Index (SOI) and monthly average rainfall (mm) data were used as indices for climate and weather, respectively. Case data were extracted from a voluntary national companion animal disease surveillance resource. Climate and weather data were obtained from the Australian Government Bureau of Meteorology. During the 4-year study period (January 2010-December 2013), a total of 4742 canine parvovirus cases and 8417 tick paralysis cases were reported. No significant (P ≥ 0.05) correlations were found between the SOI and parvovirus, canine tick paralysis or feline tick paralysis. A significant (P parvovirus occurrence and rainfall in the same month (0.28), and significant negative cross-correlations (-0.26 to -0.36) between parvovirus occurrence and rainfall 4-6 months previously. Significant (P canine tick paralysis occurrence and rainfall 1-3 months previously, and significant positive cross-correlations (0.29-0.47) between canine tick paralysis occurrence and rainfall 7-10 months previously. Significant positive cross-correlations (0.37-0.68) were found between cases of feline tick paralysis and rainfall 6-10 months previously. These findings may offer a useful tool for the management and prevention of tick paralysis and canine parvovirus, by providing an evidence base supporting the recommendations of veterinarians to clients thus reducing the impact of these diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Daoud, Jamal; Tabrizian, Maryam; Asami, Koji; Rosenberg, Lawrence
2012-01-01
In this study, we introduce a cellular differentiation cellular model based on dielectric spectroscopy that characterizes epithelial differentiation processes. Non-invasive cellular monitoring was achieved within a three-dimensional microenvironment consisting of a cell-containing collagen I gel seeded onto microfabricated scaffolds. In this proof-of-concept investigation, Madin–Darby canine kidney cells were cultured within microfabricated, geometrically controlled scaffolds and allowed us to differentiate to hollow cyst-like structures. This transformation within the three-dimensional environment is monitored and characterized through dielectric spectroscopy while maintaining cell culture in vitro. (paper)
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted fo...
Evaluation of post-vaccination immunity to canine distemper and ...
African Journals Online (AJOL)
SERVER
2007-08-20
Aug 20, 2007 ... Key words: Immunoblot ELISA, post-vaccination immunity, canine distemper, parvoviruses. INTRODUCTION. Canine ..... NGOs and other government agencies to fund and intensify ... Vaccination Programs for Dogs. In: recent ...
Canine as a biomedical research model: immunological, hematological, and oncological aspects
International Nuclear Information System (INIS)
Shifrine, M.; Wilson, F.D.
1980-01-01
The canine has been used as a biomedical research model in radiation studies by a number of laboratories supported primarily by the US Department of Energy and its predecessors. These studies were unique in that they covered the life spans of the canines and permitted the collection of data from birth to death under controlled conditions. Since these were multiparametric studies, an extensive data base has been established, not the least of which are normative values covering all biologic systems, including immunohematology. The canine model has also been extensively used by other groups, such as transplantation biologists. The virtues of the canine as a model in these and many other endeavors are becoming increasingly more apparent with the passing of time. One of the primary goals of this volume was to compile the knowledge and experience of researchers using the canine model and to focus their expertise on furthering the use of the canine for studies in immunology, hematology, and oncology. We have attempted to present some of the contemporary, diverse uses of the canine in biomedical research, emphasizing immunologic endpoints, and also to present in detail some of the latest technology used in such studies
Bagshaw, Clarence; Isdell, Allen E; Thiruvaiyaru, Dharma S; Brisbin, I Lehr; Sanchez, Susan
2014-06-01
More than thirty years have passed since canine parvovirus (CPV) emerged as a significant pathogen and it continues to pose a severe threat to world canine populations. Published information suggests that flies (Diptera) may play a role in spreading this virus; however, they have not been studied extensively and the degree of their involvement is not known. This investigation was directed toward evaluating the vector capacity of such flies and determining their potential role in the transmission and ecology of CPV. Molecular diagnostic methods were used in this cross-sectional study to detect the presence of CPV in flies trapped at thirty-eight canine facilities. The flies involved were identified as belonging to the house fly (Mucidae), flesh fly (Sarcophagidae) and blow/bottle fly (Calliphoridae) families. A primary surveillance location (PSL) was established at a canine facility in south-central South Carolina, USA, to identify fly-virus interaction within the canine facility environment. Flies trapped at this location were pooled monthly and assayed for CPV using polymerase chain reaction (PCR) methods. These insects were found to be positive for CPV every month from February through the end of November 2011. Fly vector behavior and seasonality were documented and potential environmental risk factors were evaluated. Statistical analyses were conducted to compare the mean numbers of each of the three fly families captured, and after determining fly CPV status (positive or negative), it was determined whether there were significant relationships between numbers of flies captured, seasonal numbers of CPV cases, temperature and rainfall. Flies were also sampled at thirty-seven additional canine facility surveillance locations (ASL) and at four non-canine animal industry locations serving as negative field controls. Canine facility risk factors were identified and evaluated. Statistical analyses were conducted on the number of CPV cases reported within the past year
Directory of Open Access Journals (Sweden)
Sophia Pfahler
Full Text Available A genome-wide association study for canine hip dysplasia (CHD and canine elbow dysplasia (CED using the Illumina canine high density bead chip had been performed for 174 Bernese mountain dogs. General and mixed linear model analysis identified two different regions with single nucleotide polymorphisms (SNPs on dog chromosome (CFA 14 significantly associated with CHD and a further significantly CHD-associated region on CFA37. For CED, four SNPs on CFA11 and 27 were significantly associated. The identified SNPs of four associated regions included nearby candidate genes. These possible positional candidates were the genes PON2 on CFA14 and FN1 on CFA37 for CHD and the genes LMNB1 on CFA11 and WNT10B on CFA27 for CED.
Feeding ecology and morphology of the upper canines in bears (carnivora: Ursidae).
Christiansen, Per
2008-07-01
The morphology and mechanical strength of the upper canines in all eight extant species of ursids is analyzed, and the findings are discussed in relation to feeding ecology. Ursids have proportionally smaller canines than other large carnivores with a specialized feeding ecology, such as large felids, and the upper canine morphology is both canid-like and felid-like. The giant panda is the most divergent species, and its short, blunt, and cone-like canines appear well adapted for tearing into bamboo. The almost equally herbivorous spectacled bear has a less derived canine morphology. The large canines of the sun bear are divergent from other ursine ursids, and may be an adaptation for tearing open tree trunks in search of insects. Discriminant Analysis is successful in separating ursid species on the basis of canine morphology, but the canines of ursine ursids, and also of the spectacled bear, show greater resemblance among the species than the marked differences in feeding ecology would suggest. This could be in part due to a short evolutionary history, and in part due to canines not having been subjected to much evolutionary selection as has been the case among other large carnivores, such as large felids. Ursids are probably evolutionarily and ecologically successful due to physical size and strength rather than a derived craniodental anatomy. Copyright 2008 Wiley-Liss, Inc.
Canine length in wild male baboons: maturation, aging and social dominance rank.
Directory of Open Access Journals (Sweden)
Jordi Galbany
Full Text Available Canines represent an essential component of the dentition for any heterodont mammal. In primates, like many other mammals, canines are frequently used as weapons. Hence, tooth size and wear may have significant implications for fighting ability, and consequently for social dominance rank, reproductive success, and fitness. We evaluated sources of variance in canine growth and length in a well-studied wild primate population because of the potential importance of canines for male reproductive success in many primates. Specifically, we measured maxillary canine length in 80 wild male baboons (aged 5.04-20.45 years from the Amboseli ecosystem in southern Kenya, and examined its relationship with maturation, age, and social dominance rank. In our analysis of maturation, we compared food-enhanced baboons (those that fed part time at a refuse pit associated with a tourist lodge with wild-feeding males, and found that food-enhanced males achieved long canines earlier than wild-feeding males. Among adult males, canine length decreased with age because of tooth wear. We found some evidence that, after controlling for age, longer canines were associated with higher adult dominance rank (accounting for 9% of the variance in rank, but only among relatively high-ranking males. This result supports the idea that social rank, and thus reproductive success and fitness, may depend in part on fighting ability mediated by canine size.
Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki
2012-10-01
The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.
IQGAP1 is an oncogenic target in canine melanoma.
Directory of Open Access Journals (Sweden)
Becky H Lee
Full Text Available Canine oral mucosal melanoma is an aggressive malignant neoplasm and is characterized by local infiltration and a high metastatic potential. The disease progression is similar to that of human oral melanomas. Whereas human cutaneous melanoma is primarily driven by activating mutations in Braf (60% or Nras (20%, human mucosal melanoma harbors these mutations much less frequently. This makes therapeutic targeting and research modeling of the oral form potentially different from that of the cutaneous form in humans. Similarly, research has found only rare Nras mutations and no activating Braf mutations in canine oral melanomas, but they are still reliant on MAPK signaling. IQGAP1 is a signaling scaffold that regulates oncogenic ERK1/2 MAPK signaling in human Ras- and Raf- driven cancers, including melanomas. To investigate whether IQGAP1 is a potential target in canine melanoma, we examined the expression and localization of IQGAP1 in primary canine melanomas and canine oral melanoma cell lines obtained from the University of California-Davis. Using CRISPR/Cas9 knockout of IQGAP1, we examined effects on downstream ERK1/2 pathway activity and assayed proliferation of cell lines when treated with a peptide that blocks the interaction between IQGAP1 and ERK1/2. We observed that canine IQGAP1 is expressed and localizes to a similar extent in both human and canine melanoma by qPCR, Western blot, and immunofluorescence. Deletion of IQGAP1 reduces MAPK pathway activation in cell lines, similar to effects seen in human BrafV600E cell lines. Additionally, we demonstrated reduced proliferation when these cells are treated with a blocking peptide in vitro.
Expression and function of survivin in canine osteosarcoma.
Shoeneman, Jenette K; Ehrhart, E J; Eickhoff, Jens C; Charles, J B; Powers, Barbara E; Thamm, Douglas H
2012-01-01
Osteosarcoma has a high mortality rate and remains in need of more effective therapeutic approaches. Survivin is an inhibitor of apoptosis family member protein that blocks apoptosis and drives proliferation in human cancer cells where it is commonly elevated. In this study, we illustrate the superiority of a canine osteosarcoma model as a translational tool for evaluating survivin-directed therapies, owing to the striking similarities in gross and microscopic appearance, biologic behavior, gene expression, and signaling pathway alterations. Elevated survivin expression in primary canine osteosarcoma tissue correlated with increased histologic grade and mitotic index and a decreased disease-free interval (DFI). Survivin attenuation in canine osteosarcoma cells inhibited cell-cycle progression, increased apoptosis, mitotic arrest, and chemosensitivity, and cooperated with chemotherapy to significantly improve in vivo tumor control. Our findings illustrate the utility of a canine system to more accurately model human osteosarcoma and strongly suggest that survivin-directed therapies might be highly effective in its treatment. ©2011 AACR.
American Canine Hepatozoonosis
Ewing, S. A.; Panciera, R. J.
2003-01-01
American canine hepatozoonosis (ACH) is a tick-borne disease that is spreading in the southeastern and south-central United States. Characterized by marked leukocytosis and periosteal bone proliferation, ACH is very debilitating and often fatal. Dogs acquire infection by ingesting nymphal or adult Gulf Coast ticks (Amblyomma maculatum) that, in a previous life stage, ingested the parasite in a blood meal taken from some vertebrate intermediate host. ACH is caused by the apicomplexan Hepatozoon americanum and has been differentiated from Old World canine hepatozoonosis caused by H. canis. Unlike H. canis, which is transmitted by the ubiquitous brown dog tick (Rhipicephalus sanguineus), H. americanum is essentially an accidental parasite of dogs, for which Gulf Coast ticks are not favored hosts. The geographic portrait of the disease parallels the known distribution of the Gulf Coast tick, which has expanded in recent years. Thus, the endemic cycle of H. americanum involves A. maculatum as definitive host and some vertebrate intermediate host(s) yet to be identified. Although coyotes (Canis latrans) are known to be infected, it is not known how important this host is in maintaining the endemic cycle. This review covers the biology of the parasite and of the tick that transmits it and contrasts ACH with classical canine hepatozoonosis. Clinical aspects of the disease are discussed, including diagnosis and treatment, and puzzling epidemiologic issues are examined. Brief consideration is given to the potential for ACH to be used as a model for study of angiogenesis and of hypertrophic osteoarthropathy. PMID:14557294
National clinical guidelines for management of the palatally ectopic maxillary canine.
Husain, J; Burden, D; McSherry, P; Morris, D; Allen, M
2012-08-01
This review summarises updated clinical guidelines produced by the Clinical Standards Committee of the Faculty of Dental Surgery, Royal College of Surgeons of England (FDSRCS). This guideline on the management of the palatally ectopic maxillary canine illustrates the information contained in the recently updated online version. The timely recognition of ectopic canines is important for the overall management of the dentition. This review illustrates five management strategies for ectopic permanent canines: interceptive treatment by extraction of the deciduous canine, surgical exposure and orthodontic alignment, surgical removal of the palatally ectopic permanent canine, auto-transplantation and no active treatment/leave and observe. The current available evidence for each of these management options has been evaluated and awarded a grade used by the Scottish Intercollegiate Guidelines Network.
Orthodontic-surgical treatment of four impacted canines in an adult patient: A case report.
Pavlović, Jasna; Tabaković, Saša Z; Simić, Sanja; Vujačić, Amila; Vukićević, Vladanka
2016-07-01
Full impaction of canines, in both jaws, is a rare phenomenon. It is usually coupled with the persistence of deciduous canines, or any other irregularity in the dental arch. Panoramic radiograph of a 24-year-old female patient showed bilateral canine impaction in both jaws. Due to vestibular, apical and medial position of canines in the upper jaw, the surgical approach implied the apically positioned flap technique. The position of impacted mandibular canines was vertical with more coronal position relative to the upper canines, thus requiring a closed eruption technique. Inadequate position of impacted canines in the bone fully justifies the use of orthodontic-surgical treatment.
Extreme Beta-Cell Deficiency in Pancreata of Dogs with Canine Diabetes.
Directory of Open Access Journals (Sweden)
Emily J Shields
Full Text Available The pathophysiology of canine diabetes remains poorly understood, in part due to enigmatic clinical features and the lack of detailed histopathology studies. Canine diabetes, similar to human type 1 diabetes, is frequently associated with diabetic ketoacidosis at onset or after insulin omission. However, notable differences exist. Whereas human type 1 diabetes often occurs in children, canine diabetes is typically described in middle age to elderly dogs. Many competing theories have been proposed regarding the underlying cause of canine diabetes, from pancreatic atrophy to chronic pancreatitis to autoimmune mediated β-cell destruction. It remains unclear to what extent β-cell loss contributes to canine diabetes, as precise quantifications of islet morphometry have not been performed. We used high-throughput microscopy and automated image processing to characterize islet histology in a large collection of pancreata of diabetic dogs. Diabetic pancreata displayed a profound reduction in β-cells and islet endocrine cells. Unlike humans, canine non-diabetic islets are largely comprised of β-cells. Very few β-cells remained in islets of diabetic dogs, even in pancreata from new onset cases. Similarly, total islet endocrine cell number was sharply reduced in diabetic dogs. No compensatory proliferation or lymphocyte infiltration was detected. The majority of pancreata had no evidence of pancreatitis. Thus, canine diabetes is associated with extreme β-cell deficiency in both new and longstanding disease. The β-cell predominant composition of canine islets and the near-total absence of β-cells in new onset elderly diabetic dogs strongly implies that similar to human type 1 diabetes, β-cell loss underlies the pathophysiology of canine diabetes.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique
Directory of Open Access Journals (Sweden)
Julieta Zacarias
2016-07-01
Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique
Management of an Unusual Ectopic Eruption of Maxillary Canine.
Aileni, Kaladhar Reddy; Rachala, Madhukar Reddy; Prathima, Chintakunta Reddy; Naveen, Pitalla Kumar; Soujanya, Donthula
2017-05-01
Transposition of teeth is a rare condition, with a prevalence of 0.3-0.4% in general population. They are more commonly observed in females, and may occur unilaterally/bilaterally with greater frequency of left side occurrence in unilateral transposition cases. A 17-year-old female patient reported with the chief complaint of unaesthetic smile. On clinical examination the patient was diagnosed with Angle's class I malocclusion with an ectopically erupted maxillary left canine labial to the left central incisor with retained deciduous canine. The treatment plan decided was to extract the retained deciduous canine, level and align the ectopic canine using an R-loop. The treatment for the patient was finished in 14 months and was retained using a fixed lingual retainer in the upper and lower arches.
Cardiac involvement in canine babesiosis : review article
Directory of Open Access Journals (Sweden)
R.G. Lobetti
2005-06-01
Full Text Available Cardiac dysfunction in canine babesiosis has traditionally been regarded as a rare complication, with the majority of lesions reported as incidental findings at post-mortem examination. Recent studies have, however, demonstrated cardiac lesions in canine babesiosis. Cardiac troponins, especially troponin I, are sensitive markers of myocardial injury in canine babesiosis, and the magnitude of elevation of plasma troponin I concentrations appears to be proportional to the severity of the disease. ECG changes in babesiosis are similar to the pattern described for myocarditis and myocardial ischaemia and together with histopathological findings indicate that the heart suffers from the same pathological processes described in other organs in canine babesiosis, namely inflammation and hypoxia. The clinical application of the ECG appears to be limited and thus cardiovascular assessment should be based on functional monitoring rather than an ECG tracing. On cardiac histopathology from dogs that succumbed to babesiosis, haemorrhage, necrosis, inflammation and fibrin microthrombi in the myocardium were documented, all of which would have resulted in ECG changes and elevations in cardiac troponin. Myocardial damage causes left ventricular failure, which will result in hypotension and an expansion of the plasma volume due to homeostatic mechanisms.
The Ondersteport Canine distemper virus strain and measles ...
African Journals Online (AJOL)
Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...
Management of an impacted and transposed maxillary canine
Directory of Open Access Journals (Sweden)
Deepti A
2010-03-01
Full Text Available Maxillary canine-lateral incisor transposition is a relatively rare anomaly, with both dental and facial esthetic implications. This is a case report of a maxillary canine-lateral incisor transposition that was successfully treated by surgical-orthodontic treatment followed by esthetic reshaping of the involved teeth.
Aspects and clinical procedures of eruptive changes of permanent upper canines
Directory of Open Access Journals (Sweden)
Sheila Marcia Francisco
2012-04-01
Full Text Available INTRODUCTION: Even though the upper canine is the tooth that presents most eruption anomalies, after the third molars, canine retention prevalence in the population is quite low. Local, physiologic and pathologic factors can provide difficulties for the tooth eruptive process. The correct diagnosis in trying to prevent upper canine retention with ectopic eruption is fundamental to choose the ideal treatment, which can be performed by various methods. OBJECTIVE: The present paper has the purpose of approaching aspects related to impacted upper permanent canines by a literature review, including localization and treatment conducts.
A randomized clinical study of two interceptive approaches to palatally displaced canines.
Baccetti, Tiziano; Leonardi, Maria; Armi, Pamela
2008-08-01
This study evaluated the effectiveness of two interceptive approaches to palatally displaced canines (PDC), i.e. extraction of the primary canines alone or in association with the use of a cervical-pull headgear. The randomized prospective design comprised 75 subjects with PDC (92 maxillary canines) who were randomly assigned to three groups: extraction of the primary canine only (EG), extraction of the primary canine and cervical-pull headgear (EHG), and an untreated control group (CG). Panoramic radiographs were evaluated at the time of initial observation (T1) and after an average period of 18 months (T2). At T2, an evaluation of the success of canine eruption was undertaken. Between-group statistical comparisons, Kruskal-Wallis test with Bonferroni correction, were performed on the T1-T2 changes of the diagnostic parameters on panoramic radiographs and the prevalence rates of success in canine eruption. A superimposition study on lateral cephalograms at T1 and T2 was carried out to evaluate the changes in the sagittal position of the upper molars in the three groups. The removal of the primary canine as an isolated measure to intercept palatal displacement of maxillary canines showed a success rate of 65.2 per cent, which was significantly greater than that in the untreated controls (36 per cent). The additional use of a headgear resulted in successful eruption in 87.5 per cent of the subjects, with a significant improvement in the measurements for intraosseous canine position. The cephalometric superimposition study showed a significant mesial movement of the upper first molars in the CG and EG when compared with the EHG.
International Nuclear Information System (INIS)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-01-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using 125 I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed
Morphology of palatally impacted canines: A case-controlled cone-beam volumetric tomography study.
Hettiarachchi, Pilana Vithanage Kalani Shihanika; Olive, Richard John; Monsour, Paul
2017-02-01
The aim of this study was to investigate the relationships between an apical curvature or a hook and the crown/root ratio in subjects with and without palatally impacted maxillary canines. An experimental group of 44 patients (17 boys, 27 girls; mean age, 13.6 years) with 59 palatally impacted maxillary canines was selected from the records of patients referred to a radiology practice for cone-beam imaging. If a patient had bilateral palatally impacted canines, 1 canine was randomly selected for analysis. The palatally impacted canine group was matched for age and sex with 49 normal subjects (25 boys, 24 girls; mean age, 13.2 years) with 98 canines. Cone-beam DICOM files were imported into In Vivo imaging software (version 5.3; Anatomage, San Jose, Calif) for analysis. The angulations and linear variables of the maxillary canines were measured by using the software measurement tools. Chi-square and independent t tests were used to test for differences between the groups. The presence of a hook at the apical third and other root curvature were significantly different between the 2 groups (P <0.001 and P <0.05, respectively). Of the 44 palatally impacted canines, 16 (36.4%) had an apical hook and only 1 canine in the control group had an apical hook (1.0%). The mean root length of the palatally impacted canines was 2.66 mm shorter (P <0.001), and the mean crown/root ratio was significantly greater for the palatally impacted canines compared with the nonimpacted group (P <0.001). Palatally impacted canines have a greater tendency to develop apical hooks and are less likely to develop other root curvatures than are nonimpacted canines. Also, they have shorter roots resulting in larger crown/root ratios compared with the control group. Copyright © 2017 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.
Canine detection of free-ranging brown treesnakes on Guam
Savidge, J.A.; Stanford, J.W.; Reed, R.N.; Haddock, G.R.; Adams, A.A.Y.
2011-01-01
We investigated canine teams (dogs and their handlers) on Guam as a potential tool for finding invasive brown treesnakes (Boiga irregularis) in the wild. Canine teams searched a 40 ?? 40 m forested area for a snake that had consumed a dead mouse containing a radio-transmitter. To avoid tainting the target or target area with human scent, no snake was handled or closely approached prior to searches. Trials were conducted during the morning when these nocturnal snakes were usually hidden in refugia. A radiotracker knew the snake's location, but dog handlers and search navigators did not. Of 85 trials conducted over four months, the two canine teams had an average success rate of 35% of correctly defining an area ??? 5 ?? 5 m that contained the transmittered snake; the team with more experience prior to the trials had a success rate of 44% compared with 26% for the less experienced team. Canine teams also found 11 shed skins from wild snakes. Although dogs alerted outside the vicinity of transmittered snakes, only one wild, non-transmittered snake was found during the trials, possibly reflecting the difficulty humans have in locating non-transmittered brown treesnakes in refugia. We evaluated success at finding snakes as a function of canine team, number of prior trials (i.e. experience gained during the trials), recent canine success at finding a target snake, various environmental conditions, snake perch height, and snake characteristics (snout-vent length and sex). Success rate increased over the course of the trials. Canine team success also increased with increasing average humidity and decreased with increasing average wind speed. Our results suggest dogs could be useful at detecting brown treesnakes in refugia, particularly when compared to daytime visual searches by humans, but techniques are needed to help humans find and extract snakes once a dog has alerted. ?? New Zealand Ecological Society.
Cryopreservation of microencapsulated canine sperm.
Shah, Shambhu; Otsuki, Tsubasa; Fujimura, Chika; Yamamoto, Naoki; Yamashita, Yasuhisa; Higaki, Shogo; Hishinuma, Mitsugu
2011-03-01
The objective was to develop a method for cryopreserving microencapsulated canine sperm. Pooled ejaculates from three beagle dogs were extended in egg yolk tris extender and encapsulated using alginate and poly-L-lysine at room temperature. The microcapsules were cooled at 4 °C, immersed in pre-cooled extender (equivalent in volume to the microcapsules) to reach final concentration of 7% (v/v) glycerol and 0.75% (v/v) Equex STM paste, and equilibrated for 5, 30 and 60 min at 4 °C. Thereafter, microcapsules were loaded into 0.5 mL plastic straws and frozen in liquid nitrogen. In Experiment 1, characteristics of microencapsulated canine sperm were evaluated after glycerol addition at 4 °C. Glycerol exposure for 5, 30 and 60 min did not significantly affect progressive motility, viability, or acrosomal integrity of microencapsulated sperm compared with pre-cooled unencapsulated sperm (control). In Experiment 2, characteristics of frozen-thawed canine microencapsulated sperm were evaluated at 0, 3, 6, and 9 h of culture at 38.5 °C. Pre-freeze glycerol exposure for 5, 30, and 60 min at 4 °C did not influence post-thaw quality in unencapsulated sperm. Post-thaw motility and acrosomal integrity of microencapsulated sperm decreased more than those of unencapsulated sperm (P < 0.05) following glycerol exposure for 5 min. However, motility, viability and acrosomal integrity of microencapsulated sperm after 30 and 60 min glycerol exposure were higher than unencapsulated sperm cultured for 6 or 9 h (P < 0.05). In conclusion, since microencapsulated canine sperm were successfully cryopreserved, this could be a viable alternative to convention sperm cryopreservation in this species. Copyright © 2011 Elsevier Inc. All rights reserved.
Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J
2006-01-01
Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.
Management of impacted all canines with surgical exposure and alignment by orthodontic treatment
Directory of Open Access Journals (Sweden)
Radha Katiyar
2013-01-01
Full Text Available Canine impaction is a dental problem very often encountered in orthodontic practice. After the third molar, the canine is the most frequently impacted tooth. Bringing the impacted canine into a normal position is important for functional occlusion and the final esthetics of the orthodontic treatment. This article illustrates a peculiar case, in which all four permanent canines maintained their unerupted status at age of 16 years. All four impacted canines were surgically exposed, attachment bonded, traction given with K-9 spring and ideally positioned with fixed orthodontic mechanotherapy.
FLT3 mutations in canine acute lymphocytic leukemia
International Nuclear Information System (INIS)
Suter, Steven E; Small, George W; Seiser, Eric L; Thomas, Rachael; Breen, Matthew; Richards, Kristy L
2011-01-01
FMS-like tyrosine kinase 3 (FLT3) is a commonly mutated protein in a variety of human acute leukemias. Mutations leading to constitutively active FLT3, including internal tandem duplications of the juxtamembrane domain (ITD), result in continuous cellular proliferation, resistance to apoptotic cell death, and a poorer prognosis. A better understanding of the molecular consequences of FLT3 activation would allow improved therapeutic strategies in these patients. Canine lymphoproliferative diseases, including lymphoma and acute leukemias, share evolutionarily conserved chromosomal aberrations and exhibit conserved mutations within key oncogenes when compared to their human counterparts. A small percentage of canine acute lymphocytic leukemias (ALL) also exhibit FLT3 ITD mutations. We molecularly characterized FLT3 mutations in two dogs and one cell line, by DNA sequencing, gene expression analysis via quantitative real-time PCR, and sensitivity to the FLT3 inhibitor lestaurtinib via in vitro proliferation assays. FLT 3 and downstream mediators of FLT3 activation were assessed by Western blotting. The canine B-cell leukemia cell line, GL-1, and neoplastic cells from 2/7 dogs diagnosed cytologically with ALL were found to have FLT3 ITD mutations and FLT3 mRNA up-regulation. Lestaurtinib, a small molecule FLT3 inhibitor, significantly inhibited the growth of GL-1 cells, while not affecting the growth of two other canine lymphoid cell lines without the FLT3 mutation. Finally, western blots were used to confirm the conserved downstream mediators of FLT3 activating mutations. These results show that ALL and FLT3 biology is conserved between canine and human patients, supporting the notion that canine ALL, in conjunction with the GL-1 cell line, will be useful in the development of a relevant large animal model to aid in the study of human FLT3 mutant leukemias
Vaccine-induced canine distemper in a lesser panda.
Bush, M; Montali, R J; Brownstein, D; James, A E; Appel, M J
1976-11-01
A fatal disease occurred in a lesser panda (Ailurus fulgens) 2 weeks after vaccination with modified live distemper vaccine. The disease clinically resembled canine distemper. Pathologically there was giant cell pneumonia, with canine distemper viral inclusion bodies in pulmonary and digestive tract epithelium. Viral isolates were indicative of an attenuated strain rather than virulent types.
Alpha-1-antitrypsin studies: canine serum and canine surfactant protein
International Nuclear Information System (INIS)
Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.
1974-01-01
Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)
Canine hip dysplasia: significance of early bony spurring
International Nuclear Information System (INIS)
Morgan, J.P.
1987-01-01
It is the purpose of this study to call attention to new bone production that often occurs early in the sequence of pathological changes associated with canine hip dysplasia. New bone production extending to bony remodeling, as well as femoral head subluxation, both occur in the sequence of pathologic changes associated with canine hip dysplasia. Subluxation is considered primary, while osteoarthrosis is a secondary feature, and both are used in the diagnosis of canine hip dysplasia. This report concerns the significance of the presence of a solitary bony osteophyte, or spur, that is frequently evident on the caudal aspect of the femoral neck as viewed on the conventional ventrodorsal projection. This report utilizes findings from pelvic radiographs of 605 dogs (five breeds). There was a greater frequency (54%)of this bony change in cases diagnosed radiographically as dysplastic than in cases diagnosed as normal(15%).Thus, it is suggested that this minimal radiographic change can be used as an indicator of early canine hip dysplasia, especially in the absence of subluxation of the femoral head
Radiographic assessment of dental anomalies in patients with ectopic maxillary canines
DEFF Research Database (Denmark)
Sørensen, Helle Budtz; Artmann, Lone; Larsen, Helle Juul
2008-01-01
dental deviations in cases with either palatal or labial ectopic canines. Design. Panoramic and intra-oral radiographs from 50 patients with palatally located (38 females and 12 males) and 19 patients with labially located ectopic canines (11 females and 8 males), aged 10 years, 2 months-18 years, 1...... month, were analysed. Dental deviations registered were crown and root malformations, agenesis, and eruption deviations. Registrations were performed in the maxillary incisor field and in the dentition in general. Results. The study documented that palatally as well as labially located ectopic canines...... can occur in dentitions without other dental deviations. Dental deviations occurred in approximately two-thirds of all cases, more often in females and in cases with palatally located canines. More than half of the females with palatally located canines had deviations in the maxillary incisors...
Canine Babesiosis in China Caused by Babesia gibsoni: A Molecular Approach.
Directory of Open Access Journals (Sweden)
Da-Wei Yao
2014-06-01
Full Text Available To provide a point of reference to study the epidemiology and clinical expression of canine babesiosis in China.A total of 30 dogs infected with canine babesiosis were evaluated by mean of clinical history, physical examination, hematological, restriction fragment length polymorphism of PCR products (PCR-RFLP and sequencing analysis.The most prevalent clinical abnormalities were lethargy (100%, anorexia (100%, pale or icteric mucous membranes (80%, fever (70% and dark urine (70%. Hematology parameters revealed that anemia and thrombocytopenia were the major abnormalities in blood of dogs infected with canine babesia. The results of PCR-RFLP and sequencing analysis indicated that B. gibsoni was the main species responsible for canine babesiosis cases at the time of the study in Nanjing, China.The results provide valuable information for better understanding of the epidemiology of canine babesiosis in China.
The expression and serological reactivity of recombinant canine herpesvirus 1 glycoprotein D
Directory of Open Access Journals (Sweden)
Markéta Vaňková
2016-01-01
Full Text Available The aim of this work was to express recombinant glycoprotein D of canine herpesvirus 1 in bacterial cells and to evaluate its diagnostic sensitivity and specificity when compared to traditional serological methods. The gene fragment coding glycoprotein D of canine herpesvirus 1 was amplified by polymerase chain reaction, cloned into plasmid vector and expressed in Escherichia coli cells. Recombinant protein was then purified and used as an antigen in immunoblot for a detection of canine herpesvirus 1 specific antibodies. Antibody testing was performed on the panel of 100 canine sera by immunoblot with recombinant glycoprotein D as antigen and compared with indirect immunofluorescence assay. Serum samples were collected from 83 dogs with no history of canine herpesvirus 1 or reproductive disorders, and from 17 dogs from breeding kennels with a history of canine herpesvirus 1 related reproductive disorders. Sensitivity of glycoprotein D based immunoblot was 89.2% and specificity was 93%. Kappa value was calculated to be 0.8 between immunoblot and indirect immunofluorescence assay. Antibodies against canine herpesvirus 1 infection were detected in 33% of samples by immunoblot assay. Our study confirms that recombinant glycoprotein D expressed in bacterial cells could be used as a suitable and sensitive antigen for immunological tests and that herpesvirus infection seems to be common among the canine population in the Czech Republic.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Directory of Open Access Journals (Sweden)
Sumitra
2012-01-01
Full Text Available A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle′s Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth and periodontium is a challenge. The bilaterally impacted maxillary canines were successfully aligned and leveled. The depth of the gingival sulcus and clinical crown heights of disimpacted teeth were normal post-treatment and after 1 year of retention.
Prostate histotripsy for BPH: initial canine results
Roberts, William W.; Hall, Timothy L.; Hempel, Christopher R.; Cain, Charles A.
2009-02-01
Histotripsy is an extracorporeal ablative technology that utilizes microsecond pulses of intense ultrasound (< 1% duty cycle) to produce nonthermal, mechanical fractionation of targeted tissue. We have previously demonstrated the feasibility of histotripsy prostate ablation. In this study we sought to assess the chronic tissue response, tolerability and safety of histotripsy in a chronic in vivo canine model. Five acute and thirteen chronic canine subjects were anesthetized and treated with histotripsy targeting the prostate. Pulses consisted of 3 cycle bursts of 750 kHz ultrasound at a repetition rate of 300 Hz delivered transabdominally from a highly focused 15 cm aperture array. Transrectal ultrasound imaging provided accurate targeting and real-time monitoring of histotripsy treatment. Prostates were harvested at 0, 7, 28, or 56 days after treatment. Consistent mechanical tissue fractionation and debulking of prostate tissue was seen acutely and at delayed time points without collateral injury. Urothelialization of the treatment cavity was apparent 28 days after treatment. Canine subjects tolerated histotripsy with minimal hematuria or discomfort. Only mild transient lab abnormalities were noted. Histotripsy is a promising non-invasive therapy for prostate tissue fractionation and debulking that appears safe and well tolerated without systemic side effects in the canine model.
Difficulties in estimating the human burden of canine rabies.
Taylor, Louise H; Hampson, Katie; Fahrion, Anna; Abela-Ridder, Bernadette; Nel, Louis H
2017-01-01
Current passive surveillance data for canine rabies, particularly for the regions where the burden is highest, are inadequate for appropriate decision making on control efforts. Poor enforcement of existing legislation and poor implementation of international guidance reduce the effectiveness of surveillance systems, but another set of problems relates to the fact that canine rabies is an untreatable condition which affects very poor sectors of society. This results in an unknown, but potentially large proportion of rabies victims dying outside the health system, deaths that are unlikely to be recorded by surveillance systems based on health center records. This article critically evaluates the potential sources of information on the number of human deaths attributable to canine rabies, and how we might improve the estimates required to move towards the goal of global canine rabies elimination. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Meyers, K.M.; Boehme, M.; Inbar, O.
1982-10-01
Endotoxin from Escherichia coli O127:B8, Salmonella abortus-equi and S minnesota induced clumping of some canine platelets (PLT) at a final endotoxin concentration of 1 microgram/ml. Endotoxin-induced clumping of canine PLT was independent of PLT energy-requiring processes, because clumping was observed with canine PLT incubated with 2-deoxy-D-glucose and antimycin A. The PLT responded to adenosine diphosphate before, but not after, incubation with the metabolic inhibitors. Endotoxin induced a slight and inconsistant clumping of bovine and equine PLT at high (mg/ml) endotoxin concentration. High-affinity binding sites could not be demonstrated on canine, bovine, and equine PLT, using /sup 125/I-labeled E coli O127:B8 endotoxin. Nonspecific binding was observed and appeared to be due primarily to an extraneous coat on the PLT surface that was removed by gel filtration. The endotoxin that was bound to PLT did not appear to modify PLT function. An attempt to identify plasma proteins that bound physiologically relevant amounts of endotoxin was not successful. The significance of the endotoxin-induced clumping or lack of it on the pathophysiology of endotoxemia is discussed.
Lotspeich, Erica; Kitts, Kelley; Goodpaster, John
2012-07-10
It is a common misconception that the amount of explosive is the chief contributor to the quantity of vapor that is available to trained canines. In fact, this quantity (known as odor availability) depends not only on the amount of explosive material, but also the container volume, explosive vapor pressure and temperature. In order to better understand odor availability, headspace experiments were conducted and the results were compared to theory. The vapor-phase concentrations of three liquid explosives (nitromethane, nitroethane and nitropropane) were predicted using the Ideal Gas Law for containers of various volumes that are in use for canine testing. These predictions were verified through experiments that varied the amount of sample, the container size, and the temperature. These results demonstrated that the amount of sample that is needed to saturate different sized containers is small, predictable and agrees well with theory. In general, and as expected, once the headspace of a container is saturated, any subsequent increase in sample volume will not result in the release of more vapors. The ability of canines to recognize and alert to differing amounts of nitromethane has also been studied. In particular, it was found that the response of trained canines is independent of the amount of nitromethane present, provided it is a sufficient quantity to saturate the container in which it is held. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar
2009-12-10
Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.
Intranasal vaccine trial for canine infectious tracheobronchitis (kennel cough).
Glickman, L T; Appel, M J
1981-08-01
Two field trials were conducted during periods of endemic (summer) and epizootic (winter) canine infectious tracheobronchitis activity to evaluate the efficacy of three intranasal vaccines in a closed commercial beagle breeding kennel. A trivalent vaccine containing Bordetella bronchiseptica, canine parainfluenza, and canine adenovirus-2 was administered at 3 weeks of age. The vaccine was 71.2% and 81.8% effective in decreasing the incidence of coughing during the winter and summer trials, respectively. The number of deaths was lower in each of the vaccine groups than in the placebo groups. No adverse reactions were observed with any of the intranasal vaccines.
Current practices and research updates on diabetes mellitus in canine
Directory of Open Access Journals (Sweden)
Pankaj Kumar
2014-11-01
Full Text Available Diabetes has evidence in ancient literatures, though recently is being considered as one amongst the most emerging disease condition in both human and companion animals. Diabetes mellitus is one of the common endocrinopathy of dog characterized by hyperglycemia, glycosuria and weight loss. Reports suggests high fraction of canine population suffer with diabetes world over. Studies in different veterinary hospitals of United States suggest increase in cases of canine diabetes and decrease in case fatality rate over time. Increase in cases of canine diabetes worldwide is attributed to awareness amongst pet owners, better veterinary health facilities, breed preferences by dog owners, increase dependence on commercial feeds, obesity, etc. Diabetes in most dogs is immune mediated and insulin dependent. Breed predisposition in canine is attributed to dog leukocyte antigen gene pool encoding form major histocompatibility complex-II molecules, however research is still underway. Diagnosis of diabetes still relies on blood sugar evaluation for screening of canine population, though many other diagnostic methods have shown promising benefits including measurement of fructosamine and glycated haemoglobin. Management of diabetes in dog is based on insulin therapy, diet modification and exercise. Use of oral anti-diabetics drugs in canine is limited though experimental studies have shown promising results. Alternative therapies have been explored, but only a few approaches have shown promise for clinical application.
Eruption of the maxillary canines in relation to skeletal maturity.
Baccetti, Tiziano; Franchi, Lorenzo; De Lisa, Simona; Giuntini, Veronica
2008-05-01
Our aim in this study was to assess the relationship between the eruption of the permanent maxillary canines and skeletal maturity in subjects with different skeletal relationships in the sagittal and vertical planes. A sample of 152 subjects (63 boys, 89 girls) with erupting permanent maxillary canines was analyzed. On the lateral cephalograms, the stage of cervical vertebral maturation was assessed. Then the subjects were divided into prepeak (before the pubertal growth spurt, cervical stage [CS]1 and CS2), peak (during the pubertal growth spurt, CS3 and CS4), and postpeak (after the pubertal growth spurt, CS5 and CS6) groups. Skeletal relationships in the sagittal and vertical planes were evaluated, and relationships to timing of canine eruption were tested statistically. The prepeak group comprised 86 subjects, the peak group 66 subjects, and the postpeak group 0 subjects. The differences in prevalence rates between either the prepeak or peak groups and the postpeak group were statistically significant (P < 0.001). The prevalence rate for hyperdivergent subjects showing eruption of the permanent maxillary canine in the prepeak group (37.2%) was significantly higher than in the reference orthodontic population (21%). The eruption of the permanent maxillary canine can occur at any stage in skeletal maturation before the end the pubertal growth spurt (CS1-CS4), with hyperdivergent subjects more frequently having prepubertal canine eruption.
Citizen science: a new direction in canine behavior research.
Hecht, Julie; Spicer Rice, Eleanor
2015-01-01
Researchers increasingly rely on members of the public to contribute to scientific projects-from collecting or identifying, to analyzing and disseminating data. The "citizen science" model proves useful to many thematically distinctive fields, like ornithology, astronomy, and phenology. The recent formalization of citizen science projects addresses technical issues related to volunteer participation--like data quality--so that citizen scientists can make longstanding, meaningful contributions to scientific projects. Since the late 1990s, canine science research has relied with greater frequency on the participation of the general public, particularly dog owners. These researchers do not typically consider the methods and technical issues that those conducting citizen science projects embrace and continue to investigate. As more canine science studies rely on public input, an in-depth knowledge of the benefits and challenges of citizen science can help produce relevant, high-quality data while increasing the general public's understanding of canine behavior and cognition as well as the scientific process. We examine the benefits and challenges of current citizen science models in an effort to enhance canine citizen science project preparation, execution, and dissemination. This article is part of a Special Issue entitled: Canine Behavior. Copyright © 2014 Elsevier B.V. All rights reserved.
Antiviral effect of lithium chloride on infection of cells by canine parvovirus.
Zhou, Pei; Fu, Xinliang; Yan, Zhongshan; Fang, Bo; Huang, San; Fu, Cheng; Hong, Malin; Li, Shoujun
2015-11-01
Canine parvovirus type 2 causes significant viral disease in dogs, with high morbidity, high infectivity, and high mortality. Lithium chloride is a potential antiviral drug for viruses. We determined the antiviral effect of Lithium Chloride on canine parvovirus type 2 in feline kidney cells. The viral DNA and proteins of canine parvovirus were suppressed in a dose-dependent manner by lithium chloride. Further investigation verified that viral entry into cells was inhibited in a dose-dependent manner by lithium chloride. These results indicated that lithium chloride could be a potential antiviral drug for curing dogs with canine parvovirus infection. The specific steps of canine parvovirus entry into cells that are affected by lithium chloride and its antiviral effect in vivo should be explored in future studies.
Dehghani, Mahdieh; Shadkam, Elaheh; Ahrari, Farzaneh; Dehghani, Mahboobe
2018-04-01
Age estimation in adults is an important issue in forensic science. This study aimed to estimate the chronological age of Iranians by means of pulp/tooth area ratio (AR) of canines in digital panoramic radiographs. The sample consisted of panoramic radiographs of 271 male and female subjects aged 16-64 years. The pulp/tooth area ratio (AR) of upper and lower canines was calculated by AutoCAD software. Data were subjected to correlation and regression analysis. There was a significant and inverse correlation between age and pulp/tooth area ratio of upper and lower canines (r=-0.794 for upper canine and r=-0.282 for lower canine; p-value<0.001). Linear regression equations were derived separately for upper, lower and both canines. The mean difference between actual and estimated age using upper canine was 6.07±1.7. The results showed that the pulp/tooth area ratios of canines are a reliable method for age estimation in Iranians. The pulp/tooth area ratio of upper canine was better correlated with chronological age than that of lower canine. Copyright © 2018 Elsevier B.V. All rights reserved.
Galar-Martinez, Marcela; Gomez-Olivan, Leobardo Manuel; Amaya-Chavez, Araceli; Razo-Estrada, Celene; Garcia-Medina, Sandra
2010-01-01
Madin Reservoir (MR), located in the State of Mexico, is fed mainly by the Rio Tlalnepantla. MR supplies potable water to the municipalities of Naucalpan and Atizapan, and various recreational activities take place in its vicinity, such as sailing and the fishing of diverse species including the common carp Cyprinus carpio. The purpose of this study was to determine the toxic effects of contaminants present in MR water and sediment on C. carpio. Five sampling stations were selected (those considered to have the most problems due to discharges). Water and sediment samples were taken and toxicity studies were performed, including acute toxicity (lethality) and subacute toxicity assays. The biomarkers used in the subacute assays were lipid peroxidation (LPX) and activity of the antioxidant enzymes superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) in the liver and brain of test organisms. These biomarkers were also evaluated in local carp, i.e. carp with chronic exposure in situ to reservoir contaminants. Results show that contaminants in the water and sediment of the different sampling stations induce oxidative stress, this toxicity being more evident in samples from stations near the entry point of the Rio Tlalnepantla tributary and in local carp. This may be due to high contaminant levels as well as the fact that the physicochemical characteristics of the matrices might favor their bioavailability. Thus, both the water and sediment of this reservoir are contaminated with xenobiotics hazardous to C. carpio, a species consumed by the local human population.
Ultrasonographic evaluation of the canine shoulder.
Long, C D; Nyland, T G
1999-01-01
The aim of this study was to determine the normal ultrasonographic anatomy of the canine shoulder. Fourteen shoulders from 7 clinically normal mid-sized dogs were radiographed and imaged using high frequency ultrasound. Each shoulder was isolated postmortem, and the ultrasonographic and gross anatomy was studied during dissection. The ultrasonographic appearance of the shoulder specimens was similar to that found in the live dogs. Twenty-four shoulders isolated postmortem from 12 variably sized dogs were also used to characterize the normal ultrasound anatomy over a range of sizes. Important anatomic structures that could be consistently evaluated were the biceps tendon and bursa, the bicipital groove surface, the supraspinatous tendon, the infraspinatous tendon, the teres minor tendon, and the caudal aspect of the humeral head. Results of ultrasonographic examination of 4 dogs with shoulder lameness are described to illustrate some applications of canine shoulder ultrasonography in the evaluation of the canine shoulder. In these dogs, ultrasound was a valuable tool to evaluate effusion and synovial proliferation within the bicipital bursa, supraspinatous and biceps tendinitis, biceps tendon strain, and dystrophic calcification.
The Comparative Diagnostic Features of Canine and Human Lymphoma
Directory of Open Access Journals (Sweden)
Davis M. Seelig
2016-06-01
Full Text Available The non-Hodgkin lymphomas (NHLs are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
The Comparative Diagnostic Features of Canine and Human Lymphoma.
Seelig, Davis M; Avery, Anne C; Ehrhart, E J; Linden, Michael A
2016-06-01
The non-Hodgkin lymphomas (NHLs) are a heterogeneous family of lymphoid malignancies that are among the most common neoplasms of both dogs and humans. Owing to shared molecular, signaling, incidence, and pathologic features, there is a strong framework supporting the utilization of canine lymphoma as a comparative, large animal model of human NHL. In alignment with the biologic similarities, the current approach towards the diagnosis and classification of canine lymphoma is based upon the human World Health Organization guidelines. While this approach has contributed to an increasing appreciation of the potential biological scope of canine lymphoma, it has also become apparent that the most appropriate diagnostic philosophy must be multimodal, namely by requiring knowledge of microscopic, immunophenotypic, and clinical features before establishing a final disease diagnosis. This review seeks to illustrate the comparative similarities and differences in the diagnosis of canine lymphoma through the presentation of the microscopic and immunophenotypic features of its most common forms.
Directory of Open Access Journals (Sweden)
Shalini Gupta
2014-01-01
Full Text Available Aim: To investigate whether sexual dimorphism can be established by odontometric study of permanent maxillary canine teeth as well as inter-canine width in north Indian population. Study Design: The study was carried out at department of oral and maxillofacial pathology, King George′s Medical University, Lucknow, India on students and patients reporting at OPD. Out of total 180 subjects examined 90 subjects were female and 90 were male. Impressions of the upper arch were made using alginate and casts poured in dental stone. The mesiodistal diameter (MD of the crown of permanent maxillary canine both on right and left sides and inter-canine width were measured. From these measurements, maxillary canine index was calculated. The percentage of sexual dimorphism (SD was assessed for all the parameters. Results: In the present study, the MD of maxillary canine for both right (P = 0.001 and left side (P = 0.005 was significantly higher among male subjects than females, Similar observation was found for inter-canine width too (P = 0.0001. However, the maxillary canine index for right and left was almost similar (P > 0.05 for both male and female subjects. The SD in right and left MDs of maxillary canine was 4.2% and 3.6% respectively. For, inter-canine width it was maximum (13.7%. However, SD in right and left canine index showed negative values (−2.1% and -0.9% respectively. Conclusion: There was SD in MD and inter-canine width of permanent maxillary canine teeth. SD was more on right permanent maxillary canine teeth than left permanent maxillary canine.
[Nonsurgical endodontic treatment of an invaginated canine].
Fernández Guerrero, F; Miñana Laliga, R; Bullon Fernandez, P
1989-01-01
We present a case of a maxillary canine with a dens invaginatus treated successfully. The patient had pain, swelling and a sinus tract coming from the inmature apex of the canine. The canals were enlarged and cleaned and the main canal was filled with Calcium Hydroxide to allow the root development. Seven months later, the patient was asymptomatic and the tooth was obturated with guttapercha. One year later it was confirm the success in the treatment.
Canine babesiosis: from molecular taxonomy to control
Directory of Open Access Journals (Sweden)
Irwin Peter J
2009-03-01
Full Text Available Abstract Canine babesiosis is a clinically significant emerging vector-borne disease caused by protozoan haemoparasites. This review article considers recent literature pertaining to the taxonomic classification of Babesia and Theileria species affecting dogs and the geographical distribution of these parasites. The diagnosis of canine babesiosis by traditional, molecular and serological methods is reviewed, together with recent advances in our understanding of the pathophysiology of piroplasmosis, and of the treatment and prevention of this disease.
Genetic characterization of canine influenza A virus (H3N2) in Thailand.
Bunpapong, Napawan; Nonthabenjawan, Nutthawan; Chaiwong, Supassama; Tangwangvivat, Ratanaporn; Boonyapisitsopa, Supanat; Jairak, Waleemas; Tuanudom, Ranida; Prakairungnamthip, Duangduean; Suradhat, Sanipa; Thanawongnuwech, Roongroje; Amonsin, Alongkorn
2014-02-01
In January 2012, several clinical cases of dogs with flu-like symptoms, including coughing, sneezing, nasal discharge, and fever, were reported in a small-animal hospital located in Bangkok, Thailand. One influenza A virus was identified and characterized as an avian-like influenza virus H3N2. The virus was named A/canine/Thailand/CU-DC5299/12. A phylogenetic analysis indicated that the canine virus belonged to an avian Eurasian lineage and was genetically related to the canine influenza viruses H3N2 from China and Korea. This canine virus displays a unique genetic signature with two amino acid insertions in the NA protein, which is similar to the canine influenza viruses from eastern China (Zhejiang and Jiangsu). This study constitutes the first report of H3N2 canine influenza virus infection in a small-animal hospital in Thailand.
Glucosamine and chondroitin use in canines for osteoarthritis: A ...
African Journals Online (AJOL)
Osteoarthritis is a slowly progressive and debilitating disease that affects canines of all breeds. Pain and decreased mobility resulting from osteoarthritis often have a negative impact on the affected canine's quality of life, level of comfort, daily functioning, activity, behaviour, and client-pet companionship. Despite limited and ...
A case of unusual root morphology: Maxillary canine with two roots
Directory of Open Access Journals (Sweden)
Nagesh Bolla
2009-01-01
Full Text Available The case describes a 3 months follow-up of the treatment of a maxillary canine with two roots. Clinical examination revealed a maxillary canine with a large carious lesion and an exaggerated response to cold thermal tests. Radiographic examination revealed a large distal carious lesion that appeared to invade the pulp chamber. The radiograph also revealed what appeared to be an extra root in this permanent maxillary canine.
Langedijk, Johannes P. M.; Janda, Jozef; Origgi, Francesco C.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe
2011-01-01
The morbilliviruses measles virus (MeV) and canine distemper virus (CDV) both rely on two surface glycoproteins, the attachment (H) and fusion proteins, to promote fusion activity for viral cell entry. Growing evidence suggests that morbilliviruses infect multiple cell types by binding to distinct host cell surface receptors. Currently, the only known in vivo receptor used by morbilliviruses is CD150/SLAM, a molecule expressed in certain immune cells. Here we investigated the usage of multiple receptors by the highly virulent and demyelinating CDV strain A75/17. We based our study on the assumption that CDV-H may interact with receptors similar to those for MeV, and we conducted systematic alanine-scanning mutagenesis on CDV-H throughout one side of the β-propeller documented in MeV-H to contain multiple receptor-binding sites. Functional and biochemical assays performed with SLAM-expressing cells and primary canine epithelial keratinocytes identified 11 residues mutation of which selectively abrogated fusion in keratinocytes. Among these, four were identical to amino acids identified in MeV-H as residues contacting a putative receptor expressed in polarized epithelial cells. Strikingly, when mapped on a CDV-H structural model, all residues clustered in or around a recessed groove located on one side of CDV-H. In contrast, reported CDV-H mutants with SLAM-dependent fusion deficiencies were characterized by additional impairments to the promotion of fusion in keratinocytes. Furthermore, upon transfer of residues that selectively impaired fusion induction in keratinocytes into the CDV-H of the vaccine strain, fusion remained largely unaltered. Taken together, our results suggest that a restricted region on one side of CDV-H contains distinct and overlapping sites that control functional interaction with multiple receptors. PMID:21849439
Purification and partial characterization of canine S100A12.
Heilmann, Romy M; Suchodolski, Jan S; Steiner, Jörg M
2010-12-01
Canine S100A12 (cS100A12) is a calcium-binding protein of the S100 superfamily of EF-hand proteins, and its expression is restricted to neutrophils and monocytes. Interaction of S100A12 with the receptor for advanced glycation end products (RAGE) has been suggested to play a central role in inflammation. Moreover, S100A12 has been shown to represent a sensitive and specific marker for gastrointestinal inflammation in humans. Only human, porcine, bovine, and rabbit S100A12 have been purified to date, and an immunoassay for the quantification of S100A12 is available only for humans. Therefore, the aim of this study was to develop a protocol for the purification of S100A12 and to partially characterize this protein in the dog (Canis lupus familiaris) as a prelude to the development of an immunologic method for its detection and quantification in canine serum and fecal specimens. Leukocytes were isolated from canine whole blood by dextran sedimentation, and canine S100A12 was extracted from the cytosol fraction of these cells. Further purification of cS100A12 comprised of ammonium sulfate precipitation, hydrophobic interaction chromatography, and strong cation- and anion-exchange column chromatography. Canine S100A12 was successfully purified from canine whole blood. The relative molecular mass of the protein was estimated at 10,379.5 and isoelectric focusing revealed an isoelectric point of 6.0. The approximate specific absorbance of cS100A12 at 280 nm was determined to be 1.78 for a 1 mg/ml solution. The N-terminal AA sequence of the first 15 residues of cS100A12 was Thr-Lys-Leu-Glu-Asp-His-X-Glu-Gly-Ile-Val-Asp-Val-Phe-His, and revealed 100% identity with the predicted protein sequence available through the canine genome project. Sequence homology for the 14 N-terminal residues identified for cS100A12 with those of feline, bovine, porcine, and human S100A12 was 78.6%. We conclude that canine S100A12 can be successfully purified from canine whole blood using the
Guarnieri, R; Cavallini, C; Vernucci, R; Vichi, M; Leonardi, R; Barbato, E
2016-11-01
The prevalence of impacted maxillary canine is reported to be between 1% and 3%. The lack of monitoring and the delay in the treatment of the impacted canine can cause different complications such as: displacement of adjacent teeth, loss of vitality of neighbouring teeth, shortening of the dental arch, follicular cysts, canine ankylosis, recurrent infections, recurrent pain, internal resorption of the canine and the adjacent teeth, external resorption of the canine and the adjacent teeth, combination of these factors. An appropriate diagnosis, accurate predictive analysis and early intervention are likely to prevent such undesirable effects. The objective is to evaluate, by means of a retrospective observational study, the possibility of carrying out a predictive analysis of root resorption adjacent to the impacted canines by means of orthopantomographs, so as to limit the prescription of additional 3D radiography. 120 subjects with unilateral or bilateral maxillary impacted canine were examined and 50 patients with 69 impacted maxillary canine (22 male, 28 female; mean age: 11.7 years) satisfied the inclusion criteria of the study. These patients were subjected to a basic clinical and radiographic investigation (orthopantomographs and computerized tomography). All panoramic films were viewed under standardized conditions for the evaluation of two main variables: maxillary canine angulations (a, b, g angles) and the overlapping between the impacted teeth and the lateral incisor (Analysis of Lindauer). Binary logistic regression was used to estimate the likelihood of resorbed lateral incisors depending on sector location and angle measurements. Results indicated that b angle has the greatest influence on the prediction of root resorption (predictive value of b angle = 76%). If β angle <18° and Lindauer = I, the probability of resorption is 0.06. Evaluation of b angle and superimposition lateral incisor/impacted canine analysed on orthopantomographs could be one of
Efficient adenovector CD40 ligand immunotherapy of canine malignant melanoma.
von Euler, Henrik; Sadeghi, Arian; Carlsson, Björn; Rivera, Patricio; Loskog, Angelica; Segall, Thomas; Korsgren, Olle; Tötterman, Thomas H
2008-05-01
Cutaneous canine melanomas are usually benign in contrast to human malignant melanoma. However, the canine oropharyngeal, uveal, and mucocutaneous neoplasms are aggressive and have metastatic potential. Surgery and to a lesser extent radiotherapy and chemotherapy are widely adopted treatments but are seldom curative in advanced stages. The similarities between human and canine melanoma make spontaneous canine melanoma an excellent disease model for exploring novel therapies. Herein, we report the first 2 adenovector CD40L immunogene (AdCD40L) treatments of aggressive canine malignant melanoma. Case no. 1 was an advanced stage III oral melanoma that was cured from malignant melanoma with 2 intratumor AdCD40L injections before cytoreductive surgery. After treatment, the tumor tissue was infiltrated with T lymphocytes and B lymphocytes suggesting immune activation. This dog survived 401 days after the first round of gene therapy and was free of melanoma at autopsy. Case no. 2 had a conjunctival malignant melanoma with a rapid progression. This case was treated with 6 AdCD40L injections over 60 days. One hundred and twenty days after start of gene therapy and 60 days after the last injection, the tumor had regressed dramatically, and the dog had a minimal tumor mass and no signs of progression or metastasis. Our results indicate that AdCD40L immunogene therapy is beneficial in canine malignant melanoma and could be considered for human malignant melanoma as well.
Orthodontic Traction of Impacted Canine Using Cantilever
Nakandakari, Cláudia; Gonçalves, João Roberto; Cassano, Daniel Serra; Raveli, Taísa Boamorte; Bianchi, Jonas; Raveli, Dirceu Barnabé
2016-01-01
The impaction of the maxillary canines causes relevant aesthetic and functional problems. The multidisciplinary approach to the proper planning and execution of orthodontic traction of the element in question is essential. Many strategies are cited in the literature; among them is the good biomechanical control in order to avoid possible side effects. The aim of this paper is to present a case report in which a superior canine impacted by palatine was pulled out with the aid of the cantilever...
Scerri, Erica Sultana; McDonald, Fraser; Camilleri, Simon
2016-02-01
To compare the developmental dental anomalies associated with maxillary canine-first premolar (MxCP1) transposition and those of palatally displaced canine (PDC) with each other and with the background prevalence in the Maltese population in order to elucidate whether the two conditions have similar or differing genetic backgrounds. Dental records of 477 subjects with PDC, 57 subjects with MxCP1, and a control group of 500 subjects with no history of a PDC or tooth transposition were compared for canine eruption anomalies and hypodontia. A high frequency of bilateral occurrence was present for both canine malpositions and when unilateral, a trend to right-sided occurrence was evident. The occurrence of transpositions in the PDC group and of PDC in the MxCP1 group was higher than expected. The prevalence of incisor hypodontia was significantly higher in subjects with PDC and MxCP1, as compared to the control group. The size of the MxCP1 group is relatively small. The study population is a small isolated Caucasian population and the results may not be applicable to other populations. There is no significant difference between the MxCP1 and PDC groups in the prevalence or distribution of hypodontia and each of these groups exhibits a higher prevalence of the other canine anomaly. These findings support the theory that PDC and MxCP1 form part of a group of interrelated dental anomalies that share a common genetic basis. © The Author 2015. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Detection of canine pneumovirus in dogs with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Renshaw, Randall W; Dubovi, Edward J; Brownlie, Joe
2013-12-01
Canine pneumovirus (CnPnV) was recently identified during a retrospective survey of kenneled dogs in the United States. In this study, archived samples from pet and kenneled dogs in the United Kingdom were screened for CnPnV to explore the relationship between exposure to CnPnV and the development of canine infectious respiratory disease (CIRD). Within the pet dog population, CnPnV-seropositive dogs were detected throughout the United Kingdom and Republic of Ireland, with an overall estimated seroprevalence of 50% (n = 314/625 dogs). In the kennel population, there was a significant increase in seroprevalence, from 26% (n = 56/215 dogs) on the day of entry to 93.5% (n = 201/215 dogs) after 21 days (P respiratory disease than those that did not seroconvert (P respiratory disease than immunologically naive dogs (P respiratory signs and histopathological changes and in dogs housed for 8 to 14 days, which coincided with a significant increase in the risk of developing respiratory disease compared to the risk of those housed 1 to 7 days (P disease prevention strategy.
Directory of Open Access Journals (Sweden)
Patil Sandeep S
2012-01-01
Full Text Available Abstract Oncolytic viruses refer to those that are able to eliminate malignancies by direct targeting and lysis of cancer cells, leaving non-cancerous tissues unharmed. Several oncolytic viruses including adenovirus strains, canine distemper virus and vaccinia virus strains have been used for canine cancer therapy in preclinical studies. However, in contrast to human studies, clinical trials with oncolytic viruses for canine cancer patients have not been reported. An 'ideal' virus has yet to be identified. This review is focused on the prospective use of oncolytic viruses in the treatment of canine tumors - a knowledge that will undoubtedly contribute to the development of oncolytic viral agents for canine cancer therapy in the future.
Miles, Edwena D; Xue, Yan; Strickland, James R; Boling, James A; Matthews, James C
2011-09-14
Neotyphodium coenophialum-infected tall fescue contains ergopeptines. Except for interactions with biogenic amine receptors (e.g., dopamine type-2 receptor, D2R), little is known about how ergopeptines affect animal metabolism. The effect of ergopeptines on bovine nucleoside transporters (NT) was evaluated using Madin-Darby bovine kidney (MDBK) cells. Equilibrative NT1 (ENT1)-like activity accounted for 94% of total NT activity. Inhibitory competition (IC(50)) experiments found that this activity was inhibited by both bromocriptine (a synthetic model ergopeptine and D2R agonist) and ergovaline (a predominant ergopeptine of tall fescue). Kinetic inhibition analysis indicated that bromocriptine inhibited ENT1-like activity through a competitive and noncompetitive mechanism. Domperidone (a D2R antagonist) inhibited ENT1 activity more in the presence than in the absence of bromocriptine and displayed an IC(50) value lower than that of bromocriptine or ergovaline, suggesting that inhibition was not through D2R-mediated events. These novel mechanistic findings imply that cattle consuming endophyte-infected tall fescue have reduced ENT1 activity and, thus, impaired nucleoside metabolism.
Directory of Open Access Journals (Sweden)
Kovačević Strahinja Z.
2013-01-01
Full Text Available In the present paper, the antifungal activity of a series of benzoxazole and oxazolo[ 4,5-b]pyridine derivatives was evaluated against Candida albicans by using quantitative structure-activity relationships chemometric methodology with artificial neural network (ANN regression approach. In vitro antifungal activity of the tested compounds was presented by minimum inhibitory concentration expressed as log(1/cMIC. In silico pharmacokinetic parameters related to absorption, distribution, metabolism and excretion (ADME were calculated for all studied compounds by using PreADMET software. A feedforward back-propagation ANN with gradient descent learning algorithm was applied for modelling of the relationship between ADME descriptors (blood-brain barrier penetration, plasma protein binding, Madin-Darby cell permeability and Caco-2 cell permeability and experimental log(1/cMIC values. A 4-6-1 ANN was developed with the optimum momentum and learning rates of 0.3 and 0.05, respectively. An excellent correlation between experimental antifungal activity and values predicted by the ANN was obtained with a correlation coefficient of 0.9536. [Projekat Ministarstva nauke Republike Srbije, br. 172012 i br. 172014
Wilmes, Benedict; Drescher, Dieter
2009-05-01
In the course of a clinical pilot study we tested the vertical periodontal ligament (V-PDL) distraction as a means of aligning ankylosed upper canines. The objective of this study was to analyze the appropriateness und effectiveness of this method. The ankylosed upper canines of five female patients aged between 16 und 19 years were surgically exposed, luxated, and after a latency period of 5 to 7 days, distracted at a rate of 0.5 mm per day. The installed distractors were borne by the periodontal-mucosa, the periodontal-mucosa and the bone, or by the bone exclusively. We evaluated the distraction distance and time and degree of hard and soft tissue generation present in the region surrounding the distracted teeth. All canines were aligned after a mean distraction period of 43.2 days (+/- 3.6 days). The mean distraction distance was 10.8 mm. Three canines had defects at the cemento-enamel junction, and one canine had to be extracted due to a large defect at the root. Vertical PDL distraction is a minimally-invasive therapy to align ankylosed impacted canines. Even if the long-term prognosis of distracted canines with defects is uncertain, the patient benefits from the vertical PDL distraction because both hard and soft tissues are generated in the vicinity of the distracted canine.
Directory of Open Access Journals (Sweden)
Craig D Blanchette
Full Text Available BACKGROUND: Phagocytosis has been extensively examined in 'professional' phagocytic cells using pH sensitive dyes. However, in many of the previous studies, a separation between the end of internalization, beginning of acidification and completion of phagosomal-endosomal/lysosomal fusion was not clearly established. In addition, very little work has been done to systematically examine phagosomal maturation in 'non-professional' phagocytic cells. Therefore, in this study, we developed a simple method to measure and decouple particle internalization, phagosomal acidification and phagosomal-endosomal/lysosomal fusion in Madin-Darby Canine Kidney (MDCK and Caco-2 epithelial cells. METHODOLOGY/PRINCIPAL FINDINGS: Our method was developed using a pathogen mimetic system consisting of polystyrene beads coated with Internalin A (InlA, a membrane surface protein from Listeria monocytogenes known to trigger receptor-mediated phagocytosis. We were able to independently measure the rates of internalization, phagosomal acidification and phagosomal-endosomal/lysosomal fusion in epithelial cells by combining the InlA-coated beads (InlA-beads with antibody quenching, a pH sensitive dye and an endosomal/lysosomal dye. By performing these independent measurements under identical experimental conditions, we were able to decouple the three processes and establish time scales for each. In a separate set of experiments, we exploited the phagosomal acidification process to demonstrate an additional, real-time method for tracking bead binding, internalization and phagosomal acidification. CONCLUSIONS/SIGNIFICANCE: Using this method, we found that the time scales for internalization, phagosomal acidification and phagosomal-endosomal/lysosomal fusion ranged from 23-32 min, 3-4 min and 74-120 min, respectively, for MDCK and Caco-2 epithelial cells. Both the static and real-time methods developed here are expected to be readily and broadly applicable, as they simply
Production of inactivated influenza H5N1 vaccines from MDCK cells in serum-free medium.
Directory of Open Access Journals (Sweden)
Alan Yung-Chih Hu
Full Text Available BACKGROUND: Highly pathogenic influenza viruses pose a constant threat which could lead to a global pandemic. Vaccination remains the principal measure to reduce morbidity and mortality from such pandemics. The availability and surging demand for pandemic vaccines needs to be addressed in the preparedness plans. This study presents an improved high-yield manufacturing process for the inactivated influenza H5N1 vaccines using Madin-Darby canine kidney (MDCK cells grown in a serum-free (SF medium microcarrier cell culture system. PRINCIPAL FINDING: The current study has evaluated the performance of cell adaptation switched from serum-containing (SC medium to several commercial SF media. The selected SF medium was further evaluated in various bioreactor culture systems for process scale-up evaluation. No significant difference was found in the cell growth in different sizes of bioreactors studied. In the 7.5 L bioreactor runs, the cell concentration reached to 2.3 × 10(6 cells/mL after 5 days. The maximum virus titers of 1024 Hemagglutinin (HA units/50 µL and 7.1 ± 0.3 × 10(8 pfu/mL were obtained after 3 days infection. The concentration of HA antigen as determined by SRID was found to be 14.1 µg/mL which was higher than those obtained from the SC medium. A mouse immunogenicity study showed that the formalin-inactivated purified SF vaccine candidate formulated with alum adjuvant could induce protective level of virus neutralization titers similar to those obtained from the SC medium. In addition, the H5N1 viruses produced from either SC or SF media showed the same antigenic reactivity with the NIBRG14 standard antisera. CONCLUSIONS: The advantages of this SF cell-based manufacturing process could reduce the animal serum contamination, the cost and lot-to-lot variation of SC medium production. This study provides useful information to manufacturers that are planning to use SF medium for cell-based influenza vaccine production.
Wang, Mengshu; Zhang, Yong; Feng, Jiao; Gu, Tiejun; Dong, Qingguang; Yang, Xu; Sun, Yanan; Wu, Yongge; Chen, Yan; Kong, Wei
2013-01-01
Background Exendin-4 is an incretin mimetic agent approved for type 2 diabetes treatment. However, the required frequent injections restrict its clinical application. Here, the potential use of chitosan-coated poly (d,l-lactide-co-glycolide) (CS-PLGA) nanoparticles was investigated for intestinal delivery of exendin-4. Methods and results Nanoparticles were prepared using a modified water–oil–water (w/o/w) emulsion solvent-evaporation method, followed by coating with chitosan. The physical properties, particle size, and cell toxicity of the nanoparticles were examined. The cellular uptake mechanism and transmembrane permeability were performed in Madin-Darby canine kidney-cell monolayers. Furthermore, in vivo intraduodenal administration of exendin-4-loaded nanoparticles was carried out in rats. The PLGA nanoparticle coating with chitosan led to a significant change in zeta potential, from negative to positive, accompanied by an increase in particle size of ~30 nm. Increases in both the molecular weight and degree of deacetylation of chitosan resulted in an observable increase in zeta potential but no apparent change in the particle size of ~300 nm. Both unmodified PLGA and chitosan-coated nanoparticles showed only slight cytotoxicity. Use of different temperatures and energy depletion suggested that the cellular uptake of both types of nanoparticles was energy-dependent. Further investigation revealed that the uptake of PLGA nanoparticles occurred via caveolin-mediated endocytosis and that of CS-PLGA nanoparticles involved both macropinocytosis and clathrin-mediated endocytosis, as evidenced by using endocytic inhibitors. However, under all conditions, CS-PLGA nanoparticles showed a greater potential to be transported into cells, as shown by flow cytometry and confocal microscopy. Transmembrane permeability analysis showed that unmodified and modified PLGA nanoparticles could improve the transport of exendin-4 by up to 8.9- and 16.5-fold, respectively
Procopio, Elsa Quartapelle; Colombo, Valentina; Santo, Nadia; Sironi, Angelo; Lenardi, Cristina; Maggioni, Daniela
2018-02-02
The role of substrate topography in phenotype expression of in vitro cultured cells has been widely assessed. However, the production of the nanostructured interface via the deposition of sol-gel synthesized nanoparticles (NPs) has not yet been fully exploited. This is also evidenced by the limited number of studies correlating the morphological, structural and chemical properties of the grown thin films with those of the sol-gel 'brick' within the framework of the bottom-up approach. Our work intends to go beyond this drawback presenting an accurate investigation of sol-gel TiO 2 NPs shaped as spheres and rods. They have been fully characterized by complementary analytical techniques both suspended in apolar solvents, by dynamic light scattering (DLS) and nuclear magnetic resonance (NMR) and after deposition on substrates (solid state configuration) by transmission electron microscopy (TEM) and powder x-ray diffraction (PXRD). In the case of suspended anisotropic rods, the experimental DLS data, analyzed by the Tirado-Garcia de la Torre model, present the following ranges of dimensions: 4-5 nm diameter (∅) and 11-15 nm length (L). These results are in good agreement with that obtained by the two solid state techniques, namely 3.8(9) nm ∅ and 13.8(2.5) nm L from TEM and 5.6(1) ∅ and 13.3(1) nm L from PXRD data. To prove the suitability of the supported sol-gel NPs for biological issues, spheres and rods have been separately deposited on coverslips. The cell response has been ascertained by evaluating the adhesion of the epithelial cell line Madin-Darby canine kidney. The cellular analysis showed that titania films promote cell adhesion as well clustering organization, which is a distinguishing feature of this type of cell line. Thus, the use of nanostructured substrates via sol-gel could be considered a good candidate for cell culture with the further advantages of likely scalability and interfaceability with many different materials usable as supports.
Directory of Open Access Journals (Sweden)
Kanu Priya Aggarwal
Full Text Available BACKGROUND: The increasing number of patients suffering from urolithiasis represents one of the major challenges which nephrologists face worldwide today. For enhancing therapeutic outcomes of this disease, the pathogenic basis for the formation of renal stones is the need of hour. Proteins are found as major component in human renal stone matrix and are considered to have a potential role in crystal-membrane interaction, crystal growth and stone formation but their role in urolithiasis still remains obscure. METHODS: Proteins were isolated from the matrix of human CaOx containing kidney stones. Proteins having MW>3 kDa were subjected to anion exchange chromatography followed by molecular-sieve chromatography. The effect of these purified proteins was tested against CaOx nucleation and growth and on oxalate injured Madin-Darby Canine Kidney (MDCK renal epithelial cells for their activity. Proteins were identified by Matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF MS followed by database search with MASCOT server. In silico molecular interaction studies with CaOx crystals were also investigated. RESULTS: Five proteins were identified from the matrix of calcium oxalate kidney stones by MALDI-TOF MS followed by database search with MASCOT server with the competence to control the stone formation process. Out of which two proteins were promoters, two were inhibitors and one protein had a dual activity of both inhibition and promotion towards CaOx nucleation and growth. Further molecular modelling calculations revealed the mode of interaction of these proteins with CaOx at the molecular level. CONCLUSIONS: We identified and characterized Ethanolamine-phosphate cytidylyltransferase, Ras GTPase-activating-like protein, UDP-glucose:glycoprotein glucosyltransferase 2, RIMS-binding protein 3A, Macrophage-capping protein as novel proteins from the matrix of human calcium oxalate stone which play a critical role in kidney stone
Braun, Doreen; Schweizer, Ulrich
2017-03-01
Mutations in the thyroid hormone transporter monocarboxylate transporter 8 (MCT8) prevent appropriate entry of thyroid hormones into brain cells during development and cause severe mental retardation in affected patients. The current treatment options are thyromimetic compounds that enter the brain independently of MCT8. Some MCT8-deficient patients (e.g., those carrying MCT8delF501) will not be as severely affected as most others. We have shown that the MCT8delF501 protein has decreased protein stability but important residual function once it reaches the plasma membrane. We were able to rescue protein expression and the function of MCT8delF501 in a Madin-Darby canine kidney cell model by application of the chemical chaperone sodium phenylbutyrate (NaPB), a drug that has been used to treat patients with cystic fibrosis and urea cycle defects for extended periods of time. In the present study, we have extended our previous study and report on the NaPB-dependent rescue of a series of other pathogenic MCT8 mutants associated with milder patient phenotypes. We show that NaPB can functionally rescue the expression and activities of Ser194Phe, Ser290Phe, Leu434Trp, Arg445Cys, Leu492Pro, and Leu568Pro mutations in MCT8 in a dose-dependent manner. The soy isoflavone genistein, a dietary supplement, which was effective in MCT8delF501, was also effective in increasing the expression and transport of these MCT8 mutants; however, the effect size differed among mutants. Kinetic analyses revealed that the Michaelis constants of the mutants toward the primary substrate 3,3',5-triiodothyronine were not much different from the wild-type value, suggesting that these mutants are not impaired in their interaction with substrate but rather destabilized by the mutation and degraded. Copyright © 2017 by the Endocrine Society.
Quartapelle Procopio, Elsa; Colombo, Valentina; Santo, Nadia; Sironi, Angelo; Lenardi, Cristina; Maggioni, Daniela
2018-02-01
The role of substrate topography in phenotype expression of in vitro cultured cells has been widely assessed. However, the production of the nanostructured interface via the deposition of sol-gel synthesized nanoparticles (NPs) has not yet been fully exploited. This is also evidenced by the limited number of studies correlating the morphological, structural and chemical properties of the grown thin films with those of the sol-gel ‘brick’ within the framework of the bottom-up approach. Our work intends to go beyond this drawback presenting an accurate investigation of sol-gel TiO2 NPs shaped as spheres and rods. They have been fully characterized by complementary analytical techniques both suspended in apolar solvents, by dynamic light scattering (DLS) and nuclear magnetic resonance (NMR) and after deposition on substrates (solid state configuration) by transmission electron microscopy (TEM) and powder x-ray diffraction (PXRD). In the case of suspended anisotropic rods, the experimental DLS data, analyzed by the Tirado-Garcia de la Torre model, present the following ranges of dimensions: 4-5 nm diameter (∅) and 11-15 nm length (L). These results are in good agreement with that obtained by the two solid state techniques, namely 3.8(9) nm ∅ and 13.8(2.5) nm L from TEM and 5.6(1) ∅ and 13.3(1) nm L from PXRD data. To prove the suitability of the supported sol-gel NPs for biological issues, spheres and rods have been separately deposited on coverslips. The cell response has been ascertained by evaluating the adhesion of the epithelial cell line Madin-Darby canine kidney. The cellular analysis showed that titania films promote cell adhesion as well clustering organization, which is a distinguishing feature of this type of cell line. Thus, the use of nanostructured substrates via sol-gel could be considered a good candidate for cell culture with the further advantages of likely scalability and interfaceability with many different materials usable as supports.
Meyer Zu Schwabedissen, Henriette E; Ferreira, Celio; Schaefer, Anima M; Oufir, Mouhssin; Seibert, Isabell; Hamburger, Matthias; Tirona, Rommel G
2018-07-01
Levothyroxine replacement therapy forms the cornerstone of hypothyroidism management. Variability in levothyroxine oral absorption may contribute to the well-recognized large interpatient differences in required dose. Moreover, levothyroxine-drug pharmacokinetic interactions are thought to be caused by altered oral bioavailability. Interestingly, little is known regarding the mechanisms contributing to levothyroxine absorption in the gastrointestinal tract. Here, we aimed to determine whether the intestinal drug uptake transporter organic anion transporting polypeptide 2B1 (OATP2B1) may be involved in facilitating intestinal absorption of thyroid hormones. We also explored whether thyroid hormones regulate OATP2B1 gene expression. In cultured Madin-Darby Canine Kidney II/OATP2B1 cells and in OATP2B1-transfected Caco-2 cells, thyroid hormones were found to inhibit OATP2B1-mediated uptake of estrone-3-sulfate. Competitive counter-flow experiments evaluating the influence on the cellular accumulation of estrone-3-sulfate in the steady state indicated that thyroid hormones were substrates of OATP2B1. Additional evidence that thyroid hormones were OATP2B1 substrates was provided by OATP2B1-dependent stimulation of thyroid hormone receptor activation in cell-based reporter assays. Bidirectional transport studies in intestinal Caco-2 cells showed net absorptive flux of thyroid hormones, which was attenuated by the presence of the OATP2B1 inhibitor, atorvastatin. In intestinal Caco-2 and LS180 cells, but not in liver Huh-7 or HepG2 cells, OATP2B1 expression was induced by treatment with thyroid hormones. Reporter gene assays revealed thyroid hormone receptor α -mediated transactivation of the SLCO2B1 1b and the SLCO2B1 1e promoters. We conclude that thyroid hormones are substrates and transcriptional regulators of OATP2B1. These insights provide a potential mechanistic basis for oral levothyroxine dose variability and drug interactions. Copyright © 2018 by The American
Heldens, Jacco; Hulskotte, Ellen; Voeten, Theo; Breedveld, Belinda; Verweij, Pierre; van Duijnhoven, Wilbert; Rudenko, Larissa; van Damme, Pierre; van den Bosch, Han
2014-09-03
Live attenuated influenza vaccine (LAIV) offers the promise of inducing a variety of immune responses thereby conferring protection to circulating field strains. LAIVs are based on cold adapted and temperature sensitive phenotypes of master donor viruses (MDVs) containing the surface glycoprotein genes of seasonal influenza strains. Two types of MDV lineages have been described, the Ann Arbor lineages and the A/Leningrad/17 and B/USSR/60 lineages. Here the safety and immunogenicity of a Madin Darby Canine Kidney - cell culture based, intranasal LAIV derived from A/Leningrad/17 and B/USSR, was evaluated in healthy influenza non-naive volunteers 18-50 years of age. In a double-blind, randomized, placebo-controlled design, single escalating doses of 1×10(5), 1×10(6), or 1×10(7) tissue culture infectious dose 50% (TCID50) of vaccine containing each of the three influenza virus re-assortants recommended by the World Health Organization for the 2008-2009 season were administered intranasally. A statistically significant geometric mean increase in hemagglutination inhibition titer was reached for influenza strain A/H3N2 after immunization with all doses of LAIV. For the A/H1N1 and B strains, the GMI in HI titer did not increase for any of the doses. Virus neutralization antibody titers showed a similar response pattern. A dose-response effect could not be demonstrated for any of the strains, neither for the HI antibody nor for the VN antibody responses. No influenza like symptoms, no nasal congestions, no rhinorrhea, or other influenza related upper respiratory tract symptoms were observed. In addition, no difference in the incidence or nature of adverse events was found between vaccine and placebo treated subjects. Overall, the results indicated that the LAIV for nasal administration is immunogenic (i.e. able to provoke an immune response) and safe both from the perspective of the attenuated virus and the MDCK cell line from which it was derived, and it warrants
Karthikeyan, Chandrabose; Lee, Crystal; Moore, Joshua; Mittal, Roopali; Suswam, Esther A; Abbott, Kodye L; Pondugula, Satyanarayana R; Manne, Upender; Narayanan, Narayanan K; Trivedi, Piyush; Tiwari, Amit K
2015-02-01
Naturally occurring condensed quinolines have anticancer properties. In efforts to find active analogues, we designed and synthesized eight polycyclic heterocycles with a pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline framework (IND series). The compounds were evaluated for activity against colon (HCT-116 and S1-MI-80), prostate (PC3 and DU-145), breast (MCF-7 and MDAMB-231), ovarian (ov2008 and A2780), and hepatocellular (HepG2) cancer cells and against non-cancerous Madin Darby canine kidney (MDCK), mouse embryonic fibroblast (NIH/3T3), and human embryonic kidney cells (HEK293). IND-2, a 4-chloro-2-methyl pyrimido[1″,2″:1,5]pyrazolo[3,4-b]quinoline, exhibited more than ten-fold selectivity and potent cytotoxic activity against colon cancer cells relative to the other cancer and non-cancer cells. With five additional colon cancer cell lines (HT-29, HCT-15, LS-180, LS-174, and LoVo), IND-2 had similar cytotoxicity and selectivity, and sub-micromolar concentrations caused changes in the morphology of HCT-116 and HCT-15 cells. IND-2 did not activate the transactivating function of the pregnane X receptor (PXR), indicating that it does not induce PXR-regulated ABCB1 or ABCG2 transporters. Indeed, IND-2 was not a substrate of ABCB1 or ABCG2, and it induced cytotoxicity in HEK293 cells overexpressing ABCB1 or ABCG2 to the same extent as in normal HEK293 cells. IND-2 was cytotoxic to resistant colon carcinoma S1-MI-80 cells, approximately three- and five-fold more than SN-38 and topotecan, respectively. In HCT-116 colon cancer cells, IND-2 produced concentration-dependent changes in mitochondrial membrane potential, leading to apoptosis, and sub-micromolar concentrations caused chromosomal DNA fragmentation. These findings suggest that, by increasing apoptosis, IND-2 has potential therapeutic efficacy for colorectal cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.
Genetic analysis of influenza B viruses isolated in Uganda during the 2009–2010 seasons
Directory of Open Access Journals (Sweden)
Byarugaba Denis K
2013-01-01
Full Text Available Abstract Background Influenza B viruses can cause morbidity and mortality in humans but due to the lack of an animal reservoir are not associated with pandemics. Because of this, there is relatively limited genetic sequences available for influenza B viruses, especially from developing countries. Complete genome analysis of one influenza B virus and several gene segments of other influenza B viruses isolated from Uganda from May 2009 through December 2010 was therefore undertaken in this study. Methods Samples were collected from patients showing influenza like illness and screened for influenza A and B by PCR. Influenza B viruses were isolated on Madin-Darby Canine Kidney cells and selected isolates were subsequently sequenced and analyzed phylogenetically. Findings Of the 2,089 samples collected during the period, 292 were positive by PCR for influenza A or B; 12.3% of the PCR positives were influenza B. Thirty influenza B viruses were recovered and of these 25 that grew well consistently on subculture were subjected to further analysis. All the isolates belonged to the B/Victoria-lineage as identified by hemagglutination inhibition assay and genetic analysis except one isolate that grouped with the B-Yamagata-lineage. The Ugandan B/Victoria-lineage isolates grouped in clade 1 which was defined by the N75K, N165K and S172P substitutions in hemagglutinin (HA protein clustered together with the B/Brisbane/60/2008 vaccine strain. The Yamagata-like Ugandan strain, B/Uganda/MUWRP-053/2009, clustered with clade 3 Yamagata viruses such as B/Bangladesh/3333/2007 which is characterized by S150I and N166Y substitutions in HA. Conclusion In general there was limited variation among the Ugandan isolates but they were interestingly closer to viruses from West and North Africa than from neighboring Kenya. Our isolates closely matched the World Health Organization recommended vaccines for the seasons.
ABC transporters affect the elimination and toxicity of CdTe quantum dots in liver and kidney cells
Energy Technology Data Exchange (ETDEWEB)
Chen, Mingli; Yin, Huancai; Bai, Pengli [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Miao, Peng [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Deng, Xudong [Department of Chemical Engineering, McMaster University, Hamilton, Ontario, L8S 4L7 (Canada); Xu, Yingxue [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Hu, Jun [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China); Yin, Jian, E-mail: yinj@sibet.ac.cn [CAS Key Lab of Bio-Medical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences, Suzhou, Jiangsu 215163 (China)
2016-07-15
This paper aimed to investigate the role of adenosine triphosphate-binding cassette (ABC) transporters on the efflux and the toxicity of nanoparticles in liver and kidney cells. In this study, we synthesized CdTe quantum dots (QDs) that were monodispersed and emitted green fluorescence (maximum peak at 530 nm). Such QDs tended to accumulate in human hepatocellular carcinoma cells (HepG2), human kidney cells 2 (HK-2), and Madin-Darby canine kidney (MDCK) cells, and cause significant toxicity in all the three cell lines. Using specific inhibitors and inducers of P-glycoprotein (Pgp) and multidrug resistance associated proteins (Mrps), the cellular accumulation and subsequent toxicity of QDs in HepG2 and HK-2 cells were significantly affected, while only slight changes appeared in MDCK cells, corresponding well with the functional expressions of ABC transporters in cells. Moreover, treatment of QDs caused concentration- and time- dependent induction of ABC transporters in HepG2 and HK-2 cells, but such phenomenon was barely found in MDCK cells. Furthermore, the effects of CdTe QDs on ABC transporters were found to be greater than those of CdCl{sub 2} at equivalent concentrations of cadmium, indicating that the effects of QDs should be a combination of free Cd{sup 2+} and specific properties of QDs. Overall, these results indicated a strong dependence between the functional expressions of ABC transporters and the efflux of QDs, which could be an important reason for the modulation of QDs toxicity by ABC transporters. - Highlights: • ABC transporters contributed actively to the cellular efflux of CdTe quantum dots. • ABC transporters affected the cellular toxicity of CdTe quantum dots. • Treatment of CdTe quantum dots induced the gene expression of ABC transporters. • Free Cd{sup 2+} should be partially involved in the effects of QDs on ABC transporters. • Cellular efflux of quantum dots could be an important modulator for its toxicity.
Canine Plasminogen: Spectral Responses to Changes in 6-Aminohexanoate and Temperature
Directory of Open Access Journals (Sweden)
Jack A. Kornblatt
2007-01-01
Full Text Available We studied the near UV absorption spectrum of canine plasminogen. There are 19 tryptophans, 19 phenylalanines and 34 tyrosines in the protein. 4th derivative spectra optimized for either tryptophan or tyrosine give a measure of the polarity of the environments of these two aromatic amino acids. Plasminogen at temperatures between 0 °C and 37 °C exists as a mixture of four conformations: closed-relaxed, open-relaxed, closed-compact, and open-compact. The closed to open transition is driven by addition of ligand to a site on the protein. The relaxed to compact transition is driven by increasing temperature from 0 °C to above 15–20 °C.When the conformation of plasminogen is mainly closed-relaxed, the 4th derivative spectra suggest that the average tryptophan environment is similar to a solution of 20% methanol at the same temperature. Under the same conditions, 4th derivative spectra suggest that the average tyrosine environment is similar to water. These apparent polarities change as the plasminogen is forced to assume the other conformations. We try to rationalize the information based on the known portions of the plasminogen structure.Abbreviations: 6-AH: 6-aminohexanoate, a homolog of lysine; DPGN: dog plasminogen; HPGN: human plasminogen. NTP: the N-terminal peptide of DPGN (It consists of the fi rst 77 amino acids in the protein.
Genetics of Human and Canine Dilated Cardiomyopathy
Siobhan Simpson; Jennifer Edwards; Thomas F. N. Ferguson-Mignan; Malcolm Cobb; Nigel P. Mongan; Catrin S. Rutland
2015-01-01
Cardiovascular disease is a leading cause of death in both humans and dogs. Dilated cardiomyopathy (DCM) accounts for a large number of these cases, reported to be the third most common form of cardiac disease in humans and the second most common in dogs. In human studies of DCM there are more than 50 genetic loci associated with the disease. Despite canine DCM having similar disease progression to human DCM studies into the genetic basis of canine DCM lag far behind those of human DCM. In th...
Orthodontic treatment of a complete transposed impacted maxillary canine
Directory of Open Access Journals (Sweden)
Pi-Huei Liu
2015-03-01
Full Text Available Tooth transposition is a positional interchange of two adjacent teeth. Transposition most often occurs at maxillary canine. Moving transposed teeth to their normal positions is challenging because this requires bodily movement and translation of one tooth to pass another. This procedure may cause damage to the teeth or supporting structures. We report a case of complete transposition of maxillary canine and lateral incisor. Transposed teeth were successfully moved orthodontically to their normal positions. Multiple mechanics were meticulously applied to achieve complete correction of the tooth positions and to minimize root resorption and/or periodontal defects of canine and lateral incisors. Factors concerning treatment planning for transposed teeth are discussed.
Tooth fractures in canine clinical practice
International Nuclear Information System (INIS)
Capik, I.; Ledecky, V.; Sevcik, A.
2001-01-01
Tooth fractures constitute a considerable fraction of all tooth diseases. Out of the 5,370 dogs treated during four years, 492 were presented with dental problems and 28.3 % of the latter were treated for tooth fractures. Canines were the most frequently affected teeth (38.8 %), followed by premolars (33.1 %), incisors (25.9 %), and molars (2.2 %), 55.4 % of the patients with canine and incisor fractures being large breed dogs. Fractures of premolars (mostly of 108, 208) were divided evenly irrespective of breed or body size. Nonsurgical endodontic treatment yielded good therapeutic results in most cases, but repeated treatment was necessary in some patients
Canine faecal contamination and parasitic risk in the city of Naples (southern Italy
Directory of Open Access Journals (Sweden)
Veneziano Vincenzo
2006-09-01
Full Text Available Abstract Background Dogs are associated with more than 60 zoonotic diseases among which, parasitosis and, in particular, helminthosis, can pose serious public-health concerns worldwide. Many canine gastrointestinal parasites eliminate their dispersion elements (eggs, larvae, oocysts by the faecal route. The quantity of canine faeces deposited on public and private property in cities worldwide is both a perennial nuisance and an important health issue. Public sites such as playgrounds, parks, gardens, public squares and sandpits may be an important source of human infection. The aim of this study was to evaluate the extent of both canine faecal contamination in the city of Naples (southern Italy, and presence of canine parasitic elements, with particular regard to those which are potential agents of zoonosis. A regular grid of sub-areas (1 km × 700 m was overlaid on the city map using a Geographical Information System (GIS. In each sub-area the straightest 1 km transect was drawn and digitalized on-screen in the GIS. Between February and May 2005 canine faeces were counted along the 1 km transects in 143 sub-areas, and 415 canine faecal samples were collected and submitted to coprological examinations. Negative binomial regression models and Gaussian random effects models were used to analyze the association between faeces count and human population density taking into account for extraPoisson variability. Logistic regression model was used to evaluate the association between positivity to parasitic elements and number of canine faeces. Results Out of the 143 studied sub-areas, 141 (98.6% contained canine faeces. There was a strong spatial gradient with 48% of the total variability accounted by between neighbourhood variability; a positive association between the number of faeces and the human population density was found. Seventy (over 415, 16.9% canine faecal samples were positive for parasitic elements. There was no association between
Current state of knowledge: the canine gastrointestinal microbiome.
Hooda, Seema; Minamoto, Yasushi; Suchodolski, Jan S; Swanson, Kelly S
2012-06-01
Gastrointestinal (GI) microbes have important roles in the nutritional, immunological, and physiologic processes of the host. Traditional cultivation techniques have revealed bacterial density ranges from 10(4) to 10(5) colony forming units (CFU)/g in the stomach, from 10(5) to 10(7) CFU/g in the small intestine, and from 10(9) to 10(11) CFU/g in the colon of healthy dogs. As a small number of bacterial species can be grown and studied in culture, however, progress was limited until the recent emergence of DNA-based techniques. In recent years, DNA sequencing technology and bioinformatics have allowed for better phylogenetic and functional/metabolic characterization of the canine gut microbiome. Predominant phyla include Firmicutes, Bacteroidetes, Fusobacteria, Proteobacteria, and Actinobacteria. Studies using 16S ribosomal RNA (rRNA) gene pyrosequencing have demonstrated spatial differences along the GI tract and among microbes adhered to the GI mucosa compared to those in intestinal contents or feces. Similar to humans, GI microbiome dysbiosis is common in canine GI diseases such as chronic diarrhea and inflammatory bowel diseases. DNA-based assays have also identified key pathogens contributing to such conditions, including various Clostridium, Campylobacter, Salmonella, and Escherichia spp. Moreover, nutritionists have applied DNA-based techniques to study the effects of dietary interventions such as dietary fiber, prebiotics, and probiotics on the canine GI microbiome and associated health indices. Despite recent advances in the field, the canine GI microbiome is far from being fully characterized and a deeper characterization of the phylogenetic and functional/metabolic capacity of the GI microbiome in health and disease is needed. This paper provides an overview of recent studies performed to characterize the canine GI microbiome.
Castanheira, Pedro; Duarte, Ana; Gil, Solange; Cartaxeiro, Clara; Malta, Manuel; Vieira, Sara; Tavares, Luis
2014-04-23
Infections caused by canine parvovirus, canine distemper virus and canine coronavirus are an important cause of mortality and morbidity in dogs worldwide. Prior to this study, no information was available concerning the incidence and prevalence of these viruses in Cape Verde archipelago. To provide information regarding the health status of the canine population in Vila do Maio, Maio Island, Cape Verde, 53 rectal swabs were collected from 53 stray dogs during 2010 and 93 rectal swabs and 88 blood samples were collected from 125 stray dogs in 2011. All rectal swabs (2010 n = 53; 2011 n = 93) were analysed for the presence of canine parvovirus, canine distemper virus and canine coronavirus nucleic acids by quantitative PCR methods. Specific antibodies against canine distemper virus and canine parvovirus were also assessed (2011 n = 88).From the 2010 sampling, 43.3% (23/53) were positive for canine parvovirus DNA, 11.3% (6/53) for canine distemper virus RNA and 1.9% (1/53) for canine coronavirus RNA. In 2011, the prevalence values for canine parvovirus and canine coronavirus were quite similar to those from the previous year, respectively 44.1% (41/93), and 1.1% (1/93), but canine distemper virus was not detected in any of the samples analysed (0%, 0/93). Antibodies against canine parvovirus were detected in 71.6% (63/88) blood samples and the seroprevalence found for canine distemper virus was 51.1% (45/88). This study discloses the data obtained in a molecular and serological epidemiological surveillance carried out in urban populations of stray and domestic animals. Virus transmission and spreading occurs easily in large dog populations leading to high mortality rates particularly in unvaccinated susceptible animals. In addition, these animals can act as disease reservoirs for wild animal populations by occasional contact. Identification of susceptible wildlife of Maio Island is of upmost importance to evaluate the risk of pathogen spill over from
Decaro, Nicola; Mari, Viviana; Larocca, Vittorio; Losurdo, Michele; Lanave, Gianvito; Lucente, Maria Stella; Corrente, Marialaura; Catella, Cristiana; Bo, Stefano; Elia, Gabriella; Torre, Giorgio; Grandolfo, Erika; Martella, Vito; Buonavoglia, Canio
2016-08-30
A molecular survey for traditional and emerging pathogens associated with canine infectious respiratory disease (CIRD) was conducted in Italy between 2011 and 2013 on a total of 138 dogs, including 78 early acute clinically ill CIRD animals, 22 non-clinical but exposed to clinically ill CIRD dogs and 38 CIRD convalescent dogs. The results showed that canine parainfluenza virus (CPIV) was the most commonly detected CIRD pathogen, followed by canine respiratory coronavirus (CRCoV), Bordetella bronchiseptica, Mycoplasma cynos, Mycoplasma canis and canine pneumovirus (CnPnV). Some classical CIRD agents, such as canine adenoviruses, canine distemper virus and canid herpesvirus 1, were not detected at all, as were not other emerging respiratory viruses (canine influenza virus, canine hepacivirus) and bacteria (Streptococcus equi subsp. zooepidemicus). Most severe forms of respiratory disease were observed in the presence of CPIV, CRCoV and M. cynos alone or in combination with other pathogens, whereas single CnPnV or M. canis infections were detected in dogs with no or very mild respiratory signs. Interestingly, only the association of M. cynos (alone or in combination with either CRCoV or M. canis) with severe clinical forms was statistically significant. The study, while confirming CPIV as the main responsible for CIRD occurrence, highlights the increasing role of recently discovered viruses, such as CRCoV and CnPnV, for which effective vaccines are not available in the market. Copyright © 2016 Elsevier B.V. All rights reserved.
Comparison of canine retraction using single and Siamese edgewise brackets: An in vivo study
Directory of Open Access Journals (Sweden)
Zeeshan Iqbal Bhat
2013-01-01
Full Text Available Objectives: The purpose of this study was to check the rate of canine retraction with bodily mechanics using two different pre-adjusted edgewise bracket Systems. Materials and Methods: A split mouth study with twenty patients who were randomly selected and allotted to a single operator. Duration of canine retraction, angulation of canine during its retraction, degree of Rotation, anchorage Loss, distance between canine and premolar at different time intervals were then evaluated, pre- (To, 3 months- (T1 and canine tip touches the second premolar- (T2. Descriptive statistics including mean values and standard deviations were calculated. Paired and unpaired t-test was performed to evaluate the differences between the groups. Results: Rotation and angulation of the canines did not show significant difference in both the systems. There was statistically significant difference (P<0.01 in anchorage loss between single wing and Siamese bracket being 2.65 ±1.41 mm and 1.31 ± 0.93 respectively. There was statistically significant intergroup difference (P<0.01 in canine movement i.e distance between canine and premolar was recorded as 4.72mm (15.06 ± 1.69 to 10.34 ± 1.68mm in single wing bracket and 6.25mm in Siamese (15.52 ± 1.41 to 9.27 ± 1.94. Conclusion: In cases where high anchorage is required and the rate of canine retraction is a concern, Siamese brackets pose a definite advantage over Single wing brackets.
Directory of Open Access Journals (Sweden)
Laura Nordio
2017-05-01
Full Text Available FXR1 (Fragile X mental retardation-related protein 1 is a cytoplasmic RNA binding protein, which genetic expression has been related to metastatic potential in human melanoma. The aims of the present study were: the validation of two commercially available clones of polyclonal anti-human FXR1 antibody in dogs; their application to investigate FXR1 expression in a group of canine oral melanomas. Anti-FXR1 antibody was not previously validated in the canine species. Two different commercially available polyclonal anti-FXR1 antibodies (respectively made in goat and in rabbit were used. FXR1 protein in canine serum was identified by western blot after SDS-PAGE, using human serum as control. FXR1 immunohistochemical expression was tested in a series of normal tissues, that are expected to express FXR1, and in 31 cases of oral melanomas. The final immunohistochemical protocol used heat-induced unmasking and overnight incubation. FXR1 protein bands in canine serum were detected by tested antibodies, in a more specific way by the rabbit antibody. FXR1 immunohistochemical staining was positive in all tested organs, with different levels of expression. FXR1 was also expressed in 31/31 tested melanomas, with variable intensity and percentage of positive cells (Figure 1. Equal results were achieved with the two antibodies in 8 cases of melanoma, whereas there were variable differences in 22, and one case stained only with goat antibody. The rabbit antibody gave less background staining. This study validated anti-FXR1 antibodies for use in the canine species. This protein was expressed in various normal tissues, as well as in the tested neoplasms. Significance of different level of expression is undergoing evaluation with further studies.
Models of experimental saccular aneurysms of carotid arteries in canine
International Nuclear Information System (INIS)
Zhang Haixia; Cheng Yingsheng; Li Minghua
2006-01-01
Objective: To study the availability by making experimental saccular aneurysm models of carotid arteries in canine similar to human intracranial aneurysms. Methods: Twenty healthy canines with experimental saccular side-wall aneurysms of carotid arteries were created successfully by surgery. Results: Forty experimental saccular side-wall aneurysms of carotid arteries were created successfully with 36 aneurysms and parent arteries maintaining patency with each other and four spontaneously occluded confirmed by angiography. Model successful rate reached 90%. Conclusions: Experimental saccular side-wall aneurysms of carotid arteries in canines were one of best models created for simulating human intracranial aneurysms. (authors)
Testosterone biotransformation by the isolated perfused canine pancreas
International Nuclear Information System (INIS)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G.
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, [3H]testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with [3H]testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis
Testosterone biotransformation by the isolated perfused canine pancreas
Energy Technology Data Exchange (ETDEWEB)
Fernandez-del Castillo, C.; Diaz-Sanchez, V.; Varela-Fascinetto, G.; Altamirano, A.; Odor-Morales, A.; Lopez-Medrano, R.M.; Robles-Diaz, G. (Instituto Nacional de la Nutricion Salvador Zubiran, Mexico City (Mexico))
1991-01-01
There is strong evidence indicating that the pancreas is under the influence of sex steroid hormones, and that it may even participate in their biosynthesis and metabolism. In the present study, (3H)testosterone was perfused into the isolated canine pancreas, and measured in the effluent with several of its metabolites (5 alpha-dihydrotestosterone, androstenedione, and estradiol). Results show that testosterone is readily transformed by the canine pancreas. The main product found in the effluent is androstenedione. The testis and spleen were also perfused with (3H)testosterone and used as controls. In both cases, this hormone appeared mostly unchanged in the effluent as compared to the pancreatic perfusion (p less than 0.0001). From our data, we conclude that the canine pancreas has the capacity to transform sex steroid hormones, and could be considered an extragonadal site of sex steroid biosynthesis.
Influence of feeding on serum canine pancreatic lipase immunoreactivity concentrations
Directory of Open Access Journals (Sweden)
Steiner JM
2014-10-01
Full Text Available Jörg M Steiner, Craig G Ruaux, David A Williams Gastrointestinal Laboratory, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, USA Abstract: Measurement of serum concentration of pancreatic lipase immunoreactivity (PLI has been shown to be highly specific for exocrine pancreatic function and sensitive for the diagnosis of canine pancreatitis. Currently, it is recommended that food be withheld for at least 12 hours before collecting a blood sample for analysis from dogs. However, it is unknown whether feeding has any influence on serum canine PLI concentration. Thus, the goal of this study was to evaluate the influence of feeding on serum canine PLI concentrations in healthy dogs. Food was withheld from eight healthy adult Beagle dogs for at least 17 hours and a baseline serum sample (0 minutes was collected. Dogs were fed and serum samples were collected at 15, 30, 45, 60, 75, 90, 105, 150, 180, 210, 240, 300, 360, 420, and 480 minutes. There was no significant difference in serum canine PLI concentrations at any time after feeding (P=0.131. We conclude that feeding has no significant influence on serum canine PLI concentrations. Keywords: dog, pancreatic function, pancreatitis, biomarker, diagnostic test
Alkaline phosphatase activity in gingival crevicular fluid during canine retraction.
Batra, P; Kharbanda, Op; Duggal, R; Singh, N; Parkash, H
2006-02-01
The aim of the study was to investigate alkaline phosphatase activity in the gingival crevicular fluid (GCF) during orthodontic tooth movement in humans. Postgraduate orthodontic clinic. Ten female patients requiring all first premolar extractions were selected and treated with standard edgewise mechanotherapy. Canine retraction was done using 100 g sentalloy springs. Maxillary canine on one side acted as experimental site while the contralateral canine acted as control. Gingival crevicular fluid was collected from mesial and distal of canines before initiation of canine retraction (baseline), immediately after initiation of retraction, and on 1st, 7th, 14th and 21st day and the alkaline phosphatase activity was estimated. The results show significant (p < 0.05) changes in alkaline phosphatase activity on the 7th, 14th and 21st day on both mesial and distal aspects of the compared experimental and control sides. The peak in enzyme activity occurred on the 14th day of initiation of retraction followed by a significant fall in activity especially on the mesial aspect. The study showed that alkaline phosphatase activity could be successfully estimated in the GCF using calorimetric estimation assay kits. The enzyme activity showed variation according to the amount of tooth movement.
Orthodontic-surgical treatment of bilateral maxillary canine impaction
Sumitra
2012-01-01
A 13-year-old female patient reported with the chief complaint of irregular front teeth. She had a skeletal Class III and Angle's Class I malocclusion with hyperdivergent growth pattern and bilateral impaction of maxillary canines. Surgical exposure of the impacted teeth and orthodontic alignment was planned. The surgical exposure was done by a minimally invasive modified window technique. Orthodontic treatment of impacted canines without causing significant morbidity to the adjacent teeth an...
Povey, C.
1982-01-01
A parvovirus of canine origin, cultured in a feline kidney cell line, was inactivated with formalin. Three pilot serials were produced and three forms of finished vaccine (nonadjuvanted, single adjuvanted and double adjuvanted) were tested in vaccination and challenge trials. A comparison was also made with two inactivated feline panleukopenia virus vaccines, one of which has official approval for use in dogs. The inactivated canine vaccine in nonadjuvanted, adjuvanted or double adjuvanted form was immunogenic in 20 of 20 vaccinated dogs. The double adjuvanted vaccine is selected as the one of choice on the basis of best and most persistent seriological response. PMID:7039811
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Lopez, Cecilia M; Yu, Peter Y; Zhang, Xiaoli; Yilmaz, Ayse Selen; London, Cheryl A; Fenger, Joelle M
2018-01-01
Osteosarcoma (OSA) is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease. RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes. These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
MiR-34a regulates the invasive capacity of canine osteosarcoma cell lines.
Directory of Open Access Journals (Sweden)
Cecilia M Lopez
Full Text Available Osteosarcoma (OSA is the most common bone tumor in children and dogs; however, no substantial improvement in clinical outcome has occurred in either species over the past 30 years. MicroRNAs (miRNAs are small non-coding RNAs that regulate gene expression and play a fundamental role in cancer. The purpose of this study was to investigate the potential contribution of miR-34a loss to the biology of canine OSA, a well-established spontaneous model of the human disease.RT-qPCR demonstrated that miR-34a expression levels were significantly reduced in primary canine OSA tumors and canine OSA cell lines as compared to normal canine osteoblasts. In canine OSA cell lines stably transduced with empty vector or pre-miR-34a lentiviral constructs, overexpression of miR-34a inhibited cellular invasion and migration but had no effect on cell proliferation or cell cycle distribution. Transcriptional profiling of canine OSA8 cells possessing enforced miR-34a expression demonstrated dysregulation of numerous genes, including significant down-regulation of multiple putative targets of miR-34a. Moreover, gene ontology analysis of down-regulated miR-34a target genes showed enrichment of several biological processes related to cell invasion and motility. Lastly, we validated changes in miR-34a putative target gene expression, including decreased expression of KLF4, SEM3A, and VEGFA transcripts in canine OSA cells overexpressing miR-34a and identified KLF4 and VEGFA as direct target genes of miR-34a. Concordant with these data, primary canine OSA tumor tissues demonstrated increased expression levels of putative miR-34a target genes.These data demonstrate that miR-34a contributes to invasion and migration in canine OSA cells and suggest that loss of miR-34a may promote a pattern of gene expression contributing to the metastatic phenotype in canine OSA.
Homologous radioimmunoassay for canine prolactin and its application in various physiological states
International Nuclear Information System (INIS)
Graef, K.-J.; Friedreich, E.; Matthes, S.; Hasan, S.H.
1977-01-01
The purification of canine prolactin and the development of an homologous radioimmunoassay including several physiological studies in the Beagle dog are described. The assay measured immunoreactive canine prolactin with a sensitivity limit of 0.6 ng/ml. Purified canine luteinizing hormone gave no significant inhibition in the assay whereas purified canine growth hormone inhibited the binding of 125 I-labelled canine prolactin to antiserum only at very high dose levels. In Beagle dogs, basal serum prolactin concentrations were in the range 1 to 2 ng/ml in normal male, normal female (metoestrus and anoestrus) and oophorectomized-hysterectomized female dogs. The prolactin concentration in one sample of amniotic fluid was in the same range, while in hypophysectomized make dogs no serum prolactin could be detected by the assay system. Serum prolactin concentrations tended to increase during late pregnancy and parturition, remaining high during the first 9 days of lactation. In consequence, a negative correlation was suggested between serum prolactin and serum progesterone concentrations. (author)
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus
Directory of Open Access Journals (Sweden)
Lourdes M. B. Pessoa
2016-01-01
Full Text Available The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
Extraction of Unerupted Maxillary Canine Teeth in a Maned Wolf (Chrysocyon brachyurus)
Pessoa, Lourdes M. B.; Roza, Marcello; Farias, Anderson; Jesus, Pedro Henrique de; Campbell, Rita de Cassia; Pinho, Mariângela Pereira de
2016-01-01
The purpose of this case report is to describe the diagnosis and treatment of unerupted canine teeth in a maned wolf. After physical examination, complete blood count, and serum biochemical profile, the animal underwent general anesthesia and head radiography was performed to confirm the diagnosis. The treatment consisted of the extraction of both maxillary canine teeth and clinical and radiographic follow-up of the right mandibular canine tooth.
PMab-38 Recognizes Canine Podoplanin of Squamous Cell Carcinomas.
Kaneko, Mika K; Honma, Ryusuke; Ogasawara, Satoshi; Fujii, Yuki; Nakamura, Takuro; Saidoh, Noriko; Takagi, Michiaki; Kagawa, Yumiko; Konnai, Satoru; Kato, Yukinari
2016-10-01
Podoplanin, a type I transmembrane protein, is expressed in lymphatic endothelial cells. Although we previously developed an anticanine podoplanin monoclonal antibody (mAb), PMab-38, immunohistochemistry (IHC) showed that it did not react with canine lymphatic endothelial cells. Here, we determined whether PMab-38 recognizes canine podoplanin of squamous cell carcinomas (SCCs) and clarified its epitope. In IHC, PMab-38 reacted with 83% of SCCs (15/18 cases). Flow cytometry showed that the epitope of PMab-38 was different from that of the platelet aggregation-stimulating domain of the N-terminus, which was detected by almost all antipodoplanin mAbs such as D2-40 or NZ-1. PMab-38 is expected to be useful for investigating the function of podoplanin in canine tumors.
Severe canine distemper outbreak in unvaccinated dogs in Mozambique.
Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G
2016-07-15
Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.
[Biological characteristics of a chimeric rabies virus expressing canine parvovirus VP2 protein].
Niu, Xue-Feng; Liu, Xiao-Hui; Sun, Zhao-Jin; Shi, He-He; Chen, Jing; Jiang, Bido; Sun, Jing-Chen; Guo, Xiao-Feng
2009-09-01
To obtain a bivalence vaccine against canine rabies virus and canine parvovirus, a chimeric rabies virus expressing canine parvovirus VP2 protein was generated by the technique of reverse genetics. It was shown that the chimeric virus designated as HEP-Flury (VP2) grew well on BHK-21 cells and the VP2 gene could still be stably expressed after ten passages on BHK-21 cells. Experiments on the mice immunized with the chimeric virus HEP-Flury (VP2) demonstrated that specific antibodies against rabies virus and canine parvovirus were induced in immunized mice after vaccination with the live chimeric virus.
Cellular endocytic compartment localization of expressed canine CD1 molecules
DEFF Research Database (Denmark)
Schjærff, Mette; Keller, Stefan M.; Affolter, Verena K.
2016-01-01
CD1 molecules are glycoproteins present primarily on dendritic cells (DCs), which recognize and presenta variety of foreign- and self-lipid antigens to T-cells. Humans have five different CD1 isoforms that sur-vey distinct cellular compartments allowing for recognition of a large repertoire...... onlya diminished GFP expression. In conclusion, canine CD1 transfectants show distinct localization patternsthat are similar to human CD1 proteins with the exception of the canine CD1d isoform, which most likelyis non-functional. These findings imply that canine CD1 localization overall resembles human...... CD1 traf-ficking patterns. This knowledge is important for the understanding of lipid antigen-receptor immunityin the dog....
Canine Gouging: A Taboo Resurfacing in Migrant Urban Population.
Noman, Anila Virani; Wong, Ferranti; Pawar, Ravikiran Ramakrishna
2015-01-01
Cosmopolitan cities have become a pool of migrants from different parts of the world, who carry their cultural beliefs and superstitions with them around the globe. Canine gouging is a kind of infant oral mutilation (IOM) which is widely practiced among rural population of Africa where the primary tooth bud of the deciduous canine is enucleated. The belief is that the life threatening illnesses in children like vomiting, diarrhoea, and fevers are caused by worms which infest on tooth buds. This case report is of a 15-year-old Somalian born boy, who presented at the dental institute with intermittent pain in his lower right permanent canine which was associated with a discharging intra oral buccal sinus. The tooth was endodontically treated and then restored with composite. General dental practitioners need to be vigilant when encountered with tooth presenting unusual morphology, unilateral missing tooth, and shift in the midline due to early loss of deciduous/permanent canines. Identification of any such dental mutilation practice will need further counselling of the individual and family members. It is the duty of every dental professional to educate and safeguard the oral and dental health of general public.
Cellular and Phenotypic Characterization of Canine Osteosarcoma Cell Lines
Directory of Open Access Journals (Sweden)
Marie E. Legare, Jamie Bush, Amanda K. Ashley, Taka Kato, William H. Hanneman
2011-01-01
Full Text Available Canine and human osteosarcoma (OSA have many similarities, with the majority of reported cases occurring in the appendicular skeleton, gender predominance noted, high rate of metastasis at the time of presentation, and a lack of known etiology for this devastating disease. Due to poor understanding of the molecular mechanisms underlying OSA, we have characterized seven different OSA canine cell lines: Abrams, D17, Grey, Hughes, Ingles, Jarques, and Marisco and compared them to U2, a human OSA cell line, for the following parameters: morphology, growth, contact inhibition, migrational tendencies, alkaline phosphatase staining, heterologous tumor growth, double-strand DNA breaks, and oxidative damage. All results demonstrated the positive characteristics of the Abrams cell line for use in future studies of OSA. Of particular interest, the robust growth of a subcutaneous tumor and rapid pulmonary metastasis of the Abrams cell line in an immunocompromised mouse shows incredible potential for the future use of Abrams as a canine OSA model. Further investigations utilizing a canine cell model of OSA, such as Abrams, will be invaluable to understanding the molecular events underlying OSA, pharmaceutical inhibition of metastasis, and eventual prevention of this devastating disease.
Orthodontic management of bilaterally impacted mandibular canines in a growing patient
Directory of Open Access Journals (Sweden)
Rajaganesh J Gautam
2016-01-01
Full Text Available KK, an 11.9-year-old male patient, presented with the chief complaint of forwardly placed upper front teeth. Diagnosis revealed a Class II subdivision right malocclusion on an underlying Class I skeletal base with a horizontal growth pattern, bimaxillary proclination, crowding in the lower arch, over retained deciduous canines in the upper right and lower quadrants, an unerupted maxillary right permanent canine, and bilaterally impacted mandibular permanent canines, an increased overjet, and a deep overbite. He had a mild convex profile, a toothy smile with a nonconsonant smile arc and mildly protrusive lips. Treatment with a nonextraction treatment plan, which included surgical uncovering and orthodontic eruptive guidance of the impacted mandibular canines, with multibracket metallic fixed appliances, solved the patient′s complaints and achieved an esthetically pleasing and functionally adequate occlusal result.
Comparison of canine parvovirus with mink enteritis virus by restriction site mapping.
McMaster, G K; Tratschin, J D; Siegl, G
1981-01-01
The genomes of canine parvovirus and mink enteritis virus were compared by restriction enzyme analysis of their replicative-form DNAs. Of 79 mapped sites, 68, or 86%, were found to be common for both types of DNA, indicating that canine parvovirus and mink enteritis virus are closely related viruses. Whether they evolved from a common precursor or whether canine parvovirus is derived from mink enteritis virus, however, cannot be deduced from our present data.
Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus
Directory of Open Access Journals (Sweden)
Sudarisman
2006-03-01
Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.
Comparative photoelastic study of dental and skeletal anchorages in the canine retraction
Directory of Open Access Journals (Sweden)
Cristiane Aparecida de Assis Claro
2014-01-01
Full Text Available OBJECTIVE: To compare dental and skeletal anchorages in mandibular canine retraction by means of a stress distribution analysis. METHODS: A photoelastic model was produced from second molar to canine, without the first premolar, and mandibular canine retraction was simulated by a rubber band tied to two types of anchorage: dental anchorage, in the first molar attached to adjacent teeth, and skeletal anchorage with a hook simulating the mini-implant. The forces were applied 10 times and observed in a circular polariscope. The stresses located in the mandibular canine were recorded in 7 regions. The Mann-Whitney test was employed to compare the stress in each region and between both anchorage systems. The stresses in the mandibular canine periradicular regions were compared by the Kruskal-Wallis test. RESULTS: Stresses were similar in the cervical region and the middle third. In the apical third, the stresses associated with skeletal anchorage were higher than the stresses associated with dental anchorage. The results of the Kruskal-Wallis test showed that the highest stresses were identified in the cervical-distal, apical-distal, and apex regions with the use of dental anchorage, and in the apical-distal, apical-mesial, cervical-distal, and apex regions with the use of skeletal anchorage. CONCLUSIONS: The use of skeletal anchorage in canine retraction caused greater stress in the apical third than the use of dental anchorage, which indicates an intrusive component resulting from the direction of the force due to the position of the mini-implant and the bracket hook of the canine.
Sajnani, Anand K
2015-02-01
The position of the permanent maxillary canine at the angle of the mouth is strategically significant in maintaining the harmony and symmetry of the occlusal relationship. However, the maxillary canine is the second most frequently impacted tooth, with prevalence reported to be between 1% and 2%. Moreover, treatment of this condition is often complex and involves substantial time and financial cost. Hence, it is only prudent to monitor the eruption and identify the etiological factors that lead to impaction of the maxillary canine. Numerous researchers have tried to identify specific and nonspecific etiological factors responsible for displacement of canines. The purpose of this review was to track the development processes of maxillary canines and determine the hindrances that affect the eruption at different ages. Awareness of the eruption process and etiology of noneruption will help to reduce the incidence of impacted canines by allowing for early recognition and interceptive treatment. © 2013 Wiley Publishing Asia Pty Ltd.
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Mann, Elizabeth; Whittington, Lisa
2014-01-01
Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4) was significantly higher (p < 0.05) than that in the control (0.83 ± 0.3) and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009). Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended. PMID:26770752
Tumor microvessel density–associated mast cells in canine nodal lymphoma
Directory of Open Access Journals (Sweden)
Moges Woldemeskel
2014-11-01
Full Text Available Objective: Mast cells are associated in angiogenesis in various human and animal neoplasms. However, association of mast cells with tumor microvessel density in canine lymphoma was not previously documented. The objective of the study is to determine if mast cells are increased in canine nodal lymphomas and to evaluate their correlation with tumor microvessel density and grading of lymphomas. Methods: Nodal lymphomas from 33 dogs were studied and compared with nonneoplastic lymph nodes from 6 dogs as control. Mast cell count was made on Toluidine blue stained sections. Immunohistochemistry using antibody against Factor VIII was employed to visualize and determine microvessel density. Results: The mast cell count in lymphoma (2.95 ± 2.4 was significantly higher (p < 0.05 than that in the control (0.83 ± 0.3 and was positively correlated with tumor microvessel density (r = 0.44, p = 0.009. Significant difference was not observed in mast cell count and tumor microvessel density among different gradings of lymphomas. Conclusions: Mast cells are associated with tumor microvessel density in canine nodal lymphoma with no significant difference among gradings of lymphomas. Mast cells may play an important role in development of canine nodal lymphomas. Further detailed investigation on the role of mast cells as important part of tumor microenvironment in canine nodal lymphomas is recommended.
How far is the root apex of a unilateral impacted canine from the root apices' arch form?
Kim, Sung-Hun; Kim, You-Min; Oh, Sewoong; Kim, Seong-Sik; Park, Soo-Byung; Son, Woo-Sung; Kim, Yong-Il
2017-02-01
The purpose of this study was to determine the arch form of the root apices of normally erupting teeth and then determine the differences in the location of the apex of impacted canines relative to normally erupting canines. In addition, we sought to determine whether the labiopalatal position of the impacted canines influences the position of the apices. The study included 21 patients with unerupted canines that subsequently had a normal eruption, 21 patients with palatally impacted canines, 27 patients with labially impacted canines, and 17 patients with midalveolus impacted canines. Images were obtained using cone beam computed tomography, and the x, y, and z coordinates of the root apices were determined using Ondemand3D software (Cybermed Co., Seoul, Korea). Two-dimensional coordinates were converted from acquired 3-dimensional coordinates via projection on a palatal plane, and the Procrustes method was used to process the converted 2-dimensional coordinates and to draw the arch forms of the root apices. Finally, we measured the extent of root apex deviation from the arch forms of the root apices. Normally erupting canines showed that even though calcifications may be immature, their positions were aligned with a normal arch form. The root apices of the impacted canines were an average of 6.572 mm away from the root apices' arch form, whereas those of the contralateral nonimpacted canines were an average distance of 2.221 mm away, a statistically significant difference. The palatally impacted canines' root apices distribution tended toward the first premolar root apices. Incompletely calcified, unerupted teeth with a subsequent normal eruption showed a normal arch form of the root apices. The root apices of impacted canines were farther from the arch forms than were the nonimpacted canines. Also, the root apices of impacted canines in the palatal area showed distributions different from those of the other impacted canine groups. Copyright © 2017 American
The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.
Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki
2015-04-17
Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Automated tru-cut imaging-guided core needle biopsy of canine ...
African Journals Online (AJOL)
The purpose of this study was to evaluate the diagnostic value of imaging-guided core needle biopsy for canine orbital mass diagnosis. A second excisional biopsy obtained during surgery or necropsy was used as the reference standard. A prospective feasibility study was conducted in 23 canine orbital masses at a single ...
Wu, Lisa Y; Johnson, Jacqueline M; Simmons, Jessica K; Mendes, Desiree E; Geruntho, Jonathan J; Liu, Tiancheng; Dirksen, Wessel P; Rosol, Thomas J; Davis, William C; Berkman, Clifford E
2014-05-01
Prostate-specific membrane antigen (PSMA) remains an important target for diagnostic and therapeutic application for human prostate cancer. Model cell lines have been recently developed to study canine prostate cancer but their PSMA expression and enzymatic activity have not been elucidated. The present study was focused on determining PSMA expression in these model canine cell lines and the use of fluorescent small-molecule enzyme inhibitors to detect canine PSMA expression by flow cytometry. Western blot and RT-PCR were used to determine the transcriptional and translational expression of PSMA on the canine cell lines Leo and Ace-1. An endpoint HPLC-based assay was used to monitor the enzymatic activity of canine PSMA and the potency of enzyme inhibitors. Flow cytometry was used to detect the PSMA expressed on Leo and Ace-1 cells using a fluorescently tagged PSMA enzyme inhibitor. Canine PSMA expression on the Leo cell line was confirmed by Western blot and RT-PCR, the enzyme activity, and flow cytometry. Kinetic parameters Km and Vmax of PSMA enzymatic activity for the synthetic substrate (PABGγG) were determined to be 393 nM and 220 pmol min(-1) mg protein(-1) , respectively. The inhibitor core 1 and fluorescent inhibitor 2 were found to be potent reversible inhibitors (IC50 = 13.2 and 1.6 nM, respectively) of PSMA expressed on the Leo cell line. Fluorescent labeling of Leo cells demonstrated that the fluorescent PSMA inhibitor 2 can be used for the detection of PSMA-positive canine prostate tumor cells. Expression of PSMA on Ace-1 was low and not detectable by flow cytometry. The results described herein have demonstrated that PSMA is expressed on canine prostate tumor cells and exhibits similar enzymatic characteristics as human PSMA. The findings show that the small molecule enzyme inhibitors currently being studied for use in diagnosis and therapy of human prostate cancer can also be extended to include canine prostate cancer. Importantly
Evaluation of the kinase domain of c-KIT in canine cutaneous mast cell tumors
International Nuclear Information System (INIS)
Webster, Joshua D; Kiupel, Matti; Yuzbasiyan-Gurkan, Vilma
2006-01-01
Mutations in the c-KIT proto-oncogene have been implicated in the progression of several neoplastic diseases, including gastrointestinal stromal tumors and mastocytosis in humans, and cutaneous mast cell tumors (MCTs) in canines. Mutations in human mastocytosis patients primarily occur in c-KIT exon 17, which encodes a portion of its kinase domain. In contrast, deletions and internal tandem duplication (ITD) mutations are found in the juxtamembrane domain of c-KIT in approximately 15% of canine MCTs. In addition, ITD c-KIT mutations are significantly associated with aberrant KIT protein localization in canine MCTs. However, some canine MCTs have aberrant KIT localization but lack ITD c-KIT mutations, suggesting that other mutations or other factors may be responsible for aberrant KIT localization in these tumors. In order to characterize the prevalence of mutations in the phospho-transferase portion of c-KIT's kinase domain in canine MCTs exons 16–20 of 33 canine MCTs from 33 dogs were amplified and sequenced. Additionally, in order to determine if mutations in c-KIT exon 17 are responsible for aberrant KIT localization in MCTs that lack juxtamembrane domain c-KIT mutations, c-KIT exon 17 was amplified and sequenced from 18 canine MCTs that showed an aberrant KIT localization pattern but did not have ITD c-KIT mutations. No mutations or polymorphisms were identified in exons 16–20 of any of the MCTs examined. In conclusion, mutations in the phospho-transferase portion of c-KIT's kinase domain do not play an important role in the progression of canine cutaneous MCTs, or in the aberrant localization of KIT in canine MCTs
Feline and canine coronaviruses: common genetic and pathobiological features.
Le Poder, Sophie
2011-01-01
A new human coronavirus responsible for severe acute respiratory syndrome (SARS) was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP) and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV) will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine osteosarcomas, whereas cat samples more often displayed moderate levels. High levels of pro-MMP9, pro-MMP2, and active MMP2 were detected by gelatin zymography in both species, with significantly higher values for active MMP2 in canine osteosarcoma. These findings indicate that MMP2 is probably involved in canine and feline osteosarcoma and their expression and activity could be associated with the different metastatic behavior of canine and feline osteosarcoma.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Directory of Open Access Journals (Sweden)
Otávio Valério Carvalho
2012-01-01
Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.
Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus
Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo
2012-01-01
Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403
Canine Leishmaniosis: tools for diagnosis in veterinary practice in Colombia
Directory of Open Access Journals (Sweden)
Víctor Acero P
2015-09-01
Full Text Available The objective of this article is to perform a critical analysis and guide veterinarians in the management of canine Leishmaniosis. A systematic literature review was performed between 2005 and 2014 including scientific papers which take into account experiences and reports of: pathogenesis, diagnosis, clinical presentation, treatment, vaccination, prevention and control strategies. We discuss the different aspects of VL management and aspects that should be taken into account depending on the country, after a patient is suspected or confirmed as positive, including the possibility of euthanasia. We describe the different clinical manifestations of the disease, diagnosis, signs and treatment of canine leishmaniosis. Canine leishmaniosis is present in different parts of the country, therefore it must be considered as a possible differential diagnosis in the veterinary clinic, in patients with dermatological and systemic signs that are compatible with various diseases. In Colombia, the patients diagnosed with cutaneous leishmaniasis could be treated and have a favorable prognosis, whereas in canines with diagnosis of visceral leishmaniasis euthanasia should be considered because of the public health implications.
Compensatory canine angulation in angle Class II and III patients
Directory of Open Access Journals (Sweden)
Mauro Carlos Agner Busato
2009-09-01
Full Text Available The aim of this study was to evaluate the occurence of compensation in mesiodistal axial inclinations of canines in skeletal malocclusions patients. The sample consisted of 25 Angle Class II, division 1 malocclusion (group 1 and 19 Angle Class III malocclusion patients (group 2. After measurement of dental angulations through a method that associates plaster model photography and AutoCad software, comparisons between the groups were performed by T-test for independent samples. Results showed that there was no statistically significant difference (p < 0.05 between groups, when maxillary canine angulations were compared. Regarding the mandibular canines, there was a statistically significant difference in dental angulation, expressed by 3.2° for group 1 and 0.15° for group 2. An upright position tendency for mandibular canines was observed in the Angle Class III sample. This configures a pattern of compensatory coronary positioning, since the angulation of these teeth makes them occupy less space in the dental arch and consequently mandibular incisors can be in a more retracted position in the sagittal plane.
European surveillance of emerging pathogens associated with canine infectious respiratory disease.
Mitchell, Judy A; Cardwell, Jacqueline M; Leach, Heather; Walker, Caray A; Le Poder, Sophie; Decaro, Nicola; Rusvai, Miklos; Egberink, Herman; Rottier, Peter; Fernandez, Mireia; Fragkiadaki, Eirini; Shields, Shelly; Brownlie, Joe
2017-12-01
Canine infectious respiratory disease (CIRD) is a major cause of morbidity in dogs worldwide, and is associated with a number of new and emerging pathogens. In a large multi-centre European study the prevalences of four key emerging CIRD pathogens; canine respiratory coronavirus (CRCoV), canine pneumovirus (CnPnV), influenza A, and Mycoplasma cynos (M. cynos); were estimated, and risk factors for exposure, infection and clinical disease were investigated. CIRD affected 66% (381/572) of the dogs studied, including both pet and kennelled dogs. Disease occurrence and severity were significantly reduced in dogs vaccinated against classic CIRD agents, canine distemper virus (CDV), canine adenovirus 2 (CAV-2) and canine parainfluenza virus (CPIV), but substantial proportions (65.7%; 201/306) of vaccinated dogs remained affected. CRCoV and CnPnV were highly prevalent across the different dog populations, with overall seropositivity and detection rates of 47% and 7.7% for CRCoV, and 41.7% and 23.4% for CnPnV, respectively, and their presence was associated with increased occurrence and severity of clinical disease. Antibodies to CRCoV had a protective effect against CRCoV infection and more severe clinical signs of CIRD but antibodies to CnPnV did not. Involvement of M. cynos and influenza A in CIRD was less apparent. Despite 45% of dogs being seropositive for M. cynos, only 0.9% were PCR positive for M. cynos. Only 2.7% of dogs were seropositive for Influenza A, and none were positive by PCR. Copyright © 2017 Elsevier B.V. All rights reserved.
Gossellin, J; Wren, J A; Sunderland, S J
2007-08-01
Canine patients are generally regarded as being clinically obese when their body weight is at least 15% above ideal. The incidence of obesity in dogs is thought to be in the range of 20-40% of the general population and, since obesity is known to predispose or exacerbate a range of serious medical conditions, its importance cannot be overstated. Management of obesity through dietary restriction and increased exercise is often difficult to achieve and dependent upon owner compliance. Until recently there has been no authorized therapeutic medication available for weight reduction in dogs, and drugs used in people have proved unsuitable. However, with the development of microsomal triglyceride transfer protein inhibitors for canine use, such as dirlotapide, the veterinarian has a novel method with which to augment traditional weight control programmes. This approach has the additional advantage that weight loss is achieved without dietary restriction or change in exercise regimen, providing encouragement for the owner to comply with subsequent dietary and exercise recommendations, thereby increasing the likelihood for long-term success.
Peracute Infectious Canine Hepatitis
Directory of Open Access Journals (Sweden)
A. H. Cheema*, I. Ahmed, G. Mustafa and A. Aslam
2012-05-01
Full Text Available Peracute infectious canine hepatitis (ICH was diagnosed in two young male dogs out of 56 dead canines presented for necropsy examination during the period of April 2009 to June 2010. These dogs were purebred, one- month old Alsatian and 5-month old Labrador. None of the dogs had received any vaccination or deworming treatment; both had died after illness lasting for six hours and twenty four hours respectively. The dogs had shown signs of depression, anorexia and fever. At necropsy, lymph nodes were swollen, edematous and congested; livers were enlarged, bright red and mottled with numerous small white foci. Petechial hemorrhages were seen in the mucosa. Excessive serosanguinous fluid was present in the abdominal cavities. Histologically, the most significant lesion was necrohemorrhagic hepatitis with single cell necrosis of hepatocytes, lacunose dilation of sinusoids filled with blood and numerous large, solid intranuclear inclusion bodies (IIBs in the hepatocytes and macrophages. Both eosinophilic and basophilic (amphophilic inclusions were seen. It has been observed that ICH is re-emerging in some endemic countries. Pet dogs should be regularly protected by effective vaccination.
Radioresistant canine hematopoietic cells
International Nuclear Information System (INIS)
Kawakami, T.G.; Shimizu, J.; Rosenblatt, L.S.; Goldman, M.
1987-01-01
Survival of dogs that are continuously exposed to a moderate dose-rate of gamma radiation (10 cGy/day) is dependent on the age of the dog at the time of exposure. Most dogs exposed postpartum to gamma radiation suffered from suppressed hematopoiesis and died of aplasia. On the other hand, none of the in utero-exposed dogs suffered from suppressed hematopoiesis and most became long-term survivors, tolerating 10-fold greater total dose, but dying of myeloproliferative disease (MPD). Using acute gamma irradiation of hematopoietic cells and colony forming unit cell assay (CFU), they observed that a canine hematopoietic cell line established from a myeloid leukemic dog that was a long-term survivor of continuous irradiation was approximately 4-fold more radioresistant than a hematopoietic cell line established from a dog with nonradiation-induced myeloid leukemia or hematopoietic cells from normal canine bone marrow. In utero dogs that are long-term survivors of continuous irradiation have radioresistant hematopoietic cells, and radioresistance that is a constitutive property of the cells
Surgical innovations in canine gonadectomy
Van Goethem, Bart
2016-01-01
In this thesis some recent technological developments in human surgery are evaluated for their potential use in veterinary medicine by introducing them as surgical innovations for canine gonadectomy. Barbed sutures achieve wound apposition without surgical knot tying and thus avoid knot-associated
Stahl, Franka; Grabowski, Rosemarie
2003-05-01
The relationship between maxillary canine displacement and the simultaneous occurrence of "genetically determined predisposition to disturbed development of the dentition" as defined by Hoffmeister was investigated in 675 patients. Panoramic radiographs taken of each patient during the first and the second mixed dentition periods were evaluated. Canine inclination and the distance between the tip of the canine and a line connecting the cusps of the molars were computed in five different age groups according to Dausch-Neumann. Statistical analysis revealed 34 patients with "potential canine displacement", who exhibited further symptoms of "genetically determined predisposition to disturbed development of the dentition" significantly more frequently than the total group. The symptoms concerned were agenesia, displaced tooth buds, rotated or tilted incisors, aplasia and microdontia of lateral incisors. Careful follow-ups in patients with a predisposition to disturbed dental development enables risks to be anticipated and canine displacement to be detected at an early stage.
Expression of nociceptive ligands in canine osteosarcoma.
Shor, S; Fadl-Alla, B A; Pondenis, H C; Zhang, X; Wycislo, K L; Lezmi, S; Fan, T M
2015-01-01
Canine osteosarcoma (OS) is associated with localized pain as a result of tissue injury from tumor infiltration and peritumoral inflammation. Malignant bone pain is caused by stimulation of peripheral pain receptors, termed nociceptors, which reside in the localized tumor microenvironment, including the periosteal and intramedullary bone cavities. Several nociceptive ligands have been determined to participate directly or indirectly in generating bone pain associated with diverse skeletal abnormalities. Canine OS cells actively produce nociceptive ligands with the capacity to directly or indirectly activate peripheral pain receptors residing in the bone tumor microenvironment. Ten dogs with appendicular OS. Expression of nerve growth factor, endothelin-1, and microsomal prostaglandin E synthase-1 was characterized in OS cell lines and naturally occurring OS samples. In 10 dogs with OS, circulating concentrations of nociceptive ligands were quantified and correlated with subjective pain scores and tumor volume in patients treated with standardized palliative therapies. Canine OS cells express and secrete nerve growth factor, endothelin-1, and prostaglandin E2. Naturally occurring OS samples uniformly express nociceptive ligands. In a subset of OS-bearing dogs, circulating nociceptive ligand concentrations were detectable but failed to correlate with pain status. Localized foci of nerve terminal proliferation were identified in a minority of primary bone tumor samples. Canine OS cells express nociceptive ligands, potentially permitting active participation of OS cells in the generation of malignant bone pain. Specific inhibitors of nociceptive ligand signaling pathways might improve pain control in dogs with OS. Copyright © 2015 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of American College of Veterinary Internal Medicine.
Feline and Canine Coronaviruses: Common Genetic and Pathobiological Features
Directory of Open Access Journals (Sweden)
Sophie Le Poder
2011-01-01
Full Text Available A new human coronavirus responsible for severe acute respiratory syndrome (SARS was identified in 2003, which raised concern about coronaviruses as agents of serious infectious disease. Nevertheless, coronaviruses have been known for about 50 years to be major agents of respiratory, enteric, or systemic infections of domestic and companion animals. Feline and canine coronaviruses are widespread among dog and cat populations, sometimes leading to the fatal diseases known as feline infectious peritonitis (FIP and pantropic canine coronavirus infection in cats and dogs, respectively. In this paper, different aspects of the genetics, host cell tropism, and pathogenesis of the feline and canine coronaviruses (FCoV and CCoV will be discussed, with a view to illustrating how study of FCoVs and CCoVs can improve our general understanding of the pathobiology of coronaviruses.
THE REDUCED CANINE PANCREAS TO STUDY THE EFFECTS OF INTRAOPERATIVE RADIOTHERAPY
HEIJMANS, HJ; MEHTA, D; KLEIBEUKER, JH; SLUITER, WJ; HOEKSTRA, HJ
1993-01-01
A canine model is described to study the tolerance of the pancreas to intra-operative radiotherapy (IORT). The canine pancreas is a horseshoe-shaped organ. To create a homogeneous delivery of IORT to the whole pancreas surgical manipulation is necessary which may induce pancreatitis. A resection of
Laparoscopic radical prostatectomy in the canine model.
Price, D T; Chari, R S; Neighbors, J D; Eubanks, S; Schuessler, W W; Preminger, G M
1996-12-01
The purpose of this study was to determine the feasibility of performing laparoscopic radical prostatectomy in a canine model. Laparoscopic radical prostatectomy was performed on six adult male canines. A new endoscopic needle driver was used to construct a secure vesicourethral anastomosis. Average operative time required to complete the procedure was 304 min (range 270-345 min). Dissection of the prostate gland took an average of 67 min (range 35-90 min), and construction of the vesicourethral anastomosis took 154 min (rage 80-240 min). There were no intraoperative complications and only one postoperative complication (anastomotic leak). Five of the six animals recovered uneventfully from the procedure, and their foley catheters were removed 10-14 days postoperatively after a retrograde cystourethrogram demonstrated an intact vesicourethral anastomosis. Four (80%) of the surviving animals were clinically continent within 10 days after catheter removal. Post mortem examination confirmed that the vesicourethral anastomosis was intact with no evidence of urine extravasation. These data demonstrate the feasibility of laparoscopic radical prostatectomy in a canine model, and suggest that additional work with this technique should be continued to develop its potential clinical application.
Angstadt, Andrea Y; Motsinger-Reif, Alison; Thomas, Rachael; Kisseberth, William C; Guillermo Couto, C; Duval, Dawn L; Nielsen, Dahlia M; Modiano, Jaime F; Breen, Matthew
2011-11-01
Osteosarcoma (OS) is the most commonly diagnosed malignant bone tumor in humans and dogs, characterized in both species by extremely complex karyotypes exhibiting high frequencies of genomic imbalance. Evaluation of genomic signatures in human OS using array comparative genomic hybridization (aCGH) has assisted in uncovering genetic mechanisms that result in disease phenotype. Previous low-resolution (10-20 Mb) aCGH analysis of canine OS identified a wide range of recurrent DNA copy number aberrations, indicating extensive genomic instability. In this study, we profiled 123 canine OS tumors by 1 Mb-resolution aCGH to generate a dataset for direct comparison with current data for human OS, concluding that several high frequency aberrations in canine and human OS are orthologous. To ensure complete coverage of gene annotation, we identified the human refseq genes that map to these orthologous aberrant dog regions and found several candidate genes warranting evaluation for OS involvement. Specifically, subsequenct FISH and qRT-PCR analysis of RUNX2, TUSC3, and PTEN indicated that expression levels correlated with genomic copy number status, showcasing RUNX2 as an OS associated gene and TUSC3 as a possible tumor suppressor candidate. Together these data demonstrate the ability of genomic comparative oncology to identify genetic abberations which may be important for OS progression. Large scale screening of genomic imbalance in canine OS further validates the use of the dog as a suitable model for human cancers, supporting the idea that dysregulation discovered in canine cancers will provide an avenue for complementary study in human counterparts. Copyright © 2011 Wiley-Liss, Inc.
Cavalli, Alessandra; Desario, Costantina; Kusi, Ilir; Mari, Viviana; Lorusso, Eleonora; Cirone, Francesco; Kumbe, Ilirjan; Colaianni, Maria Loredana; Buonavoglia, Domenico; Decaro, Nicola
2014-07-01
An epidemiological survey for Canine parvovirus 2 (CPV-2) and Canine coronavirus (CCoV) was conducted in Albania. A total of 57 fecal samples were collected from diarrheic dogs in the District of Tirana during 2011-2013. The molecular assays detected 53 and 31 CPV- and CCoV-positive specimens, respectively, with mixed CPV-CCoV infections diagnosed in 28 dogs. The most frequently detected CPV type was 2a, whereas IIa was the predominant CCoV subtype. A better comprehension of the CPV-CCoV epidemiology in eastern European countries will help to assess the most appropriate vaccination strategies to prevent disease due to infections with these widespread agents of acute gastroenteritis in the dog.
Effects of aurothiomalate treatment on canine osteosarcoma in a murine xenograft model.
Scharf, Valery F; Farese, James P; Siemann, Dietmar W; Abbott, Jeffrey R; Kiupel, Matti; Salute, Marc E; Milner, Rowan J
2014-03-01
Osteosarcoma is a highly fatal cancer, with most patients ultimately succumbing to metastatic disease. The purpose of this study was to evaluate the effects of the antirheumatoid drug aurothiomalate on canine and human osteosarcoma cells and on canine osteosarcoma growth and metastasis in a mouse xenograft model. We hypothesized that aurothiomalate would decrease osteosarcoma cell survival, tumor cellular proliferation, tumor growth, and metastasis. After performing clonogenic assays, aurothiomalate or a placebo was administered to 54 mice inoculated with canine osteosarcoma. Survival, tumor growth, embolization, metastasis, histopathology, cell proliferation marker Ki67, and apoptosis marker caspase-3 were compared between groups. Statistical analysis was carried out using the Kaplan-Meier method with the log-rank test and one-way analysis of variance with the Tukey's test or Dunn's method. Aurothiomalate caused dose-dependent inhibition of osteosarcoma cell survival (Posteosarcoma cell survival and reduced tumor cell proliferation, growth, embolization, and pulmonary metastasis. Given aurothiomalate's established utility in canine and human medicine, our results suggest that this compound may hold promise as an adjunctive therapy for osteosarcoma. Further translational research is warranted to better characterize the dose response of canine and human osteosarcoma to aurothiomalate.
Intra- and interspecies gene expression models for predicting drug response in canine osteosarcoma.
Fowles, Jared S; Brown, Kristen C; Hess, Ann M; Duval, Dawn L; Gustafson, Daniel L
2016-02-19
Genomics-based predictors of drug response have the potential to improve outcomes associated with cancer therapy. Osteosarcoma (OS), the most common primary bone cancer in dogs, is commonly treated with adjuvant doxorubicin or carboplatin following amputation of the affected limb. We evaluated the use of gene-expression based models built in an intra- or interspecies manner to predict chemosensitivity and treatment outcome in canine OS. Models were built and evaluated using microarray gene expression and drug sensitivity data from human and canine cancer cell lines, and canine OS tumor datasets. The "COXEN" method was utilized to filter gene signatures between human and dog datasets based on strong co-expression patterns. Models were built using linear discriminant analysis via the misclassification penalized posterior algorithm. The best doxorubicin model involved genes identified in human lines that were co-expressed and trained on canine OS tumor data, which accurately predicted clinical outcome in 73 % of dogs (p = 0.0262, binomial). The best carboplatin model utilized canine lines for gene identification and model training, with canine OS tumor data for co-expression. Dogs whose treatment matched our predictions had significantly better clinical outcomes than those that didn't (p = 0.0006, Log Rank), and this predictor significantly associated with longer disease free intervals in a Cox multivariate analysis (hazard ratio = 0.3102, p = 0.0124). Our data show that intra- and interspecies gene expression models can successfully predict response in canine OS, which may improve outcome in dogs and serve as pre-clinical validation for similar methods in human cancer research.
Functional Characterization of Canine Interferon-Lambda
Fan, Wenhui; Xu, Lei; Ren, Liqian; Qu, Hongren; Li, Jing; Liang, Jingjing; Liu, Wenjun
2014-01-01
In this study, we provide the first comprehensive annotation of canine interferon-λ (CaIFN-λ, type III IFN). Phylogenetic analysis based on genomic sequences indicated that CaIFN-λ is located in the same branch with Swine IFN-λ1 (SwIFN-λ), Bat IFN-λ1 (BaIFN-λ), and human IFN-λ1 (HuIFN-λ1). CaIFN-λ was cloned, expressed in Escherichia coli, and purified to further investigate the biological activity in vitro. The recombinant CaIFN-λ (rCaIFN-λ) displayed potent antiviral activity on both homologous and heterologous animal cells in terms of inhibiting the replication of the New Jersey serotype of vesicular stomatitis virus (VSV), canine parvovirus, and influenza virus A/WSN/33 (H1N1), respectively. In addition, we also found that rCaIFN-λ exhibits a significant antiproliferative response against A72 canine tumor cells and MDCK cells in a dose-dependent manner. Furthermore, CaIFN-λ activated the JAK-STAT signaling pathway. To evaluate the expression of CaIFN-λ induced by virus and the expression of IFN-stimulated genes (ISGs) induced by rCaIFN-λ in the MDCK cells, we measured the relative mRNA level of CaIFN-λ and ISGs (ISG15, Mx1, and 2′5′-OAS) by quantitative real-time PCR and found that the mRNA level of CaIFN-λ and the ISGs significantly increased after treating the MDCK cells with viruses and rCaIFN-λ protein, respectively. Finally, to evaluate the binding activity of rCaIFN-λ to its receptor, we expressed the extracellular domain of the canine IFN-λ receptor 1 (CaIFN-λR1-EC) and determined the binding activity via ELISA. Our results demonstrated that rCaIFN-λ bound tightly to recombinant CaIFN-λR1-EC (rCaIFN-λR1-EC). PMID:24950142
Maxillary canine impactions related to impacted central incisors: two case reports.
Bayram, Mehmet; Ozer, Mete; Sener, Ismail
2007-09-01
The purpose of this case report is to describe the combined surgical and orthodontic treatment of two cases with an impacted maxillary central incisor and canine in the same quadrant and to discuss the causal relationship between them. The most common causes of canine impactions are usually the result of one or more factors such as a long path of eruption, tooth size-arch length discrepancies, abnormal position of the tooth bud, prolonged retention or early loss of the deciduous canine, trauma, the presence of an alveolar cleft, ankylosis, cystic or neoplastic formation, dilaceration of the root, supernumerary teeth, and odontomas. Although impaction of the maxillary central incisor is almost as prevalent as impacted canines its etiology is different. The principal factors involved in causing the anomaly are supernumerary teeth, odontomas, and trauma. Case #1: A 10.5-year-old girl in the early mixed dentition stage presented with a chief complaint of the appearance of her anterior teeth. She had a Class I skeletal pattern and a history of trauma to the maxillary central incisors at age five with premature exfoliation. Radiographs revealed an impacted upper right central incisor in the region of the nasal floor, delayed eruption of the maxillary permanent central incisor, and the adjacent lateral incisor was inclined toward the edentulous space. Treatment was done in two stages consisting of surgical exposure and traction of the impacted central incisor and fixed orthodontic treatment. Case #2: An 11.5-year-old girl presented for orthodontic treatment with the chief complaint of an unerupted tooth and the appearance of her upper anterior teeth. She was in the late mixed dentition period with a Class III skeletal pattern along with an anterior cross-bite with some maxillary transverse deficiency. The maxillary right canine and central incisor were absent, but the maxillary right deciduous canine was still present. Treatment included arch expansion followed by
Orthodontic treatment of a stubborn palatally ectopic canine: a case report.
Al-Musfir, Tumadher M; Morris, David O
2014-03-01
This is a case report that highlights a different treatment approach in dealing with palatally ectopic canines. The modified transpalatal arch with an 'active' arm was used to align a palatally ectopic canine with 'push' mechanics after the initial use of more conventional 'pull' mechanics (piggy-back archwire technique) had failed.
Successful experimental challenge of dogs with canine parvovirus-2.
Carman, S; Povey, C
1982-01-01
Withholding food from dogs for 24 hours prior to, and for 48 hours following oral challenge with a gut mucosal homogenate of canine parvovirus-2, was a successful means of reproducing gastroenteric signs of canine parvovirus-2 infection. Twenty-one of 24 dogs, which had previously received various vaccine preparations of mink enteritis virus or were unvaccinated, and which were starved at challenge, developed soft or liquid feces with large or without large clots of mucus. Altered feces were ...
Adina Coșarcă; Mariana Păcurar; Cecilia Petrovan; Alina Ormenișan
2014-01-01
Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of t...
Bilateral Second Premolars Agenesia Together with a Unilateral Canine Radiculomegaly.
Kemoli, Arthur Musakulu; Junior, Thomas Munyao
2017-01-01
Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
Recent advances in canine leptospirosis: focus on vaccine development
Directory of Open Access Journals (Sweden)
Klaasen HLBM
2015-06-01
Full Text Available Henricus LBM (Eric Klaasen,1 Ben Adler2 1Global Companion Animals Research and Development, Merck Sharp and Dohme Animal Health, Boxmeer, the Netherlands; 2Department of Microbiology, Monash University, Clayton, VIC, Australia Abstract: Leptospirosis is a global infection of humans and animals caused by pathogenic Leptospira spp. Leptospirosis is a major zoonosis, with infection acquired from wild and domestic animals. It is also a significant cause of morbidity, mortality, and economic loss in production and companion animals. Leptospirosis in dogs is prevalent worldwide and as well as a cause of canine disease, it presents a zoonotic risk to human contacts. Canine leptospirosis does not differ greatly from the syndromes seen in other animal species, with hepatic, renal, and pulmonary involvement being the main manifestations. While the pathogenesis of disease is well documented at the whole animal level, the cellular and molecular basis remains obscure. Killed, whole-cell bacterin vaccines are licensed worldwide and have not changed greatly over the past several decades. Vaccine-induced immunity is restricted to serologically related serovars and is generally short-lived, necessitating annual revaccination. The appearance of new serovars as causes of canine leptospirosis requires constant epidemiological surveillance and tailoring of vaccines to cover emerging serovars. At the present time, there is no realistic prospect of alternative, non-bacterin vaccines in the foreseeable future. Keywords: canine leptospirosis, vaccines, diagnosis, epidemiology, pathogenesis
Efficacy of feline anti-parvovirus antibodies in the treatment of canine parvovirus infection.
Gerlach, M; Proksch, A L; Unterer, S; Speck, S; Truyen, U; Hartmann, K
2017-07-01
This prospective, randomised, placebo-controlled, double-blinded study aimed to evaluate efficacy of commercially available feline anti-parvovirus antibodies in dogs with canine parvovirus infection. First, cross-protection of feline panleukopenia virus antibodies against canine parvovirus was evaluated in vitro. In the subsequent prospective clinical trial, 31 dogs with clinical signs of canine parvovirus infection and a positive faecal canine parvovirus polymerase chain reaction were randomly assigned to a group receiving feline panleukopenia virus antibodies (n=15) or placebo (n=16). All dogs received additional routine treatment. Clinical signs, blood parameters, time to clinical recovery and mortality were compared between the groups. Serum antibody titres and quantitative faecal polymerase chain reaction were compared on days 0, 3, 7, and 14. In vitro, canine parvovirus was fully neutralised by feline panleukopenia virus antibodies. There were no detected significant differences in clinical signs, time to clinical recovery, blood parameters, mortality, faecal virus load, or viral shedding between groups. Dogs in the placebo group showed a significant increase of serum antibody titres and a significant decrease of faecal virus load between day 14 and day 0, which was not detectable in dogs treated with feline panleukopenia virus antibodies. No significant beneficial effect of passively transferred feline anti-parvovirus antibodies in the used dosage regimen on the treatment of canine parvovirus infection was demonstrated. © 2017 British Small Animal Veterinary Association.
Impacted canines: Etiology, diagnosis, and orthodontic management
Directory of Open Access Journals (Sweden)
Ranjit Manne
2012-01-01
Full Text Available Impaction of maxillary and mandibular canines is a frequently encountered clinical problem, the treatment of which usually requires an interdisciplinary approach. Surgical exposure of the impacted tooth and the complex orthodontic mechanisms that are applied to align the tooth into the arch may lead to varying amounts of damage to the supporting structures of the tooth, not to mention the long treatment duration and the financial burden to the patient. Hence, it seems worthwhile to focus on the means of early diagnosis and interception of this clinical situation. In the present article, an overview of the incidence and sequelae, as well as the surgical, periodontal, and orthodontic considerations in the management of impacted canines is presented.
Leigh, S R; Jungers, W L
1994-12-01
A recent study suggests that differing populations of woolly spider monkeys exhibit a substantial degree of morphological, cytogenetic, and behavioral variation. We re-evaluate the differences between populations in the degree of canine tooth height sexual dimorphism and in the frequency of thumbs. Statistical analysis of variation in the degree of canine sexual dimorphism between these populations fails to provide strong evidence for subspecific variation: differences in the degree of canine dimorphism cannot be considered statistically significant. Differences between populations in the frequency of thumbs are, however, statistically significant. The lack of clear distinctions between populations in the degree of canine dimorphism complicates assessments of behavioral variation between these populations. We suggest that the level of geographic variation in woolly spider monkey canine dimorphism is not consistent with subspecific status.
Cost-effectiveness of canine vaccination to prevent human rabies in rural Tanzania.
Fitzpatrick, Meagan C; Hampson, Katie; Cleaveland, Sarah; Mzimbiri, Imam; Lankester, Felix; Lembo, Tiziana; Meyers, Lauren A; Paltiel, A David; Galvani, Alison P
2014-01-21
The annual mortality rate of human rabies in rural Africa is 3.6 deaths per 100 000 persons. Rabies can be prevented with prompt postexposure prophylaxis, but this is costly and often inaccessible in rural Africa. Because 99% of human exposures occur through rabid dogs, canine vaccination also prevents transmission of rabies to humans. To evaluate the cost-effectiveness of rabies control through annual canine vaccination campaigns in rural sub-Saharan Africa. We model transmission dynamics in dogs and wildlife and assess empirical uncertainty in the biological variables to make probability-based evaluations of cost-effectiveness. Epidemiologic variables from a contact-tracing study and literature and cost data from ongoing vaccination campaigns. Two districts of rural Tanzania: Ngorongoro and Serengeti. 10 years. Health policymaker. Vaccination coverage ranging from 0% to 95% in increments of 5%. Life-years for health outcomes and 2010 U.S. dollars for economic outcomes. Annual canine vaccination campaigns were very cost-effective in both districts compared with no canine vaccination. In Serengeti, annual campaigns with as much as 70% coverage were cost-saving. Across a wide range of variable assumptions and levels of societal willingness to pay for life-years, the optimal vaccination coverage for Serengeti was 70%. In Ngorongoro, although optimal coverage depended on willingness to pay, vaccination campaigns were always cost-effective and lifesaving and therefore preferred. Canine vaccination was very cost-effective in both districts, but there was greater uncertainty about the optimal coverage in Ngorongoro. Annual canine rabies vaccination campaigns conferred extraordinary value and dramatically reduced the health burden of rabies. National Institutes of Health.
Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas
2014-09-09
Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.
Identification and function analysis of canine stimulator of interferon gene (STING).
Zhang, Yuxiang; Zhu, Mengyan; Li, Gairu; Liu, Jie; Zhai, Xiaofeng; Wang, Ruyi; Zhang, Junyan; Xing, Gang; Gu, Jinyan; Yan, Liping; Lei, Jing; Sun, Haifeng; Shi, Zhiyu; Liu, Fei; Hu, Boli; Su, Shuo; Zhou, Jiyong
2017-12-01
Stimulator of interferon gene (STING) plays an important role in the cyclic GMP-AMP synthase (cGAS)-mediated activation of type I IFN responses. In this study, we identified and cloned canine STING gene. Full-length STING encodes a 375 amino acid product that shares the highest similarity with feline STING. Highest levels of mRNA of canine STING were detected in the spleen and lungs while the lowest levels in the heart and muscle. Analysis of its cellular localization showed that STING is localizes to the endoplasmic reticulum. STING overexpression induced the IFN response via the IRF3 and NF-κB pathways and up-regulated the expression of ISG15 and viperin. However, knockdown of STING did not inhibit the IFN-β response triggered by poly(dA:dT), poly(I:C), or SeV. Finally, overexpression of STING significantly inhibited the replication of canine influenza virus H3N2. Collectively, our findings indicate that STING is involved in the regulation of the IFN-β pathway in canine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Mandibular Canine Dimorphism in Establishing Sex Identity in the Lebanese Population
Directory of Open Access Journals (Sweden)
Fouad Ayoub
2014-01-01
Full Text Available Background and Objective. In forensic investigations, mandibular canines provide excellent materials to identify gender since they are more likely to survive disasters. The objective of this study was to investigate gender dimorphism by comparing the mesiodistal width of mandibular permanent canines and intercanine distance in a group of Lebanese population. Methods. Participants consisted of undergraduate students from the School of Dentistry, Lebanese University, for two academic years who fulfilled the inclusion criteria. Canine widths and intercanine distance were measured by one operator directly on dental casts using a digital caliper. Results. One hundred thirty-three Lebanese dental students (54 males and 69 females aged 18–25 were included in the study. The intercanine distance was significantly greater in males (P value 0.05 and females (P value > 0.05. The mean width of canine was greater than 7.188 mm for males. Conclusion. The parameters measured in the present study are of great help in sex identification in forensic investigations in the Lebanese adult population.
Increasing Incidence of Canine Leptospirosis in Switzerland
Directory of Open Access Journals (Sweden)
Andrea Major
2014-07-01
Full Text Available A marked increase in canine leptospirosis was observed in Switzerland over 10 years with a peak incidence of 28.1 diagnosed cases/100,000 dogs/year in the most affected canton. With 95% affected dogs living at altitudes <800 m, the disease presented a seasonal pattern associated with temperature (r2 0.73 and rainfall (r2 0.39, >90% cases being diagnosed between May and October. The increasing yearly incidence however was only weakly correlated with climatic data including number of summer (r2 0.25 or rainy days (r2 0.38. Serovars Australis and Bratislava showed the highest seropositivity rates with 70.5% and 69.1%, respectively. Main clinical manifestations included renal (99.6%, pulmonary (76.7%, hepatic (26.0%, and hemorrhagic syndromes (18.2%, leading to a high mortality rate (43.3%. Similar to the human disease, liver involvement had the strongest association with negative outcome (OR 16.3. Based on these data, canine leptospirosis presents similar features and severity as the human infection for which it therefore can be considered a model. Its re-emergence in a temperate country with very high incidence rates in canines should thus be viewed as a warning and emphasize the need for increased awareness in other species.
Directory of Open Access Journals (Sweden)
Jennifer Ann Foltz
2016-11-01
Full Text Available Canines spontaneously develop many cancers similar to humans - including osteosarcoma, leukemia, and lymphoma - offering the opportunity to study immune therapies in a genetically heterogeneous and immunocompetent environment. However, a lack of antibodies recognizing canine NK cell markers has resulted in suboptimal characterization and unknown purity of NK cell products, hindering the development of canine models of NK cell adoptive immunotherapy. To this end, we generated a novel antibody to canine NCR1 (NKp46, the putative species-wide marker of NK cells, enabling purification of NK cells for further characterization. We demonstrate that CD3-/NKp46+ cells in healthy and osteosarcoma-bearing canines have phenotypic similarity to human CD3-/NKp46+ NK cells, expressing mRNA for CD16 and the natural cytotoxicity receptors NKp30, NKp44, and NKp80. Functionally, we demonstrate with the calcein release assay that canine CD3-/NKp46+ cells kill canine tumor cell lines without prior sensitization and secrete IFN-γ, TNF-α, IL-8, IL-10, and GM-CSF as measured by Luminex. Like human NK cells, CD3-/NKp46+ cells expand rapidly on feeder cells expressing 4-1BBL and membrane-bound IL-21 (median= 20,283-fold in 21 days. Further, we identify a minor Null population (CD3-/CD21-/CD14-/NKp46- with reduced cytotoxicity against osteosarcoma cells, but similar cytokine secretion as CD3-/NKp46+ cells. Null cells in canines and humans have reduced expression of NKG2D, NKp44, and CD16 compared to NKp46+ NK cells, and can be induced to express NKp46 with further expansion on feeder cells. In conclusion, we have identified and characterized canine NK cells, including an NKp46- subset of canine and human NK cells, using a novel anti-canine NKp46 antibody, and report robust ex vivo expansion of canine NK cells sufficient for adoptive immunotherapy.
Sequence-independent VIDISCA-454 technique to discover new viruses in canine livers
van der Heijden, Mitzi; de Vries, Michel; van Steenbeek, Frank G.; Favier, Robert P.; Deijs, Martin; Brinkhof, Bas; Rothuizen, Jan; van der Hoek, Lia; Penning, Louis C.
2012-01-01
In many mammals, viruses cause hepatitis. Despite many efforts a specific virus responsible for canine idiopathic hepatitis has not been identified. The discovery of a viral etiology in canine hepatitis will promote the development of specific drugs and vaccines for the treatment of idiopathic
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Directory of Open Access Journals (Sweden)
Kimon C. Kanelakis
2009-01-01
Full Text Available The heme-regulated inhibitor (HRI negatively regulates protein synthesis by phosphorylating eukaryotic initiation factor-2α (eIF2α thereby inhibiting protein translation. The importance of HRI in regulating hemoglobin synthesis in erythroid cells makes it an attractive molecular target in need of further characterization. In this work, we have cloned and expressed the canine form of the HRI kinase. The canine nucleotide sequence has 86%, 82%, and 81% identity to the human, mouse, and rat HRI, respectively. It was noted that an isoleucine residue in the ATP binding site of human, rat, and mouse HRI is replaced by a valine in the canine kinase. The expression of canine HRI protein by in vitro translation using wheat germ lysate or in Sf9 cells using a baculovirus expression system was increased by the addition of hemin. Following purification, the canine protein was found to be 72 kD and showed kinase activity determined by its ability to phosphorylate a synthetic peptide substrate. Quercetin, a kinase inhibitor known to inhibit mouse and human HRI, inhibits canine HRI in a concentration-dependent manner. Additionally, quercetin is able to increase de novo protein synthesis in canine reticulocytes. We conclude that the canine is a suitable model species for studying the role of HRI in erythropoiesis.
Hassan, Siba E; Hajeer, Mohammad Y; Alali, Osama H; Kaddah, Ayham S
2016-06-01
The results of previous studies about the efficacy of using self-ligating brackets (SLBs) in controlling canine movement during retraction are not in harmony. Therefore, the current study aimed to compare the effects of using new passive SLBs on maxillary canine retraction with sliding mechanics vs conventional ligating brackets (CLBs) tied with metal ligatures. The sample comprised 15 adult patients (4 males, 11 females; 18-24 years) requiring bilateral extraction of maxillary first premolars. Units of randomization are the left or right maxillary canines within the same patient. The two maxillary canines in each patient were randomly assigned to one of the two groups in a simple split-mouth design. The canines in the SLBs group (n = 15) were bracketed with SLBs (Damon Q™), while the canines in the CLBs group (n = 15) were bracketed with conventional brackets (Mini Master Series). Transpalatal bars were used for anchorage. After leveling and alignment, 0.019 × 0.025" stainless steel working archwires were placed. Canines were retracted using a nickel-titanium close-coil springs with a 150 gm force. The amount and rate of maxillary canine retraction, canine rotation, and loss of anchorage were measured on study models collected at the beginning of canine retraction (T0) and 12 weeks later (T1). Differences were analyzed using paired-samples t-tests. The effect differences were statistically significant (p brackets gave better results compared to the CLBs in terms of rate of movement, amount of canine rotation following extraction, and anchorage loss.
Canine osteosarcoma cells exhibit resistance to aurora kinase inhibitors.
Cannon, C M; Pozniak, J; Scott, M C; Ito, D; Gorden, B H; Graef, A J; Modiano, J F
2015-03-01
We evaluated the effect of Aurora kinase inhibitors AZD1152 and VX680 on canine osteosarcoma cells. Cytotoxicity was seen in all four cell lines; however, half-maximal inhibitory concentrations were significantly higher than in human leukaemia and canine lymphoma cells. AZD1152 reduced Aurora kinase B phosphorylation, indicating resistance was not because of failure of target recognition. Efflux mediated by ABCB1 and ABCG2 transporters is one known mechanism of resistance against these drugs and verapamil enhanced AZD1152-induced apoptosis; however, these transporters were only expressed by a small percentage of cells in each line and the effects of verapamil were modest, suggesting other mechanisms contribute to resistance. Our results indicate that canine osteosarcoma cells are resistant to Aurora kinase inhibitors and suggest that these compounds are unlikely to be useful as single agents for this disease. Further investigation of these resistance mechanisms and the potential utility of Aurora kinase inhibitors in multi-agent protocols is warranted. © 2013 Blackwell Publishing Ltd.
An RCT on treatment of palatally displaced canines with RME and/or a transpalatal arch.
Baccetti, Tiziano; Sigler, Lauren M; McNamara, James A
2011-12-01
To investigate the effect of rapid maxillary expansion (RME) and/or transpalatal arch (TPA) therapy in combination with deciduous canine extraction on the eruption of palatally displaced canines (PDCs). Hundred and twenty subjects were enrolled in an RCT based on PDCs diagnosed on panoramic radiographs and they were randomly assigned to one of four study groups. Three treatment groups (TGs) (RME followed by TPA therapy plus extraction of deciduous canines, RME/TPA/EC group, 40 subjects; TPA therapy plus extraction of deciduous canines, TPA/EC group, 25 subjects; extraction of deciduous canines, EC group, 25 subjects) were analyzed. A control group (CG, 30 subjects) received no orthodontic treatment. Prevalence rates of eruption of PDCs in the three TGs were compared with the CG at T2. Predictive features at T1 for successful canine eruption were tested in the three TGs. The prevalence of canine eruption was 80 per cent for the RME/TPA/EC group, 79 per cent for the TPA/EC group, 62.5 per cent for the EC group, versus 28 per cent in the CG, with statistically significant differences between all the groups, with the exception of the comparison between RME/TPA/EC and TPA/EC. Predictive pretreatment variables for the success of treatment were less severe sectors of canine displacement, prepubertal stages of skeletal maturity, and an open root apex of PDCs. The use of a TPA in absence of RME can be equally effective than the RME/TPA combination in PDC cases not requiring maxillary expansion, thus reducing the burden of treatment for the patient.
Bilateral second premolars agenesia together with a unilateral canine radiculomegaly
Directory of Open Access Journals (Sweden)
Arthur Musakulu Kemoli
2017-01-01
Full Text Available Congenitally missing teeth is a common feature for the third molars. However, missing teeth, macrodontia and radiculomegaly occurring in a single patient is very rare. This article describes a case of agenesis of mandibular second premolars, radiculomegaly with dilacerations of a canine tooth together with elongated roots of other canines. All these features had been discerned through diagnostic radiographs taken during a routine treatment planning.
In vitro development of canine somatic cell nuclear transfer embryos in different culture media.
Kim, Dong-Hoon; No, Jin-Gu; Choi, Mi-Kyung; Yeom, Dong-Hyeon; Kim, Dong-Kyo; Yang, Byoung-Chul; Yoo, Jae Gyu; Kim, Min Kyu; Kim, Hong-Tea
2015-01-01
The objective of the present study was to investigate the effects of three different culture media on the development of canine somatic cell nuclear transfer (SCNT) embryos. Canine cloned embryos were cultured in modified synthetic oviductal fluid (mSOF), porcine zygote medium-3 (PZM-3), or G1/G2 sequential media. Our results showed that the G1/G2 media yielded significantly higher morula and blastocyst development in canine SCNT embryos (26.1% and 7.8%, respectively) compared to PZM-3 (8.5% and 0%or mSOF (2.3% and 0%) media. In conclusion, this study suggests that blastocysts can be produced more efficiently using G1/G2 media to culture canine SCNT embryos.
Directory of Open Access Journals (Sweden)
Deli Liu
2015-06-01
Full Text Available Spontaneous canine head and neck squamous cell carcinoma (HNSCC represents an excellent model of human HNSCC but is greatly understudied. To better understand and utilize this valuable resource, we performed a pilot study that represents its first genome-wide characterization by investigating 12 canine HNSCC cases, of which 9 are oral, via high density array comparative genomic hybridization and RNA-seq. The analyses reveal that these canine cancers recapitulate many molecular features of human HNSCC. These include analogous genomic copy number abnormality landscapes and sequence mutation patterns, recurrent alteration of known HNSCC genes and pathways (e.g., cell cycle, PI3K/AKT signaling, and comparably extensive heterogeneity. Amplification or overexpression of protein kinase genes, matrix metalloproteinase genes, and epithelial-mesenchymal transition genes TWIST1 and SNAI1 are also prominent in these canine tumors. This pilot study, along with a rapidly growing body of literature on canine cancer, reemphasizes the potential value of spontaneous canine cancers in HNSCC basic and translational research.
Surgical Removal of a Canine Aortic Thromboembolism Secondary to Pancreatitis
Directory of Open Access Journals (Sweden)
Jill Narak
2015-01-01
Full Text Available A 7-year-old castrated male Pomeranian was evaluated on emergency for diagnostic work-up and treatment for acute nonpainful paraparesis. The neurologic examination suggested a L4-S3 myelopathy, but physical examination revealed lack of femoral pulses and rectal hypothermia, as well as a grade II/VI systolic heart murmur, so ischemic neuromyopathy was suspected. Clinicopathologic analysis revealed increased muscle enzymes and proteinuria. Abdominal ultrasonography confirmed aortic thromboembolism (ATE, and surgical histopathology diagnosed necrotizing pancreatitis. Surgical aortic thrombectomy was performed, and antithrombotic therapy was instituted. Pancreatitis was treated supportively. The dog was discharged to the owners after 10 days of hospitalization. Recheck examination 6 weeks after initial presentation revealed a normal neurologic examination and normal femoral pulses. The patient has had no further bouts of pancreatitis and remains neurologically normal 5 years after initial presentation. Canine ATE is relatively rare compared to the feline counterpart. Directed therapy for feline ATE is often not recommended, as underlying conditions are oftentimes ultimately fatal. Underlying etiologies for canine ATE include cardiovascular disease and endocrinopathies, but canine ATE secondary to pancreatitis has not yet been reported. Surgical removal of aortic thromboembolus should be considered as curative for pelvic limb dysfunction in the canine patient without a terminal underlying disease.
Kobayashi, Tetsuro; Fujisawa, Akiko; Amagai, Masayuki; Iwasaki, Toshiroh; Ohyama, Manabu
2011-10-01
The dermal papilla (DP) plays pivotal roles in hair follicle morphogenesis and cycling. However, our understanding of the biology of the canine DP is extremely limited. The aim of this study was to elucidate molecular biological and immunohistochemical characteristics of canine DP cells and determine appropriate conditions for in vitro expansion. Histological investigation revealed that the canine DP expressed biomarkers of human and rodent DP, including alkaline phosphatase (ALP) and versican. When microdissected, canine DP, but not fibroblasts, strongly expressed the DP-related genes for alkaline phosphatase, Wnt inhibitory factor 1 and lymphoid enhancer-binding factor 1, confirming successful isolation. The growth rate of isolated canine DP cells was moderate in conventional culture conditions for rodent and human DP; however, AmnioMAX-C100 complete medium allowed more efficient cultivation. Dermal papilla marker gene expression was maintained in early passage cultured DP cells, but gradually lost after the third passage. Approaches to mimic the in vivo DP environment in culture, such as supplementation of keratinocyte-conditioned medium or use of extracellular matrix-coated dishes, moderately ameliorated loss of DP gene expression in canine DP cells. It is possible that constituent factors in AmnioMAX may influence culture. These findings suggested that further refinements of culture conditions may enable DP cell expansion without impairing intrinsic properties and, importantly, demonstrated that AmnioMAX-cultured early passage canine DP cells partly maintained the biological characteristics of in vivo canine DP cells. This study provides crucial information necessary for further optimization of culture conditions of canine DP. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.
Collett, A R; Fletcher, B
2000-12-01
A case report is detailed in which autotransplanted maxillary canines were removed and the spaces closed. Substantial surrounding bone loss was associated with the upper right canine, and a bone graft was needed to reestablish normal dentoalveolar ridge morphology. Bone was taken from the maxillary tuberosity and placed in the canine extraction site, fixed with a bone screw, and covered with GoreTex. Seven months after placement of the bone graft, the GoreTex and stabilizing screw were removed to allow for consolidation of the bone. The upper left canine and lower second premolars were extracted, and fixed appliances were placed in both arches to align the teeth and close the spaces. Protraction of the upper right first premolar and retraction of the lateral incisor into the graft site were kept slow and constant with continued periodontal assessment. During the space closure, there was some concern that the bone in the graft site might resorb, leaving the teeth with compromised periodontal support. However, no significant periodontal attachment loss occurred despite ongoing concern about the amount of keratinized tissue. Perhaps the relatively slow rate of tooth movement provided for bone to be maintained and recreated ahead of the tooth. Almost complete closure of the upper canine extraction spaces was achieved. The upper premolars were substituted for the maxillary canines, and unfavorable prosthetic options were thus avoided. The lower arch was aligned, and the extraction spaces completely closed.
Antibacterial, antifungal, and antiviral activities of some flavonoids.
Orhan, Didem Deliorman; Ozçelik, Berrin; Ozgen, Selda; Ergun, Fatma
2010-08-20
Antibacterial and antifungal activities of six plant-derived flavonoids representing two different structural groups were evaluated against standard strains of Escherichia coli, Pseudomonas aeruginosa, Proteus mirabilis, Klebsiella pneumoniae, Acinetobacter baumannii, Staphylococcus aureus, Enterococcus faecalis, Bacillus subtilis and their drug-resistant isolates, as well as fungi (Candida albicans, C. krusei) using the microdilution broth method. Herpes simplex virus Type-1 and Parainfluenza-3 virus were employed for antiviral assessment of the flavonoids using Madin-Darby bovine kidney and Vero cell lines. Ampicillin, gentamycin, ofloxacin, levofloxacin, fluconazole, ketoconazole, acyclovir, and oseltamivir were used as the control agents. All tested compounds (32-128 microg/ml) showed strong antimicrobial and antifungal activities against isolated strains of P. aeruginosa, A. baumanni, S. aureus, and C. krusei. Rutin, 5,7-dimethoxyflavanone-4'-O-beta-D-glucopyranoside and 5,7,3'-trihydroxy-flavanone-4'-O-beta-D-glucopyranoside (0.2-0.05 microg/ml) were active against PI-3, while 5,7-dimethoxyflavanone-4'-O-[2''-O-(5'''-O-trans-cinnamoyl)-beta-D-apiofuranosyl]-beta-D-glucopyranoside (0.16-0.2 microg/ml) inhibited potently HSV-1. Copyright 2009 Elsevier GmbH. All rights reserved.
"Fooling fido"--chemical and behavioral studies of pseudo-explosive canine training aids.
Kranz, William D; Strange, Nicholas A; Goodpaster, John V
2014-12-01
Genuine explosive materials are traditionally employed in the training and testing of explosive-detecting canines so that they will respond reliably to these substances. However, challenges arising from the acquisition, storage, handling, and transportation of explosives have given rise to the development of "pseudo-explosive" training aids. These products attempt to emulate the odor of real explosives while remaining inert. Therefore, a canine trained on a pseudo-explosive should respond to its real-life analog. Similarly, a canine trained on an actual explosive should respond to the pseudo-explosive as if it was real. This research tested those assumptions with a focus on three explosives: single-base smokeless powder, 2,4,6-trinitrotoluene (TNT), and a RDX-based plastic explosive (Composition C-4). Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we determined that the volatile compounds given off by pseudo-explosive products consisted of various solvents, known additives from explosive formulations, and common impurities present in authentic explosives. For example, simulated smokeless powders emitted terpenes, 2,4-dinitrotoluene, diphenylamine, and ethyl centralite. Simulated TNT products emitted 2,4- and 2,6-dinitrotoluene. Simulated C-4 products emitted cyclohexanone, 2-ethyl-1-hexanol, and dimethyldinitrobutane. We also conducted tests to determine whether canines trained on pseudo-explosives are capable of alerting to genuine explosives and vice versa. The results show that canines trained on pseudo-explosives performed poorly at detecting all but the pseudo-explosives they are trained on. Similarly, canines trained on actual explosives performed poorly at detecting all but the actual explosives on which they were trained.
Morphological study of maxillary canine region based on CT
International Nuclear Information System (INIS)
Yamada, Maiko; Takamori, Hitoshi; Ide, Yoshiaki; Yosue, Takashi
2010-01-01
The maxilla is generally known as a site where anatomical limitations make it difficult to obtain sufficient bone volume. A large amount of bone exists in the canine region between the anterior margin of the maxillary sinus and the piriform aperture margin. Although this region is crucial for implant treatments, there have not been any reports on morphological studies of the region. In this study, we investigated the morphology of the canine region based on CT, and also the morphology and position of the maxillary sinus located posterior to the canine region. The results were as follows: In the area above the anterior nasal spine, the higher the level, the smaller the mesio-distal length and the bucco-lingual width tended to become. In the area above the anterior nasal spine, the mesio-distal length and the bucco-lingual width tended to be smaller in female patients than in male patients. In the area above the anterior nasal spine, no significant differences in mesio-distal length and bucco-lingual width were observed between dentulous and edentulous jaws. The morphology of the maxillary sinus was mainly of an inverse-trapezoidal, circular, or triangular form. The position of the anterior wall of the maxillary sinus was most frequently found at the site corresponding to the second premolar. Through this study, we have reconfirmed that the canine region is vital for implant treatments in the maxilla. (author)
Pathophysiology, diagnosis, and treatment of canine hip dysplasia
International Nuclear Information System (INIS)
Cook, J.L.; Tomlinson, J.L.; Constantinescu, G.M.
1996-01-01
Dogs with hip dysplasia are commonly presented to veterinarians for evaluation. Although many causes of the condition have been proposed, a definitive cause has not been established. The multifactorial nature of canine hip dysplasia can confuse client education and management ofthe disease. The basic concept involved is the biomechanical imbalance between the forces on the coxofemoral joint and the associated muscle mass; the result is joint laxity in young, growing dogs. This laxity leads to incongruity; the eventual result is degenerative joint disease. Canine hip dysplasia can affect any breed but is most often reported in large and giant breeds. Understanding the pathophysiology and biomechanics involved with this developmental disease is important in providing clients with diagnostic, therapeutic, and prognostic information. The selection of treatment is influenced by the following factors:the age, health, and intended use of the patient; clinical signs; diagnostic findings; the availability of treatment; and the financial constraints of the owner. This article discusses the current concepts concerning the pathophysiology and biomechanics of canine hip dysplasia and outlines diagnostic and therapeutic options. The objective of the article is to provide practitioners with a reference for decision making and client education
Does contemporary canine diet cause cancer? ; A review
Directory of Open Access Journals (Sweden)
Joseph B Gentzel
2013-07-01
Full Text Available Recent discoveries have discerned the presence of advanced glycation end products (AGEs and their impact on chronic diseases that include cancer in dogs. AGEs are closely allied with chronic systemic inflammation (metaflammation. These two occurrences are observed in many cancers in both humans and dogs. AGEs are exogenous and endogenous. Exogenous AGEs occur from, among other causes, ingestion of food that is affected by the Maillard reaction in its preparation. The result is an accumulation of AGEs and progressive metaflammation that is linked with many cancers in both humans and dogs. Aspects of AGE ingestion and formation are reviewed in association with the contemporary canine diet that is primarily a kibbled meal based diet. Anovel canine diet paradigm is offered as one that diminishes the AGE/ metaflammation axis. This is proposed to be less carcinogenic than the current canine diet in use by much of the civilized world. The proposed paradigm is a unique approach that offers opportunities to be tested for AGE and metaflammation accumulation that results in diminished prevalence and incidence of cancer in dogs. The paradigm diet is suggested as a prevention, treatment, and recovery aide from cancer
Almuhtaseb, Eyad; Mao, Jing; Mahony, Derek; Bader, Rawan; Zhang, Zhi-xing
2014-06-01
The purpose of this study was to develop a new way to localize the impacted canines from three dimensions and to investigate the root resorption of the adjacent teeth by using cone beam computed tomography (CBCT). Forty-six patients undergoing orthodontic treatments and having impacted canines in Tongji Hospital were examined. The images of CBCT scans were obtained from KaVo 3D exam vision. Angular and linear measurements of the cusp tip and root apex according to the three planes (mid-sagittal, occlusal and frontal) have been taken using the cephalometric tool of the InVivo Dental Anatomage Version 5.1.10. The measurements of the angular and linear coordinates of the maxillary and mandibular canines were obtained. Using this technique the operators could envision the location of the impacted canine according to the three clinical planes. Adjacent teeth root resorption of 28.26 % was in the upper lateral incisors while 17.39% in upper central incisors, but no lower root resorption was found in our samples. Accurate and reliable localization of the impacted canines could be obtained from the novel analysis system, which offers a better surgical and orthodontic treatment for the patients with impacted canines.
Successful management of refractory cases of canine demodicosis with homeopathy medicine Graphitis.
Ranjan, Rakesh; Dua, Kirti; Turkar, Sujata; Singh, Harkirat; Singla, L D
2014-12-01
Canine demodicosis is a refractory skin disease caused by excessive proliferation of mite Demodex canis. Despite availability of several treatment options, the disease poses a great challenge to clinicians for its long term management as some drugs may be ineffective or toxic. Present report describes successful treatment of two refractory cases of canine demodicosis using homeopathy medicine. After oral administration of Graphitis 200 C two drops once daily for 2 months, complete cure from the disease was observed. No adverse health effects of the medication were recorded during the treatment. Thus, it may be concluded that homeopathy medicine may be used safely for long-term management of canine demodicosis.
Canine parvovirus in asymptomatic feline carriers.
Clegg, S R; Coyne, K P; Dawson, S; Spibey, N; Gaskell, R M; Radford, A D
2012-05-25
Canine parvovirus (CPV) and feline panleukopaenia virus (FPLV) are two closely related viruses, which are known to cause severe disease in younger unvaccinated animals. As well as causing disease in their respective hosts, CPV has recently acquired the feline host range, allowing it to infect both cats and dogs. As well as causing disease in dogs, there is evidence that under some circumstances CPV may also cause disease in cats. This study has investigated the prevalence of parvoviruses in the faeces of clinically healthy cats and dogs in two rescue shelters. Canine parvovirus was demonstrated in 32.5% (13/50) of faecal samples in a cross sectional study of 50 cats from a feline only shelter, and 33.9% (61/180) of faecal samples in a longitudinal study of 74 cats at a mixed canine and feline shelter. Virus was isolated in cell cultures of both canine and feline origin from all PCR-positive samples suggesting they contained viable, infectious virus. In contrast to the high CPV prevalence in cats, no FPLV was found, and none of 122 faecal samples from dogs, or 160 samples collected from the kennel environment, tested positive for parvovirus by PCR. Sequence analysis of major capsid VP2 gene from all positive samples, as well as the non-structural gene from 18 randomly selected positive samples, showed that all positive cats were shedding CPV2a or 2b, rather than FPLV. Longitudinally sampling in one shelter showed that all cats appeared to shed the same virus sequence type at each date they were positive (up to six weeks), despite a lack of clinical signs. Fifty percent of the sequences obtained here were shown to be similar to those recently obtained in a study of sick dogs in the UK (Clegg et al., 2011). These results suggest that in some circumstances, clinically normal cats may be able to shed CPV for prolonged periods of time, and raises the possibility that such cats may be important reservoirs for the maintenance of infection in both the cat and the dog
Electroencephalography as a diagnostic technique for canine neurological diseases
Directory of Open Access Journals (Sweden)
Wrzosek Marcin
2016-06-01
Full Text Available Electroencephalography (EEG is a non-invasive examination method for the assessment of functional central nervous system (CNS disturbances. In human medicine it has a special importance as a diagnostic tool for epilepsy. Although many studies were done on the use of EEG for diagnostics of canine central nervous system disorders, the technique is still not applied routinely. The purpose of this paper was to review the use of the electroencephalography in canine neurological disorders of central nervous system diagnosis and assess the future perspectives of this technique in veterinary medicine.
Canine distemper virus detection in asymptomatic and non vaccinated dogs
Directory of Open Access Journals (Sweden)
Helen L. Del Puerto
2010-02-01
Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom
Experimental study of pulmonary thromboembolism ischemia-reperfusion injury in canine model
International Nuclear Information System (INIS)
Li Jianjun; Zhai Renyou; Zhang Dongpo; Huang Qiang; Yu Ping; Dai Dingke; Bao Na
2009-01-01
Objective: To establish a canine model of pulmonary thromboembolism ischemia- reperfusion injury (PTE IRI) that may be used for imaging study. Methods: Ten male and 10 female healthy mongrel canines with (18.6±0.8) kg/body weight, were used. A Swan-Ganz catheter was introduced into the right internal jugular vein via a preset percutaneous sheath using the Seldinger technique, and then was with further insertion the pulmonary artery. Balloon occlusion of the right inferior lobe pulmonary artery for 4 hours was followed by removing the catheter and ending with 4 hours of reperfusion. CT was performed before ischemia, 4 h after ischemia and 4 h after reperfusion. At last, dogs were killed and the bilateral inferior lung tissues were prepared for the examination by light and electronic microscopy. Results: All canine models were successfully developed pulmonary thromboembolism ischemia-reperfusion injury. The examination of CT, light and electron microscopy consistently indicated the presence of permeability pulmonary edema after reperfusion. Conclusions: A closed-chest canine model in vivo of pulmonary thromboembolism ischemia-reperfusion injury can be established with virtual pathophysiological process in human and be as well as for imaging experimental study. (authors)
A survey of canine tick-borne diseases in India
Directory of Open Access Journals (Sweden)
Coleman Glen T
2011-07-01
Full Text Available Abstract Background There are few published reports on canine Babesia, Ehrlichia, Anaplasma, Hepatozoon and haemotropic Mycoplasma infections in India and most describe clinical disease in individual dogs, diagnosed by morphological observation of the microorganisms in stained blood smears. This study investigated the occurrence and distribution of canine tick-borne disease (TBD pathogens using a combination of conventional and molecular diagnostic techniques in four cities in India. Results On microscopy examination, only Hepatozoon gamonts were observed in twelve out of 525 (2.3%; 95% CI: 1.2, 4 blood smears. Using polymerase chain reaction (PCR, a total of 261 from 525 dogs (49.7%; 95% CI: 45.4, 54.1 in this study were infected with one or more canine tick-borne pathogen. Hepatozoon canis (30%; 95% CI: 26.0, 34.0 was the most common TBD pathogen found infecting dogs in India followed by Ehrlichia canis (20.6%; 95% CI: 17.2, 24.3, Mycoplasma haemocanis (12.2%; 95% CI: 9.5, 15.3, Anaplasma platys (6.5%; 95% CI: 4.5, 8.9, Babesia vogeli (5.5%, 95% CI: 3.7, 7.8 and Babesia gibsoni (0.2%, 95% CI: 0.01, 1.06. Concurrent infection with more than one TBD pathogen occurred in 39% of cases. Potential tick vectors, Rhipicephalus (most commonly and/or Haemaphysalis ticks were found on 278 (53% of dogs examined. Conclusions At least 6 species of canine tick-borne pathogens are present in India. Hepatozoon canis was the most common pathogen and ticks belonging to the genus Rhipicephalus were encountered most frequently. Polymerase chain reaction was more sensitive in detecting circulating pathogens compared with peripheral blood smear examination. As co-infections with canine TBD pathogens were common, Indian veterinary practitioners should be cognisant that the discovery of one such pathogen raises the potential for multiple infections which may warrant different clinical management strategies.
New hominin fossils from Kanapoi, Kenya, and the mosaic evolution of canine teeth in early hominins
Directory of Open Access Journals (Sweden)
J. Michael Plavcan
2012-03-01
Full Text Available Whilst reduced size, altered shape and diminished sexual dimorphism of the canine–premolar complex are diagnostic features of the hominin clade, little is known about the rate and timing of changes in canine size and shape in early hominins. The earliest Australopithecus, Australopithecus anamensis, had canine crowns similar in size to those of its descendant Australopithecus afarensis, but a single large root alveolus has suggested that this species may have had larger and more dimorphic canines than previously recognised. Here we present three new associated dentitions attributed to A. anamensis, recently recovered from the type site of Kanapoi, Kenya, that provide evidence of canine evolution in early Australopithecus. These fossils include the largest mandibular canine root in the hominin fossil record. We demonstrate that, although canine crown height did not differ between these species, A. anamensis had larger and more dimorphic roots, more like those of extant great apes and Ardipithecus ramidus, than those of A. afarensis. The canine and premolar occlusal shapes of A. anamensis also resemble those of Ar. ramidus, and are intermediary between extant great apes and A. afarensis. A. afarensis achieved Homo-like maxillary crown basal proportions without a reduction in crown height. Thus, canine crown size and dimorphism remained stable during the early evolution of Australopithecus, but mandibular root dimensions changed only later within the A. anamensis–afarensis lineage, coincident with morphological changes in the canine–premolar complex. These observations suggest that selection on canine tooth crown height, shape and root dimensions was not coupled in early hominin evolution, and was not part of an integrated adaptive package.
Molecular characterization of the canine HMGB1.
Murua Escobar, H; Meyer, B; Richter, A; Becker, K; Flohr, A M; Bullerdiek, J; Nolte, I
2003-01-01
Due to the close similarities of numerous canine diseases to their human counterparts, the dog could join the mouse as the species of choice to unravel the genetic background of complex diseases as e.g. cancer and metabolic diseases. Accordingly, the role of the dog as a model for therapeutic approaches is strongly increasing. However, prerequisite for such studies is the characterization of the corresponding canine genes. Recently, the human high mobility group protein B1 (HMGB1) has attracted considerable interest of oncologists because of what is called its "double life". Besides its function as an architectural transcription factor HMGB1 can also be secreted by certain cells and then acts as a ligand for the receptor for advanced glycation end products (RAGE). The binding of HMGB1 to RAGE can activate key cell signaling pathways, such as p38(MAPK), JNK, and p42/p44(MAPK) emphasizing the important role of HMGB1 in inflammation and tumor metastasis. These results make HMGB1 a very interesting target for therapeutic studies done in model organisms like the dog. In this study we characterized the molecular structure of the canine HMGB1 gene on genomic and cDNA levels, its predicted protein, the gene locus and a basic expression pattern. Copyright 2003 S. Karger AG, Basel
Milovancev, Milan; Hilgart-Martiszus, Ian; McNamara, Michael J; Goodall, Cheri P; Seguin, Bernard; Bracha, Shay; Wickramasekara, Samanthi I
2013-06-13
Osteosarcoma (OSA) is the most common primary bone tumor of dogs and carries a poor prognosis despite aggressive treatment. An improved understanding of the biology of OSA is critically needed to allow for development of novel diagnostic, prognostic, and therapeutic tools. The surface-exposed proteome (SEP) of a cancerous cell includes a multifarious array of proteins critical to cellular processes such as proliferation, migration, adhesion, and inter-cellular communication. The specific aim of this study was to define a SEP profile of two validated canine OSA cell lines and a normal canine osteoblast cell line utilizing a biotinylation/streptavidin system to selectively label, purify, and identify surface-exposed proteins by mass spectrometry (MS) analysis. Additionally, we sought to validate a subset of our MS-based observations via quantitative real-time PCR, Western blot and semi-quantitative immunocytochemistry. Our hypothesis was that MS would detect differences in the SEP composition between the OSA and the normal osteoblast cells. Shotgun MS identified 133 putative surface proteins when output from all samples were combined, with good consistency between biological replicates. Eleven of the MS-detected proteins underwent analysis of gene expression by PCR, all of which were actively transcribed, but varied in expression level. Western blot of whole cell lysates from all three cell lines was effective for Thrombospondin-1, CYR61 and CD44, and indicated that all three proteins were present in each cell line. Semi-quantitative immunofluorescence indicated that CD44 was expressed at much higher levels on the surface of the OSA than the normal osteoblast cell lines. The results of the present study identified numerous differences, and similarities, in the SEP of canine OSA cell lines and normal canine osteoblasts. The PCR, Western blot, and immunocytochemistry results, for the subset of proteins evaluated, were generally supportive of the mass spectrometry data
Wen, Jiexia; Pan, Sumin; Liang, Shuang; Zhong, Zhenyu; He, Ying; Lin, Hongyu; Li, Wenyan; Wang, Liyue; Li, Xiujin; Zhong, Fei
2013-01-01
Canine parvovirus (CPV) disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR) was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR)) possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo. PMID:24089666
Directory of Open Access Journals (Sweden)
Jiexia Wen
2013-01-01
Full Text Available Canine parvovirus (CPV disease is an acute, highly infectious disease threatening the dog-raising industry. So far there are no effective therapeutic strategies to control this disease. Although the canine transferrin receptor (TfR was identified as a receptor for CPV infection, whether extracellular domain of TfR (called soluble TfR (sTfR possesses anti-CPV activities remains elusive. Here, we used the recombinant sTfR prepared from HEK293T cells with codon-optimized gene structure to investigate its anti-CPV activity both in vitro and in vivo. Our results indicated that codon optimization could significantly improve sTfR expression in HEK293T cells. The prepared recombinant sTfR possessed a binding activity to both CPV and CPV VP2 capsid proteins and significantly inhibited CPV infection of cultured feline F81 cells and decreased the mortality of CPV-infected dogs, which indicates that the sTfR has the anti-CPV activity both in vitro and in vivo.
3D enamel thickness in Neandertal and modern human permanent canines.
Buti, Laura; Le Cabec, Adeline; Panetta, Daniele; Tripodi, Maria; Salvadori, Piero A; Hublin, Jean-Jacques; Feeney, Robin N M; Benazzi, Stefano
2017-12-01
Enamel thickness figures prominently in studies of human evolution, particularly for taxonomy, phylogeny, and paleodietary reconstruction. Attention has focused on molar teeth, through the use of advanced imaging technologies and novel protocols. Despite the important results achieved thus far, further work is needed to investigate all tooth classes. We apply a recent approach developed for anterior teeth to investigate the 3D enamel thickness of Neandertal and modern human (MH) canines. In terms of crown size, the values obtained for both upper and lower unworn/slightly worn canines are significantly greater in Neandertals than in Upper Paleolithic and recent MH. The 3D relative enamel thickness (RET) is significantly lower in Neandertals than in MH. Moreover, differences in 3D RET values between the two groups appear to decrease in worn canines beginning from wear stage 3, suggesting that both the pattern and the stage of wear may have important effects on the 3D RET value. Nevertheless, the 3D average enamel thickness (AET) does not differ between the two groups. In both groups, 3D AET and 3D RET indices are greater in upper canines than in lower canines, and overall the enamel is thicker on the occlusal half of the labial aspect of the crown, particularly in MH. By contrast, the few early modern humans investigated show the highest volumes of enamel while for all other components of 3D enamel, thickness this group holds an intermediate position between Neandertals and recent MH. Overall, our study supports the general findings that Neandertals have relatively thinner enamel than MH (as also observed in molars), indicating that unworn/slightly worn canines can be successfully used to discriminate between the two groups. Further studies, however, are needed to understand whether these differences are functionally related or are the result of pleiotropic or genetic drift effects. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K
2011-04-09
Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.
Gebhard, Christiane; Fuchs-Baumgartinger, Andrea; Razzazi-Fazeli, Ebrahim; Miller, Ingrid; Walter, Ingrid
2016-01-01
Overexpression of matrix metalloproteinases (MMPs) has been associated with increased tumor aggressiveness and metastasis dissemination. We investigated whether the contrasting metastatic behavior of feline and canine osteosarcoma is related to levels and activities of MMP2 and MMP9. Zymography and immunohistochemistry were used to determine expression levels of MMP2 and MMP9 in canine and feline osteosarcoma. Using immunohistochemistry, increased MMP9 levels were identified in most canine os...
Directory of Open Access Journals (Sweden)
I Nyoman Suartha
2008-03-01
Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA.
Folitse, R D; Kodie, D O; Amemor, E; Dei, D; Tasiame, W; Burimuah, V; Emikpe, B O
2018-01-01
Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT ® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α 0.05 . We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection.
DETECTION OF CANINE PARVOVIRUS ANTIGEN IN DOGS IN KUMASI, GHANA
Folitse, R. D; Kodie, D.O; Amemor, E.; Dei, D.; Tasiame, W.; Burimuah, V.; Emikpe, B.O
2018-01-01
Background: Canine Parvovirus (CPV) in dogs has been documented in many countries. However, evidence of the infection is scanty in Ghana. This study was conducted to detect canine parvovirus antigen in dogs presented with diarrhoea to the Government Veterinary Clinic in Kumasi, Ghana. Materials and Methods: Faecal samples from 72 dogs presented with diarrhoea were tested for the presence of canine parvovirus antigen using commercially available rapid test kit (BIT® Rapid Colour Canine Parvovirus Ag Test Kit, BIOINDIST Co. Ltd, Korea) based on the principle of immunochromatography. Influence of breed, sex, age, vaccination history and the nature of diarrhoea were assessed. Data obtained was analysed with SPSS and subjected to the chi-square test. Significance was at α0.05 Results: We found 61.11% tested positive (44/72) for CPV. Based on sex, 61.54% of males (20/33) and 60.61% of females tested positive (24/39). A total of 65.67% of samples from puppies below 6 months were positive. 56.25% of CPV vaccinated dogs and 70.83% of unvaccinated dogs were positive respectively. 69.05% of samples from haemorrhagic diarrhoeic dogs and 50.00% from non-haemorrhagic diarrhoeic dogs were positive of CPV. Conclusion: The study is the first documented evidence of the existence of CPV in Ghana. It also revealed that absence of bloody diarrhoea does not necessarily rule out CPV infection. PMID:29302647
Canine Detection of Illict Drugs: Sensory Apparatus Technology
National Research Council Canada - National Science Library
Morrison, Edward
2000-01-01
This report describes basic anatomical and physiological observations of the peripheral canine olfactory system, provided by means of investigations into its structural and molecular characteristics...
Coryneform bacteria associated with canine otitis externa
DEFF Research Database (Denmark)
Aalbæk, Bent; Bemis, David A.; Schjærff, Mette
2010-01-01
This study aims to investigate the occurrence of coryneform bacteria in canine otitis externa. A combined case series and case-control study was carried out to improve the current knowledge on frequency and clinical significance of coryneform bacteria in samples from canine otitis externa. A total...... of 16 cases of otitis externa with involvement of coryneform bacteria were recorded at two referral veterinary hospitals in Denmark and the US, respectively. Coryneform bacteria were identified by partial 16S rRNA gene sequencing. Corynebacterium auriscanis was the most common coryneform species (10...... cases). Small colony variants of this species were also observed. Other coryneform isolates were identified as Corynebacterium amycolatum (3 cases), Corynebacterium freneyi (2 cases) and an Arcanobacterium-like species (1 case). The coryneform bacteria were in all cases isolated together with other...
Antigenic typing Polish isolates of canine parvovirus
Energy Technology Data Exchange (ETDEWEB)
Mizak, B. [National Veterinary Research Institute, Pulawy (Poland); Plucienniczak, A. [Polish Academy ofd Sciences. Microbiology and Virology Center, Lodz (Poland)
1995-12-31
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs.
Antigenic typing Polish isolates of canine parvovirus
International Nuclear Information System (INIS)
Mizak, B.; Plucienniczak, A.
1995-01-01
Polish strains of canine parvovirus isolated between 1982 and 1993 were examined to determine the extent to which the virus has evolved antigenically and genetically over eleven years. Two CPV isolates obtained in Warsaw in 1982 and Pulawy in 1993, were examined using monoclonal antibody typing, restriction analysis and sequencing VP-2 protein gene. Five other isolates from Warsaw and Pulawy were tested with the panel of monoclonal antibodies specific to CPV-2, CPV-2a and common for canine parvovirus, feline panleukopenia virus and milk enteritis virus. Results of the studies demonstrated that all isolates tested represented CPV-2a antigenic type. Rapid antigenic strain replacement recorded by Parrish and Senda in the U.S.A and Japan was not confirmed in Poland. (author). 30 refs, 2 tabs
Szarmach, I J; Szarmach, J; Waszkiel, D; Paniczko, A
2006-01-01
The aim of the study was to assess the effect of orthodontic movement of the impacted canines after surgical exposure and alignment on the periodontal status of the transpositioned and adjacent teeth as well as to compare certain parameters with those of spontaneously erupted teeth. Twenty-four patients (mean age 18.4 +/- 3.66) with unilaterally impacted 24 canines were enrolled in the study. The following parameters were assessed: pocket depth (PD), clinical attachment level (CAL), platelet index (PI) of Silness and Löe, and modified sulcus bleeding index (SBI). Optic density of the alveolar bone along the root surface of the aligned canine was analysed based on digital radiological images made with the right angle technique. Control group consisted of spontaneously erupted teeth. In comparison to the control group, in the orthodonticaly treated group PD was found to increase on the mesial buccal and palatal surfaces of the first premolar (p aligned canine (p aligned tooth were statistically significant (p alignment zone and the control, and there was no link between the method of treatment and periodontal status, either. The alignment of the impacted permanent maxillary canines poses a risk of periodontal deterioration. Patients subjected to surgical-orthodontic treatment require periodic periodontal follow-ups.
Directory of Open Access Journals (Sweden)
D S Kothavade
2012-01-01
Full Text Available Aim : The purpose of the present study was to establish the relationship between the eruption of permanent maxillary canines and cervical vertebral maturation stages (CVMs to assess an alternative method for determining time of canine eruption in the late mixed dentition. Materials and Methods : One hundred and twenty subjects with erupting permanent maxillary canines were observed both intraorally and radiographically with orthopantamograms. Lateral cephalograms were recorded to divide subjects according to CVM stage into prepeak (CS1 and CS2, peak (CS3 and CS4 and postpeak (CS5 and CS6 groups of puberty. Statistical Analysis : The differences between the prevalence rates of canine eruption in different groups of puberty were estimated using ′z test′. Results : Prepeak group comprised of forty six subjects, peak group sixty eight subjects and postpeak group six subjects. The differences in prevalence rates between peak and prepeak and between peak and postpeak groups were noticed highly significant (p<0.001, while prevalence rates between peak and postpeak was found less significant ( p0 <0.01. Conclusion : Eruption of the permanent maxillary canine can occur at any CVM stage till end of the puberty or after puberty (CS1-CS6. Thus, an absence of maxillary canine during or after postpeak stage of puberty (CS5 or CS6 suggests delayed eruption and canine impaction.
Cathepsin K expression and activity in canine osteosarcoma.
Schmit, J M; Pondenis, H C; Barger, A M; Borst, L B; Garrett, L D; Wypij, J M; Neumann, Z L; Fan, T M
2012-01-01
Cathepsin K (CatK) is a lysosomal protease with collagenolytic activity, and its secretion by osteoclasts is responsible for degrading organic bone matrix. People with pathologic bone resorption have higher circulating CatK concentrations. Canine osteosarcoma (OS) cells will possess CatK, and its secretion will be cytokine inducible. Circulating CatK concentrations will be increased in dogs with OS, and will be a surrogate marker of bone resorption. Fifty-one dogs with appendicular OS and 18 age- and weight-matched healthy control dogs. In a prospective study, expressions of CatK mRNA and protein were investigated in OS cells. The inducible secretion and proteolytic activity of CatK from OS cells was assessed in vitro. Serum CatK concentrations were quantified in normal dogs and dogs with OS and its utility as a bone resorption marker was evaluated in dogs with OS treated with palliative radiation and antiresorptive agents. Canine OS cells contain preformed CatK within cytoplasmic vesicles. In OS cells, TGFβ1 induced the secretion of CatK, which degraded bone-derived type I collagen in vitro. CatK concentrations were higher in dogs with OS than healthy dogs (11.3 ± 5.2 pmol/L versus 8.1 ± 5.0 pmol/L, P = .03). In a subset of dogs with OS, pretreatment CatK concentrations gradually decreased after palliative radiation and antiresorptive treatment, from 9.3 ± 3.2 pmol/L to 5.0 ± 3.1 pmol/L, P = .03. Canine OS is associated with pathologic bone resorption, and CatK inhibitors might aid in the management of canine OS-related malignant osteolysis. Copyright © 2011 by the American College of Veterinary Internal Medicine.
Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa
Directory of Open Access Journals (Sweden)
Nozyechi Ngulube Chidumayo
2018-02-01
Full Text Available Abstract Background Dogs have a close association with humans providing companionship, security and a source of dietary protein. However, dogs are also potential carriers of zoonotic pathogens. Dogs, therefore, pose a public health risk and a good understanding of canine diseases is important for planning and implementing control measures. The aim of this study was to characterise canine helminthiasis in sub-Saharan Africa using a systematic approach. Methods Pubmed and Google Scholar were searched for relevant primary studies published from 2000. Forty-one eligible studies were included in the meta-analysis. Pooled prevalences were estimated using the quality effects model. Results and conclusions Twenty-six genera of enteric helminths were reported and the pooled estimate of canine helminthiasis was 71% (95% CI: 63–79%. Species of Ancylostoma and Toxocara, causative agents of larva migrans in humans, were the most frequently reported helminths with pooled estimated prevalences of 41% (95% CI: 32–50% and 22% (95% CI: 16–29%, respectively. Dipylidium caninum and Taenia spp. were the most frequently reported cestodes with pooled estimated prevalences of 20% (95% CI: 12–29% and 9% (95% CI: 5–15%, respectively. Trematodes were rarely reported. There was a high level of heterogeneity in most pooled estimates (I2 ˃ 80%. The results of this study show that canine helminthiasis is highly prevalent in sub-Saharan Africa and there is need for regular deworming programmes to improve the health status of the dogs and minimise the potential health risk to humans.
Canine trypanosomosis: Clinical observations and morphological ...
African Journals Online (AJOL)
Clinical and pathological aspects of canine trypanosomosis were determined in naturally infected dogs presented to the Veterinary Teaching Hospital, Federal University of Agriculture, Abeokuta, at different times between 2012 and 2013. The breeds, sexes, ages and body weights of the dogs were recorded. Clinical signs ...
The unerupted maxillary canine - a post-surgical review.
LENUS (Irish Health Repository)
O'Dowling, Ian
2009-10-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
The unerupted maxillary canine--a post-surgical review.
O'Dowling, Ian
2009-01-01
The orthodontic records of 685 patients referred for surgical exposure of an unerupted impacted maxillary canine tooth were examined. The condition was more common among females than males, slightly less than 2:1. The impacted teeth had a palatal-labial ratio of 3:1. All of the teeth were exposed using the open surgical technique and in 98% of cases the tooth erupted and was orthodontically aligned. In 2% of cases ankylosis occurred and the teeth were subsequently extracted. The presence of peg-shaped lateral incisors associated with the impacted maxillary canine tooth was 3.4% of the total number of impacted teeth and congenital absence was found in 1.7% of impacted teeth.
Canine distemper spillover in domestic dogs from urban wildlife.
Kapil, Sanjay; Yeary, Teresa J
2011-11-01
Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.
Relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction
Directory of Open Access Journals (Sweden)
Anísio Bueno de Carvalho
2012-12-01
Full Text Available OBJECTIVE: The purpose was to obtain information about the relation between agenesis and shape anomaly of maxillary lateral incisors and canine impaction. METHODS: Seventy-three patients with canine impaction and 73 control patients, without canine impaction, were evaluated. The mesiodistal distances of the maxillary lateral incisors adjacent to the impacted canines and the correspondent mandibular lateral incisors were measured. The adjacent lateral incisors were classified in: 1 - absent, 2 - small, 3 - peg-shaped, 4 - standard. RESULTS: The results showed that among the patients with impacted canines, there were 21 anomalous teeth (small and peg-shaped and among the control patients there were only three small and peg-shaped teeth, with a statistically significant difference (p = 0.001. No patients were found with impacted canines and absent lateral incisors. CONCLUSION: It was concluded that in patients with anomalous lateral incisors (small and peg-shaped there is a probability to present impacted canines and this must be considered.OBJETIVO: o objetivo foi obter informação sobre a relação existente entre a agenesia e/ou anomalia de forma de incisivos laterais superiores e impacção de caninos. MÉTODOS: foram avaliados 73 pacientes com impacção de caninos e 73 pacientes controle, sem impacção de caninos. Foram medidas as distâncias mesiodistais dos incisivos laterais superiores adjacentes aos caninos impactados e os incisivos laterais correspondentes inferiores. Os incisivos laterais adjacentes foram classificados em: 1 - ausentes; 2 - pequenos; 3 - conoides; 4 - normais. RESULTADOS: os resultados mostraram que no grupo de pacientes com caninos impactados foram encontrados 22 dentes anômalos (pequenos e conoides, e no grupo controle apenas três dentes pequenos e conoides, sendo uma diferença estatisticamente significativa (p=0,001. Não foram encontrados pacientes com canino impactado e incisivo lateral ausente. CONCLUS
Vulnerability of cultured canine lung tumor cells to NK cell-mediated cytolysis
International Nuclear Information System (INIS)
Haley, P.J.; Kohr, J.M.; Kelly, G.; Muggenburg, B.A.; Guilmette, B.A.
1988-01-01
Five cell lines, designated as canine lung epithelial cell (CLEP), derived from radiation induced canine lung tumors and canine thyroid adeno-carcinoma (CTAC) cells were compared for their susceptibility to NK cell-mediated cytolysis using peripheral blood lymphocytes from normal, healthy Beagle dogs as effector cells. Effector cells and chromium 51 radiolabeled target cells were incubated for 16 h at ratios of 12.5:1, 25:1, 50:1, and 100:1. Increasing cytolysis was observed for all cell lines as the effector-to-target-cell ratios increased from 12.5:1 to 100:1. The percent cytotoxicity was significantly less for all lung tumor cell lines as compared to CTAC at the 100:1 ratio. One lung tumor cell line, CLEP-9, had 85% of the lytic vulnerability of the CTAC cell line and significantly greater susceptibility to NK cell-mediated lysis than all of the other lung tumor cell lines. Susceptibility to NK cell cytolysis did not correlate with in vivo malignant behavior of the original tumor. These data suggest that cultured canine lung tumor cells are susceptible to NK cell cytolytic activity in vitro and that at least one of these cell lines (CLEP-9) is a candidate for substitution of the standard canine NK cell target, CTAC, in NK cell assays. The use of lung tumor cells in NK cell assays may provide greater insight into the control of lung tumors by immune mechanisms. (author)
International Nuclear Information System (INIS)
Alif, Sheikh Mohammad; Haque, Sejuty; Nimmi, Naima; Ashraf, Ali; Khan, Saeed Hossain; Khan, Mahfujul Haq
2011-01-01
This study was performed to determine the prevalence of maxillary canine impaction on a basis of a single panoramic radiograph in Bangladeshi population. A random sample of seven hundred panoramic radiographs was collected from the patient record of a dental clinic. All the selected panoramic radiographs were taken from January 2009 to August 2010 by a single panoramic radiograph machine with the same exposure time (19 seconds) for all radiographs. One hundred and twenty panoramic radiographs were excluded to minimize the selection bias. In a dim lit room, an observer assessed the radiographs on a standard radiographic light box. The position of the impacted maxillary canine was recorded in line with the longitudinal axis of a tooth using the edge of a metal ruler. Data were subsequently put on SPSS 11.5 software and chi-square (x 2 ) tests were applied to find out the association. Among 580 panoramic radiographs it was found that impacted maxillary canines were present in only 7 (1.2%) radiographs. A statistical significant difference was found between the age of the patients and the vertical position of the impacted canines (p=0.000) and between the age of the patients and the horizontal position of the impacted canines (p=0.003). The prevalence was found to be low compared with the present study from the limitation of panoramic image. Further study needs to include three-dimensional imaging modality.
A comparative study between mixed-type tumours from human salivary and canine mammary glands
International Nuclear Information System (INIS)
Genelhu, Marisa CLS; Cardoso, Sérgio V; Gobbi, Helenice; Cassali, Geovanni D
2007-01-01
In comparative pathology, canine mammary tumours have special interest because of their similarities with human breast cancer. Mixed tumours are uncommon lesions in the human breast, but they are found most frequently in the mammary gland of the female dogs and in the human salivary glands. The aim of the study was to compare clinical, morphological and immunohistochemical features of human salivary and canine mammary gland mixed tumours, in order to evaluate the latter as an experimental model for salivary gland tumours. Ten examples of each mixed tumour type (human pleomorphic adenoma and carcinomas ex-pleomorphic adenomas and canine mixed tumour and metaplastic carcinoma) were evaluated. First, clinical and morphologic aspects of benign and malignant variants were compared between the species. Then, streptavidin-biotin-peroxidase immunohistochemistry was performed to detect the expression of cytokeratins, vimentin, p63 protein, estrogen receptor, β-catenin, and E-cadherin. After standardization, similar age and site distributions were observed in human and canine tumours. Histological similarities were identified in the comparison of the benign lesions as well. Metaplastic carcinomas also resembled general aspects of carcinomas ex-pleomorphic adenomas in morphological evaluation. Additionally, immunohistochemical staining further presented similar antigenic expression between lesions. There are many similar features between human salivary and canine mammary gland mixed tumours. This observation is of great relevance for those interested in the study and management of salivary gland tumours, since canine lesions may constitute useful comparative models for their investigations
Dettwiler, M; Croci, M; Vaughan, L; Guscetti, F
2013-09-01
The BH3-only protein Bad is a proapoptotic Bcl-2 family member that acts as a sensitizer in intrinsic apoptosis by inactivating antiapoptotic members through heterodimer formation. Bad has been shown to contribute to tumorigenesis, including lymphoma formation in humans and mice, through alteration in expression or functional status. Here, its immunohistochemical expression was analyzed in canine nonneoplastic and lymphoma tissues using tissue microarrays. Bad was expressed in the cytoplasm of a wide range of nonneoplastic tissues, especially epithelial cells. Nonneoplastic lymph nodes displayed weak immunostaining in the follicular germinal centers only. Immunoblotting supported these observations but also revealed presence of nonspecific labeling in some organs. Of 81 lymphomas, 29 (35.8%) displayed moderate to strong immunohistochemical Bad labeling, and a significant expression increase was found in lymphomas (especially B cell and double negative) compared to nonneoplastic lymph nodes. These findings warrant further investigations of the functional status, the involvement of partner proteins, and a possible impact of Bad on prognosis in canine lymphoma.
Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T
1995-06-01
For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.
Cytotoxic action of Brazilian propolis in vitro on canine osteosarcoma cells.
Cinegaglia, N C; Bersano, P R O; Búfalo, M C; Sforcin, J M
2013-09-01
Osteosarcoma (OSA) is a primary bone neoplasm frequently diagnosed in dogs. The biology of OSA in pet dogs is identical to that of pediatric patients, and it has been considered an excellent model in vivo to study human OSA. Since the individual response to chemotherapy is unpredictable and considering that propolis is a natural product with several biological properties, this work evaluated the cytotoxic action of propolis on canine OSA cells. The primary cell culture of canine OSA was obtained from the tumor of a dog with OSA. Cell viability was assessed after incubation with propolis, 70% ethanol (propolis solvent), and carboplatin after 6, 24, 48, and 72 h. Cell viability was analyzed by the crystal violet method. Data showed that canine OSA cells were sensitive to propolis in a dose- and time-dependent manner and had a distinct morphology compared to control. Its solvent (70% ethanol) had no effect on cell viability, suggesting that the cytotoxic action was exclusively due to propolis. Our propolis sample exerted a cytotoxic effect on canine OSA cells, and its introduction as a possible therapeutic agent in vivo could be investigated, providing a new contribution to OSA treatment. Copyright © 2012 John Wiley & Sons, Ltd.
Mechanical properties of canine osteosarcoma-affected antebrachia.
Steffey, Michele A; Garcia, Tanya C; Daniel, Leticia; Zwingenberger, Allison L; Stover, Susan M
2017-05-01
To determine the influence of neoplasia on the biomechanical properties of canine antebrachia. Ex vivo biomechanical study. Osteosarcoma (OSA)-affected canine antebrachia (n = 12) and unaffected canine antebrachia (n = 9). Antebrachia were compressed in axial loading until failure. A load-deformation curve was used to acquire the structural mechanical properties of neoplastic and unaffected specimens. Structural properties and properties normalized by body weight (BW) and radius length were compared using analysis of variance (ANOVA). Modes of failure were compared descriptively. Neoplastic antebrachia fractured at, or adjacent to, the OSA in the distal radial diaphysis. Unaffected antebrachia failed via mid-diaphyseal radial fractures with a transverse cranial component and an oblique caudal component. Structural mechanical properties were more variable in neoplastic antebrachia than unaffected antebrachia, which was partially attributable to differences in bone geometry related to dog size. When normalized by dog BW and radial length, strength, stiffness, and energy to yield and failure, were lower in neoplastic antebrachia than in unaffected antebrachia. OSA of the distal radial metaphysis in dogs presented for limb amputation markedly compromises the structural integrity of affected antebrachia. However, biomechanical properties of affected bones was sufficient for weight-bearing, as none of the neoplastic antebrachia fractured before amputation. The behavior of tumor invaded bone under cyclic loading warrants further investigations to evaluate the viability of in situ therapies for bone tumors in dogs. © 2017 The American College of Veterinary Surgeons.
Outbreak of canine visceral leishmaniasis in Barra Mansa, State of Rio de Janeiro
Directory of Open Access Journals (Sweden)
Cintia Xavier de Mello
2014-12-01
Full Text Available Introduction In Brazil, visceral leishmaniasis (VL has spread to various regions. This study reports canine cases of VL in Barra Mansa, where human VL cases were recently reported. Methods Using the human index case, a canine survey was performed by dual-path platform immunochromatography and enzyme-linked immunosorbent assay. Seropositive animals were euthanized. Cultures were collected to detect Leishmania parasites. Results Serological tests detected 141 canine VL cases, and Leishmania chagasi were isolated from 82.2% animals. Conclusions Leishmania chagasi is in circulation in Barra Mansa. This study broadens information on the parasite's distribution in the State of Rio de Janeiro.
Directory of Open Access Journals (Sweden)
Adina Coșarcă
2014-02-01
Full Text Available Aim: The aim of this study was to compare the periodontal status of impacted canines after 5 years following completion of the combined surgical and orthodontic treatment. Materials and methods: We examined 20 labially impacted canines and 20 palatally impacted canines at 5 years after the end of treatment. We assessed the periodontal status of these teeth. Results: Different outcomes were found regarding the probing depth and the amount of keratinized gingiva in the two mentioned groups of teeth. Conclusions: The assessed periodontal indices may signal the appearance of a periodontal disease around the teeth that were surgically and orthodontically treated
Canine Distemper Viral Inclusions in Blood Cells of Four Vaccinated Dogs
McLaughlin, Bruce G.; Adams, Pamela S.; Cornell, William D.; Elkins, A. Darrel
1985-01-01
Four cases of canine distemper were detected by the presence of numerous cytoplasmic inclusions in various circulating blood cells. Fluorescent antibody techniques and electron microscopy confirmed the identity of the viral inclusions. The cases occurred in the same geographic area and within a short time span. All four dogs had been vaccinated against canine distemper, but stress or other factors may have compromised their immune status. The possibility of an unusually virulent virus strain ...
BMI1 is expressed in canine osteosarcoma and contributes to cell growth and chemotherapy resistance.
Shahi, Mehdi Hayat; York, Daniel; Gandour-Edwards, Regina; Withers, Sita S; Holt, Roseline; Rebhun, Robert B
2015-01-01
BMI1, a stem cell factor and member of the polycomb group of genes, has been shown to contribute to growth and chemoresistance of several human malignancies including primary osteosarcoma (OSA). Naturally occurring OSA in the dog represents a large animal model of human OSA, however the potential role of BMI1 in canine primary and metastatic OSA has not been examined. Immunohistochemical staining of canine primary and metastatic OSA tumors revealed strong nuclear expression of BMI1. An identical staining pattern was found in both primary and metastatic human OSA tissues. Canine OSA cell lines (Abrams, Moresco, and D17) expressed high levels of BMI1 compared with canine osteoblasts and knockdown or inhibition of BMI1 by siRNA or by small molecule BMI1-inhibitor PTC-209 demonstrated a role for BMI1 in canine OSA cell growth and resistance to carboplatin and doxorubicin chemotherapy. These findings suggest that inhibition of BMI1 in primary or metastatic OSA may improve response to chemotherapy and that the dog may serve as a large animal model to evaluate such therapy.
Nd : YAG surgical laser effects in canine prostate tissue: temperature and damage distribution
van Nimwegen, S. A.; L'Eplattenier, H. F.; Rem, A. I.; van der Lugt, J. J.; Kirpensteijn, J.
2009-01-01
An in vitro model was used to predict short-term, laser-induced, thermal damage in canine prostate tissue. Canine prostate tissue samples were equipped with thermocouple probes to measure tissue temperature at 3, 6, 9 and 12 mm depths. The tissue surface was irradiated with a Nd:YAG laser in contact
Nayak, Reshma; Nayak, Us Krishna; Hegde, Gautam
2010-01-01
Orthodontic diagnosis and treatment planning for growing children must involve growth prediction, especially in the treatment of skeletal problems. Studies have shown that a strong association exists between skeletal maturity and dental calcification stages. The present study was therefore taken up to provide a simple and practical method for assessing skeletal maturity using a dental periapical film and standard dental X-ray machine, to compare the developmental stages of the mandibular canine with that of developmental stages of modified MP3 and to find out if any correlation exists, to determine if the developmental stages of the mandibular canine alone can be used as a reliable indicator for assessment of skeletal maturity. A total of 160 periapical radiographs (80 males and 80 females), of the mandibular right canine and the MP3 region was taken and assessed according to the Dermirjian's stages of dental calcification and the modified MP3 stages. The correlation between the developmental stages of MP3 and the mandibular right canine in male and female groups, is of high statistical significance (p = 0.001). The correlation coefficient between MP3 stages and developmental stages of mandibular canine and chronological age in male and females was found to be not significant. The correlation between the mandibular canine calcification stages and MP3 stages was found to be significant. The developmental stages of the mandibular canine could be used very reliably as a sole indicator for assessment of skeletal maturity.
Directory of Open Access Journals (Sweden)
Pamela M. Ortiz
2018-01-01
Full Text Available Objectives. To investigate the association between unilateral/bilateral maxillary canine impaction and sella-turcica bridging using CBCT imaging. Methods. This retrospective comparative study analyzed 76 CBCT images of the craniofacial complex including sella-turcica. The impacted cuspid group consisted of thirty-eight subjects (7 males, 31 females; mean age, 14.6 ± 3.2 years diagnosed with unilateral (left n=14, right n=11 or bilateral (n=13 palatal canine impaction. The control group included thirty-eight subjects matched by sex (7 males, 31 females; mean age, 19.5 ± 3.6 years with no impaction. Multinomial logistic regression analysis was used to determine the association between unilateral/bilateral canine impaction and right and left sella-turcica bridging. Results. The prevalence of sella-turcica bridging was 59.3% and 50% in the impacted canine and control groups, respectively. Although the odds for unilateral canine impaction were increased in the right and left sella-turcica bridging groups compared to the controls, the difference was not statistically significant. The risk of bilateral impaction was different between the two sides of sella-turcica bridging, but, again, the findings were not statistically significant. Conclusion. Contrary to previous 2D studies, there is no statistically significant association between unilateral/bilateral palatal canine impaction and sella-turcica bridging when using 3D CBCT.
Automation of gender determination in human canines using artificial intelligence
Directory of Open Access Journals (Sweden)
F. Fidya
2017-09-01
Full Text Available Background: Gender determination is an important aspect of the identification process. The tooth represents a part of the human body that indicates the nature of sexual dimorphism. Artificial intelligence enables computers to perform to the same standard the same tasks as those carried out by humans. Several methods of classification exist within an artificial intelligence approach to identifying sexual dimorphism in canines. Purpose: This study aimed to quantify the respective accuracy of the Naive Bayes, decision tree, and multi-layer perceptron (MLP methods in identifying sexual dimorphism in canines. Methods: A sample of results derived from 100 measurements of the diameter of mesiodistal, buccolingual, and diagonal upper and lower canine jaw models of both genders were entered into an application computer program that implements the algorithm (MLP. The analytical process was conducted by the program to obtain a classification model with testing being subsequently carried out in order to obtain 50 new measurement results, 25 each for males and females. A comparative analysis was conducted on the program-generated information. Results: The accuracy rate of the Naive Bayes method was 82%, while that of the decision tree and MLP amounted to 84%. The MLP method had an absolute error value lower than that of its decision tree counterpart. Conclusion: The use of artificial intelligence methods produced a highly accurate identification process relating to the gender determination of canine teeth. The most appropriate method was the MLP with an accuracy rate of 84%.
Experimental research of covered stent implanted in canine hepatic artery
International Nuclear Information System (INIS)
Zhou Bing; Liu Linxiang; Li Minghua; Wang Yongli; Cheng Yongde
2007-01-01
Objective: To evaluate the feasibility of success rate of implantation, post-procedure stenosis rate, apposition ability and endothelialization level, etc. for implantation with balloon-expandable covered stent in canine hepatic artery. Methods: 8 adult canines were implanted with balloon-expendable stents covered by expandable poly Teflon ester membrane (e-PTFEM). Follow-up DSA was performed immediately, 2, 4 and 12 wk after the procedure. The canines were sacrificed for histopathologic examination and statistical analysis with correlation of implantation manenvor and angiographic manifestations. Results: 8 cases were all implanted with the covered stents in proper hepatic artery/right hepatic artery successfully; showing good apposition ability and non-opacification of the separated branches. 2 cases showed intraluminal obvious stenosis( > 50%)of the stent at 2 weeks follow-up, so did 3 cases at 12 weeks follow-up, and the total stenosis rate was 37.5% and 5 cases manifested full endothelialization (3 different locations of the sample all manifested full endothelialization), 3 cased manifested partial endothelialization (at least 1 location of the sample didn't show full endothelialization), and the two terminal parts were easier to get endothelialization than the central part. Before and after the stent implantation, hepatic function of all cases didn't demonstrate any obvious changes. Conclusions: Balloon-expandable covered stent can be implanted in canine hepatic artery. successfully, with good apposition ability, full endothelialization, and no influence on hepatic function. (authors)
Extrusion processing : effects on dry canine diets
Tran, Q.D.
2008-01-01
Keywords: Extrusion, Canine diet, Protein, Lysine, Starch gelatinization, Palatability, Drying.
Extrusion cooking is a useful and economical tool for processing animal feed. This high temperature, short time processing technology causes chemical and physical changes that alter the
International Nuclear Information System (INIS)
Pang, Lisa Y.; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J.
2011-01-01
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology
Energy Technology Data Exchange (ETDEWEB)
Pang, Lisa Y., E-mail: lisa.pang@ed.ac.uk; Cervantes-Arias, Alejandro; Else, Rod W.; Argyle, David J. [Royal (Dick) School of Veterinary Studies and Roslin Institute, The University of Edinburgh, Easter Bush, Midlothian, EH25 9RG (United Kingdom)
2011-03-30
Canine mammary carcinoma is the most common cancer among female dogs and is often fatal due to the development of distant metastases. In humans, solid tumors are made up of heterogeneous cell populations, which perform different roles in the tumor economy. A small subset of tumor cells can hold or acquire stem cell characteristics, enabling them to drive tumor growth, recurrence and metastasis. In veterinary medicine, the molecular drivers of canine mammary carcinoma are as yet undefined. Here we report that putative cancer stem cells (CSCs) can be isolated form a canine mammary carcinoma cell line, REM134. We show that these cells have an increased ability to form tumorspheres, a characteristic of stem cells, and that they express embryonic stem cell markers associated with pluripotency. Moreover, canine CSCs are relatively resistant to the cytotoxic effects of common chemotherapeutic drugs and ionizing radiation, indicating that failure of clinical therapy to eradicate canine mammary cancer may be due to the survival of CSCs. The epithelial to mesenchymal transition (EMT) has been associated with cancer invasion, metastasis, and the acquisition of stem cell characteristics. Our results show that canine CSCs predominantly express mesenchymal markers and are more invasive than parental cells, indicating that these cells have a mesenchymal phenotype. Furthermore, we show that canine mammary cancer cells can be induced to undergo EMT by TGFβ and that these cells have an increased ability to form tumorspheres. Our findings indicate that EMT induction can enrich for cells with CSC properties, and provide further insight into canine CSC biology.
Sigler, Lauren M; Baccetti, Tiziano; McNamara, James A
2011-03-01
Our aim was to investigate the effect of rapid maxillary expansion and transpalatal arch therapy combined with deciduous canine extraction on the eruption rate of palatally displaced canines (PDCs) in patients in the late mixed dentition in a 2-center prospective study. Seventy subjects were enrolled based on PDCs diagnosed on panoramic radiographs. The treatment group (TG, 40 subjects) underwent RME followed by TPA therapy and extraction of the deciduous canines. The control group (CG, 30 subjects) received no orthodontic treatment. At the start of the trial, panoramic radiographs and dental casts were compared between the TG and the CG with the Mann-Whitney U test (P anomalies was reported. No statistically significant difference was found for any measurement at the start of the trial between the 2 groups. The prevalence rates of eruption of the maxillary canines were 80% for the TG and 28% in the CG, a statistically significant difference (chi-square =16.26, P mixed dentition with PDCs. Pretreatment variables indicating success of treatment on the eruption of PDCs were less severe sectors of displacement, prepubertal stages of skeletal maturity, and open root apices of PDCs. Several dental anomalies were associated significantly with PDCs, thus confirming the genetic etiology of this eruption disturbance. Copyright © 2011 American Association of Orthodontists. Published by Mosby, Inc. All rights reserved.
DEFF Research Database (Denmark)
Damborg, Peter; Guardabassi, Luca; Pedersen, Karl
2008-01-01
Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...
To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age.
Malik, Pooja; Rana, Vivek; Rehani, Usha
2012-01-01
The purpose of this study was to assess skeletal age and establish relationship between mandibular canine calcification and skeletal age. The study included 147 females aged 10 to 13 years. The subjects were divided into three groups: Group I-comprising of 10 to 11 years old female; Group II-comprising of 11 to 12 years old female; Group III-12 to 13 years female. OPG and hand and wrist radiographs of left side for each subject were taken with prior consent of their parents. The calcification status of canine was evaluated from orthopantomograms according to scores given in Demirjian's method. The stages of ossification of various carpal bones were evaluated using radiographic atlas of Greulich-Pyle and skeletal age was calculated. Data collected was statistically analyzed. The results drawn from this study showed that a strong correlation was observed for canine calcification stage F for 10 to 11 years and for stage G in 11 to 12 years and 12 to 13 years respectively. How to cite this article: Malik P, Rana V, Rehani U. To Evaluate the Relationship between Mandibular Canine Calcification Stages and Skeletal Age. Int J Clin Pediatr Dent 2012;5(1): 14-19.
Identification of a new genotype of canine distemper virus circulating in America.
Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón
2011-08-01
Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.
Dimopoulou, Maria; Kirpensteijn, Jolle; Moens, Hester; Kik, Marja
2008-07-01
To investigate the histologic characteristics of feline osteosarcoma (OS) and compare the histologic data with phenotypically comparable canine OS. The effects of histologic and clinical variables on survival statistics were evaluated. Retrospective study. Cats (n=62) and dogs (22). Medical records of 62 cats with OS were reviewed for clinically relevant data. Clinical outcome was obtained by telephone interview. Histologic characteristics of OS were classified using a standardized grading system. Histologic characteristics in 22 feline skeletal OS were compared with 22 canine skeletal OS of identical location and subtype. Prognostic variables for clinical outcome were determined using multivariate analysis. Feline OS was characterized by moderate to abundant cellular pleomorphism, low mitotic index, small to moderate amounts of matrix, high cellularity, and a moderate amount of necrosis. There was no significant difference between histologic variables in feline and canine OS. Histologic grade, surgery, and mitotic index significantly influenced clinical outcome as determined by multivariate analysis. Tumor invasion into vessels was not identified as a significant prognosticator. Feline and canine skeletal OS have similar histologic but different prognostic characteristics. Prognosis for cats with OS is related to histologic grade and mitotic index of the tumor.
Gregers-Jensen, Louise; Agger, Jens Frederik; Hammer, Anne Sofie Vedsted; Andresen, Lars; Chrièl, Mariann; Hagberg, Emma; Jensen, Mette Kragh; Hansen, Mette Sif; Hjulsager, Charlotte Kristiane; Struve, Tina
2015-09-30
During 8 months from July 2012 to February 2013, a major outbreak of canine distemper involving 64 mink farms occurred on the Danish peninsula of Jutland. The canine distemper outbreak was associated with exposure of farmed mink to infected wild carnivores and could represent a deficit in biosecurity on the mink farms. The aim of this study was to investigate the extent and association of specific biosecurity measures with the outbreak. The study was carried out in an epidemiological case-control design. The case group consisted of the 61 farms, which had a confirmed outbreak of canine distemper from July 2012 to February 2013. The control group included 54 farms without an outbreak of canine distemper in 2012 or 2013, selected as the closest geographical neighbour to a case farm. The results showed that significantly more control than case farms had vaccinated their mink against canine distemper virus. Mortality was only assessed on the case farms, and there was a non-significantly lower mortality on vaccinated farms than on the non-vaccinated farms. Furthermore, the proportion of farms with observations of wild red foxes (Vulpes vulpes) inside the farm enclosures were larger for case farms, indicating that the control farms had a better biosecurity or were not equally exposed to canine distemper virus. Generally, all farms had very few specific precautions at the gate entrance in respect to human visitors as well as animals. The use of biosecurity measures was very variable in both case and control farms. Not using plastic boot covers, presence of dogs and cats, presence of demarcated area for changing clothes when entering and leaving the farm area and presence of hand washing facilities significantly lowered the odds of the farm having a canine distemper virus outbreak. The results of the study indicate that consistent use of correct vaccination strategies, implementation of biosecurity measures and limiting human and animal access to the mink farm can be
A retrospective investigation of canine adenovirus (CAV infection in adult dogs in Turkey : article
Directory of Open Access Journals (Sweden)
S. Gur
2009-05-01
Full Text Available Canine adenovirus (CAV type 1 and 2, respectively, cause infectious canine hepatitis and infectious canine laryngotracheitis in members of the families Canidae and Ursidae worldwide. Both of these infections are acute diseases, especially in young dogs. The aim of this study was to conduct a serological investigation of canine adenovirus infection. For this purpose, serumsamples were collected from native pure-bred Kangal (n = 11, and Akbash dogs (n = 17 and Turkish Greyhounds (n=15 in Eskisehir and Konya provinces. None ofthe dogs were previously vaccinated against CAV types. Indirect ELISA detected 88.2 %, 93.3 % and 100 % prevalences in Akbash, Greyhound and Kangal dogs, respectively. The remainder of the samples (n = 51 were collected at the Afyonkarahisar Municipality Shelter. Fourty-two of these dogs (82.3 % were detected as seropositive. In total, 82 of 94 dogs (87.2 % were found to be positive for CAV serum antibodies.
The effects of sulforaphane on canine osteosarcoma proliferation and invasion.
Rizzo, V L; Levine, C B; Wakshlag, J J
2017-09-01
Recent evidence in in vitro and in vivo models suggests that sulforaphane (SFN), found in raw cruciferous vegetables, may have utility in chemoprevention, as an antineoplastic agent and as a free radical scavenger. The effects of SFN alone or with doxorubicin on cell viability were examined, as well as cell cycle kinetics, invasion capabilities and apoptosis in three canine osteosarcoma cell line (D17, OS 2.4 and HMPOS). Results showed that SFN could not induce cell death at potentially physiological concentrations (canine osteosarcoma. © 2016 John Wiley & Sons Ltd.
Construct canine intracranial aneurysm model by endovascular technique
International Nuclear Information System (INIS)
Liang Xiaodong; Liu Yizhi; Ni Caifang; Ding Yi
2004-01-01
Objective: To construct canine bifurcation aneurysms suitable for evaluating the exploration of endovascular devices for interventional therapy by endovascular technique. Methods: The right common carotid artery of six dogs was expanded with a pliable balloon by means of endovascular technique, then embolization with detached balloon was taken at their originations DAS examination were performed on 1, 2, 3 d after the procedurse. Results: 6 aneurysm models were created in six dogs successfully with the mean width and height of the aneurysms decreasing in 3 days. Conclusions: This canine aneurysm model presents the virtue in the size and shape of human cerebral bifurcation saccular aneurysms on DSA image, suitable for developing the exploration of endovascular devices for aneurismal therapy. The procedure is quick, reliable and reproducible. (authors)
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
Energy Technology Data Exchange (ETDEWEB)
Kim, Jong-Hyuk, E-mail: jhkim@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Robinson, Sally [Department of Veterinary and Biomedical Sciences, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Sharkey, Leslie C. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); O' Brien, Timothy D. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Dickerson, Erin B. [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States); Modiano, Jaime F., E-mail: modiano@umn.edu [Department of Veterinary Clinical Science, College of Veterinary Medicine, University of Minnesota, St. Paul, MN (United States); Masonic Cancer Center, University of Minnesota, Minneapolis, MN (United States)
2014-04-15
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Interleukin-8 promotes canine hemangiosarcoma growth by regulating the tumor microenvironment
International Nuclear Information System (INIS)
Kim, Jong-Hyuk; Frantz, Aric M.; Anderson, Katie L.; Graef, Ashley J.; Scott, Milcah C.; Robinson, Sally; Sharkey, Leslie C.; O'Brien, Timothy D.; Dickerson, Erin B.; Modiano, Jaime F.
2014-01-01
Interleukin-8 (IL-8) gene expression is highly up-regulated in canine hemangiosarcoma (HSA); however, its role in the pathogenesis of this disease is unknown. We investigated the expression of IL-8 in canine HSA tissues and cell lines, as well and the effects of IL-8 on canine HSA in vitro, and in vivo using a mouse xenograft model for the latter. Constitutive expression of IL-8 mRNA, IL-8 protein, and IL-8 receptor were variable among different tumor samples and cell lines, but they showed stable steady states in each cell line. Upon the addition of IL-8, HSA cells showed transient intracellular calcium fluxes, suggesting that their IL-8 receptors are functional and that IL-8 binding activates relevant signaling pathways. Yet, neither addition of exogenous IL-8 nor blockade of endogenous IL-8 by neutralizing anti-IL-8 antibody (α-IL-8 Ab) affected HSA cell proliferation or survival in vitro. To assess potential effects of IL-8 in other tumor constituents, we stratified HSA cell lines and whole tumor samples into “IL-8 high” and “IL-8 low” groups. Genome-wide gene expression profiling showed that samples in the “IL-8 high” tumor group were enriched for genes associated with a “reactive microenvironment,” including activation of coagulation, inflammation, and fibrosis networks. Based on these findings, we hypothesized that the effects of IL-8 on these tumors were mostly indirect, regulating interactions with the microenvironment. This hypothesis was supported by in vivo xenograft experiments where survival and engraftment of tumor cells was inhibited by administration of neutralizing α-IL-8 Ab. Together, our results suggest that IL-8 contributes to establishing a permissive microenvironment during the early stages of tumorigenesis in HSA. - Highlights: • IL-8 is expressed in canine hemangiosarcoma tumor samples and cell lines. • IL-8 transduces a relevant biological signal in canine hemangiosarcoma cells. • IL-8 gene signature is associated
Wallis, Corrin V; Lowden, Preena; Marshall-Jones, Zoe V; Hilton, Anthony C
2018-02-26
Salmonella enterica is a recognised cause of diarrhoea in dogs and humans, yet the potential for transfer of salmonellosis between dogs and their owners is unclear, with reported evidence both for and against Salmonella as a zoonotic pathogen. A collection of 174 S. enterica isolates from clinical infections in humans and dogs were analysed for serotype distribution, carbon source utilisation, chemical and antimicrobial sensitivity profiles. The aim of the study was to understand the degree of conservation in phenotypic characteristics of isolates across host species. Serovar distribution across human and canine isolates demonstrated nine serovars common to both host species, 24 serovars present in only the canine collection and 39 solely represented within the human collection. Significant differences in carbon source utilisation profiles and ampicillin, amoxicillin and chloramphenicol sensitivity profiles were detected in isolates of human and canine origin. Differences between the human and canine Salmonella collections were suggestive of evolutionary separation, with canine isolates better able to utilise several simple sugars than their human counterparts. Generally higher minimum inhibitory concentrations of three broad-spectrum antimicrobials, commonly used in veterinary medicine, were also observed in canine S. enterica isolates. Differential carbon source utilisation and antimicrobial sensitivity profiles in pathogenic Salmonella isolated from humans and dogs are suggestive of distinct reservoirs of infection for these hosts. Although these findings do not preclude zoonotic or anthroponotic potential in salmonellae, the separation of carbon utilisation and antibiotic profiles with isolate source is indicative that infectious isolates are not part of a common reservoir shared frequently between these host species.
Canine and incisor microwear in pitheciids and Ateles reflects documented patterns of tooth use.
Delezene, Lucas K; Teaford, Mark F; Ungar, Peter S
2016-09-01
Platyrrhine species differ in the extent to and the manner in which they use their incisors and canines during food ingestion. For example, Ateles uses its anterior teeth to process mechanically nondemanding soft fruits, while the sclerocarp-harvesting pitheciids rely extensively on these teeth to acquire and process more demanding foods. Pitheciids themselves vary in anterior tooth use, with the pitheciines (Cacajao, Chiropotes, and Pithecia) noted to use their robust canines in a variety of ways to predate seeds, while Callicebus, which rarely predates seeds, uses its incisors and exceptionally short canines to scrape tough mesocarp from fruits. To investigate the relationship between tooth use and dental wear, microwear textures were investigated for the anterior teeth of these five genera of platyrrhine primates. Using a white light confocal microscope, 12 microwear texture attributes that reflect feature size, anisotropy, density, and complexity were recorded from high-resolution epoxy casts of the incisors and canines of adult wild-collected Brazilian specimens of Ateles, Callicebus, Cacajao, Chiropotes, and Pithecia. Pitheciine canines tend to have deep microwear features and complex, anisotropic microwear textures, while Ateles anterior teeth tend to have very small features, low feature density, and less complex and anisotropic surfaces. Callicebus incisor and canine microwear is generally intermediate in size and complexity between those extremes. These findings align with expectations from reported field observations of tooth use and illustrate the potential for using microwear texture analysis to infer patterns of anterior tooth use in extinct primates. Am J Phys Anthropol 161:6-25, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Development of an Arthroscopic Joint Capsule Injury Model in the Canine Shoulder.
Directory of Open Access Journals (Sweden)
David Kovacevic
Full Text Available The natural history of rotator cuff tears can be unfavorable as patients develop fatty infiltration and muscle atrophy that is often associated with a loss of muscle strength and shoulder function. To facilitate study of possible biologic mechanisms involved in early degenerative changes to rotator cuff muscle and tendon tissues, the objective of this study was to develop a joint capsule injury model in the canine shoulder using arthroscopy.Arthroscopic surgical methods for performing a posterior joint capsulectomy in the canine shoulder were first defined in cadavers. Subsequently, one canine subject underwent bilateral shoulder joint capsulectomy using arthroscopy, arthroscopic surveillance at 2, 4 and 8 weeks, and gross and histologic examination of the joint at 10 weeks.The canine subject was weight-bearing within eight hours after index and follow-up surgeries and had no significant soft tissue swelling of the shoulder girdle or gross lameness. Chronic synovitis and macroscopic and microscopic evidence of pathologic changes to the rotator cuff bony insertions, tendons, myotendinous junctions and muscles were observed.This study demonstrates feasibility and proof-of-concept for a joint capsule injury model in the canine shoulder. Future work is needed to define the observed pathologic changes and their role in the progression of rotator cuff disease. Ultimately, better understanding of the biologic mechanisms of early progression of rotator cuff disease may lead to clinical interventions to halt or slow this process and avoid the more advanced and often irreversible conditions of large tendon tears with muscle fatty atrophy.
Expression of monocarboxylate transporter 1 in oral and ocular canine melanocytic tumors.
Shimoyama, Y; Akihara, Y; Kirat, D; Iwano, H; Hirayama, K; Kagawa, Y; Ohmachi, T; Matsuda, K; Okamoto, M; Kadosawa, T; Yokota, H; Taniyama, H
2007-07-01
Solid tumors are composed of a heterogeneous population of cells surviving in various concentrations of oxygen. In a hypoxic environment, tumor cells generally up-regulate glycolysis and, therefore, generate more lactate that must be expelled from the cell through proton transporters to prevent intracellular acidosis. Monocarboxylate transporter 1 (MCT1) is a major proton transporter in mammalian cells that transports monocarboxylates, such as lactate and pyruvate, together with a proton across the plasma membrane. Melanocytic neoplasia occurs frequently in dogs, but the prognosis is highly site-dependent. In this study, 50 oral canine melanomas, which were subdivided into 3 histologic subtypes, and 17 ocular canine melanocytic neoplasms (14 melanocytomas and 3 melanomas) were used to examine and compare MCT1 expression. Immunohistochemistry using a polyclonal chicken anti-rat MCT1 antibody showed that most oral melanoma exhibited cell membrane staining, although there were no significant differences observed among the 3 histologic subtypes. In contrast, the majority of ocular melanocytic tumors were not immunoreactive. Additionally, we documented the presence of a 45-kDa band in cell membrane protein Western blots, and sequencing of a reverse transcriptase polymerase chain reaction band of expected size confirmed its identity as a partial canine MCT1 transcript in 3 oral tumors. Increased MCT1 expression in oral melanomas compared with ocular melanocytic tumors may reflect the very different biology between these tumors in dogs. These results are the first to document canine MCT1 expression in canine tumors and suggest that increased MCT1 expression may provide a potential therapeutic target for oral melanoma.
Migrastatin analogues inhibit canine mammary cancer cell migration and invasion.
Directory of Open Access Journals (Sweden)
Kinga Majchrzak
Full Text Available BACKGROUND: Cancer spread to other organs is the main cause of death of oncological patients. Migration of cancer cells from a primary tumour is the crucial step in the complex process of metastasis, therefore blocking this process is currently the main treatment strategy. Metastasis inhibitors derived from natural products, such as, migrastatin, are very promising anticancer agents. Thus, the aim of our study was to investigate the effect of six migrastatin analogues (MGSTA-1 to 6 on migration and invasion of canine mammary adenocarcinoma cell lines isolated from primary tumours and their metastases to the lungs. Canine mammary tumours constitute a valuable tool for studying multiple aspect of human cancer. RESULTS: OUR RESULTS SHOWED THAT TWO OF SIX FULLY SYNTHETIC ANALOGUES OF MIGRASTATIN: MGSTA-5 and MGSTA-6 were potent inhibitors of canine mammary cancer cells migration and invasion. These data were obtained using the wound healing test, as well as trans-well migration and invasion assays. Furthermore, the treatment of cancer cells with the most effective compound (MGSTA-6 disturbed binding between filamentous F-actin and fascin1. Confocal microscopy analyses revealed that treatment with MGSTA-6 increased the presence of unbound fascin1 and reduced co-localization of F-actin and fascin1 in canine cancer cells. Most likely, actin filaments were not cross-linked by fascin1 and did not generate the typical filopodial architecture of actin filaments in response to the activity of MGSTA-6. Thus, administration of MGSTA-6 results in decreased formation of filopodia protrusions and stress fibres in canine mammary cancer cells, causing inhibition of cancer migration and invasion. CONCLUSION: Two synthetic migrastatin analogues (MGSTA-5 and MGSTA-6 were shown to be promising compounds for inhibition of cancer metastasis. They may have beneficial therapeutic effects in cancer therapy in dogs, especially in combination with other anticancer drugs
International Nuclear Information System (INIS)
Ditte, Zuzana; Ditte, Peter; Labudova, Martina; Simko, Veronika; Iuliano, Filippo; Zatovicova, Miriam; Csaderova, Lucia; Pastorekova, Silvia; Pastorek, Jaromir
2014-01-01
Carbonic anhydrase IX (CA IX) is a transmembrane enzyme that is present in many types of solid tumors. Expression of CA IX is driven predominantly by the hypoxia-inducible factor (HIF) pathway and helps to maintain intracellular pH homeostasis under hypoxic conditions, resulting in acidification of the tumor microenvironment. Carnosine (β-alanyl-L-histidine) is an anti-tumorigenic agent that inhibits the proliferation of cancer cells. In this study, we investigated the role of CA IX in carnosine-mediated antitumor activity and whether the underlying mechanism involves transcriptional and translational modulation of HIF-1α and CA IX and/or altered CA IX function. The effect of carnosine was studied using two-dimensional cell monolayers of several cell lines with endogenous CA IX expression as well as Madin Darby canine kidney transfectants, three-dimensional HeLa spheroids, and an in vivo model of HeLa xenografts in nude mice. mRNA and protein expression and protein localization were analyzed by real-time PCR, western blot analysis, and immunofluorescence staining, respectively. Cell viability was measured by a flow cytometric assay. Expression of HIF-1α and CA IX in tumors was assessed by immunohistochemical staining. Real-time measurement of pH was performed using a sensor dish reader. Binding of CA IX to specific antibodies and metabolon partners was investigated by competitive ELISA and proximity ligation assays, respectively. Carnosine increased the expression levels of HIF-1α and HIF targets and increased the extracellular pH, suggesting an inhibitory effect on CA IX-mediated acidosis. Moreover, carnosine significantly inhibited the growth of three-dimensional spheroids and tumor xenografts compared with untreated controls. Competitive ELISA showed that carnosine disrupted binding between CA IX and antibodies specific for its catalytic domain. This finding was supported by reduced formation of the functional metabolon of CA IX and anion exchanger 2 in the
Directory of Open Access Journals (Sweden)
Carmen Aravena
Full Text Available Arsenic main inorganic compound is arsenic trioxide (ATO presented in solution mainly as arsenite. ATO increases intracellular pH (pHi, cell proliferation and tumor growth. Sodium-proton exchangers (NHEs modulate the pHi, with NHE1 playing significant roles. Whether ATO-increased cell proliferation results from altered NHEs expression and activity is unknown. We hypothesize that ATO increases cell proliferation by altering pHi due to increased NHEs-like transport activity. Madin-Darby canine kidney (MDCK cells grown in 5 mmol/L D-glucose-containing DMEM were exposed to ATO (0.05, 0.5 or 5 µmol/L, 0-48 hours in the absence or presence of 5-N,N-hexamethylene amiloride (HMA, 5-100 µmol/L, NHEs inhibitor, PD-98059 (30 µmol/L, MAPK1/2 inhibitor, Gö6976 (10 µmol/L, PKCα, βI and μ inhibitor, or Schering 28080 (10 µmol/L, H(+/K(+ATPase inhibitor plus concanamycin (0.1 µmol/L, V type ATPases inhibitor. Incorporation of [(3H]thymidine was used to estimate cell proliferation, and counting cells with a hemocytometer to determine the cell number. The pHi was measured by fluorometry in 2,7-bicarboxyethyl-5,6-carboxyfluorescein loaded cells. The Na(+-dependent HMA-sensitive NHEs-like mediated proton transport kinetics, NHE1 protein abundance in the total, cytoplasm and plasma membrane protein fractions, and phosphorylated and total p42/44 mitogen-activated protein kinases (p42/44(mapk were also determined. Lowest ATO (0.05 µmol/L, ~0.01 ppm used in this study increased cell proliferation, pHi, NHEs-like transport and plasma membrane NHE1 protein abundance, effects blocked by HMA, PD-98059 or Gö6976. Cell-buffering capacity did not change by ATO. The results show that a low ATO concentration increases MDCK cells proliferation by NHEs (probably NHE1-like transport dependent-increased pHi requiring p42/44(mapk and PKCα, βI and/or μ activity. This finding could be crucial in diseases where uncontrolled cell growth occurs, such as tumor growth, and