WorldWideScience

Sample records for polarization resistance method

  1. Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

    OpenAIRE

    Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

  2. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    International Nuclear Information System (INIS)

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  3. Electrical Methods: Resistivity Methods

    Science.gov (United States)

    Surface electrical resistivity surveying is based on the principle that the distribution of electrical potential in the ground around a current-carrying electrode depends on the electrical resistivities and distribution of the surrounding soils and rocks.

  4. Polarization of lanthanum nucleus by dynamic polarization method

    International Nuclear Information System (INIS)

    Adachi, Toshikazu; Ishimoto, Shigeru; Masuda, Yasuhiro; Morimoto, Kimio

    1989-01-01

    Preliminary studies have been carried out concerning the application of a dynamic polarization method to polarizing lanthanum fluoride single crystal to be employed as target in experiments with time reversal invariance. The present report briefly outlines the dynamic polarization method and describes some preliminary studies carried out so far. Dynamic polarization is of particular importance because no techniques are currently available that can produce highly polarized static nucleus. Spin interaction between electrons and protons (nuclei) plays a major role in the dynamic polarization method. In a thermal equilibrium state, electrons are polarized almost completely while most protons are not polarized. Positively polarized proton spin is produced by applying microwave to this system. The most hopeful candidate target material is single crystal of LaF 3 containing neodymium because the crystal is chemically stable and easy to handle. The spin direction is of great importance in experiments with time reversal invariance. The spin of neutrons in the target can be cancelled by adjusting the external magnetic field applied to a frozen polarized target. In a frozen spin state, the polarity decreases slowly with a relaxation time that depends on the external magnetic field and temperature. (N.K.)

  5. Development of a new method of measurement of the polarization resistance to estimate the level of corrosion of the reinforced concrete of cooling towers

    International Nuclear Information System (INIS)

    Mitzithra, M.E.; Deby, F.; Laurens, S.; Balayssac, J.P.; Salin, J.

    2014-01-01

    This paper summarises the results obtained from the numerical simulations of an operative measurement mode of polarization resistance adapted for evaluating the corrosion of reinforced concrete on cooling towers. A simple operative measurement mode of R p is proposed, adapted for cooling towers submitted to corrosion due to carbonation. By means of numerical experimentations, abacuses and correction laws are built involving the different influencing parameters: steel reinforcement's concrete cover, concrete resistivity and current intensity injected from the counter electrode. Finally, a first application of the proposed procedure for calculating the real value of R p in laboratory conditions is presented. (authors)

  6. Polarization fatigue resistance of Ca-doped Pb(Zr0.52Ti0.48)O3 thin films prepared by the sol-gel method

    International Nuclear Information System (INIS)

    Wei, T.; Wang, Y.; Zhu, C.; Dong, X.W.; Xia, Y.D.; Zhu, J.S.; Liu, J.-M.

    2008-01-01

    The ferroelectric and polarization fatigue characteristics of Pb 1-x Ca x (Zr 0.52 Ti 0.48 )O 3 (PCZT) thin films prepared using the sol-gel method were studied. The Ca-doping slightly suppresses the ferroelectricity of Pb(Zr 0.52 Ti 0.48 )O 3 (PZT) because of the quantum paraelectric behavior of CaTiO 3 . Compared with PZT thin films, the PCZT (x=0.2) thin films show enhanced fatigue resistance at room temperature, further emphasized by the almost fatigue-free behavior at 100 K. The temperature-dependent dc-conductivity suggests a decrease of the oxygen vacancy density by almost 20 times and a slightly declined activation energy U for oxygen vacancies, upon increasing of the Ca-doping content from 0.0 to 0.2. It is argued that the improved fatigue endurance is ascribed to the decreasing density of oxygen vacancies due to the Ca-doping, although the lowered activation energy of oxygen vacancies is unfavorable. (orig.)

  7. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  8. Application of concentration-volume fractal method in induced polarization and resistivity data interpretation for Cu-Mo porphyry deposits exploration, case study: Nowchun Cu-Mo deposit, SE Iran

    Directory of Open Access Journals (Sweden)

    L. Daneshvar Saein

    2012-08-01

    Full Text Available The aim of this study is the utilization of the concentration-volume (C-V fractal method based on geoelectrical data including induced polarization (IP and resistivity (RS in targeting areas hosting different sulfidic mineralization zones in Nowchun Cu-Mo porphyry deposit, SE Iran. The C-V fractal model employed in this research in order to separate high and moderate sulfidic zones from low sulfidic zone and barren wall rocks in the deposit is corresponding to chargeability and resistivity. Results obtained from the C-V method indicate that there is a positive correlation between subsurface mineralization and sulfide mineralized zones; additionally, use of the C-V method based on geophysical data is recognized as an accurate approach for delineation of various mineralization zones in the depth for optimization of mineral exploration operation, particularly in porphyry deposits.

  9. Effect of composition on the polarization and ohmic resistances of ...

    Indian Academy of Sciences (India)

    2017-06-09

    Jun 9, 2017 ... Solid oxide fuel cell; composite cathodes; polarization resistance; ohmic resistance; ... of Oad on LSM, (iii) conversion of Oad into oxygen ion ... ions need to flow through the low temperature sintered ..... TPB's are present) suggest the formation of face-to-face con- ..... calculated using the following equation.

  10. Multi-polar resistance switching and memory effect in copper phthalocyanine junctions

    International Nuclear Information System (INIS)

    Qiao Shi-Zhu; Kang Shi-Shou; Li Qiang; Zhong Hai; Kang Yun; Yu Shu-Yun; Han Guang-Bing; Yan Shi-Shen; Mei Liang-Mo; Qin Yu-Feng

    2014-01-01

    Copper phthalocyanine junctions, fabricated by magnetron sputtering and evaporating methods, show multi-polar (unipolar and bipolar) resistance switching and the memory effect. The multi-polar resistance switching has not been observed simultaneously in one organic material before. With both electrodes being cobalt, the unipolar resistance switching is universal. The high resistance state is switched to the low resistance state when the bias reaches the set voltage. Generally, the set voltage increases with the thickness of copper phthalocyanine and decreases with increasing dwell time of bias. Moreover, the low resistance state could be switched to the high resistance state by absorbing the phonon energy. The stability of the low resistance state could be tuned by different electrodes. In Au/copper phthalocyanine/Co system, the low resistance state is far more stable, and the bipolar resistance switching is found. Temperature dependence of electrical transport measurements demonstrates that there are no obvious differences in the electrical transport mechanism before and after the resistance switching. They fit quite well with Mott variable range hopping theory. The effect of Al 2 O 3 on the resistance switching is excluded by control experiments. The holes trapping and detrapping in copper phthalocyanine layer are responsible for the resistance switching, and the interfacial effect between electrodes and copper phthalocyanine layer affects the memory effect. (interdisciplinary physics and related areas of science and technology)

  11. Uranium deposit interpretation based on resistivity and induced polarization data in Rabau hulu sector

    International Nuclear Information System (INIS)

    Dwi Haryanto; Bambang Soetopo; Adhika Junara Karunianto; Supriyanto

    2015-01-01

    Rabau Hulu area, Kalan, Kalimantan Barat is a potential area of uranium that has been explored in detail by various methods. Methods of resistivity and induced polarization can be applied in the exploration of uranium deposits in which its mineralization associated with sulphide minerals. Processing, analysis, and interpretation of resistivity and induced polarization data conducted in order to identify the distribution of uranium deposits and lithology of the rocks in the study area. Uranium deposits in the area Rabau Hulu is generally associated with sulphides, tourmaline and contained in favorable rocks. Symptoms of uranium mineralization encountered in other forms of irregular and uneven consists of uraninite, pyrite, chalcopyrite, pyrrhotite, molybdenite, and ilmenite minerals. Data acquisition using dipole-dipole configuration in an area of approximately 36 hectares, 46 lines along ± 425 m. Acquisition of induced polarization frequency domain data which the same points and lines with resistivity data. Data processing produces resistivity and metal factor values and subsequently made two-dimensional section. Determination of resistivity and induced polarization are done by correlated boreholes data with the results of data processing. Resistivity of uranium deposits zone worth less than 2,000 Ωm and the value of metal factor greater than 90 mho/m. Uranium deposit zone is expanding along with the depth. Uranium deposits distribution trending Southwestern-Northeast and shaped lens. (author)

  12. Three-dimensional induced polarization data inversion for complex resistivity

    Energy Technology Data Exchange (ETDEWEB)

    Commer, M.; Newman, G.A.; Williams, K.H.; Hubbard, S.S.

    2011-03-15

    The conductive and capacitive material properties of the subsurface can be quantified through the frequency-dependent complex resistivity. However, the routine three-dimensional (3D) interpretation of voluminous induced polarization (IP) data sets still poses a challenge due to large computational demands and solution nonuniqueness. We have developed a flexible methodology for 3D (spectral) IP data inversion. Our inversion algorithm is adapted from a frequency-domain electromagnetic (EM) inversion method primarily developed for large-scale hydrocarbon and geothermal energy exploration purposes. The method has proven to be efficient by implementing the nonlinear conjugate gradient method with hierarchical parallelism and by using an optimal finite-difference forward modeling mesh design scheme. The method allows for a large range of survey scales, providing a tool for both exploration and environmental applications. We experimented with an image focusing technique to improve the poor depth resolution of surface data sets with small survey spreads. The algorithm's underlying forward modeling operator properly accounts for EM coupling effects; thus, traditionally used EM coupling correction procedures are not needed. The methodology was applied to both synthetic and field data. We tested the benefit of directly inverting EM coupling contaminated data using a synthetic large-scale exploration data set. Afterward, we further tested the monitoring capability of our method by inverting time-lapse data from an environmental remediation experiment near Rifle, Colorado. Similar trends observed in both our solution and another 2D inversion were in accordance with previous findings about the IP effects due to subsurface microbial activity.

  13. Apparent resistivity and spectral induced polarization in the submarine environment

    Directory of Open Access Journals (Sweden)

    HERCULES DE SOUZA

    2001-09-01

    Full Text Available Relatively few investigations have employed electrical methods in the submarine environment, which may be promising for mineral deposits or threatened by environmental problems. We have measured the electric field using both disk and bar electrodes in the sea water at three different levels: sea surface, seven meters deep, and sea bottom at a depth of ten meters, employing a 2 m spacing dipole-dipole array with 7 array spacings of investigation, and 13 values of frequencies at steps of (2N hertz, N = -2, -1, 0, 1, 2,.....10. The measurement allowed the analysis of the electric field as a function of frequency and spacing, and of the spectral induced polarization. Modelling and interpretation of the apparent resistivity yielded a good fit with previous drilling data. Analysis of the spectrum of the complex apparent resistivity and the comparison with equivalent circuits, provided information about the grain size, the mineral composition and the major induced polarization phenomenon occurring below the sea. Therefore the result of the present research show the feasibility of measuring the variation of seawater resistivity in situ, as well as the resistivity of sea bottom sediments.Relativamente poucas investigações têm empregado métodos elétricos no ambiente submarino, o qual pode ser promissor para depósitos minerais ou ameaçado por problemas ambientais. Nós medimos o campo elétrico usando eletrodos em forma de disco e de barra na água do mar, em três níveis distintos: superfície, sete metros de profundidade, e fundo do mar a dez metros de profundidade, empregando um dispositivo dipolo-dipolo com 2m de afastamento, 7 níveis de investigação e 13 valores de freqüência a intervalos de (2N hertz, N = -2, -1, 0, 1, 2, ... 10. A medida permitiu a análise do campo elétrico como uma função de freqüência e afastamento, e da polarização induzida espectral. A modelagem e a interpretação da resistividade aparente se ajustaram bem

  14. Polarization-coupled tunable resistive behavior in oxide ferroelectric heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Gruverman, Alexei [Univ. of Nebraska, Lincoln, NE (United States); Tsymbal, Evgeny Y. [Univ. of Nebraska, Lincoln, NE (United States); Eom, Chang-Beom [Univ. of Wisconsin, Madison, WI (United States)

    2017-05-03

    This research focuses on investigation of the physical mechanism of the electrically and mechanically tunable resistive behavior in oxide ferroelectric heterostructures with engineered interfaces realized via a strong coupling of ferroelectric polarization with tunneling electroresistance and metal-insulator (M-I) transitions. This report describes observation of electrically conductive domain walls in semiconducting ferroelectrics, voltage-free control of resistive switching and demonstration of a new mechanism of electrical control of 2D electron gas (2DEG) at oxide interfaces. The research goals are achieved by creating strong synergy between cutting-edge fabrication of epitaxial single-crystalline complex oxides, nanoscale electrical characterization by scanning probe microscopy and theoretical modeling of the observed phenomena. The concept of the ferroelectric devices with electrically and mechanically tunable nonvolatile resistance represents a new paradigm shift in realization of the next-generation of non-volatile memory devices and low-power logic switches.

  15. Dual-polarized feed antenna apparatus and method of use

    Science.gov (United States)

    Sarehraz, Mohammed (Inventor); Buckle, Kenneth A. (Inventor); Stefanakos, Elias (Inventor); Weller, Thomas (Inventor); Goswami, D. Yogi (Inventor)

    2009-01-01

    An antenna apparatus and method for the interception of randomly polarized electromagnetic waves utilizing a dual polarized antenna which is excited through a cross-slot aperture using two well-isolated orthogonal feeds.

  16. POLARIZATION REMOTE SENSING PHYSICAL MECHANISM, KEY METHODS AND APPLICATION

    Directory of Open Access Journals (Sweden)

    B. Yang

    2017-09-01

    Full Text Available China's long-term planning major projects "high-resolution earth observation system" has been invested nearly 100 billion and the satellites will reach 100 to 2020. As to 2/3 of China's area covered by mountains,it has a higher demand for remote sensing. In addition to light intensity, frequency, phase, polarization is also the main physical characteristics of remote sensing electromagnetic waves. Polarization is an important component of the reflected information from the surface and the atmospheric information, and the polarization effect of the ground object reflection is the basis of the observation of polarization remote sensing. Therefore, the effect of eliminating the polarization effect is very important for remote sensing applications. The main innovations of this paper is as follows: (1 Remote sensing observation method. It is theoretically deduced and verified that the polarization can weaken the light in the strong light region, and then provide the polarization effective information. In turn, the polarization in the low light region can strengthen the weak light, the same can be obtained polarization effective information. (2 Polarization effect of vegetation. By analyzing the structure characteristics of vegetation, polarization information is obtained, then the vegetation structure information directly affects the absorption of biochemical components of leaves. (3 Atmospheric polarization neutral point observation method. It is proved to be effective to achieve the ground-gas separation, which can achieve the effect of eliminating the atmospheric polarization effect and enhancing the polarization effect of the object.

  17. Polarized atomic orbitals for linear scaling methods

    Science.gov (United States)

    Berghold, Gerd; Parrinello, Michele; Hutter, Jürg

    2002-02-01

    We present a modified version of the polarized atomic orbital (PAO) method [M. S. Lee and M. Head-Gordon, J. Chem. Phys. 107, 9085 (1997)] to construct minimal basis sets optimized in the molecular environment. The minimal basis set derives its flexibility from the fact that it is formed as a linear combination of a larger set of atomic orbitals. This approach significantly reduces the number of independent variables to be determined during a calculation, while retaining most of the essential chemistry resulting from the admixture of higher angular momentum functions. Furthermore, we combine the PAO method with linear scaling algorithms. We use the Chebyshev polynomial expansion method, the conjugate gradient density matrix search, and the canonical purification of the density matrix. The combined scheme overcomes one of the major drawbacks of standard approaches for large nonorthogonal basis sets, namely numerical instabilities resulting from ill-conditioned overlap matrices. We find that the condition number of the PAO overlap matrix is independent from the condition number of the underlying extended basis set, and consequently no numerical instabilities are encountered. Various applications are shown to confirm this conclusion and to compare the performance of the PAO method with extended basis-set calculations.

  18. The origin of polarized blackbody radiation from resistively heated multiwalled carbon nanotubes

    International Nuclear Information System (INIS)

    Aliev, Ali E.; Kuznetsov, Alexander A.

    2008-01-01

    We observed very pronounced polarization of light emitted by highly aligned free-standing multiwall carbon nanotube (MWNT) sheet in axial direction which is turned to the perpendicular polarization when a number of layers are increased. The radiation spectrum of resistively heated MWNT sheet closely follows to the Plank's blackbody radiation distribution. The obtained polarization features can be described by a classical dielectric cylindrical shell model, taking into consideration the contribution of delocalized π-electrons (π surface plasmons). In absorption (emission) the optical transverse polarizability, which is much smaller than longitudinal one, is substantially suppressed by depolarization effect due to screening by induced charges. This phenomenon suggests very simple and precise method to estimate the alignment of nanotubes in bundles or large assemblies

  19. Enhanced Macrophage M1 Polarization and Resistance to Apoptosis Enable Resistance to Plague.

    Science.gov (United States)

    Pachulec, Emilia; Abdelwahed Bagga, Rym Ben; Chevallier, Lucie; O'Donnell, Hope; Guillas, Chloé; Jaubert, Jean; Montagutelli, Xavier; Carniel, Elisabeth; Demeure, Christian E

    2017-09-15

    Susceptibility to infection is in part genetically driven, and C57BL/6 mice resist various pathogens through the proinflammatory response of their M1 macrophages (MPs). However, they are susceptible to plague. It has been reported elsewhere that Mus spretus SEG mice resist plague and develop an immune response characterized by a strong recruitment of MPs. The responses of C57BL/6 and SEG MPs exposed to Yersinia pestis in vitro were examined. SEG MPs exhibit a stronger bactericidal activity with higher nitric oxide production, a more proinflammatory polarized cytokine response, and a higher resistance to Y. pestis-induced apoptosis. This response was not specific to Y. pestis and involved a reduced sensitivity to M2 polarization/signal transducer and activator of transcription 6 activation and inhibition of caspase 8. The enhanced M1 profile was inducible in C57BL/6 MPs in vitro, and when transferred to susceptible C57BL/6 mice, these MPs significantly increased survival of bubonic plague. MPs can develop an enhanced functional profile beyond the prototypic M1, characterized by an even more potent proinflammatory response coordinated with resistance to killing. This programming plays a key role in the plague-resistance phenotype and may be similarly significant in other highly lethal infections, suggesting that orienting the MP response may represent a new therapeutic approach. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  20. Polarizing matter and antimatter: A new method

    International Nuclear Information System (INIS)

    Onel, Y.

    1992-02-01

    Several years ago a self-polarization effect for stored (anti)- protons and ions was investigated theoretically. The effect is based on the well-known Stern-Gerlach effect in gradient fields. The aim of the ongoing measurements at the Indiana University Cyclotron Facility (IUCF) is to verify experimentally the various assumptions on which this effect is based. The final goal is to demonstrate this new polarization effect. The proposed effect could be a powerful tool to produce polarized stored hadron beams both in the low-energy range and at SSC and LHC energies. In this progress report we will describe our progress in three parts: (A) Experimental work at IUCF Cooler Ring; (B) Our extensive computer simulations of the spin stability for the IUCF Cooler Ring; and (C) Theoretical studies

  1. Polarization sensitive optical coherence tomography detection method

    International Nuclear Information System (INIS)

    Colston, B W; DaSilva, L B; Everett, M J; Featherstone, J D B; Fried, D; Ragadio, J N; Sathyam, U S.

    1999-01-01

    This study demonstrates the potential of polarization sensitive optical coherence tomography (PS-OCT) for non-invasive in vivo detection and characterization of early, incipient caries lesions. PS-OCT generates cross-sectional images of biological tissue while measuring the effect of the tissue on the polarization state of incident light. Clear discrimination between regions of normal and demineralized enamel is first shown in PS-OCT images of bovine enamel blocks containing well-characterized artificial lesions. High-resolution, cross-sectional images of extracted human teeth are then generated that clearly discriminate between the normal and carious regions on both the smooth and occlusal surfaces. Regions of the teeth that appeared to be demineralized in the PS-OCT images were verified using histological thin sections examined under polarized light microscopy. The PS-OCT system discriminates between normal and carious regions by measuring the polarization state of the back-scattered 1310 nm light, which is affected by the state of demineralization of the enamel. Demineralization of enamel increases the scattering coefficient, thus depolarizing the incident light. This study shows that PS-OCT has great potential for the detection, characterization, and monitoring of incipient caries lesions

  2. The evaluation of the polarization resistance in a tubular electrode and its application to the hydrogen electrode reaction

    International Nuclear Information System (INIS)

    Montero, M.A.; Marozzi, C.A.; Chialvo, M.R. Gennero de; Chialvo, A.C.

    2007-01-01

    An alternative method for the determination of the kinetic parameters involved in the elementary steps of the reaction mechanism of the hydrogen electrode reaction is proposed. It is based on the determination of the variation of the polarization resistance in a tubular platinum electrode with a laminar flow of electrolyte as a function of the activity of protons of the electrolyte solution. A theoretical expression that relates the experimental variables and the equilibrium polarization resistance is developed, which takes into account the current distribution along the electrode surface. The results are compared with others obtained previously, contributing to the verification of the kinetic mechanism through a completely different experimental procedure

  3. A Bionic Polarization Navigation Sensor and Its Calibration Method.

    Science.gov (United States)

    Zhao, Huijie; Xu, Wujian

    2016-08-03

    The polarization patterns of skylight which arise due to the scattering of sunlight in the atmosphere can be used by many insects for deriving compass information. Inspired by insects' polarized light compass, scientists have developed a new kind of navigation method. One of the key techniques in this method is the polarimetric sensor which is used to acquire direction information from skylight. In this paper, a polarization navigation sensor is proposed which imitates the working principles of the polarization vision systems of insects. We introduce the optical design and mathematical model of the sensor. In addition, a calibration method based on variable substitution and non-linear curve fitting is proposed. The results obtained from the outdoor experiments provide support for the feasibility and precision of the sensor. The sensor's signal processing can be well described using our mathematical model. A relatively high degree of accuracy in polarization measurement can be obtained without any error compensation.

  4. PolarTREC: Successful Methods and Tools for Attaining Broad Educational Impacts with Interdisciplinary Polar Science

    Science.gov (United States)

    Timm, K. M.; Warburton, J.; Owens, R.; Warnick, W. K.

    2008-12-01

    PolarTREC--Teachers and Researchers Exploring and Collaborating, a program of the Arctic Research Consortium of the U.S. (ARCUS), is a National Science Foundation (NSF)-funded International Polar Year (IPY) project in which K-12 educators participate in hands-on field experiences in the polar regions, working closely with IPY scientists as a pathway to improving science education. Developing long-term teacher- researcher collaborations through PolarTREC ensures up-to-date climate change science content will permeate the K-12 education system long after the IPY. By infusing education with the cutting edge science from the polar regions, PolarTREC has already shown an increase in student and public knowledge of and interest in the polar regions and global climate change. Preliminary evaluations have shown that PolarTREC's program activities have many positive impacts on educators and their ability to teach science concepts and improve their teaching methods. Additionally, K-12 students polled in interest surveys showed significant changes regarding the importance of understanding the polar regions as a person in today's world. Researchers have been overwhelmingly satisfied with PolarTREC and cited several specific strengths, including the program's crucial link between the teachers' field research experiences and their classroom and the extensive training provided to teachers prior to their expedition. This presentation will focus on other successful components of the PolarTREC program and how researchers and organizations might use these tools to reach out to the public for long-term impacts. Best practices include strategies for working with educators and the development of an internet-based platform for teachers and researchers to interact with the public, combining several communication tools such as online journals and forums, real-time Internet seminars, lesson plans, activities, audio, and other educational resources that address a broad range of scientific

  5. One directional polarized neutron reflectometry with optimized reference layer method

    International Nuclear Information System (INIS)

    Masoudi, S. Farhad; Jahromi, Saeed S.

    2012-01-01

    In the past decade, several neutron reflectometry methods for determining the modulus and phase of the complex reflection coefficient of an unknown multilayer thin film have been worked out among which the method of variation of surroundings and reference layers are of highest interest. These methods were later modified for measurement of the polarization of the reflected beam instead of the measurement of the intensities. In their new architecture, these methods not only suffered from the necessity of change of experimental setup but also another difficulty was added to their experimental implementations. This deficiency was related to the limitations of the technology of the neutron reflectometers that could only measure the polarization of the reflected neutrons in the same direction as the polarization of the incident beam. As the instruments are limited, the theory has to be optimized so that the experiment could be performed. In a recent work, we developed the method of variation of surroundings for one directional polarization analysis. In this new work, the method of reference layer with polarization analysis has been optimized to determine the phase and modulus of the unknown film with measurement of the polarization of the reflected neutrons in the same direction as the polarization of the incident beam.

  6. Polarity-dependent reversible resistance switching in Ge-Sb-Te phase-change thin films

    NARCIS (Netherlands)

    Pandian, Ramanathaswamy; Kooi, Bart J.; Palasantzas, George; De Hosson, Jeff T. M.; Pauza, Andrew

    2007-01-01

    In this paper, we demonstrate reversible resistance switching in a capacitorlike cell using a Ge-Sb-Te film that does not rely on amorphous-crystalline phase change. The polarity of the applied electric field switches the cell resistance between lower- and higher-resistance states, as was observed

  7. Global positioning method based on polarized light compass system

    Science.gov (United States)

    Liu, Jun; Yang, Jiangtao; Wang, Yubo; Tang, Jun; Shen, Chong

    2018-05-01

    This paper presents a global positioning method based on a polarized light compass system. A main limitation of polarization positioning is the environment such as weak and locally destroyed polarization environments, and the solution to the positioning problem is given in this paper which is polarization image de-noising and segmentation. Therefore, the pulse coupled neural network is employed for enhancing positioning performance. The prominent advantages of the present positioning technique are as follows: (i) compared to the existing position method based on polarized light, better sun tracking accuracy can be achieved and (ii) the robustness and accuracy of positioning under weak and locally destroyed polarization environments, such as cloudy or building shielding, are improved significantly. Finally, some field experiments are given to demonstrate the effectiveness and applicability of the proposed global positioning technique. The experiments have shown that our proposed method outperforms the conventional polarization positioning method, the real time longitude and latitude with accuracy up to 0.0461° and 0.0911°, respectively.

  8. A novel polarization demodulation method using polarization beam splitter (PBS) for dynamic pressure sensor

    Science.gov (United States)

    Su, Yang; Zhou, Hua; Wang, Yiming; Shen, Huiping

    2018-03-01

    In this paper we propose a new design to demodulate polarization properties induced by pressure using a PBS (polarization beam splitter), which is different with traditional polarimeter based on the 4-detector polarization measurement approach. The theoretical model is established by Muller matrix method. Experimental results confirm the validity of our analysis. Proportional relationships and linear fit are found between output signal and applied pressure. A maximum sensitivity of 0.092182 mv/mv is experimentally achieved and the frequency response exhibits a <0.14 dB variation across the measurement bandwidth. The sensitivity dependence on incident SOP (state of polarization) is investigated. The simple and all-fiber configuration, low-cost and high speed potential make it promising for fiber-based dynamic pressure sensing.

  9. Chiral retrieval method based on right circularly polarized and left circularly polarized waves

    International Nuclear Information System (INIS)

    Martín, Ernesto; Muñoz, Juan; Margineda, José; Molina-Cuberos, Gregorio J; García-Collado, Ángel J

    2014-01-01

    The free-wave characterization of metamaterials is usually carried out by illuminating a sample with a linearly polarized plane electromagnetic wave. At points before and after the sample, sensors are introduced to measure the transverse components of the field, in order to compute the reflection and transmission coefficients related with the co- and cross-polar field components. Based on this information, retrieval algorithms allow parameters like rotation angle, effective chirality and refraction index to be calculated. Here we propose to use the transmission signals under illumination with plane circularly polarized waves, without sensing the reflection signal, to calculate the chirality parameter and the rotation angle due to the electromagnetic activity of the material. This new method, which allows a simpler characterization of a chiral slab, is applied to the study of metamaterials composed of both periodic and random distributions of metallic structures with chiral symmetry. The experimental results are contrasted with simulations and alternative measurements obtained using linearly polarized waves. (paper)

  10. Analysis of Resistive-Vee Dipole Antennas for Producing Polarization Diversity

    Science.gov (United States)

    2014-08-01

    3 1.2 Existing Circular Polarization GPR Technologies . . . . . . . . . . . . . 4 1.2.1 Crossed-Dipole Antennas...8 1.3 Proposed Circular Polarization GPR System . . . . . . . . . . . . . . . . 10 1.4 Outline...reshaped RVD with the Kim resistive profile is marked by the square. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101 Figure 89

  11. Method of measuring the polarization of high momentum proton beams

    International Nuclear Information System (INIS)

    Underwood, D.G.

    1976-01-01

    A method of measuring the polarization of high momentum proton beams is proposed. This method utilizes the Primakoff effect and relates asymmetries at high energy to large asymmetries already measured at low energy. Such a new method is essential for the success of future experiments at energies where present methods are no longer feasible

  12. Polarization control method for UV writing of advanced bragg gratings

    DEFF Research Database (Denmark)

    Deyerl, Hans-Jürgen; Plougmann, Nikolai; Jensen, Jesper Bo Damm

    2002-01-01

    We report the application of the polarization control method for the UV writing of advanced fiber Bragg gratings (FBG). We demonstrate the strength of the new method for different apodization profiles, including the Sinc-profile and two designs for dispersion-free square filters. The method has...

  13. A novel x-ray circularly polarized ranging method

    International Nuclear Information System (INIS)

    Song Shi-Bin; Xu Lu-Ping; Zhang Hua; Shen Yang-He; Gao Na

    2015-01-01

    Range measurement has found multiple applications in deep space missions. With more and further deep space exploration activities happening now and in the future, the requirement for range measurement has risen. In view of the future ranging requirement, a novel x-ray polarized ranging method based on the circular polarization modulation is proposed, termed as x-ray circularly polarized ranging (XCPolR). XCPolR utilizes the circular polarization modulation to process x-ray signals and the ranging information is conveyed by the circular polarization states. As the circular polarization states present good stability in space propagation and x-ray detectors have light weight and low power consumption, XCPolR shows great potential in the long-distance range measurement and provides an option for future deep space ranging. In this paper, we present a detailed illustration of XCPolR. Firstly, the structure of the polarized ranging system is described and the signal models in the ranging process are established mathematically. Then, the main factors that affect the ranging accuracy, including the Doppler effect, the differential demodulation, and the correlation error, are analyzed theoretically. Finally, numerical simulation is carried out to evaluate the performance of XCPolR. (paper)

  14. Results of polarization resistance and impedance of steel bars embedded in carbonated concrete contaminated with chlorides

    International Nuclear Information System (INIS)

    Andrade, C.; Alonso, C.; Gonzalez, J.A.

    1989-01-01

    Laboratory results of the corrosion rate of steel embedded in carbonated concrete contaminated with chlorides determined through the Polarization Resistance method are presented here as examples of the possibilities offered by this technique in order to monitor the reinforcement corrosion process. The Rp technique has the advantages of fast response, simple and relatively accurate. Contrasts with gravimetric losses are presented. The A.C. Impedance measurements determined on the same specimens are also presented. The difficulties found in the interpretation of the results are stressed. R T values cannot easily be obtained. Several electrical circuits which may model the behaviour of the steel/concrete system are discussed. Finally, comments on the basic criteria to interpret results of both techniques are given. (author) 4 refs., 6 figs

  15. A method for the accurate determination of the polarization of a neutron beam using a polarized 3He spin filter

    International Nuclear Information System (INIS)

    Greene, G.L.; Thompson, A.K.; Dewey, M.S.

    1995-01-01

    A new method for the accurate determination of the degree of polarization of a neutron beam which has been polarized by transmission through a spin polarized 3 He cell is given. The method does not require the use of an analyzer or spin flipper nor does it require an accurate independent determination of the 3 He polarization. The method provides a continuous on-line determination of the neutron polarization. The method may be of use in the accurate determination of correlation coefficients in neutron beta decay which provide a test of the standard model for the electroweak interaction. The method may also provide an accurate procedure for the calibration of polarized 3 He targets used in medium and high energy scattering experiments. ((orig.))

  16. Modeling and inversion Matlab algorithms for resistivity, induced polarization and seismic data

    Science.gov (United States)

    Karaoulis, M.; Revil, A.; Minsley, B. J.; Werkema, D. D.

    2011-12-01

    M. Karaoulis (1), D.D. Werkema (3), A. Revil (1,2), A., B. Minsley (4), (1) Colorado School of Mines, Dept. of Geophysics, Golden, CO, USA. (2) ISTerre, CNRS, UMR 5559, Université de Savoie, Equipe Volcan, Le Bourget du Lac, France. (3) U.S. EPA, ORD, NERL, ESD, CMB, Las Vegas, Nevada, USA . (4) USGS, Federal Center, Lakewood, 10, 80225-0046, CO. Abstract We propose 2D and 3D forward modeling and inversion package for DC resistivity, time domain induced polarization (IP), frequency-domain IP, and seismic refraction data. For the resistivity and IP case, discretization is based on rectangular cells, where each cell has as unknown resistivity in the case of DC modelling, resistivity and chargeability in the time domain IP modelling, and complex resistivity in the spectral IP modelling. The governing partial-differential equations are solved with the finite element method, which can be applied to both real and complex variables that are solved for. For the seismic case, forward modeling is based on solving the eikonal equation using a second-order fast marching method. The wavepaths are materialized by Fresnel volumes rather than by conventional rays. This approach accounts for complicated velocity models and is advantageous because it considers frequency effects on the velocity resolution. The inversion can accommodate data at a single time step, or as a time-lapse dataset if the geophysical data are gathered for monitoring purposes. The aim of time-lapse inversion is to find the change in the velocities or resistivities of each model cell as a function of time. Different time-lapse algorithms can be applied such as independent inversion, difference inversion, 4D inversion, and 4D active time constraint inversion. The forward algorithms are benchmarked against analytical solutions and inversion results are compared with existing ones. The algorithms are packaged as Matlab codes with a simple Graphical User Interface. Although the code is parallelized for multi

  17. Resistivity and Induced Polarization Imaging at a Hydrocarbon Contaminated Site in Brazil

    Science.gov (United States)

    Ustra, A.; Elis, V.; Hiodo, F.; Bondioli, A.; Miura, G.

    2012-12-01

    An area contaminated by accidental BTEX spills was investigated with resistivity and induced polarization methods. The main objective in this study was to relate the geophysical signature of the area with zones that were possibly undergoing microbial degradation of the contaminants. The spills took place over a decade ago; however, the exact location of these spills is unknown, as well as the amount of contaminant that was released into the subsurface. DC-resistivity identified a high contrast between the background (rho up to 2000 ohm.m) and a relatively conductive zone (rho 30 mV/V). Normalized chargeability is enhanced in this anomaly zone (mn > 0.1). Soil samples collected in the area were submitted to direct bacterial count, clay content estimation, X-ray diffraction and SEM analysis. The electrical properties of each samples was also measured. The samples collected from the "background" (high resistivity zone) presented total bacterial amounts much smaller (dozens of colony forming units) than the samples from the conductive zone (millions of colony forming units). This observation could lead us to interpret that the zone of higher bacteria amount is undergoing biodegradation that would explain the increased conductivity at that portion of the subsurface. However, the geophysical properties observed at this zone could also be related to the clay content distribution throughout the surveyed area (concentrations up to 30%). Moreover, despite the fact that more microbes were found in the area, SEM images did not find any biodegradation typical feature of the grains, which are for example, mineral corrosion and dissolution or even biomineralization. This study is still undergoing and we are searching for more evidence of biodegradation in the samples. This study shows the limitation of the use of geophysical methods to access contaminant presence and/or biodegradation zones when the exact location of the contamination is unknown.

  18. A novel x-ray circularly polarized ranging method

    Science.gov (United States)

    Song, Shi-Bin; Xu, Lu-Ping; Zhang, Hua; Gao, Na; Shen, Yang-He

    2015-05-01

    Range measurement has found multiple applications in deep space missions. With more and further deep space exploration activities happening now and in the future, the requirement for range measurement has risen. In view of the future ranging requirement, a novel x-ray polarized ranging method based on the circular polarization modulation is proposed, termed as x-ray circularly polarized ranging (XCPolR). XCPolR utilizes the circular polarization modulation to process x-ray signals and the ranging information is conveyed by the circular polarization states. As the circular polarization states present good stability in space propagation and x-ray detectors have light weight and low power consumption, XCPolR shows great potential in the long-distance range measurement and provides an option for future deep space ranging. In this paper, we present a detailed illustration of XCPolR. Firstly, the structure of the polarized ranging system is described and the signal models in the ranging process are established mathematically. Then, the main factors that affect the ranging accuracy, including the Doppler effect, the differential demodulation, and the correlation error, are analyzed theoretically. Finally, numerical simulation is carried out to evaluate the performance of XCPolR. Projects supported by the National Natural Science Foundation of China (Grant Nos. 61172138 and 61401340), the Natural Science Basic Research Plan in Shaanxi Province of China (Grant No. 2013JQ8040), the Research Fund for the Doctoral Program of Higher Education of China (Grant No. 20130203120004), the Open Research Fund of the Academy of Satellite Application, China (Grant No. 2014 CXJJ-DH 12), the Xi’an Science and Technology Plan, China (Grant No. CXY1350(4)), the Fundamental Research Funds for the Central Universities, China (Grant Nos. 201413B, 201412B, and JB141303), and the Open Fund of Key Laboratory of Precision Navigation and Timing Technology, National Time Service Center, Chinese

  19. Analytical method for establishing indentation rolling resistance

    Directory of Open Access Journals (Sweden)

    Gładysiewicz Lech

    2018-01-01

    Full Text Available Belt conveyors are highly reliable machines able to work in special operating conditions. Harsh environment, long distance of transporting and great mass of transported martials are cause of high energy usage. That is why research in the field of belt conveyor transportation nowadays focuses on reducing the power consumption without lowering their efficiency. In this paper, previous methods for testing rolling resistance are described, and new method designed by authors was presented. New method of testing rolling resistance is quite simple and inexpensive. Moreover it allows to conduct the experimental tests of the impact of different parameters on the value of indentation rolling resistance such as core design, cover thickness, ambient temperature, idler travel frequency, or load value as well. Finally results of tests of relationship between rolling resistance and idler travel frequency and between rolling resistance and idler travel speed was presented.

  20. Analytical method for establishing indentation rolling resistance

    Science.gov (United States)

    Gładysiewicz, Lech; Konieczna, Martyna

    2018-01-01

    Belt conveyors are highly reliable machines able to work in special operating conditions. Harsh environment, long distance of transporting and great mass of transported martials are cause of high energy usage. That is why research in the field of belt conveyor transportation nowadays focuses on reducing the power consumption without lowering their efficiency. In this paper, previous methods for testing rolling resistance are described, and new method designed by authors was presented. New method of testing rolling resistance is quite simple and inexpensive. Moreover it allows to conduct the experimental tests of the impact of different parameters on the value of indentation rolling resistance such as core design, cover thickness, ambient temperature, idler travel frequency, or load value as well. Finally results of tests of relationship between rolling resistance and idler travel frequency and between rolling resistance and idler travel speed was presented.

  1. Field Trials of the Multi-Source Approach for Resistivity and Induced Polarization Data Acquisition

    Science.gov (United States)

    LaBrecque, D. J.; Morelli, G.; Fischanger, F.; Lamoureux, P.; Brigham, R.

    2013-12-01

    with depths of exploration ranging from 150 to 450 m. The sites included shallow geothermal sites near Reno Nevada, Pomarance Italy, and Volterra Italy; a mineral exploration site near Timmins Quebec; and a landslide investigation near Vajont Dam in northern Italy. These sites provided a series of challenges in survey design and deployment including some extremely difficult terrain and a broad range of background resistivity and induced values. Despite these challenges, comparison of multi-source results to resistivity and induced polarization data collection with more traditional methods support the thesis that the multi-source approach is capable of providing substantial improvements in both depth of penetration and resolution over conventional approaches.

  2. Ionization detector, electrode configuration and single polarity charge detection method

    Science.gov (United States)

    He, Z.

    1998-07-07

    An ionization detector, an electrode configuration and a single polarity charge detection method each utilize a boundary electrode which symmetrically surrounds first and second central interlaced and symmetrical electrodes. All of the electrodes are held at a voltage potential of a first polarity type. The first central electrode is held at a higher potential than the second central or boundary electrodes. By forming the first and second central electrodes in a substantially interlaced and symmetrical pattern and forming the boundary electrode symmetrically about the first and second central electrodes, signals generated by charge carriers are substantially of equal strength with respect to both of the central electrodes. The only significant difference in measured signal strength occurs when the charge carriers move to within close proximity of the first central electrode and are received at the first central electrode. The measured signals are then subtracted and compared to quantitatively measure the magnitude of the charge. 10 figs.

  3. Arbitrary Control of Polarization and Intensity Profiles of Diffraction-Attenuation-Resistant Beams along the Propagation Direction

    Science.gov (United States)

    Corato-Zanarella, Mateus; Dorrah, Ahmed H.; Zamboni-Rached, Michel; Mojahedi, Mo

    2018-02-01

    We report on the theory and experimental generation of a class of diffraction-attenuation-resistant beams with state of polarization (SOP) and intensity that can be controlled on demand along the propagation direction. This control is achieved by a suitable superposition of Bessel beams, whose parameters are systematically chosen based on closed-form analytic expressions provided by the frozen waves method. Using an amplitude-only spatial light modulator, we experimentally demonstrate three scenarios. In the first, the SOP of a horizontally polarized beam evolves to radial polarization and is then changed to vertical polarization, with the beam intensity held constant. In the second, we simultaneously control the SOP and the longitudinal intensity profile, which is chosen such that the beam's central ring can be switched off over predefined space regions, thus generating multiple foci with different SOPs and at different intensity levels along the propagation. Finally, the ability to control the SOP while overcoming attenuation inside lossy fluids is shown experimentally. We envision our proposed method to be of great interest for many applications, such as optical tweezers, atom guiding, material processing, microscopy, and optical communications.

  4. Evaluation of Extraction Protocols for Simultaneous Polar and Non-Polar Yeast Metabolite Analysis Using Multivariate Projection Methods

    Directory of Open Access Journals (Sweden)

    Nicolas P. Tambellini

    2013-07-01

    Full Text Available Metabolomic and lipidomic approaches aim to measure metabolites or lipids in the cell. Metabolite extraction is a key step in obtaining useful and reliable data for successful metabolite studies. Significant efforts have been made to identify the optimal extraction protocol for various platforms and biological systems, for both polar and non-polar metabolites. Here we report an approach utilizing chemoinformatics for systematic comparison of protocols to extract both from a single sample of the model yeast organism Saccharomyces cerevisiae. Three chloroform/methanol/water partitioning based extraction protocols found in literature were evaluated for their effectiveness at reproducibly extracting both polar and non-polar metabolites. Fatty acid methyl esters and methoxyamine/trimethylsilyl derivatized aqueous compounds were analyzed by gas chromatography mass spectrometry to evaluate non-polar or polar metabolite analysis. The comparative breadth and amount of recovered metabolites was evaluated using multivariate projection methods. This approach identified an optimal protocol consisting of 64 identified polar metabolites from 105 ion hits and 12 fatty acids recovered, and will potentially attenuate the error and variation associated with combining metabolite profiles from different samples for untargeted analysis with both polar and non-polar analytes. It also confirmed the value of using multivariate projection methods to compare established extraction protocols.

  5. A method to calculate Stokes parameters and angle of polarization of skylight from polarized CIMEL sun/sky radiometers

    International Nuclear Information System (INIS)

    Li, L.; Li, Z.; Li, K.; Blarel, L.; Wendisch, M.

    2014-01-01

    The polarized CIMEL sun/sky radiometers have been routinely operated within the Sun/sky-radiometer Observation NETwork (SONET) in China and some sites of the AErosol RObotic NETwork (AERONET) around the world. However, the polarization measurements are not yet widely used due to in a certain degree the lack of Stokes parameters derived directly from these polarization measurements. Meanwhile, it have been shown that retrievals of several microphysical properties of aerosol particles can be significantly improved by using degree of linear polarization (DoLP) measurements of polarized CIMEL sun/sky radiometers (CE318-DP). The Stokes parameters Q and U, as well as angle of polarization (AoP) contain additional information about linear polarization and its orientation. A method to calculate Stokes parameters Q, U, and AoP from CE318-DP polarized skylight measurements is introduced in this study. A new polarized almucantar geometry based on CE318-DP is measured to illustrate abundant variation features of these parameters. The polarization parameters calculated in this study are consistent with previous results of DoLP and I, and also comparable to vector radiative transfer simulations. - Highlights: • The CE318-DP polarized measurements are not yet widely used except DoLP. • Compared with DoLP and I, difficulty in calculating Stokes Q and U is discussed. • A new polarized almucantar observation geometry based on CE318-DP is executed. • We derive Stokes Q, U, and AoP both in principal and almucantar plane geometries. • The results are comparable with previous DoLP and I, as well as model simulations

  6. Polarization and resistivity measurements of post-crystallization changes in amorphous Fe-B-Si alloys

    International Nuclear Information System (INIS)

    Chattoraj, I.; Bhattamishra, A.K.; Mitra, A.

    1993-01-01

    The effects of grain growth and compositional changes on the electrochemical behavior and the resistivity of amorphous iron-boron-silicon (Fe 77.5 B 15 Si 7.5 ) alloys after crystallization were studied. Deterioration of the protective passive film was observed, along with increased annealing. Potentiodynamic polarization provided excellent information about microstructural and chemical changes. It was concluded that electrochemical measurements could be used in conjunction with resistivity measurements in direct studies of grain growth and chemical changes occurring in different phases of the devitrified alloy

  7. The use of the multiple-gradient array for geoelectrical resistivity and induced polarization imaging

    Science.gov (United States)

    Aizebeokhai, Ahzegbobor P.; Oyeyemi, Kehinde D.

    2014-12-01

    The use of most conventional electrode configurations in electrical resistivity survey is often time consuming and labour intensive, especially when using manual data acquisition systems. Often, data acquisition teams tend to reduce data density so as to speed up field operation thereby reducing the survey cost; but this could significantly degrade the quality and resolution of the inverse models. In the present work, the potential of using the multiple-gradient array, a non-conventional electrode configuration, for practical cost effective and rapid subsurface resistivity and induced polarization mapping was evaluated. The array was used to conduct 2D resistivity and time-domain induced polarization imaging along two traverses in a study site at Ota, southwestern Nigeria. The subsurface was characterised and the main aquifer delineated using the inverse resistivity and chargeability images obtained. The performance of the multiple-gradient array was evaluated by correlating the 2D resistivity and chargeability images with those of the conventional Wenner array as well as the result of some soundings conducted along the same traverses using Schlumberger array. The multiple-gradient array has been found to have the advantage of measurement logistics and improved image resolution over the Wenner array.

  8. Polarization methods for diode laser excitation of solid state lasers

    Science.gov (United States)

    Holtom, Gary R.

    2008-11-25

    A mode-locked laser employs a coupled-polarization scheme for efficient longitudinal pumping by reshaped laser diode bars. One or more dielectric polarizers are configured to reflect a pumping wavelength having a first polarization and to reflect a lasing wavelength having a second polarization. A Yb-doped gain medium can be used that absorbs light having a first polarization and emits light having a second polarization. Using such pumping with laser cavity dispersion control, pulse durations of less than 100 fs can be achieved.

  9. Mapping geological structures in bedrock via large-scale direct current resistivity and time-domain induced polarization tomography

    DEFF Research Database (Denmark)

    Rossi, Matteo; Olsson, Per-Ivar; Johansson, Sara

    2017-01-01

    -current resistivity distribution of the subsoil and the phase of the complex conductivity using a constant-phase angle model. The joint interpretation of electrical resistivity and induced-polarization models leads to a better understanding of complex three-dimensional subsoil geometries. The results have been......An investigation of geological conditions is always a key point for planning infrastructure constructions. Bedrock surface and rock quality must be estimated carefully in the designing process of infrastructures. A large direct-current resistivity and time-domain induced-polarization survey has......, there are northwest-trending Permian dolerite dykes that are less deformed. Four 2D direct-current resistivity and time-domain induced-polarization profiles of about 1-km length have been carefully pre-processed to retrieve time-domain induced polarization responses and inverted to obtain the direct...

  10. On some methods to produce high-energy polarized electron beams by means of proton synchrotrons

    International Nuclear Information System (INIS)

    Bessonov, E.G.; Vazdik, Ya.A.

    1980-01-01

    Some methods of production of high-energy polarized electron beams by means of proton synchrotrons are considered. These methods are based on transfer by protons of a part of their energy to the polarized electrons of a thin target placed inside the working volume of the synchrotron. It is suggested to use as a polarized electron target a magnetized crystalline iron in which proton channeling is realized, polarized atomic beams and the polarized plasma. It is shown that by this method one can produce polarized electron beams with energy approximately 100 GeV, energy spread +- 5 % and intensity approximately 10 7 electron/c, polarization approximately 30% and with intensity approximately 10 4 -10 5 electron/c, polarization approximately 100% [ru

  11. Extended discrete-ordinate method considering full polarization state

    International Nuclear Information System (INIS)

    Box, Michael A.; Qin Yi

    2006-01-01

    This paper presents an extension to the standard discrete-ordinate method (DOM) to consider generalized sources including: beam sources which can be placed at any (vertical) position and illuminate in any direction, thermal emission from the atmosphere and angularly distributed sources which illuminate from a surface as continuous functions of zenith and azimuth angles. As special cases, the thermal emission from the surface and deep space can be implemented as angularly distributed sources. Analytical-particular solutions for all source types are derived using the infinite medium Green's function. Radiation field zenith angle interpolation using source function integration is developed for all source types. The development considers the full state of polarization, including the sources (as applicable) and the (BRDF) surface, but the development can be reduced easily to scalar problems and is ready to be implemented in a single set of code for both scalar and vector radiative transfer computation

  12. Extended discrete-ordinate method considering full polarization state

    Energy Technology Data Exchange (ETDEWEB)

    Box, Michael A. [School of Physics, University of New South Wales (Australia)]. E-mail: m.box@unsw.edu.au; Qin Yi [School of Physics, University of New South Wales (Australia)]. E-mail: yi.qin@csiro.au

    2006-01-15

    This paper presents an extension to the standard discrete-ordinate method (DOM) to consider generalized sources including: beam sources which can be placed at any (vertical) position and illuminate in any direction, thermal emission from the atmosphere and angularly distributed sources which illuminate from a surface as continuous functions of zenith and azimuth angles. As special cases, the thermal emission from the surface and deep space can be implemented as angularly distributed sources. Analytical-particular solutions for all source types are derived using the infinite medium Green's function. Radiation field zenith angle interpolation using source function integration is developed for all source types. The development considers the full state of polarization, including the sources (as applicable) and the (BRDF) surface, but the development can be reduced easily to scalar problems and is ready to be implemented in a single set of code for both scalar and vector radiative transfer computation.

  13. 77 GHz MEMS antennas on high-resistivity silicon for linear and circular polarization

    KAUST Repository

    Sallam, M. O.

    2011-07-01

    Two new MEMS antennas operating at 77 GHz are presented in this paper. The first antenna is linearly polarized. It possesses a vertical silicon wall that carries a dipole on top of it. The wall is located on top of silicon substrate covered with a ground plane. The other side of the substrate carries a microstrip feeding network in the form of U-turn that causes 180 phase shift. This phase-shifter feeds the arms of the dipole antenna via two vertical Through-Silicon Vias (TSVs) that go through the entire wafer. The second antenna is circularly polarized and formed using two linearly polarized antennas spatially rotated with respect to each other by 90 and excited with 90 phase shift. Both antennas are fabricated using novel process flow on a single high-resistivity silicon wafer via bulk micromachining. Only three processing steps are required to fabricate these antennas. The proposed antennas have appealing characteristics, such as high polarization purity, high gain, and high radiation efficiency. © 2011 IEEE.

  14. FNDC5 attenuates adipose tissue inflammation and insulin resistance via AMPK-mediated macrophage polarization in obesity.

    Science.gov (United States)

    Xiong, Xiao-Qing; Geng, Zhi; Zhou, Bing; Zhang, Feng; Han, Ying; Zhou, Ye-Bo; Wang, Jue-Jin; Gao, Xing-Ya; Chen, Qi; Li, Yue-Hua; Kang, Yu-Ming; Zhu, Guo-Qing

    2018-06-01

    Obesity-induced chronic inflammation is critical in the pathogenesis of insulin resistance, and the recruitment and proinflammatory activation of adipose tissue macrophages (ATMs) is important for the development of this process. Here, we examined the effects of fibronectin type III domain-containing 5 (FNDC5) on inflammation and insulin resistance in high-fat diet-induced obese mice. Male wild-type (WT) and FNDC5 -/- mice were fed with standard chow (Ctrl) or high fat diet (HFD) for 20 weeks to induce obesity and insulin resistance. Firstly, effects of FNDC5 gene deletion on obesity, insulin resistance, macrophage accumulation and polarization and adipose tissue inflammation were determined in mice. Secondly, the macrophage polarity shift was further examined with flow cytometry in isolated stromal vascular fraction (SVF). Thirdly, the effects of exogenous FNDC5 on lipopolysaccharide (LPS)-induced macrophage polarization, inflammation and the underlying signaling mechanism were investigated in RAW264.7 macrophages and primary mouse peritoneal cavity macrophages (PMs). Finally, the therapeutic effects of FNDC5 overexpression were examined in HFD-induced obese WT and FNDC5 -/- mice. FNDC5 gene deletion aggravated obesity, insulin resistance, fat accumulation and inflammation accompanied with enhanced AMPK inhibition, macrophages recruitment and M1 polarization in mice fed with HFD. Exogenous FNDC5 inhibited LPS-induced M1 macrophage polarization and inflammatory cytokine production via AMPK phosphorylation in both RAW264.7 macrophages and PMs. FNDC5 overexpression attenuated insulin resistance, AMPK inhibition, M1 macrophage polarization and inflammatory cytokine production in adipose tissue of obese WT and FNDC5 -/- mice. FNDC5 attenuates adipose tissue inflammation and insulin resistance via AMPK-mediated macrophage polarization in HFD-induced obesity. FNDC5 plays several beneficial roles in obesity and may be used as a therapeutic regimen for preventing

  15. Corrosion characterization of in-situ titanium diboride (TiB2) reinforced aluminium-copper (Al-Cu) alloy by two methods: Salts spray fog and linear polarization resistance (LPR)

    Science.gov (United States)

    Rosmamuhamadani, R.; Talari, M. K.; Yahaya, Sabrina M.; Sulaiman, S.; Ismail, M. I. S.; Hanim, M. A. Azmah

    2018-05-01

    Aluminium-copper (Al-Cu) alloys is the one of most Metal Matrix Composites (MMCs) have important high-strength Al alloys. The aluminium (Al) casting alloys, based on the Al-Cu system are widely used in light-weight constructions and transport applications requiring a combination of high strength and ductility. In this research, Al-Cu master alloy was reinforced with 3 and 6wt.% titanium diboride (TiB2) that obtained from salts route reactions. The salts used were were potassium hexafluorotitanate (K2TiF6) and potassium tetrafluoroborate (KBF4). The salts route reaction process were done at 800 °C. The Al-Cu alloy then has characterized on the mechanical properties and microstructure characterization. Salts spray fog test and Gamry-electrode potentiometer instruments were used to determine the corrosion rate of this alloys. From results obtained, the increasement of 3wt.%TiB2 contents will decrease the value of the corrosion rate. In corrosion test that conducted both of salt spray fog and Gamry-electrode potentiometer, the addition of 3wt.%TiB2 gave the good properties in corrosion characterization compare to Al-Cu-6wt.%TiB2 and Al-Cu cast alloy itself. As a comparison, Al-Cu with 3wt.%TiB2 gave the lowest value of corrosion rate, which means alloy has good properties in corrosion characterization. The results obtained show that in-situ Al-Cu alloy composites containing the different weight of TiB2 phase were synthesized successfully by the salt-metal reaction method.

  16. Oxide properties of autoclaved zircaloy cladding tubes investigated by the photoelectric polarization method

    International Nuclear Information System (INIS)

    Nystrand, A.C.

    2000-06-01

    Corrosion of zirconium alloys is an important lifetime limiting factor for the nuclear reactor fuel. The corrosion resistance of a metal is highly dependent on the ability of the surface metal oxide to transport electrons and ions, which is related to the stoichiometry of the oxide and the oxide defect concentration. The Photoelectric Polarization Method (PEP) is a structure sensitive method which earlier has been investigated as a possible method to study the defect structure in zirconium oxides. The purpose of the following work is, by using more optimized experimental equipment, to verify if the PEP method is a suitable method to study the defect structure in zirconium oxides and to predict the corrosion resistance for different zirconium alloys. The conclusions from the experiments are as follows: - The modifications of the experimental setup by means of a new source of light (deuterium lamp) and a new oscilloscope with an amplifier gave distinct Vpep signals. - The photoresponse is negative for all types of cladding and under all kind of oxidation regimes and hence the oxide is a n-type semiconductor with deficiency of oxygen. - The method needs to be verified by testing semiconductors with a known defect concentration

  17. Method for universal detection of two-photon polarization entanglement

    Science.gov (United States)

    Bartkiewicz, Karol; Horodecki, Paweł; Lemr, Karel; Miranowicz, Adam; Życzkowski, Karol

    2015-03-01

    Detecting and quantifying quantum entanglement of a given unknown state poses problems that are fundamentally important for quantum information processing. Surprisingly, no direct (i.e., without quantum tomography) universal experimental implementation of a necessary and sufficient test of entanglement has been designed even for a general two-qubit state. Here we propose an experimental method for detecting a collective universal witness, which is a necessary and sufficient test of two-photon polarization entanglement. It allows us to detect entanglement for any two-qubit mixed state and to establish tight upper and lower bounds on its amount. A different element of this method is the sequential character of its main components, which allows us to obtain relatively complicated information about quantum correlations with the help of simple linear-optical elements. As such, this proposal realizes a universal two-qubit entanglement test within the present state of the art of quantum optics. We show the optimality of our setup with respect to the minimal number of measured quantities.

  18. A Simplified, Low-Cost Method for Polarized Light Microscopy

    Science.gov (United States)

    Maude, Richard J.; Buapetch, Wanchana; Silamut, Kamolrat

    2009-01-01

    Malaria pigment is an intracellular inclusion body that appears in blood and tissue specimens on microscopic examination and can help in establishing the diagnosis of malaria. In simple light microscopy, it can be difficult to discern from cellular background and artifacts. It has long been known that if polarized light microscopy is used, malaria pigment can be much easier to distinguish. However, this technique is rarely used because of the need for a relatively costly polarization microscope. We describe a simple and economical technique to convert any standard light microscope suitable for examination of malaria films into a polarization microscope. PMID:19861611

  19. Apparatus and methods for memory using in-plane polarization

    Science.gov (United States)

    Liu, Junwei; Chang, Kai; Ji, Shuai-Hua; Chen, Xi; Fu, Liang

    2018-05-01

    A memory device includes a semiconductor layer with an in-plane polarization component switchable between a first direction and a second direction. A writing electrode is employed to apply a writing voltage to the semiconductor layer to change the in-plane polarization component between the first direction and the second direction. A reading electrode is employed to apply a reading voltage to the semiconductor layer to measure a tunneling current substantially perpendicular to the polarization direction of the in-plane polarization component. The directions of the reading voltage and the writing voltage are substantially perpendicular to each other. Therefore, the reading process is non-destructive. Thin films (e.g., one unit cell thick) of ferroelectric material can be used in the memory device to increase the miniaturization of the device.

  20. The electrical resistivity method in cased boreholes

    Energy Technology Data Exchange (ETDEWEB)

    Schenkel, C.J.

    1991-05-01

    The use of downhole current sources in resistivity mapping can greatly enhance the detection and delineation of subsurface features. The purpose of this work is to examine the resistivity method for current sources in wells cased with steel. The resistivity method in cased boreholes with downhole current sources is investigated using the integral equation (IE) technique. The casing and other bodies are characterized as conductivity inhomogeneities in a half-space. For sources located along the casing axis, an axially symmetric Green's function is used to formulate the surface potential and electric field (E-field) volume integral equations. The situations involving off-axis current sources and three-dimensional (3-D) bodies is formulated using the surface potential IE method. The solution of the 3-D Green's function is presented in cylindrical and Cartesian coordinate systems. The methods of moments is used to solve the Fredholm integral equation of the second kind for the response due to the casing and other bodies. The numerical analysis revealed that the current in the casing can be approximated by its vertical component except near the source and the axial symmetric approximation of the casing is valid even for the 3-D problem. The E-field volume IE method is an effective and efficient technique to simulate the response of the casing in a half-space, whereas the surface potential approach is computationally better when multiple bodies are involved. Analyzing several configurations of the current source indicated that the casing response is influenced by four characteristic factors: conduction length, current source depth,casing depth, and casing length. 85 refs., 133 figs., 11 tabs.

  1. CTLA-4Ig immunotherapy of obesity-induced insulin resistance by manipulation of macrophage polarization in adipose tissues

    International Nuclear Information System (INIS)

    Fujii, Masakazu; Inoguchi, Toyoshi; Batchuluun, Battsetseg; Sugiyama, Naonobu; Kobayashi, Kunihisa; Sonoda, Noriyuki; Takayanagi, Ryoichi

    2013-01-01

    Highlights: •CTLA-4Ig completely alleviates HFD-induced insulin resistance. •CTLA-4Ig reduces epididymal and subcutaneous fat tissue weight and adipocyte size. •CTLA-4Ig alters ATM polarization from inflammatory M1 to anti-inflammatory M2. •CTLA-4Ig may lead to a novel anti-obesity/inflammation/insulin resistance agent. •We identified the mechanism of the novel favorable effects of CTLA-4lg. -- Abstract: It has been established that obesity alters the metabolic and endocrine function of adipose tissue and, together with accumulation of adipose tissue macrophages, contributes to insulin resistance. Although numerous studies have reported that shifting the polarization of macrophages from M1 to M2 can alleviate adipose tissue inflammation, manipulation of macrophage polarization has not been considered as a specific therapy. Here, we determined whether cytotoxic T-lymphocyte-associated antigen-4IgG1 (CTLA-4Ig) can ameliorate insulin resistance by induction of macrophages from proinflammatory M1 to anti-inflammatory M2 polarization in the adipose tissues of high fat diet-induced insulin-resistant mice. CTLA4-Ig treatment prevented insulin resistance by changing gene expression to M2 polarization, which increased the levels of arginase 1. Furthermore, flow cytometric analysis confirmed the alteration of polarization from CD11c (M1)- to CD206 (M2)-positive cells. Concomitantly, CTLA-4Ig treatment resulted in weight reductions of epididymal and subcutaneous adipose tissues, which may be closely related to overexpression of apoptosis inhibitors in macrophages. Moreover, proinflammatory cytokine and chemokine levels decreased significantly. In contrast, CCAAT enhancer binding protein α, peroxisome proliferator-activated receptor γ, and adiponectin expression increased significantly in subcutaneous adipose tissue. This novel mechanism of CTLA-4lg immunotherapy may lead to an ideal anti-obesity/inflammation/insulin resistance agent

  2. CTLA-4Ig immunotherapy of obesity-induced insulin resistance by manipulation of macrophage polarization in adipose tissues

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Masakazu, E-mail: masakazu731079@yahoo.co.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Inoguchi, Toyoshi, E-mail: toyoshi@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Batchuluun, Battsetseg, E-mail: battsetseg.batchuluun@gmail.com [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Sugiyama, Naonobu, E-mail: nao1@intmed1.med.kyushu-u.ac.jp [Department of Medicine and Biosystemic Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Kobayashi, Kunihisa, E-mail: nihisak@fukuoka-u.ac.jp [Department of Endocrinology and Diabetes Mellitus, Fukuoka University Chikushi Hospital, 1-1-1 Zokumyoin, Chikushino, Fukuoka 818-8502 (Japan); Sonoda, Noriyuki, E-mail: noriyuki@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Takayanagi, Ryoichi, E-mail: takayana@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2013-08-16

    Highlights: •CTLA-4Ig completely alleviates HFD-induced insulin resistance. •CTLA-4Ig reduces epididymal and subcutaneous fat tissue weight and adipocyte size. •CTLA-4Ig alters ATM polarization from inflammatory M1 to anti-inflammatory M2. •CTLA-4Ig may lead to a novel anti-obesity/inflammation/insulin resistance agent. •We identified the mechanism of the novel favorable effects of CTLA-4lg. -- Abstract: It has been established that obesity alters the metabolic and endocrine function of adipose tissue and, together with accumulation of adipose tissue macrophages, contributes to insulin resistance. Although numerous studies have reported that shifting the polarization of macrophages from M1 to M2 can alleviate adipose tissue inflammation, manipulation of macrophage polarization has not been considered as a specific therapy. Here, we determined whether cytotoxic T-lymphocyte-associated antigen-4IgG1 (CTLA-4Ig) can ameliorate insulin resistance by induction of macrophages from proinflammatory M1 to anti-inflammatory M2 polarization in the adipose tissues of high fat diet-induced insulin-resistant mice. CTLA4-Ig treatment prevented insulin resistance by changing gene expression to M2 polarization, which increased the levels of arginase 1. Furthermore, flow cytometric analysis confirmed the alteration of polarization from CD11c (M1)- to CD206 (M2)-positive cells. Concomitantly, CTLA-4Ig treatment resulted in weight reductions of epididymal and subcutaneous adipose tissues, which may be closely related to overexpression of apoptosis inhibitors in macrophages. Moreover, proinflammatory cytokine and chemokine levels decreased significantly. In contrast, CCAAT enhancer binding protein α, peroxisome proliferator-activated receptor γ, and adiponectin expression increased significantly in subcutaneous adipose tissue. This novel mechanism of CTLA-4lg immunotherapy may lead to an ideal anti-obesity/inflammation/insulin resistance agent.

  3. Iterative Methods for the Non-LTE Transfer of Polarized Radiation: Resonance Line Polarization in One-dimensional Atmospheres

    Science.gov (United States)

    Trujillo Bueno, Javier; Manso Sainz, Rafael

    1999-05-01

    This paper shows how to generalize to non-LTE polarization transfer some operator splitting methods that were originally developed for solving unpolarized transfer problems. These are the Jacobi-based accelerated Λ-iteration (ALI) method of Olson, Auer, & Buchler and the iterative schemes based on Gauss-Seidel and successive overrelaxation (SOR) iteration of Trujillo Bueno and Fabiani Bendicho. The theoretical framework chosen for the formulation of polarization transfer problems is the quantum electrodynamics (QED) theory of Landi Degl'Innocenti, which specifies the excitation state of the atoms in terms of the irreducible tensor components of the atomic density matrix. This first paper establishes the grounds of our numerical approach to non-LTE polarization transfer by concentrating on the standard case of scattering line polarization in a gas of two-level atoms, including the Hanle effect due to a weak microturbulent and isotropic magnetic field. We begin demonstrating that the well-known Λ-iteration method leads to the self-consistent solution of this type of problem if one initializes using the ``exact'' solution corresponding to the unpolarized case. We show then how the above-mentioned splitting methods can be easily derived from this simple Λ-iteration scheme. We show that our SOR method is 10 times faster than the Jacobi-based ALI method, while our implementation of the Gauss-Seidel method is 4 times faster. These iterative schemes lead to the self-consistent solution independently of the chosen initialization. The convergence rate of these iterative methods is very high; they do not require either the construction or the inversion of any matrix, and the computing time per iteration is similar to that of the Λ-iteration method.

  4. Polarizing matter and antimatter: A new method. Final report

    International Nuclear Information System (INIS)

    Onel, Y.

    1994-12-01

    Several years ago a self-polarization effect for stored (anti-)protons and ions was investigated theoretically. The effect is based on the well-known Stern-Gerlach effect in gradient fields. The aim of the ongoing measurements at the Indiana University Cyclotron Facility (IUCF) is to verify experimentally the various assumptions on which this effect is based. The final goal is to demonstrate this new polarization effect. The proposed effect could be a powerful tool to produce polarized stored hadron beams both in the low-energy range and at SSC and LHC energies. In this progress report the authors will describe the progress in three parts: (A) experimental work at IUCF Cooler Ring; (B) the extensive computer simulations of the spin stability for the IUCF Cooler Ring; and (C) theoretical studies

  5. THE METHODS OF PRODUCING AND ANALYZING POLARIZED NEUTRON BEAMS FOR HYSPEC AT THE SNS

    International Nuclear Information System (INIS)

    SHAPIRO, S.M.; PASSELL, L.; ZALIZNYAK, A.; GHOSH, V.J.; LEONHARDT, W.L.; HAGEN, M.E.

    2005-01-01

    The Hybrid Spectrometer (HYSPEC), under construction at the SNS on beam line 14B, is the only inelastic scattering instrument designed to enable polarization of the incident and the scattered neutron beams. A Heusler monochromator will replace the graphite crystal for producing polarized neutrons. In the scattered beam it is planned to use a collimator--multi-channel supermirror bender array to analyze the polarization of the scattered beam over the final energy range from 5-20 meV. Other methods of polarization analysis under consideration such as transmission filters using He 3 , Sm, and polarized protons are considered. Their performance is estimated and a comparison of the various methods of polarization is made

  6. The optimal method for the measurement of tau polarization

    International Nuclear Information System (INIS)

    Davier, M.; Duflot, L.; Le Diberder, F.; Rouge, A.

    1992-12-01

    A variable is constructed for each τ decay channel which carries all the available information on the τ spin state. Its use allows a simple determination of the polarization with the maximal sensitivity for all final states. Further applications to the τ → α 1 ν channel are discussed, and it is shown that a sizeable improvement of the measurement can be achieved. (author) 14 refs., 2 figs., 1 tab

  7. A novel method for polarization squeezing with Photonic Crystal Fibers

    DEFF Research Database (Denmark)

    Milanovic, Josip; Lassen, Mikael Østergaard; Andersen, Ulrik Lund

    2010-01-01

    Photonic Crystal Fibers can be tailored to increase the effective Kerr nonlinearity, while producing smaller amounts of excess noise compared to standard silicon fibers. Using these features of Photonic Crystal Fibers we create polarization squeezed states with increased purity compared to standa...... Stokes parameter squeezing of −3.9 ±0.3dB and anti-squeezing of 16.2 ±0.3dB....

  8. A new polarized neutrons method for studying depth-inhomogeneously magnetized magnetic films

    International Nuclear Information System (INIS)

    Korneev, D.A.

    1990-01-01

    The main specific features of the process of polarized thermal neutrons specular reflection from the surface of depth-inhomogeneously magnetic films are considered theoretically. It is shown how using the method of specular reflection of polarized thermal neutrons from such a films surface, one may restore the depth distribution of the local magnetization vector M-vector(z). 9 refs

  9. Beta4 integrin-dependent formation of polarized three-dimensionalarchitecture confers resistance to apoptosis in normal and malignantmammary epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Weaver, Valerie M.; Lelievre, Sophie; Lakins, Johnathon N.; Chrenek, Micah A.; Jones, Jonathan C.R.; Giancotti, Filippo; Werb, Zena; Bissell, Mina J.

    2002-08-27

    Tumor cells can evade chemotherapy by acquiring resistanceto apoptosis. We investigated the molecular mechanism whereby malignantand nonmalignant mammary epithelial cells become insensitive toapoptosis. We show that regardless of growth status formation ofpolarized, three-dimensional structures driven by basement membraneconfers protection to apoptosis in both nonmalignant and malignantmammary epithelial cells. By contrast, irrespective of their malignantstatus, nonpolarized structures are sensitive to induction of apoptosis.Resistance to apoptosis requires ligation of beta4 integrins, whichregulates tissue polarity, hemidesmosome formation and NFkB activation.Expression of beta4 integrin that lacks the hemidesmosome targetingdomain interferes with tissue polarity and NFkB activation and permitsapoptosis. These results indicate that integrin-induced polarity maydrive tumor cell resistance to apoptosis-inducing agents via effects onNFkB.

  10. Complementary resistive switching in BaTiO{sub 3}/NiO bilayer with opposite switching polarities

    Energy Technology Data Exchange (ETDEWEB)

    Li, Shuo [State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials, Southwest University of Science and Technology, Mianyang 621010 (China); Institut d’Electronique de Micro-électronique et de Nanotechnologie (IEMN), CNRS, Université des Sciences et Technologies de Lille, avenue Poincaré, BP 60069, 59652, Villeneuve d’Ascq cedex (France); Wei, Xianhua, E-mail: weixianhua@swust.edu.cn [State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials, Southwest University of Science and Technology, Mianyang 621010 (China); Lei, Yao [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronics Science and Technology of China, Chengdu 610054 (China); Yuan, Xincai [State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials, Southwest University of Science and Technology, Mianyang 621010 (China); Zeng, Huizhong [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronics Science and Technology of China, Chengdu 610054 (China)

    2016-12-15

    Graphical abstract: Au/BaTiO{sub 3}/NiO/Pt bilayer device shows complementary resistive switching (CRS) without electroforming which is mainly ascribed to anti-serial stack of two RRAM cells with bipolar behaviors. - Highlights: • Complementary resistive switching (CRS) has been investigated in Au/BaTiO{sub 3}/NiO/Pt by stacking the two elements with different switching types. • The realization of complementary resistive switching (CRS) is mainly ascribed to the anti-serial stack of two RRAM cells with bipolar behaviors. • Complementary resistive switching (CRS) in bilayer is effective to solve the sneak current problem briefly and economically. - Abstract: Resistive switching behaviors have been investigated in the Au/BaTiO{sub 3}/NiO/Pt structure by stacking the two elements with different switching types. The conducting atomic force microscope measurements on BaTiO{sub 3} thin films and NiO thin films suggest that with the same active resistive switching region, the switching polarities in the two semiconductors are opposite to each other. It is in agreement with the bipolar hysteresis I–V curves with opposite switching polarities for single-layer devices. The bilayer devices show complementary resistive switching (CRS) without electroforming and unipolar resistive switching (URS) after electroforming. The coexistence of CRS and URS is mainly ascribed to the co-effect of electric field and Joule heating mechanisms, indicating that changeable of resistance in this device is dominated by the redistribution of oxygen vacancies in BaTiO{sub 3} and the formation, disruption, restoration of conducting filaments in NiO. CRS in bilayer with opposite switching polarities is effective to solve the sneak current without the introduction of any selector elements or an additional metal electrode.

  11. A three-dimensional polarization domain retrieval method from electron diffraction data

    International Nuclear Information System (INIS)

    Pennington, Robert S.; Koch, Christoph T.

    2015-01-01

    We present an algorithm for retrieving three-dimensional domains of picometer-scale shifts in atomic positions from electron diffraction data, and apply it to simulations of ferroelectric polarization in BaTiO 3 . Our algorithm successfully and correctly retrieves polarization domains in which the Ti atom positions differ by less than 3 pm (0.4% of the unit cell diagonal distance) with 5 and 10 nm depth resolution along the beam direction, and we also retrieve unit cell strain, corresponding to tetragonal-to-cubic unit cell distortions, for 10 nm domains. Experimental applicability is also discussed. - Highlights: • We show a retrieval method for ferroelectric polarization from TEM diffraction data. • Simulated strain and polarization variations along the beam direction are retrieved. • This method can be used for 3D strain and polarization mapping without specimen tilt

  12. Direct current (DC) resistivity and Induced Polarization (IP) monitoring of active layer dynamics at high temporal resolution

    DEFF Research Database (Denmark)

    Doetsch, J.; Fiandaca, G.; Ingeman-Nielsen, Thomas

    2015-01-01

    With permafrost thawing and changes in active layer dynamics induced by climate change, interactions between biogeochemical and thermal processes in the ground are of great importance. Here, active layer dynamics have been monitored using direct current (DC) resistivity and induced polarization (IP...... the soil freezing as a strong increase in resistivity. While the freezing horizon generally moves deeper with time, some variations in the freezing depth are observed along the profile. Comparison with depth-specific soil temperature indicates an exponential relationship between resistivity and below...

  13. Direct current (DC) resistivity and induced polarization (IP) monitoring of active layer dynamics at high temporal resolution

    DEFF Research Database (Denmark)

    Doetsch, Joseph; Ingeman-Nielsen, Thomas; Christiansen, Anders V.

    2015-01-01

    With permafrost thawing and changes in active layer dynamics induced by climate change, interactions between biogeochemical and thermal processes in the ground are of great importance. Here, active layer dynamics have been monitored using direct current (DC) resistivity and induced polarization (IP...... in resistivity. While the freezing horizon generally moves deeper with time, some variations in the freezing depth are observed along the profile. Comparison with depth-specific soil temperature indicates an exponential relationship between resistivity and below-freezing temperature. Time-lapse inversions...

  14. Complementary resistive switching in BaTiO3/NiO bilayer with opposite switching polarities

    Science.gov (United States)

    Li, Shuo; Wei, Xianhua; Lei, Yao; Yuan, Xincai; Zeng, Huizhong

    2016-12-01

    Resistive switching behaviors have been investigated in the Au/BaTiO3/NiO/Pt structure by stacking the two elements with different switching types. The conducting atomic force microscope measurements on BaTiO3 thin films and NiO thin films suggest that with the same active resistive switching region, the switching polarities in the two semiconductors are opposite to each other. It is in agreement with the bipolar hysteresis I-V curves with opposite switching polarities for single-layer devices. The bilayer devices show complementary resistive switching (CRS) without electroforming and unipolar resistive switching (URS) after electroforming. The coexistence of CRS and URS is mainly ascribed to the co-effect of electric field and Joule heating mechanisms, indicating that changeable of resistance in this device is dominated by the redistribution of oxygen vacancies in BaTiO3 and the formation, disruption, restoration of conducting filaments in NiO. CRS in bilayer with opposite switching polarities is effective to solve the sneak current without the introduction of any selector elements or an additional metal electrode.

  15. Proposed method to produce a highly polarized e+ beam for future linear colliders

    International Nuclear Information System (INIS)

    Okugi, Toshiyuki; Chiba, Masami; Kurihara, Yoshimasa

    1996-01-01

    We propose a method to produce a spin-polarized e + beam using e + e - pair-creation by circularly polarized photons. Assuming Compton scattering of an unpolarized e - beam and circularly polarized laser light, scattered γ-rays at the high end of the energy spectrum are also circularly polarized. If those γ-rays are utilized to create e ± pairs on a thin target, the spin-polarization is preserved for e + 's at the high end of their energy spectrum. By using the injector linac of Accelerator Test Facility at KEK and a commercially available Nd:YAG pulse laser, we can expect about 10 5 polarized e + 's per second with a degree of polarization of 80% and a kinetic energy of 35-80 MeV. The apparatus for creation and measurement of polarized e + 's is being constructed. We present new idea for possible application of our method to future linear colliders by utilizing a high-power CO 2 laser. (author)

  16. [Progress in sample preparation and analytical methods for trace polar small molecules in complex samples].

    Science.gov (United States)

    Zhang, Qianchun; Luo, Xialin; Li, Gongke; Xiao, Xiaohua

    2015-09-01

    Small polar molecules such as nucleosides, amines, amino acids are important analytes in biological, food, environmental, and other fields. It is necessary to develop efficient sample preparation and sensitive analytical methods for rapid analysis of these polar small molecules in complex matrices. Some typical materials in sample preparation, including silica, polymer, carbon, boric acid and so on, are introduced in this paper. Meanwhile, the applications and developments of analytical methods of polar small molecules, such as reversed-phase liquid chromatography, hydrophilic interaction chromatography, etc., are also reviewed.

  17. Some Remarks on Methods of QCD Analysis of Polarized DIS Data

    CERN Document Server

    Leader, Elliot; Stamenov, Dimiter B

    2009-01-01

    The results on polarized parton densities (PDFs) obtained using different methods of QCD analysis of the present polarized DIS data are discussed. Their dependence on the method used in the analysis, accounting or not for the kinematic and dynamic 1/Q^2 corrections to spin structure function g_1, is demonstrated. It is pointed out that the precise data in the preasymptotic region require a more careful matching of the QCD predictions to the data in this region in order to determine the polarized PDFs correctly.

  18. BACKWARD AND FORWARD MONTE CARLO METHOD IN POLARIZED RADIATIVE TRANSFER

    Energy Technology Data Exchange (ETDEWEB)

    Yong, Huang; Guo-Dong, Shi; Ke-Yong, Zhu, E-mail: huangy_zl@263.net [School of Aeronautical Science and Engineering, Beihang University, Beijing 100191 (China)

    2016-03-20

    In general, the Stocks vector cannot be calculated in reverse in the vector radiative transfer. This paper presents a novel backward and forward Monte Carlo simulation strategy to study the vector radiative transfer in the participated medium. A backward Monte Carlo process is used to calculate the ray trajectory and the endpoint of the ray. The Stocks vector is carried out by a forward Monte Carlo process. A one-dimensional graded index semi-transparent medium was presented as the physical model and the thermal emission consideration of polarization was studied in the medium. The solution process to non-scattering, isotropic scattering, and the anisotropic scattering medium, respectively, is discussed. The influence of the optical thickness and albedo on the Stocks vector are studied. The results show that the U, V-components of the apparent Stocks vector are very small, but the Q-component of the apparent Stocks vector is relatively larger, which cannot be ignored.

  19. Molecular Methods for Detection of Antimicrobial Resistance

    DEFF Research Database (Denmark)

    Anjum, Muna F.; Zankari, Ea; Hasman, Henrik

    2017-01-01

    The increase in bacteria harboring antimicrobial resistance (AMR) is a global problem because there is a paucity of antibiotics available to treat multidrug-resistant bacterial infections in humans and animals. Detection of AMR present in bacteria that may pose a threat to veterinary and public...

  20. Experimental study on reactivity measurement in thermal reactor by polarity correlation method

    International Nuclear Information System (INIS)

    Yasuda, Hideshi

    1977-11-01

    Experimental study on the polarity correlation method for measuring the reactivity of a thermal reactor, especially the one possessing long prompt neutron lifetime such as graphite on heavy water moderated core, is reported. The techniques of reactor kinetics experiment are briefly reviewed, which are classified in two groups, one characterized by artificial disturbance to a reactor and the other by natural fluctuation inherent in a reactor. The fluctuation phenomena of neutron count rate are explained using F. de Hoffman's stochastic method, and correlation functions for the neutron count rate fluctuation are shown. The experimental results by polarity correlation method applied to the β/l measurements in both graphite-moderated SHE core and light water-moderated JMTRC and JRR-4 cores, and also to the measurement of SHE shut down reactivity margin are presented. The measured values were in good agreement with those by a pulsed neutron method in the reactivity range from critical to -12 dollars. The conditional polarity correlation experiments in SHE at -20 cent and -100 cent are demonstrated. The prompt neutron decay constants agreed with those obtained by the polarity correlation experiments. The results of experiments measuring large negative reactivity of -52 dollars of SHE by pulsed neutron, rod drop and source multiplication methods are given. Also it is concluded that the polarity and conditional polarity correlation methods are sufficiently applicable to noise analysis of a low power thermal reactor with long prompt neutron lifetime. (Nakai, Y.)

  1. Three-Dimensional Induced Polarization Parallel Inversion Using Nonlinear Conjugate Gradients Method

    Directory of Open Access Journals (Sweden)

    Huan Ma

    2015-01-01

    Full Text Available Four kinds of array of induced polarization (IP methods (surface, borehole-surface, surface-borehole, and borehole-borehole are widely used in resource exploration. However, due to the presence of large amounts of the sources, it will take much time to complete the inversion. In the paper, a new parallel algorithm is described which uses message passing interface (MPI and graphics processing unit (GPU to accelerate 3D inversion of these four methods. The forward finite differential equation is solved by ILU0 preconditioner and the conjugate gradient (CG solver. The inverse problem is solved by nonlinear conjugate gradients (NLCG iteration which is used to calculate one forward and two “pseudo-forward” modelings and update the direction, space, and model in turn. Because each source is independent in forward and “pseudo-forward” modelings, multiprocess modes are opened by calling MPI library. The iterative matrix solver within CULA is called in each process. Some tables and synthetic data examples illustrate that this parallel inversion algorithm is effective. Furthermore, we demonstrate that the joint inversion of surface and borehole data produces resistivity and chargeability results are superior to those obtained from inversions of individual surface data.

  2. Biotechnological Methods for Precise Diagnosis of Methicillin Resistance in Staphylococci

    Directory of Open Access Journals (Sweden)

    Aija Zilevica

    2005-04-01

    Full Text Available Antimicrobial resistance is one of the most urgent problems in medicine nowadays. The purpose of the study was to investigate the microorganisms resistant to first-line antimicrobials, including gram-positive cocci, particularly the methicillin-resistant Staphylococcus aureus and coagulase-negative Staphylococci, the major agents of nosocomial infections. Owing to the multi-resistance of these agents, precise diagnosis of the methicillin resistance of Staphylococci is of greatest clinical importance. It is not enough to use only conventional microbiological diagnostic methods. Biotechnological methods should be also involved. In our studies, the following methicillin resistance identification methods were used: the disk diffusion method, detection of the mecA gene by PCR, E-test and Slidex MRSA test. For molecular typing, PFGL, RAPD tests and detection of the coa gene were used. All the MRS strains were multiresistant to antibacterials. No vancomycine resistance was registered.

  3. Numerical methods in simulation of resistance welding

    DEFF Research Database (Denmark)

    Nielsen, Chris Valentin; Martins, Paulo A.F.; Zhang, Wenqi

    2015-01-01

    Finite element simulation of resistance welding requires coupling betweenmechanical, thermal and electrical models. This paper presents the numerical models and theircouplings that are utilized in the computer program SORPAS. A mechanical model based onthe irreducible flow formulation is utilized...... a resistance welding point of view, the most essential coupling between the above mentioned models is the heat generation by electrical current due to Joule heating. The interaction between multiple objects is anothercritical feature of the numerical simulation of resistance welding because it influences...... thecontact area and the distribution of contact pressure. The numerical simulation of resistancewelding is illustrated by a spot welding example that includes subsequent tensile shear testing...

  4. resistivity methods in hydro-geophysical investigation

    African Journals Online (AJOL)

    Home

    age (Short and Stauble, 1967; Asseez, 1989). Above the .... The resistivity of the pore water was used for estimating the total dissolved solids (TDS) in ppm of groundwater using equation (4). .... clear felling a sitka spruce (pica stichensis).

  5. Polarization characterization of PZT disks and of embedded PZT plates by thermal wave methods

    International Nuclear Information System (INIS)

    Eydam, Agnes; Suchaneck, Gunnar; Gerlach, Gerald; Esslinger, Sophia; Schönecker, Andreas; Neumeister, Peter

    2014-01-01

    In this work, the thermal wave method was applied to characterize PZT disks and embedded PZT plates with regard to the polarization magnitude and spatial homogeneity. The samples were exposed to periodic heating by means of a laser beam and the pyroelectric response was determined. Thermal relaxation times (single time constants or distributions of time constants) describe the heat losses of the PZT samples to the environment. The resulting pyroelectric current spectrum was fitted to the superposition of thermal relaxation processes. The pyroelectric coefficient gives insight in the polarization distribution. For PZT disks, the polarization distribution in the surface region showed a characteristic decrease towards the electrodes

  6. Design of fused-silica rectangular transmission gratings for polarizing beam splitter based on modal method.

    Science.gov (United States)

    Zhao, Huajun; Yuan, Dairong

    2010-02-10

    Examples of optimal designs for a fused-silica transmitted grating with high-intensity tolerance are discussed. It has the potential of placing up to 99% incident polarized light in a single diffraction order. The modal method has been used to analyze the effective indices for TE and TM polarization propagating through the grating region, and the eigenvalue equation of the modal method is transformed to a new form. It is shown that the effective indices of the first two modes depend on the value of the period under Littrow mounting with filling factor f=0.5. The polarization properties of the polarizing beam splitter are analyzed by rigorous coupled-wave analysis (RCWA) at the wavelength of 1.064 microm. The optimal design perfectly matches the RCWA simulation result.

  7. Monte Carlo method for polarized radiative transfer in gradient-index media

    International Nuclear Information System (INIS)

    Zhao, J.M.; Tan, J.Y.; Liu, L.H.

    2015-01-01

    Light transfer in gradient-index media generally follows curved ray trajectories, which will cause light beam to converge or diverge during transfer and induce the rotation of polarization ellipse even when the medium is transparent. Furthermore, the combined process of scattering and transfer along curved ray path makes the problem more complex. In this paper, a Monte Carlo method is presented to simulate polarized radiative transfer in gradient-index media that only support planar ray trajectories. The ray equation is solved to the second order to address the effect induced by curved ray trajectories. Three types of test cases are presented to verify the performance of the method, which include transparent medium, Mie scattering medium with assumed gradient index distribution, and Rayleigh scattering with realistic atmosphere refractive index profile. It is demonstrated that the atmospheric refraction has significant effect for long distance polarized light transfer. - Highlights: • A Monte Carlo method for polarized radiative transfer in gradient index media. • Effect of curved ray paths on polarized radiative transfer is considered. • Importance of atmospheric refraction for polarized light transfer is demonstrated

  8. A novel method to assay special nuclear materials by measuring prompt neutrons from polarized photofission

    Energy Technology Data Exchange (ETDEWEB)

    Mueller, J.M., E-mail: mueller@tunl.duke.edu [Triangle Universities Nuclear Laboratory, Durham, NC 27710 (United States); Department of Physics, Duke University, Durham, NC 27708 (United States); Ahmed, M.W. [Triangle Universities Nuclear Laboratory, Durham, NC 27710 (United States); Department of Physics, Duke University, Durham, NC 27708 (United States); Department of Mathematics and Physics, North Carolina Central University, Durham, NC 27707 (United States); Weller, H.R. [Triangle Universities Nuclear Laboratory, Durham, NC 27710 (United States); Department of Physics, Duke University, Durham, NC 27708 (United States)

    2014-08-01

    A novel method of measuring the enrichment of special nuclear material is presented. Recent photofission measurements using a linearly polarized γ-ray beam were performed on samples of {sup 232}Th, {sup 233,235,238}U, {sup 237}Np, and {sup 239,240}Pu. Prompt neutron polarization asymmetries, defined to be the difference in the prompt neutron yields parallel and perpendicular to the plane of beam polarization divided by their sum, were measured. It was discovered that the prompt neutron polarization asymmetries differed significantly depending on the sample. Prompt neutrons from photofission of even–even (non-fissile) targets had significant polarization asymmetries (∼0.2 to 0.5), while those from odd-A (generally fissile) targets had polarization asymmetries close to zero. This difference in the polarization asymmetries could be exploited to measure the fissile versus non-fissile content of special nuclear materials, and potentially to detect the presence of fissile material during active interrogation. The proposed technique, its expected performance, and its potential applicability are discussed.

  9. A novel method to assay special nuclear materials by measuring prompt neutrons from polarized photofission

    International Nuclear Information System (INIS)

    Mueller, J.M.; Ahmed, M.W.; Weller, H.R.

    2014-01-01

    A novel method of measuring the enrichment of special nuclear material is presented. Recent photofission measurements using a linearly polarized γ-ray beam were performed on samples of 232 Th, 233,235,238 U, 237 Np, and 239,240 Pu. Prompt neutron polarization asymmetries, defined to be the difference in the prompt neutron yields parallel and perpendicular to the plane of beam polarization divided by their sum, were measured. It was discovered that the prompt neutron polarization asymmetries differed significantly depending on the sample. Prompt neutrons from photofission of even–even (non-fissile) targets had significant polarization asymmetries (∼0.2 to 0.5), while those from odd-A (generally fissile) targets had polarization asymmetries close to zero. This difference in the polarization asymmetries could be exploited to measure the fissile versus non-fissile content of special nuclear materials, and potentially to detect the presence of fissile material during active interrogation. The proposed technique, its expected performance, and its potential applicability are discussed

  10. An Operator Perturbation Method of Polarized Line Transfer V ...

    Indian Academy of Sciences (India)

    tribpo

    imate Lambda Iteration) method to the resonance scattering in spectral lines formed in the presence of weak magnetic fields. The method is based on an operator perturbation approach, and can efficiently give solutions for oriented vector magnetic fields in the solar atmosphere. Key words. ... 1999 for observational.

  11. Simulation of AZ-PN100 resist pattern fluctuation in X-ray lithography, including synchrotron beam polarization

    International Nuclear Information System (INIS)

    Scheckler, E.W.; Ogawa, Taro; Tanaka, Toshihiko; Takeda, Eiji; Oizumi, Hiroaki.

    1993-01-01

    A new simulation model for nanometer-scale pattern fluctuation in X-ray lithography is presented and applied to a study of AZ-PN100 negative chemical amplification resist. The exposure simulation considers polarized photons from a synchrotron radiation (SR) source. Monte Carlo simulation of Auger and photoelectron generation is followed by electron scattering simulation to determine the deposited energy distribution at the nanometer scale, including beam polarization effects. An acid-catalyst random walk model simulates the post-exposure bake (PEB) step. Fourier transform infrared (FTIR) spectroscopy and developed resist thickness measurements are used to fit PEB and rate models for AZ-PN100. A polymer removal model for development simulation predicts the macroscopic resist shape and pattern roughness. The simulated 3σ linewidth variation is in excess of 24 nm. Simulation also shows a detrimental effect if the beam polarization is perpendicular to the line. Simulation assuming a theoretical ideal exposure yields a 50 nm minimum line for standard process conditions. (author)

  12. Electrical resistivity and induced polarization tomography in identifying the plume of chlorinated hydrocarbons in sedimentary formation: a case study in Rho (Milan - Italy).

    Science.gov (United States)

    Cardarelli, Ettore; Di Filippo, Gerardina

    2009-09-01

    Resistivity and induced polarization surveying were originally developed for mineral exploration but are now finding new applications in the field of environmental and engineering geophysics. The present article reports the results of a geophysical survey performed with the aim of identifying a plume of chlorinated hydrocarbons in sedimentary formations of the Pandania plain. The tested site is characterized by three sand and gravel aquifers containing a quantity of clay particles which influence the overall bulk resistivity and chargeability. According to data obtained using shallow boreholes, mainly dense non-aqueous phase liquids were found as contaminants in the first and second aquifer. The aforementioned geo-electrical methods were applied in both two- and three-dimensional approaches. Steel and copper electrodes were used in the process of field data acquisition and the results of the survey were compared. The geophysical survey revealed some anomalies that could be explained by the presence of dense non-aqueous phase liquids in the soil medium. The concept of normalized chargeability facilitates the interpretation of detected induced polarization anomalies. The shape of the plume was inferred from maps of resistivity and chargeability to a depth of 25 m below the surface of the ground.

  13. Optical image encryption method based on incoherent imaging and polarized light encoding

    Science.gov (United States)

    Wang, Q.; Xiong, D.; Alfalou, A.; Brosseau, C.

    2018-05-01

    We propose an incoherent encoding system for image encryption based on a polarized encoding method combined with an incoherent imaging. Incoherent imaging is the core component of this proposal, in which the incoherent point-spread function (PSF) of the imaging system serves as the main key to encode the input intensity distribution thanks to a convolution operation. An array of retarders and polarizers is placed on the input plane of the imaging structure to encrypt the polarized state of light based on Mueller polarization calculus. The proposal makes full use of randomness of polarization parameters and incoherent PSF so that a multidimensional key space is generated to deal with illegal attacks. Mueller polarization calculus and incoherent illumination of imaging structure ensure that only intensity information is manipulated. Another key advantage is that complicated processing and recording related to a complex-valued signal are avoided. The encoded information is just an intensity distribution, which is advantageous for data storage and transition because information expansion accompanying conventional encryption methods is also avoided. The decryption procedure can be performed digitally or using optoelectronic devices. Numerical simulation tests demonstrate the validity of the proposed scheme.

  14. Characterization of molecularly imprinted polymers using a new polar solvent titration method.

    Science.gov (United States)

    Song, Di; Zhang, Yagang; Geer, Michael F; Shimizu, Ken D

    2014-07-01

    A new method of characterizing molecularly imprinted polymers (MIPs) was developed and tested, which provides a more accurate means of identifying and measuring the molecular imprinting effect. In the new polar solvent titration method, a series of imprinted and non-imprinted polymers were prepared in solutions containing increasing concentrations of a polar solvent. The polar solvent additives systematically disrupted the templation and monomer aggregation processes in the prepolymerization solutions, and the extent of disruption was captured by the polymerization process. The changes in binding capacity within each series of polymers were measured, providing a quantitative assessment of the templation and monomer aggregation processes in the imprinted and non-imprinted polymers. The new method was tested using three different diphenyl phosphate imprinted polymers made using three different urea functional monomers. Each monomer had varying efficiencies of templation and monomer aggregation. The new MIP characterization method was found to have several advantages. To independently verify the new characterization method, the MIPs were also characterized using traditional binding isotherm analyses. The two methods appeared to give consistent conclusions. First, the polar solvent titration method is less susceptible to false positives in identifying the imprinting effect. Second, the method is able to differentiate and quantify changes in binding capacity, as measured at a fixed guest and polymer concentration, arising from templation or monomer aggregation processes in the prepolymerization solution. Third, the method was also easy to carry out, taking advantage of the ease of preparing MIPs. Copyright © 2014 John Wiley & Sons, Ltd.

  15. Prospects of hydrocarbon deposits exploration using the method of induced polarization during geomagnetic-variation profiling

    Directory of Open Access Journals (Sweden)

    К. М. Ермохин

    2017-10-01

    Full Text Available Traditionally it is believed that the effect of induced polarization is an interfering factor for the measurement of electromagnetic fields and their interpretation during conducting works using magnetotelluric sounding and geomag-netic-variation profiling methods. A new method is proposed for isolating the effects of induced polarization during geomagnetic-variation profiling aimed at searching for hydrocarbon deposits on the basis of phase measurements during the conduct of geomagnetic-variation profiling. The phenomenon of induced polarization is proposed to be used as a special exploration mark for deep-lying hydrocarbon deposits. The traditional method of induced polarization uses artificial field sources, the powers of which are principally insufficient to reach depths of 3-5 km, which leads to the need to search for alternative - natural sources in the form of telluric and magnetotelluric fields. The proposed method makes it possible to detect and interpret the effects of induced polarization from deep-seated oil and gas reservoirs directly, without relying on indirect signs.

  16. Flow velocity measurement by using zero-crossing polarity cross correlation method

    International Nuclear Information System (INIS)

    Xu Chengji; Lu Jinming; Xia Hong

    1993-01-01

    Using the designed correlation metering system and a high accurate hot-wire anemometer as a calibration device, the experimental study of correlation method in a tunnel was carried out. The velocity measurement of gas flow by using zero-crossing polarity cross correlation method was realized and the experimental results has been analysed

  17. Detection-Discrimination Method for Multiple Repeater False Targets Based on Radar Polarization Echoes

    Directory of Open Access Journals (Sweden)

    Z. W. ZONG

    2014-04-01

    Full Text Available Multiple repeat false targets (RFTs, created by the digital radio frequency memory (DRFM system of jammer, are widely used in practical to effectively exhaust the limited tracking and discrimination resource of defence radar. In this paper, common characteristic of radar polarization echoes of multiple RFTs is used for target recognition. Based on the echoes from two receiving polarization channels, the instantaneous polarization radio (IPR is defined and its variance is derived by employing Taylor series expansion. A detection-discrimination method is designed based on probability grids. By using the data from microwave anechoic chamber, the detection threshold of the method is confirmed. Theoretical analysis and simulations indicate that the method is valid and feasible. Furthermore, the estimation performance of IPRs of RFTs due to the influence of signal noise ratio (SNR is also covered.

  18. Method for forming permanent magnets with different polarities for use in microelectromechanical devices

    Science.gov (United States)

    Roesler, Alexander W [Tijeras, NM; Christenson, Todd R [Albuquerque, NM

    2007-04-24

    Methods are provided for forming a plurality of permanent magnets with two different north-south magnetic pole alignments for use in microelectromechanical (MEM) devices. These methods are based on initially magnetizing the permanent magnets all in the same direction, and then utilizing a combination of heating and a magnetic field to switch the polarity of a portion of the permanent magnets while not switching the remaining permanent magnets. The permanent magnets, in some instances, can all have the same rare-earth composition (e.g. NdFeB) or can be formed of two different rare-earth materials (e.g. NdFeB and SmCo). The methods can be used to form a plurality of permanent magnets side-by-side on or within a substrate with an alternating polarity, or to form a two-dimensional array of permanent magnets in which the polarity of every other row of the array is alternated.

  19. Increasing the pump-up rate to polarize 3He gas using spin-exchange optical pumping method

    International Nuclear Information System (INIS)

    Lee, W.T.; Tong Xin; Rich, Dennis; Liu Yun; Fleenor, Michael; Ismaili, Akbar; Pierce, Joshua; Hagen, Mark; Dadras, Jonny; Robertson, J. Lee

    2009-01-01

    In recent years, polarized 3 He gas has increasingly been used as neutron polarizers and polarization analyzers. Two of the leading methods to polarize the 3 He gas are the spin-exchange optical pumping (SEOP) method and the meta-stable exchange optical pumping (MEOP) method. At present, the SEOP setup is comparatively compact due to the fact that it does not require the sophisticated compressor system used in the MEOP method. The temperature and the laser power available determine the speed, at which the SEOP method polarizes the 3 He gas. For the quantity of gas typically used in neutron scattering work, this speed is independent of the quantity of the gas required, whereas the polarizing time using the MEOP method is proportional to the quantity of gas required. Currently, using the SEOP method to polarize several bar-liters of 3 He to 70% polarization would require 20-40 h. This is an order of magnitude longer than the MEOP method for the same quantity of gas and polarization. It would therefore be advantageous to speed up the SEOP process. In this article, we analyze the requirements for temperature, laser power, and the type of alkali used in order to shorten the time required to polarize 3 He gas using the SEOP method.

  20. Nuclear-optical methods for production of polarized photons with energies of a few hundred GeV

    International Nuclear Information System (INIS)

    Ispiryan, K.A.; Ispiryan, M.K.

    1985-01-01

    The absorption coefficients of linearly polarized photons passing through a crystal in parallel to its crystallographic planes are calculated. The methods of determination of the obtainable degree of polarization as well as of the intensity losses for the cases when non-polarized photon beams pass through various crystals in parallel to the planes (110) are described. The energy dependence of the thickness of the quarter-wave plate crystals transforming the linear polarization of the beam into circular one is obtained

  1. Design of a Fused-Silica Subwavelength Polarizing Beam Splitter Grating Based on the Modal Method

    International Nuclear Information System (INIS)

    Hua-Jun, Zhao; Dai-Rong, Yuan; Pei, Wang; Yong-Hua, Lu; Hai, Ming

    2010-01-01

    A polarizing beam splitter (PBS) design based on a fused-silica lamellar subwavelength transmission grating is demonstrated with the modal method, where TE- and TM-polarized waves are mainly diffracted in the −1 st and 0 th orders, respectively. The physical explanation of the grating diffraction is illustrated by the interference of the corresponding parts of the two propagating modes, which is very similar to a Mach–Zehnder interferometer. It is shown that diffraction efficients over 99% for a TM-polarized wave in the −1 st order and 90% for a TE-polarized wave in the 0 th order are obtained at the wavelength of 1.053 μm. The polarization transmission extinction ratios are better than 33 dB and 51 dB for the order 0 th and the −1 st order, respectively. The splitting properties of the PBS grating designed by the modal method are in good agreement with the results simulated by the rigorous coupled wave analysis method. (fundamental areas of phenomenology(including applications))

  2. Analysis of Circularly Polarized Hemispheroidal Dielectric Resonator Antenna Phased Arrays Using the Method of Auxiliary Sources

    DEFF Research Database (Denmark)

    Larsen, Niels Vesterdal; Breinbjerg, Olav

    2007-01-01

    The method of auxiliary sources is employed to model and analyze probe-fed hemispheroidal dielectric resonator antennas and arrays. Circularly polarized antenna elements of different designs are analyzed, and impedance bandwidths of up to 14.7% are achieved. Selected element designs are subsequen......The method of auxiliary sources is employed to model and analyze probe-fed hemispheroidal dielectric resonator antennas and arrays. Circularly polarized antenna elements of different designs are analyzed, and impedance bandwidths of up to 14.7% are achieved. Selected element designs...

  3. Characterization of polarization-independent phase modulation method for practical plug and play quantum cryptography

    International Nuclear Information System (INIS)

    Kwon, Osung; Lee, Min-Soo; Woo, Min Ki; Park, Byung Kwon; Kim, Il Young; Kim, Yong-Su; Han, Sang-Wook; Moon, Sung

    2015-01-01

    We characterized a polarization-independent phase modulation method, called double phase modulation, for a practical plug and play quantum key distribution (QKD) system. Following investigation of theoretical backgrounds, we applied the method to the practical QKD system and characterized the performance through comparing single phase modulation (SPM) and double phase modulation. Consequently, we obtained repeatable and accurate phase modulation confirmed by high visibility single photon interference even for input signals with arbitrary polarization. Further, the results show that only 80% of the bias voltage required in the case of single phase modulation is needed to obtain the target amount of phase modulation. (paper)

  4. Method of generating intense nuclear polarized beams by selective photodetachment of negative ions

    International Nuclear Information System (INIS)

    Hershcovitch, A.

    1986-01-01

    A novel method for production of nuclear polarized negative hydrogen ions by selective neutralization with a laser of negative hydrogen ions in a magnetic field is described. This selectivity is possible since a final state of the neutralized atom, and hence the neutralization energy, depends on its nuclear polarization. The main advantages of this scheme are the availability of multi-ampere negative ion sources and the possibility of neutralizing negative ions with very high efficiency. An assessment of the required laser power indicates that this method is in principle feasible with today's technology

  5. Deterministic and stochastic methods of calculation of polarization characteristics of radiation in natural environment

    Science.gov (United States)

    Strelkov, S. A.; Sushkevich, T. A.; Maksakova, S. V.

    2017-11-01

    We are talking about russian achievements of the world level in the theory of radiation transfer, taking into account its polarization in natural media and the current scientific potential developing in Russia, which adequately provides the methodological basis for theoretically-calculated research of radiation processes and radiation fields in natural media using supercomputers and mass parallelism. A new version of the matrix transfer operator is proposed for solving problems of polarized radiation transfer in heterogeneous media by the method of influence functions, when deterministic and stochastic methods can be combined.

  6. Fabrication of advanced Bragg gratings with complex apodization profiles by use of the polarization control method

    DEFF Research Database (Denmark)

    Deyerl, Hans-Jürgen; Plougmann, Nikolai; Jensen, Jesper Bo Damm

    2004-01-01

    The polarization control method offers a flexible, robust, and low-cost route for the parallel fabrication of gratings with complex apodization profiles including several discrete phase shifts and chirp. The performance of several test gratings is evaluated in terms of their spectral response...... and compared with theoretical predictions. Short gratings with sidelobe-suppression levels in excess of 32 dB and transmission dips lower than 80 dB have been realized. Finally, most of the devices fabricated by the polarization control method show comparable quality to gratings manufactured by far more...

  7. Corrosion Resistance Evaluation of Welded AISI 316 Stainless Steel by Electrochemical Method

    International Nuclear Information System (INIS)

    Baik, Shin Young; Kim, Kwan Hyu

    1990-01-01

    Electrochemical potentiokinetic polarization technique is known as quantitative, non-destructive and a rapid method for detecting sensitization and is essentially suitable for use in industrial fields and as laboratory research tools. In this study, electrochemical method was tested as a convenient means of the corrosion resistance evaluation for AISI 316L and 316 stainless steel(SS) and their welded sections. The sections were welded by TIG, MIG, CO 2 and ARC in 0.5N HCl as well as 1N H 2 SO 4 electrolyte with or without 0.01N KSCN. The results confirmed that electrochemical method could be used conveniently for corrosion resistance evaluation except reactivation aspect

  8. Polarization measurement for internal polarized gaseous targets

    International Nuclear Information System (INIS)

    Ye Zhenyu; Ye Yunxiu; Lv Haijiang; Mao Yajun

    2004-01-01

    The authors present an introduction to internal polarized gaseous targets, polarization method, polarization measurement method and procedure. To get the total nuclear polarization of hydrogen atoms (including the polarization of the recombined hydrogen molecules) in the target cell, authors have measured the parameters relating to atomic polarization and polarized hydrogen atoms and molecules. The total polarization of the target during our measurement is P T =0.853 ± 0.036. (authors)

  9. Testing methods for using high-resolution satellite imagery to monitor polar bear abundance and distribution

    Science.gov (United States)

    LaRue, Michelle A.; Stapleton, Seth P.; Porter, Claire; Atkinson, Stephen N.; Atwood, Todd C.; Dyck, Markus; Lecomte, Nicolas

    2015-01-01

    High-resolution satellite imagery is a promising tool for providing coarse information about polar species abundance and distribution, but current applications are limited. With polar bears (Ursus maritimus), the technique has only proven effective on landscapes with little topographic relief that are devoid of snow and ice, and time-consuming manual review of imagery is required to identify bears. Here, we evaluated mechanisms to further develop methods for satellite imagery by examining data from Rowley Island, Canada. We attempted to automate and expedite detection via a supervised spectral classification and image differencing to expedite image review. We also assessed what proportion of a region should be sampled to obtain reliable estimates of density and abundance. Although the spectral signature of polar bears differed from nontarget objects, these differences were insufficient to yield useful results via a supervised classification process. Conversely, automated image differencing—or subtracting one image from another—correctly identified nearly 90% of polar bear locations. This technique, however, also yielded false positives, suggesting that manual review will still be required to confirm polar bear locations. On Rowley Island, bear distribution approximated a Poisson distribution across a range of plot sizes, and resampling suggests that sampling >50% of the site facilitates reliable estimation of density (CV in certain areas, but large-scale applications remain limited because of the challenges in automation and the limited environments in which the method can be effectively applied. Improvements in resolution may expand opportunities for its future uses.

  10. Testing methods for using high-resolution satellite imagery to monitor polar bear abundance and distribution

    Science.gov (United States)

    LaRue, Michelle A.; Stapleton, Seth P.; Porter, Claire; Atkinson, Stephen N.; Atwood, Todd C.; Dyck, Markus; Lecomte, Nicolas

    2015-01-01

    High-resolution satellite imagery is a promising tool for providing coarse information about polar species abundance and distribution, but current applications are limited. With polar bears (Ursus maritimus), the technique has only proven effective on landscapes with little topographic relief that are devoid of snow and ice, and time-consuming manual review of imagery is required to identify bears. Here, we evaluated mechanisms to further develop methods for satellite imagery by examining data from Rowley Island, Canada. We attempted to automate and expedite detection via a supervised spectral classification and image differencing to expedite image review. We also assessed what proportion of a region should be sampled to obtain reliable estimates of density and abundance. Although the spectral signature of polar bears differed from nontarget objects, these differences were insufficient to yield useful results via a supervised classification process. Conversely, automated image differencing—or subtracting one image from another—correctly identified nearly 90% of polar bear locations. This technique, however, also yielded false positives, suggesting that manual review will still be required to confirm polar bear locations. On Rowley Island, bear distribution approximated a Poisson distribution across a range of plot sizes, and resampling suggests that sampling >50% of the site facilitates reliable estimation of density (CV large-scale applications remain limited because of the challenges in automation and the limited environments in which the method can be effectively applied. Improvements in resolution may expand opportunities for its future uses.

  11. Analysis of polarization methods for elimination of power overshoot in microbial fuel cells

    KAUST Repository

    Watson, Valerie J.; Logan, Bruce E.

    2011-01-01

    Polarization curves from microbial fuel cells (MFCs) often show an unexpectedly large drop in voltage with increased current densities, leading to a phenomenon in the power density curve referred to as "power overshoot". Linear sweep voltammetry (LSV, 1 mV s- 1) and variable external resistances (at fixed intervals of 20 min) over a single fed-batch cycle in an MFC both resulted in power overshoot in power density curves due to anode potentials. Increasing the anode enrichment time from 30 days to 100 days did not eliminate overshoot, suggesting that insufficient enrichment of the anode biofilm was not the primary cause. Running the reactor at a fixed resistance for a full fed-batch cycle (~ 1 to 2 days), however, completely eliminated the overshoot in the power density curve. These results show that long times at a fixed resistance are needed to stabilize current generation by bacteria in MFCs, and that even relatively slow LSV scan rates and long times between switching circuit loads during a fed-batch cycle may produce inaccurate polarization and power density results for these biological systems. © 2010 Elsevier B.V. All rights reserved.

  12. Analysis of method of polarization surveying of water surface oil pollution

    Science.gov (United States)

    Zhukov, B. S.

    1979-01-01

    A method of polarization surveying of oil films on the water surface is analyzed. Model calculations of contrasted oil and water obtained with different orientations of the analyzer are discussed. The model depends on the spectral range, water transparency and oil film, and the selection of observational direction.

  13. A possible method to produce a polarized antiproton beam at intermediate energies

    International Nuclear Information System (INIS)

    Spinka, H.; Vaandering, E.W.; Hofmann, J.S.

    1994-01-01

    A feasible and conservative design for a medium energy polarized antiproton beam has been presented. The design requires an intense beam of unpolarized antiprotons (≥ 10 7 /sec) from a typical secondary beam line in order to achieve reasonable anti pp elastic scattering count rates. All three beam spin directions can be achieved. Methods were discussed to reverse the spin directions in modest times, and to change to a polarized proton beam if desired. It is expected that experiments with such a beam would have a profound effect on the understanding of the anti NN interaction at intermediate energies

  14. Laser damage resistance of RbTiOPO(4): evidence of polarization dependent anisotropy.

    Science.gov (United States)

    Wagner, F R; Hildenbrand, A; Natoli, J Y; Commandré, M; Théodore, F; Albrecht, H

    2007-10-17

    Nanosecond-laser induced damage of RbTiOPO(4) crystals (RTP) has been studied at 1064 nm as a function of propagation direction and polarization orientation. A significant difference in the Laser Induced Damage Threshold (LIDT) was observed for x-cut and y-cut crystals in Pockels cell configuration, where the light propagation direction is along the x and y axes of the crystal respectively. In Pockels cell configuration the polarization is oriented at 45? with respect to the z-axis of the crystal. Experiments with the polarization oriented parallel to the principal axes of the crystal pointed out the importance of the polarization direction for the LIDT whereas the propagation direction did not significantly influence the LIDT. Comparison of the experimental data with a simple model reveals the influence of frequency doubling on the LIDT in Pockels cell configuration. In the case of the y-cut Pockels cell, the generation of frequency doubled light causes an LIDT below the LIDT of x and z-polarized light at the fundamental wavelength.

  15. Space-polarization Collaborative Suppression Method for Ionospheric Clutter in HFSWR

    Directory of Open Access Journals (Sweden)

    Yang Yunlong

    2016-12-01

    Full Text Available High Frequency Surface Wave Radar (HFSWR is able to receive surface target and low-flying aircraft echoes at a long-distance, but it suffers severely from ionospheric clutter. In this paper, a spacepolarization collaborative-based filter is introduced to mitigate ionospheric clutter. For parameter estimation on ionospheric clutter used for filters, a spatial parameter estimation algorithm based on compressive sensing is introduced to the DOA estimation of ionospheric clutter. In addition, a polarized parameter estimation algorithm based on statistical characteristics is proposed for ionospheric clutter in the range-Doppler spectrum. Higher estimation accuracy is achieved as a result of the range-Doppler spectrum; therefore, these two estimation algorithms enhance the performance of the space-polarization collaborative suppression method for ionospheric clutter. Experimental results of practical dual-polarized HFSWR data show the effectiveness of the two algorithms and the above mentioned filter for ionospheric clutter suppression.

  16. Applying electric field to charged and polar particles between metallic plates: extension of the Ewald method.

    Science.gov (United States)

    Takae, Kyohei; Onuki, Akira

    2013-09-28

    We develop an efficient Ewald method of molecular dynamics simulation for calculating the electrostatic interactions among charged and polar particles between parallel metallic plates, where we may apply an electric field with an arbitrary size. We use the fact that the potential from the surface charges is equivalent to the sum of those from image charges and dipoles located outside the cell. We present simulation results on boundary effects of charged and polar fluids, formation of ionic crystals, and formation of dipole chains, where the applied field and the image interaction are crucial. For polar fluids, we find a large deviation of the classical Lorentz-field relation between the local field and the applied field due to pair correlations along the applied field. As general aspects, we clarify the difference between the potential-fixed and the charge-fixed boundary conditions and examine the relationship between the discrete particle description and the continuum electrostatics.

  17. The Use of Resistivity Methods in Terrestrial Forensic Searches

    Science.gov (United States)

    Wolf, R. C.; Raisuddin, I.; Bank, C.

    2013-12-01

    The increasing use of near-surface geophysical methods in forensic searches has demonstrated the need for further studies to identify the ideal physical, environmental and temporal settings for each geophysical method. Previous studies using resistivity methods have shown promising results, but additional work is required to more accurately interpret and analyze survey findings. The Ontario Provincial Police's UCRT (Urban Search and Rescue; Chemical, Biolgical, Radiological, Nuclear and Explosives; Response Team) is collaborating with the University of Toronto and two additional universities in a multi-year study investigating the applications of near-surface geophysical methods to terrestrial forensic searches. In the summer of 2012, on a test site near Bolton, Ontario, the OPP buried weapons, drums and pigs (naked, tarped, and clothed) to simulate clandestine graves and caches. Our study aims to conduct repeat surveys using an IRIS Syscal Junior with 48 electrode switching system resistivity-meter. These surveys will monitor changes in resistivity reflecting decomposition of the object since burial, and identify the strengths and weaknesses of resistivity when used in a rural, clandestine burial setting. Our initial findings indicate the usefulness of this method, as prominent resistivity changes have been observed. We anticipate our results will help to assist law enforcement agencies in determining the type of resistivity results to expect based on time since burial, depth of burial and state of dress of the body.

  18. Distribution of conductive minerals as associated with uranium minerals at Dendang Arai sector by induced polarization method

    International Nuclear Information System (INIS)

    Nurdin, M.; Nikijuluw, N.; Subardjo; Sudarto, S.

    2000-01-01

    Based on previous investigation results, a favourable zone of 20-80 meters in wide, 80-240 meters in length and in the direction of East-West to Northwest-Southeast was found. The favourable zone is conductor, associated with sulfide. Induced polarization method has been applied to find vertical and horizontal sulfide distribution. The measurement was conducted in perpendicular to lateral direction of the conductive zone in an interval of 20 meters. Properties measured are apparent resistivity and charge ability. Measurement results indicated the presence of sulfide zone with the position and dip are sub-vertical. Sulfide zones were found on the fault cross-point with the directions being East-West to East South East-West North West by fault is North-South. This anomalies were then represented in 3 (three) dimension tomographic model. (author)

  19. Review of polarized ammonium target

    International Nuclear Information System (INIS)

    Matsuda, Tatsuo

    1987-01-01

    Recently, ammonia (NH 3 ) and deutron ammonia (ND 3 ), instead of conventional alcohol substances, have been used more frequently as a polarized target substance for experiments of polarization at high energy regions. This article reviews major features of the polarized (deutron) ammonia targets. The dynamic nuclear polarization (DNT) method is widely used in high energy polarization experiments. While only a low polarization degree of hydrogen nucleus of 1.7 percent can be obtained by the Brute force method, DNP can produce polarization as high as ∼ 90 percent (2.5 T, ∼ 200 mK). In 1979, ammonia was irradiated with radiations to form NH 2 free radicals, resulting in the achievement of a high polarization degree of greater than 90 percent (hydrogen). Since then, ammonia and deutron ammonia have increasingly been replacing alcohols including butanol. Irradiation of a target substance with radiations destroys the structure of the substance, leading to a decrease in polarization degree. However, ammonia produces unpaired electrons as a result of irradiation, allowing it to be highly resistant to radiation. This report also present some study results, including observations on effects of radiation on the polarization degree of a target, effects of annealing, and polarization of 14 N. A process for producing an ammonia target is also described. (Nogami, K.)

  20. Polarization ratio property and material classification method in passive millimeter wave polarimetric imaging

    Science.gov (United States)

    Cheng, Yayun; Qi, Bo; Liu, Siyuan; Hu, Fei; Gui, Liangqi; Peng, Xiaohui

    2016-10-01

    Polarimetric measurements can provide additional information as compared to unpolarized ones. In this paper, linear polarization ratio (LPR) is created to be a feature discriminator. The LPR properties of several materials are investigated using Fresnel theory. The theoretical results show that LPR is sensitive to the material type (metal or dielectric). Then a linear polarization ratio-based (LPR-based) method is presented to distinguish between metal and dielectric materials. In order to apply this method to practical applications, the optimal range of incident angle have been discussed. The typical outdoor experiments including various objects such as aluminum plate, grass, concrete, soil and wood, have been conducted to validate the presented classification method.

  1. Nanofiltration and Tight Ultrafiltration Membranes for Natural Organic Matter Removal-Contribution of Fouling and Concentration Polarization to Filtration Resistance.

    Science.gov (United States)

    Winter, Joerg; Barbeau, Benoit; Bérubé, Pierre

    2017-07-02

    Nanofiltration (NF) and tight ultrafiltration (tight UF) membranes are a viable treatment option for high quality drinking water production from sources with high concentrations of contaminants. To date, there is limited knowledge regarding the contribution of concentration polarization (CP) and fouling to the increase in resistance during filtration of natural organic matter (NOM) with NF and tight UF. Filtration tests were conducted with NF and tight UF membranes with molecular weight cut offs (MWCOs) of 300, 2000 and 8000 Da, and model raw waters containing different constituents of NOM. When filtering model raw waters containing high concentrations of polysaccharides (i.e., higher molecular weight NOM), the increase in resistance was dominated by fouling. When filtering model raw waters containing humic substances (i.e., lower molecular weight NOM), the increase in filtration resistance was dominated by CP. The results indicate that low MWCO membranes are better suited for NOM removal, because most of the NOM in surface waters consist mainly of humic substances, which were only effectively rejected by the lower MWCO membranes. However, when humic substances are effectively rejected, CP can become extensive, leading to a significant increase in filtration resistance by the formation of a cake/gel layer at the membrane surface. For this reason, cross-flow operation, which reduces CP, is recommended.

  2. Nanofiltration and Tight Ultrafiltration Membranes for Natural Organic Matter Removal—Contribution of Fouling and Concentration Polarization to Filtration Resistance

    Directory of Open Access Journals (Sweden)

    Joerg Winter

    2017-07-01

    Full Text Available Nanofiltration (NF and tight ultrafiltration (tight UF membranes are a viable treatment option for high quality drinking water production from sources with high concentrations of contaminants. To date, there is limited knowledge regarding the contribution of concentration polarization (CP and fouling to the increase in resistance during filtration of natural organic matter (NOM with NF and tight UF. Filtration tests were conducted with NF and tight UF membranes with molecular weight cut offs (MWCOs of 300, 2000 and 8000 Da, and model raw waters containing different constituents of NOM. When filtering model raw waters containing high concentrations of polysaccharides (i.e., higher molecular weight NOM, the increase in resistance was dominated by fouling. When filtering model raw waters containing humic substances (i.e., lower molecular weight NOM, the increase in filtration resistance was dominated by CP. The results indicate that low MWCO membranes are better suited for NOM removal, because most of the NOM in surface waters consist mainly of humic substances, which were only effectively rejected by the lower MWCO membranes. However, when humic substances are effectively rejected, CP can become extensive, leading to a significant increase in filtration resistance by the formation of a cake/gel layer at the membrane surface. For this reason, cross-flow operation, which reduces CP, is recommended.

  3. Determination of slope failure using 2-D resistivity method

    Science.gov (United States)

    Muztaza, Nordiana Mohd; Saad, Rosli; Ismail, Nur Azwin; Bery, Andy Anderson

    2017-07-01

    Landslides and slope failure may give negative economic effects including the cost to repair structures, loss of property value and medical costs in the event of injury. To avoid landslide, slope failure and disturbance of the ecosystem, good and detailed planning must be done when developing hilly area. Slope failure classification and various factors contributing to the instability using 2-D resistivity survey conducted in Selangor, Malaysia are described. The study on landslide and slope failure was conducted at Site A and Site B, Selangor using 2-D resistivity method. The implications of the anticipated ground conditions as well as the field observation of the actual conditions are discussed. Nine 2-D resistivity survey lines were conducted in Site A and six 2-D resistivity survey lines with 5 m minimum electrode spacing using Pole-dipole array were performed in Site B. The data were processed using Res2Dinv and Surfer10 software to evaluate the subsurface characteristics. 2-D resistivity results from both locations show that the study areas consist of two main zones. The first zone is alluvium or highly weathered with the resistivity of 100-1000 Ωm at 20-70 m depth. This zone consists of saturated area (1-100 Ωm) and boulders with resistivity value of 1200-3000 Ωm. The second zone with resistivity values of > 3000 Ωm was interpreted as granitic bedrock. The study area was characterized by saturated zones, highly weathered zone, highly contain of sand and boulders that will trigger slope failure in the survey area. Based on the results obtained from the study findings, it can be concluded that 2-D resistivity method is useful method in determination of slope failure.

  4. Polarized secondary radioactive beams

    International Nuclear Information System (INIS)

    Zaika, N.I.

    1992-01-01

    Three methods of polarized radioactive nuclei beam production: a) a method nuclear interaction of the non-polarized or polarized charged projectiles with target nuclei; b) a method of polarization of stopped reaction radioactive products in a special polarized ion source with than following acceleration; c) a polarization of radioactive nuclei circulating in a storage ring are considered. Possible life times of the radioactive ions for these methods are determined. General schemes of the polarization method realizations and depolarization problems are discussed

  5. Using polarized Raman spectroscopy and the pseudospectral method to characterize molecular structure and function

    Science.gov (United States)

    Weisman, Andrew L.

    Electronic structure calculation is an essential approach for determining the structure and function of molecules and is therefore of critical interest to physics, chemistry, and materials science. Of the various algorithms for calculating electronic structure, the pseudospectral method is among the fastest. However, the trade-off for its speed is more up-front programming and testing, and as a result, applications using the pseudospectral method currently lag behind those using other methods. In Part I of this dissertation, we first advance the pseudospectral method by optimizing it for an important application, polarized Raman spectroscopy, which is a well-established tool used to characterize molecular properties. This is an application of particular importance because often the easiest and most economical way to obtain the polarized Raman spectrum of a material is to simulate it; thus, utilization of the pseudospectral method for this purpose will accelerate progress in the determination of molecular properties. We demonstrate that our implementation of Raman spectroscopy using the pseudospectral method results in spectra that are just as accurate as those calculated using the traditional analytic method, and in the process, we derive the most comprehensive formulation to date of polarized Raman intensity formulas, applicable to both crystalline and isotropic systems. Next, we apply our implementation to determine the orientations of crystalline oligothiophenes -- a class of materials important in the field of organic electronics -- achieving excellent agreement with experiment and demonstrating the general utility of polarized Raman spectroscopy for the determination of crystal orientation. In addition, we derive from first-principles a method for using polarized Raman spectra to establish unambiguously whether a uniform region of a material is crystalline or isotropic. Finally, we introduce free, open-source software that allows a user to determine any of a

  6. Method of separate determination of high-ohmic sample resistance and contact resistance

    Directory of Open Access Journals (Sweden)

    Vadim A. Golubiatnikov

    2015-09-01

    Full Text Available A method of separate determination of two-pole sample volume resistance and contact resistance is suggested. The method is applicable to high-ohmic semiconductor samples: semi-insulating gallium arsenide, detector cadmium-zinc telluride (CZT, etc. The method is based on near-contact region illumination by monochromatic radiation of variable intensity from light emitting diodes with quantum energies exceeding the band gap of the material. It is necessary to obtain sample photo-current dependence upon light emitting diode current and to find the linear portion of this dependence. Extrapolation of this linear portion to the Y-axis gives the cut-off current. As the bias voltage is known, it is easy to calculate sample volume resistance. Then, using dark current value, one can determine the total contact resistance. The method was tested for n-type semi-insulating GaAs. The contact resistance value was shown to be approximately equal to the sample volume resistance. Thus, the influence of contacts must be taken into account when electrophysical data are analyzed.

  7. Experimental noise-resistant Bell-inequality violations for polarization-entangled photons

    International Nuclear Information System (INIS)

    Bovino, Fabio A.; Castagnoli, Giuseppe; Cabello, Adan; Lamas-Linares, Antia

    2006-01-01

    We experimentally demonstrate that violations of Bell's inequalities for two-photon polarization-entangled states with colored noise are extremely robust, whereas this is not the case for states with white noise. Controlling the amount of noise by using the timing compensation scheme introduced by Kim et al. [Phys. Rev. A 67, 010301(R) (2003)], we have observed violations even for states with very high noise, in excellent agrement with the predictions of Cabello et al. [Phys. Rev. A 72, 052112 (2005)

  8. General method for calculating polarization electric fields produced by auroral Cowling mechanism and application examples

    Science.gov (United States)

    Vanhamäki, Heikki; Amm, Olaf; Fujii, Ryo; Yoshikawa, Aki; Ieda, Aki

    2013-04-01

    The Cowling mechanism is characterized by the generation of polarization space charges in the ionosphere in consequence of a partial or total blockage of FAC flowing between the ionosphere and the magnetosphere. Thus a secondary polarization electric field builds up in the ionosphere, which guarantees that the whole (primary + secondary) ionospheric current system is again in balance with the FAC. In the Earth's ionosphere the Cowling mechanism is long known to operate in the equatorial electrojet, and several studies indicate that it is important also in auroral current systems. We present a general method for calculate the secondary polarization electric field, when the ionospheric conductances, the primary (modeled) or the total (measured) electric field, and the Cowling efficiency are given. Here the Cowling efficiency is defined as the fraction of the divergent Hall current canceled by secondary Pedersen current. In contrast to previous studies, our approach is a general solution which is not limited to specific geometrical setups (like an auroral arc), and all parameters may have any kind of spatial dependence. The solution technique is based on spherical elementary current (vector) systems (SECS). This way, we avoid the need to specify explicit boundary conditions for the searched polarization electric field or its potential, which would be required if the problem was solved in a differential equation approach. Instead, we solve an algebraic matrix equation, for which the implicit boundary condition that the divergence of the polarization electric field vanishes outside our analysis area is sufficient. In order to illustrate the effect of Cowling mechanism on ionospheric current systems, we apply our method to two simple models of auroral electrodynamic situations: 1) a mesoscale strong conductance enhancement in the early morning sector within a relatively weak southward primary electric field, 2) a morning sector auroral arc with only a weak conductance

  9. Method for measuring retardation of infrared wave-plate by modulated-polarized visible light

    Science.gov (United States)

    Zhang, Ying; Song, Feijun

    2012-11-01

    A new method for precisely measuring the optical phase retardation of wave-plates in the infrared spectral region is presented by using modulated-polarized visible light. An electro-optic modulator is used to accurately determine the zero point by the frequency-doubled signal of the Modulated-polarized light. A Babinet-Soleil compensator is employed to make the phase delay compensation. Based on this method, an instrument is set up to measure the retardations of the infrared wave-plates with visible region laser. Measurement results with high accuracy and sound repetition are obtained by simple calculation. Its measurement precision is less than and repetitive precision is within 0.3%.

  10. Formal Solutions for Polarized Radiative Transfer. II. High-order Methods

    Energy Technology Data Exchange (ETDEWEB)

    Janett, Gioele; Steiner, Oskar; Belluzzi, Luca, E-mail: gioele.janett@irsol.ch [Istituto Ricerche Solari Locarno (IRSOL), 6605 Locarno-Monti (Switzerland)

    2017-08-20

    When integrating the radiative transfer equation for polarized light, the necessity of high-order numerical methods is well known. In fact, well-performing high-order formal solvers enable higher accuracy and the use of coarser spatial grids. Aiming to provide a clear comparison between formal solvers, this work presents different high-order numerical schemes and applies the systematic analysis proposed by Janett et al., emphasizing their advantages and drawbacks in terms of order of accuracy, stability, and computational cost.

  11. Apparatus and Method for Elimination of Polarization-Induced Fading in Fiber-optic Sensor System

    Science.gov (United States)

    Chan, Hon Man (Inventor); Parker, Jr., Allen R. (Inventor)

    2015-01-01

    The invention is an apparatus and method of eliminating polarization-induced fading in interferometric fiber-optic sensor system having a wavelength-swept laser optical signal. The interferometric return signal from the sensor arms are combined and provided to a multi-optical path detector assembly and ultimately to a data acquisition and processing unit by way of a switch that is time synchronized with the laser scan sweep cycle.

  12. Application of the Ursell-Mayer method in the theory of spin-polarized atomic hydrogen

    International Nuclear Information System (INIS)

    Kilic, S.; Radelja, T.

    1981-01-01

    Employing the Ursell-Mayer method and Ljolje semi-free gas model analytic relations describing ground state properties (energy, pressure, compressibility, sound velocity, radial distribution function and one-particle density matrix) of spin-polarized atomic hydrogen were derived. The expressions are valid up to density 2 10 26 atoms/m 3 . It was found out that at density of 2 10 26 atoms/m 3 the condensation of particle in momentum space is 88% (at absolute zero). (orig.)

  13. Effect of current intensity and pulse duration on polarization resistance of steel 20 in tap water measured on computer-aided unit

    International Nuclear Information System (INIS)

    Sorokin, V.I.; Boriskin, A.V.; Stepanets, G.P.; Shestopalova, A.O.

    1995-01-01

    The paper deals with a study of the impact of polarization current and time on the measurement of polarization resistance R p and coefficient K which relates it to the corrosion rate of low carbon Steel 20 in tap water. The formation of thick films of corrosion products on the surface of metal affects R p and K. The obtained data are used to develop an algorithm for corrosivity measuring microprocessor system operation program. 6 refs.; 3 figs.; 1 tab

  14. Large 3D resistivity and induced polarization acquisition using the Fullwaver system: towards an adapted processing methodology

    Science.gov (United States)

    Truffert, Catherine; Leite, Orlando; Gance, Julien; Texier, Benoît; Bernard, Jean

    2017-04-01

    Driven by needs in the mineral exploration market for ever faster and ever easier set-up of large 3D resistivity and induced polarization, autonomous and cableless recorded systems come to the forefront. Opposite to the traditional centralized acquisition, this new system permits a complete random distribution of receivers on the survey area allowing to obtain a real 3D imaging. This work presents the results of a 3 km2 large experiment up to 600m of depth performed with a new type of autonomous distributed receivers: the I&V-Fullwaver. With such system, all usual drawbacks induced by long cable set up over large 3D areas - time consuming, lack of accessibility, heavy weight, electromagnetic induction, etc. - disappear. The V-Fullwavers record the entire time series of voltage on two perpendicular axes, for a good determination of the data quality although I-Fullwaver records injected current simultaneously. For this survey, despite good assessment of each individual signal quality, on each channel of the set of Fullwaver systems, a significant number of negative apparent resistivity and chargeability remains present in the dataset (around 15%). These values are commonly not taken into account in the inversion software although they may be due to complex geological structure of interest (e.g. linked to the presence of sulfides in the earth). Taking into account that such distributed recording system aims to restitute the best 3D resistivity and IP tomography, how can 3D inversion be improved? In this work, we present the dataset, the processing chain and quality control of a large 3D survey. We show that the quality of the data selected is good enough to include it into the inversion processing. We propose a second way of processing based on the modulus of the apparent resistivity that stabilizes the inversion. We then discuss the results of both processing. We conclude that an effort could be made on the inclusion of negative apparent resistivity in the inversion

  15. Characterization of textural and hydric heterogeneities in argillaceous geo-materials using induced polarization method: application to the excavation damaged zone (EDZ) of the Tournemire experimental station

    International Nuclear Information System (INIS)

    Okay, Gonca

    2011-01-01

    This Ph-D thesis investigates the potential of clay rocks for deep geological disposal of radioactive waste. Underground excavations are responsible in their vicinity a region, where the clay-rock is damaged or disturbed. This region must to be characterized to ensure the safety of repositories. The extension of the excavation damaged zone (EDZ) and its evolution over time have been investigated thought electrical resistivity and induced polarization methods from three galleries belonging to the French Institute of Radioprotection and Nuclear Safety (IRSN)'s experimental underground research laboratory of Tournemire (Aveyron, France). Time domain induced polarisation indicates the presence of mineralization (e.g., especially pyrite) located in the structural discontinuities such as tectonic fractures (mm-cm), tectonic fault (m) and calcareous nodules (cm). Combined electrical resistivity and Induced Polarization methods show the possibility to delineate textural changes associated to desaturation of the clay-rock induced by the ventilation of galleries. The impact of the desaturation is particularly observed on the gallery's walls. In addition, Spectral Induced Polarization (SIP) tomography results can be used to discriminate the responses of the de-saturated zones from the fractured zones. We have performed laboratory experiments (in the range 1.4 mHz - 12 kHz) using saturated unconsolidated sand-clay mixtures. The results illustrate that the amplitude of polarization is strongly affected by the surface properties of these mixtures (e.g., cation exchange capacity, specific surface area) and by the volumetric clay content. However, the amplitude of polarization is independent of the concentration of electrolyte. The SIP response is also strongly sensitive to the mineralogy of the clays. (author)

  16. Ultralow nonalloyed Ohmic contact resistance to self aligned N-polar GaN high electron mobility transistors by In(Ga)N regrowth

    International Nuclear Information System (INIS)

    Dasgupta, Sansaptak; Nidhi,; Brown, David F.; Wu, Feng; Keller, Stacia; Speck, James S.; Mishra, Umesh K.

    2010-01-01

    Ultralow Ohmic contact resistance and a self-aligned device structure are necessary to reduce the effect of parasitic elements and obtain higher f t and f max in high electron mobility transistors (HEMTs). N-polar (0001) GaN HEMTs, offer a natural advantage over Ga-polar HEMTs, in terms of contact resistance since the contact is not made through a high band gap material [Al(Ga)N]. In this work, we extend the advantage by making use of polarization induced three-dimensional electron-gas through regrowth of graded InGaN and thin InN cap in the contact regions by plasma (molecular beam epitaxy), to obtain an ultralow Ohmic contact resistance of 27 Ω μm to a GaN 2DEG.

  17. Can Electron Propagator Methods Be Used To Improve Polarization Propagator Methods?

    DEFF Research Database (Denmark)

    Jensen, Hans Jørgen Aagaard

    2008-01-01

    Calculations of Rydberg excitation energies with the second-order polarization propagator approximation (SOPPA) often produce results which are more in error than the random phase approximation (RPA), which formally is the first-order model. This is obviously because of cancellation of errors...... at the RPA level. On the other hand, valence excitation energies behave as expected, and they are systematically improved in SOPPA compared to RPA. Note that a Rydberg series is related to one of the ionization thresholds of the molecule, and it is thus obvious that a good description of the ionization...

  18. 3-D Forward modeling of Induced Polarization Effects of Transient Electromagnetic Method

    Science.gov (United States)

    Wu, Y.; Ji, Y.; Guan, S.; Li, D.; Wang, A.

    2017-12-01

    In transient electromagnetic (TEM) detection, Induced polarization (IP) effects are so important that they cannot be ignored. The authors simulate the three-dimensional (3-D) induced polarization effects in time-domain directly by applying the finite-difference time-domain method (FDTD) based on Cole-Cole model. Due to the frequency dispersion characteristics of the electrical conductivity, the computations of convolution in the generalized Ohm's law of fractional order system makes the forward modeling particularly complicated. Firstly, we propose a method to approximate the fractional order function of Cole-Cole model using a lower order rational transfer function based on error minimum theory in the frequency domain. In this section, two auxiliary variables are introduced to transform nonlinear least square fitting problem of the fractional order system into a linear programming problem, thus avoiding having to solve a system of equations and nonlinear problems. Secondly, the time-domain expression of Cole-Cole model is obtained by using Inverse Laplace transform. Then, for the calculation of Ohm's law, we propose an e-index auxiliary equation of conductivity to transform the convolution to non-convolution integral; in this section, the trapezoid rule is applied to compute the integral. We then substitute the recursion equation into Maxwell's equations to derive the iterative equations of electromagnetic field using the FDTD method. Finally, we finish the stimulation of 3-D model and evaluate polarization parameters. The results are compared with those obtained from the digital filtering solution of the analytical equation in the homogeneous half space, as well as with the 3-D model results from the auxiliary ordinary differential equation method (ADE). Good agreements are obtained across the three methods. In terms of the 3-D model, the proposed method has higher efficiency and lower memory requirements as execution times and memory usage were reduced by 20

  19. Resistivity measurements using a direct current induction method (1963)

    International Nuclear Information System (INIS)

    Delaplace, J.; Hillairet, J.

    1964-01-01

    The conventional methods for measuring electrical resistivities necessitate the fixing of electrical contacts on the sample either mechanically or by soldering. Furthermore it is also necessary to carry,out the measurements on low cross-section samples which are not always easy to obtain. Our direct-current induction method on the other hand requires no contacts and can easily be applied to samples of large cross-section. The sample is placed in a uniform magnetic field; at the moment when the current is cut, eddy currents appear in the sample which tend to oppose the disappearance of the field. The way in which the magnetic flux decreases in the sample makes it possible to determine the resistivity of the material. This method has been applied to samples having diameters of between 1 and 30 mm in the case of metals which are good conductors. It gives a value for the local resistivity and makes it possible to detect any variation along a sample. The measurements can be carried out at all temperature from a few degrees absolute to 500 deg. C. We have used the induction method to follow the purification of beryllium by zone-melting; it is in effect possible to estimate the purity of a material by resistivity measurements. We have measured the resistivity along each bar treated by the zone-melting technique and have thus, localised the purest section. High temperature measurements have been carried out on uranium carbide and on iron-aluminium alloys. This method constitutes an interesting means of investigation the resistivity of solid materials. Its accuracy and rapidity make it particularly adapted both to fundamental research and to production control. (authors) [fr

  20. A new method for the measurement of the polarization characteristics of ferromagnetic films on ultracold neutrons

    International Nuclear Information System (INIS)

    Taran, Yu.V.

    1985-01-01

    A new method has been developed for measuring the polarization characteristics of ferromagnetic films on ultracold neutrons (UCN) by single-, double- and triple-transmission of UCN beam through one and the same film. To realize the method an installation has been proposed consisting of the two UCN storage traps connected with a mirror neutron guide. An investigated film is placed in the slit in the middle of the neutron guide. On both sides of the film a spin-flipper is installed bottle is equiped with three neutron values which permit filling in the bottle with UCN and allow oneto let UCN out to the neutron guide or detector. The neutrons once let out from one bottle into the neutron guide are caught by the other. The film can be moved out of the neutron guide or rotated. By manipulating with spin-flippers and the film one may take the integral polarization parameters of the film: transmission, polarizing and analysing efficiencies, so-called S-factor, which is the fourth independent linear combination of the elements of the square 2x2 transmission matrix of the film. The measurement parameters help to restore the film transmission matrix. Then a comparison is drawn with the theoretical models of UCN depolarization on transmission through a ferromagnetic film

  1. Laboratory methods for diagnosis and detection of drug resistant ...

    African Journals Online (AJOL)

    Data source: Published series of peer reviewed journals and manuals written on laboratory methods that are currently used for diagnosis and detection of drug resistance of Mycobacterium tuberculosis complex were reviewed using the index medicus, pubmed and medline search. Conventional bacteriological microscopy ...

  2. Finite-Geometry and Polarized Multiple-Scattering Corrections of Experimental Fast- Neutron Polarization Data by Means of Monte Carlo Methods

    Energy Technology Data Exchange (ETDEWEB)

    Aspelund, O; Gustafsson, B

    1967-05-15

    After an introductory discussion of various methods for correction of experimental left-right ratios for polarized multiple-scattering and finite-geometry effects necessary and sufficient formulas for consistent tracking of polarization effects in successive scattering orders are derived. The simplifying assumptions are then made that the scattering is purely elastic and nuclear, and that in the description of the kinematics of the arbitrary Scattering {mu}, only one triple-parameter - the so-called spin rotation parameter {beta}{sup ({mu})} - is required. Based upon these formulas a general discussion of the importance of the correct inclusion of polarization effects in any scattering order is presented. Special attention is then paid to the question of depolarization of an already polarized beam. Subsequently, the afore-mentioned formulas are incorporated in the comprehensive Monte Carlo program MULTPOL, which has been designed so as to correctly account for finite-geometry effects in the sense that both the scattering sample and the detectors (both having cylindrical shapes) are objects of finite dimensions located at finite distances from each other and from the source of polarized fast-neutrons. A special feature of MULTPOL is the application of the method of correlated sampling for reduction of the standard deviations .of the results of the simulated experiment. Typical data of performance of MULTPOL have been obtained by the application of this program to the correction of experimental polarization data observed in n + '{sup 12}C elastic scattering between 1 and 2 MeV. Finally, in the concluding remarks the possible modification of MULTPOL to other experimental geometries is briefly discussed.

  3. Standard test method for galling resistance of material couples

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This test method covers a laboratory test that ranks the galling resistance of material couples using a quantitative measure. Bare metals, alloys, nonmetallic materials, coatings, and surface modified materials may be evaluated by this test method. 1.2 This test method is not designed for evaluating the galling resistance of material couples sliding under lubricated conditions, because galling usually will not occur under lubricated sliding conditions using this test method. 1.3 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  4. Stokes vector based interpolation method to improve the efficiency of bio-inspired polarization-difference imaging in turbid media

    Science.gov (United States)

    Guan, Jinge; Ren, Wei; Cheng, Yaoyu

    2018-04-01

    We demonstrate an efficient polarization-difference imaging system in turbid conditions by using the Stokes vector of light. The interaction of scattered light with the polarizer is analyzed by the Stokes-Mueller formalism. An interpolation method is proposed to replace the mechanical rotation of the polarization axis of the analyzer theoretically, and its performance is verified by the experiment at different turbidity levels. We show that compared with direct imaging, the Stokes vector based imaging method can effectively reduce the effect of light scattering and enhance the image contrast.

  5. A novel method for analysing key corticosteroids in polar bear (Ursus maritimus) hair using liquid chromatography tandem mass spectrometry

    DEFF Research Database (Denmark)

    Weisser, Johan; Hansen, Martin; Björklund, Erland

    2016-01-01

    . This procedure allows for the simultaneous determination of multiple steroids, which is in contrast to previous polar bear studies based on ELISA techniques. Absolute method recoveries were 81%, 75% and 60% for cortisol, corticosterone and aldosterone, respectively. We applied the developed method on a hair......This paper presents the development and evaluation of a methodology for extraction, clean-up and analysis of three key corticosteroids (aldosterone, cortisol and corticosterone) in polar bear hair. Such a methodology can be used to monitor stress biomarkers in polar bears and may provide...

  6. Polarity-dependent resistance switching in GeSbTe phase-change thin films : The importance of excess Sb in filament formation

    NARCIS (Netherlands)

    Pandian, Ramanathaswamy; Kooi, Bart J.; Oosthoek, Jasper L. M.; van den Dool, Pim; Palasantzas, George; Pauza, Andrew

    2009-01-01

    We show that polarity-dependent resistance switching in GeSbTe thin films depends strongly on Sb composition by comparing current-voltage characteristics in Sb-excess Ge(2)Sb(2+x)Te(5) and stoichiometric Ge(2)Sb(2)Te(5) samples. This type of switching in Ge(2)Sb(2+x)Te(5) films is reversible with

  7. A Novel Method for Performance Analysis of OFDM Polarization Diversity System in Ricean Fading Environment

    DEFF Research Database (Denmark)

    Ilic-Delibasic, M.; Pejanovic-Djurisic, M.; Prasad, R.

    2012-01-01

    OFDM (Orthogonal Frequency Division Multiplexing) is proven to be a very effective modulation and multiple access technique that enables high data rate transmission. Due to its good performance it is already implemented in several standardized technologies, and it is very promising technique...... conditions. In order to calculate BER (Bit Error Rate) for the considered OFDM polarization diversity system with a certain level of the received signals correlation, we propose a novel analytical method. The obtained results are compared with the ones attained by simulation....

  8. Chemical passivation as a method of improving the electrochemical corrosion resistance of Co-Cr-based dental alloy.

    Science.gov (United States)

    Rylska, Dorota; Sokołowski, Grzegorz; Sokołowski, Jerzy; Łukomska-Szymańska, Monika

    2017-01-01

    The purpose of the study was to evaluate corrosion resistance of Wirobond C® alloy after chemical passivation treatment. The alloy surface undergone chemical passivation treatment in four different media. Corrosion studies were carried out by means of electrochemical methods in saline solution. Corrosion effects were determined using SEM. The greatest increase in the alloy polarization resistance was observed for passive layer produced in Na2SO4 solution with graphite. The same layer caused the highest increase in corrosion current. Generally speaking, the alloy passivation in Na2SO4 solution with graphite caused a substantial improvement of the corrosion resistance. The sample after passivation in Na2SO4 solution without graphite, contrary to others, lost its protective properties along with successive anodic polarization cycles. The alloy passivation in Na3PO4 solution with graphite was the only one that caused a decrease in the alloy corrosion properties. The SEM studies of all samples after chemical passivation revealed no pit corrosion - in contrast to the sample without any modification. Every successive polarization cycle in anodic direction of pure Wirobond C® alloy enhances corrosion resistance shifting corrosion potential in the positive direction and decreasing corrosion current value. The chemical passivation in solutions with low pH values decreases susceptibility to electrochemical corrosion of Co-Cr dental alloy. The best protection against corrosion was obtained after chemical passivation of Wirobond C® in Na2SO4 solution with graphite. Passivation with Na2SO4 in solution of high pH does not cause an increase in corrosion resistance of WIROBOND C. Passivation process increases alloy resistance to pit corrosion.

  9. Computational methods for structural load and resistance modeling

    Science.gov (United States)

    Thacker, B. H.; Millwater, H. R.; Harren, S. V.

    1991-01-01

    An automated capability for computing structural reliability considering uncertainties in both load and resistance variables is presented. The computations are carried out using an automated Advanced Mean Value iteration algorithm (AMV +) with performance functions involving load and resistance variables obtained by both explicit and implicit methods. A complete description of the procedures used is given as well as several illustrative examples, verified by Monte Carlo Analysis. In particular, the computational methods described in the paper are shown to be quite accurate and efficient for a material nonlinear structure considering material damage as a function of several primitive random variables. The results show clearly the effectiveness of the algorithms for computing the reliability of large-scale structural systems with a maximum number of resolutions.

  10. Method of making sulfur-resistant composite metal membranes

    Science.gov (United States)

    Way, J Douglas [Boulder, CO; Lusk, Mark [Golden, CO; Thoen, Paul [Littleton, CO

    2012-01-24

    The invention provides thin, hydrogen-permeable, sulfur-resistant membranes formed from palladium or palladium-alloy coatings on porous, ceramic or metal supports. Also disclosed are methods of making these membranes via sequential electroless plating techniques, wherein the method of making the membrane includes decomposing any organic ligands present on the substrate, reducing the palladium crystallites on the substrate to reduced palladium crystallites, depositing a film of palladium metal on the substrate and then depositing a second, gold film on the palladium film. These two metal films are then annealed at a temperature between about 200.degree. C. and about 1200.degree. C. to form a sulfur-resistant, composite PdAu alloy membrane.

  11. Clozapine-resistant schizophrenia – non pharmacological augmentation methods

    Directory of Open Access Journals (Sweden)

    Gałaszkiewicz Joanna

    2017-12-01

    Full Text Available Clozapine is the drug of choice for drug-resistant schizophrenia, but despite its use, 30-40% patients fail to achieve satisfactory therapeutic effects. In such situations, augmentation attempts are made by both pharmacological and non-pharmacological methods. To date, most of the work has been devoted to pharmacological strategies, much less to augemantation of clozapine with electroconvulsive therapy (C+ECT, transcranial direct current stimulation (tDCS or transcranial magnetic stimulation (TMS.

  12. Detecting and monitoring of water inrush in tunnels and coal mines using direct current resistivity method: A review

    Directory of Open Access Journals (Sweden)

    Shucai Li

    2015-08-01

    Full Text Available Detecting, real-time monitoring and early warning of underground water-bearing structures are critically important issues in prevention and mitigation of water inrush hazards in underground engineering. Direct current (DC resistivity method is a widely used method for routine detection, advanced detection and real-time monitoring of water-bearing structures, due to its high sensitivity to groundwater. In this study, the DC resistivity method applied to underground engineering is reviewed and discussed, including the observation mode, multiple inversions, and real-time monitoring. It is shown that a priori information constrained inversion is desirable to reduce the non-uniqueness of inversion, with which the accuracy of detection can be significantly improved. The focused resistivity method is prospective for advanced detection; with this method, the flanking interference can be reduced and the detection distance is increased subsequently. The time-lapse resistivity inversion method is suitable for the regions with continuous conductivity changes, and it can be used to monitor water inrush in those regions. Based on above-mentioned features of various methods in terms of benefits and limitations, we propose a three-dimensional (3D induced polarization method characterized with multi-electrode array, and introduce it into tunnels and mines combining with real-time monitoring with time-lapse inversion and cross-hole resistivity method. At last, the prospective applications of DC resistivity method are discussed as follows: (1 available advanced detection technology and instrument in tunnel excavated by tunnel boring machine (TBM, (2 high-resolution detection method in holes, (3 four-dimensional (4D monitoring technology for water inrush sources, and (4 estimation of water volume in water-bearing structures.

  13. Application of vertical electrical sounding combined with induced polarization method in ground water exploration; IP koka wo koryoshita hiteikoho suichoku tansa no chikasui chosa eno tekiyo

    Energy Technology Data Exchange (ETDEWEB)

    Kondo, M; Sakurada, H [Sumiko Consultants Co. Ltd., Tokyo (Japan); Suzuki, T [Hokkaido Development Bureau, Hokkaido Development Agency, Sapporo (Japan)

    1996-10-01

    For ground water exploration using vertical Schlumberger exploration method, measurement and analysis combined with induced polarization (IP) effect were conducted as trial. For the Schlumberger method, potential is measured at the center between potential electrodes during flow of dc current between current electrodes. In the case of vertical exploration, measurements are repeated with fixed potential electrodes by extending the distance between current electrodes. Ground water exploration was conducted using this method at Otaki village, Hokkaido. Geology of surveyed plateau consists of a basement of Pliocene tuffs and Quaternary Pleistocene sediments covering on the surface. For the results of analysis, four to seven beds were detected from the resistivity. The depth up to the lowest bed was between 25 and 85 m, the resistivity of each bed was between 9 and 8,000 ohm{times}m, and the polarizability was between 1 and 15 mV/V. Among these resistivity zones, it was judged that zones satisfying following three conditions correspond to coarse grain sediments saturated with ground water, and can be expected as aquifers; having resistivity ranging between 100 and 1,000 ohm{times}m, polarizability higher than 10 mV/V, and relatively large thickness. 11 refs., 6 figs.

  14. The second-order polarization propagator approximation (SOPPA) method coupled to the polarizable continuum model

    DEFF Research Database (Denmark)

    Eriksen, Janus Juul; Solanko, Lukasz Michal; Nåbo, Lina J.

    2014-01-01

    2) wave function coupled to PCM, we introduce dynamical PCM solvent effects only in the Random Phase Approximation (RPA) part of the SOPPA response equations while the static solvent contribution is kept in both the RPA terms as well as in the higher order correlation matrix components of the SOPPA...... response equations. By dynamic terms, we refer to contributions that describe a change in environmental polarization which, in turn, reflects a change in the core molecular charge distribution upon an electronic excitation. This new combination of methods is termed PCM-SOPPA/RPA. We apply this newly...... defined method to the challenging cases of solvent effects on the lowest and intense electronic transitions in o-, m- and p-nitroaniline and o-, m- and p-nitrophenol and compare the performance of PCM-SOPPA/RPA with more conventional approaches. Compared to calculations based on time-dependent density...

  15. Standard Reference Test Method for Making Potentiostatic and Potentiodynamic Anodic Polarization Measurements

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2004-01-01

    1.1 This test method covers an experimental procedure for checking experimental technique and instrumentation. If followed, this test method will provide repeatable potentiostatic and potentiodynamic anodic polarization measurements that will reproduce data determined by others at other times and in other laboratories provided all laboratories are testing reference samples from the same lot of Type 430 stainless steel. 1.2 Values stated in SI units are to be regarded as the standard. Inch-pound units given in parentheses are for information only. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  16. An open circuit voltage equation enabling separation of cathode and anode polarization resistances of ceria electrolyte based solid oxide fuel cells

    Science.gov (United States)

    Zhang, Yanxiang; Chen, Yu; Yan, Mufu

    2017-07-01

    The open circuit voltage (OCV) of solid oxide fuel cells is generally overestimated by the Nernst equation and the Wagner equation, due to the polarization losses at electrodes. Considering both the electronic conduction of electrolyte and the electrode polarization losses, we express the OCV as an implicit function of the characteristic oxygen pressure of electrolyte (p* [atm], at which the electronic and ionic conductivities are the same), and the relative polarization resistance of electrodes (rc = Rc/Ri and ra = Ra/Ri, where Ri/c/a [Ωcm2] denotes the ionic resistance of electrolyte, and the polarization resistances of cathode and anode, respectively). This equation approaches to the Wagner equation when the electrodes are highly active (rc and ra → 0), and approaches to the Nernst equation when the electrolyte is a purely ionic conductor (p* → 0). For the fuel cells whose OCV is well below the prediction of the Wagner equation, for example with thin doped ceria electrolyte, it is demonstrated that the combination of OCV and impedance spectroscopy measurements allows the determination of p*, Rc and Ra. This equation can serve as a simple yet powerful tool to study the internal losses in the cell under open circuit condition.

  17. Pulsed Polarization-Based NOx Sensors of YSZ Films Produced by the Aerosol Deposition Method and by Screen-Printing.

    Science.gov (United States)

    Exner, Jörg; Albrecht, Gaby; Schönauer-Kamin, Daniela; Kita, Jaroslaw; Moos, Ralf

    2017-07-26

    The pulsed polarization technique on solid electrolytes is based on alternating potential pulses interrupted by self-discharge pauses. Since even small concentrations of nitrogen oxides (NO x ) in the ppm range significantly change the polarization and discharge behavior, pulsed polarization sensors are well suited to measure low amounts of NO x . In contrast to all previous investigations, planar pulsed polarization sensors were built using an electrolyte thick film and platinum interdigital electrodes on alumina substrates. Two different sensor layouts were investigated, the first with buried Pt electrodes under the electrolyte and the second one with conventional overlying Pt electrodes. Electrolyte thick films were either formed by aerosol deposition or by screen-printing, therefore exhibiting a dense or porous microstructure, respectively. For screen-printed electrolytes, the influence of the electrolyte resistance on the NO x sensing ability was investigated as well. Sensors with buried electrodes showed little to no response even at higher NO x concentrations, in good agreement with the intended sensor mechanism. Electrolyte films with overlying electrodes, however, allowed the quantitative detection of NO x . In particular, aerosol deposited electrolytes exhibited high sensitivities with a sensor output signal Δ U of 50 mV and 75 mV for 3 ppm of NO and NO₂, respectively. For screen-printed electrolytes, a clear trend indicated a decrease in sensitivity with increased electrolyte resistance.

  18. Resistivity Correction Factor for the Four-Probe Method: Experiment I

    Science.gov (United States)

    Yamashita, Masato; Yamaguchi, Shoji; Enjoji, Hideo

    1988-05-01

    Experimental verification of the theoretically derived resistivity correction factor (RCF) is presented. Resistivity and sheet resistance measurements by the four-probe method are made on three samples: isotropic graphite, ITO film and Au film. It is indicated that the RCF can correct the apparent variations of experimental data to yield reasonable resistivities and sheet resistances.

  19. Corrosion evaluation of heat recovery steam generator superheater tube in two methods of testing: Tafel polarization and electrochemical impedance spectroscopy (EIS)

    Science.gov (United States)

    Santoso, Rio Pudjidarma; Riastuti, Rini

    2018-05-01

    The purpose of this research is to evaluate the corrosion process which occurs on the water side of Heat Recovery Steam Generator (HRSG) superheater tube. The tube was 13CrMo44 and divided into 3 types of specimen: new tube, used tube (with oxide layer on surface), cleaned-used tube (without oxide layer on surface). The evaluation of corrosion parameters wasperformed using deaerated ultra-high purity water (boiler feed water) in two methods of testing: Tafel polarization and Electrochemical Impedance Spectroscopy (EIS). Tafel polarization was excellent as its capability to show the value of corrosion current and the corrosion rate explicitly, on the other hand, EIS was excellent as its capability to explain for corrosion mechanism on metal interface in detail. Both methods showed that the increase of electrolyte temperature from 25°C to 55°C would increase the corrosion rate with the mechanism of decreasing polarization resistance due to thinning out the passive film thickness and enlarge the area of reduction reaction of cathode. Magnetite oxide scale which is laid on the surface of used tube specimen shows protective nature to reduce the corrosion rate, and clear up this oxide would increase the corrosion rate back as new tube.

  20. Method of manufacturing a shapeable short-resistant capacitor

    Science.gov (United States)

    Taylor, Ralph S.; Myers, John D.; Baney, William J.

    2013-04-02

    A method that employs a novel combination of conventional fabrication techniques provides a ceramic short-resistant capacitor that is bendable and/or shapeable to provide a multiple layer capacitor that is extremely compact and amenable to desirable geometries. The method allows thinner and more flexible ceramic capacitors to be made. The method includes forming a first thin metal layer on a substrate; depositing a thin, ceramic dielectric layer over the metal layer; depositing a second thin metal layer over the dielectric layer to form a capacitor exhibiting a benign failure mode; and separating the capacitor from the substrate. The method may also include bending the resulting capacitor into a serpentine arrangement with gaps between the layers that allow venting of evaporated electrode material in the event of a benign failure.

  1. Development in LIYaF of the method of polarized thermal neutron beam production by mirror reflection

    International Nuclear Information System (INIS)

    Borovikova, N.V.; Bulkin, A.P.; Gukasov, A.G.

    1980-01-01

    Main stages of development of polarizing neutron guide equipment in LIYaF of the USSR Academy of Sciences are described. To carry out experiments on solid-state physics constructed was a working mock-up of a polarizing neutron guide having 1570 mm length of a mirror channel. Successful application of polarizing mirrors to the working mock-up permitted to develop and fabricate five-meter polarizing neutron guide with output flux equal to 1.5x10 7 neutr/cm 2 xs. The following stage of development of polarizing neutron guides was the construction of four-meter neutron guide at the WWR-M reactor with output flux equal to the highest possible. Improvement of optical sections geometry made it possible to produce integral flux of 6.0x10 7 neutr/cm 2 xs in this neutron guide at 15 MW reactor power. The results obtained testify to prospects of the mirror method for polarization of thermal neutrons of a wave length lambda >= A. Neutron guides-polarizators permit to produce high fluxes of polarized thermal neutrons in the wide interval of wave length [ru

  2. In vitro screening methods for assessing plant disease resistance

    International Nuclear Information System (INIS)

    Lebeda, A.; Svabova, L.

    2010-01-01

    A combination of biotechnological and phytopathological techniques provides an alternative approach to classical resistance breeding methods. Such techniques have been increasingly used since the 1980s, in parallel with the progress in plant biotechnology. In the approach of resistance screening and selection in vitro, both experimental objects, i.e., the plant and the pathogen, must first be transferred to in vitro conditions, and finally, the plant material must be transferred back to in vivo conditions and adapted to the outside settings. Specific attention must be paid to the methods of pathogen preparation for use in screening and selection in vitro. The selection agents are classified according to their origin, the methods of preparation, nature and content of active substances, and effective utilisation for screening or selection in vitro. Basic principles and methodological aspects of the in vitro work (explant cultures, sources of in vitro variability, screening and selection methods, types of selection agents) as well as examples of practical applications in the breeding of different crops are critically reviewed in this chapter. (author)

  3. A new and efficient culture method for porcine bone marrow-derived M1- and M2-polarized macrophages.

    Science.gov (United States)

    Gao, Jiye; Scheenstra, Maaike R; van Dijk, Albert; Veldhuizen, Edwin J A; Haagsman, Henk P

    2018-06-01

    Macrophages play an important role in the innate immune system as part of the mononuclear phagocyte system (MPS). They have a pro-inflammatory signature (M1-polarized macrophages) or anti-inflammatory signature (M2-polarized macrophages) based on expression of surface receptors and secretion of cytokines. However, very little is known about the culture of macrophages from pigs and more specific about the M1 and M2 polarization in vitro. Porcine monocytes or mononuclear bone marrow cells were used to culture M1- and M2-polarized macrophages in the presence of GM-CSF and M-CSF, respectively. Surface receptor expression was measured with flow cytometry and ELISA was used to quantify cytokine secretion in response to LPS and PAM 3 CSK 4 stimulation. Human monocyte-derived macrophages were used as control. Porcine M1- and M2-polarized macrophages were cultured best using porcine GM-CSF and murine M-CSF, respectively. Cultures from bone marrow cells resulted in a higher yield M1- and M2-polarized macrophages which were better comparable to human monocyte-derived macrophages than cultures from porcine monocytes. Porcine M1-polarized macrophages displayed the characteristic fried egg shape morphology, lower CD163 expression and low IL-10 production. Porcine M2-polarized macrophages contained the spindle-like morphology, higher CD163 expression and high IL-10 production. Porcine M1- and M2-polarized macrophages can be most efficiently cultured from mononuclear bone marrow cells using porcine GM-CSF and murine M-CSF. The new culture method facilitates more refined studies of porcine macrophages in vitro, important for both porcine and human health since pigs are increasingly used as model for translational research. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  4. USING SESSION RPE TO MONITOR DIFFERENT METHODS OF RESISTANCE EXERCISE

    Directory of Open Access Journals (Sweden)

    Alison D. Egan

    2006-06-01

    Full Text Available The purpose of this study was to compare session rating of perceived exertion for different resistance training techniques in the squat exercise. These techniques included traditional resistance training, super slow, and maximal power training. Fourteen college-age women (Mean ± SD; age = 22 ± 3 years; height = 1.68 ± 0. 07 m completed three experimental trials in a randomized crossover design. The traditional resistance training protocol consisted of 6 sets of 6 repetitions of squats using 80% of 1-RM. The super slow protocol consisted of 6 sets of 6 repetitions using 55% of 1-RM. The maximal power protocol consisted of 6 sets of 6 repetitions using 30% of 1-RM. Rating of perceived exertion (RPE measures were obtained following each set using Borg's CR-10 scale. In addition, a session RPE value was obtained 30 minutes following each exercise session. When comparing average RPE and session RPE, no significant difference was found. However, power training had significantly lower (p < 0.05 average and session RPE (4.50 ± 1.9 and 4.5 ± 2.1 compared to both super slow training (7.81 ± 1.75 and 7.43 ± 1.73 and traditional training (7.33 ± 1.52 and 7.13 ± 1.73. The results indicate that session RPE values are not significantly different from the more traditional methods of measuring RPE during exercise bouts. It does appear that the resistance training mode that is used results in differences in perceived exertion that does not relate directly to the loading that is used. Using session RPE provides practitioners with the same information about perceived exertion as the traditional RPE measures. Taking a single measure following a training session would appear to be much easier than using multiple measures of RPE throughout a resistance training workout. However, practitioners should also be aware that the RPE does not directly relate to the relative intensity used and appears to be dependent on the mode of resistance exercise that is used

  5. Dynamic nuclear polarization methods in solids and solutions to explore membrane proteins and membrane systems.

    Science.gov (United States)

    Cheng, Chi-Yuan; Han, Songi

    2013-01-01

    Membrane proteins regulate vital cellular processes, including signaling, ion transport, and vesicular trafficking. Obtaining experimental access to their structures, conformational fluctuations, orientations, locations, and hydration in membrane environments, as well as the lipid membrane properties, is critical to understanding their functions. Dynamic nuclear polarization (DNP) of frozen solids can dramatically boost the sensitivity of current solid-state nuclear magnetic resonance tools to enhance access to membrane protein structures in native membrane environments. Overhauser DNP in the solution state can map out the local and site-specific hydration dynamics landscape of membrane proteins and lipid membranes, critically complementing the structural and dynamics information obtained by electron paramagnetic resonance spectroscopy. Here, we provide an overview of how DNP methods in solids and solutions can significantly increase our understanding of membrane protein structures, dynamics, functions, and hydration in complex biological membrane environments.

  6. An Image Matching Method Based on Fourier and LOG-Polar Transform

    Directory of Open Access Journals (Sweden)

    Zhijia Zhang

    2014-04-01

    Full Text Available This Traditional template matching methods are not appropriate for the situation of large angle rotation between two images in the online detection for industrial production. Aiming at this problem, Fourier transform algorithm was introduced to correct image rotation angle based on its rotatary invariance in time-frequency domain, orienting image under test in the same direction with reference image, and then match these images using matching algorithm based on log-polar transform. Compared with the current matching algorithms, experimental results show that the proposed algorithm can not only match two images with rotation of arbitrary angle, but also possess a high matching accuracy and applicability. In addition, the validity and reliability of algorithm was verified by simulated matching experiment targeting circular images.

  7. Transfer of polarized light in planetary atmospheres basic concepts and practical methods

    CERN Document Server

    Hovenier, Joop W; Domke, Helmut

    2004-01-01

    The principal elements of the theory of polarized light transfer in planetary atmospheres are expounded in a systematic but concise way. Basic concepts and practical methods are emphasized, both for single and multiple scattering of electromagnetic radiation by molecules and particles in the atmospheres of planets in the Solar System, including the Earth, and beyond. A large part of the book is also useful for studies of light scattering by particles in comets, the interplanetary and interstellar medium, circumstellar disks, reflection nebulae, water bodies like oceans and suspensions of particles in a gas or liquid in the laboratory. Throughout the book symmetry principles, such as the reciprocity principle and the mirror symmetry principle, are employed. In this way the theory is made more transparent and easier to understand than in most papers on the subject. In addition, significant computational reductions, resulting from symmetry principles, are presented. Hundreds of references to relevant literature ...

  8. Consistent calculation of the polarization electric dipole moment by the shell-correction method

    International Nuclear Information System (INIS)

    Denisov, V.Yu.

    1992-01-01

    Macroscopic calculations of the polarization electric dipole moment which arises in nuclei with an octupole deformation are discussed in detail. This dipole moment is shown to depend on the position of the center of gravity. The conditions of consistency of the radii of the proton and neutron potentials and the radii of the proton and neutron surfaces, respectively, are discussed. These conditions must be incorporated in a shell-correction calculation of this dipole moment. A correct calculation of this moment by the shell-correction method is carried out. Dipole transitions between (on the one hand) levels belonging to an octupole vibrational band and (on the other) the ground state in rare-earth nuclei with a large quadrupole deformation are studied. 19 refs., 3 figs

  9. Applying polarity rapid assessment method and ultrafiltration to characterize NDMA precursors in wastewater effluents.

    Science.gov (United States)

    Chen, Chao; Leavey, Shannon; Krasner, Stuart W; Mel Suffet, I H

    2014-06-15

    Certain nitrosamines in water are disinfection byproducts that are probable human carcinogens. Nitrosamines have diverse and complex precursors that include effluent organic matter, some anthropogenic chemicals, and natural (likely non-humic) substances. An easy and selective tool was first developed to characterize nitrosamine precursors in treated wastewaters, including different process effluents. This tool takes advantages of the polarity rapid assessment method (PRAM) and ultrafiltration (UF) (molecular weight distribution) to locate the fractions with the strongest contributions to the nitrosamine precursor pool in the effluent organic matter. Strong cation exchange (SCX) and C18 solid-phase extraction cartridges were used for their high selectivity for nitrosamine precursors. The details of PRAM operation, such as cartridge clean-up, capacity, pH influence, and quality control were included in this paper, as well as the main parameters of UF operation. Preliminary testing of the PRAM/UF method with effluents from one wastewater treatment plant gave very informative results. SCX retained 45-90% of the N-nitrosodimethylamine (NDMA) formation potential (FP)-a measure of the precursors-in secondary and tertiary wastewater effluents. These results are consistent with NDMA precursors likely having a positively charged amine group. C18 adsorbed 30-45% of the NDMAFP, which indicates that a substantial portion of these precursors were non-polar. The small molecular weight (MW) (10 kDa) fractions obtained from UF were the primary contributors to NDMAFP. The combination of PRAM and UF brings important information on the characteristics of nitrosamine precursors in water with easy operation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Seismic passive earth resistance using modified pseudo-dynamic method

    Science.gov (United States)

    Pain, Anindya; Choudhury, Deepankar; Bhattacharyya, S. K.

    2017-04-01

    In earthquake prone areas, understanding of the seismic passive earth resistance is very important for the design of different geotechnical earth retaining structures. In this study, the limit equilibrium method is used for estimation of critical seismic passive earth resistance for an inclined wall supporting horizontal cohesionless backfill. A composite failure surface is considered in the present analysis. Seismic forces are computed assuming the backfill soil as a viscoelastic material overlying a rigid stratum and the rigid stratum is subjected to a harmonic shaking. The present method satisfies the boundary conditions. The amplification of acceleration depends on the properties of the backfill soil and on the characteristics of the input motion. The acceleration distribution along the depth of the backfill is found to be nonlinear in nature. The present study shows that the horizontal and vertical acceleration distribution in the backfill soil is not always in-phase for the critical value of the seismic passive earth pressure coefficient. The effect of different parameters on the seismic passive earth pressure is studied in detail. A comparison of the present method with other theories is also presented, which shows the merits of the present study.

  11. Stainless steel welding method with excellent nitric acid corrosion resistance

    International Nuclear Information System (INIS)

    Matsushita, Yukinobu; Inazumi, Toru; Hyakubo, Tamako; Masamura, Katsumi.

    1996-01-01

    The present invention concerns a welding method for a stainless steel used in a circumstance being in contact with a highly oxidizing nitric acid solution such as nuclear fuel reprocessing facilities, upon welding 316 type austenite steel containing Mo while giving excellent nitric acid resistance. A method of TIG welding using a filler metal having a composition of C, Si, Mn, P, S, Ni, Cr, Mo and Cu somewhat different from a stainless steel mother material in which C, Si, Mn, P, S, Ni, Cr and Mo are specified comprises a step of TIG-welding the surface of the mother material and a step of TIG-welding the rear face of the mother material, in which the welding conditions for the rear face of the mother material are such that the distance between the surface of the outermost welding metal layer on the side of the surface of the mother material and the bottom of the groove is not less than 5mm, and an amount of welding heat is made constant. As a result, even if the method is used in a circumstance being in contact with a highly corrosive solution such as nitric acid, corrosion resistance is not degraded. (N.H.)

  12. Standard Test Method for Abrasive Wear Resistance of Cemented

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers the determination of abrasive wear resistance of cemented carbides. 1.2 The values stated in inch-pound units are to be regarded as the standard. The SI equivalents of inch-pound units are in parentheses and may be approximate. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  13. Standard test method for measurement of soil resistivity using the two-electrode soil box method

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers the equipment and a procedure for the measurement of soil resistivity, for samples removed from the ground, for use in the control of corrosion of buried structures. 1.2 Procedures allow for this test method to be used n the field or in the laboratory. 1.3 The test method procedures are for the resistivity measurement of soil samples in the saturated condition and in the as-received condition. 1.4 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information only. Soil resistivity values are reported in ohm-centimeter. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and to determine the applicability of regulatory limitations prior to use.

  14. Integrated Geophysical Measurements for Bioremediation Monitoring: Combining Spectral Induced Polarization, Nuclear Magnetic Resonance and Magnetic Methods

    Energy Technology Data Exchange (ETDEWEB)

    Keating, Kristina [Rutgers Univ., Newark, NJ (United States). Dept. of Earth and Environmental Sciences; Slater, Lee [Rutgers Univ., Newark, NJ (United States). Dept. of Earth and Environmental Sciences; Ntarlagiannis, Dimitris [Rutgers Univ., Newark, NJ (United States). Dept. of Earth and Environmental Sciences; Williams, Kenneth H. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Earth Sciences Division

    2015-02-24

    This documents contains the final report for the project "Integrated Geophysical Measurements for Bioremediation Monitoring: Combining Spectral Induced Polarization, Nuclear Magnetic Resonance and Magnetic Methods" (DE-SC0007049) Executive Summary: Our research aimed to develop borehole measurement techniques capable of monitoring subsurface processes, such as changes in pore geometry and iron/sulfur geochemistry, associated with remediation of heavy metals and radionuclides. Previous work has demonstrated that geophysical method spectral induced polarization (SIP) can be used to assess subsurface contaminant remediation; however, SIP signals can be generated from multiple sources limiting their interpretation value. Integrating multiple geophysical methods, such as nuclear magnetic resonance (NMR) and magnetic susceptibility (MS), with SIP, could reduce the ambiguity of interpretation that might result from a single method. Our research efforts entails combining measurements from these methods, each sensitive to different mineral forms and/or mineral-fluid interfaces, providing better constraints on changes in subsurface biogeochemical processes and pore geometries significantly improving our understanding of processes impacting contaminant remediation. The Rifle Integrated Field Research Challenge (IFRC) site was used as a test location for our measurements. The Rifle IFRC site is located at a former uranium ore-processing facility in Rifle, Colorado. Leachate from spent mill tailings has resulted in residual uranium contamination of both groundwater and sediments within the local aquifer. Studies at the site include an ongoing acetate amendment strategy, native microbial populations are stimulated by introduction of carbon intended to alter redox conditions and immobilize uranium. To test the geophysical methods in the field, NMR and MS logging measurements were collected before, during, and after acetate amendment. Next, laboratory NMR, MS, and SIP measurements

  15. Development of Extended Ray-tracing method including diffraction, polarization and wave decay effects

    Science.gov (United States)

    Yanagihara, Kota; Kubo, Shin; Dodin, Ilya; Nakamura, Hiroaki; Tsujimura, Toru

    2017-10-01

    Geometrical Optics Ray-tracing is a reasonable numerical analytic approach for describing the Electron Cyclotron resonance Wave (ECW) in slowly varying spatially inhomogeneous plasma. It is well known that the result with this conventional method is adequate in most cases. However, in the case of Helical fusion plasma which has complicated magnetic structure, strong magnetic shear with a large scale length of density can cause a mode coupling of waves outside the last closed flux surface, and complicated absorption structure requires a strong focused wave for ECH. Since conventional Ray Equations to describe ECW do not have any terms to describe the diffraction, polarization and wave decay effects, we can not describe accurately a mode coupling of waves, strong focus waves, behavior of waves in inhomogeneous absorption region and so on. For fundamental solution of these problems, we consider the extension of the Ray-tracing method. Specific process is planned as follows. First, calculate the reference ray by conventional method, and define the local ray-base coordinate system along the reference ray. Then, calculate the evolution of the distributions of amplitude and phase on ray-base coordinate step by step. The progress of our extended method will be presented.

  16. Incorporation of charge transfer into the explicit polarization fragment method by grand canonical density functional theory.

    Science.gov (United States)

    Isegawa, Miho; Gao, Jiali; Truhlar, Donald G

    2011-08-28

    Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics

  17. Retrieve polarization aberration from image degradation: a new measurement method in DUV lithography

    Science.gov (United States)

    Xiang, Zhongbo; Li, Yanqiu

    2017-10-01

    Detailed knowledge of polarization aberration (PA) of projection lens in higher-NA DUV lithographic imaging is necessary due to its impact to imaging degradations, and precise measurement of PA is conductive to computational lithography techniques such as RET and OPC. Current in situ measurement method of PA thorough the detection of degradations of aerial images need to do linear approximation and apply the assumption of 3-beam/2-beam interference condition. The former approximation neglects the coupling effect of the PA coefficients, which would significantly influence the accuracy of PA retrieving. The latter assumption restricts the feasible pitch of test masks in higher-NA system, conflicts with the Kirhhoff diffraction model of test mask used in retrieving model, and introduces 3D mask effect as a source of retrieving error. In this paper, a new in situ measurement method of PA is proposed. It establishes the analytical quadratic relation between the PA coefficients and the degradations of aerial images of one-dimensional dense lines in coherent illumination through vector aerial imaging, which does not rely on the assumption of 3-beam/2- beam interference and linear approximation. In this case, the retrieval of PA from image degradation can be convert from the nonlinear system of m-quadratic equations to a multi-objective quadratic optimization problem, and finally be solved by nonlinear least square method. Some preliminary simulation results are given to demonstrate the correctness and accuracy of the new PA retrieving model.

  18. Comparison of soft-input-soft-output detection methods for dual-polarized quadrature duobinary system

    Science.gov (United States)

    Chang, Chun; Huang, Benxiong; Xu, Zhengguang; Li, Bin; Zhao, Nan

    2018-02-01

    Three soft-input-soft-output (SISO) detection methods for dual-polarized quadrature duobinary (DP-QDB), including maximum-logarithmic-maximum-a-posteriori-probability-algorithm (Max-log-MAP)-based detection, soft-output-Viterbi-algorithm (SOVA)-based detection, and a proposed SISO detection, which can all be combined with SISO decoding, are presented. The three detection methods are investigated at 128 Gb/s in five-channel wavelength-division-multiplexing uncoded and low-density-parity-check (LDPC) coded DP-QDB systems by simulations. Max-log-MAP-based detection needs the returning-to-initial-states (RTIS) process despite having the best performance. When the LDPC code with a code rate of 0.83 is used, the detecting-and-decoding scheme with the SISO detection does not need RTIS and has better bit error rate (BER) performance than the scheme with SOVA-based detection. The former can reduce the optical signal-to-noise ratio (OSNR) requirement (at BER=10-5) by 2.56 dB relative to the latter. The application of the SISO iterative detection in LDPC-coded DP-QDB systems makes a good trade-off between requirements on transmission efficiency, OSNR requirement, and transmission distance, compared with the other two SISO methods.

  19. Creation of a longitudinally polarized subwavelength hotspot with an ultra-thin planar lens: vectorial Rayleigh–Sommerfeld method

    International Nuclear Information System (INIS)

    Ye, Huapeng; Qiu, Cheng-Wei; Huang, Kun; Yeo, Swee Ping; Teng, Jinghua; Luk’yanchuk, Boris

    2013-01-01

    This letter shows how a longitudinally polarized hotspot can be created by a planar ultra-thin lens that beats the diffraction limit. On the imaging plane, a subwavelength optical resolution 0.39λ with almost purely longitudinal electric component has been demonstrated in air ambient. This novel paradigm addresses simultaneously both longitudinal polarization and deep sub-diffraction imaging, by a planar lens composed of ultra-thin opaque concentric annuli. The vectorial Rayleigh–Sommerfeld (VRS) approach, offering the advantage of significant reduction in computation, has been developed for a particular optimization of a flat lens with full control of polarization. Empowered by the robustness of VRS in dealing with polarization states, the proposed roadmap may be universally and efficiently integrated with other optimization algorithms to design super-resolution imaging with controlled polarization states at any wavelength without luminescence of the object. The lens, which is empowered by the proposed method, opens an avenue for the first time toward a highly integrated imaging system with advanced functionalities in far-field super-imaging, tailored polarization states and flat ultra-thin geometry simultaneously. (letter)

  20. Theoretical investigation into negative differential resistance characteristics of resonant tunneling diodes based on lattice-matched and polarization-matched AlInN/GaN heterostructures

    Science.gov (United States)

    Rong, Taotao; Yang, Lin-An; Yang, Lin; Hao, Yue

    2018-01-01

    In this work, we report an investigation of resonant tunneling diodes (RTDs) with lattice-matched and polarization-matched AlInN/GaN heterostructures using the numerical simulation. Compared with the lattice-matched AlInN/GaN RTDs, the RTDs based on polarization-matched AlInN/GaN hetero-structures exhibit symmetrical conduction band profiles due to eliminating the polarization charge discontinuity, which achieve the equivalence of double barrier transmission coefficients, thereby the relatively high driving current, the high symmetry of current density, and the high peak-to-valley current ratio (PVCR) under the condition of the positive and the negative sweeping voltages. Simulations show that the peak current density approaches 1.2 × 107 A/cm2 at the bias voltage of 0.72 V and the PVCR approaches 1.37 at both sweeping voltages. It also shows that under the condition of the same shallow energy level, when the trap density reaches 1 × 1019 cm-3, the polarization-matched RTDs still have acceptable negative differential resistance (NDR) characteristics, while the NDR characteristics of lattice-matched RTDs become irregular. After introducing the deeper energy level of 1 eV into the polarization-matched and lattice-matched RTDs, 60 scans are performed under the same trap density. Simulation results show that the degradation of the polarization-matched RTDs is 22%, while lattice-matched RTDs have a degradation of 55%. It can be found that the polarization-matched RTDs have a greater defect tolerance than the lattice-matched RTDs, which is beneficial to the available manufacture of actual terahertz RTD devices.

  1. Application of Electrical Resistivity Method (ERM) in Groundwater Exploration

    Science.gov (United States)

    Izzaty Riwayat, Akhtar; Nazri, Mohd Ariff Ahmad; Hazreek Zainal Abidin, Mohd

    2018-04-01

    The geophysical method which dominant by geophysicists become one of most popular method applied by engineers in civil engineering fields. Electrical Resistivity Method (ERM) is one of geophysical tool that offer very attractive technique for subsurface profile characterization in larger area. Applicable alternative technique in groundwater exploration such as ERM which complement with existing conventional method may produce comprehensive and convincing output thus effective in terms of cost, time, data coverage and sustainable. ERM has been applied by various application in groundwater exploration. Over the years, conventional method such as excavation and test boring are the tools used to obtain information of earth layer especially during site investigation. There are several problems regarding the application of conventional technique as it only provides information at actual drilling point only. This review paper was carried out to expose the application of ERM in groundwater exploration. Results from ERM could be additional information to respective expert for their problem solving such as the information on groundwater pollution, leachate, underground and source of water supply.

  2. A New Method for Simulating Power Flow Density Focused by a Silicon Lens Antenna Irradiated with Linearly Polarized THz Wave

    Directory of Open Access Journals (Sweden)

    Catur Apriono

    2015-08-01

    Full Text Available A terahertz system uses dielectric lens antennas for focusing and collimating beams of terahertz wave radiation. Linearly polarized terahertz wave radiation has been widely applied in the terahertz system. Therefore, an accurate method for analyzing the power flow density in the dielectric lens antenna irradiated with the linearly polarized terahertz wave radiation is important to design the terahertz systems. In optics, ray-tracing method has been used to calculate the power flow density by a number density of rays. In this study, we propose a method of ray-tracing combined with Fresnel’s transmission, including transmittance and polarization of the terahertz wave radiation to calculate power flow density in a Silicon lens antenna. We compare power flow density calculated by the proposed method with the regular ray-tracing method. When the Silicon lens antenna is irradiated with linearly polarized terahertz wave radiation, the proposed method calculates the power flow density more accurately than the regular ray-tracing.

  3. Multi-layer solid-phase extraction and evaporation-enrichment methods for polar organic chemicals from aqueous matrices.

    Science.gov (United States)

    Köke, Niklas; Zahn, Daniel; Knepper, Thomas P; Frömel, Tobias

    2018-03-01

    Analysis of polar organic chemicals in the aquatic environment is exacerbated by the lack of suitable and widely applicable enrichment methods. In this work, we assessed the suitability of a novel combination of well-known solid-phase extraction (SPE) materials in one cartridge as well as an evaporation method and for the enrichment of 26 polar model substances (predominantly log D evaporation method were investigated for the recovery and matrix effects of the model substances and analyzed with hydrophilic interaction liquid chromatography-tandem mass spectrometry (HILIC-MS/MS). In total, 65% of the model substances were amenable (> 10% recovery) to the mlSPE method with a mean recovery of 76% while 73% of the model substances were enriched with the evaporation method achieving a mean recovery of 78%. Target and non-target screening comparison of both methods with a frequently used reversed-phase SPE method utilizing "hydrophilic and lipophilic balanced" (HLB) material was performed. Target analysis showed that the mlSPE and evaporation method have pronounced advantages over the HLB method since the HLB material retained only 30% of the model substances. Non-target screening of a ground water sample with the investigated enrichment methods showed that the median retention time of all detected features on a HILIC system decreased in the order mlSPE (3641 features, median t R 9.7 min), evaporation (1391, 9.3 min), HLB (4414, 7.2 min), indicating a higher potential of the described methods to enrich polar analytes from water compared with HLB-SPE. Graphical abstract Schematic of the method evaluation (recovery and matrix effects) and method comparison (target and non-target analysis) of the two investigated enrichment methods for very polar chemicals in aqueousmatrices.

  4. A new surface resistance measurement method with ultrahigh sensitivity

    International Nuclear Information System (INIS)

    Liang, Changnian.

    1993-01-01

    A superconducting niobium triaxial cavity has been designed and fabricated to study residual surface resistance of planar superconducting materials. The edge of a 25.4 mm or larger diameter sample in the triaxial cavity is located outside the strong field region. Therefore, the edge effects and possible losses between the thin film and the substrate have been minimized, ensuring that induced RF losses are intrinsic to the test material. The fundamental resonant frequency of the cavity is the same as the working frequency of CEBAF cavities. The cavity has a compact size compared to its TE 011 counterpart, which makes it more sensitive to the sample's loss. For even higher sensitivity, a calorimetry method has been used to measure the RF losses on the superconducting sample. At 2 K, a 2 μK temperature change can be resolved by using carbon resistor sensors. The temperature distribution caused by RF heating is measured by 16 carbon composition resistor sensors. A 0.05 μW heating power can be detected as such a resolution, which translates to a surface resistance of 0.02 nΩ at a surface magnetic field of 52 Oe. This is the most sensitive device for surface resistance measurements to date. In addition, losses due to the indium seal, coupling probes, field emission sites other than the sample, and all of the high field resonator surface, are excluded in the measurement. Surface resistance of both niobium and high-Tc superconducting thin films has been measured. A low R s of 35.2 μΩ was measured for a 25.4 mm diameter YBa 2 Cu 3 O 7 thin film at 1.5 GHz and at 2 K. The measurement result is the first result for a large area epitaxially grown thin film sample at such a low RF frequency. The abrupt disappearance of multipacting between two parallel plates has been observed and monitored with the 16 temperature mapping sensors. Field emission or some field dependent anomalous RF losses on the niobium plate have also been observed

  5. Evaluation of direct analysis in real time for the determination of highly polar pesticides in lettuce and celery using modified Quick Polar Pesticides Extraction method.

    Science.gov (United States)

    Lara, Francisco J; Chan, Danny; Dickinson, Michael; Lloyd, Antony S; Adams, Stuart J

    2017-05-05

    Direct analysis in real time (DART) was evaluated for the determination of a number of highly polar pesticides using the Quick Polar Pesticides Extraction (QuPPe) method. DART was hyphenated to high resolution mass spectrometry (HRMS) in order to get the required selectivity that allows the determination of these compounds in complex samples such as lettuce and celery. Experimental parameters such as desorption temperature, scanning speed, and distances between the DART ion source and MS inlet were optimized. Two different mass analyzers (Orbitrap and QTOF) and two accessories for sample introduction (Dip-it ® tips and QuickStrip™ sample cards) were evaluated. An extra clean-up step using primary-secondary amine (PSA) was included in the QuPPe method to improve sensitivity. The main limitation found was in-source fragmentation, nevertheless QuPPe-DART-HRMS proved to be a fast and reliable tool with quantitative capabilities for at least seven compounds: amitrole, cyromazine, propamocarb, melamine, diethanolamine, triethanolamine and 1,2,4-triazole. The limits of detection ranged from 20 to 60μg/kg. Recoveries for fortified samples ranged from 71 to 115%, with relative standard deviations <18%. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Geophysical methods in protected environments. Electrical resistivity tomography

    International Nuclear Information System (INIS)

    Rubio Sánchez-Aguililla, F.M.; Ramiro-Camacho, A.; Ibarra Torre, P.

    2017-01-01

    There is a strong interest in protecting the environment with the aim of its long term preservation. Sometimes the heritage value of these natural areas is related to their biodiversity as there are restricted ecosystems that depend directly on them. In other cases there a singular geological record might exist, essential for the understanding of certain processes affecting the planet, such as volcanic events or glacial periods. To achieve the protection and conservation of these areas it is necessary to generate knowledge about the distribution of geological materials and groundwater masses, to study the parameters that dominate the behaviour of these systems and then define those elements that require special protection or attention. In these protected environments, research methods with a minimal environmental impact should be used. Therefore, indirect methods, such as geophysical techniques, are reliable and complementary tools with a minimum environmental impact and are therefore useful for research these unique areas. The IGME has conducted several geophysical surveys in different protected environments in Spain with the aim of achieving a better understanding, and thus facilitate their preservation and exploitation in a sustainable manner. In this paper we present a review of some case studies where geophysical methods have been used. In all the cases electrical resistivity tomography has been the axis of the geophysical research and stands out due to its great effectiveness. The main objective of this communication is to divulgate and increase awareness of the important role that these geophysical methods can play in the sustainable study of these unique places. [es

  7. SGLT2 Inhibition by Empagliflozin Promotes Fat Utilization and Browning and Attenuates Inflammation and Insulin Resistance by Polarizing M2 Macrophages in Diet-induced Obese Mice

    Directory of Open Access Journals (Sweden)

    Liang Xu

    2017-06-01

    Full Text Available Sodium-glucose cotransporter (SGLT 2 inhibitors increase urinary glucose excretion (UGE, leading to blood glucose reductions and weight loss. However, the impacts of SGLT2 inhibition on energy homeostasis and obesity-induced insulin resistance are less well known. Here, we show that empagliflozin, a SGLT2 inhibitor, enhanced energy expenditure and attenuated inflammation and insulin resistance in high-fat-diet-induced obese (DIO mice. C57BL/6J mice were pair-fed a high-fat diet (HFD or a HFD with empagliflozin for 16 weeks. Empagliflozin administration increased UGE in the DIO mice, whereas it suppressed HFD-induced weight gain, insulin resistance, and hepatic steatosis. Moreover, empagliflozin shifted energy metabolism towards fat utilization, elevated AMP-activated protein kinase and acetyl-CoA carbolxylase phosphorylation in skeletal muscle, and increased hepatic and plasma fibroblast growth factor 21 levels. Importantly, empagliflozin increased energy expenditure, heat production, and the expression of uncoupling protein 1 in brown fat and in inguinal and epididymal white adipose tissue (WAT. Furthermore, empagliflozin reduced M1-polarized macrophage accumulation while inducing the anti-inflammatory M2 phenotype of macrophages within WAT and liver, lowering plasma TNFα levels and attenuating obesity-related chronic inflammation. Thus, empagliflozin suppressed weight gain by enhancing fat utilization and browning and attenuated obesity-induced inflammation and insulin resistance by polarizing M2 macrophages in WAT and liver.

  8. Standard Test Method for Thermal Oxidative Resistance of Carbon Fibers

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1982-01-01

    1.1 This test method covers the apparatus and procedure for the determination of the weight loss of carbon fibers, exposed to ambient hot air, as a means of characterizing their oxidative resistance. 1.2 The values stated in SI units are to be regarded as standard. The values given in parentheses are mathematical conversions to inch-pound units which are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. For specific hazard information, see Section 8.

  9. Corrosion and wear resistant metallic layers produced by electrochemical methods

    DEFF Research Database (Denmark)

    Christoffersen, Lasse; Maahn, Ernst Emanuel

    1999-01-01

    Corrosion and wear-corrosion properties of novel nickel alloy coatings with promising production characteristics have been compared with conventional bulk materials and hard platings. Corrosion properties in neutral and acidic environments have been investigated with electrochemical methods....... Determination of polarisation resistance during 100 hours followed by stepwise anodic polarisation seems to be a promising technique to obtain steady state data on slowly corroding coatings with transient kinetics. A slurry test enables determination of simultaneous corrosion and abrasive wear. Comparison...... of AISI 316, hard chromium and hardened Ni-P shows that there is no universal correlation between surface hardness and wear-corrosion loss. The possible relation between questionable passivity of Ni-P coatings and their high wear-corrosion loss rate compared to hard chromium is discussed....

  10. A new method for generating axially-symmetric and radially-polarized beams

    International Nuclear Information System (INIS)

    Niu Chunhui; Gu Benyuan; Dong Bizhen; Zhang Yan

    2005-01-01

    A scheme for generating axially-symmetric and radially-polarized beams is proposed by using two diffractive phase elements (DPEs) made of birefringent materials. The design of these two DPEs is based on the general theory of phase-retrieval of optical system in combination with an iterative algorithm. The first DPE is used for demultiplexing two orthogonally linearly-polarized light beams to produce diffractive patterns, and the second DPE is used for compensating the phase difference to obtain the desired radially-polarized beam

  11. Experimental method for investigating γd→pn photodisintegration reaction on the linearly polarized photon beam of the Erevan synchrotron

    International Nuclear Information System (INIS)

    Agababyan, K.Sh.; Adamyan, F.V.; Ajrapetyan, A.V.

    1985-01-01

    The experimental method for measuring the asymmetry of the γd → pn photodisintegration reaction on the linearly polarized photon beam of the Erevan synchrotron is described. The results of Monte Carlo calculations, the calibration of apparatus, the procedure of measurements and experimental data processing are repored

  12. Electrochemical Cathodic Polarization, a Simplified Method That Can Modified and Increase the Biological Activity of Titanium Surfaces: A Systematic Review.

    Directory of Open Access Journals (Sweden)

    Jose Carlos Bernedo Alcazar

    Full Text Available The cathodic polarization seems to be an electrochemical method capable of modifying and coat biomolecules on titanium surfaces, improving the surface activity and promoting better biological responses.The aim of the systematic review is to assess the scientific literature to evaluate the cellular response produced by treatment of titanium surfaces by applying the cathodic polarization technique.The literature search was performed in several databases including PubMed, Web of Science, Scopus, Science Direct, Scielo and EBSCO Host, until June 2016, with no limits used. Eligibility criteria were used and quality assessment was performed following slightly modified ARRIVE and SYRCLE guidelines for cellular studies and animal research.Thirteen studies accomplished the inclusion criteria and were considered in the review. The quality of reporting studies in animal models was low and for the in vitro studies it was high. The in vitro and in vivo results reported that the use of cathodic polarization promoted hydride surfaces, effective deposition, and adhesion of the coated biomolecules. In the experimental groups that used the electrochemical method, cellular viability, proliferation, adhesion, differentiation, or bone growth were better or comparable with the control groups.The use of the cathodic polarization method to modify titanium surfaces seems to be an interesting method that could produce active layers and consequently enhance cellular response, in vitro and in vivo animal model studies.

  13. Ionic polarization

    International Nuclear Information System (INIS)

    Mahan, G.D.

    1992-01-01

    Ferroelectricity occurs in many different kinds of materials. Many of the technologically important solids, which are ferroelectric, can be classified as ionic. Any microscopic theory of ferroelectricity must contain a description of local polarization forces. We have collaborated in the development of a theory of ionic polarization which is quite successful. Its basic assumption is that the polarization is derived from the properties of the individual ions. We have applied this theory successfully to diverse subjects as linear and nonlinear optical response, phonon dispersion, and piezoelectricity. We have developed numerical methods using the local Density approximation to calculate the multipole polarizabilities of ions when subject to various fields. We have also developed methods of calculating the nonlinear hyperpolarizability, and showed that it can be used to explain light scattering experiments. This paper elaborates on this polarization theory

  14. A novel autonomous real-time position method based on polarized light and geomagnetic field

    OpenAIRE

    Wang, Yinlong; Chu, Jinkui; Zhang, Ran; Wang, Lu; Wang, Zhiwen

    2015-01-01

    Many animals exploit polarized light in order to calibrate their magnetic compasses for navigation. For example, some birds are equipped with biological magnetic and celestial compasses enabling them to migrate between the Western and Eastern Hemispheres. The Vikings' ability to derive true direction from polarized light is also widely accepted. However, their amazing navigational capabilities are still not completely clear. Inspired by birds' and Vikings' ancient navigational skills. Here we...

  15. Laser-polarized xenon-129 magnetic resonance spectroscopy and imaging. The development of a method for in vivo perfusion measurement

    Science.gov (United States)

    Rosen, Matthew Scot

    2001-07-01

    This thesis presents in vivo nuclear magnetic resonance (NMR) and magnetic resonance imaging (MRI) studies with laser-polarized 129Xe delivered to living rats by inhalation and transported to tissue via blood flow. The results presented herein include the observation, assignment, and dynamic measurement of 129Xe resonances in the brain and body, the first one- and two-dimensional chemical-shift-resolved images of 129Xe in blood, tissue, and gas in the thorax, and the first images of 129Xe in brain tissue. These results establish that laser-polarized 129Xe can be used as a magnetic resonance tracer in vivo. NMR resonances at 0, 191, 198, and 209 ppm relative to the 129 Xe gas resonance are observed in the rat thorax and assigned to 129Xe in gas, fat, tissue, and blood respectively. Resonances at 189, 192, 195, 198, and 209 ppm are observed in the brain, and the 195 and 209 ppm resonances are assigned to 129Xe in grey matter, and blood, respectively. The design and construction of a laser-polarized 129Xe production and delivery system is described. This system produces liter-volumes of laser- polarized 129Xe by spin-exchange optical- pumping. It represented an order of magnitude increase over previously reported production volumes of polarized 129Xe. At approximately 3-7% polarization, 157 cc-atm of xenon is produced and stored as ice every 5 minutes. This reliable, effective, and simple production method for large volumes of 129Xe can be applied to other areas of research involving the use of laser-polarized noble gases. A model of the in vivo transport of laser polarized 129Xe to tissue under realistic experimental NMR conditions is described. Appropriate control of the NMR parameters is shown to allow tissue perfasion and 129Xe tissue T1 to be extracted from measurement of the steady-state 129Xe tissue signal. In vivo rodent 129Xe NMR results are used to estimate the signal-to-noise ratio of this technique, and an inhaled 30% xenon/70% O2 mixture polarized to 5

  16. CT image reconstruction of steel pipe section from few projections using the method of rotating polar-coordinate

    International Nuclear Information System (INIS)

    Peng Shuaijun; Wu Zhifang

    2008-01-01

    Fast online inspection in steel pipe production is a big challenge. Radiographic CT imaging technology, a high performance non-destructive testing method, is quite appropriate for inspection and quality control of steel pipes. The method of rotating polar-coordinate is used to reconstruct the steel pipe section from few projections with the purpose of inspecting it online. It reduces the projection number needed and the data collection time, and accelerates the reconstruction algorithm and saves the inspection time evidently. The results of simulation experiment and actual experiment indicate that the image quality and reconstruction time of rotating polar-coordinate method meet the requirements of inspecting the steel tube section online basically. The study is of some theoretical significance and the method is expected to be widely used in practice. (authors)

  17. Workshop on polarized neutron filters and polarized pulsed neutron experiments

    International Nuclear Information System (INIS)

    Itoh, Shinichi

    2004-07-01

    The workshop was held in KEK by thirty-three participants on April 26, 2004. The polarized neutron filter method was only discussed. It consists of three parts; the first part was discussed on the polarized neutron methods, the second part on the polarized neutron experiments and the third on the pulse neutron spectrometer and polarized neutron experiments. The six papers were presented such as the polarized 3 He neutron spin filter, neutron polarization by proton polarized filter, soft master and neutron scattering, polarized neutron in solid physics, polarization experiments by chopper spectroscope and neutron polarization system in superHRPD. (S.Y.)

  18. A method for increase abrasive wear resistance parts by obtaining on methods casting on gasifying models

    Science.gov (United States)

    Sedukhin, V. V.; Anikeev, A. N.; Chumanov, I. V.

    2017-11-01

    Method optimizes hardening working layer parts’, working in high-abrasive conditions looks in this work: bland refractory particles WC and TiC in respect of 70/30 wt. % prepared by beforehand is applied on polystyrene model in casting’ mould. After metal poured in mould, withstand for crystallization, and then a study is carried out. Study macro- and microstructure received samples allows to say that thickness and structure received hardened layer depends on duration interactions blend harder carbides and liquid metal. Different character interactions various dispersed particles and matrix metal observed under the same conditions. Tests abrasive wear resistance received materials of method calculating residual masses was conducted in laboratory’ conditions. Results research wear resistance showed about that method obtaining harder coating of blend carbide tungsten and carbide titanium by means of drawing on surface foam polystyrene model before moulding, allows receive details with surface has wear resistance in 2.5 times higher, than details of analogy steel uncoated. Wherein energy costs necessary for transformation units mass’ substances in powder at obtained harder layer in 2.06 times higher, than materials uncoated.

  19. A novel method for analysing key corticosteroids in polar bear (Ursus maritimus) hair using liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Weisser, Johan J; Hansen, Martin; Björklund, Erland; Sonne, Christian; Dietz, Rune; Styrishave, Bjarne

    2016-04-01

    This paper presents the development and evaluation of a methodology for extraction, clean-up and analysis of three key corticosteroids (aldosterone, cortisol and corticosterone) in polar bear hair. Such a methodology can be used to monitor stress biomarkers in polar bears and may provide as a useful tool for long-term and retrospective information. We developed a combined pressurized liquid extraction (PLE)-solid phase extraction (SPE) procedure for corticosteroid extraction and clean-up followed by high pressure liquid chromatography tandem mass spectrometry (HPLC-MS/MS) analysis. This procedure allows for the simultaneous determination of multiple steroids, which is in contrast to previous polar bear studies based on ELISA techniques. Absolute method recoveries were 81%, 75% and 60% for cortisol, corticosterone and aldosterone, respectively. We applied the developed method on a hair sample pooled from four East Greenland polar bears. Herein cortisol and corticosterone were successfully determined in levels of 0.32±0.02ng/g hair and 0.13±0.02ng/g hair, respectively. Aldosterone was below limit of detection (LODpolar bears was consistent with cortisol levels previously determined in the Southern Hudson Bay and James Bay in Canada using ELISA kits. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Method for preventing and/or treating insulin resistance

    NARCIS (Netherlands)

    Nieuwdorp, M.; Vos, de W.M.

    2013-01-01

    The present invention describes use of Eubacterium hallii et rel. and/or Alcaligenes faecalis et rel., as well as pharmaceutical, food, or feed compositions comprising these bacteria, as a medicament, in particular for preventing and/or treating insulin resistance and/or insulin resistance-related

  1. Polarization switching detection method using a ferroelectric liquid crystal for dichroic atomic vapor laser lock frequency stabilization techniques.

    Science.gov (United States)

    Dudzik, Grzegorz; Rzepka, Janusz; Abramski, Krzysztof M

    2015-04-01

    We present a concept of the polarization switching detection method implemented for frequency-stabilized lasers, called the polarization switching dichroic atomic vapor laser lock (PSDAVLL) technique. It is a combination of the well-known dichroic atomic vapor laser lock method for laser frequency stabilization with a synchronous detection system based on the surface-stabilized ferroelectric liquid crystal (SSFLC).The SSFLC is a polarization switch and quarter wave-plate component. This technique provides a 9.6 dB better dynamic range ratio (DNR) than the well-known two-photodiode detection configuration known as the balanced polarimeter. This paper describes the proposed method used practically in the VCSEL laser frequency stabilization system. The applied PSDAVLL method has allowed us to obtain a frequency stability of 2.7×10⁻⁹ and a reproducibility of 1.2×10⁻⁸, with a DNR of detected signals of around 81 dB. It has been shown that PSDAVLL might be successfully used as a method for spectra-stable laser sources.

  2. Comparison Of Metal Corrosion Inhibition By Gravimetric And Linear Polarization Resistance Methods

    OpenAIRE

    Banerji, Shankha

    1992-01-01

    Studies were conducted to evaluate the effectiveness of various dosages of the selected silicate and phosphate compounds applied for corrosion inhibition of cast iron, copper, lead, and galvanized steel specimens. The compounds selected for study were zinc polyphosphate (Calgon C-39), zinc orthophosphate (Virchem V-931), sodium metasilicate and glassy silicate. The effectiveness of these compounds for corrosion inhibition were studied under differing water quality conditions using gravimetric...

  3. TX-RX isolation method based on polarization diversity, spatial diversity and TX beamforming

    DEFF Research Database (Denmark)

    Foroozanfard, Ehsan; Carvalho, Elisabeth De; Pedersen, Gert F.

    2016-01-01

    In this paper, the feasibility of an antenna isolation technique based on null-steer beamforming, polarization diversity and spatial diversity is investigated. The proposed system consists of six patch antennas which are fed by a feeding network to obtain a null-steer beamformer. To achieve spatial...... diversity, antenna elements are located on two layers, facing in a different direction. Moreover, the antenna elements in two layers use different polarization. The measured results of the antenna system present a high TX-RX isolation in the order of 70 dB which shows the feasibility of such a system...

  4. Molecular detection methods of resistance to antituberculosis drugs in Mycobacterium tuberculosis.

    Science.gov (United States)

    Brossier, F; Sougakoff, W

    2017-09-01

    Molecular methods predict drug resistance several weeks before phenotypic methods and enable rapid implementation of appropriate therapeutic treatment. We aimed to detail the most representative molecular tools used in routine practice for the rapid detection of resistance to antituberculosis drugs among Mycobacterium tuberculosis strains. The molecular diagnosis of resistance to antituberculosis drugs in clinical samples or from in vitro cultures is based on the detection of the most common mutations in the genes involved in the development of resistance in M. tuberculosis strains (encoding either protein targets of antibiotics, or antibiotic activating enzymes) by commercial molecular kits or by sequencing. Three hypotheses could explain the discrepancies between the genotypic results and the phenotypic drug susceptibility testing results: a low percentage of resistant mutants precluding the detection by genotypic methods on the primary culture; a low level of resistance not detected by phenotypic testing; and other resistance mechanisms not yet characterized. Molecular methods have varying sensitivity with regards to detecting antituberculosis drug resistance; that is why phenotypic susceptibility testing methods are mandatory for detecting antituberculosis drug-resistant isolates that have not been detected by molecular methods. The questionable ability of existing phenotypic and genotypic drug susceptibility testing to properly classify strains as susceptible or resistant, and at what level of resistance, was raised for several antituberculosis agents. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Numerical method to optimize the polar-azimuthal orientation of infrared superconducting-nanowire single-photon detectors.

    Science.gov (United States)

    Csete, Mária; Sipos, Áron; Najafi, Faraz; Hu, Xiaolong; Berggren, Karl K

    2011-11-01

    A finite-element method for calculating the illumination-dependence of absorption in three-dimensional nanostructures is presented based on the radio frequency module of the Comsol Multiphysics software package (Comsol AB). This method is capable of numerically determining the optical response and near-field distribution of subwavelength periodic structures as a function of illumination orientations specified by polar angle, φ, and azimuthal angle, γ. The method was applied to determine the illumination-angle-dependent absorptance in cavity-based superconducting-nanowire single-photon detector (SNSPD) designs. Niobium-nitride stripes based on dimensions of conventional SNSPDs and integrated with ~ quarter-wavelength hydrogen-silsesquioxane-filled nano-optical cavity and covered by a thin gold film acting as a reflector were illuminated from below by p-polarized light in this study. The numerical results were compared to results from complementary transfer-matrix-method calculations on composite layers made of analogous film-stacks. This comparison helped to uncover the optical phenomena contributing to the appearance of extrema in the optical response. This paper presents an approach to optimizing the absorptance of different sensing and detecting devices via simultaneous numerical optimization of the polar and azimuthal illumination angles. © 2011 Optical Society of America

  6. Methods for polarized light emission from CdSe quantum dot based monolithic pillar microcavities

    Energy Technology Data Exchange (ETDEWEB)

    Seyfried, Moritz; Kalden, Joachim; Sebald, Kathrin; Gutowski, Juergen; Kruse, Carsten; Hommel, Detlef [Institute of Solid State Physics, University of Bremen (Germany)

    2010-07-01

    A lifting of the polarization degeneracy of the fundamental cavity mode in pillar microcavities (MCs) would allow for controlling the polarization state of the emitted photons. Therefore, monolithic VCSEL structures were grown by molecular beam epitaxy containing either one CdSe/ZnSSe quantum dot layer or three quantum well layers as active material. By using focused-ion-beam etching, MC pillars with different geometries were prepared out of the planar samples. Among these are circularly shaped pillar MCs with diameters in the range from 500 nm up to 4 {mu}m and quality factors of up to 7860, elliptically shaped MCs, and so-called photonic molecules consisting of circular pillar MCs which are connected by small bars. Polarization dependent photoluminescence investigations of the fundamental cavity mode reveal a lifting of the polarization degeneracy for all three types of MCs. The energy splitting of up to 0.42 meV in the circularly shaped pillar MCs is probably caused by anisotropic strain conditions within the sample and directly dependent on the pillar diameter, whereas the larger energy splitting of up to 0.72 meV for the photonic molecules or even 4.5 meV for the elliptically shaped MC is based on their asymmetric cross sections.

  7. Several methods to detect the inheritance and resistance to the ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... Table 1. Compositions of plant tissue culture media for cabbage genetic .... Bioassay of in vitro leaves from transgenic cabbages of ZG for evaluating resistance to .... extraction of DNA from tomato and other herbaceous plant.

  8. Method to locate the polar cap boundary in the nightside ionosphere and application to a substorm event

    Directory of Open Access Journals (Sweden)

    A. T. Aikio

    2006-08-01

    Full Text Available In this paper we describe a new method to be used for the polar cap boundary (PCB determination in the nightside ionosphere by using the EISCAT Svalbard radar (ESR field-aligned measurements by the 42-m antenna and southward directed low-elevation measurements by the ESR 32 m antenna or northward directed low-elevation measurements by the EISCAT VHF radar at Tromsø. The method is based on increased electron temperature (Te caused by precipitating particles on closed field lines. Since the Svalbard field-aligned measurement provides the reference polar cap Te height profile, the method can be utilised only when the PCB is located between Svalbard and the mainland. Comparison with the Polar UVI images shows that the radar-based method is generally in agreement with the PAE (poleward auroral emission boundary from Polar UVI. The new technique to map the polar cap boundary was applied to a substorm event on 6 November 2002. Simultaneous measurements by the MIRACLE magnetometers enabled us to put the PCB location in the framework of ionospheric electrojets. During the substorm growth phase, the polar cap expands and the region of the westward electrojet shifts gradually more apart from the PCB. The substorm onset takes place deep within the region of closed magnetic field region, separated by about 6–7° in latitude from the PCB in the ionosphere. We interpret the observations in the framework of the near-Earth neutral line (NENL model of substorms. After the substorm onset, the reconnection at the NENL reaches within 3 min the open-closed field line boundary and then the PCB moves poleward together with the poleward boundary of the substorm current wedge. The poleward expansion occurs in the form of individual bursts, which are separated by 2–10 min, indicating that the reconnection in the magnetotail neutral line is impulsive. The poleward expansions of the PCB are followed by latitude dispersed intensifications in the westward electrojet

  9. Entropy resistance minimization: An alternative method for heat exchanger analyses

    International Nuclear Information System (INIS)

    Cheng, XueTao

    2013-01-01

    In this paper, the concept of entropy resistance is proposed based on the entropy generation analyses of heat transfer processes. It is shown that smaller entropy resistance leads to larger heat transfer rate with fixed thermodynamic force difference and smaller thermodynamic force difference with fixed heat transfer rate, respectively. For the discussed two-stream heat exchangers in which the heat transfer rates are not given and the three-stream heat exchanger with prescribed heat capacity flow rates and inlet temperatures of the streams, smaller entropy resistance leads to larger heat transfer rate. For the two-stream heat exchangers with fixed heat transfer rate, smaller entropy resistance leads to larger effectiveness. Furthermore, it is shown that smaller values of the concepts of entropy generation numbers and modified entropy generation number do not always correspond to better performance of the discussed heat exchangers. - Highlights: • The concept of entropy resistance is defined for heat exchangers. • The concepts based on entropy generation are used to analyze heat exchangers. • Smaller entropy resistance leads to better performance of heat exchangers. • The applicability of entropy generation minimization is conditional

  10. QSPR studies for predicting polarity parameter of organic compounds in methanol using support vector machine and enhanced replacement method.

    Science.gov (United States)

    Golmohammadi, H; Dashtbozorgi, Z

    2016-12-01

    In the present work, enhanced replacement method (ERM) and support vector machine (SVM) were used for quantitative structure-property relationship (QSPR) studies of polarity parameter (p) of various organic compounds in methanol in reversed phase liquid chromatography based on molecular descriptors calculated from the optimized structures. Diverse kinds of molecular descriptors were calculated to encode the molecular structures of compounds, such as geometric, thermodynamic, electrostatic and quantum mechanical descriptors. The variable selection method of ERM was employed to select an optimum subset of descriptors. The five descriptors selected using ERM were used as inputs of SVM to predict the polarity parameter of organic compounds in methanol. The coefficient of determination, r 2 , between experimental and predicted polarity parameters for the prediction set by ERM and SVM were 0.952 and 0.982, respectively. Acceptable results specified that the ERM approach is a very effective method for variable selection and the predictive aptitude of the SVM model is superior to those obtained by ERM. The obtained results demonstrate that SVM can be used as a substitute influential modeling tool for QSPR studies.

  11. Dynamic nuclear polarization of irradiated target materials

    International Nuclear Information System (INIS)

    Seely, M.L.

    1982-01-01

    Polarized nucleon targets used in high energy physics experiments usually employ the method of dynamic nuclear polarization (DNP) to polarize the protons or deuterons in an alcohol. DNP requires the presence of paramagnetic centers, which are customarily provided by a chemical dopant. These chemically doped targets have a relatively low polarizable nucleon content and suffer from loss of polarization when subjected to high doses of ionizing radiation. If the paramagnetic centers formed when the target is irradiated can be used in the DNP process, it becomes possible to produce targets using materials which have a relatively high polarizable nucleon content, but which are not easily doped by chemical means. Furthermore, the polarization of such targets may be much more radiation resistant. Dynamic nuclear polarization in ammonia, deuterated ammonia, ammonium hydroxide, methylamine, borane ammonia, butonal, ethane and lithium borohydride has been studied. These studies were conducted at the Stanford Linear Accelerator Center using the Yale-SLAC polarized target system. Results indicate that the use of ammonia and deuterated ammonia as polarized target materials would make significant increases in polarized target performance possible

  12. Modification of the method of polarized orbitals for electron--alkali-metal scattering: Application to e-Li

    International Nuclear Information System (INIS)

    Bhatia, A.K.; Temkin, A.; Silver, A.; Sullivan, E.C.

    1978-01-01

    The method of polarized orbitals is modified to treat low-energy scattering of electrons from highly polarizable systems, specifically alkali-metal atoms. The modification is carried out in the particular context of the e-Li system, but the procedure is general; it consists of modifying the polarized orbital, so that when used in the otherwise orthodox form of the method, it gives (i) the correct electron affinity of the negative ion (in this case Li - ), (ii) the proper (i.e., Levinson-Swan) number of nodes of the associated zero-energy scattering orbital, and (iii) the correct polarizability. A procedure is devised whereby the scattering length can be calculated from the (known) electron affinity without solving the bound-state equation. Using this procedure we adduce a 1 S scattering length of 8.69a 0 . (The 3 S scattering length is -9.22a 0 .) The above modifications can also be carried out in the (lesser) exchange adiabatic approximation. However, they lead to qualitatively incorrect 3 S phase shifts. The modified polarized-orbital phase shifts are qualitatively similar to close-coupling and elaborate variational calculations. Quantitative differences from the latter calculations, however, remain; they are manifested most noticeably in the very-low-energy total and differential spin-flip cross sections

  13. Detection of Ground Clutter from Weather Radar Using a Dual-Polarization and Dual-Scan Method

    Directory of Open Access Journals (Sweden)

    Mohammad-Hossein Golbon-Haghighi

    2016-06-01

    Full Text Available A novel dual-polarization and dual-scan (DPDS classification algorithm is developed for clutter detection in weather radar observations. Two consecutive scans of dual-polarization radar echoes are jointly processed to estimate auto- and cross-correlation functions. Discriminants are then defined and estimated in order to separate clutter from weather based on their physical and statistical properties. An optimal Bayesian classifier is used to make a decision on clutter presence from the estimated discriminant functions. The DPDS algorithm is applied to the data collected with the KOUN polarimetric radar and compared with the existing detection methods. It is shown that the DPDS algorithm yields a higher probability of detection and lower false alarm rate in clutter detection.

  14. Simulation of natural convection in an inclined polar cavity using a finite-difference lattice Boltzmann method

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Fan; Yang, Haicheng; Guo, Xueyan; Ren Dai [University of Shanghai for Science and Technology, Shanghai (China); Yan, Yonghua [Shanghai Key Laboratory of Multiphase Flow and Heat Transfer in Power Engineering, Shanghai (China); Liu, Chaoqun [University of Texas at Arlington, Arlington (United States)

    2017-06-15

    Natural convection heat transfer in an inclined polar cavity was studied using a Finite-difference lattice Boltzmann method (FDLBM) based on a double-population approach for body-fitted coordinates. A D2G9 model coupled with the simplest TD2Q4 lattice model was applied to determine the velocity field and temperature field. For both velocity and temperature fields, the discrete spatial derivatives were obtained by combining the upwind scheme with the central scheme, and the discrete temporal term is obtained using a fourth-order Runge-Kutta scheme. Studies were carried out for different Rayleigh numbers and different inclination angles. The results in terms of streamlines, isotherms, and Nusselt numbers explain the heat transfer mechanism of natural convection in an inclined polar cavity due to the change of Rayleigh number and inclination angle.

  15. Differential resistances to anthracnose in Capsicum baccatum as responding to two Colletotrichum pathotypes and inoculation methods.

    Science.gov (United States)

    Mahasuk, Pitchayapa; Chinthaisong, Jittima; Mongkolporn, Orarat

    2013-09-01

    Chili anthracnose, caused by Colletotrichum spp., is one of the major diseases to chili production in the tropics and subtropics worldwide. Breeding for durable anthracnose resistance requires a good understanding of the resistance mechanisms to different pathotypes and inoculation methods. This study aimed to investigate the inheritances of differential resistances as responding to two different Colletotrichum pathotypes, PCa2 and PCa3 and as by two different inoculation methods, microinjection (MI) and high pressure spray (HP). Detached ripe fruit of Capsicum baccatum 'PBC80' derived F2 and BC1s populations was assessed for anthracnose resistance. Two dominant genes were identified responsible for the differential resistance to anthracnose. One was responsible for the resistance to PCa2 and PCa3 by MI and the other was responsible for the resistance to PCa3 by HP. The two genes were linked with 16.7 cM distance.

  16. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data

    DEFF Research Database (Denmark)

    Clausen, Philip T. L. C.; Zankari, Ea; Aarestrup, Frank Møller

    2016-01-01

    to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared...... with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance...... was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads...

  17. Scattering with polarized neutrons

    International Nuclear Information System (INIS)

    Schweizer, J.

    2007-01-01

    In the history of neutron scattering, it was shown very soon that the use of polarized neutron beams brings much more information than usual scattering with unpolarized neutrons. We shall develop here the different scattering methods that imply polarized neutrons: 1) polarized beams without polarization analysis, the flipping ratio method; 2) polarized beams with a uniaxial polarization analysis; 3) polarized beams with a spherical polarization analysis. For all these scattering methods, we shall give examples of the physical problems which can been solved by these methods, particularly in the field of magnetism: investigation of complex magnetic structures, investigation of spin or magnetization densities in metals, insulators and molecular compounds, separation of magnetic and nuclear scattering, investigation of magnetic properties of liquids and amorphous materials and even, for non magnetic material, separation between coherent and incoherent scattering. (author)

  18. Polarity-Free Resistive Switching Characteristics of CuxO Films for Non-volatile Memory Applications

    International Nuclear Information System (INIS)

    Hang-Bing, Lv; Peng, Zhou; Xiu-Feng, Fu; Ming, Yin; Ya-Li, Song; Li, Tang; Ting-Ao, Tang; Yin-Yin, Lin

    2008-01-01

    Resistive switching characteristics of Cu x O films grown by plasma oxidation process at room temperature are investigated. Both bipolar and unipolar stable resistive switching behaviours are observed and confirmed by repeated current–voltage measurements. It is found that the RESET current is dependent on SET compliance current. The mechanism behind this new phenomenon can be understood in terms of conductive filaments formation/rupture with the contribution of Joule heating

  19. LEAF WHORL INOCULATION METHOD FOR SCREENING SUGARCANE RUST RESISTANCE

    Science.gov (United States)

    Technical Abstract: Sugarcane rust diseases, brown rust caused by Puccinia melanocephala, and orange rust caused by P. kuehnii, are agronomically important diseases in Florida. Cultivar resistance is the best means of controlling these diseases. Natural infection has been the primary means of asses...

  20. Several methods to detect the inheritance and resistance to the ...

    African Journals Online (AJOL)

    Majority of the transgenic plants had only a single copy of the inserted CryIA(c) gene. Leaf section bioassays showed that resistance against larvae of diamondback moth in CryIA(c) transgenic cabbage was significantly enhanced. The inheritance patterns of the transgene in T1 offspring of transgenic cabbage were ...

  1. Adaptive Motor Resistance Video Game Exercise Apparatus and Method of Use Thereof

    Science.gov (United States)

    Reich, Alton (Inventor); Shaw, James (Inventor)

    2015-01-01

    The invention comprises a method and/or an apparatus using computer configured exercise equipment and an electric motor provided physical resistance in conjunction with a game system, such as a video game system, where the exercise system provides real physical resistance to a user interface. Results of user interaction with the user interface are integrated into a video game, such as running on a game console. The resistance system comprises: a subject interface, software control, a controller, an electric servo assist/resist motor, an actuator, and/or a subject sensor. The system provides actual physical interaction with a resistance device as input to the game console and game run thereon.

  2. An innovative method for ideal and resistive MHD stability analysis of tokamaks

    International Nuclear Information System (INIS)

    Tokuda, S.

    2001-01-01

    An advanced asymptotic matching method of ideal and resistive MHD stability analysis in tokamaks is reported. A solution method for the two dimensional Newcomb equation, a dispersion relation for an unstable ideal MHD mode in tokamaks and a new scheme for solving resistive MHD inner layer equations as an initial value problem are reported. (author)

  3. An innovative method for ideal and resistive MHD stability analysis of tokamaks

    International Nuclear Information System (INIS)

    Tokuda, S.

    2001-01-01

    An advanced asymptotic matching method of ideal and resistive MHD stability analysis in tokamak is reported. The report explains a solution method of two-dimensional Newcomb equation, dispersion relation for an unstable ideal MHD mode in tokamak, and a new scheme for solving resistive MHD inner layer equations as an initial-value problem. (author)

  4. Calibration of resistance factors for drilled shafts for the new FHWA design method.

    Science.gov (United States)

    2013-01-01

    The Load and Resistance Factor Design (LRFD) calibration of deep foundation in Louisiana was first completed for driven piles (LTRC Final Report 449) in May 2009 and then for drilled shafts using 1999 FHWA design method (ONeill and Reese method) (...

  5. Polarized neutrons

    International Nuclear Information System (INIS)

    Williams, W.G.

    1988-01-01

    The book on 'polarized neutrons' is intended to inform researchers in condensed matter physics and chemistry of the diversity of scientific problems that can be investigated using polarized neutron beams. The contents include chapters on:- neutron polarizers and instrumentation, polarized neutron scattering, neutron polarization analysis experiments and precessing neutron polarization. (U.K.)

  6. A METHOD FOR CREATING STRUCTURES OR DEVICES USING AN ORGANIC ICE RESIST

    DEFF Research Database (Denmark)

    2017-01-01

    The invention relates to a method for creating an organic resist on a surface of a cooled substrate, the method comprising the steps of condensing a vapour into a solid film on the surface of the cooled substrate; patterning at least part of the solid film by exposing selected portions of said...... solid film to at least one electron beam thereby creating the organic resist on 5 the surface of the cooled substrate in accordance with a predetermined pattern; wherein the created organic resist remains essentially intact at ambient conditions; and using the created organic resist as a mask...... for creating semiconductor structures and/or semiconductor devices....

  7. New method for preparing a liquid crystal polymer that exhibits linearly polarized white fluorescence

    International Nuclear Information System (INIS)

    Zheng Shijun; Kun, Wang; Kobayashi, Takaomi

    2011-01-01

    With the aim of developing a single-chain white-light-emitting polymer, liquid crystal (LC) polymers with a shish-kebab-type moiety on their cross-conjugated (p-phenylene)s-poly(p-phenylenevinylene)s main chain were synthesized by Gilch polymerization. They were characterized by nuclear magnetic resonance (NMR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC), X-ray diffraction (XRD), and polarizing optical microscopy (POM). 1 H-NMR indicated that the polymers had a shish-kebab structure, which strongly suppressed the formation of structural defects in the polymers. DSC revealed that the polymers had thermotropic LC properties, indicating that the LC polymers were enantiotropic. XRD showed that the polymers had a mesophase, which implies that they were in a smectic LC phase. A polymer with 'kebabs' of 2,5-bis(4'-alkoxyphenyl)benzene was combined with an aligned polyimide film with orientated microgrooves. The polymer main chain was aligned due to the orientation of the 'kebabs' of the uniform cross-conjugated structure. It lay between the kebabs and the 'shish' of the polymer main chains. The aligned polymer main chain emitted yellow light while and the oriented LC side chains emitted blue light emission. These two emissions resulted in linearly polarized white fluorescence.

  8. A method for automatic grain segmentation of multi-angle cross-polarized microscopic images of sandstone

    Science.gov (United States)

    Jiang, Feng; Gu, Qing; Hao, Huizhen; Li, Na; Wang, Bingqian; Hu, Xiumian

    2018-06-01

    Automatic grain segmentation of sandstone is to partition mineral grains into separate regions in the thin section, which is the first step for computer aided mineral identification and sandstone classification. The sandstone microscopic images contain a large number of mixed mineral grains where differences among adjacent grains, i.e., quartz, feldspar and lithic grains, are usually ambiguous, which make grain segmentation difficult. In this paper, we take advantage of multi-angle cross-polarized microscopic images and propose a method for grain segmentation with high accuracy. The method consists of two stages, in the first stage, we enhance the SLIC (Simple Linear Iterative Clustering) algorithm, named MSLIC, to make use of multi-angle images and segment the images as boundary adherent superpixels. In the second stage, we propose the region merging technique which combines the coarse merging and fine merging algorithms. The coarse merging merges the adjacent superpixels with less evident boundaries, and the fine merging merges the ambiguous superpixels using the spatial enhanced fuzzy clustering. Experiments are designed on 9 sets of multi-angle cross-polarized images taken from the three major types of sandstones. The results demonstrate both the effectiveness and potential of the proposed method, comparing to the available segmentation methods.

  9. Microstructure characterization and corrosion resistance properties of Pb-Sb alloys for lead acid battery spine produced by different casting methods

    Science.gov (United States)

    Baig, Muneer; Alam, Mohammad Asif; Alharthi, Nabeel

    2018-01-01

    The aim of this study is to find out the microstructure, hardness, and corrosion resistance of Pb-5%Sb spine alloy. The alloy has been produced by high pressure die casting (HPDC), medium pressure die casting (AS) and low pressure die casting (GS) methods, respectively. The microstructure was characterized by using optical microscopy and scanning electron microscopy (SEM). The hardness was also reported. The corrosion resistance of the spines in 0.5M H2SO4 solution has been analyzed by measuring the weight loss, impedance spectroscopy and the potentiodynamic polarization techniques. It has been found that the spine produced by HPDC has defect-free fine grain structure resulting improvement in hardness and excellent corrosion resistance. PMID:29668709

  10. Use of cyclic current reversal polarization voltammetry for investigating the relationship between corrosion resistance and heat-treatment induced variations in microstructures of 400 C martensitic stainless steels

    Science.gov (United States)

    Ambrose, John R.

    1992-01-01

    Software for running a cyclic current reversal polarization voltammagram has been developed for use with a EG&G Princeton Applied Research Model 273 potentiostat/galvanostat system. The program, which controls the magnitude, direction and duration of an impressed galvanostatic current, will produce data in ASCII spreadsheets (Lotus, Quattro) for graphical representation of CCRPV voltammograms. The program was used to determine differences in corrosion resistance of 440 C martenstic stainless steel produced as a result of changes in microstructure effected by tempering. It was determined that tempering at all temperatures above 400 F resulted in increased polarizability of the material, with the increased likelihood that pitting would be initiated upon exposure to marine environments. These results will be used in development of remedial procedures for lowering the susceptibility of these alloys toward the stress corrosion cracking experienced in bearings used in high pressure oxygen turbopumps used in the main engines of space shuttle orbiters.

  11. Estimation of the flow resistances exerted in coronary arteries using a vessel length-based method.

    Science.gov (United States)

    Lee, Kyung Eun; Kwon, Soon-Sung; Ji, Yoon Cheol; Shin, Eun-Seok; Choi, Jin-Ho; Kim, Sung Joon; Shim, Eun Bo

    2016-08-01

    Flow resistances exerted in the coronary arteries are the key parameters for the image-based computer simulation of coronary hemodynamics. The resistances depend on the anatomical characteristics of the coronary system. A simple and reliable estimation of the resistances is a compulsory procedure to compute the fractional flow reserve (FFR) of stenosed coronary arteries, an important clinical index of coronary artery disease. The cardiac muscle volume reconstructed from computed tomography (CT) images has been used to assess the resistance of the feeding coronary artery (muscle volume-based method). In this study, we estimate the flow resistances exerted in coronary arteries by using a novel method. Based on a physiological observation that longer coronary arteries have more daughter branches feeding a larger mass of cardiac muscle, the method measures the vessel lengths from coronary angiogram or CT images (vessel length-based method) and predicts the coronary flow resistances. The underlying equations are derived from the physiological relation among flow rate, resistance, and vessel length. To validate the present estimation method, we calculate the coronary flow division over coronary major arteries for 50 patients using the vessel length-based method as well as the muscle volume-based one. These results are compared with the direct measurements in a clinical study. Further proving the usefulness of the present method, we compute the coronary FFR from the images of optical coherence tomography.

  12. [A non-invasive glucose measurement method based on orthogonal twin-polarized light and its pilot experimental investigation].

    Science.gov (United States)

    Wang, Hong; Wu, Baoming; Liu, Ding

    2010-04-01

    In order to overcome the existing shortcomings of the non-invasive blood glucose polarized light measurement methods of optical heterodyne detection and direct detection, we present in this paper a new orthogonal twin-polarized light (OTPL) non-invasive blood glucose measurement method, which converts the micro-angle rotated by an optical active substance such as glucose to the energy difference of OTPL, amplifies the signals by the high-sensitivity lock-in amplifier made of relevant principle, controls Faraday coil current to compensate the changes in deflection angle caused by blood glucose, and makes use of the linear relationship between blood glucose concentration and Faraday coil current to calculate blood glucose concentration. In our comparative experiment using the data measured by LX-20 automatic biochemical analyzer as a standard, a 0.9777 correlation coefficient is obtained in glucose concentration experiment, and a 0.952 in serum experiment. The result shows that this method has higher detection sensitivity and accuracy and lays a foundation for the development of practical new type of non-invasive blood glucose tester for diabetic patients.

  13. Facile fabrication of superhydrophobic surface with excellent mechanical abrasion and corrosion resistance on copper substrate by a novel method.

    Science.gov (United States)

    Su, Fenghua; Yao, Kai

    2014-06-11

    A novel method for controllable fabrication of a superhydrophobic surface with a water contact angle of 162 ± 1° and a sliding angle of 3 ± 0.5° on copper substrate is reported in this Research Article. The facile and low-cost fabrication process is composed from the electrodeposition in traditional Watts bath and the heat-treatment in the presence of (heptadecafluoro-1,1,2,2-tetradecyl) triethoxysilane (AC-FAS). The superhydrophobicity of the fabricated surface results from its pine-cone-like hierarchical micro-nanostructure and the assembly of low-surface-energy fluorinated components on it. The superhydrophobic surface exhibits high microhardness and excellent mechanical abrasion resistance because it maintains superhydrophobicity after mechanical abrasion against 800 grit SiC sandpaper for 1.0 m at the applied pressure of 4.80 kPa. Moreover, the superhydrophobic surface has good chemical stability in both acidic and alkaline environments. The potentiodynamic polarization and electrochemical impedance spectroscopy test shows that the as-prepared superhydrophobic surface has excellent corrosion resistance that can provide effective protection for the bare Cu substrate. In addition, the as-prepared superhydrophobic surface has self-cleaning ability. It is believed that the facile and low-cost method offer an effective strategy and promising industrial applications for fabricating superhydrophobic surfaces on various metallic materials.

  14. A review of methods to evaluate borehole thermal resistances in geothermal heat-pump systems

    Energy Technology Data Exchange (ETDEWEB)

    Lamarche, Louis; Kajl, Stanislaw; Beauchamp, Benoit [Ecole de Technologie Superieure, 1100 Notre-Dame Ouest, Montreal (Canada)

    2010-06-15

    In the design of a ground-source heat pump (GSHP) system, the heat transfer from the fluid to the ground is influenced by the thermal borehole resistance between the fluid and the borehole surface and also by the interference resistance between the two (or four) pipes inside the borehole. Several authors have proposed empirical and theoretical relations to evaluate these resistances as well as methods to evaluate them experimentally. The paper compares the different approaches and proposes good practice to evaluate the resistances. The impact of the different approaches on the design of heat exchanger is also examined. Two-dimensional and fully three-dimensional numerical simulations are used to evaluate the different methods. A new method is also proposed to evaluate the borehole resistances from in situ tests. (author)

  15. Burrowing as a novel voluntary strength training method for mice: A comparison of various voluntary strength or resistance exercise methods.

    Science.gov (United States)

    Roemers, P; Mazzola, P N; De Deyn, P P; Bossers, W J; van Heuvelen, M J G; van der Zee, E A

    2018-04-15

    Voluntary strength training methods for rodents are necessary to investigate the effects of strength training on cognition and the brain. However, few voluntary methods are available. The current study tested functional and muscular effects of two novel voluntary strength training methods, burrowing (digging a substrate out of a tube) and unloaded tower climbing, in male C57Bl6 mice. To compare these two novel methods with existing exercise methods, resistance running and (non-resistance) running were included. Motor coordination, grip strength and muscle fatigue were measured at baseline, halfway through and near the end of a fourteen week exercise intervention. Endurance was measured by an incremental treadmill test after twelve weeks. Both burrowing and resistance running improved forelimb grip strength as compared to controls. Running and resistance running increased endurance in the treadmill test and improved motor skills as measured by the balance beam test. Post-mortem tissue analyses revealed that running and resistance running induced Soleus muscle hypertrophy and reduced epididymal fat mass. Tower climbing elicited no functional or muscular changes. As a voluntary strength exercise method, burrowing avoids the confounding effects of stress and positive reinforcers elicited in forced strength exercise methods. Compared to voluntary resistance running, burrowing likely reduces the contribution of aerobic exercise components. Burrowing qualifies as a suitable voluntary strength training method in mice. Furthermore, resistance running shares features of strength training and endurance (aerobic) exercise and should be considered a multi-modal aerobic-strength exercise method in mice. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. A new capacitive/resistive probe method for studying magnetic surfaces

    International Nuclear Information System (INIS)

    Kitajima, Sumio; Takayama, Masakazu; Zama, Tatsuya; Takaya, Kazuhiro; Takeuchi, Nobunao; Watanabe, Hiroshige

    1991-01-01

    A new capacitive/resistive probe method for mapping the magnetic surfaces from resistance or capacitance between a magnetic surface and a vacuum vessel was developed and tested. Those resistances and capacitances can be regarded as components of a simple electrical bridge circuit. This method exploits electrical transient response of the bridge circuit for a square pulse. From equiresistance or equicapacitance points, the magnetic surface structure can be deduced. Measurements on the Tohoku University Heliac, which is a small-size standard heliac, show good agreement with numerical calculations. This method is particularly useful for pulse-operated machines. (author)

  17. Test methods for on site measurement of resistivity of concrete. A RILEM TC-154 Technical Recommendation

    NARCIS (Netherlands)

    Polder, R.B.

    2000-01-01

    This paper describes methods to assess concrete resistivity on site for various purposes related to corrosion and protection of reinforcement. It is based on a first draft of a RILEM Technical Recommendation. The electrical resistivity of concrete can be related to the two processes involved in

  18. Mixed-Methods Resistance Training Increases Power and Strength of Young and Older Men.

    Science.gov (United States)

    Newton, Robert U.; Hakkinen, Keijo; Hakkinen, Arja; McCormick, Matt; Volek, Jeff; Kraemer, William J.

    2002-01-01

    Examined the effects of a 10-week, mixed-methods resistance training program on young and older men. Although results confirmed some age-related reductions in muscle strength and power, the older men demonstrated similar capacity to the younger men for increases in muscle strength and power via an appropriate, periodized resistance training…

  19. An efficient motion-resistant method for wearable pulse oximeter.

    Science.gov (United States)

    Yan, Yong-Sheng; Zhang, Yuan-Ting

    2008-05-01

    Reduction of motion artifact and power saving are crucial in designing a wearable pulse oximeter for long-term telemedicine application. In this paper, a novel algorithm, minimum correlation discrete saturation transform (MCDST) has been developed for the estimation of arterial oxygen saturation (SaO2), based on an optical model derived from photon diffusion analysis. The simulation shows that the new algorithm MCDST is more robust under low SNRs than the clinically verified motion-resistant algorithm discrete saturation transform (DST). Further, the experiment with different severity of motions demonstrates that MCDST has a slightly better performance than DST algorithm. Moreover, MCDST is more computationally efficient than DST because the former uses linear algebra instead of the time-consuming adaptive filter used by latter, which indicates that MCDST can reduce the required power consumption and circuit complexity of the implementation. This is vital for wearable devices, where the physical size and long battery life are crucial.

  20. Electrical Resistivity Measurement of Petroleum Coke Powder by Means of Four-Probe Method

    Science.gov (United States)

    Rouget, G.; Majidi, B.; Picard, D.; Gauvin, G.; Ziegler, D.; Mashreghi, J.; Alamdari, H.

    2017-10-01

    Carbon anodes used in Hall-Héroult electrolysis cells are involved in both electrical and chemical processes of the cell. Electrical resistivity of anodes depends on electrical properties of its constituents, of which carbon coke aggregates are the most prevalent. Electrical resistivity of coke aggregates is usually characterized according to the ISO 10143 standardized test method, which consists of measuring the voltage drop in the bed of particles between two electrically conducing plungers through which the current is also applied. Estimation of the electrical resistivity of coke particles from the resistivity of particle bed is a challenging task and needs consideration of the contribution of the interparticle void fraction and the particle/particle contact resistances. In this work, the bed resistivity was normalized by subtracting the interparticle void fraction. Then, the contact size was obtained from discrete element method simulation and the contact resistance was calculated using Holm's theory. Finally, the resistivity of the coke particles was obtained from the bed resistivity.

  1. Methods for the evaluation of antibiotic resistance in Lactobacillus isolated from fermented sausages

    Directory of Open Access Journals (Sweden)

    Hanna Lethycia Wolupeck

    Full Text Available ABSTRACT: The present study aimed to assess the antibiotic resistance in 54 indigenous Lactobacillus plantarum isolated from artisanal fermented sausages. The confirmation of the strain species was performed by multiplex-PCR assay. Antibiotic resistance was assessed by disk diffusion (DD and Minimum Inhibitory Concentration (MIC methods. Of 54 L. plantarum, 44 strains were genotypically confirmed as L. plantarum and 3 as Lactobacillus pentosus. The highest resistance rates were to ampicillin and streptomycin. The highest susceptibility rates were shown to tetracycline, chloramphenicol and penicillin G. None of the strains showed multidrug resistance. Resistance rates by DD and MIC were not different (P>0.05 for ampicillin, chloramphenicol, erythromycin and penicillin G. Future research should assess the genetic mechanisms underlying the phenotypic resistance in Lactobacillus strains to screen the potential probiotic strains for the development of functional meat products.

  2. A measurement method for determination of dc internal resistance of batteries and supercapacitors

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Shuhong; Wu, Feng [Department of Materials Science, Beijing Science and Technology University, Beijing 100081 (China); Yang, Liuxiang; Gao, Lijun [Department of Chemistry, NanChang University, JiangXi 330031 (China); Burke, Andrew F. [Institute of Transportation, University of California, Davis, CA 95616 (United States)

    2010-02-15

    Internal resistance is an importance parameter determining the power performance of a battery or supercapacitor. An 8.5 Ah Li-ion battery and a 350 F supercapacitor were tested as examples to validate the measurement method of dc internal resistance. Voltage data were taken at 10 ms, 2 s and 30 s after the current interruption or pulse. The ac resistances at 1 kHz of the battery and supercapacitor were also measured for comparison with the dc values. Based on these tests, it is proposed that the dc internal resistance of the battery and supercapacitor be obtained from {delta}V/{delta}I where the {delta}V is the voltage change after the current interruption, and {delta}I means current change from I to 0. When the voltage change at 10 ms or less is selected, the resistance corresponds to the Ohmic resistance of the device. (author)

  3. Development of Methods for Genetic Assessment of Antibiotic Resistance In Animal Herds

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy

    with a parallel selection for resistant bacteria. Since the hazards related to antibiotic resistance development have been recognized, the prudent use of antibiotics has been in focus, especially concerning their use in animal production. For many years antibiotics have been, and still are, recklessly used...... in the animal production especially in the form of growth promoters. Due to the associated risks of resistant zoonotic bacteria transmission from animals to humans, it is of interest to keep antibiotic use and antibiotic resistance under strict surveillance.This PhD study was based on the development of real......-time PCR (qPCR) assays that supply an easy and rapid method for quantifying antibiotic resistance levels in animal herds. The pig production is accountable for a large portion of the antibiotics used for food producing animals in Denmark. Therefore, the antibiotic resistance genes included in this study...

  4. Method and apparatus for measuring surface movement of an object using a polarizing interferometer

    Science.gov (United States)

    Schultz, T.J.; Kotidis, P.A.; Woodroffe, J.A.; Rostler, P.S.

    1995-05-09

    A system for non-destructively measuring an object and controlling industrial processes in response to the measurement is disclosed in which an impulse laser generates a plurality of sound waves over timed increments in an object. A polarizing interferometer is used to measure surface movement of the object caused by the sound waves and sensed by phase shifts in the signal beam. A photon multiplier senses the phase shift and develops an electrical signal. A signal conditioning arrangement modifies the electrical signals to generate an average signal correlated to the sound waves which in turn is correlated to a physical or metallurgical property of the object, such as temperature, which property may then be used to control the process. External, random vibrations of the workpiece are utilized to develop discernible signals which can be sensed in the interferometer by only one photon multiplier. In addition the interferometer includes an arrangement for optimizing its sensitivity so that movement attributed to various waves can be detected in opaque objects. The interferometer also includes a mechanism for sensing objects with rough surfaces which produce speckle light patterns. Finally the interferometer per se, with the addition of a second photon multiplier is capable of accurately recording beam length distance differences with only one reading. 38 figs.

  5. Wave resistance calculation method combining Green functions based on Rankine and Kelvin source

    Directory of Open Access Journals (Sweden)

    LI Jingyu

    2017-12-01

    Full Text Available [Ojectives] At present, the Boundary Element Method(BEM of wave-making resistance mostly uses a model in which the velocity distribution near the hull is solved first, and the pressure integral is then calculated using the Bernoulli equation. However,the process of this model of wave-making resistance is complex and has low accuracy.[Methods] To address this problem, the present paper deduces a compound method for the quick calculation of ship wave resistance using the Rankine source Green function to solve the hull surface's source density, and combining the Lagally theorem concerning source point force calculation based on the Kelvin source Green function so as to solve the wave resistance. A case for the Wigley model is given.[Results] The results show that in contrast to the thin ship method of the linear wave resistance theorem, this method has higher precision, and in contrast to the method which completely uses the Kelvin source Green function, this method has better computational efficiency.[Conclusions] In general, the algorithm in this paper provides a compromise between precision and efficiency in wave-making resistance calculation.

  6. Application of column tests and electrical resistivity methods for leachate transport monitoring

    Directory of Open Access Journals (Sweden)

    Wychowaniak Dorota

    2015-09-01

    Full Text Available Development of the human civilization leads to the pollution of environment. One of the contamination which are a real threat to soil and groundwater are leachates from landfills. In this paper the solute transport through soil was considered. For this purpose, the laboratory column tests of chlorides tracer and leachates transport on two soil samples have been carried out. Furthermore, the electrical resistivity method was applied as auxiliary tool to follow the movements of solute through the soil column what allowed to compare between the results obtained with column test method and electrical resistivity measurements. Breakthrough curves obtained by conductivity and resistivity methods represents similar trends which leads to the conclusion about the suitability of electrical resistivity methods for contamination transport monitoring in soil-water systems.

  7. Fast and Simple Method for Evaluation of Polarization Correction to Propagation Constant of Arbitrary Order Guided Modes in Optical Fibers with Arbitrary Refractive Index Profile

    Directory of Open Access Journals (Sweden)

    Anton Bourdine

    2015-01-01

    Full Text Available This work presents fast and simple method for evaluation of polarization correction to scalar propagation constant of arbitrary order guided modes propagating over weakly guiding optical fibers. Proposed solution is based on earlier on developed modified Gaussian approximation extended for analysis of weakly guiding optical fibers with arbitrary refractive index profile in the core region bounded by single solid outer cladding. Some results are presented that illustrate the decreasing of computational error during the estimation of propagation constant when polarization corrections are taken into account. Analytical expressions for the first and second derivatives of polarization correction are derived and presented.

  8. A Novel Ship Detection Method Based on Gradient and Integral Feature for Single-Polarization Synthetic Aperture Radar Imagery

    Directory of Open Access Journals (Sweden)

    Hao Shi

    2018-02-01

    Full Text Available With the rapid development of remote sensing technologies, SAR satellites like China’s Gaofen-3 satellite have more imaging modes and higher resolution. With the availability of high-resolution SAR images, automatic ship target detection has become an important topic in maritime research. In this paper, a novel ship detection method based on gradient and integral features is proposed. This method is mainly composed of three steps. First, in the preprocessing step, a filter is employed to smooth the clutters and the smoothing effect can be adaptive adjusted according to the statistics information of the sub-window. Thus, it can retain details while achieving noise suppression. Second, in the candidate area extraction, a sea-land segmentation method based on gradient enhancement is presented. The integral image method is employed to accelerate computation. Finally, in the ship target identification step, a feature extraction strategy based on Haar-like gradient information and a Radon transform is proposed. This strategy decreases the number of templates found in traditional Haar-like methods. Experiments were performed using Gaofen-3 single-polarization SAR images, and the results showed that the proposed method has high detection accuracy and rapid computational efficiency. In addition, this method has the potential for on-board processing.

  9. Comparison of Several Methods for Determining the Internal Resistance of Lithium Ion Cells

    Directory of Open Access Journals (Sweden)

    Hans-Georg Schweiger

    2010-06-01

    Full Text Available The internal resistance is the key parameter for determining power, energy efficiency and lost heat of a lithium ion cell. Precise knowledge of this value is vital for designing battery systems for automotive applications. Internal resistance of a cell was determined by current step methods, AC (alternating current methods, electrochemical impedance spectroscopy and thermal loss methods. The outcomes of these measurements have been compared with each other. If charge or discharge of the cell is limited, current step methods provide the same results as energy loss methods.

  10. Polarized particles in storage rings

    International Nuclear Information System (INIS)

    Derbenev, Ya.S.; Kondratenko, A.M.; Serednyakov, S.I.; Skrinskij, A.N.; Tumajkin, G.M.; Shatunov, Yu.M.

    1977-01-01

    Experiments with polarized beams on the VEPP-2M and SPEAK storage rings are described. Possible methods of producing polarized particle beams in storage rings as well as method of polarization monitoring are counted. Considered are the processes of radiation polarization of electrons and positrons. It is shown, that to preserve radiation polarization the introduction of regions with a strong sign-variable magnetic field is recommended. Methods of polarization measurement are counted. It is suggested for high energies to use dependence of synchrotron radiation power on transverse polarization of electrons and positrons. Examples of using polarizability of colliding beams in storage rings are presented

  11. Combined DC resistivity and induced polarization (DC-IP) for mapping the internal composition of a mine waste rock pile in Nova Scotia, Canada

    Science.gov (United States)

    Power, Christopher; Tsourlos, Panagiotis; Ramasamy, Murugan; Nivorlis, Aristeidis; Mkandawire, Martin

    2018-03-01

    Mine waste rock piles (WRPs) can contain sulfidic minerals whose interaction with oxygen and water can generate acid mine drainage (AMD). Thus, WRPs can be a long-term source of environmental pollution. Since the generation of AMD and its release into the environment is dependent on the net volume and bulk composition of waste rock, effective characterization of WRPs is necessary for successful remedial design and monitoring. In this study, a combined DC resistivity and induced polarization (DC-IP) approach was employed to characterize an AMD-generating WRP in the Sydney Coalfield, Nova Scotia, Canada. Two-dimensional (2D) DC-IP imaging with 6 survey lines was performed to capture the full WRP landform. 2D DC results indicated a highly heterogeneous and moderately conductive waste rock underlain by a resistive bedrock containing numerous fractures. 2D IP (chargeability) results identified several highly-chargeable regions within the waste, with normalized chargeability delineating regions specific to waste mineralogy only. Three-dimensional (3D) DC-IP imaging, using 17 parallel lines on the plateau of the pile, was then used to focus on the composition of the waste rock. The full 3D inverted DC-IP distributions were used to identify coincident and continuous zones (isosurfaces) of low resistivity (0.4 mS/m) that were inferred as generated AMD (leachate) and stored AMD (sulfides), respectively. Integrated geological, hydrogeological and geochemical data increased confidence in the geoelectrical interpretations. Knowledge on the location of potentially more reactive waste material is extremely valuable for improved long-term AMD monitoring at the WRP.

  12. The Application of 2-D Resistivity and Self Potential (SP) Methods in Determining the Water Flow

    Science.gov (United States)

    Nordiana, M. M.; Tajudeen Olugbenga, Adeeko; Afiq Saharudin, Muhamad; nabila, S.; El Hidayah Ismail, Noer

    2018-04-01

    Existence of water flow at urban area will decrease the shear strength and increase hydraulic conductivity of soil which finally caused subsurface problems at this area. To avoid landslide, slope instability and disturbance of the ecosystem, good and detailed planning must be done when developing hilly area. The understanding about geological condition has to be considering before construction activities be done. Six 2-D resistivity survey lines with minimum 5 m electrode spacing were executed using Pole-dipole array. The field investigation such as borehole was carried out at multiple locations in the area where the 2-D resistivity method have been conducted. The directions and intensities of the water were evaluated with self-potential (SP) method. Subsequently, the results from borehole were used to verify the results of electrical resistivity method. Interpretation of 2-D resistivity data showed a low resistivity value (ohm-m), which appears to be a zone that is fully saturated with sandy silt and this could be an influence factor the increasing water level because sandy silt is highly permeable in nature. The borehole, support the results of 2-D resistivity method relating a saturated zone in the survey area. There is a good correlation between the 2-D resistivity investigations and the results of borehole records.

  13. Pyrene absorption can be a convenient method for probing critical micellar concentration (cmc) and indexing micellar polarity.

    Science.gov (United States)

    Basu Ray, Gargi; Chakraborty, Indranil; Moulik, Satya P

    2006-02-01

    The critical micellar concentration (cmc) of both ionic and non-ionic surfactants can be conveniently determined from the measurements of UV absorption of pyrene in surfactant solution. The results on a number of surfactants have agreed with that realized from pyrene fluorescence measurements as well as that obtained following conductometric, tensiometric and calorimetric methods. The absorbance vs [surfactant] profiles for all the major UV spectral peaks of pyrene have been found to be sigmoidal in nature which were analyzed according to Sigmoidal-Boltzmann equation (SBE) to evaluate the cmcs of the studied surfactants. The difference between the initial and the final asymptotes (a(i) and a(f), respectively) of the sigmoidal profile, Delta a = (a(f)-a(i)) and the slope of the sigmoid, S(sig) have been observed to depend on the type of the surfactant. The Delta a has shown a linear correlation with the ratio of the fluorescence intensities of the first and the third vibronic peaks, I1/I3 of pyrene which is considered as a measure of the environmental polarity (herein micellar interior) of the probe (pyrene). Thus, Delta a values have the prospect for use as another index for the estimation of polarity of micellar interior.

  14. Methods for Specific Electrode Resistance Measurement during Transcranial Direct Current Stimulation

    Science.gov (United States)

    Khadka, Niranjan; Rahman, Asif; Sarantos, Chris; Truong, Dennis Q.; Bikson, Marom

    2014-01-01

    Background Transcranial Direct Current Stimulation (tDCS) is investigated to treat a wide range of neuropsychiatric disorders, for rehabilitation, and for enhancing cognitive performance. The monitoring of electrode resistance before and during tDCS is considered important for tolerability and safety, where an unusually high resistance is indicative of undesired electrode or poor skin contact conditions. Conventional resistance measurement methods do not isolate individual electrode resistance but rather measures overall voltage. Moreover, for HD-tDCS devices, cross talk across electrodes makes concurrent resistance monitoring unreliable. Objective We propose a novel method for monitoring of the individual electrode resistance during tDCS, using a super-position of direct current with a test-signal (low-intensity and low-frequency sinusoids with electrode– specific frequencies) and a single sentinel electrode (not used for DC). Methods To validate this methodology, we developed lumped-parameter models of two and multi-electrode tDCS. Approaches with and without a sentinel electrode were solved and underlying assumptions identified. Assumptions were tested and parameterized in healthy participants using forearm stimulation combining tDCS (2 mA) and sinusoidal test-signals (38 μA and 76 μA peak to peak at 1 Hz, 10 Hz, and 100 Hz) and an in vitro test (where varied electrode failure modes were created). DC and AC component voltages across the electrodes were compared and participants were asked to rate subjective pain. Results A sentinel electrode is required to isolate electrode resistance in a two-electrode tDCS system. For multi-electrode resistance tracking, cross talk was aggravated with electrode proximity and current/resistance mismatches, but could be corrected using proposed approaches. Average voltage and average pain scores were not significantly different across test current intensities and frequencies (two-way repeated measures ANOVA) indicating the

  15. Standard method for detecting Bombyx mori nucleopolyhedrovirus disease-resistant silkworm varieties

    Directory of Open Access Journals (Sweden)

    Yang Qiong

    Full Text Available ABSTRACT Bombyx mori nucleopolyhedrovirus (BmNPV disease is one of the most serious silkworm diseases, and it has caused great economic losses to the sericulture industry. So far, the disease has not been controlled effectively by therapeutic agents. Breeding resistant silkworm varieties breeding may be an effective way to improve resistance to BmNPV and reduce economic losses. A precise resistance-detection method will help to accelerate the breeding process. For this purpose, here we described the individual inoculation method (IIM. Details of the IIM include pathogen BmNPV preparation, mulberry leaf size, pathogen volume, rearing conditions, course of infection, and breeding conditions. Finally, a resistance comparison experiment was performed using the IIM and the traditional group inoculation method (GIM. The incidence of BmNPV infection and the within-group variance results showed that the IIM was more precise and reliable than the GIM.

  16. Survey of anthelmintic resistance on Danish horse farms, using 5 different methods of calculating faecal egg count reduction

    DEFF Research Database (Denmark)

    Craven, J.; Bjørn, H.; Henriksen, S.A.

    1998-01-01

    of resistance in sheep was the most sensitive procedure for detecting resistance. Using this method benzimidazole resistance was detected on 33 of 42 farms (79%) examined. Pyrantel was tested on 15 farms and FECR tests indicate resistance on 3 (30%) farms. On 2 farms on which resistance to pyrantel was detected...... resistance to benzimidazoles was also detected. On one of 16 farms examined ivermectin resistance was indicated at Day 14 but not at Day 19. On the 15 remaining farms ivermectin was effective. Due to the high prevalence of anthelmintic resistance in Danish horse herds it is recommended that tests...

  17. Characterization of textural and hydric heterogeneities in argillaceous geo-materials using induced polarization method: application to the excavation damaged zone (EDZ) of the Tournemire experimental station; Caracterisation des heterogeneites texturales et hydriques des geomateriaux argileux par la methode de Polarisation Provoquee: Application a l'EDZ de la station experimentale de Tournemire

    Energy Technology Data Exchange (ETDEWEB)

    Okay, Gonca

    2011-03-25

    This Ph-D thesis investigates the potential of clay rocks for deep geological disposal of radioactive waste. Underground excavations are responsible in their vicinity a region, where the clay-rock is damaged or disturbed. This region must to be characterized to ensure the safety of repositories. The extension of the excavation damaged zone (EDZ) and its evolution over time have been investigated thought electrical resistivity and induced polarization methods from three galleries belonging to the French Institute of Radioprotection and Nuclear Safety (IRSN)'s experimental underground research laboratory of Tournemire (Aveyron, France). Time domain induced polarisation indicates the presence of mineralization (e.g., especially pyrite) located in the structural discontinuities such as tectonic fractures (mm-cm), tectonic fault (m) and calcareous nodules (cm). Combined electrical resistivity and Induced Polarization methods show the possibility to delineate textural changes associated to desaturation of the clay-rock induced by the ventilation of galleries. The impact of the desaturation is particularly observed on the gallery's walls. In addition, Spectral Induced Polarization (SIP) tomography results can be used to discriminate the responses of the de-saturated zones from the fractured zones. We have performed laboratory experiments (in the range 1.4 mHz - 12 kHz) using saturated unconsolidated sand-clay mixtures. The results illustrate that the amplitude of polarization is strongly affected by the surface properties of these mixtures (e.g., cation exchange capacity, specific surface area) and by the volumetric clay content. However, the amplitude of polarization is independent of the concentration of electrolyte. The SIP response is also strongly sensitive to the mineralogy of the clays. (author)

  18. Improvement of methods to evaluate brittle failure resistance of the WWER reactor pressure vessels

    Energy Technology Data Exchange (ETDEWEB)

    Popov, A A; Parshutin, E V [Engineering Center of Nuclear Equipment Strength, Research and Development Inst. of Power Engineering, Moscow (Russian Federation); Rogov, M F; Dragunov, U G [Experimenter` s and Designer` s Office ` ` Hydropress` ` (Russian Federation)

    1997-09-01

    At the next 10 years a number of Russian WWER nuclear power plants will complete its design lifetime. Normative methods to evaluate brittle failure resistance of the reactor pressure vessels used in Russia have been intended for design stage. The evaluation of reactor pressure vessel lifetime in operation stage demands to create new methods of calculation and new methods for experimental evaluation of brittle failure resistance degradation. The main objective of the study in this type of reactor is weldment number 4. In this report an analysis is made of methods to determine critical temperature of reactor materials including the results of instrumented Charpy testing. 12 figs.

  19. Standard test method for determining the crevice repassivation potential of corrosion-resistant alloys using a potentiodynamic-galvanostatic-potentiostatic technique

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This test method covers a procedure for conducting anodic polarization studies to determine the crevice repassivation potential for corrosion–resistant alloys. The concept of the repassivation potential is similar to that of the protection potential given in Reference Test Method G 5. 1.2 The test method consists in applying successively potentiodynamic, galvanostatic, and potentiostatic treatments for the initial formation and afterward repassivation of crevice corrosion. 1.3 This test method is a complement to Test Method G 61. 1.4 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information only. 1.5 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  20. An optical liquid level sensor based on core-offset fusion splicing method using polarization-maintaining fiber

    Science.gov (United States)

    Lou, Weimin; Chen, Debao; Shen, Changyu; Lu, Yanfang; Liu, Huanan; Wei, Jian

    2016-01-01

    A simple liquid level sensor using a small piece of hydrofluoric acid (HF) etched polarization maintaining fiber (PMF), with SMF-PMF-SMF fiber structure based on Mach- Zehnder interference (MZI) mechanism is proposed. The core-offset fusion splicing method induced cladding modes interfere with the core mode. Moreover, the changing liquid level would influence the optical path difference of the MZI since the effective refractive indices of the air and the liquid is different. Both the variations of the wavelength shifts and power intensity attenuation corresponding to the liquid level can be obtained with a sensitivity of 0.4956nm/mm and 0.2204dB/mm, respectively.

  1. The polarization of fast neutrons

    International Nuclear Information System (INIS)

    Talov, V.V.

    2000-01-01

    The present work is the review of polarization of fast neutrons and methods of polarization analysis. This also includes information about polarization of fast neutrons from first papers, which described polarization in the D(d,n) 3 He, 7 Li(p,n) 7 Be, and T(p,n) 3 He reactions. (authors)

  2. Design of a 50/50 splitting ratio non-polarizing beam splitter based on the modal method with fused-silica transmission gratings

    Science.gov (United States)

    Zhao, Huajun; Yuan, Dairong; Ming, Hai

    2011-04-01

    The optical design of a beam splitter that has a 50/50 splitting ratio regardless of the polarization is presented. The non-polarizing beam splitter (NPBS) is based on the fused-silica rectangular transmission gratings with high intensity tolerance. The modal method has been used to estimate the effective index of the modes excited in the grating region for TE and TM polarizations. If a phase difference equals an odd multiples of π/2 for the first two modes (i.e. modes 0 and 1), the incident light will be diffracted into the 0 and -1 orders with about 50% and 50% diffraction efficiency for TM and TE polarizations, respectively.

  3. Method of producing oxidation resistant coatings for molybdenum

    International Nuclear Information System (INIS)

    Timmons, G.A.

    1989-01-01

    A method is described for producing a molybdenum element having adherently bonded thereto a thermally self-healing plasma-sprayed coating consisting essentially of a composite of molybdenum and a refactory oxide material capable of reacting with molybdenum oxide under oxidizing conditions to form a substantially thermally stable refractory compound of molybdenum, the method comprising plasma-spraying a coating formed by the step-wise application of a plurality of interbonded plasma-sprayed layers of a composite of molybdenum/refractory oxide material produced from a particulate mixture thereof. The coating comprises a first layer of molybdenum plasma-sprayed bonded to the substrate of the molybdenum element, a second layer of plasma-sprayed mixture of particulate molybdenum/refactory oxide consisting essentially of predominantly molybdenum bonded to the first layer, and succeeding layers of this mixture. The next step is heating the coated molybdenum element under oxidizing conditions to an elevated temperature sufficient to cause oxygen to diffuse into the surface of the multi-layered coating to react with dispersed molybdenum therein to form molybdenum oxide and effect healing of the coating by reaction of the molybdenum oxide with the contained refractory oxide and thereby protect the substrate of the molybdenum element against oxidation

  4. Comparative Analysis of Three Methods for Determination of Imipenem Resistance in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Tanaz Zabihi

    2016-02-01

    Full Text Available "> Background: These days, the antibiotic resistance of Pseudomonas aeruginosa isolates toimipenem has significantly increased. Therefore the study of resistance to imipenem in thisorganism to imipenem in determining the appropriate treatment is crucial and necessary. The goalof this study is to compare three phenotypic methods of E-test, disk diffusion and micro brothdilution in the study of resistance to imipenem in clinical isolates of P. aeruginosa.Methods: Within a 6-month interval, 120 clinical specimens were collected and evaluated. Allisolates were identified as P. aeruginosa by standard biochemical tests and amplification of 16SrRNA gene. Three phenotypic methods of E-test, disk diffusion, and micro broth dilution wereused to determine imipenem resistance in P. aeruginosa isolates.Results: Of the 96 P. aeruginosa isolates studied for their resistance to imipenem by the use ofE-test, disk diffusion and micro broth dilution methods, 38.5% of the strains in micro broth dilutionmethod and 33.3% in the two methods of E-test and disk diffusion were resistant to imipenem. Therate of sensitivity and specificity of disk diffusion and E-test methods were 100%, 90.1%, and theywere 100% and 83.1% for micro broth dilution, respectively.Conclusions: With regard to the results obtained from the comparison of the three methods100% agreement were observed among the antimicrobial susceptibility results obtained by the Etest and disk diffusion methods (P ≥ 0.05. Therefore, the use of disk diffusion method can bean appropriate replacement for E-test method with regard to its being easy and cost-effective.

  5. Paleointensity determinations during the Akaroa polarity reversal, New Zealand: New input from the multispecimen parallel differential pTRM method

    Science.gov (United States)

    Camps, P.; Fanjat, G.; Poidras, T.; Hoffman, K. A.; Carvallo, C.; kennedy, B.

    2011-12-01

    We resampled two polarity reversals of late Miocene age (~ 9 Ma) recorded successively in the Akaroa volcano (Hoffman, 1986, Nature). Our main objective was to check old paleointensity determinations (Sherwood & Shaw, 1986, J. Geomag. Geoelec.) that yielded stronger values during the transitional period than during stable periods that preceded and followed the reversals. This observation is opposite to what is generally observed. An increase in intensity during the reversal would provide an extreme example of increasing secular variation. However, the experimental method used for determining the paleointensity, method of Shaw, is strongly questioned by the scientific community. A check of these data by the conventional Thellier method was required. Unfortunately, among the 72 sampled flows, only 4 yielded rock magnetic properties well suited for Thellier determinations. In most of the flows, the presence of large Multi-Domain grains of Ti-magnetite, which are frequently associated with Ti-maghemite, precludes any Thellier paleointensity determinations. We implement the domain-state independent paleointensity method (the multispecimen parallel differential pTRM, Dekkers & Bohnel, 2006, EPSL; Fabian & Leonhardt, 2010, EPSL) for 16 lava flows in which the MD Ti-magnetite are not oxidized. Thellier paleointensities obtained do not confirm the Sherwood results but show more scattered values of the intensity even during the stable periods of the field. To complete the data, multispecimen mesearements are being to be done.

  6. Validation of attenuation, beam blockage, and calibration estimation methods using two dual polarization X band weather radars

    Science.gov (United States)

    Diederich, M.; Ryzhkov, A.; Simmer, C.; Mühlbauer, K.

    2011-12-01

    The amplitude a of radar wave reflected by meteorological targets can be misjudged due to several factors. At X band wavelength, attenuation of the radar beam by hydro meteors reduces the signal strength enough to be a significant source of error for quantitative precipitation estimation. Depending on the surrounding orography, the radar beam may be partially blocked when scanning at low elevation angles, and the knowledge of the exact amount of signal loss through beam blockage becomes necessary. The phase shift between the radar signals at horizontal and vertical polarizations is affected by the hydrometeors that the beam travels through, but remains unaffected by variations in signal strength. This has allowed for several ways of compensating for the attenuation of the signal, and for consistency checks between these variables. In this study, we make use of several weather radars and gauge network measuring in the same area to examine the effectiveness of several methods of attenuation and beam blockage corrections. The methods include consistency checks of radar reflectivity and specific differential phase, calculation of beam blockage using a topography map, estimating attenuation using differential propagation phase, and the ZPHI method proposed by Testud et al. in 2000. Results show the high effectiveness of differential phase in estimating attenuation, and potential of the ZPHI method to compensate attenuation, beam blockage, and calibration errors.

  7. METHODS FOR INOCULATION WITH Fusarium guttiforme AND GENETIC RESISTANCE OF PINEAPPLE ( Ananas comosus var. comosus )

    OpenAIRE

    WANDREILLA MOREIRA GARCIA; WILLIAN KRAUSE; DEJÂNIA VIEIRA DE ARAÚJO; ISANE VERA KARSBURG; RIVANILDO DALLACORT

    2017-01-01

    The objective of this work was to evaluate Fusarium guttiforme inoculation methods and genetic resistance of pineapple accessions. Thus, three experiments were conducted: pathogen inoculation of different leaf types ( B, D and F ) of pineapple (1), pathogen inoculation of pineapple cuttings and detached D leaves (2), and identification of resistance to fusariosis in 19 pineapple accessions (3) sampled in the State of Mato Grosso, Brazil. The cultivars Pérola (susceptible...

  8. Methods for quantifying adipose tissue insulin resistance in overweight/obese humans.

    Science.gov (United States)

    Ter Horst, K W; van Galen, K A; Gilijamse, P W; Hartstra, A V; de Groot, P F; van der Valk, F M; Ackermans, M T; Nieuwdorp, M; Romijn, J A; Serlie, M J

    2017-08-01

    Insulin resistance of adipose tissue is an important feature of obesity-related metabolic disease. However, assessment of lipolysis in humans requires labor-intensive and expensive methods, and there is limited validation of simplified measurement methods. We aimed to validate simplified methods for the quantification of adipose tissue insulin resistance against the assessment of insulin sensitivity of lipolysis suppression during hyperinsulinemic-euglycemic clamp studies. We assessed the insulin-mediated suppression of lipolysis by tracer-dilution of [1,1,2,3,3- 2 H 5 ]glycerol during hyperinsulinemic-euglycemic clamp studies in 125 overweight or obese adults (85 men, 40 women; age 50±11 years; body mass index 38±7 kg m -2 ). Seven indices of adipose tissue insulin resistance were validated against the reference measurement method. Low-dose insulin infusion resulted in suppression of the glycerol rate of appearance ranging from 4% (most resistant) to 85% (most sensitive), indicating a good range of adipose tissue insulin sensitivity in the study population. The reference method correlated with (1) insulin-mediated suppression of plasma glycerol concentrations (r=0.960, PInsulin Resistance (Adipo-IR) index (fasting plasma insulin-NEFA product; r=-0.526, Pinsulin-glycerol product (r=-0.467, PInsulin Resistance Index (fasting plasma insulin-basal lipolysis product; r=0.460, PInsulin Sensitivity Check Index (QUICKI)-NEFA index (r=0.621, Pinsulin resistance (area under the curve ⩾0.801, Pinsulin sensitivity (that is, the antilipolytic action of insulin) can be reliably quantified in overweight and obese humans by simplified index methods. The sensitivity and specificity of the Adipo-IR index and the fasting plasma insulin-glycerol product, combined with their simplicity and acceptable agreement, suggest that these may be most useful in clinical practice.

  9. Development and validation of polar RP-HPLC method for screening for ectoine high-yield strains in marine bacteria with green chemistry.

    Science.gov (United States)

    Chen, Jun; Chen, Jianwei; Wang, Sijia; Zhou, Guangmin; Chen, Danqing; Zhang, Huawei; Wang, Hong

    2018-04-02

    A novel, green, rapid, and precise polar RP-HPLC method has been successfully developed and screened for ectoine high-yield strain in marine bacteria. Ectoine is a polar and extremely useful solute which allows microorganisms to survive in extreme environmental salinity. This paper describes a polar-HPLC method employed polar RP-C18 (5 μm, 250 × 4.6 mm) using pure water as the mobile phase and a column temperature of 30 °C, coupled with a flow rate at 1.0 mL/min and detected under a UV detector at wavelength of 210 nm. Our method validation demonstrates excellent linearity (R 2  = 0.9993), accuracy (100.55%), and a limit of detection LOQ and LOD of 0.372 and 0.123 μgmL -1 , respectively. These results clearly indicate that the developed polar RP-HPLC method for the separation and determination of ectoine is superior to earlier protocols.

  10. Multilayer sulfur-resistant composite metal membranes and methods of making and repairing the same

    Science.gov (United States)

    Way, J. Douglas; Hatlevik, Oyvind

    2014-07-15

    The invention relates to thin, hydrogen-permeable, sulfur-resistant membranes formed from multi-layers of palladium or palladium-alloy coatings on porous, ceramic or metal supports, methods of making these membranes, methods of repairing layers of these membranes and devices that incorporate these membranes.

  11. Investigation of colistin sensitivity via three different methods in Acinetobacter baumannii isolates with multiple antibiotic resistance.

    Science.gov (United States)

    Sinirtaş, Melda; Akalin, Halis; Gedikoğlu, Suna

    2009-09-01

    In recent years there has been an increase in life-threatening infections caused by Acinetobacter baumannii with multiple antibiotic resistance, which has lead to the use of polymyxins, especially colistin, being reconsidered. The aim of this study was to investigate the colistin sensitivity of A. baumannii isolates with multiple antibiotic resistance via different methods, and to evaluate the disk diffusion method for colistin against multi-resistant Acinetobacter isolates, in comparison to the E-test and Phoenix system. The study was carried out on 100 strains of A. baumannii (colonization or infection) isolated from the microbiological samples of different patients followed in the clinics and intensive care units of Uludağ University Medical School between the years 2004 and 2005. Strains were identified and characterized for their antibiotic sensitivity by Phoenix system (Becton Dickinson, Sparks, MD, USA). In all studied A. baumannii strains, susceptibility to colistin was determined to be 100% with the disk diffusion, E-test, and broth microdilution methods. Results of the E-test and broth microdilution method, which are accepted as reference methods, were found to be 100% consistent with the results of the disk diffusion tests; no very major or major error was identified upon comparison of the tests. The sensitivity and the positive predictive value of the disk diffusion method were found to be 100%. Colistin resistance in A. baumannii was not detected in our region, and disk diffusion method results are in accordance with those of E-test and broth microdilution methods.

  12. Slope failures evaluation and landslides investigation using 2-D resistivity method

    Directory of Open Access Journals (Sweden)

    M.M. Nordiana

    2018-06-01

    Full Text Available Slope failure is a complex phenomenon that may caused to landslides. Buildings and infrastructure such as transportation facilities and pipelines located within the boundaries of a landslide can be damaged or destroyed. Slope failure classification and various factors contributing to the instability using 2-D resistivity survey conducted in Selangor, Malaysia are described. Six 2-D resistivity survey lines with 5 m minimum electrode spacing using Pole-dipole array were performed. The data were processed using Res2Dinv and surfer10 software to evaluate the subsurface characteristics. The 2-D resistivity results show that the subsurface consist of two main zones. The first zone was alluvium or highly weathered with resistivity value of 100–1000 Ω m and depth of >30 m. This zone consists of saturated area with resistivity value of 1–100 Ω m and boulders with resistivity value of 1200–7000 Ω m. The second zone with resistivity value of >7000 Ω m was interpreted as granitic bedrock. The study area was characterized by saturated zones, highly weathered zone, highly contain of sand and boulders that will trigger slope failure in the survey area. This will cause to low strength of soil, debris flow and movement of earth. On the basis of the case examples described, 2-D resistivity method is categorized into desirable and useful method in determination of slope failure and future assessments. Keywords: Slope failure, Landslides, 2-D resistivity, Saturated, Boulders

  13. When measured spin polarization is not spin polarization

    International Nuclear Information System (INIS)

    Dowben, P A; Wu Ning; Binek, Christian

    2011-01-01

    Spin polarization is an unusually ambiguous scientific idiom and, as such, is rarely well defined. A given experimental methodology may allow one to quantify a spin polarization but only in its particular context. As one might expect, these ambiguities sometimes give rise to inappropriate interpretations when comparing the spin polarizations determined through different methods. The spin polarization of CrO 2 and Cr 2 O 3 illustrate some of the complications which hinders comparisons of spin polarization values. (viewpoint)

  14. Flashed-feed VMD configuration as a novel method for eliminating temperature polarization effect and enhancing water vapor flux

    KAUST Repository

    Alsaadi, Ahmad Salem

    2018-05-28

    The coupling of heat and mass transfer in membrane distillation (MD) process makes enhancing water vapor flux and determining MD membrane mass transfer coefficient (MTC) fairly challenging due to the development of temperature gradient near the membrane surface, referred to as temperature polarization (TP). As a result, the change in feed temperature at the membrane surface will be difficult to measure accurately. In this paper, the effect of TP was decoupled from the membrane MTC by preventing the liquid feed stream from contacting the membrane surface through the use of a novel custom-made vacuum MD (VMD) module design. Results showed that a temperature difference of 10°C between the feed bulk and feed temperatures at the membrane surface/interface is estimated to take place in the typical VMD configuration, while the proposed flashed-feed VMD configuration eliminates TP effect and gives a flux 3.5-fold higher (200kg/m2.hr) under similar operating conditions. Therefore, it can be concluded that heat transfer coefficient is considered to be the main factor controlling resistance of water vapor flux in the typical VMD configuration. The measured MTC of the tested commercial membrane was found to be more accurate and the highest among all reported MTCs in the MD literature (2.44×10−6kg/m2.s.Pa). Additionally, a transmembrane temperature difference of 5°C and 10°C in the novel configuration can produce water vapor fluxes of about 9kg/m2.hr and 40kg/m2.hr, respectively, at a feed temperature of 70°C, which is very attractive for scaling-up the process.

  15. A polar-region-adaptable systematic bias collaborative measurement method for shipboard redundant rotational inertial navigation systems

    Science.gov (United States)

    Wang, Lin; Wu, Wenqi; Wei, Guo; Lian, Junxiang; Yu, Ruihang

    2018-05-01

    The shipboard redundant rotational inertial navigation system (RINS) configuration, including a dual-axis RINS and a single-axis RINS, can satisfy the demand of marine INSs of especially high reliability as well as achieving trade-off between position accuracy and cost. Generally, the dual-axis RINS is the master INS, and the single-axis RINS is the hot backup INS for high reliability purposes. An integrity monitoring system performs a fault detection function to ensure sailing safety. However, improving the accuracy of the backup INS in case of master INS failure has not been given enough attention. Without the aid of any external information, a systematic bias collaborative measurement method based on an augmented Kalman filter is proposed for the redundant RINSs. Estimates of inertial sensor biases can be used by the built-in integrity monitoring system to monitor the RINS running condition. On the other hand, a position error prediction model is designed for the single-axis RINS to estimate the systematic error caused by its azimuth gyro bias. After position error compensation, the position information provided by the single-axis RINS still remains highly accurate, even if the integrity monitoring system detects a dual-axis RINS fault. Moreover, use of a grid frame as a navigation frame makes the proposed method applicable in any area, including the polar regions. Semi-physical simulation and experiments including sea trials verify the validity of the method.

  16. Determination of nitrate and nitrite in Hanford defense waste (HDW) by reverse polarity capillary zone electrophoresis (RPCE) method

    International Nuclear Information System (INIS)

    Metcalf, S.G.

    1998-01-01

    This paper describes the first application of reverse polarity capillary zone electrophoresis (RPCE) for rapid and accurate determination of nitrate and nitrite in Hanford Defense Waste (HDW). The method development was carried out by using Synthetic Hanford Waste (SHW), followed by the analysis of 4 real HDW samples. Hexamethonium bromide (HMB) was used as electroosmotic flow modifier in borate buffer at pH 9.2 to decrease the electroosmotic flow (EOF) in order to enhance the speed of analysis and the resolution of nitrate and nitrite in high ionic strength HDW samples. The application of this capillary zone electrophoresis method, when compared with ion chromatography for two major components of HDW, nitrate and nitrite slightly reduced analysis time, eliminated most pre-analysis handling of the highly radioactive sample, and cut analysis wastes by more than 2 orders of magnitude. The analysis of real HDW samples that were validated by using sample spikes showed a concentration range of 1.03 to 1.42 M for both nitrate. The migration times of the real HDW and the spiked HDW samples were within a precision of less than 3% relative standard deviation. The selectivity ratio test used for peak confirmation of the spiked samples was within 96% of the real sample. Method reliability was tested by spiking the matrix with 72.4 mM nitrate and nitrite. Recoveries for these spiked samples were 93-103%

  17. A fully automated temperature-dependent resistance measurement setup using van der Pauw method

    Science.gov (United States)

    Pandey, Shivendra Kumar; Manivannan, Anbarasu

    2018-03-01

    The van der Pauw (VDP) method is widely used to identify the resistance of planar homogeneous samples with four contacts placed on its periphery. We have developed a fully automated thin film resistance measurement setup using the VDP method with the capability of precisely measuring a wide range of thin film resistances from few mΩ up to 10 GΩ under controlled temperatures from room-temperature up to 600 °C. The setup utilizes a robust, custom-designed switching network board (SNB) for measuring current-voltage characteristics automatically at four different source-measure configurations based on the VDP method. Moreover, SNB is connected with low noise shielded coaxial cables that reduce the effect of leakage current as well as the capacitance in the circuit thereby enhancing the accuracy of measurement. In order to enable precise and accurate resistance measurement of the sample, wide range of sourcing currents/voltages are pre-determined with the capability of auto-tuning for ˜12 orders of variation in the resistances. Furthermore, the setup has been calibrated with standard samples and also employed to investigate temperature dependent resistance (few Ω-10 GΩ) measurements for various chalcogenide based phase change thin films (Ge2Sb2Te5, Ag5In5Sb60Te30, and In3SbTe2). This setup would be highly helpful for measurement of temperature-dependent resistance of wide range of materials, i.e., metals, semiconductors, and insulators illuminating information about structural change upon temperature as reflected by change in resistances, which are useful for numerous applications.

  18. ArF photo resist pattern sample preparation method using FIB without protective coating

    Science.gov (United States)

    Okushima, Hirohisa; Onozuka, Toshihiko; Kuroda, Yasushi; Yaguchi, Toshie; Umemura, Kaoru; Tamochi, Ryuichiro; Watanabe, Kenji; Hasegawa, Norio; Kawata, Isao; Rijpers, Bart

    2006-03-01

    This paper presents a novel method of FIB (FIB: focused ion beam) sample preparation to accurately evaluate critical dimensions and profiles of ArF photo resist patterns without the use of a protective coating on the photo resist. In order to accomplish this, the FIB micro-sampling method that is one of effective FIB milling and fabrication method was employed. First a Si cap is picked up from a silicon wafer and fixed to ArF photo resist patterns to protect against ion beam irradiation. Then, a micro-sample, a piece of Si-capped ArF photo resist, was extracted from the bulk ArF photo resist. In this procedure, this silicon cap always protects ArF photo resist patterns against ion beam irradiation. For the next step, the micro-sample is fixed to a needle stub of the FIB-STEM (STEM: scanning transmission electron microscopy) compatible rotation holder. This sample on the needle stub was rotated 180 degrees and milled from the side of Si substrate. Lastly, the sample is milled to the thickness of 2μm. In this process, the ion beam is irradiating from the silicon substrate side to minimize the ion beam irradiation damages on the ArF photo resist patterns. EDX (EDX: Energy dispersive X-ray spectroscopy) analysis proved that no gallium ions were detected on the surface of the ArF photo resist patterns. The feasibility of high accelerating voltage observation of STEM to observe line edge roughness of a thick sample like 2μm without shrinkage has been demonstrated.

  19. Comparison of Resistant and Susceptible Strains of Trichomons vaginalis to Metronidazole Using PCR Method

    Directory of Open Access Journals (Sweden)

    M Fallah

    2012-09-01

    Full Text Available Background: Metronidazole is drug of choice recommended by WHO for treatment of trichomoniasis, however, some reports claims drug resistance in Trichomonas vaginalis isolates recently. The objective of this study was to determine the minimum lethal concentration (MLC of metronidazole in resistant and sensitive strains, as well as genetic patterns of these stains by PCR method. Methods: From February 2006 to March 2007, in a cross sectional study, clinical and wet mount examination of vaginal smear along with culture were performed on 683 women attending to public and private outpatient clinics in Hamadan. Trichomoniasis marked based on major clinical symptoms. Diagnosis confirmed using wet mount microscopically and culture in Diamond medium. A serial concentration of metronidazole was provided and all isolated Trichomonas strains (resistant and sensitive tested by standard method. Finally, all sensitive and resistant strains examined by PCR technique. Results: Only 15/683, (2.2% of patients clinically diagnosed trichomonal vaginitis were positive for T. vaginalis by wet smear and culture. The minimum lethal concentration (MLC for clinically sensitive isolates was 25 µg/ml; however, this concentration for resistant isolates was 200 µg/ml after 24 h and 100 µg/ml after 50 h. The results of PCR examination of DNA from sensitive and resistant isolates had same pattern. The lanes appeared by two primers were 98 bp and 261 bp for both clinically sensitive and resistant strains. Conclusion: Resistance to metronidazole in T. vaginalis has not relation to genetic variations and might be related to some physiologic pathways of organism.

  20. Oriented Polar Molecules in a Solid Inert-Gas Matrix: A Proposed Method for Measuring the Electric Dipole Moment of the Electron

    Directory of Open Access Journals (Sweden)

    A. C. Vutha

    2018-01-01

    Full Text Available We propose a very sensitive method for measuring the electric dipole moment of the electron using polar molecules embedded in a cryogenic solid matrix of inert-gas atoms. The polar molecules can be oriented in the z ^ -direction by an applied electric field, as has recently been demonstrated by Park et al. The trapped molecules are prepared into a state that has its electron spin perpendicular to z ^ , and a magnetic field along z ^ causes precession of this spin. An electron electric dipole moment d e would affect this precession due to the up to 100 GV/cm effective electric field produced by the polar molecule. The large number of polar molecules that can be embedded in a matrix, along with the expected long coherence times for the precession, allows for the possibility of measuring d e to an accuracy that surpasses current measurements by many orders of magnitude. Because the matrix can inhibit molecular rotations and lock the orientation of the polar molecules, it may not be necessary to have an electric field present during the precession. The proposed technique can be applied using a variety of polar molecules and inert gases, which, along with other experimental variables, should allow for careful study of systematic uncertainties in the measurement.

  1. Oriented Polar Molecules in a Solid Inert-Gas Matrix: A Proposed Method for Measuring the Electric Dipole Moment of the Electron

    Science.gov (United States)

    Vutha, A.; Horbatsch, M.; Hessels, E.

    2018-01-01

    We propose a very sensitive method for measuring the electric dipole moment of the electron using polar molecules embedded in a cryogenic solid matrix of inert-gas atoms. The polar molecules can be oriented in the $\\hat{\\rm{z}}$ direction by an applied electric field, as has recently been demonstrated by Park, et al. [Angewandte Chemie {\\bf 129}, 1066 (2017)]. The trapped molecules are prepared into a state which has its electron spin perpendicular to $\\hat{\\rm{z}}$, and a magnetic field along $\\hat{\\rm{z}}$ causes precession of this spin. An electron electric dipole moment $d_e$ would affect this precession due to the up to 100~GV/cm effective electric field produced by the polar molecule. The large number of polar molecules that can be embedded in a matrix, along with the expected long coherence times for the precession, allows for the possibility of measuring $d_e$ to an accuracy that surpasses current measurements by many orders of magnitude. Because the matrix can inhibit molecular rotations and lock the orientation of the polar molecules, it may not be necessary to have an electric field present during the precession. The proposed technique can be applied using a variety of polar molecules and inert gases, which, along with other experimental variables, should allow for careful study of systematic uncertainties in the measurement.

  2. Method for making low-resistivity contacts to high T/sub c/ superconductors

    International Nuclear Information System (INIS)

    Ekin, J.W.; Panson, A.J.; Blankenship, B.A.

    1988-01-01

    A method for making low-resistivity contacts to high T/sub c/ superconductors has been developed, which has achieved contact surface resistivities less than 10 μΩ cm 2 at 76 K and does not require sample heating above ∼150 0 C. This is an upper limit for the contact resistivity obtained at high current densities up to 10 2 --10 3 A/cm 2 across the contact interface. At lower measuring current densities the contact resistivities were lower and the voltage-current curve was nonlinear, having a superconducting transition character. On cooling from 295 to 76 K, the contact resistivity decreased several times, in contrast to indium solder contacts where the resistivity increased on cooling. The contacts showed consistently low resistivity and little degradation when exposed to dry air over a four-month period and when repeatedly cycled between room temperature and 76 K. The contacts are formed by sputter depositing a layer of a noble metal-silver and gold were used-on a clean superconductor surface to protect the surface and serve as a contact pad. External connections to the contact pads have been made using both solder and wire-bonding techniques

  3. A Novel Method of Modeling the Deformation Resistance for Clad Sheet

    International Nuclear Information System (INIS)

    Hu Jianliang; Yi Youping; Xie Mantang

    2011-01-01

    Because of the excellent thermal conductivity, the clad sheet (3003/4004/3003) of aluminum alloy is extensively used in various heat exchangers, such as radiator, motorcar air conditioning, evaporator, and so on. The deformation resistance model plays an important role in designing the process parameters of hot continuous rolling. However, the complex behaviors of the plastic deformation of the clad sheet make the modeling very difficult. In this work, a novel method for modeling the deformation resistance of clad sheet was proposed by combining the finite element analysis with experiments. The deformation resistance model of aluminum 3003 and 4004 was proposed through hot compression test on the Gleeble-1500 thermo-simulation machine. And the deformation resistance model of clad sheet was proposed through finite element analysis using DEFORM-2D software. The relationship between cladding ratio and the deformation resistance was discussed in detail. The results of hot compression simulation demonstrate that the cladding ratio has great effects on the resistance of the clad sheet. Taking the cladding ratio into consideration, the mathematical model of the deformation resistance for clad sheet has been proved to have perfect forecasting precision of different cladding ratio. Therefore, the presented model can be used to predict the rolling force of clad sheet during the hot continuous rolling process.

  4. Theodolite Polar measurements system and definition of the grid-lines method

    Directory of Open Access Journals (Sweden)

    Andréa de Seixas

    2004-12-01

    Full Text Available The requirements of construction quality, mainly in the car and airplane industries, accelerate the development of new 3D-Measurement Systems and Measurement Processes that make possible the automatic object recording and it’s post-processing on the basis, for example, on deformations. The geometrical reconstruction of objects or surface requires a minimal number of points, which abstracts and will be fulfill through interpolation its exact form and quality of the object in each case. The applications of the laser for the active signalization of a point object in combination with the directional measurement make possible in such way the determination of objects or surfaces, including also, places where the use of artificial targets is dangerous or impossible. This work describes the development of such measurement system based on two measurement robots or a reflector-free measuring tachymeter. The system is capable of reaching the intersections points of a grid-line that is defined in an appropriate coordinate system. The aim of this paper is to present the development of measurement methods that can reconstruct unknown three-dimensional and not signalized objects. The existing deformation-measurement, based on Pointer Theodolite and a Video Theodolite Measurement System and the other reflector-free Tachymeter Measurement System in context with the problematic analysis of deformation will be presented. The grid-lines Methods appear a solution and stand as new alternative for the geometrical reconstruction of the object surfaces. Its definition and preparations in a suitable coordinate system are discussed in detail.

  5. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  6. Germination test as a fast method to detect glyphosate-resistant sourgrass

    Directory of Open Access Journals (Sweden)

    Marcos Altomani Neves Dias

    2015-01-01

    Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

  7. Germination test as a fast method to detect glyphosate-resistant sourgrass

    Directory of Open Access Journals (Sweden)

    Marcos Altomani Neves Dias

    2015-09-01

    Full Text Available The occurrence of weed species with different levels of resistance to glyphosate has increasingly spread in agricultural areas. In Brazil, sourgrass is among the main species presenting issues in this regard. Thus, fast and reliable methods to detect glyphosate resistance are of special interest for this specie, either for research or rational management purposes. This study was carried out to verify the feasibility of using the germination test to detect glyphosate resistance in sourgrass. The experiment was conducted with two sourgrass biotypes, with different levels of susceptibility to glyphosate. The seeds were previously imbibed in solutions composed of 0, 0.1875%, 0.25%, 0.75%, 1.5%, 3% and 6% of glyphosate during two periods, five and ten minutes, and submitted to germination tests. The results indicate the germination test as a feasible and time-saving approach to evaluate glyphosate-resistant sourgrass, with results available in seven days.

  8. Application of two electrical methods for the rapid assessment of freezing resistance in Salix epichloro

    Energy Technology Data Exchange (ETDEWEB)

    Tsarouhas, V.; Kenney, W.A.; Zsuffa, L. [University of Toronto, Ontario (Canada). Faculty of Forestry

    2000-09-01

    The importance of early selection of frost-resistant Salix clones makes it desirable to select a rapid and accurate screening method for assessing freezing resistance among several genotypes. Two electrical methods, stem electrical impedance to 1 and 10 khz alternating current, and electrolyte leakage of leaf tissue, were evaluated for detecting freezing resistance on three North America Salix epichloro Michx., clones after subjecting them to five different freezing temperatures (-1, -2, -3, -4, and -5 deg C). Differences in the electrical impedance to 1 and 10 kHz, and the ratio of the impedance at the two frequencies (low/high) before and after the freezing treatment (DZ{sub low}, DZ{sub high}, and DZ{sub ratio}, respectively) were estimated. Electrolyte leakage was expressed as relative conductivity (RC{sub t}) and index of injury (IDX{sub t}). Results from the two methods, obtained two days after the freezing stress, showed that both electrical methods were able to detect freezing injury in S. eriocephala. However, the electrolyte leakage method detected injury in more levels of freezing stress (-3, -4, and -5 deg C) than the impedance (-4, and -5 deg C), it assessed clonal differences in S. eriocephala freezing resistance, and it was best suited to correlate electrical methods with the visual assessed freezing injury. No significant impedance or leakage changes were found after the -1 and -2 deg C freezing temperatures. (author)

  9. Study of true-remanent polarization using remanent hysteresis task and resistive leakage analysis in ferroelectric 0.64Pb(Mg1/3Nb2/3)O3-0.36PbTiO3 ceramics

    Science.gov (United States)

    Joseph, Abhilash J.; Kumar, Binay

    2018-03-01

    The conventionally reported value of remanent polarization (Pr) contains contribution from non-remanent components which are not usable for memory device applications. This report presents techniques which extract the true-remanent (intrinsic) component of polarization after eliminating the non-remanent component in ferroelectric ceramics. For this, "remanent hysteresis task" and "positive-up-negative-down technique" were performed which utilized the switchable properties of polarizations to nullify the contributions from the non-remanent (non-switchable) components. The report also addresses the time-dependent leakage behavior of the ceramics focusing on the presence of resistive leakage (a time-dependent parameter) present in the ceramics. The techniques presented here are especially useful for polycrystalline ceramics where leakage current leads to an erroneous estimation of Pr.

  10. The Analysis Of Accuracy Of Selected Methods Of Measuring The Thermal Resistance Of IGBTs

    Directory of Open Access Journals (Sweden)

    Górecki Krzysztof

    2015-09-01

    Full Text Available In the paper selected methods of measuring the thermal resistance of an IGBT (Insulated Gate Bipolar Transistor are presented and the accuracy of these methods is analysed. The analysis of the measurement error is performed and operating conditions of the considered device, at which each measurement method assures the least measuring error, are pointed out. Theoretical considerations are illustrated with some results of measurements and calculations.

  11. Comparative study of on-line response time measurement methods for platinum resistance thermometer

    International Nuclear Information System (INIS)

    Zwingelstein, G.; Gopal, R.

    1979-01-01

    This study deals with the in site determination of the response time of platinum resistance sensor. In the first part of this work, two methods furnishing the reference response time of the sensors are studied. In the second part of the work, two methods obtaining the response time without dismounting of the sensor, are studied. A comparative study of the performances of these methods is included for fluid velocities varying from 0 to 10 m/sec, in both laboratory and plant conditions

  12. Resistance Torque Based Variable Duty-Cycle Control Method for a Stage II Compressor

    Science.gov (United States)

    Zhong, Meipeng; Zheng, Shuiying

    2017-07-01

    The resistance torque of a piston stage II compressor generates strenuous fluctuations in a rotational period, and this can lead to negative influences on the working performance of the compressor. To restrain the strenuous fluctuations in the piston stage II compressor, a variable duty-cycle control method based on the resistance torque is proposed. A dynamic model of a stage II compressor is set up, and the resistance torque and other characteristic parameters are acquired as the control targets. Then, a variable duty-cycle control method is applied to track the resistance torque, thereby improving the working performance of the compressor. Simulated results show that the compressor, driven by the proposed method, requires lower current, while the rotating speed and the output torque remain comparable to the traditional variable-frequency control methods. A variable duty-cycle control system is developed, and the experimental results prove that the proposed method can help reduce the specific power, input power, and working noise of the compressor to 0.97 kW·m-3·min-1, 0.09 kW and 3.10 dB, respectively, under the same conditions of discharge pressure of 2.00 MPa and a discharge volume of 0.095 m3/min. The proposed variable duty-cycle control method tracks the resistance torque dynamically, and improves the working performance of a Stage II Compressor. The proposed variable duty-cycle control method can be applied to other compressors, and can provide theoretical guidance for the compressor.

  13. TECHNICAL EVALUATION OF ELECTRICAL RESISTIVITY METHODS AT THE DEPARTMENT OF ENERGY HANFORD SITE

    International Nuclear Information System (INIS)

    PETERSEN SW

    2008-01-01

    There is a continuing need for cost-effective subsurface characterization within the vadose zone and groundwater at the U.S. Department of Energy (DOE) Hanford Site, Richland, Washington. With more than 1600 liquid and solid waste sites and 200 burial sites, contaminants have migrated to and through the vadose zone. In addition, future groundwater plumes may be generated from contaminants presently in the vadose zone. Relatively low-cost geophysical techniques can provide spatially extensive data that may provide information about the presence and extent of some contaminants. Recent electrical resistivity surveys at Hanford have provided encouraging results for mapping of some contaminants, such as nitrate, in the vadose zone. Because mobile radionuclides and trace elements may have been transported with nitrate through the vadose zone, the method may be used to map some mobile contaminants of concern, such as technetium-99 (99Tc). Validation of these recent electrical resistivity survey results remains to be completed. Electrical resistivity surveys have been conducted at various waste sites in the 200 Area of the Hanford Site: BC Cribs and Trenches (BCCT), T, S, U, C, B Tank Farms and the Purex Plant. Surveys have been completed using surface and well-to-well (WTW) array configurations. The goals of the surveys, as described by Fluor Hanford and CH2MHill Hanford staff, were to test the applicability of resistivity methods in identifying the presence of and mapping approximate extent of contaminant plumes within the vadose zone. The overall goal of the project was to evaluate the utility of electrical resistivity methods for characterizing contaminants of potential concern in the vadose zone in the 200 Area of the Hanford Site. The panel was asked to perform the following activities: (1) Evaluate recently completed and ongoing electrical resistivity projects at Hanford in terms of methodology used, results obtained, and lessons learned, with specific focus on (a

  14. A simple identification method for spore-forming bacteria showing high resistance against γ-rays

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko; Sone, Koji; Kobayashi, Toshikazu

    1993-01-01

    A simple identification method was developed for spore-forming bacteria which are highly resistant against γ-rays. Among 23 species of Bacillus studied, the spores of Bacillus megaterium, B. cereus, B. thuringiensis, B. pumilus and B. aneurinolyticus showed high resistance against γ-rays as compared with other spores of Bacillus species. Combination of the seven kinds of biochemical tests, namely, the citrate utilization test, nitrate reduction test, starch hydrolysis test, Voges-Proskauer reaction test, gelatine hydrolysis test, mannitol utilization test and xylose utilization test showed a characteristic pattern for each species of Bacillus. The combination pattern of each the above tests with a few supplementary test, if necessary, was useful to identify Bacillus species showing high radiation resistance against γ-rays. The method is specific for B. megaterium, B. thuringiensis and B. pumilus, and highly selective for B. aneurinolyticus and B. cereus. (author)

  15. A Method for testing the integrated thermal resistance of thermoelectric modules

    Science.gov (United States)

    Gao, Junling; Du, Qungui; Chen, Min

    2013-11-01

    The integrated thermal resistance (ITR) of thermoelectric modules (TEMs) is an important parameter that represents the thermal-conduction of ceramic substrates, copper conducting strips, and welding material used in the TEM as well as the thermal contact resistances between different materials. In this study, an accurate and practical test method is proposed for the ITR of TEMs according to thermoelectric heat transfer theory and the equivalent characteristics of heat flux through the cold and hot sides of TEMs in an open-circuit situation. By using such measurements and comparisons, it is verified that the measured ITR value in our mode is accurate and reliable. In particular this method accurately predicts the actual operating conditions of TEMs, in which TEMs are under certain mechanical pressure. It effectively solves the problem of thermal resistance extraction from operating TEMs and is of great significance in their analysis and optimization.

  16. Parallelized Three-Dimensional Resistivity Inversion Using Finite Elements And Adjoint State Methods

    Science.gov (United States)

    Schaa, Ralf; Gross, Lutz; Du Plessis, Jaco

    2015-04-01

    The resistivity method is one of the oldest geophysical exploration methods, which employs one pair of electrodes to inject current into the ground and one or more pairs of electrodes to measure the electrical potential difference. The potential difference is a non-linear function of the subsurface resistivity distribution described by an elliptic partial differential equation (PDE) of the Poisson type. Inversion of measured potentials solves for the subsurface resistivity represented by PDE coefficients. With increasing advances in multichannel resistivity acquisition systems (systems with more than 60 channels and full waveform recording are now emerging), inversion software require efficient storage and solver algorithms. We developed the finite element solver Escript, which provides a user-friendly programming environment in Python to solve large-scale PDE-based problems (see https://launchpad.net/escript-finley). Using finite elements, highly irregular shaped geology and topography can readily be taken into account. For the 3D resistivity problem, we have implemented the secondary potential approach, where the PDE is decomposed into a primary potential caused by the source current and the secondary potential caused by changes in subsurface resistivity. The primary potential is calculated analytically, and the boundary value problem for the secondary potential is solved using nodal finite elements. This approach removes the singularity caused by the source currents and provides more accurate 3D resistivity models. To solve the inversion problem we apply a 'first optimize then discretize' approach using the quasi-Newton scheme in form of the limited-memory Broyden-Fletcher-Goldfarb-Shanno (L-BFGS) method (see Gross & Kemp 2013). The evaluation of the cost function requires the solution of the secondary potential PDE for each source current and the solution of the corresponding adjoint-state PDE for the cost function gradients with respect to the subsurface

  17. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  18. An on-line normal-phase high performance liquid chromatography method for the rapid detection of radical scavengers in non-polar food matrixes

    NARCIS (Netherlands)

    Zhang, Q.; Klift, van der E.J.C.; Janssen, H.G.; Beek, van T.A.

    2009-01-01

    An on-line method for the rapid pinpointing of radical scavengers in non-polar mixtures like vegetable oils was developed. To avoid problems with dissolving the sample, normal-phase chromatography on bare silica gel was used with mixtures of hexane and methyl tert-butyl ether as the eluent. The high

  19. Chiroptical methods in a wide wavelength range for obtaining Ln3+ complexes with circularly polarized luminescence of practical interest.

    Science.gov (United States)

    Górecki, Marcin; Carpita, Luca; Arrico, Lorenzo; Zinna, Francesco; Di Bari, Lorenzo

    2018-05-29

    We studied enantiopure chiral trivalent lanthanide (Ln3+ = La3+, Sm3+, Eu3+, Gd3+, Tm3+, and Yb3+) complexes with two fluorinated achiral tris(β-diketonate) ligands (HFA = hexafluoroacetylacetonate and TTA = 2-thenoyltrifluoroacetonate), incorporating a chiral bis(oxazolinyl)pyridine (PyBox) unit as a neutral ancillary ligand, by the combined use of optical and chiroptical methods, ranging from UV to IR both in absorption and circular dichroism (CD), and including circularly polarized luminescence (CPL). Ultimately, all the spectroscopic information is integrated into a total and a chiroptical super-spectrum, which allows one to characterize a multidimensional chemical space, spanned by the different Ln3+ ions, the acidity and steric demand of the diketone and the chirality of the PyBox ligand. In all cases, the Ln3+ ions endow the systems with peculiar chiroptical properties, either allied to f-f transitions or induced by the metal onto the ligand. In more detail, we found that Sm3+ complexes display interesting CPL features, which partly superimpose and partly integrate the more common Eu3+ properties. Especially, in the context of security tags, the pair Sm/Eu may be a winning choice for chiroptical barcoding.

  20. Development of Efficient Screening Methods for Resistant Cucumber Plants to Meloidogyne incognita

    Directory of Open Access Journals (Sweden)

    Sung Min Hwang

    2014-06-01

    Full Text Available Root-knot nematodes represent a significant problem in cucumber, causing reduction in yield and quality. To develop screening methods for resistance of cucumber to root-knot nematode Meloidogyne incognita, development of root-knot nematode of four cucumber cultivars (‘Dragonsamchuk’, ‘Asiastrike’, ‘Nebakja’ and ‘Hanelbakdadaki’ according to several conditions such as inoculum concentration, plant growth stage and transplanting period was investigated by the number of galls and egg masses produced in each seedling 45 days after inoculation. There was no difference in galls and egg masses according to the tested condition except for inoculum concentration. Reproduction of the nematode on all the tested cultivars according to inoculum concentration increased in a dose-dependent manner. On the basis of the result, the optimum conditions for root-knot development on the cultivars is to transplant period of 1 week, inoculum concentration of 5,000 eggs/plant and plant growth stage of 3-week-old in a greenhouse (25 ± 5°C. In addition, under optimum conditions, resistance of 45 commercial cucumber cultivars was evaluated. One rootstock cultivar, Union was moderately resistant to the root-knot nematode. However, no significant difference was in the resistance of the others cultivar. According to the result, we suggest an efficient screening method for new resistant cucumber to the root-knot nematode, M. incognita.

  1. METHODS FOR INOCULATION WITH Fusarium guttiforme AND GENETIC RESISTANCE OF PINEAPPLE ( Ananas comosus var. comosus

    Directory of Open Access Journals (Sweden)

    WANDREILLA MOREIRA GARCIA

    2017-01-01

    Full Text Available The objective of this work was to evaluate Fusarium guttiforme inoculation methods and genetic resistance of pineapple accessions. Thus, three experiments were conducted: pathogen inoculation of different leaf types ( B, D and F of pineapple (1, pathogen inoculation of pineapple cuttings and detached D leaves (2, and identification of resistance to fusariosis in 19 pineapple accessions (3 sampled in the State of Mato Grosso, Brazil. The cultivars Pérola (susceptible to fusariosis and BRS - Vitória (resistant to fusariosis were used as controls. The fusariosis severity was evaluated at 10, 15, 20, 25 and 30 days after inoculation with F. guttiforme . The lesion diameters (severity level were used in order to calculate the area under the disease progress curve (AUDPC. The inoculation of detached D leaves was the most efficient, fast and inexpensive method, and the one that most satisfactorily reproduced the disease symptoms. The period of 10 to 20 days after inoculation of the D detached leaves with the pathogen is the most suitable to evaluate the resistance of pineapple accessions to fusariosis. The lowest lesion area and AUDPC was found in the accession 1, in all evaluations. Thus, the accession 1 can be used in pineapple breeding programs for resistance to fusariosis.

  2. A NEW METHOD FOR CHARACTERIZING THE KNOCK RESISTANCE OF LNG FUELS USED IN THE TRANSPORTATION MARKET

    NARCIS (Netherlands)

    Levinsky, Howard; Gersen, Sander; van Essen, Martijn; van Dijk, Gerco

    2014-01-01

    To ensure that the engines to be used in LNG-fueled vehicles are matched with the expected variations in fuel composition, the knock resistance of the fuel must be determined unambiguously. Rather than rely on empirical methods using gas mixtures and “standard” engines traditionally employed for

  3. Alkaline resistant phosphate glasses and method of preparation and use thereof

    Science.gov (United States)

    Brow, Richard K.; Reis, Signo T.; Velez, Mariano; Day, Delbert E.

    2010-01-26

    A substantially alkaline resistant calcium-iron-phosphate (CFP) glass and methods of making and using thereof. In one application, the CFP glass is drawn into a fiber and dispersed in cement to produce glass fiber reinforced concrete (GFRC) articles having the high compressive strength of concrete with the high impact, flexural and tensile strength associated with glass fibers.

  4. Ringtest to evaluate four methods of resistance testing in fodder radish against Meloidogyne chitwoodi

    NARCIS (Netherlands)

    Visser, J.H.M.; Berg, van den W.; Korthals, G.W.

    2009-01-01

    To measure levels of resistance in fodder radish cultivars a reliable, objective and cost effective testing method is required. In 2006 German and Dutch plant breeder’s organizations (Bundesverband Deutscher Pflanzenzüchter; BDP and Plantum), a number of research institutes (PRI, PPO (WUR) and JKI)

  5. Measurement of the resistivity of porous materials with an alternating air-flow method.

    Science.gov (United States)

    Dragonetti, Raffaele; Ianniello, Carmine; Romano, Rosario A

    2011-02-01

    Air-flow resistivity is a main parameter governing the acoustic behavior of porous materials for sound absorption. The international standard ISO 9053 specifies two different methods to measure the air-flow resistivity, namely a steady-state air-flow method and an alternating air-flow method. The latter is realized by the measurement of the sound pressure at 2 Hz in a small rigid volume closed partially by the test sample. This cavity is excited with a known volume-velocity sound source implemented often with a motor-driven piston oscillating with prescribed area and displacement magnitude. Measurements at 2 Hz require special instrumentation and care. The authors suggest an alternating air-flow method based on the ratio of sound pressures measured at frequencies higher than 2 Hz inside two cavities coupled through a conventional loudspeaker. The basic method showed that the imaginary part of the sound pressure ratio is useful for the evaluation of the air-flow resistance. Criteria are discussed about the choice of a frequency range suitable to perform simplified calculations with respect to the basic method. These criteria depend on the sample thickness, its nonacoustic parameters, and the measurement apparatus as well. The proposed measurement method was tested successfully with various types of acoustic materials.

  6. Source of spin polarized electrons

    International Nuclear Information System (INIS)

    Pierce, D.T.; Meier, F.A.; Siegmann, H.C.

    1976-01-01

    A method is described of producing intense beams of polarized free electrons in which a semiconductor with a spin orbit split valence band and negative electron affinity is used as a photocathode and irradiated with circularly polarized light

  7. The application of DCPD method to evaluating dynamic J-R fracture resistance characteristics

    International Nuclear Information System (INIS)

    Yoon, Ji Hyun; Hong, Jun Hwa; Lee, Bong Sang; Chi, Se Whan; Kim, Joo Hag; Oh, Yong Jun; Kwun, Sun Chil; Oh, Jong Myung

    1999-06-01

    The reliable DCPD (Direct Current Potential Drop) test and data acquisition system were developed on the basis of analysis of various technical problems to accompanied with the application of DCPD method to J-R fracture resistance test. The test system contains electric insulation rod and high performance data acquisition system. The test and analysis method was applied to J-R fracture resistance test for SA516-Gr.70 steel for nuclear primary coolant system elbow. The reliabilities of test and analysis method were confirmed through the load-ratio method in case of dynamic loading test, and through the standard unloading compliance test in case of static loading test. (author). 17 refs., 1 tab., 18 figs

  8. The application of DCPD method to evaluating dynamic J-R fracture resistance characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Ji Hyun; Hong, Jun Hwa; Lee, Bong Sang; Chi, Se Whan; Kim, Joo Hag; Oh, Yong Jun; Kwun, Sun Chil; Oh, Jong Myung

    1999-06-01

    The reliable DCPD (Direct Current Potential Drop) test and data acquisition system were developed on the basis of analysis of various technical problems to accompanied with the application of DCPD method to J-R fracture resistance test. The test system contains electric insulation rod and high performance data acquisition system. The test and analysis method was applied to J-R fracture resistance test for SA516-Gr.70 steel for nuclear primary coolant system elbow. The reliabilities of test and analysis method were confirmed through the load-ratio method in case of dynamic loading test,and through the standard unloading compliance test in case of static loading test. (author). 17 refs., 1 tab., 18 figs.

  9. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...

  10. Components made of corrosion-resistent zirconium alloy and method for its production

    International Nuclear Information System (INIS)

    Hanneman, R.E.; Urquhart, A.W.; Vermilyea, D.A.

    1977-01-01

    The invention deals with a method to increase the resistance of zirconium alloys to blister corrosion which mainly occurs in boiling-water nuclear reactors. According to the method described, the surface of the alloy body is coated with a thin film of a suitable electronically conducting material. Gold, silver, platinum, nickel, chromium, iron and niobium are suitable as coating materials. The invention is more closely explained by means of examples. (GSC) [de

  11. Testing the plant pneumatic method to estimate xylem embolism resistance in stems of temperate trees

    OpenAIRE

    Zhang, Ya; Lamarque, Laurent J.; Torres-Ruiz, José Manuel; Schuldt, Bernhard; Karimi, Zohreh; Li, Shan; Qin, De-Wen; Bittencourt, Paulo; Burlett, Régis; Cao, Kun-Fang; Delzon, Sylvain; Oliveira, Rafael; Pereira, Luciano; Jansen, Steven

    2018-01-01

    Methods to estimate xylem embolism resistance generally rely on hydraulic measurements, which can be far from straightforward. Recently, a pneumatic method based on air flow measurements of terminal branch ends was proposed to construct vulnerability curves by linking the amount of air extracted from a branch with the degree of embolism. We applied this novel technique for 10 temperate tree species, including six diffuse, two ring-porous and two gymnosperm species, and compared the pneumatic ...

  12. A new method for calculating gas saturation of low-resistivity shale gas reservoirs

    Directory of Open Access Journals (Sweden)

    Jinyan Zhang

    2017-09-01

    Full Text Available The Jiaoshiba shale gas field is located in the Fuling area of the Sichuan Basin, with the Upper Ordovician Wufeng–Lower Silurian Longmaxi Fm as the pay zone. At the bottom of the pay zone, a high-quality shale gas reservoir about 20 m thick is generally developed with high organic contents and gas abundance, but its resistivity is relatively low. Accordingly, the gas saturation calculated by formulas (e.g. Archie using electric logging data is often much lower than the experiment-derived value. In this paper, a new method was presented for calculating gas saturation more accurately based on non-electric logging data. Firstly, the causes for the low resistivity of shale gas reservoirs in this area were analyzed. Then, the limitation of traditional methods for calculating gas saturation based on electric logging data was diagnosed, and the feasibility of the neutron–density porosity overlay method was illustrated. According to the response characteristics of neutron, density and other porosity logging in shale gas reservoirs, a model for calculating gas saturation of shale gas was established by core experimental calibration based on the density logging value, the density porosity and the difference between density porosity and neutron porosity, by means of multiple methods (e.g. the dual-porosity overlay method by optimizing the best overlay coefficient. This new method avoids the effect of low resistivity, and thus can provide normal calculated gas saturation of high-quality shale gas reservoirs. It works well in practical application. This new method provides a technical support for the calculation of shale gas reserves in this area. Keywords: Shale gas, Gas saturation, Low resistivity, Non-electric logging, Volume density, Compensated neutron, Overlay method, Reserves calculation, Sichuan Basin, Jiaoshiba shale gas field

  13. Resistivity behavior of optimized PbTiO3 thin films prepared by spin coating method

    Science.gov (United States)

    Nurbaya, Z.; Wahid, M. H.; Rozana, M. D.; Alrokayan, S. A. H.; Khan, H. A.; Rusop, M.

    2018-05-01

    Th is study presents the resistivity behavior of PbTiO3 thin films which were prepared towards metal-insulator-metal capacitor device fabrication. The PbTiO3 thin films were prepared through sol-gel spin coating method that involved various deposition parameters that is (1) different molar concentration of PbTiO3 solutions, (2) various additional PbAc-content in PbTiO3 solutions, and (3) various annealing temperature on PbTiO3 thin films. Hence, an electrical measurement of current versus voltage was done to determine the resistivity behavior of PbTiO3 thin films.

  14. Study of Thermal Fatigue Resistance of a Composite Coating Made by a Vacuum Fusion Sintering Method

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Thermal fatigue behavior of a Ni-base alloy chromium carbide composite coating made by a vacuum fusion sintering method are discussed. Results show that thermal fatigue behavior is associated with cyclic upper temperature and coating thickness. As the thickness of the coating decreases, the thermal fatigue resistance increases. The thermal fatigue resistance cuts down with the thermal cyclic upper temperature rising. The crack growth rate decreases with the increase in cyclic number until crack arrests. Thermal fatigue failure was not found along the interface of the coating/matrix. The tract of thermal fatigue crack cracks along the interfaces of phases.

  15. About the use of spatial interpolation methods to denoising Moroccan resistivity data phosphate “disturbances” map

    Directory of Open Access Journals (Sweden)

    Mahacine Amrani

    2008-06-01

    Full Text Available Several methods are currently used to optimize edges and contours of geophysical data maps. A resistivity map was expectedto allow the electrical resistivity signal to be imaged in 2D in Moroccan resistivity survey in the phosphate mining domain. Anomalouszones of phosphate deposit “disturbances” correspond to resistivity anomalies. The resistivity measurements were taken at 5151discrete locations. Much of the geophysical spatial analysis requires a continuous data set and this study is designed to create that surface. This paper identifies the best spatial interpolation method to use for the creation of continuous data for Moroccan resistivity data of phosphate “disturbances” zones. The effectiveness of our approach for successfully reducing noise has been used much successin the analysis of stationary geophysical data as resistivity data. The interpolation filtering approach methods applied to modelingsurface phosphate “disturbances” was found to be consistently useful.

  16. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same...

  17. Impact of Air Entraining Method on the Resistance of Concrete to Internal Cracking

    Science.gov (United States)

    Wawrzeńczyk, Jerzy; Molendowska, Agnieszka

    2017-10-01

    This paper presents the test results of air entrained concrete mixtures made at a constant W/C ratio of 0.44. Three different air entraining agents were used: polymer microspheres, glass microspheres and a conventional air entraining admixture. The aim of this study was to compare the effectiveness of the air entraining methods. Concrete mixture tests were performed for consistency (slump test), density and, in the case of AEA series, air content by pressure method. Hardened concrete tests were performed for compressive strength, water absorption, resistance to chloride ingress, and freeze-thaw durability - resistance to internal cracking tests were conducted in accordance with PN-88/B-06250 on cube specimens and with the modified ASTM C666 A test method on beam specimens; porosity characteristics (A, A300, \\bar L) were determined to PN-EN 480-11:1998. No significant mass and length changes were recorded for the concrete air entrained with the conventional methods or with polymer microspheres. The results indicate that polymer microspheres are a very good alternative to traditional air entraining methods for concrete, providing effective air entrainment and protection from freezing and thawing. The glass microsphere-based concretes showed insufficient freeze-thaw resistance. The test results indicate that both the conventional methods (AEA) and the air entrainment by polymer microspheres are effective air entraining methods. It has to be noted that in the case of the use of polymer microspheres, a comparable value of \\bar L and a very good freeze-thaw resistance can be achieved at a noticeably lower air and micropore contents and at lower strength loss.

  18. A simple phenotypic method for screening of MCR-1-mediated colistin resistance.

    Science.gov (United States)

    Coppi, M; Cannatelli, A; Antonelli, A; Baccani, I; Di Pilato, V; Sennati, S; Giani, T; Rossolini, G M

    2018-02-01

    To evaluate a novel method, the colistin-MAC test, for phenotypic screening of acquired colistin resistance mediated by transferable mcr-1 resistance determinants, based on colistin MIC reduction in the presence of dipicolinic acid (DPA). The colistin-MAC test consists in a broth microdilution method, in which colistin MIC is tested in the absence or presence of DPA (900 μg/mL). Overall, 74 colistin-resistant strains of Enterobacteriaceae (65 Escherichia coli and nine other species), including 61 strains carrying mcr-1-like genes and 13 strains negative for mcr genes, were evaluated with the colistin-MAC test. The presence of mcr-1-like and mcr-2-like genes was assessed by real-time PCR and end-point PCR. For 20 strains, whole-genome sequencing data were also available. A ≥8-fold reduction of colistin MIC in the presence of DPA was observed with 59 mcr-1-positive strains, including 53 E. coli of clinical origin, three E. coli transconjugants carrying MCR-1-encoding plasmids, one Enterobacter cloacae complex and two Citrobacter spp. Colistin MICs were unchanged, increased or at most reduced by twofold with the 13 mcr-negative colistin-resistant strains (nine E. coli and four Klebsiella pneumoniae), but also with two mcr-1-like-positive K. pneumoniae strains. The colistin-MAC test could be a simple phenotypic test for presumptive identification of mcr-1-positive strains among isolates of colistin-resistant E. coli, based on a ≥8-fold reduction of colistin MIC in the presence of DPA. Evaluation of the test with a larger number of strains, species and mcr-type resistance determinants would be of interest. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  19. Standard test method for determination of resistance to stable crack extension under low-constraint conditions

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2006-01-01

    1.1 This standard covers the determination of the resistance to stable crack extension in metallic materials in terms of the critical crack-tip-opening angle (CTOAc), ψc and/or the crack-opening displacement (COD), δ5 resistance curve (1). This method applies specifically to fatigue pre-cracked specimens that exhibit low constraint (crack-length-to-thickness and un-cracked ligament-to-thickness ratios greater than or equal to 4) and that are tested under slowly increasing remote applied displacement. The recommended specimens are the compact-tension, C(T), and middle-crack-tension, M(T), specimens. The fracture resistance determined in accordance with this standard is measured as ψc (critical CTOA value) and/or δ5 (critical COD resistance curve) as a function of crack extension. Both fracture resistance parameters are characterized using either a single-specimen or multiple-specimen procedures. These fracture quantities are determined under the opening mode (Mode I) of loading. Influences of environment a...

  20. The Method of Measured Electrical Resistivity in Studying Phase Transformations in Zr1Nb Alloy

    International Nuclear Information System (INIS)

    Gritsina, V.M.; Klimenko, S.P.; Chernyaeva, T.P.

    2006-01-01

    The paper systematically arranges and analyzes the data on the methods of research into α ↔ β transformation process in zirconium alloys, as well as capabilities and information provided by each method. A special emphasis is put on the method of measured electrical resistivity. The authors also present the results of their own research into α ↔ β transformation process in Zr1Nb alloy (in the material of Zr+1% Nb tubing produced in Ukraine from calciothermal zirconium). The ρ →T curve was used to define the maximum and minimum values for transformation temperatures. Combined processing of the phase data on Zr+1% Nb found in literature and obtained from measured resistivity suggests that transformation process happens in several stages. The maximum value on the ρ → T curve corresponds to the beginning of stage 3, whereas the minimum - to its completion; as suggested by the pooled data, accounts for over 95% of the total volume of the material

  1. A Novel Crosstalk Suppression Method of the 2-D Networked Resistive Sensor Array

    Directory of Open Access Journals (Sweden)

    Jianfeng Wu

    2014-07-01

    Full Text Available The 2-D resistive sensor array in the row–column fashion suffered from the crosstalk problem for parasitic parallel paths. Firstly, we proposed an Improved Isolated Drive Feedback Circuit with Compensation (IIDFCC based on the voltage feedback method to suppress the crosstalk. In this method, a compensated resistor was specially used to reduce the crosstalk caused by the column multiplexer resistors and the adjacent row elements. Then, a mathematical equivalent resistance expression of the element being tested (EBT of this circuit was analytically derived and verified by the circuit simulations. The simulation results show that the measurement method can greatly reduce the influence on the EBT caused by parasitic parallel paths for the multiplexers’ channel resistor and the adjacent elements.

  2. Three-dimensional forward modeling of DC resistivity using the aggregation-based algebraic multigrid method

    Science.gov (United States)

    Chen, Hui; Deng, Ju-Zhi; Yin, Min; Yin, Chang-Chun; Tang, Wen-Wu

    2017-03-01

    To speed up three-dimensional (3D) DC resistivity modeling, we present a new multigrid method, the aggregation-based algebraic multigrid method (AGMG). We first discretize the differential equation of the secondary potential field with mixed boundary conditions by using a seven-point finite-difference method to obtain a large sparse system of linear equations. Then, we introduce the theory behind the pairwise aggregation algorithms for AGMG and use the conjugate-gradient method with the V-cycle AGMG preconditioner (AGMG-CG) to solve the linear equations. We use typical geoelectrical models to test the proposed AGMG-CG method and compare the results with analytical solutions and the 3DDCXH algorithm for 3D DC modeling (3DDCXH). In addition, we apply the AGMG-CG method to different grid sizes and geoelectrical models and compare it to different iterative methods, such as ILU-BICGSTAB, ILU-GCR, and SSOR-CG. The AGMG-CG method yields nearly linearly decreasing errors, whereas the number of iterations increases slowly with increasing grid size. The AGMG-CG method is precise and converges fast, and thus can improve the computational efficiency in forward modeling of three-dimensional DC resistivity.

  3. Comparison of Molecular and Phenotypic Methods for the Detection and Characterization of Carbapenem Resistant Enterobacteriaceae.

    Science.gov (United States)

    Somily, Ali M; Garaween, Ghada A; Abukhalid, Norah; Absar, Muhammad M; Senok, Abiola C

    2016-03-01

    In recent years, there has been a rapid dissemination of carbapenem resistant Enterobacteriaceae (CRE). This study aimed to compare phenotypic and molecular methods for detection and characterization of CRE isolates at a large tertiary care hospital in Saudi Arabia. This study was carried out between January 2011 and November 2013 at the King Khalid University Hospital (KKUH) in Saudi Arabia. Determination of presence of extended-spectrum beta-lactamases (ESBL) and carbapenem resistance was in accordance with Clinical and Laboratory Standards Institute (CLSI) guidelines. Phenotypic classification was done by the MASTDISCS(TM) ID inhibitor combination disk method. Genotypic characterization of ESBL and carbapenemase genes was performed by the Check-MDR CT102. Diversilab rep-PCR was used for the determination of clonal relationship. Of the 883 ESBL-positive Enterobacteriaceae detected during the study period, 14 (1.6%) isolates were carbapenem resistant. Both the molecular genotypic characterization and phenotypic testing were in agreement in the detection of all 8 metalo-beta-lactamases (MBL) producing isolates. Of these 8 MBL-producers, 5 were positive for blaNDM gene and 3 were positive for blaVIM gene. Molecular method identified additional blaOXA gene isolates while MASTDISCS(TM) ID detected one AmpC producer isolate. Both methods agreed in identifying 2 carbapenem resistant isolates which were negative for carbapenemase genes. Diversilab rep-PCR analysis of the 9 Klebsiella pneumoniae isolates revealed polyclonal distribution into eight clusters. MASTDISCS(TM) ID is a reliable simple cheap phenotypic method for detection of majority of carbapenemase genes with the exception of the blaOXA gene. We recommend to use such method in the clinical laboratory.

  4. Polarized BRDF measurement of steel E235B in the near-infrared region: Based on a self-designed instrument with absolute measuring method

    Science.gov (United States)

    Liu, Yanlei; Yu, Kun; Liu, Zilong; Zhao, Yuejin; Liu, Yufang

    2018-06-01

    The spectral bidirectional reflectance distribution (BRDF) offers a complete description of the optical properties of the opaque material. Numerous studies on BRDF have been conducted for its important role in scientific research and industrial production. However, most of these studies focus on the visible region and unpolarized BRDF, and the spectral polarized BRDF in the near-infrared region is rarely reported. In this letter, we propose an absolute method to measure the spectral BRDF in the near-infrared region, and the detailed derivation is presented. A self-designed instrument is set up for the absolute measurement of BRDF. The reliability of this method is verified by comparing the experimental data of the three metal (aluminum, silver and gold) mirrors with the reference data. The in-plane polarized BRDF of steel E235B are measured, and the influence of incident angle and roughness on the BRDF are discussed. The degree of linear polarization (DOLP) are determined based on the polarized BRDF. The results indicate that both the roughness and incident angle have distinct influence on the BRDF and DOLP.

  5. Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

    Science.gov (United States)

    Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

    2016-07-07

    To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and

  6. A rapid and sensitive method for the simultaneous analysis of aliphatic and polar molecules containing free carboxyl groups in plant extracts by LC-MS/MS

    Directory of Open Access Journals (Sweden)

    Bonaventure Gustavo

    2009-11-01

    Full Text Available Abstract Background Aliphatic molecules containing free carboxyl groups are important intermediates in many metabolic and signalling reactions, however, they accumulate to low levels in tissues and are not efficiently ionized by electrospray ionization (ESI compared to more polar substances. Quantification of aliphatic molecules becomes therefore difficult when small amounts of tissue are available for analysis. Traditional methods for analysis of these molecules require purification or enrichment steps, which are onerous when multiple samples need to be analyzed. In contrast to aliphatic molecules, more polar substances containing free carboxyl groups such as some phytohormones are efficiently ionized by ESI and suitable for analysis by LC-MS/MS. Thus, the development of a method with which aliphatic and polar molecules -which their unmodified forms differ dramatically in their efficiencies of ionization by ESI- can be simultaneously detected with similar sensitivities would substantially simplify the analysis of complex biological matrices. Results A simple, rapid, specific and sensitive method for the simultaneous detection and quantification of free aliphatic molecules (e.g., free fatty acids (FFA and small polar molecules (e.g., jasmonic acid (JA, salicylic acid (SA containing free carboxyl groups by direct derivatization of leaf extracts with Picolinyl reagent followed by LC-MS/MS analysis is presented. The presence of the N atom in the esterified pyridine moiety allowed the efficient ionization of 25 compounds tested irrespective of their chemical structure. The method was validated by comparing the results obtained after analysis of Nicotiana attenuata leaf material with previously described analytical methods. Conclusion The method presented was used to detect 16 compounds in leaf extracts of N. attenuata plants. Importantly, the method can be adapted based on the specific analytes of interest with the only consideration that the

  7. Simple and efficient method of spin-polarizing a metastable helium beam by diode laser optical pumping

    International Nuclear Information System (INIS)

    Granitza, B.; Salvietti, M.; Torello, E.; Mattera, L.; Sasso, A.

    1995-01-01

    Diode laser optical pumping to produce a highly spin-polarized metastable He beam to be used in a spin-polarized metastable atom deexcitation spectroscopy experiment on magnetized surfaces is described. Efficient pumping of the beam is performed by means of an SDL-6702 distributed Bragg reflector diode laser which yields 50 mW of output power in a single longitudinal mode at 1083 nm, the resonance wavelength for the 2 3 S→2 3 P 0,1,2 (D 0 , D 1 , and D 2 ) transitions of He*. The light is circularly polarized by a quarter-wave plate, allowing easy change of the sense of atomic polarization. The laser frequency can be locked to the atomic transition for several hours by phase-sensitive detection of the saturated absorption signal in a He discharge cell. Any of the three transitions of the triplet system can be pumped with the laser but the maximum level of atomic polarization of 98.5% is found pumping the D 2 line. copyright 1995 American Institute of Physics

  8. Mechanisms of methicillin resistance in Staphylococcus aureus and methods for laboratory detection.

    Science.gov (United States)

    Jorgensen, J H

    1991-01-01

    Three distinctly different mechanisms of methicillin resistance have been described in Staphylococcus aureus. The best-documented and probably most important mechanism is production of a unique, low affinity penicillin-binding protein, PBP 2a. Strains possessing PBP 2a are resistant to methicillin, oxacillin, and probably all other currently available beta-lactam antibiotics. Two additional mechanisms of reduced susceptibility to methicillin have been described. Borderline resistance (BORSA) to the semi-synthetic penicillins has been attributed to the hyperproduction of normal staphylococcal beta-lactamase. A third mechanism has recently been advanced that describes an intermediate level of resistance to methicillin due to production of modified, normal PBPs with reduced affinity for beta-lactams (MODSA). Little is known regarding the prevalence or clinical significance of the BORSA and MODSA strains. The most reliable in vitro susceptibility test methods for detecting MRSA (strains possessing PBP 2a) include the microdilution minimum inhibitory concentration (MIC) test (with 2% NaCl supplemented broth), the oxacillin agar screen plate test (incorporating 6 micrograms/ml oxacillin in 4% NaCl supplemented agar), and the National Committee for Clinical Laboratory Standards (NCCLS) disk diffusion test with oxacillin. All three methods use direct inoculum preparation and incubation of tests at 35 degrees C for a full 24 hours.

  9. Estimating Penetration Resistance in Agricultural Soils of Ardabil Plain Using Artificial Neural Network and Regression Methods

    Directory of Open Access Journals (Sweden)

    Gholam Reza Sheykhzadeh

    2017-02-01

    Full Text Available Introduction: Penetration resistance is one of the criteria for evaluating soil compaction. It correlates with several soil properties such as vehicle trafficability, resistance to root penetration, seedling emergence, and soil compaction by farm machinery. Direct measurement of penetration resistance is time consuming and difficult because of high temporal and spatial variability. Therefore, many different regressions and artificial neural network pedotransfer functions have been proposed to estimate penetration resistance from readily available soil variables such as particle size distribution, bulk density (Db and gravimetric water content (θm. The lands of Ardabil Province are one of the main production regions of potato in Iran, thus, obtaining the soil penetration resistance in these regions help with the management of potato production. The objective of this research was to derive pedotransfer functions by using regression and artificial neural network to predict penetration resistance from some soil variations in the agricultural soils of Ardabil plain and to compare the performance of artificial neural network with regression models. Materials and methods: Disturbed and undisturbed soil samples (n= 105 were systematically taken from 0-10 cm soil depth with nearly 3000 m distance in the agricultural lands of the Ardabil plain ((lat 38°15' to 38°40' N, long 48°16' to 48°61' E. The contents of sand, silt and clay (hydrometer method, CaCO3 (titration method, bulk density (cylinder method, particle density (Dp (pychnometer method, organic carbon (wet oxidation method, total porosity(calculating from Db and Dp, saturated (θs and field soil water (θf using the gravimetric method were measured in the laboratory. Mean geometric diameter (dg and standard deviation (σg of soil particles were computed using the percentages of sand, silt and clay. Penetration resistance was measured in situ using cone penetrometer (analog model at 10

  10. Recursion-transform method for computing resistance of the complex resistor network with three arbitrary boundaries.

    Science.gov (United States)

    Tan, Zhi-Zhong

    2015-05-01

    We develop a general recursion-transform (R-T) method for a two-dimensional resistor network with a zero resistor boundary. As applications of the R-T method, we consider a significant example to illuminate the usefulness for calculating resistance of a rectangular m×n resistor network with a null resistor and three arbitrary boundaries, a problem never solved before, since Green's function techniques and Laplacian matrix approaches are invalid in this case. Looking for the exact calculation of the resistance of a binary resistor network is important but difficult in the case of an arbitrary boundary since the boundary is like a wall or trap which affects the behavior of finite network. In this paper we obtain several general formulas of resistance between any two nodes in a nonregular m×n resistor network in both finite and infinite cases. In particular, 12 special cases are given by reducing one of the general formulas to understand its applications and meanings, and an integral identity is found when we compare the equivalent resistance of two different structures of the same problem in a resistor network.

  11. Comparison of two in vitro methods for the detection of ivermectin resistance in Haemonchus contortus in sheep

    Directory of Open Access Journals (Sweden)

    Urda Dolinská M.

    2016-06-01

    Full Text Available Gastrointestinal parasitic nematodes in sheep cause severe economic losses. Anthelmintics are the most commonly used drugs for prophylaxis and therapy against parasitic helminths. The problem of drug resistance has developed for all commercially available anthelmintics in several genera and classes of helminths. In vitro and in vivo tests are used to detect anthelmintic resistance. Two in vitro methods (larval migration inhibition test and micromotility test for the detection of ivermectin (IVM resistance were compared using IVM-resistant and IVM-susceptible isolates of Haemonchus contortus. The degree of resistance for each test was expressed as a resistance factor (RF. The micromotility test was more sensitive for quantitatively measuring the degree of resistance between susceptible and resistant isolates. The RFs for this test for IVM and eprinomectin ranged from 1.00 to 108.05 and from 3.87 to 32.32, respectively.

  12. Ectoparasites of medical and veterinary importance: drug resistance and the need for alternative control methods.

    Science.gov (United States)

    McNair, Carol M

    2015-03-01

    Despite multiple attempts at eradication, many ectoparasites of humans and domestic livestock remain a persistent problem in the modern world. For many years, a range of pesticide drugs including organophosphates, organochlorides and synthetic pyrethroids provided effective control of these parasites; but intensive use of these drugs has led to the evolution of resistance in many target species. This paper aims to review the effectiveness of current control methods and discuss potential alternatives for the long term sustainable control of ectoparasites. Important medical ectoparasites such as scabies mites, head lice and bed bugs present a significant public health problem, and so adequate control methods are essential. Ectoparasites of domestic livestock and farmed fish (for example sheep scab mites, poultry mites and sea lice) are also of concern given the increasing strain on the world's food supply. These parasites have become resistant to several classes of pesticide, making control very difficult. Recently, an increasing amount of research has focussed on alternative control methods such as insect growth regulators, biological control using essential oils or fungi, as well as vaccine development against some ectoparasites of medical and veterinary importance. Drug resistance is prevalent in all of the ectoparasites discussed in this review. A wide variety of alternative control methods have been identified, however further research is necessary in order for these to be used to successfully control ectoparasitic diseases in the future. © 2015 Royal Pharmaceutical Society.

  13. Polarization developments

    International Nuclear Information System (INIS)

    Prescott, C.Y.

    1993-07-01

    Recent developments in laser-driven photoemission sources of polarized electrons have made prospects for highly polarized electron beams in a future linear collider very promising. This talk discusses the experiences with the SLC polarized electron source, the recent progress with research into gallium arsenide and strained gallium arsenide as a photocathode material, and the suitability of these cathode materials for a future linear collider based on the parameters of the several linear collider designs that exist

  14. Metabolomic method: UPLC-q-ToF polar and non-polar metabolites in the healthy rat cerebellum using an in-vial dual extraction.

    Directory of Open Access Journals (Sweden)

    Amera A Ebshiana

    Full Text Available Unbiased metabolomic analysis of biological samples is a powerful and increasingly commonly utilised tool, especially for the analysis of bio-fluids to identify candidate biomarkers. To date however only a small number of metabolomic studies have been applied to studying the metabolite composition of tissue samples, this is due, in part to a number of technical challenges including scarcity of material and difficulty in extracting metabolites. The aim of this study was to develop a method for maximising the biological information obtained from small tissue samples by optimising sample preparation, LC-MS analysis and metabolite identification. Here we describe an in-vial dual extraction (IVDE method, with reversed phase and hydrophilic liquid interaction chromatography (HILIC which reproducibly measured over 4,000 metabolite features from as little as 3mg of brain tissue. The aqueous phase was analysed in positive and negative modes following HILIC separation in which 2,838 metabolite features were consistently measured including amino acids, sugars and purine bases. The non-aqueous phase was also analysed in positive and negative modes following reversed phase separation gradients respectively from which 1,183 metabolite features were consistently measured representing metabolites such as phosphatidylcholines, sphingolipids and triacylglycerides. The described metabolomics method includes a database for 200 metabolites, retention time, mass and relative intensity, and presents the basal metabolite composition for brain tissue in the healthy rat cerebellum.

  15. Fractal analysis of polar bear hairs

    Directory of Open Access Journals (Sweden)

    Wang Qing-Li

    2015-01-01

    Full Text Available Hairs of a polar bear (Ursus maritimus are of superior properties such as the excellent thermal protection. Why do polar bears can resist such cold environment? The paper concludes that its fractal porosity plays an important role, and its fractal dimensions are very close to the golden mean, 1.618, revealing the possible optimal structure of polar bear hair.

  16. A portable borehole temperature logging system using the four-wire resistance method

    Science.gov (United States)

    Erkan, Kamil; Akkoyunlu, Bülent; Balkan, Elif; Tayanç, Mete

    2017-12-01

    High-quality temperature-depth information from boreholes with a depth of 100 m or more is used in geothermal studies and in studies of climate change. Electrical wireline tools with thermistor sensors are capable of measuring borehole temperatures with millikelvin resolution. The use of a surface readout mode allows analysis of the thermally conductive state of a borehole, which is especially important for climatic and regional heat flow studies. In this study we describe the design of a portable temperature logging tool that uses the four-wire resistance measurement method. The four-wire method enables the elimination of cable resistance effects, thus allowing millikelvin resolution of temperature data at depth. A preliminary two-wire model of the system is also described. The portability of the tool enables one to collect data from boreholes down to 300 m, even in locations with limited accessibility.

  17. Exploration of a new method in determining the glass transition temperature of BMGs by electrical resistivity

    Science.gov (United States)

    Guo, Jing; Zu, Fangqiu; Chen, Zhihao; Zheng, Shubin; Yuan, Yuan

    2005-07-01

    Based on a brief retrospect of the method in establishing Tg of the bulk metallic glasses (BMGs), some perplexities concerning this are pointed out. With the experimental results of Zr-Al-Ni-Cu-X (Nb,Ti) BMGs, a electrical resistivity method is proposed to determine the glass transition temperature of BMGs. With the method, we define two kinds of characteristic temperature related to the glass transition, Tg-dep and Tg-int, respectively. By comparing Tg-dep and Tg-int with Tg determined by the DSC method, we have found that, for the same alloy at the same heating rate, Tg-dep is very close to Tg-onset while Tg-int is approximate to Tg-mid. As a method to determine the glass transition temperature, the electrical resistivity method has proved to be more convenient and practical in comparison with the DSC method, especially when the DSC curve cannot show the glass transition character of BMGs. In addition, we would emphasize that when we refer to Tg, it is necessary to expatiate on the way of denoting the glass transition temperature, such as Tg-dep or Tg-int ( Tg-onset or Tg-mid), and on the heating rate, in order to avoid ambiguity.

  18. Response of Gravity, Magnetic, and Geoelectrical Resistivity Methods on Ngeni Southern Blitar Mineralization Zone

    Science.gov (United States)

    Sunaryo

    2018-03-01

    The research with entitle response of gravity, magnetic, and geoelectrical resistivity methods on Ngeni Southern Blitar mineralization zone has been done. This study aims to find the response of several geophysical methods of gravity, magnetic, and geoelectrical resistivity in an integrated manner. Gravity data acquisition was acquired 224 data which covers the whole region of Blitar district by using Gravity Meter La Coste & Romberg Model “G”, and magnetic data acquisition were acquired 195 data which covers the southern Blitar district only by using Proton Precession Magnetometer G-856. Meanwhile geoelectrical resistivity data only done in Ngeni village which is the location of phyropilite mining with the composition content of Fe, Si, Ca, S, Cu, and Mn by using ABEM Terrameter SAS 300C. Gravity data processing was performed to obtain the Bouguer anomaly value, which included unit conversion, tidal correction, drift correction, correction of tie point, base station correction, free air correction, and Bouguer correction. Magnetic data processing has been done by some corrections i.e daily, drift, and IGRF(International Geomagnetic Refference Field) to obtain the total magnetic anomaly. From gravity data processing has been obtained the simple Bouguer anomaly value in range from -10mGal until 115mGal. From this data processing has been obtained the total magnetic anomaly value in range from -650nT until 800nT. Meanwhile from geoelectrical resistivity 3.03Ωm until 11249.91 Ωm. There is a correlation between gravity anomaly, magnetic anomaly, and geoelectrical resistivity anomaly that are associated with deep anomaly, middle anomaly, and shallow anomaly.

  19. A Quantitative Method to Screen Common Bean Plants for Resistance to Bean common mosaic necrosis virus.

    Science.gov (United States)

    Strausbaugh, C A; Myers, J R; Forster, R L; McClean, P E

    2003-11-01

    ABSTRACT A quantitative method to screen common bean (Phaseolus vulgaris) plants for resistance to Bean common mosaic necrosis virus (BCMNV) is described. Four parameters were assessed in developing the quantitative method: symptoms associated with systemic virus movement, plant vigor, virus titer, and plant dry weight. Based on these parameters, two rating systems (V and VV rating) were established. Plants from 21 recombinant inbred lines (RILs) from a Sierra (susceptible) x Olathe (partially resistant) cross inoculated with the BCMNV-NL-3 K strain were used to evaluate this quantitative approach. In all, 11 RILs exhibited very susceptible reactions and 10 RILs expressed partially resistant reactions, thus fitting a 1:1 susceptible/partially resistant ratio (chi(2) = 0.048, P = 0.827) and suggesting that the response is mediated by a single gene. Using the classical qualitative approach based only on symptom expression, the RILs were difficult to separate into phenotypic groups because of a continuum of responses. By plotting mean percent reduction in either V (based on visual symptoms) or VV (based on visual symptoms and vigor) rating versus enzyme-linked immunosorbent assay (ELISA) absorbance values, RILs could be separated clearly into different phenotypic groups. The utility of this quantitative approach also was evaluated on plants from 12 cultivars or pure lines inoculated with one of three strains of BCMNV. Using the mean VV rating and ELISA absorbance values, significant differences were established not only in cultivar and pure line comparisons but also in virus strain comparisons. This quantitative system should be particularly useful for the evaluation of the independent action of bc genes, the discovery of new genes associated with partial resistance, and assessing virulence of virus strains.

  20. Parallel Polarization State Generation.

    Science.gov (United States)

    She, Alan; Capasso, Federico

    2016-05-17

    The control of polarization, an essential property of light, is of wide scientific and technological interest. The general problem of generating arbitrary time-varying states of polarization (SOP) has always been mathematically formulated by a series of linear transformations, i.e. a product of matrices, imposing a serial architecture. Here we show a parallel architecture described by a sum of matrices. The theory is experimentally demonstrated by modulating spatially-separated polarization components of a laser using a digital micromirror device that are subsequently beam combined. This method greatly expands the parameter space for engineering devices that control polarization. Consequently, performance characteristics, such as speed, stability, and spectral range, are entirely dictated by the technologies of optical intensity modulation, including absorption, reflection, emission, and scattering. This opens up important prospects for polarization state generation (PSG) with unique performance characteristics with applications in spectroscopic ellipsometry, spectropolarimetry, communications, imaging, and security.

  1. Evaluation of different methods to detect methicillin resistance in Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Alipour, Farzad; Ahmadi, Malahat; Javadi, Shahram

    2014-01-01

    The studies suggest that dogs living with human are potential risk of becoming MRSA carrier and increased risk of infections caused by MRSA. Phenotypic methods to detect methicillin resistance in Staphylococcus aureus (MRSA) are inadequate. The objective of the present study was to determine methicillin resistance in S. aureus by phenotypic susceptibility test (oxacillin disk diffusion, cefoxitin disk diffusion, oxacillin screen agar) and molecular methods (PCR as a gold standard) and the latex agglutination test for the detection of PBP2a and to evaluate the results of these tests for its sensitivity and specificity. A total of 100 swab samples were taken from muzzle site, in more contact with human, of dogs and MRSA were isolated. Oxacillin (1 μg), cefoxitin (30 μg) disk diffusion and oxacillin screen agar method were used. The isolates were also subjected to latex agglutination test for detection of PBP2a and PCR to detect mecA gene. By PCR 37% of isolates show the presence of mecA. Latex agglutination was found to be the most sensitive (97.29%) and cefoxitin disk diffusion to be the most specific (96.82%) tests for detection of MRSA. Our finding showed that combining oxacillin screen agar or cefoxitin disk diffusion with latex agglutination improves sensitivity and specificity to detect methicillin resistance S. aureus (MRSA) isolates. Copyright © 2014 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  2. Reactor fuel cladding tube with excellent corrosion resistance and method of manufacturing the same

    International Nuclear Information System (INIS)

    Okuda, Takanari; Kanehara, Mitsuo; Abe, Katsuhiro; Nishimura, Takashi.

    1995-01-01

    The present invention provides a fuel cladding tube having an excellent corrosion resistance and thus a long life, and a suitable manufacturing method therefor. Namely, in the fuel cladding tube, the outer circumference of an inner layer made of a zirconium base alloy is coated with an outer layer made of a metal more corrosion resistant than the zirconium base alloy. Ti or a titanium alloy is suitable for the corrosion resistant metal. In addition, the outer layer can be coated by a method such as vapor deposition or plating, not limited to joining of the inner layer material and the outer layer material. Specifically, a composite material having an inner layer made of a zirconium alloy coated by the outer material made of a titanium alloy is applied with hot fabrication at a temperature within a range of from 500 to 850degC and at a fabrication rate of not less than 5%. The fabrication method includes any of extrusion, rolling, drawing, and casting. As the titanium-base alloy, a Ti-Al alloy or a Ti-Nb alloy containing Al of not more than 20wt%, or Nb of not more than 20wt% is preferred. (I.S.)

  3. An analytic solution of projectile motion with the quadratic resistance law using the homotopy analysis method

    International Nuclear Information System (INIS)

    Yabushita, Kazuki; Yamashita, Mariko; Tsuboi, Kazuhiro

    2007-01-01

    We consider the problem of two-dimensional projectile motion in which the resistance acting on an object moving in air is proportional to the square of the velocity of the object (quadratic resistance law). It is well known that the quadratic resistance law is valid in the range of the Reynolds number: 1 x 10 3 ∼ 2 x 10 5 (for instance, a sphere) for practical situations, such as throwing a ball. It has been considered that the equations of motion of this case are unsolvable for a general projectile angle, although some solutions have been obtained for a small projectile angle using perturbation techniques. To obtain a general analytic solution, we apply Liao's homotopy analysis method to this problem. The homotopy analysis method, which is different from a perturbation technique, can be applied to a problem which does not include small parameters. We apply the homotopy analysis method for not only governing differential equations, but also an algebraic equation of a velocity vector to extend the radius of convergence. Ultimately, we obtain the analytic solution to this problem and investigate the validation of the solution

  4. The `L' Array, a method to model 3D Electrical Resistivity Tomography (ERT) data

    Science.gov (United States)

    Chavez Segura, R. E.; Chavez-Hernandez, G.; Delgado, C.; Tejero-Andrade, A.

    2010-12-01

    The electrical resistivity tomography (ERT) is a method designed to calculate the distribution of apparent electrical resistivities in the subsoil by means of a great number of observations with the aim of determining an electrical image displaying the distribution of true resistivities in the subsoil. Such process can be carried out to define 2D or 3D models of the subsurface. For a 3D ERT, usually, the electrodes are placed in a squared grid keeping the distance between adjacent electrodes constant in the x and y directions. Another design employed, consists of a series of parallel lines whose space inter-lines must be smaller or equal to four times the electrode separation. The most common electrode arrays frequently employed for this type of studies are the pole-pole, pole-dipole and dipole-dipole. Unfortunately, ERT surface sampling schemes are limited by physical conditions or obstacles, like buildings, highly populated urban zones, and geologic/topographic features, where the lines of electrodes cannot be set. However, it is always necessary to characterize the subsoil beneath such anthropogenic or natural features. The ‘L’ shaped array has the main purpose to overcome such difficulties by surrounding the study area with a square of electrode lines. The measurements are obtained by switching automatically current and potential electrodes from one line to the other. Each observation adds a level of information, from one profile to the other. Once the total levels of data are completed, the opposite ‘L’ array can be measured following the same process. The complete square is computed after the parallel profiles are observed as well. At the end, the computed resistivities are combined to form a 3D matrix of observations. Such set of data can be inverted to obtain the true resistivity distribution at depth in the form of a working cube, which can be interpreted. The method was tested with theoretical models, which included a set of two resistive cubes

  5. Method for rapid detection and identification of chaetomium and evaluation of resistance to peracetic acid.

    Science.gov (United States)

    Nakayama, Motokazu; Hosoya, Kouichi; Tomiyama, Daisuke; Tsugukuni, Takashi; Matsuzawa, Tetsuhiro; Imanishi, Yumi; Yaguchi, Takashi

    2013-06-01

    In the beverage industry, peracetic acid has been increasingly used as a disinfectant for the filling machinery and environment due to merits of leaving no residue, it is safe for humans, and its antiseptic effect against fungi and endospores of bacteria. Recently, Chaetomium globosum and Chaetomium funicola were reported resistant to peracetic acid; however, little is known concerning the detail of peracetic acid resistance. Therefore, we assessed the peracetic acid resistance of the species of Chaetomium and related genera under identical conditions and made a thorough observation of the microstructure of their ascospores by transmission electron microscopy. The results of analyses revealed that C. globosum and C. funicola showed the high resistance to peracetic acid (a 1-D antiseptic effect after 900 s and 3-D antiseptic effect after 900 s) and had thick cell walls of ascospores that can impede the action mechanism of peracetic acid. We also developed specific primers to detect the C. globosum clade and identify C. funicola by using PCR to amplify the β-tubulin gene. PCR with the primer sets designed for C. globosum (Chae 4F/4R) and C. funicola (Cfu 2F/2R) amplified PCR products specific for the C. globosum clade and C. funicola, respectively. PCR with these two primer sets did not detect other fungi involved in food spoilage and environmental contamination. This detection and identification method is rapid and simple, with extremely high specificity.

  6. Electromigration of hydrogen and deuterium in vanadium and niobium by a resistance method

    International Nuclear Information System (INIS)

    Peterson, D.T.; Jensen, C.L.

    1978-01-01

    The electric mobility of hydrogen and deuterium has been measured at 30 0 C in niobium (Cb) and vanadium by a resistance method. The electric mobility was found to be 5.7 x 10 -4 cm 2 /V-s for hydrogen and 2.8 x 10 -4 for deuterium in niobium. In vanadium the electric mobilities were 2.3 x 10 -3 and 1.3 x 10 -3 cm 2 /V-s for hydrogen and deuterium, respectively. The effective charges calculated using reported diffusion coefficients are positive and are slightly greater for deuterium than for hydrogen in both vanadium and niobium. The resistivity increase due to the hydrogen isotopes in vanadium and niobium was also measured. Hydrogen was found to contribute 0.65 μ ohm-cm/at. % and deuterium 0.58 μ ohm-cm/at. % to the resistivity of niobium. In vanadium, the solute resistivities were found to be 0.98 μ ohm-cm/at. % and 0.90 μ ohm-cm/at. % for hydrogen and deuterium, respectively

  7. Neutron polarization

    International Nuclear Information System (INIS)

    Firk, F.W.K.

    1976-01-01

    Some recent experiments involving polarized neutrons are discussed; they demonstrate how polarization studies provide information on fundamental aspects of nuclear structure that cannot be obtained from more traditional neutron studies. Until recently, neutron polarization studies tended to be limited either to very low energies or to restricted regions at higher energies, determined by the kinematics of favorable (p, vector n) and (d, vector n) reactions. With the advent of high intensity pulsed electron and proton accelerators and of beams of vector polarized deuterons, this is no longer the case. One has entered an era in which neutron polarization experiments are now being carried out, in a routine way, throughout the entire range from thermal energies to tens-of-MeV. The significance of neutron polarization studies is illustrated in discussions of a wide variety of experiments that include the measurement of T-invariance in the β-decay of polarized neutrons, a search for the effects of meson exchange currents in the photo-disintegration of the deuteron, the determination of quantum numbers of states in the fission of aligned 235 U and 237 Np induced by polarized neutrons, and the double- and triple-scattering of fast neutrons by light nuclei

  8. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  9. The Path Resistance Method for Bounding the Smallest Nontrivial Eigenvalue of a Laplacian

    Science.gov (United States)

    Guattery, Stephen; Leighton, Tom; Miller, Gary L.

    1997-01-01

    We introduce the path resistance method for lower bounds on the smallest nontrivial eigenvalue of the Laplacian matrix of a graph. The method is based on viewing the graph in terms of electrical circuits; it uses clique embeddings to produce lower bounds on lambda(sub 2) and star embeddings to produce lower bounds on the smallest Rayleigh quotient when there is a zero Dirichlet boundary condition. The method assigns priorities to the paths in the embedding; we show that, for an unweighted tree T, using uniform priorities for a clique embedding produces a lower bound on lambda(sub 2) that is off by at most an 0(log diameter(T)) factor. We show that the best bounds this method can produce for clique embeddings are the same as for a related method that uses clique embeddings and edge lengths to produce bounds.

  10. Polarization holography

    DEFF Research Database (Denmark)

    Nikolova, L.; Ramanujam, P.S.

    Current research into holography is concerned with applications in optically storing, retrieving, and processing information. Polarization holography has many unique properties compared to conventional holography. It gives results in high efficiency, achromaticity, and special polarization...... properties. This books reviews the research carried out in this field over the last 15 years. The authors provide basic concepts in polarization and the propagation of light through anisotropic materials, before presenting a sound theoretical basis for polarization holography. The fabrication...... and characterization of azobenzene based materials, which remain the most efficient for the purpose, is described in detail. This is followed by a description of other materials that are used in polarization holography. An in-depth description of various applications, including display holography and optical storage...

  11. Standard Test Method for Dust Erosion Resistance of Optical and Infrared Transparent Materials and Coatings

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers the resistance of transparent plastics and coatings used in aerospace windscreens, canopies, and viewports to surface erosion as a result of dust impingement. This test method simulates flight through a defined particle cloud environment by means of independent control of particle size, velocity, impact angle, mass loading, and test duration. 1.2 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  12. Study on creep behavior of Grade 91 heat-resistant steel using theta projection method

    Science.gov (United States)

    Ren, Facai; Tang, Xiaoying

    2017-10-01

    Creep behavior of Grade 91 heat-resistant steel used for steam cooler was characterized using the theta projection method. Creep tests were conducted at the temperature of 923K under the stress ranging from 100-150MPa. Based on the creep curve results, four theta parameters were established using a nonlinear least square fitting method. Four theta parameters showed a good linearity as a function of stress. The predicted curves coincided well with the experimental data and creep curves were also modeled to the low stress level of 60MPa.

  13. Peculiarities of Enhancing Resistant Starch in Ruminants Using Chemical Methods: Opportunities and Challenges

    Directory of Open Access Journals (Sweden)

    Qendrim Zebeli

    2013-06-01

    Full Text Available High-producing ruminants are fed high amounts of cereal grains, at the expense of dietary fiber, to meet their high energy demands. Grains consist mainly of starch, which is easily degraded in the rumen by microbial glycosidases, providing energy for rapid growth of rumen microbes and short-chain fatty acids (SCFA as the main energy source for the host. Yet, low dietary fiber contents and the rapid accumulation of SCFA lead to rumen disorders in cattle. The chemical processing of grains has become increasingly important to confer their starch resistances against rumen microbial glycosidases, hence generating ruminally resistant starch (RRS. In ruminants, unlike monogastric species, the strategy of enhancing resistant starch is useful, not only in lowering the amount of carbohydrate substrates available for digestion in the upper gut sections, but also in enhancing the net hepatic glucose supply, which can be utilized by the host more efficiently than the hepatic gluconeogenesis of SCFA. The use of chemical methods to enhance the RRS of grains and the feeding of RRS face challenges in the practice; therefore, the present article attempts to summarize the most important achievements in the chemical processing methods used to generate RRS, and review advantages and challenges of feeding RRS to ruminants

  14. Synthesis and characterization of large WO{sub 3} sheets synthesized by resistive heating method

    Energy Technology Data Exchange (ETDEWEB)

    Filippo, Emanuela, E-mail: emanuela.filippo@unisalento.it [Department of Engineering for Innovation, University of Salento, Monteroni Street, Lecce I-73100 Italy (Italy); Tepore, Marco [Department of Engineering for Innovation, University of Salento, Monteroni Street, Lecce I-73100 Italy (Italy); Baldassarre, Francesca [Department of Cultural Heritage, University of Salento, Lecce I-73100 Italy (Italy); Quarta, Gianluca; Calcagnile, Lucio [Department of Engineering for Innovation, University of Salento, Monteroni Street, Lecce I-73100 Italy (Italy); Guascito, Maria Rachele [DiSTeBA, University of Salento, Lecce I-73100 Italy (Italy); Tepore, Antonio [Department of Cultural Heritage, University of Salento, Lecce I-73100 Italy (Italy)

    2015-09-01

    A simple, low-cost method is presented to grow tungsten oxide large sheets simply by resistively heating a pure tungsten filament under air/water vapor flow. The obtained structures were studied using scanning and transmission electron microscopy, selected area diffraction, X Ray diffraction, Raman and X-ray photoelectron spectroscopy, photoluminescence and zeta potential measurements. SEM observations revealed that sheets formed by broadening of the wires/belts over longer growth period. Photoluminescence measurements showed that tungsten oxide sheets had an intense visible emission band. - Highlights: • WO{sub 3} large sheets were prepared by resistively heating a W filament. • WO{sub 3} sheets were carefully characterized. • Formation mechanism of sheets was studied. • WO{sub 3} sheets had an intense visible emission band at 462 nm.

  15. Methods and apparatus for measurement of the resistivity of geological formations from within cased boreholes

    Science.gov (United States)

    Vail, III, William B.

    1989-01-01

    Methods and apparatus are disclosed which allow measurement of the resistivity of a geological formation through borehole casing which may be surrounded by brine saturated cement. A.C. current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. The A.C. voltage difference is measured between two additional vertically disposed electrodes on the interior of the casing which provides a measure of the resistivity of the geological formation. A calibration and nulling procedure is presented which minimizes the influence of variations in the thickness of the casing. The procedure also minimizes the influence of inaccurate placements of the additional vertically disposed electrodes.

  16. System and method for determining stator winding resistance in an AC motor

    Science.gov (United States)

    Lu, Bin [Kenosha, WI; Habetler, Thomas G [Snellville, GA; Zhang, Pinjia [Atlanta, GA; Theisen, Peter J [West Bend, WI

    2011-05-31

    A system and method for determining stator winding resistance in an AC motor is disclosed. The system includes a circuit having an input connectable to an AC source and an output connectable to an input terminal of an AC motor. The circuit includes at least one contactor and at least one switch to control current flow and terminal voltages in the AC motor. The system also includes a controller connected to the circuit and configured to modify a switching time of the at least one switch to create a DC component in an output of the system corresponding to an input to the AC motor and determine a stator winding resistance of the AC motor based on the injected DC component of the voltage and current.

  17. Implementation of a method for calculating temperature-dependent resistivities in the KKR formalism

    Science.gov (United States)

    Mahr, Carsten E.; Czerner, Michael; Heiliger, Christian

    2017-10-01

    We present a method to calculate the electron-phonon induced resistivity of metals in scattering-time approximation based on the nonequilibrium Green's function formalism. The general theory as well as its implementation in a density-functional theory based Korringa-Kohn-Rostoker code are described and subsequently verified by studying copper as a test system. We model the thermal expansion by fitting a Debye-Grüneisen curve to experimental data. Both the electronic and vibrational structures are discussed for different temperatures, and employing a Wannier interpolation of these quantities we evaluate the scattering time by integrating the electron linewidth on a triangulation of the Fermi surface. Based thereupon, the temperature-dependent resistivity is calculated and found to be in good agreement with experiment. We show that the effect of thermal expansion has to be considered in the whole calculation regime. Further, for low temperatures, an accurate sampling of the Fermi surface becomes important.

  18. Comparison between the boundary layer and global resistivity methods for tearing modes in reversed field configurations

    International Nuclear Information System (INIS)

    Santiago, M.A.M.

    1987-01-01

    A review of the problem of growth rate calculations for tearing modes in field reversed Θ-pinches is presented. Its shown that in the several experimental data, the methods used for analysing the plasma with a global finite resistivity has a better quantitative agreement than the boundary layer analysis. A comparative study taking into account the m = 1 resistive kindmode and the m = 2 mode, which is more dangerous for the survey of rotational instabilities of the plasma column is done. It can see that the imaginary component of the eigenfrequency, which determinates the growth rate, has a good agreement with the experimental data and the real component is different from the rotational frequency as it has been measured in some experiments. (author) [pt

  19. A new method based on low background instrumental neutron activation analysis for major, trace and ultra-trace element determination in atmospheric mineral dust from polar ice cores

    Energy Technology Data Exchange (ETDEWEB)

    Baccolo, Giovanni, E-mail: giovanni.baccolo@mib.infn.it [Graduate School in Polar Sciences, University of Siena, Via Laterina 8, 53100, Siena (Italy); Department of Environmental Sciences, University of Milano-Bicocca, P.zza della Scienza 1, 20126, Milano (Italy); INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Clemenza, Massimiliano [INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Department of Physics, University of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Delmonte, Barbara [Department of Environmental Sciences, University of Milano-Bicocca, P.zza della Scienza 1, 20126, Milano (Italy); Maffezzoli, Niccolò [Centre for Ice and Climate, Niels Bohr Institute, Juliane Maries Vej, 30, 2100, Copenhagen (Denmark); Nastasi, Massimiliano; Previtali, Ezio [INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Department of Physics, University of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy); Prata, Michele; Salvini, Andrea [LENA, University of Pavia, Pavia (Italy); Maggi, Valter [Department of Environmental Sciences, University of Milano-Bicocca, P.zza della Scienza 1, 20126, Milano (Italy); INFN, Section of Milano-Bicocca, P.zza della Scienza 3, 20126, Milano (Italy)

    2016-05-30

    Dust found in polar ice core samples present extremely low concentrations, in addition the availability of such samples is usually strictly limited. For these reasons the chemical and physical analysis of polar ice cores is an analytical challenge. In this work a new method based on low background instrumental neutron activation analysis (LB-INAA) for the multi-elemental characterization of the insoluble fraction of dust from polar ice cores is presented. Thanks to an accurate selection of the most proper materials and procedures it was possible to reach unprecedented analytical performances, suitable for ice core analyses. The method was applied to Antarctic ice core samples. Five samples of atmospheric dust (μg size) from ice sections of the Antarctic Talos Dome ice core were prepared and analyzed. A set of 37 elements was quantified, spanning from all the major elements (Na, Mg, Al, Si, K, Ca, Ti, Mn and Fe) to trace ones, including 10 (La, Ce, Nd, Sm, Eu, Tb, Ho, Tm, Yb and Lu) of the 14 natural occurring lanthanides. The detection limits are in the range of 10{sup −13}–10{sup −6} g, improving previous results of 1–3 orders of magnitude depending on the element; uncertainties lies between 4% and 60%. - Highlights: • A new method based on neutron activation for the multi-elemental characterization of atmospheric dust entrapped in polar ice cores is proposed. • 37 elements were quantified in μg size dust samples with detection limits ranging from 10{sup −13} to 10{sup −6} g. • A low background approach and a clean analytical protocol improved INAA performances to unprecedented levels for multi-elemental analyses.

  20. Electrically resistive coating for remediation (regeneration) of a diesel particulate filter and method

    Science.gov (United States)

    Phelps, Amanda C [Malibu, CA; Kirby, Kevin K [Calabasas Hills, CA; Gregoire, Daniel J [Thousand Oaks, CA

    2012-02-14

    A resistively heated diesel particulate filter (DPF). The resistively heated DPF includes a DPF having an inlet surface and at least one resistive coating on the inlet surface. The at least one resistive coating is configured to substantially maintain its resistance in an operating range of the DPF. The at least one resistive coating has a first terminal and a second terminal for applying electrical power to resistively heat up the at least one resistive coating in order to increase the temperature of the DPF to a regeneration temperature. The at least one resistive coating includes metal and semiconductor constituents.

  1. An encoding readout method used for Multi-gap Resistive Plate Chambers (MRPCs) for muon tomography

    Science.gov (United States)

    Yue, X.; Zeng, M.; Wang, Y.; Wang, X.; Zeng, Z.; Zhao, Z.; Cheng, J.

    2014-09-01

    A muon tomography facility has been built in Tsinghua University. Because of the low flux of cosmic muon, an encoding readout method, based on the fine-fine configuration, was implemented for the 2880 channels induced signals from the Multi-gap Resistive Plate Chamber (MRPC) detectors. With the encoding method, the number of the readout electronics was dramatically reduced and thus the complexity and the cost of the facility was reduced, too. In this paper, the details of the encoding method, and the overall readout system setup in the muon tomography facility are described. With the commissioning of the facility, the readout method works well. The spatial resolution of all MRPC detectors are measured with cosmic muon and the preliminary imaging result are also given.

  2. An encoding readout method used for Multi-gap Resistive Plate Chambers (MRPCs) for muon tomography

    International Nuclear Information System (INIS)

    Yue, X; Zeng, M; Wang, Y; Wang, X; Zeng, Z; Zhao, Z; Cheng, J

    2014-01-01

    A muon tomography facility has been built in Tsinghua University. Because of the low flux of cosmic muon, an encoding readout method, based on the fine-fine configuration, was implemented for the 2880 channels induced signals from the Multi-gap Resistive Plate Chamber (MRPC) detectors. With the encoding method, the number of the readout electronics was dramatically reduced and thus the complexity and the cost of the facility was reduced, too. In this paper, the details of the encoding method, and the overall readout system setup in the muon tomography facility are described. With the commissioning of the facility, the readout method works well. The spatial resolution of all MRPC detectors are measured with cosmic muon and the preliminary imaging result are also given

  3. An educational method for evaluating the resistance to the treatment in the diagnosis of dyscalculia

    Directory of Open Access Journals (Sweden)

    Giampaolo Chiappini

    2016-04-01

    Full Text Available In this paper a didactical method that has been proven effective for evaluating the “resistance to the treatment” of the student is presented. This parameter is essential for distinguishing the learning difficulties in mathematics from the learning disorder of dyscalculia. The method is based on GimmeFive, an application that has been designed to develop skills in mental calculation of multi-digit additions and subtractions. In this paper we present the results of two experiments conducted with groups of students respectively with learning difficulties in mathematics and dyscalculia. These experiments allowed to show the effectiveness of the didactical method in the evaluation of the resistance to the treatment and to discuss the features that make it adequate for the evaluation of the learning disorder. An educational method for evaluating the resistance to the treatment in the diagnosis of dyscalculiaIn questo lavoro viene presentato un metodo didattico che si è dimostrato efficace per valutare la resistenza al trattamento dello studente che è uno dei parametri fondamentali per distinguere la difficoltà di apprendimento in matematica dal disturbo di apprendimento noto come discalculia. Il metodo si basa sull’uso dell’applicazione GimmeFive che è stata progettata per sviluppare competenze nel calcolo mentale di addizioni e sottrazioni a più cifre. In questo lavoro vengono presentati risultati di due sperimentazioni condotte con gruppi di studenti rispettivamente con difficoltà di apprendimento e con diagnosi di discalculia. Queste sperimentazioni hanno consentito di mostrare l’efficacia del metodo didattico nella valutazione della resistenza al trattamento e di discutere le caratteristiche che lo rendono adeguato per la valutazione del disturbo di apprendimento.

  4. Standard test methods for performance characteristics of metallic bonded resistance strain gages

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1992-01-01

    1.1 The purpose of this standard is to provide uniform test methods for the determination of strain gauge performance characteristics. Suggested testing equipment designs are included. 1.2 Test Methods E 251 describes methods and procedures for determining five strain gauge parameters: Section Part I—General Requirements 7 Part II—Resistance at a Reference Temperature 8 Part III—Gauge Factor at a Reference Temperature 9 Part IV—Temperature Coefficient of Gauge Factor\t10 Part V—Transverse Sensitivity\t11 Part VI—Thermal Output\t12 1.3 Strain gauges are very sensitive devices with essentially infinite resolution. Their response to strain, however, is low and great care must be exercised in their use. The performance characteristics identified by these test methods must be known to an acceptable accuracy to obtain meaningful results in field applications. 1.3.1 Strain gauge resistance is used to balance instrumentation circuits and to provide a reference value for measurements since all data are...

  5. A STUDY ON THE EARTHQUAKE RESPONSE AND EARTHQUAKE RESISTANT DESIGN METHOD OF AN OPEN TYPE WHARF WITH PNEUMATIC CAISSONS

    Science.gov (United States)

    Oishi, Masahiko; Nagao, Takashi; Shigeki, Kouji; Ouchi, Masatoshi; Sato, Yuske; Kinomiya, Osamu

    Seismic response of an open type wharf with pneumatic caisson was clarified using a dynamic finite element method. As a result, rocking behavior of caisson foundations were observed and applicability of a frame model analysis to the earthquake resistant design of a wharf was suggested. Authors proposed the framework of earthquake resistant design method of the wharf including the evaluation method of response acceleration of the wharf.

  6. Effective inclusion of polarization effects in calculations of the oscillator strengths and transition energies in atoms and molecules using the equation-of-motion method

    International Nuclear Information System (INIS)

    Glushkov, A.V.; Kol'tsova, N.Yu.

    1994-01-01

    Equations of motion were solved by a modified method in a quasi-particle representation of the density functional taking into account the most important polarization effects, including the so-called 2p-2h two-particle-two-hole interactions. Based on these calculations, spectroscopic data on energies and oscillator strengths of the helium atom (the test computation), carbon monoxide, nitrogen molecule, and ethylene are presented that refine some previously reported experimental and theoretical results. It is shown that in some cases the inclusion of polarization corrections introduced by 2p-2h effects is of basic importance because it provides up to ∼30% contribution to the energies and oscillator strengths. 23 refs., 5 tabs

  7. An extended L-curve method for choosing a regularization parameter in electrical resistance tomography

    International Nuclear Information System (INIS)

    Xu, Yanbin; Pei, Yang; Dong, Feng

    2016-01-01

    The L-curve method is a popular regularization parameter choice method for the ill-posed inverse problem of electrical resistance tomography (ERT). However the method cannot always determine a proper parameter for all situations. An investigation into those situations where the L-curve method failed show that a new corner point appears on the L-curve and the parameter corresponding to the new corner point can obtain a satisfactory reconstructed solution. Thus an extended L-curve method, which determines the regularization parameter associated with either global corner or the new corner, is proposed. Furthermore, two strategies are provided to determine the new corner–one is based on the second-order differential of L-curve, and the other is based on the curvature of L-curve. The proposed method is examined by both numerical simulations and experimental tests. And the results indicate that the extended method can handle the parameter choice problem even in the case where the typical L-curve method fails. Finally, in order to reduce the running time of the method, the extended method is combined with a projection method based on the Krylov subspace, which was able to boost the extended L-curve method. The results verify that the speed of the extended L-curve method is distinctly improved. The proposed method extends the application of the L-curve in the field of choosing regularization parameter with an acceptable running time and can also be used in other kinds of tomography. (paper)

  8. A new high accuracy non-polynomial tension spline method for the solution of one dimensional wave equation in polar co-ordinates

    Directory of Open Access Journals (Sweden)

    Venu Gopal

    2014-07-01

    Full Text Available In this paper, we propose a new three-level implicit nine point compact finite difference formulation of O(k2 + h4 based on non-polynomial tension spline approximation in r-direction and finite difference approximation in t-direction for the numerical solution of one dimensional wave equation in polar co-ordinates. We describe the mathematical formulation procedure in details and also discuss the stability of the method. Numerical results are provided to justify the usefulness of the proposed method.

  9. Monitoring Freeze Thaw Transitions in Arctic Soils using Complex Resistivity Method

    Science.gov (United States)

    Wu, Y.; Hubbard, S. S.; Ulrich, C.; Dafflon, B.; Wullschleger, S. D.

    2012-12-01

    The Arctic region, which is a sensitive system that has emerged as a focal point for climate change studies, is characterized by a large amount of stored carbon and a rapidly changing landscape. Seasonal freeze-thaw transitions in the Arctic alter subsurface biogeochemical processes that control greenhouse gas fluxes from the subsurface. Our ability to monitor freeze thaw cycles and associated biogeochemical transformations is critical to the development of process rich ecosystem models, which are in turn important for gaining a predictive understanding of Arctic terrestrial system evolution and feedbacks with climate. In this study, we conducted both laboratory and field investigations to explore the use of the complex resistivity method to monitor freeze thaw transitions of arctic soil in Barrow, AK. In the lab studies, freeze thaw transitions were induced on soil samples having different average carbon content through exposing the arctic soil to temperature controlled environments at +4 oC and -20 oC. Complex resistivity and temperature measurements were collected using electrical and temperature sensors installed along the soil columns. During the laboratory experiments, resistivity gradually changed over two orders of magnitude as the temperature was increased or decreased between -20 oC and 0 oC. Electrical phase responses at 1 Hz showed a dramatic and immediate response to the onset of freeze and thaw. Unlike the resistivity response, the phase response was found to be exclusively related to unfrozen water in the soil matrix, suggesting that this geophysical attribute can be used as a proxy for the monitoring of the onset and progression of the freeze-thaw transitions. Spectral electrical responses contained additional information about the controls of soil grain size distribution on the freeze thaw dynamics. Based on the demonstrated sensitivity of complex resistivity signals to the freeze thaw transitions, field complex resistivity data were collected over

  10. Fatigue resistance of engine-driven rotary nickel-titanium instruments produced by new manufacturing methods.

    Science.gov (United States)

    Gambarini, Gianluca; Grande, Nicola Maria; Plotino, Gianluca; Somma, Francesco; Garala, Manish; De Luca, Massimo; Testarelli, Luca

    2008-08-01

    The aim of the present study was to investigate whether cyclic fatigue resistance is increased for nickel-titanium instruments manufactured by using new processes. This was evaluated by comparing instruments produced by using the twisted method (TF; SybronEndo, Orange, CA) and those using the M-wire alloy (GTX; Dentsply Tulsa-Dental Specialties, Tulsa, OK) with instruments produced by a traditional NiTi grinding process (K3, SybronEndo). Tests were performed with a specific cyclic fatigue device that evaluated cycles to failure of rotary instruments inside curved artificial canals. Results indicated that size 06-25 TF instruments showed a significant increase (p 0.05) in the mean number of cycles to failure when compared with size 06-20 GT series X instruments. The new manufacturing process produced nickel-titanium rotary files (TF) significantly more resistant to fatigue than instruments produced with the traditional NiTi grinding process. Instruments produced with M-wire (GTX) were not found to be more resistant to fatigue than instruments produced with the traditional NiTi grinding process.

  11. 3D DC Resistivity Inversion with Topography Based on Regularized Conjugate Gradient Method

    Directory of Open Access Journals (Sweden)

    Jian-ke Qiang

    2013-01-01

    Full Text Available During the past decades, we observed a strong interest in 3D DC resistivity inversion and imaging with complex topography. In this paper, we implemented 3D DC resistivity inversion based on regularized conjugate gradient method with FEM. The Fréchet derivative is assembled with the electric potential in order to speed up the inversion process based on the reciprocity theorem. In this study, we also analyzed the sensitivity of the electric potential on the earth’s surface to the conductivity in each cell underground and introduced an optimized weighting function to produce new sensitivity matrix. The synthetic model study shows that this optimized weighting function is helpful to improve the resolution of deep anomaly. By incorporating topography into inversion, the artificial anomaly which is actually caused by topography can be eliminated. As a result, this algorithm potentially can be applied to process the DC resistivity data collected in mountain area. Our synthetic model study also shows that the convergence and computation speed are very stable and fast.

  12. Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles

    Directory of Open Access Journals (Sweden)

    Yan Jiang

    2013-06-01

    Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.

  13. Polarization experiments

    International Nuclear Information System (INIS)

    Halzen, F.

    1977-02-01

    In a theoretical review of polarization experiments two important points are emphasized: (a) their versatility and their relevance to a large variety of aspects of hadron physics (tests of basic symmetries; a probe of strong interaction dynamics; a tool for hadron spectroscopy); (b) the wealth of experimental data on polarization parameters in pp and np scattering in the Regge language and in the diffraction language. (author)

  14. Multi-resistance strategy for viral diseases and short hairpin RNA verification method in pigs

    Directory of Open Access Journals (Sweden)

    Jong-nam Oh

    2018-04-01

    Full Text Available Objective Foot and mouth disease (FMD and porcine reproductive and respiratory syndrome (PRRS are major diseases that interrupt porcine production. Because they are viral diseases, vaccinations are of only limited effectiveness in preventing outbreaks. To establish an alternative multi-resistant strategy against FMD virus (FMDV and PRRS virus (PRRSV, the present study introduced two genetic modification techniques to porcine cells. Methods First, cluster of differentiation 163 (CD163, the PRRSV viral receptor, was edited with the clustered regularly interspaced short palindromic repeats-CRISPR-associated protein 9 technique. The CD163 gene sequences of edited cells and control cells differed. Second, short hairpin RNA (shRNAs were integrated into the cells. The shRNAs, targeting the 3D gene of FMDV and the open reading frame 7 (ORF7 gene of PRRSV, were transferred into fibroblasts. We also developed an in vitro shRNA verification method with a target gene expression vector. Results shRNA activity was confirmed in vitro with vectors that expressed the 3D and ORF7 genes in the cells. Cells containing shRNAs showed lower transcript levels than cells with only the expression vectors. The shRNAs were integrated into CD163-edited cells to combine the two techniques, and the viral genes were suppressed in these cells. Conclusion We established a multi-resistant strategy against viral diseases and an in vitro shRNA verification method.

  15. A method for detection and location of high resistance earth faults

    Energy Technology Data Exchange (ETDEWEB)

    Haenninen, S; Lehtonen, M [VTT Energy, Espoo (Finland); Antila, E [ABB Transmit Oy (Finland)

    1998-08-01

    In the first part of this presentation, the theory of earth faults in unearthed and compensated power systems is briefly presented. The main factors affecting the high resistance fault detection are outlined and common practices for earth fault protection in present systems are summarized. The algorithms of the new method for high resistance fault detection and location are then presented. These are based on the change of neutral voltage and zero sequence currents, measured at the high voltage / medium voltage substation and also at the distribution line locations. The performance of the method is analyzed, and the possible error sources discussed. Among these are, for instance, switching actions, thunder storms and heavy snow fall. The feasibility of the method is then verified by an analysis based both on simulated data, which was derived using an EMTP-ATP simulator, and by real system data recorded during field tests at three substations. For the error source analysis, some real case data recorded during natural power system events, is also used

  16. Method and apparatus for remote tube crevice detection by current and voltage probe resistance measurement

    Science.gov (United States)

    Kikta, Thomas J.; Mitchell, Ronald D.

    1992-01-01

    A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet.

  17. New high resolution Random Telegraph Noise (RTN) characterization method for resistive RAM

    Science.gov (United States)

    Maestro, M.; Diaz, J.; Crespo-Yepes, A.; Gonzalez, M. B.; Martin-Martinez, J.; Rodriguez, R.; Nafria, M.; Campabadal, F.; Aymerich, X.

    2016-01-01

    Random Telegraph Noise (RTN) is one of the main reliability problems of resistive switching-based memories. To understand the physics behind RTN, a complete and accurate RTN characterization is required. The standard equipment used to analyse RTN has a typical time resolution of ∼2 ms which prevents evaluating fast phenomena. In this work, a new RTN measurement procedure, which increases the measurement time resolution to 2 μs, is proposed. The experimental set-up, together with the recently proposed Weighted Time Lag (W-LT) method for the analysis of RTN signals, allows obtaining a more detailed and precise information about the RTN phenomenon.

  18. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  19. Why Did the Bear Cross the Road? Comparing the Performance of Multiple Resistance Surfaces and Connectivity Modeling Methods

    Directory of Open Access Journals (Sweden)

    Samuel A. Cushman

    2014-12-01

    Full Text Available There have been few assessments of the performance of alternative resistance surfaces, and little is known about how connectivity modeling approaches differ in their ability to predict organism movements. In this paper, we evaluate the performance of four connectivity modeling approaches applied to two resistance surfaces in predicting the locations of highway crossings by American black bears in the northern Rocky Mountains, USA. We found that a resistance surface derived directly from movement data greatly outperformed a resistance surface produced from analysis of genetic differentiation, despite their heuristic similarities. Our analysis also suggested differences in the performance of different connectivity modeling approaches. Factorial least cost paths appeared to slightly outperform other methods on the movement-derived resistance surface, but had very poor performance on the resistance surface obtained from multi-model landscape genetic analysis. Cumulative resistant kernels appeared to offer the best combination of high predictive performance and sensitivity to differences in resistance surface parameterization. Our analysis highlights that even when two resistance surfaces include the same variables and have a high spatial correlation of resistance values, they may perform very differently in predicting animal movement and population connectivity.

  20. Error free physically unclonable function with programmed resistive random access memory using reliable resistance states by specific identification-generation method

    Science.gov (United States)

    Tseng, Po-Hao; Hsu, Kai-Chieh; Lin, Yu-Yu; Lee, Feng-Min; Lee, Ming-Hsiu; Lung, Hsiang-Lan; Hsieh, Kuang-Yeu; Chung Wang, Keh; Lu, Chih-Yuan

    2018-04-01

    A high performance physically unclonable function (PUF) implemented with WO3 resistive random access memory (ReRAM) is presented in this paper. This robust ReRAM-PUF can eliminated bit flipping problem at very high temperature (up to 250 °C) due to plentiful read margin by using initial resistance state and set resistance state. It is also promised 10 years retention at the temperature range of 210 °C. These two stable resistance states enable stable operation at automotive environments from -40 to 125 °C without need of temperature compensation circuit. The high uniqueness of PUF can be achieved by implementing a proposed identification (ID)-generation method. Optimized forming condition can move 50% of the cells to low resistance state and the remaining 50% remain at initial high resistance state. The inter- and intra-PUF evaluations with unlimited separation of hamming distance (HD) are successfully demonstrated even under the corner condition. The number of reproduction was measured to exceed 107 times with 0% bit error rate (BER) at read voltage from 0.4 to 0.7 V.

  1. Ballistic resistant article, semi-finished product for and method of making a shell for a ballistic resistant article

    NARCIS (Netherlands)

    Harings, Jules Armand Wilhelmina; Janse, Gerardus Hubertus Anna

    2013-01-01

    The invention relates to a ballistic resistant article, such as a helmet (1), comprising a double curved shell in turn comprising a stack (5) of layers (6) of an oriented anti-ballistic material, the layers comprising one or more plies and having a plurality of cuts (7), the ends of which define a

  2. Ballistic resistant article, semi-finished product for and method of making a shell for a ballistic resistant article

    NARCIS (Netherlands)

    Harings, Jules; Janse, Gerardus

    2013-01-01

    The invention relates to a ballistic resistant article, such as a helmet (1), comprising a double curved shell (2) in turn comprising a stack (5) of layers (6) of an oriented anti-ballistic material, the layers (6) comprising one or more plies and having a plurality of cuts (7), the ends of which

  3. Polarized epithermal neutron spectrometer at KENS

    International Nuclear Information System (INIS)

    Kohgi, M.

    1983-01-01

    A spectrometer employing a white, epithermal, polarized neutron beam is under construction at KENS. The neutron polarization is achieved by passage through a dynamically polarized proton filter (DPPF). The results of the test experiments show that the DPPF method is promising in obtaining polarized epithermal neutron beam. The basic design of the spectrometer is described

  4. Analysis for the depth of underground resistivity structure by using MT method

    International Nuclear Information System (INIS)

    Matsuo, Koichi; Yokoi, Koichi; Negi, Tateyuki; Kasagi, Toshio; Takahashi, Takeharu; Teshima, Minoru

    2005-03-01

    The present document is to report the result of resistivity monitoring by using MT (Magnetotelluric) method near the site proposed for the Horonobe Underground Research Program at the Horonobe-cho, Hokkaido by the Japan Nuclear Cycle Development Institute. The stationary MT observation system, installed near the HDB-1 borehole on November 2002, was moved to a site at the Hokusei-en, 4 km west of the first site. This system is monitoring for the depth of underground resistivity. Observation data at the Hokusei-en from February 1st 2004 to January 31st 2005 was added to the investigation in 2004 fiscal year. But, data cannot be obtained from July 8th to November 11th of 2004 due to the disconnection trouble of the optical fiber cable for data transfer. The results were as follows; 1) Telluric and magnetic time series data measured by MT unit were transferred to a PC installed in an observation through optical fiber cable and processed and edited automatically. 2) The standard deviation of the apparent resistivity depends on range of frequency, 3% or less in the vicinity of the Schumann resonance frequency. The Standard deviation of data from 80 Hz to 0.56 Hz was less or 13%. But the standard deviation of low frequency data was more or 15%. 3) Amplitude of telluric and magnetic spectra below 1 Hz is coincident with Geomagnetic Activity K-index. Clear correlation was not admitted in resistivity and K-index. 4) Data quality was studied compared with weather data. Clear correlation was not admitted for windy day and rainy day. 5) Data was edited by the new criterion of K-index 1.3 or more, wind 6 m/s or less, precipitation 6 mm or less. As a result, the improvement of the data quality was admitted by 5 frequencies of 9 frequencies. Only one side of resistivity Rxy and Ryx was improved by 4 frequencies of the remainder. 6) In addition, data was edited by the new criterion of the coherence of the electric-magnetic amplitude. As a result, the improvement of the data quality

  5. Porosity determination from 2-D resistivity method in studying the slope failures

    Science.gov (United States)

    Maslinda, Umi; Nordiana, M. M.; Bery, A. A.

    2017-07-01

    Slope failures have become the main focus for infrastructures development on hilly areas in Malaysia especially the development of tourism and residential. Lack of understanding and information of the subsoil conditions and geotechnical issues are the main cause of the slope failures. The failures happened are due to a combination of few factors such as topography, climate, geology and land use. 2-D resistivity method was conducted at the collapsed area in Selangor. The 2-D resistivity was done to study the instability of the area. The collapsed occurred because of the subsurface materials was unstable. Pole-dipole array was used with 5 m minimum electrode spacing for the 2-D resistivity method. The data was processed using Res2Dinv software and the porosity was calculated using Archie's law equation. The results show that the saturated zone (1-100 Ωm), alluvium or highly weathered rock (100-1000 Ωm), boulders (1600-7000 Ωm) and granitic bedrock (>7000 Ωm). Generally, the slope failures or landslides occur during the wet season or after rainfall. It is because of the water infiltrate to the slope and cause the saturation of the slope which can lead to landslides. Then, the porosity of saturated zone is usually high because of the water content. The area of alluvium or highly weathered rock and saturated zone have high porosity (>20%) and the high porosity also dominated at almost all the collapsed area which means that the materials with porosity >20% is potential to be saturated, unstable and might trigger slope failures.

  6. Dynamic nuclear spin polarization

    Energy Technology Data Exchange (ETDEWEB)

    Stuhrmann, H B [GKSS-Forschungszentrum Geesthacht GmbH (Germany)

    1996-11-01

    Polarized neutron scattering from dynamic polarized targets has been applied to various hydrogenous materials at different laboratories. In situ structures of macromolecular components have been determined by nuclear spin contrast variation with an unprecedented precision. The experiments of selective nuclear spin depolarisation not only opened a new dimension to structural studies but also revealed phenomena related to propagation of nuclear spin polarization and the interplay of nuclear polarisation with the electronic spin system. The observation of electron spin label dependent nuclear spin polarisation domains by NMR and polarized neutron scattering opens a way to generalize the method of nuclear spin contrast variation and most importantly it avoids precontrasting by specific deuteration. It also likely might tell us more about the mechanism of dynamic nuclear spin polarisation. (author) 4 figs., refs.

  7. Polarization measurements made on LFRA and OASIS emitter arrays

    Science.gov (United States)

    Geske, Jon; Sparkman, Kevin; Oleson, Jim; Laveigne, Joe; Sieglinger, Breck; Marlow, Steve; Lowry, Heard; Burns, James

    2008-04-01

    Polarization is increasingly being considered as a method of discrimination in passive sensing applications. In this paper the degree of polarization of the thermal emission from the emitter arrays of two new Santa Barbara Infrared (SBIR) micro-bolometer resistor array scene projectors was characterized at ambient temperature and at 77 K. The emitter arrays characterized were from the Large Format Resistive Array (LFRA) and the Optimized Arrays for Space-Background Infrared Simulation (OASIS) scene projectors. This paper reports the results of this testing.

  8. The polarization modulation and fabrication method of two dimensional silica photonic crystals based on UV nanoimprint lithography and hot imprint.

    Science.gov (United States)

    Guo, Shuai; Niu, Chunhui; Liang, Liang; Chai, Ke; Jia, Yaqing; Zhao, Fangyin; Li, Ya; Zou, Bingsuo; Liu, Ruibin

    2016-10-04

    Based on a silica sol-gel technique, highly-structurally ordered silica photonic structures were fabricated by UV lithography and hot manual nanoimprint efforts, which makes large-scale fabrication of silica photonic crystals easy and results in low-cost. These photonic structures show perfect periodicity, smooth and flat surfaces and consistent aspect ratios, which are checked by scanning electron microscopy (SEM) and atomic force microscopy (AFM). In addition, glass substrates with imprinted photonic nanostructures show good diffraction performance in both transmission and reflection mode. Furthermore, the reflection efficiency can be enhanced by 5 nm Au nanoparticle coating, which does not affect the original imprint structure. Also the refractive index and dielectric constant of the imprinted silica is close to that of the dielectric layer in nanodevices. In addition, the polarization characteristics of the reflected light can be modulated by stripe nanostructures through changing the incident light angle. The experimental findings match with theoretical results, making silica photonic nanostructures functional integration layers in many optical or optoelectronic devices, such as LED and microlasers to enhance the optical performance and modulate polarization properties in an economical and large-scale way.

  9. All ITO-based transparent resistive switching random access memory using oxygen doping method

    International Nuclear Information System (INIS)

    Kim, Hee-Dong; Yun, Min Ju; Kim, Sungho

    2015-01-01

    Recently, transparent memory would be useful in invisible electronics. In this work, for the first time we present a feasibility of stable unipolar resistive switching (RS) characteristics with reset current of sub-micron ampere for the fully transparent ITO/oxygen-doped ITO/ITO memory capacitors, i.e., all ITO structures, produced by sputtering method, which shows a high optical transmittance of approximately 80% in the visible region as well as near ultra-violet region. In addition, in a RS test to evaluate a reliability for the proposed memory devices, we observed a stable endurance of >100 cycles and a retention time of >10 4  s at 85 °C, with a current ratio of ∼10 2 to ∼10 3 . This result indicates that this transparent memory by engineering the amount of oxygen ions within the ITO films could be a milestone for future see-through electronic devices. - Highlights: • The resistive switching characteristics of the transparent ITO/O-doped ITO/ITO RRAM cells have investigated. • All ITO-based RRAM cell is achieved using oxygen doping method. • Good endurance and long retention time were observed.

  10. Improvement of humidity resistance of water soluble core by precipitation method

    Directory of Open Access Journals (Sweden)

    Zhang Long

    2011-05-01

    Full Text Available Water soluble core has been widely used in manufacturing complex metal components with hollow configurations or internal channels; however, the soluble core can absorb water easily from the air at room temperature. To improve the humidity resistance of the water soluble core and optimize the process parameters applied in manufacturing of the water soluble core, a precipitation method and a two-level-three-full factorial central composite design were used, respectively. The properties of the cores treated by the precipitation method were compared with that without any treatment. Through a systematical study by means of both an environmental scanning electron microscope (ESEM and an energy dispersive X-ray (EDX analyzer, the results indicate that the hygroscopicity can be reduced by 20% and the obtained optimal process conditions for three critical control factors affecting the hygroscopicity are 0.2 g·mL-1 calcium chloride concentration, 4% water concentration and 0 min ignition time. The porous surface coated by calcium chloride and the high humidity resistance products generated in the precipitation reaction between calcium chloride and potassium carbonate may contribute to the lower hygroscopicity.

  11. Determination of Soft Lithology Causes The Land Subsidence in Coastal Semarang City by Resistivity Methods

    Science.gov (United States)

    Widada, Sugeng; Saputra, Sidhi; Hariadi

    2018-02-01

    Semarang City is located in the northern coastal plain of Java which is geologically composed of alluvial deposits. The process of the sediment diagenesis has caused a land subsidence. On the other hand, the development of the industrial, service, education and housing sectors has increased the number of building significantly. The number of building makes the pressure of land surface increased, and finally, this also increased the rate of land subsidence. The drilling data indicates that not all layers of lithology are soft layers supporting the land subsidence. However, vertical distribution of the soft layer is still unclear. This study used Resistivity method to map out the soft zone layers of lithology. Schlumberger electrode configuration with sounding system method was selected to find a good vertical resolution and maximum depth. The results showed that the lithology layer with resistivity less than 3 ohm is a layer of clay and sandy clay that has the low bearing capacity so easily compressed by pressure load. A high land subsidence is happening in the thick soft layer. The thickness of that layer is smaller toward the direction of avoiding the beach. The improvement of the bearing capacity of this layer is expected to be a solution to the problem of land subsidence.

  12. ASSESSMENT OF CERAMIC TILE FROST RESISTANCE BY MEANS OF THE FREQUENCY INSPECTION METHOD

    Directory of Open Access Journals (Sweden)

    MICHAL MATYSÍK

    2011-06-01

    Full Text Available The paper presents some results of our experimental analysis of ceramic cladding element frost resistance, particular attention being paid to the application of the frequency inspection method. Three different sets of ceramic tiles of the Ia class to EN 14 411 B standard made by various manufacturers have been analyzed. The ceramic tiles under investigation have been subjected to freeze-thaw-cycle-based degradation in compliance with the relevant ČSN EN ISO 10545-12 standard. Furthermore, accelerated degradation procedure has been applied to selected test specimens, consisting in reducing the temperature of water soaked ceramic tiles in the course of the degradation cycles down –70°C. To verify the correctness of the frequency inspection results, additional physical properties of the ceramic tiles under test have been measured, such as, the ceramic tile strength limit, modulus of elasticity and modulus of deformability, resulting from the flexural tensile strength tests, integrity defect and surface micro-geometry tracking. It has been proved that the acoustic method of frequency inspection is a sensitive indicator of the structure condition and can be applied to the ceramic cladding element frost resistance and service life prediction assessment.

  13. Using Linear Spectral Method when Calculating Seismic Resistance of Large-Capacity Vertical Steel Tanks

    Directory of Open Access Journals (Sweden)

    Tarasenko Alexandr

    2016-01-01

    Full Text Available The paper is aimed at determining the possibility of applying the simplified method proposed by the authors to calculate the tank seismic resistance in compliance with current regulations and scientific provisions. The authors propose a highly detailed numerical model for a common oil storage tank RVSPK-50000 that enables static operational loads and dynamic action of earthquakes to be calculated. Within the modal analysis the natural oscillation frequencies in the range of 0-10 Hz were calculated; the results are given for the first ten modes. The model takes into account the effect of impulsive and convective components of hydrodynamic pressure during earthquakes. Within the spectral analysis by generalized response spectra was calculated a general stress-strain state of a structure during earthquakes of 7, 8, 9 intensity degrees on the MSK-64 scale for a completely filled up, a half-filled up to the mark of 8.5 m and an empty RVSPK-50000 tank. The developed finite element model can be used to perform calculations of seismic resistance by the direct dynamic method, which will give further consideration to the impact of individual structures (floating roof, support posts, adjoined elements of added stiffness on the general stress-strain state of a tank.

  14. A pseudo-spectral method for the simulation of poro-elastic seismic wave propagation in 2D polar coordinates using domain decomposition

    Energy Technology Data Exchange (ETDEWEB)

    Sidler, Rolf, E-mail: rsidler@gmail.com [Center for Research of the Terrestrial Environment, University of Lausanne, CH-1015 Lausanne (Switzerland); Carcione, José M. [Istituto Nazionale di Oceanografia e di Geofisica Sperimentale (OGS), Borgo Grotta Gigante 42c, 34010 Sgonico, Trieste (Italy); Holliger, Klaus [Center for Research of the Terrestrial Environment, University of Lausanne, CH-1015 Lausanne (Switzerland)

    2013-02-15

    We present a novel numerical approach for the comprehensive, flexible, and accurate simulation of poro-elastic wave propagation in 2D polar coordinates. An important application of this method and its extensions will be the modeling of complex seismic wave phenomena in fluid-filled boreholes, which represents a major, and as of yet largely unresolved, computational problem in exploration geophysics. In view of this, we consider a numerical mesh, which can be arbitrarily heterogeneous, consisting of two or more concentric rings representing the fluid in the center and the surrounding porous medium. The spatial discretization is based on a Chebyshev expansion in the radial direction and a Fourier expansion in the azimuthal direction and a Runge–Kutta integration scheme for the time evolution. A domain decomposition method is used to match the fluid–solid boundary conditions based on the method of characteristics. This multi-domain approach allows for significant reductions of the number of grid points in the azimuthal direction for the inner grid domain and thus for corresponding increases of the time step and enhancements of computational efficiency. The viability and accuracy of the proposed method has been rigorously tested and verified through comparisons with analytical solutions as well as with the results obtained with a corresponding, previously published, and independently benchmarked solution for 2D Cartesian coordinates. Finally, the proposed numerical solution also satisfies the reciprocity theorem, which indicates that the inherent singularity associated with the origin of the polar coordinate system is adequately handled.

  15. The polarization of fast neutrons

    International Nuclear Information System (INIS)

    Talov, V.V.

    2001-01-01

    It is insufficient to know coordinates and momentum to describe a state of a neutron. It is necessary to define a spin orientation. As far as it is known from quantum mechanics, a half spin has a projection in the positive direction or in the negative direction. The probability of both projections in an unpolarized beam is equal. If a direction exists, in which the projection is more probably then beam is called polarized in this direction. It is essential to know polarization of neutrons for characteristics of a neutron source, which is emitting it. The question of polarization of fast neutrons came up in 50's. The present work is the review of polarization of fast neutrons and methods of polarization analysis. This also includes information about polarization of fast neutrons from first papers, which described polarization in the D(d,n) 3 He, 7 Li (p,n) 7 Be, T(p,n) 3 He reactions. (authors)

  16. A facile method to prepare superhydrophobic fluorinated polysiloxane/ZnO nanocomposite coatings with corrosion resistance

    Science.gov (United States)

    Qing, Yongquan; Yang, Chuanning; Hu, Chuanbo; Zheng, Yansheng; Liu, Changsheng

    2015-01-01

    In this paper, we report a simple and inexpensive method for fabricating fluorinated polysiloxane/ZnO nanocomposite coatings on the steel substrates. The surface wettability and topology of coating were characterized by contact angle measurement, scanning electron microscope and Fourier transform infrared spectrometry. The results showed that the hydrophobic sbnd CH3 and sbnd CH2sbnd groups were introduced into ZnO particles via modification, the ZnO nanoparticles were modified from hydrophilic to hydrophobic. When the weight ratio of modified-ZnO to fluorinated polysiloxane was 13:7, the contact angle of nanocomposite coating was 166°, and a sliding angle of 4°, coating surface with hierarchical micro/nano-structures. In addition, the as-prepared superhydrophobic surface has excellent durability and corrosion resistance. It is believed that the facile and low-cost method offer an effective strategy and promising industrial applications for fabricating superhydrophobic surfaces on steel materials.

  17. A method for producing electrolyte and heat resistant drilling muds from bentonite clays

    Energy Technology Data Exchange (ETDEWEB)

    Koyev, K; Bedelcheva, A; Uzunova, I

    1979-01-01

    A method is developed for producing clay suspensions, which are resistant to electrolytes, high temperature and pressure, on the basis of bentonite clays with a high content of montmorillonite. The method is based on the subsequent introduction into the suspension of magnesium chloride (calcium chloride) and sodium chloride with intense mixing and maintenance of the high viscosity of the clay mass. The electrolytes are added in a specific order and volume: the magnesium chloride or calcium chloride at 1-3% and the sodium chloride at approximately 30%. The clay suspensions are characterized by high SNS and filtration (40 cm/sup 3/ in 30 min). The operational indicators may be regulated so that they remain in accordance with the required standards.

  18. Development of a Simple and Effective Bioassay Method to Evaluate Resistance of Watermelon Plants to Fusarium oxysporum f. sp. niveum

    Directory of Open Access Journals (Sweden)

    Eun Ju Jo

    2017-06-01

    Full Text Available Root-dipping inoculation method has been widely used to determine the resistance of watermelon to Fusarium oxysporum f. sp. niveum causing Fusarium wilt. Although this method leads to the precise results of plant disease responses, more rapid and efficient assay methods have been still required because the root-dipping inoculation method is labor-intensive and time-consuming. In this study, we established a simple and effective bioassay method based on the comparison of various inoculation methods and growth conditions. To develop the system, the occurrence of Fusarium wilt on four resistant and susceptible cultivars was investigated by four different inoculation methods, root-dipping, scalpel, tip and soil-drenching methods. Of these inoculation methods, scalpel method resulted in clear plant disease resistance responses with the simplicity. With the use of scalpel method, we also explored the disease development of the cultivars depending on inoculum concentration, growth stage of seedlings, and incubation temperature after inoculation. Furthermore, we found that the resistance degrees of 23 cultivars derived by scalpel inoculation method were similar to the results by root-dipping method established previously.

  19. Sources of polarized neutrons

    International Nuclear Information System (INIS)

    Walter, L.

    1983-01-01

    Various sources of polarized neutrons are reviewed. Monoenergetic source produced with unpolarized or polarized beams, white sources of polarized neutrons, production by transmissions through polarized hydrogen targets and polarized thermal neutronsare discussed, with appropriate applications included. (U.K.)

  20. A Simultaneous Analytical Method to Profile Non-Volatile Components with Low Polarity Elucidating Differences Between Tobacco Leaves Using Atmospheric Pressure Chemical Ionization Mass Spectrometry Detection

    Directory of Open Access Journals (Sweden)

    Ishida Naoyuki

    2016-04-01

    Full Text Available A comprehensive analytical method using liquid chromatography atmospheric pressure chemical ionization mass spectrometry detector (LC/APCI-MSD was developed to determine key non-volatile components with low polarity elucidating holistic difference among tobacco leaves. Nonaqueous reversed-phase chromatography (NARPC using organic solvent ensured simultaneous separation of various components with low polarity in tobacco resin. Application of full-scan mode to APCI-MSD hyphenated with NARPC enabled simultaneous detection of numerous intense product ions given by APCI interface. Parameters for data processing to filter, feature and align peaks were adjusted in order to strike a balance between comprehensiveness and reproducibility in analysis. 63 types of components such as solanesols, chlorophylls, phytosterols, triacylglycerols, solanachromene and others were determined on total ion chromatograms according to authentic components, wavelength spectrum and mass spectrum. The whole area of identified entities among the ones detected on total ion chromatogram reached to over 60% and major entities among those identified showed favorable linearity of determination coefficient of over 0.99. The developed method and data processing procedure were therefore considered feasible for subsequent multivariate analysis. Data matrix consisting of a number of entities was then subjected to principal component analysis (PCA and hierarchical clustering analysis. Cultivars of tobacco leaves were distributed far from each cultivar on PCA score plot and each cluster seemed to be characterized by identified non-volatile components with low polarity. While fluecured Virginia (FCV was loaded by solanachromene, phytosterol esters and triacylglycerols, free phytosterols and chlorophylls loaded Burley (BLY and Oriental (ORI respectively. Consequently the whole methodology consisting of comprehensive method and data processing procedure proved useful to determine key

  1. Sulfate resistance evaluation of the cement with fly ash (using the Koch & Steinegger method

    Directory of Open Access Journals (Sweden)

    Irassar, Edgardo F.

    1988-12-01

    Full Text Available The increase of active mineral admixtures consumption in contemporaneous cementiceous materials has stablished revision of some test methods. In the evaluation of blended cement durability, many accelerated tests of large application in portland cements become unvalid, because they don't allow to value the improvements produced by pozzolan materials. Koch-Steinegger Method appears as the most appropiate to evaluate sulfate resistance of cement with active mineral admixtures. In this paper are presented the results obtained with this test in the evaluation of an ordinary portland cement (CPN and one resisting sulfates (CPARS, with low calcium fly ash addition. Fly ash is incorporated with three fineness (280, 420 and 480 m2/Kg Blaine. The results show that this addition improves sulfate resistance of CPN and in minor way of ARS cement. Fly ash influences evolution of mechanical strength in water and chemical resistance at first ages.

    El aumento del consumo de las adiciones minerales activas en los materiales cementíceos contemporáneos ha determinado la revisión de algunos métodos de ensayo utilizados para determinar sus propiedades. En la evaluación de la durabilidad de los cementos compuestos, muchos ensayos de corta duración (de gran aplicación en cementos portland dejan de tener validez, pues no permiten evaluar las mejoras que producen los materiales puzolánicos. El método propuesto por KOCH & STEINEGGER (1960 aparece como uno de los más apropiados para determinar el comportamiento de cementos con adiciones minerales activas frente al ataque de sulfatos. En este trabajo se presentan los resultados alcanzados con ente ensayo en la determinación del comportamiento de un cemento portland normal (CRN y uno resistente a los sulfatos (CPARS, adicionados con ceniza volante de bajo contenido en óxido de calcio. La ceniza se incorpora con tres finuras (280, 420 y 480 m2/kg —Blaine—. Estos

  2. Comparison of the multi-drug resistant human hepatocellular carcinoma cell line Bel-7402/ADM model established by three methods

    Directory of Open Access Journals (Sweden)

    Zhong Xingguo

    2010-08-01

    Full Text Available Abstract Background To compare the biological characteristics of three types of human hepatocellular carcinoma multi-drug resistant cell sub-lines Bel-7402/ADM models established by three methods. Methods Established human hepatocellular carcinoma adriamycin (ADM multi-drug resistant cell sub-lines models Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS by three methods of in vitro concentration gradient increased induction, nude mice liver-implanted induction and subcutaneous-implanted induction respectively. Phase contrast microscopy was used to observe the cells and the MTT (methyl thiazolyl tetrazolium method was used to detect drug resistance of the three different sub-lines of cells. Results The three groups of drug resistant cells, Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS generated cross-resistance to ADM and CDDP (cis-Diaminedichloroplatinum, but showed a significant difference in resistance to Bel-7402 IC50 value (P V, 46 h (Bel-7402/ADML, and 45 h (Bel-7402/ADMS. The excretion rates of ADM were significantly increased compared with the parent cell (34.14% line and were 81.06% (Bel-7402/ADMV, 66.56% (Bel-7402/ADML and 61.56% (Bel-7402/ADMS. Expression of P-gp and MRP in the three groups of resistant cells was significantly enhanced (P P > 0.05. Conclusions Stable resistance was involved in the resistant cell line model established by the above three methods. Liver implantation was a good simulation of human hepatocellular and proved to be an ideal model with characteristics similar to human hepatocellular biology and the pharmacokinetics of anticancer drugs.

  3. H- ion current from a polarized vapor target

    International Nuclear Information System (INIS)

    Cornelius, W.D.

    1984-01-01

    A method of determining the polarization transferred to hydrogen atoms in charge-exchange reactions is outlined. The method also provides a means of determining target polarizations once the polarization transfer function is known

  4. Polarized Neutron Scattering

    OpenAIRE

    Roessli, B.; Böni, P.

    2000-01-01

    The technique of polarized neutron scattering is reviewed with emphasis on applications. Many examples of the usefulness of the method in various fields of physics are given like the determination of spin density maps, measurement of complex magnetic structures with spherical neutron polarimetry, inelastic neutron scattering and separation of coherent and incoherent scattering with help of the generalized XYZ method.

  5. An AC Resistance Optimization Method Applicable for Inductor and Transformer Windings with Full Layers and Partial Layers

    DEFF Research Database (Denmark)

    Shen, Zhan; Li, Zhiguang; Jin, Long

    2017-01-01

    This paper proposes an ac resistance optimization method applicable for both inductor and transformer windings with full layers and partial layers. The proposed method treats the number of layers of the windings as a design variable instead of as a predefined parameter, compared to existing methods...

  6. Effects of resistive bodies on DC electrical soundings

    Directory of Open Access Journals (Sweden)

    L. Alfano

    1996-06-01

    Full Text Available Some deep DC electrical soundings, performed in alpine and apenninic areas with the continuous polar dipole-dipole spread, show apparent resistivity curves with positive slopes. Measured values of apparent resistivity reach 30000 Wm. Applying the "surface charges" method we developed three dimensional mathematical models, by means of which we can state simple rules for determining the minimum extensions of the deep resistive bodies, fundamental information for a more precise interpretation of the field results.

  7. Polarization: A must for fusion

    Directory of Open Access Journals (Sweden)

    Didelez J.-P.

    2013-11-01

    Full Text Available The complete polarization of DT fuel would increase the fusion reactivity by 50% in magnetic as well as in inertial confinements. The persistence of polarization in a fusion process could be tested, using a terawatt laser hitting a polarized HD target. The polarized deuterons heated in the plasma induced by the laser can fuse producing a 3He and a neutron in the final state. The angular distribution of the emitted neutrons and the change in the corresponding total Cross Section (CS can sign the polarization persistence. The polarization of solid H2, D2 or T2 Hydrogen isotopes is very difficult. However, it has been possible to polarize HD, a hetero-molecular form of Hydrogen, by static polarization, at very low temperature and very high field. The radioactivity of DT molecules forbids there high polarization by the static method, therefore one has to develop the Dynamic Nuclear Polarization (DNP by RF transitions. The DNP of HD has been investigated in the past. The magnetic properties of HD and DT molecules are very similar, it is therefore expected that any polarization result obtained with HD could be extrapolated to DT.

  8. Estimation of weld nugget temperature by thermography method in resistance projection welding process

    International Nuclear Information System (INIS)

    Setty, D.S.; Rameswara Roa, A.; Hemantha Rao, G.V.S.; Jaya Raj, R.N.

    2008-01-01

    In the Pressurized Heavy Water Reactor (PHWR) fuel manufacturing, zirconium alloy appendages like spacer and bearing pads are welded to the thin wall zirconium alloy fuel tubes by using resistance projection welding process. Out of many joining processes available, resistance-welding process is reliable, environment friendly and best suitable for mass production applications. In the fuel assembly, spacer pads are used to get the required inter-element spacing and Bearing pads are used to get the required load-bearing surface for the fuel assembly. Performance of the fuel assembly in the reactor is greatly influenced by these weld joint's quality. Phase transformation from α to β phase is not acceptable while welding these tiny appendages. At present only destructive metallography test is available for this purpose. This can also be achieved by measuring weld nugget temperature where in the phase transformation temperature for zirconium alloy material is 853 o C. The temperature distribution during resistance welding of tiny parts cannot be measured by conventional methods due to very small space and short weld times involved in the process. Shear strength, dimensional accuracy and weld microstructures are some of the key parameters used to measure the quality of appendage weld joints. Weld parameters were optimized with the help of industrial experimentation methodology. Individual projection welding by split electrode concept, and during welding on empty tube firm support is achieved on inner side of the tube by using expandable pneumatic mandrel. In the present paper, an attempt was made to measure the weld nugget temperature by thermography technique and is correlated with standard microstructures of zirconium alloy material. The temperature profiles in the welding process are presented for different welding conditions. This technique has helped in measuring the weld nugget temperature more accurately. It was observed that in the present appendage welding

  9. Blazed vector grating liquid crystal cells with photocrosslinkable polymeric alignment films fabricated by one-step polarizer rotation method

    Science.gov (United States)

    Kawai, Kotaro; Kuzuwata, Mitsuru; Sasaki, Tomoyuki; Noda, Kohei; Kawatsuki, Nobuhiro; Ono, Hiroshi

    2014-12-01

    Blazed vector grating liquid crystal (LC) cells, in which the directors of low-molar-mass LCs are antisymmetrically distributed, were fabricated by one-step exposure of an empty glass cell inner-coated with a photocrosslinkable polymer LC (PCLC) to UV light. By adopting a LC cell structure, twisted nematic (TN) and homogeneous (HOMO) alignments were obtained in the blazed vector grating LC cells. Moreover, the diffraction efficiency of the blazed vector grating LC cells was greatly improved by increasing the thickness of the device in comparison with that of a blazed vector grating with a thin film structure obtained in our previous study. In addition, the diffraction efficiency and polarization states of ±1st-order diffracted beams from the resultant blazed vector grating LC cells were controlled by designing a blazed pattern in the alignment films, and these diffraction properties were well explained on the basis of Jones calculus and the elastic continuum theory of nematic LCs.

  10. Role of spin polarized tunneling in magnetoresistance and low

    Indian Academy of Sciences (India)

    Role of spin polarized tunneling in magnetoresistance and low temperature minimum of polycrystalline La1–KMnO3 ( = 0.05, 0.1, ... Manganites; magnetoresistance; low temperature resistivity; spin polarized tunneling. ... Current Issue

  11. Coal Layer Identification using Electrical Resistivity Imaging Method in Sinjai Area South Sulawesi

    Science.gov (United States)

    Ilham Samanlangi, Andi

    2018-03-01

    The purpose of this research is to image subsurface resistivity for coal identification in Panaikang Village, Sinjai, South Sulawesi.Resistivity measurements were conducted in 3 lines of length 400 meters and 300 meter using resistivity imaging, dipole-dipole configuration. Resistivity data was processed using Res2DInv software to image resistivity variation and interpret lithology. The research results shown that coal resistivity in Line is about 70-200 Ωm, Line 2 is about 70-90 Ωm, and Line 3 is about 70-200 Ωm with average thickness about 10 meters and distributed to the east of research area.

  12. Methods for estimating the burden of antimicrobial resistance: a systematic literature review protocol

    Directory of Open Access Journals (Sweden)

    Nichola R. Naylor

    2016-11-01

    Full Text Available Abstract Background Estimates of the burden of antimicrobial resistance (AMR are needed to ascertain AMR impact, to evaluate interventions, and to allocate resources efficiently. Recent studies have estimated health, cost, and economic burden relating to AMR, with outcomes of interest ranging from drug-bug resistance impact on mortality in a hospital setting to total economic impact of AMR on the global economy. However, recent collation of this information has been largely informal, with no formal quality assessment of the current evidence base (e.g. with predefined checklists. This review therefore aims to establish what perspectives and resulting methodologies have been used in establishing the burden of AMR, whilst also ascertaining the quality of these studies. Methods The literature review will identify relevant literature using a systematic review methodology. MEDLINE, EMBASE, Scopus and EconLit will be searched utilising a predefined search string. Grey literature will be identified by searching within a predefined list of organisational websites. Independent screening of retrievals will be performed in a two-stage process (abstracts and full texts, utilising a pre-defined inclusion and exclusion criteria. Data will be extracted into a data extraction table and descriptive examination will be performed. Study quality will be assessed using the Newcastle-Ottawa scales and the Philips checklists where appropriate. A narrative synthesis of the results will be presented. Discussion This review will provide an overview of previous health, cost and economic definitions of burden and the resultant impact of these different definitions on the burden of AMR estimated. The review will also explore the methods that have been used to calculate this burden and discuss resulting study quality. This review can therefore act as a guide to methods for future research in this area. Systematic review registration PROSPERO CRD42016037510

  13. NMR dispersion measurement of dynamic nuclear polarization

    International Nuclear Information System (INIS)

    Davies, K.; Cox, S.F.J.

    1978-01-01

    The feasibility of monitoring dynamic nuclear polarization from the NMR dispersive susceptibility is examined. Two prototype instruments are tested in a polarized proton target using organic target material. The more promising employs a tunnel diode oscillator, inside the target cavity, and should provide a precise polarization measurement working at a frequency far enough from the main resonance for the disturbance of the measured polarization to be negligible. Other existing methods for measuring target polarization are briefly reviewed. (author)

  14. Towards a Scalable Fully-Implicit Fully-coupled Resistive MHD Formulation with Stabilized FE Methods

    Energy Technology Data Exchange (ETDEWEB)

    Shadid, J N; Pawlowski, R P; Banks, J W; Chacon, L; Lin, P T; Tuminaro, R S

    2009-06-03

    This paper presents an initial study that is intended to explore the development of a scalable fully-implicit stabilized unstructured finite element (FE) capability for low-Mach-number resistive MHD. The discussion considers the development of the stabilized FE formulation and the underlying fully-coupled preconditioned Newton-Krylov nonlinear iterative solver. To enable robust, scalable and efficient solution of the large-scale sparse linear systems generated by the Newton linearization, fully-coupled algebraic multilevel preconditioners are employed. Verification results demonstrate the expected order-of-acuracy for the stabilized FE discretization of a 2D vector potential form for the steady and transient solution of the resistive MHD system. In addition, this study puts forth a set of challenging prototype problems that include the solution of an MHD Faraday conduction pump, a hydromagnetic Rayleigh-Bernard linear stability calculation, and a magnetic island coalescence problem. Initial results that explore the scaling of the solution methods are presented on up to 4096 processors for problems with up to 64M unknowns on a CrayXT3/4. Additionally, a large-scale proof-of-capability calculation for 1 billion unknowns for the MHD Faraday pump problem on 24,000 cores is presented.

  15. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-12-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  16. Measuring fluorescence polarization with a dichrometer.

    Science.gov (United States)

    Sutherland, John C

    2017-09-01

    A method for obtaining fluorescence polarization data from an instrument designed to measure circular and linear dichroism is compared with a previously reported approach. The new method places a polarizer between the sample and a detector mounted perpendicular to the direction of the incident beam and results in determination of the fluorescence polarization ratio, whereas the previous method does not use a polarizer and yields the fluorescence anisotropy. A similar analysis with the detector located axially with the excitation beam demonstrates that there is no frequency modulated signal due to fluorescence polarization in the absence of a polarizer. Copyright © 2017. Published by Elsevier Inc.

  17. On the use of the polarization method of remote indication of oil pollutants on the sea surface under different hydrometerological conditions and at different altitudes of the sun

    Energy Technology Data Exchange (ETDEWEB)

    Buznikov, A A; Lakhtanov, G A

    1980-01-01

    Results of experimental investigations of water areas of the Caspian sea with the aid of a specially developed shipboard polarimeter. Interpretation of the remote measurements was carried out by laboratory analysis of the thickness of the oil film and the amount of dissolved oil in samples gathered from the surface of the sea. Analysis of the influence of weather conditions and of the composition of the petroleum products on the results of remote indications made it possible to formulate concrete methodical recommendations for achieving optimum results in remote assessment of oil pollutants of seawater areas. The effectiveness of the polarization method under different hydrometerological conditions makes it possible to regard it as a good supplementation to the traditional visual and instrumental methods of monitoring pollution of bodies of water.

  18. [Diagnosis of insulin resistance by indirect methods in obese school children].

    Science.gov (United States)

    Angulo, Nerkis; de Szarvas, Sobeida Barbella; Mathison, Yaira; Hadad, Erika; González, Dora; Hernández, Ana; Guevara, Harold

    2013-06-01

    Obesity leads to a deterioration of glucose tolerance and the action of insulin. The purpose of this study was to determine insulin resistance (IR) by indirect methods, and its correlation with clinical, anthropometric and biochemical variables in obese normoglycemic school children. This was a descriptive-correlational study of 72 school prepubescent children, who attended the ambulatory "El Concejo" of the University of Carabobo (UC) and at the Gastroenterology and Pediatric Nutrition service of the city hospital "Enrique Tejera" (CHET), in Valencia, Venezuela, between January-April 2011. exogenous obesity. We assessed personal and family history, presence of Acanthosis Nigricans and nutritional and biochemical status. We found a higher percentage of IR, through the use of the QUICKI method (66.7%), followed by the HOMA (55.6%) and basal insulin (45.9%). The mean (chi) indexes of body mass and waist circumference were significantly greater (p method detected significant differences (p methods. In conclusion, the evaluated techniques, QUICKI, HOMA and basal insulin indexes, were most effective for detecting the IR.

  19. Polarization study

    International Nuclear Information System (INIS)

    Nurushev, S.B.

    1989-01-01

    Brief review is presented of the high energy polarization study including experimental data and the theoretical descriptions. The mostimportant proposals at the biggest accelerators and the crucial technical developments are also listed which may become a main-line of spin physics. 35 refs.; 10 figs.; 4 tabs

  20. Polar Stratigraphy

    Science.gov (United States)

    1999-01-01

    These three images were taken on three different orbits over the north polar cap in April 1999. Each shows a different part of the same ice-free trough. The left and right images are separated by a distance of more than 100 kilometers (62 miles). Note the similar layers in each image.

  1. Application of Monte Carlo Method for Evaluation of Uncertainties of ITS-90 by Standard Platinum Resistance Thermometer

    Science.gov (United States)

    Palenčár, Rudolf; Sopkuliak, Peter; Palenčár, Jakub; Ďuriš, Stanislav; Suroviak, Emil; Halaj, Martin

    2017-06-01

    Evaluation of uncertainties of the temperature measurement by standard platinum resistance thermometer calibrated at the defining fixed points according to ITS-90 is a problem that can be solved in different ways. The paper presents a procedure based on the propagation of distributions using the Monte Carlo method. The procedure employs generation of pseudo-random numbers for the input variables of resistances at the defining fixed points, supposing the multivariate Gaussian distribution for input quantities. This allows taking into account the correlations among resistances at the defining fixed points. Assumption of Gaussian probability density function is acceptable, with respect to the several sources of uncertainties of resistances. In the case of uncorrelated resistances at the defining fixed points, the method is applicable to any probability density function. Validation of the law of propagation of uncertainty using the Monte Carlo method is presented on the example of specific data for 25 Ω standard platinum resistance thermometer in the temperature range from 0 to 660 °C. Using this example, we demonstrate suitability of the method by validation of its results.

  2. Applicability of the lattice Boltzmann method to determine the ohmic resistance in equivalent resistor connections

    Science.gov (United States)

    Espinoza-Andaluz, Mayken; Barzola, Julio; Guarochico-Moreira, Víctor H.; Andersson, Martin

    2017-12-01

    Knowing the ohmic resistance in the materials allow to know in advance its electrical behavior when a potential difference is applied, and therefore the prediction of the electrical performance can be achieved in a most certain manner. Although the Lattice Boltzmann method (LBM) has been applied to solve several physical phenomena in complex geometries, it has only been used to describe the fluid phase, but applicability studies of LBM on the solid-electric-conducting material have not been carried out yet. The purpose of this paper is to demonstrate the accuracy of calculating the equivalent resistor connections using LBM. Several series and parallel resistor connections are effected. All the computations are carried out with 3D models, and the domain materials are designed by the authors.

  3. Method for measuring the resistive transition and critical current in superconductors using pulsed current

    International Nuclear Information System (INIS)

    McGinnis, W.C.; Jones, T.E.

    1993-01-01

    A method is described for measuring the intragranular critical current of a granular superconductive material, comprising the steps of: conducting a substantially rectangular electronic pulse through said material so as to conduct a current through said material such that when said intragranular critical current of said material is exceeded, any grains present in said material are in a superconducting state when said current is less than said intragranular critical current, said material having a critical temperature; measuring said current through said material while conducting said pulse; measuring a voltage difference across said material while conducting said pulse; and determining said intragranular critical current through said material by varying said current to discern a current level at which an electrical resistance of said material increases to that of a non-superconducting state as the grains of said material transition from said superconducting to said non-superconducting state

  4. Development of fatigue resistance evaluation method for socket-weld-jointed pipes

    International Nuclear Information System (INIS)

    Noguchi, Shinji; Shibayama, Motoaki; Iwata, Masazumi; Matsuura, Masayuki

    2003-01-01

    Vent line, drain line and sampling line in nuclear power station have many socket welded-joints made of austenitic stainless steel. Their slenderness and stagnation yield some potential of vibration-induced cracking and stress corrosion cracking. For the joints under vibration, the authors firstly elucidated their welding-defect-related fatigue strength by using fracture mechanics. It could define the allowable sets of stress amplitude and defect size. Secondly, authors developed an ultra-sonic detecting apparatus by using a focus-type probe and its programmed crawl on socket part. The authors finally measured the stress amplitude and frequency by sticking strain gage on suspected joints, then evaluated the fatigue resistance of the joints. For more efficient procedure, the method of stress amplitude analysis through vibration measurement is being developed. (author)

  5. Remote Adaptive Motor Resistance Training Exercise Apparatus and Method of Use Thereof

    Science.gov (United States)

    Reich, Alton (Inventor); Shaw, James (Inventor)

    2017-01-01

    The invention comprises a method and/or an apparatus using a computer configured exercise system equipped with an electric motor to provide physical resistance to user motion in conjunction with means for sharing exercise system related data and/or user performance data with a secondary user, such as a medical professional, a physical therapist, a trainer, a computer generated competitor, and/or a human competitor. For example, the exercise system is used with a remote trainer to enhance exercise performance, with a remote medical professional for rehabilitation, and/or with a competitor in a competition, such as in a power/weightlifting competition or in a video game. The exercise system is optionally configured with an intelligent software assistant and knowledge navigator functioning as a personal assistant application.

  6. [A method for genetic transformation of maize for resistance to viral diseases].

    Science.gov (United States)

    Valdez, Marta; Madriz, Kenneth; Ramírez, Pilar

    2004-09-01

    A system for the genetic transformation of maize was developed for two Costa Rican varieties: CR-7 and Diamantes 8843, that can allow the subsequent transfer of viral-derived genes in order to confer resistance to the disease caused by maize rayado fino virus (MRFV). The method is based on particle bombardment of organogenic calli derived from shoot tips. On the other hand, the molecular construction pRFcp-bar, containing the coat protein gene of MRFV and the marker gene bar, was elaborated. For the visual selection of the transformed material was used also the plasmid pDM803 that contains the reporter gene uidA (GUS). The results indicate that devices evaluated: the PIG ("Particle Inflow Gun") and the Bio-Rad are both enough efficient to transfer foreign genes to the genome of the maize.

  7. Method For Creating Corrosion Resistant Surface On An Aluminum Copper Alloy

    Science.gov (United States)

    Mansfeld, Florian B.; Wang, You; Lin, Simon H.

    1997-06-03

    A method for treating the surface of aluminum alloys hang a relatively high copper content is provided which includes the steps of removing substantially all of the copper from the surface, contacting the surface with a first solution containing cerium, electrically charging the surface while contacting the surface in an aqueous molybdate solution, and contacting the surface with a second solution containing cerium. The copper is substantially removed from the surface in the first step either by (i) contacting the surface with an acidic chromate solution or by (ii) contacting the surface with an acidic nitrate solution while subjecting the surface to an electric potential. The corrosion-resistant surface resulting from the invention is excellent, consistent and uniform throughout the surface. Surfaces treated by the invention may often be certified for use in salt-water services.

  8. Alkali resistant optical coatings for alkali lasers and methods of production thereof

    Science.gov (United States)

    Soules, Thomas F; Beach, Raymond J; Mitchell, Scott C

    2014-11-18

    In one embodiment, a multilayer dielectric coating for use in an alkali laser includes two or more alternating layers of high and low refractive index materials, wherein an innermost layer includes a thicker, >500 nm, and dense, >97% of theoretical, layer of at least one of: alumina, zirconia, and hafnia for protecting subsequent layers of the two or more alternating layers of high and low index dielectric materials from alkali attack. In another embodiment, a method for forming an alkali resistant coating includes forming a first oxide material above a substrate and forming a second oxide material above the first oxide material to form a multilayer dielectric coating, wherein the second oxide material is on a side of the multilayer dielectric coating for contacting an alkali.

  9. The Comparison of Two Methods of Exercise (intense interval training and concurrent resistance- endurance training on Fasting Sugar, Insulin and Insulin Resistance in Women with Mellitus Diabetes

    Directory of Open Access Journals (Sweden)

    F Bazyar

    2016-05-01

    Full Text Available Background & aim: Exercise is an important component of health and an integral approach to the management of diabetes mellitus. The purpose of this study was to compare the effects of intense interval training and concurrent resistance- endurance training on fasting sugar, insulin and insulin resistance in women with mellitus diabetes.   Methods: Fifty-two overweight female diabetic type 2 patients (aged 45-60 years old with fasting blood glucose≥ 126 mg/dl were selected to participate in the present study. Participants were assigned to intense interval training group (N=17, concurrent resistance- endurance training group (N=17 and control group (N=18. The exercises incorporated 10 weeks of concurrent resistance- endurance training and intense interval training. Fasting blood sugar, serum insulin concentrations levels were measured. Concurrent training group trained eight weeks, three times a week of endurance training at 60% of maximum heart rate (MHR and two resistance training sessions per week with 70% of one repetition maximum (1-RM. Intense interval training group trained for eight weeks, three sessions per week for 4 to 10 repeats Wingate test on the ergometer 30s performed with maximum effort. The control group did no systematic exercise. At the end of experiment 42 subjects were succeed and completed the study period, and 10 subjects were removed due to illness and absence in the exercise sessions. Fasting blood sugar and insulin levels 24 hours before and 48 hours after the last training session was measured.   Results: The findings indicated that in periodic fasting, the blood sugar in intensive training group had a marked decrease (p= 0.000 however, the fasting blood sugar of exercise and power stamina groups reduced significantly (p=0.062. The results showed no significant difference between the groups (171/0 p =0.171. Fasting insulin (p <0.001 and insulin resistance (0001/0 = p=0.001 in periodic intensive training group were

  10. Significance of steel electrical resistance method in the evaluation of reinforcement corrosion in cementitious systems

    Directory of Open Access Journals (Sweden)

    Krajci, L.

    2004-06-01

    Full Text Available The suitable detection system of steel reinforcement corrosion in concrete structures contributes to the reduction of their maintenance costs. Method of steel electrical resistance represents non-destructive monitoring of steel in cementitious systems. Specially prepared and arranged test specimen of steel as a corrosion sensor is embedded in mortar specimen. Verification tests of this method based on chloride corrosion of steel in mortars as well as its visual inspection are introduced. Significance of steel electrical resistance method lies in the expression of steel corrosion by these quantitative parameters: reduction of cross-section of steel, thickness of corroded layer and loss of weight of steel material. This method is an integral method that allows the indirect determination of mentioned corrosion characteristics. The comparison of verified method with gravimetric evaluation of steel corrosion gives a good correspondence. Test results on mortars with calcium chloride dosages between 0.5% and 4.0% by weight of cement prove high sensitiveness and reliability of steel electrical resistance method.

    La utilización de un sistema de detección de la corrosión de las armaduras en estructuras de hormigón puede contribuir a la reducción de sus costes de mantenimiento. El método de la resistencia eléctrica del acero consiste en la monitorización no-destructiva realizada sobre el acero en sistemas cementantes. Dentro de la muestra de mortero se coloca el sistema de detección, especialmente preparado y fijado, actuando como un sensor de la corrosión. En este trabajo se presentan ensayos de verificación de este método, junto con inspecciones visuales, en morteros sometidos a corrosión de armaduras por efecto de los cloruros. La efectividad de este método de la resistencia eléctrica del acero se expresa, en la corrosión de armaduras, de acuerdo a los siguientes parámetros cuantitativos: reducción de la sección transversal del

  11. Catalyst of a metal heteropoly acid salt that is insoluble in a polar solvent on a non-metallic porous support and method of making

    Science.gov (United States)

    Wang, Yong [Richland, WA; Peden, Charles H. F. [West Richland, WA; Choi, Saemin [Richland, WA

    2002-10-29

    The present invention includes a catalyst having (a) a non-metallic support having a plurality of pores; (b) a metal heteropoly acid salt that is insoluble in a polar solvent on the non-metallic support; wherein at least a portion of the metal heteropoly acid salt is dispersed within said plurality of pores. The present invention also includes a method of depositing a metal heteropoly acid salt that is insoluble in a polar solvent onto a non-metallic support having a plurality of pores. The method has the steps of: (a) obtaining a first solution containing a first precursor of a metal salt cation; (b) obtaining a second solution containing a second precursor of a heteropoly acid anion in a solvent having a limited dissolution potential for said first precursor; (c) impregnating the non-metallic support with the first precursor forming a first precursor deposit within the plurality of pores, forming a first precursor impregnated support; (d) heating said first precursor impregnated support forming a bonded first precursor impregnated support; (e) impregnating the second precursor that reacts with the precursor deposit and forms the metal heteropoly acid salt.

  12. New methods for testing fire resistance of wood façade systems

    Directory of Open Access Journals (Sweden)

    Mårtensson August

    2016-01-01

    Full Text Available Arson in schools has been a huge problem in Sweden over the last fifteen years. The average amount of school arsons between 2000 and 2014 was 285 cases each year which corresponds to 50% of the total amount of reported fires in school buildings. This is a well-known problem and a lot of research has been done in this area. Investigations has been done about fire and heat detection systems, different technical factors significance in fire scenarios and how to prevent adolescents from starting fires. Another part of the problem that partly been investigated is how the schools are constructed. Roughly 50% of the arsons are outside of the school building. In Sweden one and two storey buildings are allowed to be built with wooden façades in accordance with the building code, which is one of the reasons many schools are built with wooden façade systems. The most critical part in a wood façade system from a fire safety perspective is concluded to be the eaves because of how they usually are built to let air pass through. Even though a wood façade isn't as well resistant to fire compared to a concrete façade, three versions of new test methods for combustible façades have been developed to make it possible to make sure in advance that a construction is resistant enough. The new test methods are focused on specific details and parts of a façade system to provide a more informative and useful result compared to SP Fire 105. Observations and measurements of flame spread and temperature changes in the eave, over the window joints and in the air gap are made. With these parameters in consideration criteria's has been chosen for a critical temperature of 280 ∘C at a critical time of 20 minutes.

  13. Evaluation of Fine Aggregate Morphology by Image Method and Its Effect on Skid-Resistance of Micro-Surfacing

    Directory of Open Access Journals (Sweden)

    Yue Xiao

    2018-05-01

    Full Text Available Micro-surfacing is a widely used pavement preventive maintenance technology used all over the world, due to its advantages of fast construction, low maintenance cost, good waterproofness, and skid-resistance performance. This study evaluated the fine aggregate morphology and surface texture of micro-surfacing by AIMS (aggregate image measurement system, and explored the effect of aggregate morphology on skid-resistance of single-grade micro-surfacing. Sand patch test and British pendulum test were also used to detect skid-resistance for comparison with the image-based method. Wet abrasion test was used to measure skid-resistance durability for feasibility verification of single-grade micro-surfacing. The results show that the effect of Form2D on the skid-resistance of micro-surfacing is much stronger than that of angularity. Combining the feasibility analysis of durability and skid-resistance, 1.18–2.36 grade micro-surfacing meets the requirements of durability and skid-resistance at the same time. This study also determined that, compared with British pendulum test, the texture result obtained by sand patch test fits better with results of image method.

  14. Evaluation of Fine Aggregate Morphology by Image Method and Its Effect on Skid-Resistance of Micro-Surfacing.

    Science.gov (United States)

    Xiao, Yue; Wang, Feng; Cui, Peide; Lei, Lei; Lin, Juntao; Yi, Mingwei

    2018-05-29

    Micro-surfacing is a widely used pavement preventive maintenance technology used all over the world, due to its advantages of fast construction, low maintenance cost, good waterproofness, and skid-resistance performance. This study evaluated the fine aggregate morphology and surface texture of micro-surfacing by AIMS (aggregate image measurement system), and explored the effect of aggregate morphology on skid-resistance of single-grade micro-surfacing. Sand patch test and British pendulum test were also used to detect skid-resistance for comparison with the image-based method. Wet abrasion test was used to measure skid-resistance durability for feasibility verification of single-grade micro-surfacing. The results show that the effect of Form2D on the skid-resistance of micro-surfacing is much stronger than that of angularity. Combining the feasibility analysis of durability and skid-resistance, 1.18⁻2.36 grade micro-surfacing meets the requirements of durability and skid-resistance at the same time. This study also determined that, compared with British pendulum test, the texture result obtained by sand patch test fits better with results of image method.

  15. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  16. On-line monitoring of resistance of aqueous solutions at high temperature

    International Nuclear Information System (INIS)

    Hu Shilin; Zhang Pingzhu; Shang Weiguo

    1999-01-01

    The coulostatic measurement is a fast speed electrochemical test method. By this technology, analyzing Δ E(t)- T curves recorded under coulostatic perturbation, the solution resistance R l , resistance of coated film R f , capacity of coated film C f , Polarization resistance R p and double layer capacity C d are obtained. The resistance variety of 0.05N KCl is measured from room temperature up to 255 deg. C under saturation steam pressure. (author)

  17. A study of two kinds of electromagnetic pulse antennas with a continuous resistive loading using the FDTD method

    International Nuclear Information System (INIS)

    Mao Congguang; Zhou Hui

    2003-01-01

    The cylindrical and conical monopole antenna with a continuous resistive loading is considered as a radiator in the experiments of the electromagnetic pulse compatibility. The various principle of the resistive loading is discussed in details and the characters of the antennas are studied using the Finite-Difference Time-Domain (FDTD) method. The key techniques of the calculating are presented. The results are in good agreement with the documents and the theory

  18. The Use of Electrical Resistivity Method to Mapping The Migration of Heavy Metals by Electrokinetic

    Science.gov (United States)

    Azhar, A. T. S.; Ayuni, S. A.; Ezree, A. M.; Nizam, Z. M.; Aziman, M.; Hazreek, Z. A. M.; Norshuhaila, M. S.; Zaidi, E.

    2017-08-01

    The presence of heavy metals contamination in soil environment highly needs innovative remediation. Basically, this contamination was resulted from ex-mining sites, motor workshop, petrol station, landfill and industrial sites. Therefore, soil treatment is very important due to metal ions are characterized as non-biodegradable material that may be harmful to ecological system, food chain, human health and groundwater sources. There are various techniques that have been proposed to eliminate the heavy metal contamination from the soil such as bioremediation, phytoremediation, electrokinetic remediation, solidification and stabilization. The selection of treatment needs to fulfill some criteria such as cost-effective, easy to apply, green approach and high remediation efficiency. Electrokinetic remediation technique (EKR) offers those solutions in certain area where other methods are impractical. While, electrical resistivity method offers an alternative geophysical technique for soil subsurface profiling to mapping the heavy metals migration by the influece of electrical gradient. Consequently, this paper presents an overview of the use of EKR to treat contaminated soil by using ERM method to verify their effectiveness to remove heavy metals.

  19. Study by polarized muon

    International Nuclear Information System (INIS)

    Yamazaki, Toshimitsu

    1977-01-01

    Experiments by using polarized muon beam are reported. The experiments were performed at Berkeley, U.S.A., and at Vancouver, Canada. The muon spin rotation is a useful method for the study of the spin polarization of conductive electrons in paramagnetic Pd metal. The muon Larmor frequency and the relaxation time can be obtained by measuring the time distribution of decay electrons of muon-electron process. The anomalous depolarization of negative muon spin rotation in the transitional metal was seen. The circular polarization of the negative muon X-ray was measured to make clear this phenomena. The experimental results show that the anomalous depolarization is caused at the 1-S-1/2 state. For the purpose to obtain the strong polarization of negative muon, a method of artificial polarization is proposed, and the test experiments are in progress. The study of the hyperfine structure of mu-mesic atoms is proposed. The muon capture rate was studied systematically. (Kato, T.)

  20. Polarization reversal in BaTiO{sub 3} nanostructures synthesized by microwave-assisted hydrothermal method

    Energy Technology Data Exchange (ETDEWEB)

    Velasco-Davalos, Ivan; Ambriz-Vargas, Fabian [Centre Énergie, Matériaux et Télécommunications, INRS, 1650 Lionel-Boulet, Varennes, Québec J3X1S2 (Canada); Gómez-Yáñez, Carlos [Departamento de Ingeniería en Metalurgia y Materiales, ESIQIE, Instituto Politécnico Nacional, UPALM, Zacatenco, CP 07738 DF, México (Mexico); Thomas, Reji, E-mail: reji.thomas@emt.inrs.ca [Centre Énergie, Matériaux et Télécommunications, INRS, 1650 Lionel-Boulet, Varennes, Québec J3X1S2 (Canada); Ruediger, Andreas, E-mail: ruediger@emt.inrs.ca [Centre Énergie, Matériaux et Télécommunications, INRS, 1650 Lionel-Boulet, Varennes, Québec J3X1S2 (Canada)

    2016-05-15

    Ferroelectric BaTiO{sub 3} nanostructures and thin films were deposited by a microwave assisted hydrothermal process at low temperatures (<250 °C) on metallic Pt/Al{sub 2}O{sub 3}/SiO{sub 2}/Si and Nb:SrTiO{sub 3} (100) substrates. TiO{sub 2} nanoparticles dispersed in the Ba(OH){sub 2} alkaline solution are used as the precursors without any mineralizers. The incorporation of H{sub 2}O{sub 2} into precursor solution served as a strong oxidant and catalyst for the uniform nucleation of BaTiO{sub 3} on the substrate surface. The polycrystalline and epitaxial nature of the films were confirmed by atomic force microscopy and x-ray diffraction studies. We report the ferroelectric behavior of BaTiO{sub 3} films on Nb:SrTiO{sub 3} (100) substrates by piezoresponse force microscopy. - Highlights: • Microwave assisted hydrothermal deposition of highly ordered BaTiO{sub 3} thin films on single crystal substrates. • Fast growth without the needof any mineralizers. • Moderate addition of H{sub 2}O{sub 2} significantly improves the surface coverage. • H{sub 2}O{sub 2} substantially reduces hydrogen incorporation into the film and the associated leakage current. • Out-of-plane polarization reversal demonstrated locally.

  1. Polar vessel hullform design based on the multi-objective optimization NSGA II

    Directory of Open Access Journals (Sweden)

    DUAN Fei

    2017-12-01

    Full Text Available [Objectives] With the increasing exploitation of the Arctic abundant oil and gas resources, a large number of ships which meet the polar navigational requirements are needed.[Methods] In this paper, the fast elitist Non-Dominated Sorting Genetic Algorithm (NSGA Ⅱ is applied to the hull optimization, and the multi-objective optimization method of polar vessel design is proposed. With the optimization goal of resistance and icebreaking resistance, filtering hull forms through the standard of polar vessel displacement and EEDI, fast ship hull optimization that satisfy the ice-ship dead weight and EEDI requirements has been achieved. Taking a 65 000 t shuttle tanker as an example, full parametric modeling method is adopted, the hull optimization of three different bow forms is conducted through the polar vessel multi-objective optimization method.[Results] The ship hull after optimization can satisfy the IA class navigation require, where the resistance in calm water decreases up to 12.94%, and the minimum propulsion power in ice field has a 27.36% reduction.[Conclusions] The feasibility and validity of the NSGA Ⅱ applying in polar vessel design is verified.

  2. Polarization recovery through scattering media.

    Science.gov (United States)

    de Aguiar, Hilton B; Gigan, Sylvain; Brasselet, Sophie

    2017-09-01

    The control and use of light polarization in optical sciences and engineering are widespread. Despite remarkable developments in polarization-resolved imaging for life sciences, their transposition to strongly scattering media is currently not possible, because of the inherent depolarization effects arising from multiple scattering. We show an unprecedented phenomenon that opens new possibilities for polarization-resolved microscopy in strongly scattering media: polarization recovery via broadband wavefront shaping. We demonstrate focusing and recovery of the original injected polarization state without using any polarizing optics at the detection. To enable molecular-level structural imaging, an arbitrary rotation of the input polarization does not degrade the quality of the focus. We further exploit the robustness of polarization recovery for structural imaging of biological tissues through scattering media. We retrieve molecular-level organization information of collagen fibers by polarization-resolved second harmonic generation, a topic of wide interest for diagnosis in biomedical optics. Ultimately, the observation of this new phenomenon paves the way for extending current polarization-based methods to strongly scattering environments.

  3. Novel amide polar-embedded reversed-phase column for the fast liquid chromatography-tandem mass spectrometry method to determine polyether ionophores in environmental waters.

    Science.gov (United States)

    Herrero, P; Borrull, F; Pocurull, E; Marcé, R M

    2012-11-09

    A fast chromatographic method has been developed that takes less than 5 min per run to determine five polyether ionophores with a novel amide polar-embedded reversed-phase column coupled to a triple quadrupole mass spectrometer. A comparison between Oasis HLB and Oasis MAX sorbents for the solid-phase extraction was done. Oasis HLB sorbent gave recoveries close to 90% and the repeatability (%RSD, 25-100 ng/L, n=3) of the method was less than 7% for all compounds in all matrices. The presence of polyether ionophores in environmental waters such as river water and sewage was investigated. Monensin and narasin were frequently determined in influent and effluent sewage at concentrations from 10 ng/L to 47 ng/L in influents and from 6 ng/L to 34 ng/L in effluents. In river waters, polyether ionophores were not detected in any sample. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Study of ciclosporine blood levels in patients after kidney or bone-marrow transplantation. Comparison between the two methods, fluorescence polarization immunoassay and radioimmunoassay

    International Nuclear Information System (INIS)

    Sadeg, N.; Pham Huy, C.; Claude, J.R.; Postaire, M.; Lebrec, H.; Hamon, M.; Broyer, M.; Gagnadoux, M.F.; Fischer, A.

    1989-01-01

    The apparition of ciclosporine, immunodepressive drug, has largely improved the organ transplantations. However, the range of blood concentrations must be defined to allow the efficacity of ciclosporine therapy and to avoid toxic reactions, because there are very important variations for a same dosage according to the individuals and the diseases. Relative to the low concentrations to be determined (about one hundred ng/ml), the most useful methods for ciclosporine measurement are based on immunochemical assays. This work compares the two methods: radioimmunoassay (RIA) and fluorescence polarization immunoassay (FPIA) simultaneously performed on several hundred samples. A very significant correlation exists between the two techniques (r = 0.80). The advantages of immunofluorescent assay consists in rapidity, sensibility and facility to realize emergency analysis [fr

  5. Characterization of Multidrug Resistant E. faecalis Strains from Pigs of Local Origin by ADSRRS-Fingerprinting and MALDI -TOF MS; Evaluation of the Compatibility of Methods Employed for Multidrug Resistance Analysis.

    Directory of Open Access Journals (Sweden)

    Aneta Nowakiewicz

    Full Text Available The aim of this study was to characterize multidrug resistant E. faecalis strains from pigs of local origin and to analyse the relationship between resistance and genotypic and proteomic profiles by amplification of DNA fragments surrounding rare restriction sites (ADSRRS-fingerprinting and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI -TOF MS. From the total pool of Enterococcus spp. isolated from 90 pigs, we selected 36 multidrug resistant E. faecalis strains, which represented three different phenotypic resistance profiles. Phenotypic resistance to tetracycline, macrolides, phenicols, and lincomycin and high-level resistance to aminoglycosides were confirmed by the occurrence of at least one corresponding resistance gene in each strain. Based on the analysis of the genotypic and phenotypic resistance of the strains tested, five distinct resistance profiles were generated. As a complement of this analysis, profiles of virulence genes were determined and these profiles corresponded to the phenotypic resistance profiles. The demonstration of resistance to a wide panel of antimicrobials by the strains tested in this study indicates the need of typing to determine the spread of resistance also at the local level. It seems that in the case of E. faecalis, type and scope of resistance strongly determines the genotypic pattern obtained with the ADSRRS-fingerprinting method. The ADSRRS-fingerprinting analysis showed consistency of the genetic profiles with the resistance profiles, while analysis of data with the use of the MALDI- TOF MS method did not demonstrate direct reproduction of the clustering pattern obtained with this method. Our observations were confirmed by statistical analysis (Simpson's index of diversity, Rand and Wallace coefficients. Even though the MALDI -TOF MS method showed slightly higher discrimination power than ADSRRS-fingerprinting, only the latter method allowed reproduction of the

  6. Evaluation of in vitro antioxidant potential of different polarities stem crude extracts by different extraction methods of Adenium obesum

    Directory of Open Access Journals (Sweden)

    Mohammad Amzad Hossain

    2014-09-01

    Full Text Available Objective: To select best extraction method for the isolated antioxidant compounds from the stems of Adenium obesum. Methods: Two methods used for the extraction are Soxhlet and maceration methods. Methanol solvent was used for both extraction method. The methanol crude extract was defatted with water and extracted successively with hexane, chloroform, ethyl acetate and butanol solvents. The antioxidant potential for all crude extracts were determined by using 1, 1-diphenyl-2- picrylhydrazyl method. Results: The percentage of extraction yield by Soxhlet method is higher compared to maceration method. The antioxidant potential for methanol and its derived fractions by Soxhlet extractor method was highest in ethyl acetate and lowest in hexane crude extracts and found in the order of ethyl acetate>butanol>water>chloroform>methanol>hexane. However, the antioxidant potential for methanol and its derived fractions by maceration method was highest in butanol and lowest in hexane followed in the order of butanol>methanol>chloroform>water>ethyl acetate>hexane. Conclusions: The results showed that isolate antioxidant compounds effected on the extraction method and condition of extraction.

  7. Polarized proton collider at RHIC

    International Nuclear Information System (INIS)

    Alekseev, I.; Allgower, C.; Bai, M.; Batygin, Y.; Bozano, L.; Brown, K.; Bunce, G.; Cameron, P.; Courant, E.; Erin, S.; Escallier, J.; Fischer, W.; Gupta, R.; Hatanaka, K.; Huang, H.; Imai, K.; Ishihara, M.; Jain, A.; Lehrach, A.; Kanavets, V.; Katayama, T.; Kawaguchi, T.; Kelly, E.; Kurita, K.; Lee, S.Y.; Luccio, A.; MacKay, W.W.; Mahler, G.; Makdisi, Y.; Mariam, F.; McGahern, W.; Morgan, G.; Muratore, J.; Okamura, M.; Peggs, S.; Pilat, F.; Ptitsin, V.; Ratner, L.; Roser, T.; Saito, N.; Satoh, H.; Shatunov, Y.; Spinka, H.; Syphers, M.; Tepikian, S.; Tominaka, T.; Tsoupas, N.; Underwood, D.; Vasiliev, A.; Wanderer, P.; Willen, E.; Wu, H.; Yokosawa, A.; Zelenski, A.N.

    2003-01-01

    In addition to heavy ion collisions (RHIC Design Manual, Brookhaven National Laboratory), RHIC will also collide intense beams of polarized protons (I. Alekseev, et al., Design Manual Polarized Proton Collider at RHIC, Brookhaven National Laboratory, 1998, reaching transverse energies where the protons scatter as beams of polarized quarks and gluons. The study of high energy polarized protons beams has been a long term part of the program at BNL with the development of polarized beams in the Booster and AGS rings for fixed target experiments. We have extended this capability to the RHIC machine. In this paper we describe the design and methods for achieving collisions of both longitudinal and transverse polarized protons in RHIC at energies up to √s=500 GeV

  8. Sources of polarized ions and atoms

    International Nuclear Information System (INIS)

    Cornelius, W.D.

    1988-01-01

    In this presentation we discuss methods of producing large quantities of polarized atoms and ions (Stern-Gerlach separation, optical pumping, and spin-exchange) as well as experimental methods of measuring the degree of polarization of atomic systems. The usefulness of polarized atoms in probing the microscopic magnetic surface properties of materials will also be discussed. 39 refs., 5 figs., 2 tabs

  9. Method for increasing the resistance of a plant or a part thereof to a pathogen, method for screening the resistance of a plant or part thereof to a pathogen, and use thereof

    OpenAIRE

    Wit, de, P.; Stergiopoulos, I.; Kema, G.H.J.

    2011-01-01

    (EN)The present invention relates to the field of plant biotechnology. More in particular, the present invention relates to methods for increasing the resistance of a plant or part thereof that is susceptible to infection with a pathogen comprising an ortholog of the Avr4 protein of Cladosporium fulvum, wherein said plant is not a tomato or tobacco plant. The invention also relates to methods for screening the resistance of a plant or a part thereof to at least one pathogen, wherein said path...

  10. Methods and predictors of tampering with a tamper-resistant controlled-release oxycodone formulation.

    Science.gov (United States)

    Peacock, Amy; Degenhardt, Louisa; Hordern, Antonia; Larance, Briony; Cama, Elena; White, Nancy; Kihas, Ivana; Bruno, Raimondo

    2015-12-01

    In April 2014, a tamper-resistant controlled-release oxycodone formulation was introduced into the Australian market. This study aimed to identify the level and methods of tampering with reformulated oxycodone, demographic and clinical characteristics of those who reported tampering with reformulated oxycodone, and perceived attractiveness of original and reformulated oxycodone for misuse (via tampering). A prospective cohort of 522 people who regularly tampered with pharmaceutical opioids and had tampered with the original oxycodone product in their lifetime completed two interviews before (January-March 2014: Wave 1) and after (May-August 2014: Wave 2) introduction of reformulated oxycodone. Four-fifths (81%) had tampered with the original oxycodone formulation in the month prior to Wave 1; use and attempted tampering with reformulated oxycodone amongst the sample was comparatively low at Wave 2 (29% and 19%, respectively). Reformulated oxycodone was primarily swallowed (15%), with low levels of recent successful injection (6%), chewing (2%), drinking/dissolving (1%), and smoking (word-of-mouth or the internet). Participants rated reformulated oxycodone as more difficult to prepare and inject and less pleasant to use compared to the original formulation. Current findings suggest that the introduction of the tamper-resistant product has been successful at reducing, although not necessarily eliminating, tampering with the controlled-release oxycodone formulation, with lower attractiveness for misuse. Appropriate, effective treatment options must be available with increasing availability of abuse-deterrent products, given the reduction of oxycodone tampering and use amongst a group with high rates of pharmaceutical opioid dependence. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Dynamic polarization of radioactive nuclei

    International Nuclear Information System (INIS)

    Kiselev, Yu.F.; Lyuboshits, V.L.; )

    2001-01-01

    Radioactive nuclei, embedded into a frozen polarized proton target, atr proposed to polarize by means of some dynamic polarization methods. Angular distributions of γ-quanta emitted ny 22 Na(3 + ) in the cascade β-γ-radiation are calculated. It is shown that this distribution does not depend on the spin temperature sing at the Boltzmann distribution of populations among the Zeeman magnetic substates, whereas the tensor polarization of quadrupole nuclei, placed in the electric field of the crystal, causes the considerable sing dependence. The new method promises wide opportunities for the magnetic structure investigations as well as for the study of spin-spin interaction dynamics of rare nuclei in dielectrics. Physical-technical advantages and disadvantages of the given method are discussed for the polarization of heavy nuclei in the on-line implantation mode [ru

  12. Mapping the Eskelund landfill using time-domain spectral induced polarization data

    DEFF Research Database (Denmark)

    Legaz, Aurélie; Fiandaca, Gianluca; Pedersen, Jesper Bjergsted

    2011-01-01

    Between November 2009 and July 2010, researchers from the HydroGeophysics Group, Aarhus University, carried out a survey in the former municipal landfill, Eskelund (Denmark). Induced polarization measurements (IP) and electrical resistivity tomography (ERT) were used to define the spatial...... boundaries of the dump site. The joint application of these two methods may allow the discrimination between materials displaying an identical signature in resistivity (e.g., brine and clay)...

  13. Evaluation of different methods to recover methicillin-resistant Staphylococcus aureus from hospital environmental surfaces.

    LENUS (Irish Health Repository)

    Dolan, A

    2011-11-01

    The environment is implicated as a source of healthcare-associated infections (HAIs) and there is a need for evidence-based approaches to environmental sampling to assess cleanliness and improve infection prevention and control. We assessed, in vitro, different approaches to sampling the environment for meticillin-resistant Staphylococcus aureus (MRSA). In a laboratory-based investigation, the recovery of MRSA from two common hospital environments using six different sampling methods was evaluated, with a wild-type strain of MRSA. A 100 cm(2) section of mattress and a laboratory bench surface were contaminated with known inocula of MRSA. Bacteria were recovered by sampling at 30 min after inoculation, using either saline-moistened cotton swabs, neutralising buffer swabs, eSwabs or macrofoam swabs, which were all enriched in tryptone soya broth, or by sampling with direct contact plates or chromogenic \\'sweep\\' plates. The sensitivity (i.e. the minimum number of bacteria inoculated on to a surface which subsequently produced a positive result) of each method was determined for each surface. The most sensitive methods were eSwabs and macrofoam swabs, requiring 6.1 × 10(-1) and 3.9 × 10(-1) MRSA\\/cm(2), respectively, to produce a positive result from the bench surface. The least sensitive swabbing method was saline-moistened cotton swabs, requiring 1.1 × 10(3) MRSA\\/cm(2) of mattress. The recovery of bacteria from environmental samples varies with the swabs and methodology used and negative culture results do not exclude a pathogen-free environment. Greater standardisation is required to facilitate the assessment of cleanliness of healthcare environments.

  14. Geological Structures Mapping of Bukit Bunuh using 2-D Resistivity Imaging Method

    Science.gov (United States)

    Nur Amalina, M. K. A.; Nordiana, M. M.; Rahman, Nazrin; Saidin, Mokhtar; Masnan, S. S. K.

    2018-04-01

    The geological area of Bukit Bunuh is very complex due to the meteorite impact that has occurred millions years ago at Lenggong, Perak. The lithology of the study area consists of alluvium, tephra dust, and granitic rock. The geological contact, fault and fracture zone were found at the study area may indicate the geological process that undergoes at a place locally or regionally. These important features have led to the further research on 2-D resistivity imaging method (2-D RIM) to study the geological features. This method can provide the subsurface image that will delineate the geological structures. The surveys include three separate lines of different length which depend on the accessibility. The surveys were done by using Pole-Dipole array and 10 m of electrodes spacing. The objectives of this research are to determine the subsurface geological contact and to determine the existence of fault/fracture zones at the contact zone. The results from 2-D inversion profiles have successfully signified the types of geological structural such as fault, contact, and fractures. Hence, the results from 2-D RIM were used to draw the geological lineaments of Bukit Bunuh. The discontinuity of the lineaments may indicate the structures present.

  15. Methods of measuring floor resistance; Messverfahren zur Bestimmung des Ableitwiderstandes von Fussboeden

    Energy Technology Data Exchange (ETDEWEB)

    Seemann, A. [BGFW Berufsgenossenschaft der Gas-, Fernwaerme- und Wasserwirtschaft, Duesseldorf (Germany); Tutschek, G.; Warszewski, P. [Ruhrgas AG, Essen (Germany). Abt. Anlagensicherheit

    2001-04-01

    In gas fitting plants where explosive gas/air mixtures can occur the flooring materials must be conductive. Persons who are insulated from earth can easily acquire and retain an electrostatic charge. If an electrostatically charged person touches a conducting object (e.g. pipe, gas fitting plant) a spark occur at the point of contact. Such sparks can cause ignition of an explosive gas/air mixture. To avoid the retention of static electricity the recommended level of the earth of a floor must be lower than 10{sup 8} {omega} and the persons have to wear dissipative footwear. In several standards methods for checking floor resistance are described. A useful test method is given in DIN EN 1081. (orig.) [German] Explosionsfaehige Erdgas-/Luftgemische koennen durch elektrostatische Entladungsfunken gezuendet werden. Um eine elektrostatische Aufladung von Personen zu vermeiden, darf der Ableitwiderstand des Fussbodens den Wert von 10{sup 8} {omega} nicht ueberschreiten, und es muss ableitfaehiges Schuhwerk getragen werden. In verschiedenen Normen sind Messerfahren fuer die Ueberpruefung des Ableitwiderstandes von verlegten Fussboeden angegeben. Eine fuer die Praxis brauchbare Messmethode wird in DIN EN 1081 angegeben. (orig.)

  16. Fabricating superhydrophobic polymer surfaces with excellent abrasion resistance by a simple lamination templating method.

    Science.gov (United States)

    Xu, Qian Feng; Mondal, Bikash; Lyons, Alan M

    2011-09-01

    Fabricating robust superhydrophobic surfaces for commercial applications is challenging as the fine-scale surface features, necessary to achieve superhydrophobicity, are susceptible to mechanical damage. Herein, we report a simple and inexpensive lamination templating method to create superhydrophobic polymer surfaces with excellent abrasion resistance and water pressure stability. To fabricate the surfaces, polyethylene films were laminated against woven wire mesh templates. After cooling, the mesh was peeled from the polymer creating a 3D array of ordered polymer microposts on the polymer surface. The resulting texture is monolithic with the polymer film and requires no chemical modification to exhibit superhydrophobicity. By controlling lamination parameters and mesh dimensions, polyethylene surfaces were fabricated that exhibit static contact angles of 160° and slip angles of 5°. Chemical and mechanical stability was evaluated using an array of manual tests as well as a standard reciprocating abraser test. Surfaces remained superhydrophobic after more than 5500 abrasion cycles at a pressure of 32.0 kPa. In addition, the surface remains dry after immersing into water for 5 h at 55 kPa. This method is environmental friendly, as it employs no solvents or harsh chemicals and may provide an economically viable path to manufacture large areas of mechanically robust superhydrophobic surfaces from inexpensive polymers and reusable templates.

  17. Multidrug-resistant tuberculosis treatment failure detection depends on monitoring interval and microbiological method

    Science.gov (United States)

    White, Richard A.; Lu, Chunling; Rodriguez, Carly A.; Bayona, Jaime; Becerra, Mercedes C.; Burgos, Marcos; Centis, Rosella; Cohen, Theodore; Cox, Helen; D'Ambrosio, Lia; Danilovitz, Manfred; Falzon, Dennis; Gelmanova, Irina Y.; Gler, Maria T.; Grinsdale, Jennifer A.; Holtz, Timothy H.; Keshavjee, Salmaan; Leimane, Vaira; Menzies, Dick; Milstein, Meredith B.; Mishustin, Sergey P.; Pagano, Marcello; Quelapio, Maria I.; Shean, Karen; Shin, Sonya S.; Tolman, Arielle W.; van der Walt, Martha L.; Van Deun, Armand; Viiklepp, Piret

    2016-01-01

    Debate persists about monitoring method (culture or smear) and interval (monthly or less frequently) during treatment for multidrug-resistant tuberculosis (MDR-TB). We analysed existing data and estimated the effect of monitoring strategies on timing of failure detection. We identified studies reporting microbiological response to MDR-TB treatment and solicited individual patient data from authors. Frailty survival models were used to estimate pooled relative risk of failure detection in the last 12 months of treatment; hazard of failure using monthly culture was the reference. Data were obtained for 5410 patients across 12 observational studies. During the last 12 months of treatment, failure detection occurred in a median of 3 months by monthly culture; failure detection was delayed by 2, 7, and 9 months relying on bimonthly culture, monthly smear and bimonthly smear, respectively. Risk (95% CI) of failure detection delay resulting from monthly smear relative to culture is 0.38 (0.34–0.42) for all patients and 0.33 (0.25–0.42) for HIV-co-infected patients. Failure detection is delayed by reducing the sensitivity and frequency of the monitoring method. Monthly monitoring of sputum cultures from patients receiving MDR-TB treatment is recommended. Expanded laboratory capacity is needed for high-quality culture, and for smear microscopy and rapid molecular tests. PMID:27587552

  18. Imaging with Polarized Neutrons

    Directory of Open Access Journals (Sweden)

    Nikolay Kardjilov

    2018-01-01

    Full Text Available Owing to their zero charge, neutrons are able to pass through thick layers of matter (typically several centimeters while being sensitive to magnetic fields due to their intrinsic magnetic moment. Therefore, in addition to the conventional attenuation contrast image, the magnetic field inside and around a sample can be visualized by detecting changes of polarization in a transmitted beam. The method is based on the spatially resolved measurement of the cumulative precession angles of a collimated, polarized, monochromatic neutron beam that traverses a magnetic field or sample.

  19. Abrasion Resistance of Nano Silica Modified Roller Compacted Rubbercrete: Cantabro Loss Method and Response Surface Methodology Approach

    Science.gov (United States)

    Adamu, Musa; Mohammed, Bashar S.; Shafiq, Nasir

    2018-04-01

    Roller compacted concrete (RCC) when used for pavement is subjected to skidding/rubbing by wheels of moving vehicles, this causes pavement surface to wear out and abrade. Therefore, abrasion resistance is one of the most important properties of concern for RCC pavement. In this study, response surface methodology was used to design, evaluate and analyze the effect of partial replacement of fine aggregate with crumb rubber, and addition of nano silica on the abrasion resistance of roller compacted rubbercrete (RCR). RCR is the terminology used for RCC pavement where crumb rubber was used as partial replacement to fine aggregate. The Box-Behnken design method was used to develop the mixtures combinations using 10%, 20%, and 30% crumb rubber with 0%, 1%, and 2% nano silica. The Cantabro loss method was used to measure the abrasion resistance. The results showed that the abrasion resistance of RCR decreases with increase in crumb rubber content, and increases with increase in addition of nano silica. The analysis of variance shows that the model developed using response surface methodology (RSM) has a very good degree of correlation, and can be used to predict the abrasion resistance of RCR with a percentage error of 5.44%. The combination of 10.76% crumb rubber and 1.59% nano silica yielded the best combinations of RCR in terms of abrasion resistance of RCR.

  20. An NS5A single optimized method to determine genotype, subtype and resistance profiles of Hepatitis C strains.

    Directory of Open Access Journals (Sweden)

    Elisabeth Andre-Garnier

    Full Text Available The objective was to develop a method of HCV genome sequencing that allowed simultaneous genotyping and NS5A inhibitor resistance profiling. In order to validate the use of a unique RT-PCR for genotypes 1-5, 142 plasma samples from patients infected with HCV were analysed. The NS4B-NS5A partial region was successfully amplified and sequenced in all samples. In parallel, partial NS3 sequences were analyzed obtained for genotyping. Phylogenetic analysis showed concordance of genotypes and subtypes with a bootstrap >95% for each type cluster. NS5A resistance mutations were analyzed using the Geno2pheno [hcv] v0.92 tool and compared to the list of known Resistant Associated Substitutions recently published. In conclusion, this tool allows determination of HCV genotypes, subtypes and identification of NS5A resistance mutations. This single method can be used to detect pre-existing resistance mutations in NS5A before treatment and to check the emergence of resistant viruses while undergoing treatment in major HCV genotypes (G1-5 in the EU and the US.

  1. Resistivity Correction Factor for the Four-Probe Method: Experiment II

    Science.gov (United States)

    Yamashita, Masato; Yamaguchi, Shoji; Nishii, Toshifumi; Kurihara, Hiroshi; Enjoji, Hideo

    1989-05-01

    Experimental verification of the theoretically derived resistivity correction factor F is presented. Factor F can be applied to a system consisting of a disk sample and a four-probe array. Measurements are made on isotropic graphite disks and crystalline ITO films. Factor F can correct the apparent variations of the data and lead to reasonable resistivities and sheet resistances. Here factor F is compared to other correction factors; i.e. FASTM and FJIS.

  2. Recent developments in the use of temperature, resistivity and self-potential methods for monitoring embankment dam performance

    Energy Technology Data Exchange (ETDEWEB)

    Sheffer, M.R. [BC Hydro, Vancouver, BC (Canada); Johansson, S.; Sjodahl, P. [HydroResearch AB, Taby (Sweden)

    2009-07-01

    Significant research is being undertaken in the application and development of non-intrusive geophysical techniques as a result of the need for more comprehensive surveillance to detect internal erosion in embankment dams. Seepage and piezometric measurements are the most common methods utilized for dam surveillance. However, the spatial resolution of these measurements is generally not refined enough to detect small, local seepage changes. This paper summarized the current state of the art in the application of temperature, electrical resistivity and self-potential methods to seepage monitoring at embankment dam sites. The paper presented recent developments in using the technique and interpreting seepage parameters for each method. The methods were discussed in the context of both investigation and monitoring applications. It was concluded that the resistivity method is a non-destructive method that is well suited to long-term monitoring and has the ability to cover the entire dam. 25 refs., 11 figs.

  3. A validated stability-indicating LC method for the separation of enantiomer and potential impurities of Linezolid using polar organic mode

    Directory of Open Access Journals (Sweden)

    T. Satyanarayana Raju

    2012-08-01

    Full Text Available Although a number of methods are available for evaluating Linezolid and its possible impurities, a common method for separation if its potential impurities, degradants and enantiomer in a single method with good efficiency remain unavailable. With the objective of developing an advanced method with shorter runtimes, a simple, precise, accurate stability-indicating LC method was developed for the determination of purity of Linezolid drug substance and drug products in bulk samples and pharmaceutical dosage forms in the presence of its impurities and degradation products. This method is capable of separating all the related substances of Linezolid along with the chiral impurity. This method can also be used for the estimation of assay of Linezolid in drug substance as well as in drug product. The method was developed using Chiralpak IA (250 mm×4.6 mm, 5 μm column. A mixture of acetonitrile, ethanol, n-butyl amine and trifluoro acetic acid in 96:4:0.10:0.16 (v/v/v/v ratio was used as a mobile phase. The eluted compounds were monitored at 254 nm. Linezolid was subjected to the stress conditions of oxidative, acid, base, hydrolytic, thermal and photolytic degradation. The degradation products were well resolved from main peak and its impurities, proving the stability-indicating power of the method. The developed method was validated as per International Conference on Harmonization (ICH guidelines with respect to specificity, limit of detection, limit of quantification, precision, linearity, accuracy, robustness and system suitability. Keywords: HPLC, Linezolid, Validation, Polar organic mode, Stability-indicating

  4. Validation of the method for determination of the thermal resistance of fouling in shell and tube heat exchangers

    International Nuclear Information System (INIS)

    Markowski, Mariusz; Trafczynski, Marian; Urbaniec, Krzysztof

    2013-01-01

    Highlights: • Heat recovery in a heat exchanger network (HEN). • A novel method for on-line determination of the thermal resistance of fouling is presented. • Details are developed for shell and tube heat exchangers. • The method was validated and sensibility analysis was carried out. • Developed approach allows long-term monitoring of changes in the HEN efficiency. - Abstract: A novel method for on-line determination of the thermal resistance of fouling in shell and tube heat exchangers is presented. It can be applied under the condition that the data on pressure, temperature, mass flowrate and thermophysical properties of both heat-exchanging media are continuously available. The calculation algorithm for use in the novel method is robust and ensures reliable determination of the thermal resistance of fouling even if the operating parameters fluctuate. The method was validated using measurement data retrieved from the operation records of a heat exchanger network connected with a crude distillation unit rated 800 t/h. Sensibility analysis of the method was carried out and the calculated values of the thermal resistance of fouling were critically reviewed considering the results of qualitative evaluation of fouling layers in the exchangers inspected during plant overhaul

  5. A method to improve tree water use estimates by distinguishing sapwood from heartwood using Electrical Resistivity Tomography

    Science.gov (United States)

    Guyot, A.; Ostergaard, K.; Lenkopane, M.; Fan, J.; Lockington, D. A.

    2011-12-01

    Estimating whole-plant water use in trees requires reliable and accurate methods. Measuring sap velocity and extrapolating to tree water use is seen as the most commonly used. However, deducing the tree water use from sap velocity requires an estimate of the sapwood area. This estimate is the highest cause of uncertainty, and can reach more than 50 % of the uncertainty in the estimate of water use per day. Here, we investigate the possibility of using Electrical Resistivity Tomography to evaluate the sapwood area distribution in a plantation of Pinus elliottii. Electric resistivity tomographs of Pinus elliottii show a very typical pattern of electrical resistivity, which is highly correlated to sapwood and heartwood distribution. To identify the key factors controlling the variation of electrical resistivity, cross sections at breast height for ten trees have been monitored with electrical resistivity tomography. Trees have been cut down after the experiment to identify the heartwood/sapwood boundaries and to extract wood and sap samples. pH, electrolyte concentration and wood moisture content have then been analysed for these samples. Results show that the heartwood/sapwood patterns are highly correlated with electrical resistivity, and that the wood moisture content is the most influencing factor controlling the variability of the patterns. These results show that electric resistivity tomography could be used as a powerful tool to identify the sapwood area, and thus be used in combination with sapflow sensors to map tree water use at stand scale. However, if Pinus elliottii shows typical patterns, further work is needed to identify to see if there are species - specific characterictics as shown in previous works (, electrolyte gradients from the bark to the heartwood). Also, patterns of high resistivity in between needles positions, which are not correlated with either wood moisture content or sapwood, appear to be artifacts. Thus, inversion methods have also to

  6. The Second Zambian National Tuberculosis Drug Resistance survey - a comparison of conventional and molecular methods.

    Science.gov (United States)

    Kapata, Nathan; Mbulo, Grace; Cobelens, Frank; de Haas, Petra; Schaap, Ab; Mwamba, Pike; Mwanza, Winnie; Muvwimi, Mweemba; Muyoyeta, Monde; Moyo, Maureen; Mulenga, Lutinala; Grobusch, Martin P; Godfrey-Faussett, Peter; Ayles, Helen

    2015-11-01

    The prevalence of MDR-TB in Zambia was estimated to be 1.8% in 2001. A second drug resistance survey was conducted in 2008 to determine trends; the use of the Genotype MTBDRplus assay was applied to compare results to the gold standard. A two-stage cluster sampling, with health facilities as primary sampling units. Processed sputum specimens were inoculated on solid media for culture; heat-inactivated bacterial suspensions from sputum samples were tested on a commercial line probe assay for the identification of rifampicin and isoniazid resistance. A total of 917 patients with TB were enrolled and 883 (96.3%) analysed. A total of 574 (65%) had LJ results and 824 (93.3%) had results from MTBDRplus assay. The median age was 32, and 63.3% were males. MDR-TB according to LJ-based DST was 1.1% (CI 0.1-2.4) whereas according to MDTBDRplus assay was 1.6% (CI 0.6-2.6). Isoniazid monoresistance in new cases was 2.4% (CI 0.613-4.26) based on LJ results and 5.0% (CI 3.2-6.7) based on the MTBDRplus; in retreatment cases, it was 4.4% (CI 0.3-8.6) and 2.40% (CI <0.1-5.1) on LJ and MTBDRplus, respectively. Rifampicin monoresistance in new cases was 0.1% (CI <0.1-0.4) based on LJ and 0.6% (CI 0.01-1.1) based on the MTBDRplus; in retreatment cases, it was 0% (CI 0-3.8) and 1.8% (CI <0.1-4.0) on LJ and MTBDRplus, respectively. There were no XDR-TB cases found and no association between MDR-TB and HIV. There was no increase in MDR-TB prevalence in Zambia from 2001 to 2008; results from the two methods were similar. Molecular methods were quicker and simpler to use. © 2015 John Wiley & Sons Ltd.

  7. Evaluation of a cost effective in-house method for HIV-1 drug resistance genotyping using plasma samples.

    Directory of Open Access Journals (Sweden)

    Devidas N Chaturbhuj

    Full Text Available OBJECTIVES: Validation of a cost effective in-house method for HIV-1 drug resistance genotyping using plasma samples. DESIGN: The validation includes the establishment of analytical performance characteristics such as accuracy, reproducibility, precision and sensitivity. METHODS: The accuracy was assessed by comparing 26 paired Virological Quality Assessment (VQA proficiency testing panel sequences generated by in-house and ViroSeq Genotyping System 2.0 (Celera Diagnostics, US as a gold standard. The reproducibility and precision were carried out on five samples with five replicates representing multiple HIV-1 subtypes (A, B, C and resistance patterns. The amplification sensitivity was evaluated on HIV-1 positive plasma samples (n = 88 with known viral loads ranges from 1000-1.8 million RNA copies/ml. RESULTS: Comparison of the nucleotide sequences generated by ViroSeq and in-house method showed 99.41±0.46 and 99.68±0.35% mean nucleotide and amino acid identity respectively. Out of 135 Stanford HIVdb listed HIV-1 drug resistance mutations, partial discordance was observed at 15 positions and complete discordance was absent. The reproducibility and precision study showed high nucleotide sequence identities i.e. 99.88±0.10 and 99.82±0.20 respectively. The in-house method showed 100% analytical sensitivity on the samples with HIV-1 viral load >1000 RNA copies/ml. The cost of running the in-house method is only 50% of that for ViroSeq method (112$ vs 300$, thus making it cost effective. CONCLUSIONS: The validated cost effective in-house method may be used to collect surveillance data on the emergence and transmission of HIV-1 drug resistance in resource limited countries. Moreover, the wide applications of a cost effective and validated in-house method for HIV-1 drug resistance testing will facilitate the decision making for the appropriate management of HIV infected patients.

  8. Method for increasing the resistance of a plant or a part thereof to a pathogen, method for screening the resistance of a plant or part thereof to a pathogen, and use thereof

    NARCIS (Netherlands)

    Wit, de P.; Stergiopoulos, I.; Kema, G.H.J.

    2011-01-01

    (EN)The present invention relates to the field of plant biotechnology. More in particular, the present invention relates to methods for increasing the resistance of a plant or part thereof that is susceptible to infection with a pathogen comprising an ortholog of the Avr4 protein of Cladosporium

  9. Comparison of phenotyping methods for resistance to stem rot and aggregated sheath spot in rice

    Science.gov (United States)

    Stem and sheath diseases caused by Sclerotium oryzae Cattaneo (SCL) and Rhizoctonia oryzae-sativae Sawada Mordue (ROS) can severely reduce rice (Oryza sativa L.) yield and grain quality. Genetic resistance is the best strategy to control them. Phenotypic selection for resistance is hampered due to a...

  10. Modeling and Inversion Methods for the Interpretation of Resistivity Logging Tool Response

    NARCIS (Netherlands)

    Anderson, B.I.

    2001-01-01

    The electrical resistivity measured by well logging tools is one of the most important rock parameters for indicating the amount of hydrocarbons present in a reservoir. The main interpretation challenge is to invert the measured data, solving for the true resistivity values in each zone of a

  11. Apparatus for measuring resistance change only in a cell analyzer and method for calibrating it

    Science.gov (United States)

    Hoffman, Robert A.

    1980-01-01

    The disclosure relates to resistance only monitoring and calibration in an electrical cell analyzer. Sample and sheath fluid flows of different salinities are utilized, the sample flow being diameter modulated to produce a selected pattern which is compared to the resistance measured across the flows.

  12. Slipping on pedestrian surfaces: methods for measuring and evaluating the slip resistance.

    Science.gov (United States)

    Wetzel, Christoph; Windhövel, Ulrich; Mewes, Detlef; Ceylan, Orhan

    2015-01-01

    Tripping, slipping and falling accidents are among the types of accident with a high incidence. This article describes the requirements concerning slip resistance, as well as the state of the art of slip resistance measurement standards in the European Community and the USA. The article also describes how risk assessment can be performed in the field.

  13. Polar Polygons

    Science.gov (United States)

    2005-01-01

    18 August 2005 This Mars Global Surveyor (MGS) Mars Orbiter Camera (MOC) image shows dark-outlined polygons on a frost-covered surface in the south polar region of Mars. In summer, this surface would not be bright and the polygons would not have dark outlines--these are a product of the presence of seasonal frost. Location near: 77.2oS, 204.8oW Image width: width: 3 km (1.9 mi) Illumination from: upper left Season: Southern Spring

  14. Continuous monitoring of the composition of liquid Pb-17Li eutectic using electrical resistivity methods

    International Nuclear Information System (INIS)

    Hubberstey, P.; Sample, T.; Barker, M.G.

    1991-01-01

    The composition of liquid Pb-17Li alloys has been continously determined, using an electrical resistivity monitor, during their interaction with nitrogen, oxygen, hydrogen and water vapour. The operation of the monitor depends on the fact that the resistivity of liquid Pb-Li alloys is dependent on their composition. Accurate resistivity-composition isotherms have been derived from resistivity-temperature data for 15 Pb-Li alloys (0 Li -8 Ω m (mol% Li) -1 at 725 K) is such that a change of 0.05 mol% Li in the alloy composition can be measured. The addition of oxygen and water vapour resulted in a decrease in the resistivity of the liquid alloy. Neither nitrogen nor hydrogen had any effect. The observed changes were shown to be consistent with Li 2 O formation. (orig.)

  15. Corrosion resistance of plasma-anodized AZ91D magnesium alloy by electrochemical methods

    International Nuclear Information System (INIS)

    Barchiche, C.-E.; Rocca, E.; Juers, C.; Hazan, J.; Steinmetz, J.

    2007-01-01

    Anodic coatings formed on magnesium alloys by plasma anodization process are mainly used as protective coatings against corrosion. The effects of KOH concentration, anodization time and current density on properties of anodic layers formed on AZ91D magnesium alloy were investigated to obtain coatings with improved corrosion behaviour. The coatings were characterized by scanning electron microscopy (SEM), electron dispersion X-ray spectroscopy (EDX), X-ray diffraction (XRD) and micro-Raman spectroscopy. The film is porous and cracked, mainly composed of magnesium oxide (MgO), but contains all the elements present in the electrolyte and alloy. The corrosion behaviour of anodized Mg alloy was examined by using stationary and dynamic electrochemical techniques in corrosive water. The best corrosion resistance measured by electrochemical methods is obtained in the more concentrated electrolyte 3 M KOH + 0.5 M KF + 0.25 M Na 3 PO 4 .12 H 2 O, with a long anodization time and a low current density. A double electrochemical effects of the anodized layer on the magnesium corrosion is observed: a large inhibition of the cathodic process and a stabilization of a large passivation plateau

  16. Finite difference method for inner-layer equations in the resistive MagnetoHydroDynamic stability analysis

    International Nuclear Information System (INIS)

    Tokuda, Shinji; Watanabe, Tomoko.

    1996-08-01

    The matching problem in resistive MagnetoHydroDynamic stability analysis by the asymptotic matching method has been reformulated as an initial-boundary value problem for the inner-layer equations describing the plasma dynamics in the thin layer around a rational surface. The third boundary conditions at boundaries of a finite interval are imposed on the inner layer equations in the formulation instead of asymptotic conditions at infinities. The finite difference method for this problem has been applied to model equations whose solutions are known in a closed form. It has been shown that the initial value problem and the associated eigenvalue problem for the model equations can be solved by the finite difference method with numerical stability. The formulation presented here enables the asymptotic matching method to be a practical method for the resistive MHD stability analysis. (author)

  17. Incorpararion of Topography Effect Into Two-Dimensional DC Resistivity Modelling by Using Finite-Element Method

    International Nuclear Information System (INIS)

    Erdogan, E.

    2007-01-01

    In earth investigation done by using the direct current resistivity technique, impact of the change in the examined surface topography on determining the resistivity distrubition in the earth has been a frequently faced question. In order to get more fruitful results and make more correct interpretetions in earth surveying carried on the areas where topographical changes occur, modelling should be done by taking the change in surface topography into account and topography effect should be included into inversion. In this study impact of topography to the direct current resistivity method has been analysed. For this purpose, 2-D forward modeling algorithm has been developed by using finite element method. In this algorithm impact of topography can be incorporate into the model. Also the pseudo sections which is produced from the program can be imaged with topography. By using this algorithm response of models under different surface topography has been analysed and compared with the straight topography of same models

  18. A standardized method to determine the concentration of extracellular vesicles using tunable resistive pulse sensing

    Directory of Open Access Journals (Sweden)

    Robert Vogel

    2016-09-01

    Full Text Available Background: Understanding the pathogenic role of extracellular vesicles (EVs in disease and their potential diagnostic and therapeutic utility is extremely reliant on in-depth quantification, measurement and identification of EV sub-populations. Quantification of EVs has presented several challenges, predominantly due to the small size of vesicles such as exosomes and the availability of various technologies to measure nanosized particles, each technology having its own limitations. Materials and Methods: A standardized methodology to measure the concentration of extracellular vesicles (EVs has been developed and tested. The method is based on measuring the EV concentration as a function of a defined size range. Blood plasma EVs are isolated and purified using size exclusion columns (qEV and consecutively measured with tunable resistive pulse sensing (TRPS. Six independent research groups measured liposome and EV samples with the aim to evaluate the developed methodology. Each group measured identical samples using up to 5 nanopores with 3 repeat measurements per pore. Descriptive statistics and unsupervised multivariate data analysis with principal component analysis (PCA were used to evaluate reproducibility across the groups and to explore and visualise possible patterns and outliers in EV and liposome data sets. Results: PCA revealed good reproducibility within and between laboratories, with few minor outlying samples. Measured mean liposome (not filtered with qEV and EV (filtered with qEV concentrations had coefficients of variance of 23.9% and 52.5%, respectively. The increased variance of the EV concentration measurements could be attributed to the use of qEVs and the polydisperse nature of EVs. Conclusion: The results of this study demonstrate the feasibility of this standardized methodology to facilitate comparable and reproducible EV concentration measurements.

  19. Pilot-Scale Field Validation Of The Long Electrode Electrical Resistivity Tomography Method

    International Nuclear Information System (INIS)

    Glaser, D.R.; Rucker, D.F.; Crook, N.; Loke, M.H.

    2011-01-01

    Field validation for the long electrode electrical resistivity tomography (LE-ERT) method was attempted in order to demonstrate the performance of the technique in imaging a simple buried target. The experiment was an approximately 1/17 scale mock-up of a region encompassing a buried nuclear waste tank on the Hanford site. The target of focus was constructed by manually forming a simulated plume within the vadose zone using a tank waste simulant. The LE-ERT results were compared to ERT using conventional point electrodes on the surface and buried within the survey domain. Using a pole-pole array, both point and long electrode imaging techniques identified the lateral extents of the pre-formed plume with reasonable fidelity, but the LE-ERT was handicapped in reconstructing the vertical boundaries. The pole-dipole and dipole-dipole arrays were also tested with the LE-ERT method and were shown to have the least favorable target properties, including the position of the reconstructed plume relative to the known plume and the intensity of false positive targets. The poor performance of the pole-dipole and dipole-dipole arrays was attributed to an inexhaustive and non-optimal coverage of data at key electrodes, as well as an increased noise for electrode combinations with high geometric factors. However, when comparing the model resolution matrix among the different acquisition strategies, the pole-dipole and dipole-dipole arrays using long electrodes were shown to have significantly higher average and maximum values than any pole-pole array. The model resolution describes how well the inversion model resolves the subsurface. Given the model resolution performance of the pole-dipole and dipole-dipole arrays, it may be worth investing in tools to understand the optimum subset of randomly distributed electrode pairs to produce maximum performance from the inversion model.

  20. PILOT-SCALE FIELD VALIDATION OF THE LONG ELECTRODE ELECTRICAL RESISTIVITY TOMOGRAPHY METHOD

    Energy Technology Data Exchange (ETDEWEB)

    GLASER DR; RUCKER DF; CROOK N; LOKE MH

    2011-07-14

    Field validation for the long electrode electrical resistivity tomography (LE-ERT) method was attempted in order to demonstrate the performance of the technique in imaging a simple buried target. The experiment was an approximately 1/17 scale mock-up of a region encompassing a buried nuclear waste tank on the Hanford site. The target of focus was constructed by manually forming a simulated plume within the vadose zone using a tank waste simulant. The LE-ERT results were compared to ERT using conventional point electrodes on the surface and buried within the survey domain. Using a pole-pole array, both point and long electrode imaging techniques identified the lateral extents of the pre-formed plume with reasonable fidelity, but the LE-ERT was handicapped in reconstructing the vertical boundaries. The pole-dipole and dipole-dipole arrays were also tested with the LE-ERT method and were shown to have the least favorable target properties, including the position of the reconstructed plume relative to the known plume and the intensity of false positive targets. The poor performance of the pole-dipole and dipole-dipole arrays was attributed to an inexhaustive and non-optimal coverage of data at key electrodes, as well as an increased noise for electrode combinations with high geometric factors. However, when comparing the model resolution matrix among the different acquisition strategies, the pole-dipole and dipole-dipole arrays using long electrodes were shown to have significantly higher average and maximum values than any pole-pole array. The model resolution describes how well the inversion model resolves the subsurface. Given the model resolution performance of the pole-dipole and dipole-dipole arrays, it may be worth investing in tools to understand the optimum subset of randomly distributed electrode pairs to produce maximum performance from the inversion model.

  1. A new method for testing thermal shock resistance properties of soapstone – Effects of microstructures and mineralogical variables

    Directory of Open Access Journals (Sweden)

    A. Huhta

    2016-09-01

    Full Text Available Soapstone industry utilizes different types of soapstone mainly as a construction material for fireplaces. In this application soapstone has to meet different temperature requirements in different parts of fireplaces. Mineralogical and structural information is needed for placing an appropriate type of soapstone in an appropriate position in the fireplace construction. This allows employment of higher temperatures resulting in more particulate-free combustion, which makes it possible for soapstone industry to develop more efficient and environmentally friendly fireplaces. Of many soapstone types, which differ from each other in their chemical composition and thermal properties, carbonate soapstone and its microstructural variations were investigated in this study. A new method was developed to measure thermal shock resistant of natural stones. By exposing carbonate soapstone samples of different textural types to rapid temperature changes, it was possible to determine the parameters that affect the capacity of the rock to resist thermal shock. The results indicate that the type of microtexture is an important factor in controlling the thermal shock resistance of carbonate soapstone. The soapstone samples with a high thermal shock resistance show deformation textures, such as crenulation cleavage and S/C mylonite. A strong negative correlation was observed between the thermal shock resistance and length of cleavage domains in foliated rocks. Also a slight elevation in the iron concentration of talc and magnesite was discovered to improve the thermal shock resistance of carbonate soapstone. Attention should especially be paid to the length and planarity of cleavage domains of spaced foliation.

  2. Detection of Ampicillin Resistance Genes (bla in Clinical Isolates of Escherichia coli with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-09-01

    Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms

  3. Strategic Polarization.

    Science.gov (United States)

    Kalai, Adam; Kalai, Ehud

    2001-08-01

    In joint decision making, similarly minded people may take opposite positions. Consider the example of a marriage in which one spouse gives generously to charity while the other donates nothing. Such "polarization" may misrepresent what is, in actuality, a small discrepancy in preferences. It may be that the donating spouse would like to see 10% of their combined income go to charity each year, while the apparently frugal spouse would like to see 8% donated. A simple game-theoretic analysis suggests that the spouses will end up donating 10% and 0%, respectively. By generalizing this argument to a larger class of games, we provide strategic justification for polarization in many situations such as debates, shared living accommodations, and disciplining children. In some of these examples, an arbitrarily small disagreement in preferences leads to an arbitrarily large loss in utility for all participants. Such small disagreements may also destabilize what, from game-theoretic point of view, is a very stable equilibrium. Copyright 2001 Academic Press.

  4. Structure-based methods to predict mutational resistance to diarylpyrimidine non-nucleoside reverse transcriptase inhibitors.

    Science.gov (United States)

    Azeem, Syeda Maryam; Muwonge, Alecia N; Thakkar, Nehaben; Lam, Kristina W; Frey, Kathleen M

    2018-01-01

    Resistance to non-nucleoside reverse transcriptase inhibitors (NNRTIs) is a leading cause of HIV treatment failure. Often included in antiviral therapy, NNRTIs are chemically diverse compounds that bind an allosteric pocket of enzyme target reverse transcriptase (RT). Several new NNRTIs incorporate flexibility in order to compensate for lost interactions with amino acid conferring mutations in RT. Unfortunately, even successful inhibitors such as diarylpyrimidine (DAPY) inhibitor rilpivirine are affected by mutations in RT that confer resistance. In order to aid drug design efforts, it would be efficient and cost effective to pre-evaluate NNRTI compounds in development using a structure-based computational approach. As proof of concept, we applied a residue scan and molecular dynamics strategy using RT crystal structures to predict mutations that confer resistance to DAPYs rilpivirine, etravirine, and investigational microbicide dapivirine. Our predictive values, changes in affinity and stability, are correlative with fold-resistance data for several RT mutants. Consistent with previous studies, mutation K101P is predicted to confer high-level resistance to DAPYs. These findings were further validated using structural analysis, molecular dynamics, and an enzymatic reverse transcription assay. Our results confirm that changes in affinity and stability for mutant complexes are predictive parameters of resistance as validated by experimental and clinical data. In future work, we believe that this computational approach may be useful to predict resistance mutations for inhibitors in development. Published by Elsevier Inc.

  5. Photonic Crystal Polarizing and Non-Polarizing Beam Splitters

    International Nuclear Information System (INIS)

    Chun-Ying, Guan; Jin-Hui, Shi; Li-Boo, Yuan

    2008-01-01

    A polarizing beam splitter (PBS) and a non-polarizing beam splitter (NPBS) based on a photonic crystal (PC) directional coupler are demonstrated. The photonic crystal directional coupler consists of a hexagonal lattice of dielectric pillars in air and has a complete photonic band gap. The photonic band structure and the band gap map are calculated using the plane wave expansion (PWE) method. The splitting properties of the splitter are investigated numerically using the finite difference time domain (FDTD) method

  6. A Simple Method for the Assessment of Fusarium Head Blight Resistance in Korean Wheat Seedlings Inoculated with Fusarium graminearum

    Directory of Open Access Journals (Sweden)

    Sanghyun Shin

    2014-03-01

    Full Text Available Fusarium head blight (FHB; scab caused mainly by Fusarium graminearum is a devastating disease of wheat and barley around the world. FHB causes yield reductions and contamination of grain with trichothecene mycotoxins such as deoxynivalenol (DON which are a major health concern for humans and animals. The objective of this research was to develop an easy seed or seedling inoculation assay, and to compare these assays with whole plant resistance of twenty-nine Korean winter wheat cultivars to FHB. The clip-dipping assay consists of cutting off the coleoptiles apex, dipping the coleoptiles apex in conidial suspension, covering in plastic bag for 3 days, and measuring the lengths of lesions 7 days after inoculation. There were significant cultivar differences after inoculation with F. graminearum in seedling relative to the controls. Correlation coefficients between the lesion lengths of clip-dipping inoculation and FHB Type II resistance from adult plants were significant (r=0.45; P<0.05. Results from two other seedling inoculation methods, spraying and pin-point inoculation, were not correlated with adult FHB resistance. Single linear correlation was not significant between seed germination assays (soaking and soak-dry and FHB resistance (Type I and Type II, respectively. These results showed that clip-dipping inoculation method using F. graminearum may offer a real possibility of simple, rapid, and reliable for the early screening of FHB resistance in wheat.

  7. Understanding the mechanism of atovaquone drug resistance in Plasmodium falciparum cytochrome b mutation Y268S using computational methods.

    Directory of Open Access Journals (Sweden)

    Bashir A Akhoon

    Full Text Available The rapid appearance of resistant malarial parasites after introduction of atovaquone (ATQ drug has prompted the search for new drugs as even single point mutations in the active site of Cytochrome b protein can rapidly render ATQ ineffective. The presence of Y268 mutations in the Cytochrome b (Cyt b protein is previously suggested to be responsible for the ATQ resistance in Plasmodium falciparum (P. falciparum. In this study, we examined the resistance mechanism against ATQ in P. falciparum through computational methods. Here, we reported a reliable protein model of Cyt bc1 complex containing Cyt b and the Iron-Sulphur Protein (ISP of P. falciparum using composite modeling method by combining threading, ab initio modeling and atomic-level structure refinement approaches. The molecular dynamics simulations suggest that Y268S mutation causes ATQ resistance by reducing hydrophobic interactions between Cyt bc1 protein complex and ATQ. Moreover, the important histidine contact of ATQ with the ISP chain is also lost due to Y268S mutation. We noticed the induced mutation alters the arrangement of active site residues in a fashion that enforces ATQ to find its new stable binding site far away from the wild-type binding pocket. The MM-PBSA calculations also shows that the binding affinity of ATQ with Cyt bc1 complex is enough to hold it at this new site that ultimately leads to the ATQ resistance.

  8. The Dutch Measure for quantification of Treatment Resistance in Depression (DM-TRD) : an extension of the Maudsley Staging Method

    NARCIS (Netherlands)

    Peeters, Frenk P. M. L.; Ruhe, Henricus G.; Wichers, Marieke; Abidi, Latifa; Kaub, Karin; van der Lande, H. Josephine; Spijker, Jan; Huibers, Marcus J. H.; Schene, Aart H.

    2016-01-01

    Background: Treatment resistant depression (TRD) is common in daily practice. An empirical, widely accepted and applicable measure to quantify TRD is lacking. Previously, the Maudsley Staging Method (MSM) showed good validity. We aimed to improve the MSM by refining and extending its items resulting

  9. Resistant starch analysis of commonly consumed potatoes: Content varies by cooking method and service temperature but not by variety

    Science.gov (United States)

    Resistant starch (RS) has properties which may provide health benefits. We conducted a study to determine the contributions of cultivar, cooking method and service temperature on the RS contents of potatoes (Solanum tuberosum L.). We hypothesized that the RS content would vary by variety, cooking me...

  10. Method of determination of temperature and heat resistance of the points on the integrated circuit crystal surface

    Directory of Open Access Journals (Sweden)

    Popov V. M.

    2011-12-01

    Full Text Available Method for visualization of integrated circuit (IC surface temperature by means of the liquid crystal film deposited from solution on its surface is proposed. The boundaries of local regions represent isotherms with corresponding phase transitions. On the base of isotherms positions and consumed by IC power thermal resistances between crystal and environment are determined.

  11. Corrosion resistance assessment of Co-Cr alloy frameworks fabricated by CAD/CAM milling, laser sintering, and casting methods.

    Science.gov (United States)

    Tuna, Süleyman Hakan; Özçiçek Pekmez, Nuran; Kürkçüoğlu, Işin

    2015-11-01

    The effects of fabrication methods on the corrosion resistance of frameworks produced with Co-Cr alloys are not clear. The purpose of this in vitro study was to evaluate the electrochemical corrosion resistance of Co-Cr alloy specimens that were fabricated by conventional casting, milling, and laser sintering. The specimens fabricated with 3 different methods were investigated by potentiodynamic tests and electrochemical impedance spectroscopy in an artificial saliva. Ions released into the artificial saliva were estimated with inductively coupled plasma-mass spectrometry, and the results were statistically analyzed. The specimen surfaces were investigated with scanning electron microscopy before and after the tests. In terms of corrosion current and Rct properties, statistically significant differences were found both among the means of the methods and among the means of the material groups (Pcorrosion than those produced by milling and laser sintering. The corrosion resistance of a Co-Cr alloy specimens fabricated by milling or laser sintering was greater than that of the conventionally cast alloy specimens. The Co-Cr specimens produced by the same method also differed from one another in terms of corrosion resistance. These differences may be related to the variations in the alloy compositions. Copyright © 2015 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  12. Variations in resistance of viruses from different groups to chemico-physical decontamination methods

    Energy Technology Data Exchange (ETDEWEB)

    Mahnel, H

    1979-01-01

    The resistance of a total of 13 different viruses to some important chemico-physical influences was studied under uniform experimental conditions. Stability in tape water, thermostability and sensitivity to anodic oxidation, gamma radiation, some virucidal substances and several commercial disinfectants were tested. In evaluating the results, an attempt is made to rank the viruses investigated according to their sensitivity. On average a bovine parvovirus, and also a reovirus and three enteroviruses, proved most stable. These were followed by infectious canine hepatitis (adenoviruses). Newcastle disease (paramyxoviruses) and vaccinia (poxviruses) demonstrating less resistance. In all the tests an orthomyxovirus (influenza A), a rhabdovirus (pseudorabies) and a togavirus (sindbis) proved to have relatively low resistance.

  13. Challenges of using electrical resistivity method to locate karst conduits-A field case in the Inner Bluegrass Region, Kentucky

    Science.gov (United States)

    Zhu, J.; Currens, J.C.; Dinger, J.S.

    2011-01-01

    Conduits serve as major pathways for groundwater flow in karst aquifers. Locating them from the surface, however, is one of the most challenging tasks in karst research. Geophysical methods are often deployed to help locate voids by mapping variations of physical properties of the subsurface. Conduits can cause significant contrasts of some physical properties that can be detected; other subsurface features such as water-bearing fractures often yield similar contrasts, which are difficult to distinguish from the effects of the conduits. This study used electrical resistivity method to search for an unmapped karst conduit that recharges Royal Spring in the Inner Bluegrass karst region, Kentucky, USA. Three types of resistivity techniques (surface 2D survey, quasi-3D survey, and time-lapse survey) were used to map and characterize resistivity anomalies. Some of the major anomalies were selected as drilling targets to verify the existence of the conduits. Drilling near an anomaly identified by an electrical resistivity profile resulted in successful penetration of a major water-filled conduit. The drilling results also suggest that, in this study area, low resistivity anomalies in general are associated with water-bearing features. However, differences in the anomaly signals between the water-filled conduit and other water-bearing features such as water-filled fracture zones were undistinguishable. The electrical resistivity method is useful in conduit detection by providing potential drilling targets. Knowledge of geology and hydrogeology about the site and professional judgment also played important roles in locating the major conduit. ?? 2011 Elsevier B.V.

  14. Microwave-gated dynamic nuclear polarization

    DEFF Research Database (Denmark)

    Bornet, Aurélien; Pinon, Arthur; Jhajharia, Aditya

    2016-01-01

    Dissolution dynamic nuclear polarization (D-DNP) has become a method of choice to enhance signals in nuclear magnetic resonance (NMR). Recently, we have proposed to combine cross-polarization (CP) with D-DNP to provide high polarization P((13)C) in short build-up times. In this paper, we show...

  15. Alkali corrosion resistant coatings and ceramic foams having superfine open cell structure and method of processing

    Science.gov (United States)

    Brown, Jr., Jesse J.; Hirschfeld, Deidre A.; Li, Tingkai

    1993-12-07

    Alkali corrosion resistant coatings and ceramic foams having superfine open cell structure are created using sol-gel processes. The processes have particular application in creating calcium magnesium zirconium phosphate, CMZP, coatings and foams.

  16. Two-frequency method for measuring Hall emf in high-resistive materials with charge-carrier low mobility

    International Nuclear Information System (INIS)

    Aleksandrov, A.L.; Vedeneev, A.S.; Gulyaev, I.B.; Zhdan, A.G.

    1982-01-01

    A facility for measuring Hall emf in high-resistive materials with low mobility of charge carriers by the two-frequency method using digital synchronous integration is described. The facility permits to detect the minimum Hall emf approxamatety equat to 5 μV at approximatety equal to 1 T Ohm of the investigated.sample resistance during the measuring time of approximately equal to 2000 s. Sensitivity by Hall mobility makes up >= 0.01 cm 2 /Vxs at the same measuring time. Measuring results of the Hall emf on GaAs monocrystals, CdSe films and island film of gold are presented

  17. A method to design high SNR nanoscale magnetic sensors using an array of tunnelling magneto-resistance (TMR) devices

    International Nuclear Information System (INIS)

    Gomez, P; Litvinov, D; Khizroev, S

    2007-01-01

    This paper presents a systematic method to design and calculate tunnelling magneto-resistance (TMR) sensors with high signal-to-noise ratio (SNR). The sensing module consists of four TMR devices arranged in a Wheatstone-bridge configuration. Closed-form equations were obtained to calculate TMR sensor current, array output voltage, magneto-resistance ratio, overall noise (thermal and shot) and SNR for a given bandwidth. Using this technique we were able to maximize the SNR by tuning the many parameters of the TMR devices. Typical SNR values are in excess of 45 dB

  18. Polar crane

    International Nuclear Information System (INIS)

    Makosinski, S.

    1981-01-01

    In many applications polar cranes have to be repeatedly positioned with high accuracy. A guidance system is disclosed which has two pairs of guides. Each guide consists of two rollers carried by a sheave rotatable mounted on the crane bridge, the rollers being locatable one on each side of a guideway, e.g. the circular track on which the bridge runs. The pairs of guides are interconnected by respective rope loops which pass around and are locked to the respective pairs of sheaves in such a manner that movement of one guide results in equal movement of the other guide in a sense to maintain the repeatability of positioning of the centre of the bridge. A hydraulically-linked guide system is also described. (author)

  19. Generalized Expression for Polarization Density

    International Nuclear Information System (INIS)

    Wang, Lu; Hahm, T.S.

    2009-01-01

    A general polarization density which consists of classical and neoclassical parts is systematically derived via modern gyrokinetics and bounce-kinetics by employing a phase-space Lagrangian Lie-transform perturbation method. The origins of polarization density are further elucidated. Extending the work on neoclassical polarization for long wavelength compared to ion banana width [M. N. Rosenbluth and F. L. Hinton, Phys. Rev. Lett. 80, 724 (1998)], an analytical formula for the generalized neoclassical polarization including both finite-banana-width (FBW) and finite-Larmor-radius (FLR) effects for arbitrary radial wavelength in comparison to banana width and gyroradius is derived. In additional to the contribution from trapped particles, the contribution of passing particles to the neoclassical polarization is also explicitly calculated. Our analytic expression agrees very well with the previous numerical results for a wide range of radial wavelength.

  20. Prediction of non-polar gas solubilities in water, alcohols and aqueous alcohol solutions by the modified ASOG method

    Energy Technology Data Exchange (ETDEWEB)

    Tochigi, K.; Kojima, K.

    1982-07-01

    This study evaluated a technique for predicting gas solubilities based on a modified ASOG group-contribution method, considering water, alcohols, and aqueous alcohol solutions as the solvents. The nonpolar gaseous solutes considered were oxygen, nitrogen, hydrogen, carbon dioxide, argon, methane, ethane, ethylene, propane, and butane. Gas solubilities were correlated and predicted for a partial gas pressure of 1 atm and a temperature range of 50/sup 0/-100/sup 0/F (10/sup 0/-40/sup 0/C) in pure solvents, and then predicted for the same pressure and temperature range in mixed solvents using only the solubility data for the pure solvents. The deviations between the observed and predicted solubilities averaged 6.0% in pure systems and 10.2% in mixed solvents.