WorldWideScience

Sample records for polarization resistance method

  1. Standard test method for conducting potentiodynamic polarization resistance measurements

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1997-01-01

    1.1 This test method covers an experimental procedure for polarization resistance measurements which can be used for the calibration of equipment and verification of experimental technique. The test method can provide reproducible corrosion potentials and potentiodynamic polarization resistance measurements. 1.2 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  2. Resistivity, induced polarization, and self-potential methods in geothermal exploration

    Energy Technology Data Exchange (ETDEWEB)

    Ward, S.H.; Sill, W.R.

    1982-01-01

    An overview of the literature is presented. This is followed by a statement of some elementary electromagnetic theory necessary to establish the MKS system of units and the fundamental physics governing electrical methods of exploration. Next there is presented a reasonably detailed discussion of the electrical properties of earth materials including normal mode of conduction, surface conduction, electrode polarization, membrane polarization, semiconduction, melt conduction, real and complex resistivity, and the origin of self-potentials in geothermal systems. To illustrate how electrical methods are used within the framework of integrated geological, geochemical, and geophysical exploration, the case history of the Monroe-Red Hill hot springs system is presented.

  3. Geophysical modeling in gold deposit through DC Resistivity and Induced Polarization methods

    Directory of Open Access Journals (Sweden)

    César Augusto Moreira

    Full Text Available Abstract Ore mining fundamentally depends on the definition of its tenor and volume, something extremely complex in disseminated mineralization, as in the case of certain types of deposits of gold and sulfites. This article proposes the use of electrical tomography for definition of a geophysical signature in terms of electrical resistivity and chargeability, in an outcrop of mineralized quartz lode at the end of an inactive gold mine. One of the targets was to analyze the continuity of the mineralized body, the occurrence of new outcrops and the applicability of the method as an auxiliary tool in mineral extraction. Three parallel lines of electrical tomography in a dipole-dipole arrangement, being orthogonal to the orientation of the gold lode, were installed in an area outside the mine. The results allowed the geophysical characterization of the mineralized zone by high resistivity (above 1000Ω.m and high chargeability (above 30mV/V. The results of the 2D inversion models were interpolated in 3D visualization models, which allowed definition of the contour surfaces for the physical parameters measured, and the morphological pattern modeling of the mineralization. The data reveal the existence of a new lode in subsurface, localized 30m to the south of the lode outcrop. The versatility of the acquisition and data processing indicate the application potential of electrical tomography as a criterion for sampling and tenor definition in ore extraction activities, since it is objective and low cost.

  4. Electrical Methods: Resistivity Methods

    Science.gov (United States)

    Surface electrical resistivity surveying is based on the principle that the distribution of electrical potential in the ground around a current-carrying electrode depends on the electrical resistivities and distribution of the surrounding soils and rocks.

  5. Building Better Electrodes for Electrical Resistivity and Induced Polarization Data

    Science.gov (United States)

    Adkins, P. L.; La Brecque, D. J.

    2007-12-01

    In the third year of a project to understand and mitigate the systematic noise in resistivity and induced polarization measurements, we put a significant effort into understanding and developing better electrodes. The simple metal electrodes commonly used for both transmitting and receiving of electrical geophysical data are likely the Achilles" heal of the resistivity method. Even stainless steel, a commonly used electrode material because of its durability, showed only average results in laboratory tests for electrode noise. Better results have been found with non-polarizing metal-metal salt electrodes, which are widely used as surface electrodes and in IP surveys. But although they produce small measurement errors, they are not durable enough for in-situ borehole resistivity surveys, and often contain compounds that are toxic to the environment. They are also very seldom used as transmitters. In laboratory studies, we are exploring other materials and configurations for low-noise compound electrodes that will be nontoxic, inexpensive, and durable and can be used as both transmitters and receivers. Testing of the electrical noise levels of electrodes is an arduous task involving repeated measurements under varying conditions at field scales. Thus it is important to find methods of sorting out likely candidates from the mass of possible electrode configurations and construction methods. Testing of electrode impedance versus current density appears to provide simple criteria for predicting the suitability of electrodes. The best electrodes show relatively low overall contact impedance, relatively small changes in impedance with increased current density, and relatively small changes in impedance with time. Furthermore it can be shown that resistivity and induced polarization performance of electrodes is strongly correlated, so that methods of finding electrodes with low impedance and good direct current performance usually provide better quality induced

  6. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  7. Anthropogenic antibiotic resistance genes mobilization to the polar regions

    Directory of Open Access Journals (Sweden)

    Jorge Hernández

    2016-12-01

    Full Text Available Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL-type CTX-M genes in which multilocus sequencing typing (MLST showed different sequence types (STs, previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  8. Effect of composition on the polarization and ohmic resistances of ...

    Indian Academy of Sciences (India)

    2017-06-09

    Jun 9, 2017 ... Keywords. Solid oxide fuel cell; composite cathodes; polarization resistance; ohmic resistance; impedance spectroscopy. 1. Introduction ... cathode electrode and increase in the number of TPB's. ORR in LSM or LSM/YSZ ...... participation of increased number of TPB's from the cathode. Increased number of ...

  9. Effect of composition on the polarization and ohmic resistances of ...

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 40; Issue 3. Effect of composition on the polarization and ohmic resistances of LSM/YSZ composite cathodes in solid oxide fuel cell. B SHRI PRAKASH S SENTHIL KUMAR S T ARUNA. Volume 40 Issue 3 June 2017 pp 441-452 ...

  10. Multi-polar resistance switching and memory effect in copper phthalocyanine junctions

    International Nuclear Information System (INIS)

    Qiao Shi-Zhu; Kang Shi-Shou; Li Qiang; Zhong Hai; Kang Yun; Yu Shu-Yun; Han Guang-Bing; Yan Shi-Shen; Mei Liang-Mo; Qin Yu-Feng

    2014-01-01

    Copper phthalocyanine junctions, fabricated by magnetron sputtering and evaporating methods, show multi-polar (unipolar and bipolar) resistance switching and the memory effect. The multi-polar resistance switching has not been observed simultaneously in one organic material before. With both electrodes being cobalt, the unipolar resistance switching is universal. The high resistance state is switched to the low resistance state when the bias reaches the set voltage. Generally, the set voltage increases with the thickness of copper phthalocyanine and decreases with increasing dwell time of bias. Moreover, the low resistance state could be switched to the high resistance state by absorbing the phonon energy. The stability of the low resistance state could be tuned by different electrodes. In Au/copper phthalocyanine/Co system, the low resistance state is far more stable, and the bipolar resistance switching is found. Temperature dependence of electrical transport measurements demonstrates that there are no obvious differences in the electrical transport mechanism before and after the resistance switching. They fit quite well with Mott variable range hopping theory. The effect of Al 2 O 3 on the resistance switching is excluded by control experiments. The holes trapping and detrapping in copper phthalocyanine layer are responsible for the resistance switching, and the interfacial effect between electrodes and copper phthalocyanine layer affects the memory effect. (interdisciplinary physics and related areas of science and technology)

  11. 2D Resistivity and Induced Polarization Measurement for Manganese Ore Exploration

    Science.gov (United States)

    Srigutomo, Wahyu; Trimadona; Pratomo, Prihandhanu M.

    2016-08-01

    2D Resistivity and Induced Polarization (IP) survey was conducted to delineate the presence of minerals containing manganese in form of manganese ore. The resistivity method concerns with resistivity (ohm.m) of rocks which indicates the electrical properties in terms of ability to resist the flow of electrical current. The presence of manganese in rocks generally lowers the resistivity. The Induced Polarization (IP) method deals with chargeability (in msec) which indicates the strength of polarization effects experienced by ions in the vicinity of metallic grains in rock. The presence of manganese in rocks increases the chargeability of the rock when measured using IP method. The low resistivity zones (resistivity zones may have been influenced by the presence of clay or weathered soil. In this case, the high chargeability zones will help in confirming the prospective zones caused by manganese ore. The thicknesses of the manganese ore layer vary from about 5 to 20 m based on the cross-sections. Based on the results, we estimated the geometry of the associated manganese prospective zones for resistivity (10 msec).

  12. Three-dimensional induced polarization data inversion for complex resistivity

    Energy Technology Data Exchange (ETDEWEB)

    Commer, M.; Newman, G.A.; Williams, K.H.; Hubbard, S.S.

    2011-03-15

    The conductive and capacitive material properties of the subsurface can be quantified through the frequency-dependent complex resistivity. However, the routine three-dimensional (3D) interpretation of voluminous induced polarization (IP) data sets still poses a challenge due to large computational demands and solution nonuniqueness. We have developed a flexible methodology for 3D (spectral) IP data inversion. Our inversion algorithm is adapted from a frequency-domain electromagnetic (EM) inversion method primarily developed for large-scale hydrocarbon and geothermal energy exploration purposes. The method has proven to be efficient by implementing the nonlinear conjugate gradient method with hierarchical parallelism and by using an optimal finite-difference forward modeling mesh design scheme. The method allows for a large range of survey scales, providing a tool for both exploration and environmental applications. We experimented with an image focusing technique to improve the poor depth resolution of surface data sets with small survey spreads. The algorithm's underlying forward modeling operator properly accounts for EM coupling effects; thus, traditionally used EM coupling correction procedures are not needed. The methodology was applied to both synthetic and field data. We tested the benefit of directly inverting EM coupling contaminated data using a synthetic large-scale exploration data set. Afterward, we further tested the monitoring capability of our method by inverting time-lapse data from an environmental remediation experiment near Rifle, Colorado. Similar trends observed in both our solution and another 2D inversion were in accordance with previous findings about the IP effects due to subsurface microbial activity.

  13. Apparent resistivity and spectral induced polarization in the submarine environment

    Directory of Open Access Journals (Sweden)

    HERCULES DE SOUZA

    2001-09-01

    Full Text Available Relatively few investigations have employed electrical methods in the submarine environment, which may be promising for mineral deposits or threatened by environmental problems. We have measured the electric field using both disk and bar electrodes in the sea water at three different levels: sea surface, seven meters deep, and sea bottom at a depth of ten meters, employing a 2 m spacing dipole-dipole array with 7 array spacings of investigation, and 13 values of frequencies at steps of (2N hertz, N = -2, -1, 0, 1, 2,.....10. The measurement allowed the analysis of the electric field as a function of frequency and spacing, and of the spectral induced polarization. Modelling and interpretation of the apparent resistivity yielded a good fit with previous drilling data. Analysis of the spectrum of the complex apparent resistivity and the comparison with equivalent circuits, provided information about the grain size, the mineral composition and the major induced polarization phenomenon occurring below the sea. Therefore the result of the present research show the feasibility of measuring the variation of seawater resistivity in situ, as well as the resistivity of sea bottom sediments.Relativamente poucas investigações têm empregado métodos elétricos no ambiente submarino, o qual pode ser promissor para depósitos minerais ou ameaçado por problemas ambientais. Nós medimos o campo elétrico usando eletrodos em forma de disco e de barra na água do mar, em três níveis distintos: superfície, sete metros de profundidade, e fundo do mar a dez metros de profundidade, empregando um dispositivo dipolo-dipolo com 2m de afastamento, 7 níveis de investigação e 13 valores de freqüência a intervalos de (2N hertz, N = -2, -1, 0, 1, 2, ... 10. A medida permitiu a análise do campo elétrico como uma função de freqüência e afastamento, e da polarização induzida espectral. A modelagem e a interpretação da resistividade aparente se ajustaram bem

  14. Polarization-coupled tunable resistive behavior in oxide ferroelectric heterostructures

    Energy Technology Data Exchange (ETDEWEB)

    Gruverman, Alexei [Univ. of Nebraska, Lincoln, NE (United States); Tsymbal, Evgeny Y. [Univ. of Nebraska, Lincoln, NE (United States); Eom, Chang-Beom [Univ. of Wisconsin, Madison, WI (United States)

    2017-05-03

    This research focuses on investigation of the physical mechanism of the electrically and mechanically tunable resistive behavior in oxide ferroelectric heterostructures with engineered interfaces realized via a strong coupling of ferroelectric polarization with tunneling electroresistance and metal-insulator (M-I) transitions. This report describes observation of electrically conductive domain walls in semiconducting ferroelectrics, voltage-free control of resistive switching and demonstration of a new mechanism of electrical control of 2D electron gas (2DEG) at oxide interfaces. The research goals are achieved by creating strong synergy between cutting-edge fabrication of epitaxial single-crystalline complex oxides, nanoscale electrical characterization by scanning probe microscopy and theoretical modeling of the observed phenomena. The concept of the ferroelectric devices with electrically and mechanically tunable nonvolatile resistance represents a new paradigm shift in realization of the next-generation of non-volatile memory devices and low-power logic switches.

  15. Polarized atomic orbitals for linear scaling methods

    Science.gov (United States)

    Berghold, Gerd; Parrinello, Michele; Hutter, Jürg

    2002-02-01

    We present a modified version of the polarized atomic orbital (PAO) method [M. S. Lee and M. Head-Gordon, J. Chem. Phys. 107, 9085 (1997)] to construct minimal basis sets optimized in the molecular environment. The minimal basis set derives its flexibility from the fact that it is formed as a linear combination of a larger set of atomic orbitals. This approach significantly reduces the number of independent variables to be determined during a calculation, while retaining most of the essential chemistry resulting from the admixture of higher angular momentum functions. Furthermore, we combine the PAO method with linear scaling algorithms. We use the Chebyshev polynomial expansion method, the conjugate gradient density matrix search, and the canonical purification of the density matrix. The combined scheme overcomes one of the major drawbacks of standard approaches for large nonorthogonal basis sets, namely numerical instabilities resulting from ill-conditioned overlap matrices. We find that the condition number of the PAO overlap matrix is independent from the condition number of the underlying extended basis set, and consequently no numerical instabilities are encountered. Various applications are shown to confirm this conclusion and to compare the performance of the PAO method with extended basis-set calculations.

  16. Polarizing matter and antimatter: A new method

    International Nuclear Information System (INIS)

    Onel, Y.

    1992-02-01

    Several years ago a self-polarization effect for stored (anti)- protons and ions was investigated theoretically. The effect is based on the well-known Stern-Gerlach effect in gradient fields. The aim of the ongoing measurements at the Indiana University Cyclotron Facility (IUCF) is to verify experimentally the various assumptions on which this effect is based. The final goal is to demonstrate this new polarization effect. The proposed effect could be a powerful tool to produce polarized stored hadron beams both in the low-energy range and at SSC and LHC energies. In this progress report we will describe our progress in three parts: (A) Experimental work at IUCF Cooler Ring; (B) Our extensive computer simulations of the spin stability for the IUCF Cooler Ring; and (C) Theoretical studies

  17. Polarization sensitive optical coherence tomography detection method

    International Nuclear Information System (INIS)

    Colston, B W; DaSilva, L B; Everett, M J; Featherstone, J D B; Fried, D; Ragadio, J N; Sathyam, U S.

    1999-01-01

    This study demonstrates the potential of polarization sensitive optical coherence tomography (PS-OCT) for non-invasive in vivo detection and characterization of early, incipient caries lesions. PS-OCT generates cross-sectional images of biological tissue while measuring the effect of the tissue on the polarization state of incident light. Clear discrimination between regions of normal and demineralized enamel is first shown in PS-OCT images of bovine enamel blocks containing well-characterized artificial lesions. High-resolution, cross-sectional images of extracted human teeth are then generated that clearly discriminate between the normal and carious regions on both the smooth and occlusal surfaces. Regions of the teeth that appeared to be demineralized in the PS-OCT images were verified using histological thin sections examined under polarized light microscopy. The PS-OCT system discriminates between normal and carious regions by measuring the polarization state of the back-scattered 1310 nm light, which is affected by the state of demineralization of the enamel. Demineralization of enamel increases the scattering coefficient, thus depolarizing the incident light. This study shows that PS-OCT has great potential for the detection, characterization, and monitoring of incipient caries lesions

  18. Validation of External Corrosion Growth-Rate Using Polarization Resistance and Soil Properties

    Science.gov (United States)

    2010-08-01

    The research project evaluated the use of the Linear Polarization Resistance (LPR) and the Electric Resistance (ER) technologies in estimating the external corrosion growth rates of buried steel pipelines. This was achieved by performing laboratory a...

  19. A Bionic Polarization Navigation Sensor and Its Calibration Method.

    Science.gov (United States)

    Zhao, Huijie; Xu, Wujian

    2016-08-03

    The polarization patterns of skylight which arise due to the scattering of sunlight in the atmosphere can be used by many insects for deriving compass information. Inspired by insects' polarized light compass, scientists have developed a new kind of navigation method. One of the key techniques in this method is the polarimetric sensor which is used to acquire direction information from skylight. In this paper, a polarization navigation sensor is proposed which imitates the working principles of the polarization vision systems of insects. We introduce the optical design and mathematical model of the sensor. In addition, a calibration method based on variable substitution and non-linear curve fitting is proposed. The results obtained from the outdoor experiments provide support for the feasibility and precision of the sensor. The sensor's signal processing can be well described using our mathematical model. A relatively high degree of accuracy in polarization measurement can be obtained without any error compensation.

  20. The evaluation of the polarization resistance in a tubular electrode and its application to the hydrogen electrode reaction

    International Nuclear Information System (INIS)

    Montero, M.A.; Marozzi, C.A.; Chialvo, M.R. Gennero de; Chialvo, A.C.

    2007-01-01

    An alternative method for the determination of the kinetic parameters involved in the elementary steps of the reaction mechanism of the hydrogen electrode reaction is proposed. It is based on the determination of the variation of the polarization resistance in a tubular platinum electrode with a laminar flow of electrolyte as a function of the activity of protons of the electrolyte solution. A theoretical expression that relates the experimental variables and the equilibrium polarization resistance is developed, which takes into account the current distribution along the electrode surface. The results are compared with others obtained previously, contributing to the verification of the kinetic mechanism through a completely different experimental procedure

  1. A Low-Complexity DOA and Polarization Method of Polarization-Sensitive Array

    Directory of Open Access Journals (Sweden)

    Wen Dong

    2017-05-01

    Full Text Available This paper proposes a low-complexity method to estimate the direction of arrival and polarization based on the polarization sensitive array (PSA which is composed of cross-dipoles. We built a half-quaternions model through the Cayley–Dickson form to remove the redundant information. Then, the directions of arrival (DOAs were estimated via the root-MUSIC algorithm. Finally, the polarizations were estimated by generalized eigenvalue method. Unlike some existing searching algorithms, such as multiple signal classification (MUSIC, this method can avoid the peak searching and maintains high estimation accuracy. Moreover, we use the oblique projection operators to filter out the interference signals which are decoys of the target signal. Simulation results demonstrate the effectiveness and favorable performance of the proposed method.

  2. Using a multi-method approach based on soil radon deficit, resistivity, and induced polarization measurements to monitor non-aqueous phase liquid contamination in two study areas in Italy and India.

    Science.gov (United States)

    Castelluccio, Mauro; Agrahari, Sudha; De Simone, Gabriele; Pompilj, Francesca; Lucchetti, Carlo; Sengupta, Debashish; Galli, Gianfranco; Friello, Pierluigi; Curatolo, Pierpaolo; Giorgi, Riccardo; Tuccimei, Paola

    2018-02-20

    Geochemical and geophysical surveys employing radon deficit, resistivity, and induced polarization (IP) measurements were undertaken on soil contaminated with non-aqueous phase liquids (NAPLs) in two different sites in India and in Italy. Radon deficit, validated through the comparison with average soil radon in reference unpolluted areas, shows the extension of contamination in the upper part of the unsaturated aquifers. In site 1 (Italy), the spill is not recent. A residual film of kerosene covers soil grains, inhibiting their chargeability and reducing electrical resistivity difference with background unpolluted areas. No correlation between the two parameters is observed. Soil volatile organic compounds (VOCs) concentration is not linked with radon deficit, supporting the old age of the spillage. NAPL pollution in sites 2a and 2b (India) is more recent and probably still active, as demonstrated by higher values of electrical resistivity. A good correlation with IP values suggests that NAPL is still distributed as droplets or as a continuous phase in the pores, strengthening the scenario of a fresh spill or leakage. Residual fraction of gasoline in the pore space of sites 2a and 2b is respectively 1.5 and 11.8 kg per cubic meter of terrain. This estimation is referred to the shallower portion of the unsaturated aquifer. Electrical resistivity is still very high indicating that the gasoline has not been strongly degraded yet. Temperature and soil water content influence differently radon deficit in the three areas, reducing soil radon concentration and partly masking the deficit in sites 2a and 2b.

  3. Polarization control method for UV writing of advanced bragg gratings

    DEFF Research Database (Denmark)

    Deyerl, Hans-Jürgen; Plougmann, Nikolai; Jensen, Jesper Bo Damm

    2002-01-01

    We report the application of the polarization control method for the UV writing of advanced fiber Bragg gratings (FBG). We demonstrate the strength of the new method for different apodization profiles, including the Sinc-profile and two designs for dispersion-free square filters. The method has...

  4. Effect of composition on the polarization and ohmic resistances of ...

    Indian Academy of Sciences (India)

    However, the ohmic resistance was highest for the same composition and amounted to 60% of the total resistance value. Compositional dependence of resistances has been explained based on the variations of the triple phase boundaries and width of the O 2 −ion migration path with the composition of the electrode.

  5. Angular and Polarization Response of Multimode Sensors with Resistive-Grid Absorbers

    Science.gov (United States)

    Kusaka, Akito; Wollack, Edward J.; Stevenson, Thomas R.

    2014-01-01

    High sensitivity receiver systems with near ideal polarization sensitivity are highly desirable for development of millimeter and sub-millimeter radio astronomy. Multimoded bolometers provide a unique solution to achieve such sensitivity, for which hundreds of single-mode sensors would otherwise be required. The primary concern in employing such multimoded sensors for polarimetery is the control of the polarization systematics. In this paper, we examine the angular- and polarization- dependent absorption pattern of a thin resistive grid or membrane, which models an absorber used for a multimoded bolometer. The result shows that a freestanding thin resistive absorber with a surface resistivity of eta/2, where eta is the impedance of free space, attains a beam pattern with equal E- and H-plane responses, leading to zero cross polarization. For a resistive-grid absorber, the condition is met when a pair of grids is positioned orthogonal to each other and both have a resistivity of eta/2. When a reflective backshort termination is employed to improve absorption efficiency, the cross-polar level can be suppressed below -30 dB if acceptance angle of the sensor is limited to < or approx. 60deg. The small cross-polar systematics have even-parity patterns and do not contaminate the measurements of odd-parity polarization patterns, for which many of recent instruments for cosmic microwave background are designed. Underlying symmetry that suppresses these cross-polar systematics is discussed in detail. The estimates and formalism provided in this paper offer key tools in the design consideration of the instruments using the multimoded polarimeters.

  6. Estimation method of the fracture resistance curve

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Sung Keun; Lee, Kwang Hyeon; Koo, Jae Mean; Seok, Chang Sung [Sungkyunkwan Univ., Suwon (Korea, Republic of); Park, Jae Sil [Samsung Electric Company, Suwon (Korea, Republic of)

    2008-07-01

    Fracture resistance curves for concerned materials are required in order to perform elastic-plastic fracture mechanical analysis. Fracture resistance curve is built with J-integral values and crack extension values. The objective of this paper is to propose the estimation method of the fracture resistance curve. The estimation method of the fracture resistance curve for the pipe specimen was proposed by the load ratio method from load - displacement data for the standard specimen.

  7. Arbitrary control of the polarization and intensity profiles of diffraction-attenuation-resistant beams along their propagation direction

    OpenAIRE

    Corato-Zanarella, Mateus; Dorrah, Ahmed H.; Zamboni-Rached, Michel; Mojahedi, Mo

    2017-01-01

    We report on the theory and experimental generation of a class of diffraction-attenuation-resistant beams with state of polarization (SoP) and intensity that can be controlled on demand along the propagation direction. This is achieved by a suitable superposition of Bessel beams, whose parameters are systematically chosen based on closed-form analytic expressions provided by the Frozen Waves (FWs) method. Using an amplitude-only spatial light modulator, we experimentally demonstrate three sce...

  8. Effect of composition on the polarization and ohmic resistances of ...

    Indian Academy of Sciences (India)

    2017-06-09

    % of the total resistance value. Compositional dependence of ..... C due to our experimental limitations. However, it would not have any ... TPB's are present) suggest the formation of face-to-face con- tacts between the cathode ...

  9. Results of polarization resistance and impedance of steel bars embedded in carbonated concrete contaminated with chlorides

    International Nuclear Information System (INIS)

    Andrade, C.; Alonso, C.; Gonzalez, J.A.

    1989-01-01

    Laboratory results of the corrosion rate of steel embedded in carbonated concrete contaminated with chlorides determined through the Polarization Resistance method are presented here as examples of the possibilities offered by this technique in order to monitor the reinforcement corrosion process. The Rp technique has the advantages of fast response, simple and relatively accurate. Contrasts with gravimetric losses are presented. The A.C. Impedance measurements determined on the same specimens are also presented. The difficulties found in the interpretation of the results are stressed. R T values cannot easily be obtained. Several electrical circuits which may model the behaviour of the steel/concrete system are discussed. Finally, comments on the basic criteria to interpret results of both techniques are given. (author) 4 refs., 6 figs

  10. Method of production of polarized negative hydrogen ions

    International Nuclear Information System (INIS)

    Belov, A.S.; Kuzik, V.E.; Yakushev, V.P.

    1990-01-01

    Result of experimental examination of the method of producing negative polarized hydrogen ions are presented. Beams of polarized hydrogen atoms and deuterium plasma are injected towards each other and meet in the region of recharging 1 in 1.3 kGs magnetic field, created by a solenoid. As follows from the measurements performed and the method analysis, a possibility of producing an intense H-vector - ion beam according to the given method is mainly dependent on plasma deuterium target parameters. It is possible to produce ∼500 μA current H-vector - ion beam by the method considered under ∼0.1 relative D - ion density in plasma, ∼1 eV electron temperature, ∼10 2 eV ion temperature (typical of surface - plasma sources) and 2 cm 2 transverse area of recharging volume. The method advantages as well include the absence in a source of targets of alkali metal vapours, the presence of which in other methods limits the time of continuous source operation and makes their operation difficult

  11. Evaluation of Extraction Protocols for Simultaneous Polar and Non-Polar Yeast Metabolite Analysis Using Multivariate Projection Methods

    Directory of Open Access Journals (Sweden)

    Nicolas P. Tambellini

    2013-07-01

    Full Text Available Metabolomic and lipidomic approaches aim to measure metabolites or lipids in the cell. Metabolite extraction is a key step in obtaining useful and reliable data for successful metabolite studies. Significant efforts have been made to identify the optimal extraction protocol for various platforms and biological systems, for both polar and non-polar metabolites. Here we report an approach utilizing chemoinformatics for systematic comparison of protocols to extract both from a single sample of the model yeast organism Saccharomyces cerevisiae. Three chloroform/methanol/water partitioning based extraction protocols found in literature were evaluated for their effectiveness at reproducibly extracting both polar and non-polar metabolites. Fatty acid methyl esters and methoxyamine/trimethylsilyl derivatized aqueous compounds were analyzed by gas chromatography mass spectrometry to evaluate non-polar or polar metabolite analysis. The comparative breadth and amount of recovered metabolites was evaluated using multivariate projection methods. This approach identified an optimal protocol consisting of 64 identified polar metabolites from 105 ion hits and 12 fatty acids recovered, and will potentially attenuate the error and variation associated with combining metabolite profiles from different samples for untargeted analysis with both polar and non-polar analytes. It also confirmed the value of using multivariate projection methods to compare established extraction protocols.

  12. Antimicrobial resistance in campylobacter: susceptibility testing methods and resistance trends.

    Science.gov (United States)

    Ge, Beilei; Wang, Fei; Sjölund-Karlsson, Maria; McDermott, Patrick F

    2013-10-01

    Most Campylobacter infections are self-limiting but antimicrobial treatment (e.g., macrolides, fluoroquinolones) is necessary in severe or prolonged cases. Susceptibility testing continues to play a critical role in guiding therapy and epidemiological monitoring of resistance. The methods of choice for Campylobacter recommended by the Clinical and Laboratory Standards Institute (CLSI) are agar dilution and broth microdilution, while a disk diffusion method was recently standardized by the European Committee on Antimicrobial Susceptibility Testing (EUCAST). Macrolides, quinolones, and tetracyclines are among the common antimicrobials recommended for testing. Molecular determination of Campylobacter resistance via DNA sequencing or PCR-based methods has been performed. High levels of resistance to tetracycline and ciprofloxacin are frequently reported by many national surveillance programs, but resistance to erythromycin and gentamicin in Campylobacter jejuni remains low. Nonetheless, variations in susceptibility observed over time underscore the need for continued public health monitoring of Campylobacter resistance from humans, animals, and food. Published by Elsevier B.V.

  13. Modeling and inversion Matlab algorithms for resistivity, induced polarization and seismic data

    Science.gov (United States)

    Karaoulis, M.; Revil, A.; Minsley, B. J.; Werkema, D. D.

    2011-12-01

    M. Karaoulis (1), D.D. Werkema (3), A. Revil (1,2), A., B. Minsley (4), (1) Colorado School of Mines, Dept. of Geophysics, Golden, CO, USA. (2) ISTerre, CNRS, UMR 5559, Université de Savoie, Equipe Volcan, Le Bourget du Lac, France. (3) U.S. EPA, ORD, NERL, ESD, CMB, Las Vegas, Nevada, USA . (4) USGS, Federal Center, Lakewood, 10, 80225-0046, CO. Abstract We propose 2D and 3D forward modeling and inversion package for DC resistivity, time domain induced polarization (IP), frequency-domain IP, and seismic refraction data. For the resistivity and IP case, discretization is based on rectangular cells, where each cell has as unknown resistivity in the case of DC modelling, resistivity and chargeability in the time domain IP modelling, and complex resistivity in the spectral IP modelling. The governing partial-differential equations are solved with the finite element method, which can be applied to both real and complex variables that are solved for. For the seismic case, forward modeling is based on solving the eikonal equation using a second-order fast marching method. The wavepaths are materialized by Fresnel volumes rather than by conventional rays. This approach accounts for complicated velocity models and is advantageous because it considers frequency effects on the velocity resolution. The inversion can accommodate data at a single time step, or as a time-lapse dataset if the geophysical data are gathered for monitoring purposes. The aim of time-lapse inversion is to find the change in the velocities or resistivities of each model cell as a function of time. Different time-lapse algorithms can be applied such as independent inversion, difference inversion, 4D inversion, and 4D active time constraint inversion. The forward algorithms are benchmarked against analytical solutions and inversion results are compared with existing ones. The algorithms are packaged as Matlab codes with a simple Graphical User Interface. Although the code is parallelized for multi

  14. Lithological characterization of a contaminated site using Direct current resistivity and time domain Induced Polarization

    DEFF Research Database (Denmark)

    Maurya, Pradip Kumar; Fiandaca, Gianluca; Auken, Esben

    study a large contaminated site in Denmark was investigated using direct current resistivity and time domain induced polarization (DCIP). For this purpose 14 profiles were collected alongside a stream in order to investigate the contamination and delineate the lithological units. 2D inversion using...

  15. A method to calculate Stokes parameters and angle of polarization of skylight from polarized CIMEL sun/sky radiometers

    International Nuclear Information System (INIS)

    Li, L.; Li, Z.; Li, K.; Blarel, L.; Wendisch, M.

    2014-01-01

    The polarized CIMEL sun/sky radiometers have been routinely operated within the Sun/sky-radiometer Observation NETwork (SONET) in China and some sites of the AErosol RObotic NETwork (AERONET) around the world. However, the polarization measurements are not yet widely used due to in a certain degree the lack of Stokes parameters derived directly from these polarization measurements. Meanwhile, it have been shown that retrievals of several microphysical properties of aerosol particles can be significantly improved by using degree of linear polarization (DoLP) measurements of polarized CIMEL sun/sky radiometers (CE318-DP). The Stokes parameters Q and U, as well as angle of polarization (AoP) contain additional information about linear polarization and its orientation. A method to calculate Stokes parameters Q, U, and AoP from CE318-DP polarized skylight measurements is introduced in this study. A new polarized almucantar geometry based on CE318-DP is measured to illustrate abundant variation features of these parameters. The polarization parameters calculated in this study are consistent with previous results of DoLP and I, and also comparable to vector radiative transfer simulations. - Highlights: • The CE318-DP polarized measurements are not yet widely used except DoLP. • Compared with DoLP and I, difficulty in calculating Stokes Q and U is discussed. • A new polarized almucantar observation geometry based on CE318-DP is executed. • We derive Stokes Q, U, and AoP both in principal and almucantar plane geometries. • The results are comparable with previous DoLP and I, as well as model simulations

  16. Interferometric method for birefringence determination with a polarizing microscope.

    Science.gov (United States)

    Dumitraşcu, Leonaş; Dumitraşcu, Irina; Dorohoi, Dana-Ortansa; Toma, Mihai

    2008-12-08

    We present a new mathematical technique which can be used to determine the main refractive indices and the birefringence of an anisotropic layer by using a polarizing microscope in conoscopic illumination. The values of the birefringence for the yellow radiation of a Na lamp are determined here for a Carpathian quartz sample, but the technique can also be applied to the study of other uniaxial substances such as liquid crystals, model membranes or biological tissues. The validity of the proposed method was tested by comparing the results with those obtained with a Rayleigh interferometer and by using the technology of channeled spectra.

  17. Electrical Resistivity Tomography and Induced Polarization for Mapping the Subsurface of Alluvial Fans: A Case Study in Punata (Bolivia

    Directory of Open Access Journals (Sweden)

    Andres Gonzales Amaya

    2016-11-01

    Full Text Available Conceptual models of aquifer systems can be refined and complemented with geophysical data, and they can assist in understanding hydrogeological properties such as groundwater storage capacity. This research attempts to use geoelectrical methods, Electrical Resistivity Tomography and Induced Polarization parameters, for mapping the subsurface in alluvial fans and to demonstrate its applicability; the Punata alluvial fan was used as a case study. The resistivity measurements proved to be a good tool for mapping the subsurface in the fan, especially when used in combination with Induced Polarization parameters (i.e., Normalized Chargeability. The Punata alluvial fan characterization indicated that the top part of the subsurface is composed of boulders in a matrix of finer particles and that the grain size decreases with depth; the electrical resistivity of these deposits ranged from 200 to 1000 Ωm, while the values of normalized chargeability were lower than 0.05 mS/m. The bottom of the aquifer system consisted of a layer with high clay content, and the resistivity ranged from 10 to 100 Ωm, while the normalized chargeability is higher than 0.07 mS/m. With the integration of these results and lithological information, a refined conceptual model is proposed; this model gives a more detailed description of the local aquifer system. It can be concluded that geoelectrical methods are useful for mapping aquifer systems in alluvial fans.

  18. Polarization methods for diode laser excitation of solid state lasers

    Science.gov (United States)

    Holtom, Gary R.

    2008-11-25

    A mode-locked laser employs a coupled-polarization scheme for efficient longitudinal pumping by reshaped laser diode bars. One or more dielectric polarizers are configured to reflect a pumping wavelength having a first polarization and to reflect a lasing wavelength having a second polarization. A Yb-doped gain medium can be used that absorbs light having a first polarization and emits light having a second polarization. Using such pumping with laser cavity dispersion control, pulse durations of less than 100 fs can be achieved.

  19. Arbitrary Control of Polarization and Intensity Profiles of Diffraction-Attenuation-Resistant Beams along the Propagation Direction

    Science.gov (United States)

    Corato-Zanarella, Mateus; Dorrah, Ahmed H.; Zamboni-Rached, Michel; Mojahedi, Mo

    2018-02-01

    We report on the theory and experimental generation of a class of diffraction-attenuation-resistant beams with state of polarization (SOP) and intensity that can be controlled on demand along the propagation direction. This control is achieved by a suitable superposition of Bessel beams, whose parameters are systematically chosen based on closed-form analytic expressions provided by the frozen waves method. Using an amplitude-only spatial light modulator, we experimentally demonstrate three scenarios. In the first, the SOP of a horizontally polarized beam evolves to radial polarization and is then changed to vertical polarization, with the beam intensity held constant. In the second, we simultaneously control the SOP and the longitudinal intensity profile, which is chosen such that the beam's central ring can be switched off over predefined space regions, thus generating multiple foci with different SOPs and at different intensity levels along the propagation. Finally, the ability to control the SOP while overcoming attenuation inside lossy fluids is shown experimentally. We envision our proposed method to be of great interest for many applications, such as optical tweezers, atom guiding, material processing, microscopy, and optical communications.

  20. A novel method for polarization squeezing with Photonic Crystal Fibers

    DEFF Research Database (Denmark)

    Milanovic, Josip; Lassen, Mikael Østergaard; Andersen, Ulrik Lund

    2010-01-01

    fiber squeezing experiments. Explicit we produce squeezed states in counter propagating pulses along the same fiber axis to achieve near identical dispersion properties. This enables the production of polarization squeezing through interference in a polarization type Sagnac interferometer. We observe...

  1. Analytical method for establishing indentation rolling resistance

    Science.gov (United States)

    Gładysiewicz, Lech; Konieczna, Martyna

    2018-01-01

    Belt conveyors are highly reliable machines able to work in special operating conditions. Harsh environment, long distance of transporting and great mass of transported martials are cause of high energy usage. That is why research in the field of belt conveyor transportation nowadays focuses on reducing the power consumption without lowering their efficiency. In this paper, previous methods for testing rolling resistance are described, and new method designed by authors was presented. New method of testing rolling resistance is quite simple and inexpensive. Moreover it allows to conduct the experimental tests of the impact of different parameters on the value of indentation rolling resistance such as core design, cover thickness, ambient temperature, idler travel frequency, or load value as well. Finally results of tests of relationship between rolling resistance and idler travel frequency and between rolling resistance and idler travel speed was presented.

  2. Polarization and resistivity measurements of post-crystallization changes in amorphous Fe-B-Si alloys

    International Nuclear Information System (INIS)

    Chattoraj, I.; Bhattamishra, A.K.; Mitra, A.

    1993-01-01

    The effects of grain growth and compositional changes on the electrochemical behavior and the resistivity of amorphous iron-boron-silicon (Fe 77.5 B 15 Si 7.5 ) alloys after crystallization were studied. Deterioration of the protective passive film was observed, along with increased annealing. Potentiodynamic polarization provided excellent information about microstructural and chemical changes. It was concluded that electrochemical measurements could be used in conjunction with resistivity measurements in direct studies of grain growth and chemical changes occurring in different phases of the devitrified alloy

  3. The use of the multiple-gradient array for geoelectrical resistivity and induced polarization imaging

    Science.gov (United States)

    Aizebeokhai, Ahzegbobor P.; Oyeyemi, Kehinde D.

    2014-12-01

    The use of most conventional electrode configurations in electrical resistivity survey is often time consuming and labour intensive, especially when using manual data acquisition systems. Often, data acquisition teams tend to reduce data density so as to speed up field operation thereby reducing the survey cost; but this could significantly degrade the quality and resolution of the inverse models. In the present work, the potential of using the multiple-gradient array, a non-conventional electrode configuration, for practical cost effective and rapid subsurface resistivity and induced polarization mapping was evaluated. The array was used to conduct 2D resistivity and time-domain induced polarization imaging along two traverses in a study site at Ota, southwestern Nigeria. The subsurface was characterised and the main aquifer delineated using the inverse resistivity and chargeability images obtained. The performance of the multiple-gradient array was evaluated by correlating the 2D resistivity and chargeability images with those of the conventional Wenner array as well as the result of some soundings conducted along the same traverses using Schlumberger array. The multiple-gradient array has been found to have the advantage of measurement logistics and improved image resolution over the Wenner array.

  4. Mapping geological structures in bedrock via large-scale direct current resistivity and time-domain induced polarization tomography

    DEFF Research Database (Denmark)

    Rossi, Matteo; Olsson, Per-Ivar; Johansson, Sara

    2017-01-01

    An investigation of geological conditions is always a key point for planning infrastructure constructions. Bedrock surface and rock quality must be estimated carefully in the designing process of infrastructures. A large direct-current resistivity and time-domain induced-polarization survey has......, there are northwest-trending Permian dolerite dykes that are less deformed. Four 2D direct-current resistivity and time-domain induced-polarization profiles of about 1-km length have been carefully pre-processed to retrieve time-domain induced polarization responses and inverted to obtain the direct......-current resistivity distribution of the subsoil and the phase of the complex conductivity using a constant-phase angle model. The joint interpretation of electrical resistivity and induced-polarization models leads to a better understanding of complex three-dimensional subsoil geometries. The results have been...

  5. 77 GHz MEMS antennas on high-resistivity silicon for linear and circular polarization

    KAUST Repository

    Sallam, M. O.

    2011-07-01

    Two new MEMS antennas operating at 77 GHz are presented in this paper. The first antenna is linearly polarized. It possesses a vertical silicon wall that carries a dipole on top of it. The wall is located on top of silicon substrate covered with a ground plane. The other side of the substrate carries a microstrip feeding network in the form of U-turn that causes 180 phase shift. This phase-shifter feeds the arms of the dipole antenna via two vertical Through-Silicon Vias (TSVs) that go through the entire wafer. The second antenna is circularly polarized and formed using two linearly polarized antennas spatially rotated with respect to each other by 90 and excited with 90 phase shift. Both antennas are fabricated using novel process flow on a single high-resistivity silicon wafer via bulk micromachining. Only three processing steps are required to fabricate these antennas. The proposed antennas have appealing characteristics, such as high polarization purity, high gain, and high radiation efficiency. © 2011 IEEE.

  6. Polarizing matter and antimatter: A new method. Final report

    International Nuclear Information System (INIS)

    Onel, Y.

    1994-12-01

    Several years ago a self-polarization effect for stored (anti-)protons and ions was investigated theoretically. The effect is based on the well-known Stern-Gerlach effect in gradient fields. The aim of the ongoing measurements at the Indiana University Cyclotron Facility (IUCF) is to verify experimentally the various assumptions on which this effect is based. The final goal is to demonstrate this new polarization effect. The proposed effect could be a powerful tool to produce polarized stored hadron beams both in the low-energy range and at SSC and LHC energies. In this progress report the authors will describe the progress in three parts: (A) experimental work at IUCF Cooler Ring; (B) the extensive computer simulations of the spin stability for the IUCF Cooler Ring; and (C) theoretical studies

  7. Determination of electro-optic coefficients of lithium niobate crystal by polarization and interference methods

    Science.gov (United States)

    Syuy, A. V.; Kile, E. O.

    2016-11-01

    In this paper electrooptical coefficients r22, [r13 - 0.9r33 ], of nominally pure single congruent crystal of lithium niobate are determined. Measurement of electro-optic coefficients is produced by two independent methods: polarization and interference. The polarization scheme is based on the Senarmont method and interference scheme - on conoscopic figures.

  8. The polarization evolution of electromagnetic waves as a diagnostic method for a motional plasma

    Science.gov (United States)

    Shahrokhi, Alireza; Mehdian, Hassan; Hajisharifi, Kamal; Hasanbeigi, Ali

    2017-12-01

    The polarization evolution of electromagnetic (EM) radiation propagating through an electron beam-ion channel system is studied in the presence of self-magnetic field. Solving the fluid-Maxwell equations to obtain the medium dielectric tensor, the Stokes vector-Mueller matrix approach is employed to determine the polarization of the launched EM wave at any point in the propagation direction, applying the space-dependent Mueller matrix on the initial polarization vector of the wave at the plasma-vacuum interface. Results show that the polarization evolution of the wave is periodic in space along the beam axis with the specified polarization wavelength. Using the obtained results, a novel diagnostic method based on the polarization evolution of the EM waves is proposed to evaluate the electron beam density and velocity. Moreover, to use the mentioned plasma system as a polarizer, the fraction of the output radiation power transmitted through a motional plasma crossed with the input polarization is calculated. The results of the present investigation will greatly contribute to design a new EM amplifier with fixed polarization or EM polarizer, as well as a new diagnostic approach for the electron beam system where the polarimetric method is employed.

  9. Human macrophage polarization in vitro: Maturation and activation methods compared

    NARCIS (Netherlands)

    Vogel, D.Y.S.; Glim, J.E.; Stavenuiter, A.W.D.; Breur, M.; Heijnen, P.; Amor, S.; Dijkstra, C.D.; Beelen, R.H.J.

    2014-01-01

    Macrophages form a heterogeneous cell population displaying multiple functions, and can be polarized into pro- (M1) or anti-inflammatory (M2) macrophages, by environmental factors. Their activation status reflects a beneficial or detrimental role in various diseases. Currently several in vitro

  10. Low-Dispersion Fibre Bragg Gratings Written Using the Polarization Control Method

    DEFF Research Database (Denmark)

    Deyerl, Hans Jürgen; Plougmann, Nikolai; Jensen, Jesper Bo Damm

    2002-01-01

    We present two fibre Bragg gratings with reduced in-band dispersion for DWDM applications. The gratings were designed by the inverse scattering method and fabricated using the novel polarization control method for UV-writing of advanced gratings.......We present two fibre Bragg gratings with reduced in-band dispersion for DWDM applications. The gratings were designed by the inverse scattering method and fabricated using the novel polarization control method for UV-writing of advanced gratings....

  11. CTLA-4Ig immunotherapy of obesity-induced insulin resistance by manipulation of macrophage polarization in adipose tissues

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Masakazu, E-mail: masakazu731079@yahoo.co.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Inoguchi, Toyoshi, E-mail: toyoshi@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Batchuluun, Battsetseg, E-mail: battsetseg.batchuluun@gmail.com [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Sugiyama, Naonobu, E-mail: nao1@intmed1.med.kyushu-u.ac.jp [Department of Medicine and Biosystemic Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Kobayashi, Kunihisa, E-mail: nihisak@fukuoka-u.ac.jp [Department of Endocrinology and Diabetes Mellitus, Fukuoka University Chikushi Hospital, 1-1-1 Zokumyoin, Chikushino, Fukuoka 818-8502 (Japan); Sonoda, Noriyuki, E-mail: noriyuki@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Innovation Center for Medical Redox Navigation, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan); Takayanagi, Ryoichi, E-mail: takayana@intmed3.med.kyushu-u.ac.jp [Department of Internal Medicine and Bioregulatory Science, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582 (Japan)

    2013-08-16

    Highlights: •CTLA-4Ig completely alleviates HFD-induced insulin resistance. •CTLA-4Ig reduces epididymal and subcutaneous fat tissue weight and adipocyte size. •CTLA-4Ig alters ATM polarization from inflammatory M1 to anti-inflammatory M2. •CTLA-4Ig may lead to a novel anti-obesity/inflammation/insulin resistance agent. •We identified the mechanism of the novel favorable effects of CTLA-4lg. -- Abstract: It has been established that obesity alters the metabolic and endocrine function of adipose tissue and, together with accumulation of adipose tissue macrophages, contributes to insulin resistance. Although numerous studies have reported that shifting the polarization of macrophages from M1 to M2 can alleviate adipose tissue inflammation, manipulation of macrophage polarization has not been considered as a specific therapy. Here, we determined whether cytotoxic T-lymphocyte-associated antigen-4IgG1 (CTLA-4Ig) can ameliorate insulin resistance by induction of macrophages from proinflammatory M1 to anti-inflammatory M2 polarization in the adipose tissues of high fat diet-induced insulin-resistant mice. CTLA4-Ig treatment prevented insulin resistance by changing gene expression to M2 polarization, which increased the levels of arginase 1. Furthermore, flow cytometric analysis confirmed the alteration of polarization from CD11c (M1)- to CD206 (M2)-positive cells. Concomitantly, CTLA-4Ig treatment resulted in weight reductions of epididymal and subcutaneous adipose tissues, which may be closely related to overexpression of apoptosis inhibitors in macrophages. Moreover, proinflammatory cytokine and chemokine levels decreased significantly. In contrast, CCAAT enhancer binding protein α, peroxisome proliferator-activated receptor γ, and adiponectin expression increased significantly in subcutaneous adipose tissue. This novel mechanism of CTLA-4lg immunotherapy may lead to an ideal anti-obesity/inflammation/insulin resistance agent.

  12. CTLA-4Ig immunotherapy of obesity-induced insulin resistance by manipulation of macrophage polarization in adipose tissues

    International Nuclear Information System (INIS)

    Fujii, Masakazu; Inoguchi, Toyoshi; Batchuluun, Battsetseg; Sugiyama, Naonobu; Kobayashi, Kunihisa; Sonoda, Noriyuki; Takayanagi, Ryoichi

    2013-01-01

    Highlights: •CTLA-4Ig completely alleviates HFD-induced insulin resistance. •CTLA-4Ig reduces epididymal and subcutaneous fat tissue weight and adipocyte size. •CTLA-4Ig alters ATM polarization from inflammatory M1 to anti-inflammatory M2. •CTLA-4Ig may lead to a novel anti-obesity/inflammation/insulin resistance agent. •We identified the mechanism of the novel favorable effects of CTLA-4lg. -- Abstract: It has been established that obesity alters the metabolic and endocrine function of adipose tissue and, together with accumulation of adipose tissue macrophages, contributes to insulin resistance. Although numerous studies have reported that shifting the polarization of macrophages from M1 to M2 can alleviate adipose tissue inflammation, manipulation of macrophage polarization has not been considered as a specific therapy. Here, we determined whether cytotoxic T-lymphocyte-associated antigen-4IgG1 (CTLA-4Ig) can ameliorate insulin resistance by induction of macrophages from proinflammatory M1 to anti-inflammatory M2 polarization in the adipose tissues of high fat diet-induced insulin-resistant mice. CTLA4-Ig treatment prevented insulin resistance by changing gene expression to M2 polarization, which increased the levels of arginase 1. Furthermore, flow cytometric analysis confirmed the alteration of polarization from CD11c (M1)- to CD206 (M2)-positive cells. Concomitantly, CTLA-4Ig treatment resulted in weight reductions of epididymal and subcutaneous adipose tissues, which may be closely related to overexpression of apoptosis inhibitors in macrophages. Moreover, proinflammatory cytokine and chemokine levels decreased significantly. In contrast, CCAAT enhancer binding protein α, peroxisome proliferator-activated receptor γ, and adiponectin expression increased significantly in subcutaneous adipose tissue. This novel mechanism of CTLA-4lg immunotherapy may lead to an ideal anti-obesity/inflammation/insulin resistance agent

  13. The optimal method for the measurement of tau polarization

    International Nuclear Information System (INIS)

    Davier, M.; Duflot, L.; Le Diberder, F.; Rouge, A.

    1992-12-01

    A variable is constructed for each τ decay channel which carries all the available information on the τ spin state. Its use allows a simple determination of the polarization with the maximal sensitivity for all final states. Further applications to the τ → α 1 ν channel are discussed, and it is shown that a sizeable improvement of the measurement can be achieved. (author) 14 refs., 2 figs., 1 tab

  14. Tomographic surveys for mineral exploration using complex resistivity method

    Science.gov (United States)

    Son, J.; Park, S.; Kim, J.

    2011-12-01

    Complex resistive method is a kind of induced polarization (IP) method which all the measurement is made in frequency domain. It transmits the current with the specified frequency through current electrodes, and measure the amplitude and phase to the transmitted current at receiver electrodes. It is also called SIP (Spectral IP) method when multi-frequency measurements are involved. Our research group has been developing the methodology and interpretation technique for SIP survey for several years, and already developed 2/3D inversion algorithms and extended them to the simultaneous inversion of multi-frequency IP data. Recently we are developing mining evaluation technique by relating the inverted property of field IP data to the measured one in the laboratory through geo-statistical relationship. L1-norm inversion using IRLS (iterative reweighted least squares) method is introduced to overcome the problem of noise sensitive characteristics of complex resistivity data, especially in phase data and effectively applied to the field data. The L1-norm inversion improves the noise characteristics of complex resistivity survey. However complex resistivity method is used only for the surface survey because it require special electrode like porous pot and layout of cables to minimize the interference between transmitters and receivers. In this study, we applied complex resistivity method to the tomographic survey using boreholes and interpret data using L1-norm inversion technique to verify applicability without special electrode and layout of cables. Survey was done for the boreholes drilled in the tunnel for prospecting possible mineralized zone. Zeta system based on GDP multi-function receiver manufactured by Zonge was used in this survey and tomographic data measurement was made for two frequencies, 0.25 and 1 Hz. 30 electrodes respectively for two boreholes, a total of 60 electrodes were used in this survey and electrode spacing was 10 meter. Quality of measured data

  15. A three-dimensional polarization domain retrieval method from electron diffraction data

    International Nuclear Information System (INIS)

    Pennington, Robert S.; Koch, Christoph T.

    2015-01-01

    We present an algorithm for retrieving three-dimensional domains of picometer-scale shifts in atomic positions from electron diffraction data, and apply it to simulations of ferroelectric polarization in BaTiO 3 . Our algorithm successfully and correctly retrieves polarization domains in which the Ti atom positions differ by less than 3 pm (0.4% of the unit cell diagonal distance) with 5 and 10 nm depth resolution along the beam direction, and we also retrieve unit cell strain, corresponding to tetragonal-to-cubic unit cell distortions, for 10 nm domains. Experimental applicability is also discussed. - Highlights: • We show a retrieval method for ferroelectric polarization from TEM diffraction data. • Simulated strain and polarization variations along the beam direction are retrieved. • This method can be used for 3D strain and polarization mapping without specimen tilt

  16. The electrical resistivity method in cased boreholes

    Energy Technology Data Exchange (ETDEWEB)

    Schenkel, C.J.

    1991-05-01

    The use of downhole current sources in resistivity mapping can greatly enhance the detection and delineation of subsurface features. The purpose of this work is to examine the resistivity method for current sources in wells cased with steel. The resistivity method in cased boreholes with downhole current sources is investigated using the integral equation (IE) technique. The casing and other bodies are characterized as conductivity inhomogeneities in a half-space. For sources located along the casing axis, an axially symmetric Green's function is used to formulate the surface potential and electric field (E-field) volume integral equations. The situations involving off-axis current sources and three-dimensional (3-D) bodies is formulated using the surface potential IE method. The solution of the 3-D Green's function is presented in cylindrical and Cartesian coordinate systems. The methods of moments is used to solve the Fredholm integral equation of the second kind for the response due to the casing and other bodies. The numerical analysis revealed that the current in the casing can be approximated by its vertical component except near the source and the axial symmetric approximation of the casing is valid even for the 3-D problem. The E-field volume IE method is an effective and efficient technique to simulate the response of the casing in a half-space, whereas the surface potential approach is computationally better when multiple bodies are involved. Analyzing several configurations of the current source indicated that the casing response is influenced by four characteristic factors: conduction length, current source depth,casing depth, and casing length. 85 refs., 133 figs., 11 tabs.

  17. Detection and Identification of Multipath Jamming Method for Polarized Radar Seeker

    Directory of Open Access Journals (Sweden)

    Dai Huanyao

    2016-04-01

    Full Text Available Multipath jamming is an effective self-defense jamming mode used to counter airborne fire-control radar or radar seekers. Multipath jamming has a deceptive jamming effect on the range, velocity, and angle of radar, making it difficult to identify and suppress. In this study, a polarized radar seeker structure is proposed. Based on the mechanism of the multipath jamming effect on radar, orthogonal polarization signal models of jamming and direct arrived signal are established. Next, a method to detect multipath jamming based on statistical property differences of polarization phases is proposed. The physical connotation of this method is clear and easy to realize. This method can be used to determine the presence of a jamming signal and identify the signal pattern and polarization types. The feasibility of this method has been verified via a simulation experiment, thereby demonstrating that the method serves as a useful reference for effectively countering multipath jamming.

  18. Polarization dependent asymmetric magneto-resistance features in nanocrystalline diamond films

    International Nuclear Information System (INIS)

    Bhattacharyya, Somnath; Churochkin, Dmitry

    2014-01-01

    Polar angle-dependence of magneto-resistance (AMR) in heavily nitrogen-incorporated ultra-nanocrystalline diamond (UNCD) films is recorded by applying high magnetic fields, which shows strong anisotropic features at low temperatures. The temperature-dependence of MR and AMR can reveal transport in the weak-localization regime, which is explained by using a superlattice model for arbitrary values of disorder and angles. While a propagative Fermi surface model explains the negative MR features for low degree of disorder the azimuthal angle-dependent MR shows field dependent anisotropy due to the aligned conducting channels on the layers normal to film growth direction. The analysis of MR and AMR can extract the temperature dependence of dephasing time with respect to the elastic scattering time which not only establishes quasi-two dimensional features in this system but also suggests a potential application in monitoring the performance of UNCD based quantum devices.

  19. [Progress in sample preparation and analytical methods for trace polar small molecules in complex samples].

    Science.gov (United States)

    Zhang, Qianchun; Luo, Xialin; Li, Gongke; Xiao, Xiaohua

    2015-09-01

    Small polar molecules such as nucleosides, amines, amino acids are important analytes in biological, food, environmental, and other fields. It is necessary to develop efficient sample preparation and sensitive analytical methods for rapid analysis of these polar small molecules in complex matrices. Some typical materials in sample preparation, including silica, polymer, carbon, boric acid and so on, are introduced in this paper. Meanwhile, the applications and developments of analytical methods of polar small molecules, such as reversed-phase liquid chromatography, hydrophilic interaction chromatography, etc., are also reviewed.

  20. Beta4 integrin-dependent formation of polarized three-dimensionalarchitecture confers resistance to apoptosis in normal and malignantmammary epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Weaver, Valerie M.; Lelievre, Sophie; Lakins, Johnathon N.; Chrenek, Micah A.; Jones, Jonathan C.R.; Giancotti, Filippo; Werb, Zena; Bissell, Mina J.

    2002-08-27

    Tumor cells can evade chemotherapy by acquiring resistanceto apoptosis. We investigated the molecular mechanism whereby malignantand nonmalignant mammary epithelial cells become insensitive toapoptosis. We show that regardless of growth status formation ofpolarized, three-dimensional structures driven by basement membraneconfers protection to apoptosis in both nonmalignant and malignantmammary epithelial cells. By contrast, irrespective of their malignantstatus, nonpolarized structures are sensitive to induction of apoptosis.Resistance to apoptosis requires ligation of beta4 integrins, whichregulates tissue polarity, hemidesmosome formation and NFkB activation.Expression of beta4 integrin that lacks the hemidesmosome targetingdomain interferes with tissue polarity and NFkB activation and permitsapoptosis. These results indicate that integrin-induced polarity maydrive tumor cell resistance to apoptosis-inducing agents via effects onNFkB.

  1. Mapping geological structures in bedrock via large-scale direct current resistivity and time-domain induced polarization tomography

    DEFF Research Database (Denmark)

    Rossi, Matteo; Olsson, Per-Ivar; Johansson, Sara

    2017-01-01

    An investigation of geological conditions is always a key point for planning infrastructure constructions. Bedrock surface and rock quality must be estimated carefully in the designing process of infrastructures. A large direct-current resistivity and time-domain induced-polarization survey has b...... been performed in Dalby, Lund Municipality, southern Sweden, with the aim of mapping lithological variations in bedrock. The geology at the site is characterised by Precambrian granitic gneisses and amphibolites, which are intensely deformed, fractured, and partly weathered. In addition......-polarization profiles. The direct-current resistivity and time-domain induced-polarization methodology proved to be a suitable technique for extensively mapping weathered zones with poor geotechnical characteristics and tectonic structures, which can lead to severe problems for infrastructure construction and....../or constitute risk zones for aquifer contamination....

  2. A discrete spherical harmonics method for radiative transfer analysis in inhomogeneous polarized planar atmosphere

    Science.gov (United States)

    Tapimo, Romuald; Tagne Kamdem, Hervé Thierry; Yemele, David

    2018-03-01

    A discrete spherical harmonics method is developed for the radiative transfer problem in inhomogeneous polarized planar atmosphere illuminated at the top by a collimated sunlight while the bottom reflects the radiation. The method expands both the Stokes vector and the phase matrix in a finite series of generalized spherical functions and the resulting vector radiative transfer equation is expressed in a set of polar directions. Hence, the polarized characteristics of the radiance within the atmosphere at any polar direction and azimuthal angle can be determined without linearization and/or interpolations. The spatial dependent of the problem is solved using the spectral Chebyshev method. The emergent and transmitted radiative intensity and the degree of polarization are predicted for both Rayleigh and Mie scattering. The discrete spherical harmonics method predictions for optical thin atmosphere using 36 streams are found in good agreement with benchmark literature results. The maximum deviation between the proposed method and literature results and for polar directions \\vert μ \\vert ≥0.1 is less than 0.5% and 0.9% for the Rayleigh and Mie scattering, respectively. These deviations for directions close to zero are about 3% and 10% for Rayleigh and Mie scattering, respectively.

  3. Complementary resistive switching in BaTiO{sub 3}/NiO bilayer with opposite switching polarities

    Energy Technology Data Exchange (ETDEWEB)

    Li, Shuo [State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials, Southwest University of Science and Technology, Mianyang 621010 (China); Institut d’Electronique de Micro-électronique et de Nanotechnologie (IEMN), CNRS, Université des Sciences et Technologies de Lille, avenue Poincaré, BP 60069, 59652, Villeneuve d’Ascq cedex (France); Wei, Xianhua, E-mail: weixianhua@swust.edu.cn [State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials, Southwest University of Science and Technology, Mianyang 621010 (China); Lei, Yao [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronics Science and Technology of China, Chengdu 610054 (China); Yuan, Xincai [State Key Laboratory Cultivation Base for Nonmetal Composites and Functional Materials, Southwest University of Science and Technology, Mianyang 621010 (China); Zeng, Huizhong [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronics Science and Technology of China, Chengdu 610054 (China)

    2016-12-15

    Graphical abstract: Au/BaTiO{sub 3}/NiO/Pt bilayer device shows complementary resistive switching (CRS) without electroforming which is mainly ascribed to anti-serial stack of two RRAM cells with bipolar behaviors. - Highlights: • Complementary resistive switching (CRS) has been investigated in Au/BaTiO{sub 3}/NiO/Pt by stacking the two elements with different switching types. • The realization of complementary resistive switching (CRS) is mainly ascribed to the anti-serial stack of two RRAM cells with bipolar behaviors. • Complementary resistive switching (CRS) in bilayer is effective to solve the sneak current problem briefly and economically. - Abstract: Resistive switching behaviors have been investigated in the Au/BaTiO{sub 3}/NiO/Pt structure by stacking the two elements with different switching types. The conducting atomic force microscope measurements on BaTiO{sub 3} thin films and NiO thin films suggest that with the same active resistive switching region, the switching polarities in the two semiconductors are opposite to each other. It is in agreement with the bipolar hysteresis I–V curves with opposite switching polarities for single-layer devices. The bilayer devices show complementary resistive switching (CRS) without electroforming and unipolar resistive switching (URS) after electroforming. The coexistence of CRS and URS is mainly ascribed to the co-effect of electric field and Joule heating mechanisms, indicating that changeable of resistance in this device is dominated by the redistribution of oxygen vacancies in BaTiO{sub 3} and the formation, disruption, restoration of conducting filaments in NiO. CRS in bilayer with opposite switching polarities is effective to solve the sneak current without the introduction of any selector elements or an additional metal electrode.

  4. A novel autonomous real-time position method based on polarized light and geomagnetic field.

    Science.gov (United States)

    Wang, Yinlong; Chu, Jinkui; Zhang, Ran; Wang, Lu; Wang, Zhiwen

    2015-04-08

    Many animals exploit polarized light in order to calibrate their magnetic compasses for navigation. For example, some birds are equipped with biological magnetic and celestial compasses enabling them to migrate between the Western and Eastern Hemispheres. The Vikings' ability to derive true direction from polarized light is also widely accepted. However, their amazing navigational capabilities are still not completely clear. Inspired by birds' and Vikings' ancient navigational skills. Here we present a combined real-time position method based on the use of polarized light and geomagnetic field. The new method works independently of any artificial signal source with no accumulation of errors and can obtain the position and the orientation directly. The novel device simply consists of two polarized light sensors, a 3-axis compass and a computer. The field experiments demonstrate device performance.

  5. Applicability study of the structure-factor phase method for determining the polarity of binary semiconductors.

    Science.gov (United States)

    Cao, Jiefeng; Guo, Chao; Zou, Huamin

    2013-12-01

    The structure-factor phase method of convergent-beam electron diffraction (CBED) has been widely applied as an effective tool in determining the polarity of binary compound materials, for example, the typical sphalerite material, GaAs. However, its validity on other polar materials is still unknown. In this paper we extensively investigated its potential applicability onto 11 AB-type semiconductors by dynamical simulations of CBED. Two key factors during the simulation, the difference between A and B atomic numbers and the sample thickness, are discussed in detail. It was found that this method is efficient to determine the polarity for a sphalerite structure under certain conditions, and, reversely, limited to determine the polarity for a wurtzite structure even though it is very similar to the sphalerite structure.

  6. a Spinning Polarizer and Spinning Analyzer Method for Visualizing the Isochromates in Conoscopic Interferometers

    Science.gov (United States)

    Olorunsola, Oluwatobi; Dada, Oluwaseye; Wang, Pengqian

    2013-09-01

    We have developed a spinning polarizer and spinning analyzer (SPSA) method to visualize the whole isochromatic fringes in conoscopic interferometers for the study of optically anisotropic materials. This simple method completely eliminates the broad and dark isogyre fringes appearing in a conventional conoscopic interferometer where a linear polarizer and a linear analyzer (LPLA) are used. Our method allows the direct visualization of the isochromates on the viewing screen by eyes in real time, without the need of additional optics or detectors other than those used in a conventional conoscopic interferometer, and no additional computation is required. This method works at any polarization state of the input light, and at any wavelength permitted by the polarizers. In the case of polychromatic illumination our method reveals the isochromates of all colors indiscriminatively, in comparison to the method of circular polarizer and circular analyzer (CPCA), which is considerably subject to spectrum modulation due to the dispersion in the retardation of the quarter-wave plates. The proposed method is demonstrated in a lithium niobate (LiNbO3) crystal driven by an external electric field.

  7. Monte Carlo method for polarized radiative transfer in gradient-index media

    International Nuclear Information System (INIS)

    Zhao, J.M.; Tan, J.Y.; Liu, L.H.

    2015-01-01

    Light transfer in gradient-index media generally follows curved ray trajectories, which will cause light beam to converge or diverge during transfer and induce the rotation of polarization ellipse even when the medium is transparent. Furthermore, the combined process of scattering and transfer along curved ray path makes the problem more complex. In this paper, a Monte Carlo method is presented to simulate polarized radiative transfer in gradient-index media that only support planar ray trajectories. The ray equation is solved to the second order to address the effect induced by curved ray trajectories. Three types of test cases are presented to verify the performance of the method, which include transparent medium, Mie scattering medium with assumed gradient index distribution, and Rayleigh scattering with realistic atmosphere refractive index profile. It is demonstrated that the atmospheric refraction has significant effect for long distance polarized light transfer. - Highlights: • A Monte Carlo method for polarized radiative transfer in gradient index media. • Effect of curved ray paths on polarized radiative transfer is considered. • Importance of atmospheric refraction for polarized light transfer is demonstrated

  8. High Throughput Method to Quantify Anterior-Posterior Polarity of T-Cells and Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Susan J. Marriott

    2011-11-01

    Full Text Available The virologic synapse (VS, which is formed between a virus-infected and uninfected cell, plays a central role in the transmission of certain viruses, such as HIV and HTLV-1. During VS formation, HTLV-1-infected T-cells polarize cellular and viral proteins toward the uninfected T-cell. This polarization resembles anterior-posterior cell polarity induced by immunological synapse (IS formation, which is more extensively characterized than VS formation and occurs when a T-cell interacts with an antigen-presenting cell. One measure of cell polarity induced by both IS or VS formation is the repositioning of the microtubule organizing center (MTOC relative to the contact point with the interacting cell. Here we describe an automated, high throughput system to score repositioning of the MTOC and thereby cell polarity establishment. The method rapidly and accurately calculates the angle between the MTOC and the IS for thousands of cells. We also show that the system can be adapted to score anterior-posterior polarity establishment of epithelial cells. This general approach represents a significant advancement over manual cell polarity scoring, which is subject to experimenter bias and requires more time and effort to evaluate large numbers of cells.

  9. Methods to Study Antimicrobial Resistance in Campylobacter jejuni.

    Science.gov (United States)

    Sahin, Orhan; Shen, Zhangqi; Zhang, Qijing

    2017-01-01

    Campylobacter jejuni is a leading bacterial cause of foodborne gastroenteritis worldwide and is increasingly resistant to clinically important antibiotics. Detection of antibiotic resistance in C. jejuni can be performed with both phenotypic and genotypic methods. In this chapter, we describe the most commonly used molecular biology methods for detection of resistance to clinically important antibiotics. These methods can be employed in both clinical and research settings to facilitate clinical therapy and to monitor the emergence and dissemination of antibiotic-resistant C. jejuni.

  10. A method of measuring magnetic texture with polarized neutrons

    International Nuclear Information System (INIS)

    Akselrod, L.A.; Gordeev, G.P.; Lazebnick, J.M.; Lebedev, V.I.

    1979-01-01

    A new method of qualitative and quantitative magnetic texture investigation is described. The description of the equipment used and results of measurements on three different samples are presented. (Auth.)

  11. Optical image encryption method based on incoherent imaging and polarized light encoding

    Science.gov (United States)

    Wang, Q.; Xiong, D.; Alfalou, A.; Brosseau, C.

    2018-05-01

    We propose an incoherent encoding system for image encryption based on a polarized encoding method combined with an incoherent imaging. Incoherent imaging is the core component of this proposal, in which the incoherent point-spread function (PSF) of the imaging system serves as the main key to encode the input intensity distribution thanks to a convolution operation. An array of retarders and polarizers is placed on the input plane of the imaging structure to encrypt the polarized state of light based on Mueller polarization calculus. The proposal makes full use of randomness of polarization parameters and incoherent PSF so that a multidimensional key space is generated to deal with illegal attacks. Mueller polarization calculus and incoherent illumination of imaging structure ensure that only intensity information is manipulated. Another key advantage is that complicated processing and recording related to a complex-valued signal are avoided. The encoded information is just an intensity distribution, which is advantageous for data storage and transition because information expansion accompanying conventional encryption methods is also avoided. The decryption procedure can be performed digitally or using optoelectronic devices. Numerical simulation tests demonstrate the validity of the proposed scheme.

  12. Characterization of molecularly imprinted polymers using a new polar solvent titration method.

    Science.gov (United States)

    Song, Di; Zhang, Yagang; Geer, Michael F; Shimizu, Ken D

    2014-07-01

    A new method of characterizing molecularly imprinted polymers (MIPs) was developed and tested, which provides a more accurate means of identifying and measuring the molecular imprinting effect. In the new polar solvent titration method, a series of imprinted and non-imprinted polymers were prepared in solutions containing increasing concentrations of a polar solvent. The polar solvent additives systematically disrupted the templation and monomer aggregation processes in the prepolymerization solutions, and the extent of disruption was captured by the polymerization process. The changes in binding capacity within each series of polymers were measured, providing a quantitative assessment of the templation and monomer aggregation processes in the imprinted and non-imprinted polymers. The new method was tested using three different diphenyl phosphate imprinted polymers made using three different urea functional monomers. Each monomer had varying efficiencies of templation and monomer aggregation. The new MIP characterization method was found to have several advantages. To independently verify the new characterization method, the MIPs were also characterized using traditional binding isotherm analyses. The two methods appeared to give consistent conclusions. First, the polar solvent titration method is less susceptible to false positives in identifying the imprinting effect. Second, the method is able to differentiate and quantify changes in binding capacity, as measured at a fixed guest and polymer concentration, arising from templation or monomer aggregation processes in the prepolymerization solution. Third, the method was also easy to carry out, taking advantage of the ease of preparing MIPs. Copyright © 2014 John Wiley & Sons, Ltd.

  13. Prospects of hydrocarbon deposits exploration using the method of induced polarization during geomagnetic-variation profiling

    Directory of Open Access Journals (Sweden)

    К. М. Ермохин

    2017-10-01

    Full Text Available Traditionally it is believed that the effect of induced polarization is an interfering factor for the measurement of electromagnetic fields and their interpretation during conducting works using magnetotelluric sounding and geomag-netic-variation profiling methods. A new method is proposed for isolating the effects of induced polarization during geomagnetic-variation profiling aimed at searching for hydrocarbon deposits on the basis of phase measurements during the conduct of geomagnetic-variation profiling. The phenomenon of induced polarization is proposed to be used as a special exploration mark for deep-lying hydrocarbon deposits. The traditional method of induced polarization uses artificial field sources, the powers of which are principally insufficient to reach depths of 3-5 km, which leads to the need to search for alternative - natural sources in the form of telluric and magnetotelluric fields. The proposed method makes it possible to detect and interpret the effects of induced polarization from deep-seated oil and gas reservoirs directly, without relying on indirect signs.

  14. Method for forming permanent magnets with different polarities for use in microelectromechanical devices

    Science.gov (United States)

    Roesler, Alexander W [Tijeras, NM; Christenson, Todd R [Albuquerque, NM

    2007-04-24

    Methods are provided for forming a plurality of permanent magnets with two different north-south magnetic pole alignments for use in microelectromechanical (MEM) devices. These methods are based on initially magnetizing the permanent magnets all in the same direction, and then utilizing a combination of heating and a magnetic field to switch the polarity of a portion of the permanent magnets while not switching the remaining permanent magnets. The permanent magnets, in some instances, can all have the same rare-earth composition (e.g. NdFeB) or can be formed of two different rare-earth materials (e.g. NdFeB and SmCo). The methods can be used to form a plurality of permanent magnets side-by-side on or within a substrate with an alternating polarity, or to form a two-dimensional array of permanent magnets in which the polarity of every other row of the array is alternated.

  15. Numerical methods in simulation of resistance welding

    DEFF Research Database (Denmark)

    Nielsen, Chris Valentin; Martins, Paulo A.F.; Zhang, Wenqi

    2015-01-01

    Finite element simulation of resistance welding requires coupling betweenmechanical, thermal and electrical models. This paper presents the numerical models and theircouplings that are utilized in the computer program SORPAS. A mechanical model based onthe irreducible flow formulation is utilized...... a resistance welding point of view, the most essential coupling between the above mentioned models is the heat generation by electrical current due to Joule heating. The interaction between multiple objects is anothercritical feature of the numerical simulation of resistance welding because it influences...

  16. Deterministic and stochastic methods of calculation of polarization characteristics of radiation in natural environment

    Science.gov (United States)

    Strelkov, S. A.; Sushkevich, T. A.; Maksakova, S. V.

    2017-11-01

    We are talking about russian achievements of the world level in the theory of radiation transfer, taking into account its polarization in natural media and the current scientific potential developing in Russia, which adequately provides the methodological basis for theoretically-calculated research of radiation processes and radiation fields in natural media using supercomputers and mass parallelism. A new version of the matrix transfer operator is proposed for solving problems of polarized radiation transfer in heterogeneous media by the method of influence functions, when deterministic and stochastic methods can be combined.

  17. Method of generating intense nuclear polarized beams by selective photodetachment of negative ions

    International Nuclear Information System (INIS)

    Hershcovitch, A.

    1986-01-01

    A novel method for production of nuclear polarized negative hydrogen ions by selective neutralization with a laser of negative hydrogen ions in a magnetic field is described. This selectivity is possible since a final state of the neutralized atom, and hence the neutralization energy, depends on its nuclear polarization. The main advantages of this scheme are the availability of multi-ampere negative ion sources and the possibility of neutralizing negative ions with very high efficiency. An assessment of the required laser power indicates that this method is in principle feasible with today's technology

  18. Using a Fractal Analysis and Polarization Method for Phase Identification in Three-Component Seismograms

    Directory of Open Access Journals (Sweden)

    Boi-Yee Liao

    2010-01-01

    Full Text Available This study presents the automatic P-wave and S-wave arrivals picking algorithm which is essentially based on the fractal dimension and polarized method. With an estimate of the spectral exponent £^ in a 1/f process, an interval that indicates the preferred intersection containing both noise and the P-wave is well-detected by corresponding to the minimum absolute spectral exponent £^ value along the trace. Based on the different properties of background noise and deterministic signal, the fractal dimension technique can detect the position of the P-wave. The place where the fractal dimension value changes suddenly within the intersection interval indicates the location of arrival of the P-wave. Testing that adds various levels of noise to the seismic signal shows the method can prove able to tolerate noise to a signal-to-noise (S/N ratio 1.5. Based on the P-wave arrival, the polarized P-wave could be detected by a genetic algorithm (GA with the strength of polarization and phase difference between the vertical and horizontal components as constraints. Using the first arrival phase as the basis phase, this study combines a polarization filter including rectilinearity functions, linear polarization, phase difference and directionality with GA to detect polarized S-wave of seismograms. Finally, the technique was applied to teleseismic data and near-field motion to verify the accuracy and wide applicability of this method. To conclude, this proposed method, an efficient and brand-new method of associating signal processing technique with physical wave motion properties, may be of importance in finding P-wave and S-wave phase arrivals accurately using three-component seismograms.

  19. Molecular Methods for Detection of Antimicrobial Resistance

    DEFF Research Database (Denmark)

    Anjum, Muna F.; Zankari, Ea; Hasman, Henrik

    2017-01-01

    The increase in bacteria harboring antimicrobial resistance (AMR) is a global problem because there is a paucity of antibiotics available to treat multidrug-resistant bacterial infections in humans and animals. Detection of AMR present in bacteria that may pose a threat to veterinary and public...

  20. Groundwater potential evaluation using electrical resistivity method ...

    African Journals Online (AJOL)

    The plot of the aquifer resistivity against the coefficient of anisotropy shows that the basement in the study area is underlain by three types of rocks: Quartzite with aquifer resistivity in the range of 50 – 430m and coefficient of anisotropy between 1.01 and 1.18. This weathered mainly to sand with good to high groundwater ...

  1. Biotechnological Methods for Precise Diagnosis of Methicillin Resistance in Staphylococci

    Directory of Open Access Journals (Sweden)

    Aija Zilevica

    2005-04-01

    Full Text Available Antimicrobial resistance is one of the most urgent problems in medicine nowadays. The purpose of the study was to investigate the microorganisms resistant to first-line antimicrobials, including gram-positive cocci, particularly the methicillin-resistant Staphylococcus aureus and coagulase-negative Staphylococci, the major agents of nosocomial infections. Owing to the multi-resistance of these agents, precise diagnosis of the methicillin resistance of Staphylococci is of greatest clinical importance. It is not enough to use only conventional microbiological diagnostic methods. Biotechnological methods should be also involved. In our studies, the following methicillin resistance identification methods were used: the disk diffusion method, detection of the mecA gene by PCR, E-test and Slidex MRSA test. For molecular typing, PFGL, RAPD tests and detection of the coa gene were used. All the MRS strains were multiresistant to antibacterials. No vancomycine resistance was registered.

  2. Testing methods for using high-resolution satellite imagery to monitor polar bear abundance and distribution

    Science.gov (United States)

    LaRue, Michelle A.; Stapleton, Seth P.; Porter, Claire; Atkinson, Stephen N.; Atwood, Todd C.; Dyck, Markus; Lecomte, Nicolas

    2015-01-01

    High-resolution satellite imagery is a promising tool for providing coarse information about polar species abundance and distribution, but current applications are limited. With polar bears (Ursus maritimus), the technique has only proven effective on landscapes with little topographic relief that are devoid of snow and ice, and time-consuming manual review of imagery is required to identify bears. Here, we evaluated mechanisms to further develop methods for satellite imagery by examining data from Rowley Island, Canada. We attempted to automate and expedite detection via a supervised spectral classification and image differencing to expedite image review. We also assessed what proportion of a region should be sampled to obtain reliable estimates of density and abundance. Although the spectral signature of polar bears differed from nontarget objects, these differences were insufficient to yield useful results via a supervised classification process. Conversely, automated image differencing—or subtracting one image from another—correctly identified nearly 90% of polar bear locations. This technique, however, also yielded false positives, suggesting that manual review will still be required to confirm polar bear locations. On Rowley Island, bear distribution approximated a Poisson distribution across a range of plot sizes, and resampling suggests that sampling >50% of the site facilitates reliable estimation of density (CV in certain areas, but large-scale applications remain limited because of the challenges in automation and the limited environments in which the method can be effectively applied. Improvements in resolution may expand opportunities for its future uses.

  3. Simulation of AZ-PN100 resist pattern fluctuation in X-ray lithography, including synchrotron beam polarization

    International Nuclear Information System (INIS)

    Scheckler, E.W.; Ogawa, Taro; Tanaka, Toshihiko; Takeda, Eiji; Oizumi, Hiroaki.

    1993-01-01

    A new simulation model for nanometer-scale pattern fluctuation in X-ray lithography is presented and applied to a study of AZ-PN100 negative chemical amplification resist. The exposure simulation considers polarized photons from a synchrotron radiation (SR) source. Monte Carlo simulation of Auger and photoelectron generation is followed by electron scattering simulation to determine the deposited energy distribution at the nanometer scale, including beam polarization effects. An acid-catalyst random walk model simulates the post-exposure bake (PEB) step. Fourier transform infrared (FTIR) spectroscopy and developed resist thickness measurements are used to fit PEB and rate models for AZ-PN100. A polymer removal model for development simulation predicts the macroscopic resist shape and pattern roughness. The simulated 3σ linewidth variation is in excess of 24 nm. Simulation also shows a detrimental effect if the beam polarization is perpendicular to the line. Simulation assuming a theoretical ideal exposure yields a 50 nm minimum line for standard process conditions. (author)

  4. Conventional versus newer methods for detection of drug resistance ...

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Conventional versus newer methods for detection of drug resistance in tuberculosis. Classical microbiological methods are well established but are cumbersome and time consuming. Newer rapid methods for rapid detection of drug resistance - microbiological, ...

  5. Electrical resistivity and induced polarization tomography in identifying the plume of chlorinated hydrocarbons in sedimentary formation: a case study in Rho (Milan - Italy).

    Science.gov (United States)

    Cardarelli, Ettore; Di Filippo, Gerardina

    2009-09-01

    Resistivity and induced polarization surveying were originally developed for mineral exploration but are now finding new applications in the field of environmental and engineering geophysics. The present article reports the results of a geophysical survey performed with the aim of identifying a plume of chlorinated hydrocarbons in sedimentary formations of the Pandania plain. The tested site is characterized by three sand and gravel aquifers containing a quantity of clay particles which influence the overall bulk resistivity and chargeability. According to data obtained using shallow boreholes, mainly dense non-aqueous phase liquids were found as contaminants in the first and second aquifer. The aforementioned geo-electrical methods were applied in both two- and three-dimensional approaches. Steel and copper electrodes were used in the process of field data acquisition and the results of the survey were compared. The geophysical survey revealed some anomalies that could be explained by the presence of dense non-aqueous phase liquids in the soil medium. The concept of normalized chargeability facilitates the interpretation of detected induced polarization anomalies. The shape of the plume was inferred from maps of resistivity and chargeability to a depth of 25 m below the surface of the ground.

  6. Analysis of polarization methods for elimination of power overshoot in microbial fuel cells

    KAUST Repository

    Watson, Valerie J.

    2011-01-01

    Polarization curves from microbial fuel cells (MFCs) often show an unexpectedly large drop in voltage with increased current densities, leading to a phenomenon in the power density curve referred to as "power overshoot". Linear sweep voltammetry (LSV, 1 mV s- 1) and variable external resistances (at fixed intervals of 20 min) over a single fed-batch cycle in an MFC both resulted in power overshoot in power density curves due to anode potentials. Increasing the anode enrichment time from 30 days to 100 days did not eliminate overshoot, suggesting that insufficient enrichment of the anode biofilm was not the primary cause. Running the reactor at a fixed resistance for a full fed-batch cycle (~ 1 to 2 days), however, completely eliminated the overshoot in the power density curve. These results show that long times at a fixed resistance are needed to stabilize current generation by bacteria in MFCs, and that even relatively slow LSV scan rates and long times between switching circuit loads during a fed-batch cycle may produce inaccurate polarization and power density results for these biological systems. © 2010 Elsevier B.V. All rights reserved.

  7. Analysis of method of polarization surveying of water surface oil pollution

    Science.gov (United States)

    Zhukov, B. S.

    1979-01-01

    A method of polarization surveying of oil films on the water surface is analyzed. Model calculations of contrasted oil and water obtained with different orientations of the analyzer are discussed. The model depends on the spectral range, water transparency and oil film, and the selection of observational direction.

  8. Resisting the Terms of Polar Questions through "Ani" ("No")-Prefacing in Korean Conversation

    Science.gov (United States)

    Kim, Stephanie Hyeri

    2015-01-01

    This article reports on the conversation-analytic investigation of "ani" "no"-prefaced responses to polar questions in Korean conversation, when "ani" is not used as a negative response particle to negate or disconfirm the truth conditional proposition of the question. Understanding polar questions as advancing the…

  9. Application of macro-polarization curve method to corrosion analysis of heat exchanger

    Energy Technology Data Exchange (ETDEWEB)

    Aoki, S. [Dept. of Computational Science and Engineering, Toyo Univ., Kawagoe, Saitama (Japan); Amaya, K. [Dept. of Mechanical and Environmental Informatics, Tokyo Inst. of Tech., Tokyo (Japan); Miyuki, H. [Iron and Steel Research Labs., Sumitomo Steel Co. Ltd., Fuyocho, Amagasaki (Japan)

    2003-07-01

    A boundary element corrosion analysis was performed for a heat exchanger to predict the effect of zinc sacrificial anodes. Since a heat exchanger has thousands of stainless steel tubes held with two naval brass tube-holder plates, and hence the conventional BEM does not work, the equivalent macro-polarization curve method was applied. At first the part of the tube-holder plate surfaces which consist of a great number of stainless steel tube edges and brass tube-holder plate was assumed to be made of a homogeneous virtual material. Then, its equivalent macro-polarization curve was determined by analyzing a tube unit, which consists of a stainless steel tube and a part of naval brass tube-holder plate. By using the equivalent macro-polarization curve thus obtained, the heat exchanger was effectively analyzed with a small number of elements. (orig.)

  10. Polarization-selectable cavity locking method for generation of laser Compton scattered γ-rays.

    Science.gov (United States)

    Kosuge, Atsushi; Mori, Michiaki; Okada, Hajime; Hajima, Ryoichi; Nagashima, Keisuke

    2014-03-24

    Nowadays, generation of energy-tunable, monochromatic γ-rays is needed to establish a nondestructive assay method of nuclear fuel materials. The γ-rays are generated by collision of laser photons stored in a cavity and relativistic electrons. We propose a configuration of an enhancement cavity capable of performing polarization control fabricated by a combination of a four-mirror ring cavity with a small spot inside a cavity and a three-mirror of reflective optics as an image inverter for polarization-selectable γ-rays. The image inverter introduces a phase shift of specific polarization which can be used to generate an error signal to lock an optical cavity at a resonance condition.

  11. A method to evaluate residual phase error for polar formatted synthetic aperture radar systems

    Science.gov (United States)

    Musgrove, Cameron; Naething, Richard

    2013-05-01

    Synthetic aperture radar systems that use the polar format algorithm are subject to a focused scene size limit inherent to the polar format algorithm. The classic focused scene size limit is determined from the dominant residual range phase error term. Given the many sources of phase error in a synthetic aperture radar, a system designer is interested in how much phase error results from the assumptions made with the polar format algorithm. Autofocus algorithms have limits to the amount and type of phase error that can be corrected. Current methods correct only one or a few terms of the residual phase error. A system designer needs to be able to evaluate the contribution of the residual or uncorrected phase error terms to determine the new focused scene size limit. This paper describes a method to estimate the complete residual phase error, not just one or a few of the dominant residual terms. This method is demonstrated with polar format image formation, but is equally applicable to other image formation algorithms. A benefit for the system designer is that additional correction terms can be added or deleted from the analysis as necessary to evaluate the resulting effect upon image quality.

  12. A new method to reconstruct the ionospheric convection patterns in the polar cap

    Directory of Open Access Journals (Sweden)

    P. L. Israelevich

    1999-06-01

    Full Text Available A new method to reconstruct the instantaneous convection pattern in the Earth's polar ionosphere is suggested. Plasma convection in the polar cap ionosphere is described as a hydrodynamic incompressible flow. This description is valid in the region where the electric currents are field aligned (and hence, the Lorentz body force vanishes. The problem becomes two-dimensional, and may be described by means of stream function. The flow pattern may be found as a solution of the boundary value problem for stream function. Boundary conditions should be provided by measurements of the electric field or plasma velocity vectors along the satellite orbits. It is shown that the convection pattern may be reconstructed with a reasonable accuracy by means of this method, by using only the minimum number of satellite crossings of the polar cap. The method enables us to obtain a reasonable estimate of the convection pattern without knowledge of the ionospheric conductivity.Key words. Ionosphere (modelling and forecasting; plasma convection; polar ionosphere

  13. A new method to reconstruct the ionospheric convection patterns in the polar cap

    Directory of Open Access Journals (Sweden)

    P. L. Israelevich

    Full Text Available A new method to reconstruct the instantaneous convection pattern in the Earth's polar ionosphere is suggested. Plasma convection in the polar cap ionosphere is described as a hydrodynamic incompressible flow. This description is valid in the region where the electric currents are field aligned (and hence, the Lorentz body force vanishes. The problem becomes two-dimensional, and may be described by means of stream function. The flow pattern may be found as a solution of the boundary value problem for stream function. Boundary conditions should be provided by measurements of the electric field or plasma velocity vectors along the satellite orbits. It is shown that the convection pattern may be reconstructed with a reasonable accuracy by means of this method, by using only the minimum number of satellite crossings of the polar cap. The method enables us to obtain a reasonable estimate of the convection pattern without knowledge of the ionospheric conductivity.

    Key words. Ionosphere (modelling and forecasting; plasma convection; polar ionosphere

  14. Method for analysis of polar volatile trace components in aqueous samples by gas chromatography.

    Science.gov (United States)

    Pettersson, Johan; Roeraade, Johan

    2005-05-15

    A new method has been developed for direct analysis of volatile polar trace compounds in aqueous samples by gas chromatography. Water samples are injected onto a short packed precolumn containing anhydrous lithium chloride. A capillary column is coupled in series with the prefractionation column for final separation of the analytes. The enrichment principle of the salt precolumn is reverse to the principles employed in conventional methods such as SPE or SPME in which a sorbent or adsorbent is utilized to trap or concentrate the analytes. Such methods are not efficient for highly polar compounds. In the LiCl precolumn concept, the water matrix is strongly retained on the hygroscopic salt, whereas polar as well as nonpolar volatile organic compounds show very low retention and are eluted ahead of the water. After transfer of the analytes to the capillary column, the retained bulk water is removed by backflushing the precolumn at elevated temperature. For direct injections of 120 microL of aqueous samples, the combined time for injection and preseparation is only 3.5 min. With this procedure, direct repetitive automated analyses of highly volatile polar compounds such as methanol or tetrahydrofuran can be performed, and a limit of quantification in the low parts-per-billion region utilizing a flame ionization detector is demonstrated.

  15. Restricted access Improved hydrogeophysical characterization and monitoring through parallel modeling and inversion of time-domain resistivity andinduced-polarization data

    Science.gov (United States)

    Johnson, Timothy C.; Versteeg, Roelof J.; Ward, Andy; Day-Lewis, Frederick D.; Revil, André

    2010-01-01

    Electrical geophysical methods have found wide use in the growing discipline of hydrogeophysics for characterizing the electrical properties of the subsurface and for monitoring subsurface processes in terms of the spatiotemporal changes in subsurface conductivity, chargeability, and source currents they govern. Presently, multichannel and multielectrode data collections systems can collect large data sets in relatively short periods of time. Practitioners, however, often are unable to fully utilize these large data sets and the information they contain because of standard desktop-computer processing limitations. These limitations can be addressed by utilizing the storage and processing capabilities of parallel computing environments. We have developed a parallel distributed-memory forward and inverse modeling algorithm for analyzing resistivity and time-domain induced polar-ization (IP) data. The primary components of the parallel computations include distributed computation of the pole solutions in forward mode, distributed storage and computation of the Jacobian matrix in inverse mode, and parallel execution of the inverse equation solver. We have tested the corresponding parallel code in three efforts: (1) resistivity characterization of the Hanford 300 Area Integrated Field Research Challenge site in Hanford, Washington, U.S.A., (2) resistivity characterization of a volcanic island in the southern Tyrrhenian Sea in Italy, and (3) resistivity and IP monitoring of biostimulation at a Superfund site in Brandywine, Maryland, U.S.A. Inverse analysis of each of these data sets would be limited or impossible in a standard serial computing environment, which underscores the need for parallel high-performance computing to fully utilize the potential of electrical geophysical methods in hydrogeophysical applications.

  16. Direct current (DC) resistivity and Induced Polarization (IP) monitoring of active layer dynamics at high temporal resolution

    DEFF Research Database (Denmark)

    Doetsch, J.; Fiandaca, G.; Ingeman-Nielsen, Thomas

    2015-01-01

    With permafrost thawing and changes in active layer dynamics induced by climate change, interactions between biogeochemical and thermal processes in the ground are of great importance. Here, active layer dynamics have been monitored using direct current (DC) resistivity and induced polarization (...... non-intrusively and reliably image freezing patterns and their lateral variation on a 10-100 m scale that is difficult to sample by point measurements.......) measurements at high temporal resolution at a heath tundra site on Disko Island on the west coast of Greenland (69°N). Borehole sediment characteristics and subsurface temperatures supplemented the DC-IP measurements. Data acquired during the freezing period of October 2013 – February 2014 clearly image...... the soil freezing as a strong increase in resistivity. While the freezing horizon generally moves deeper with time, some variations in the freezing depth are observed along the profile. Comparison with depth-specific soil temperature indicates an exponential relationship between resistivity and below-freezing...

  17. Enhanced bipolar resistive switching behavior in polar Cr-doped barium titanate thin films without electro-forming process

    Directory of Open Access Journals (Sweden)

    Atul Thakre

    2017-12-01

    Full Text Available An enhanced, repeatable and robust resistive switching phenomenon was observed in Cr substituted BaTiO3 polar ferroelectric thin films; fabricated and deposited by the sol-gel approach and spin coating technique, respectively. An enhanced bistable bipolar resistive switching (BRS phenomenon without electro-forming process, low switching voltage (∼ 2 V and moderate retention characteristics of 104 s along with a high Roff/Ron resistance ratio ∼103 was achieved. The current conduction analysis showed that the space charge limited conduction (SCLC and Schottky emission conduction dominate in the high voltage range, while thermally active charge carriers (ohmic in the lower voltage range. The impedance spectroscopy study indicates the formation of current conducting path and rupturing of oxygen vacancies during SET and RESET process.

  18. Enhanced bipolar resistive switching behavior in polar Cr-doped barium titanate thin films without electro-forming process

    Science.gov (United States)

    Thakre, Atul; Kumar, Ashok

    2017-12-01

    An enhanced, repeatable and robust resistive switching phenomenon was observed in Cr substituted BaTiO3 polar ferroelectric thin films; fabricated and deposited by the sol-gel approach and spin coating technique, respectively. An enhanced bistable bipolar resistive switching (BRS) phenomenon without electro-forming process, low switching voltage (˜ 2 V) and moderate retention characteristics of 104 s along with a high Roff/Ron resistance ratio ˜103 was achieved. The current conduction analysis showed that the space charge limited conduction (SCLC) and Schottky emission conduction dominate in the high voltage range, while thermally active charge carriers (ohmic) in the lower voltage range. The impedance spectroscopy study indicates the formation of current conducting path and rupturing of oxygen vacancies during SET and RESET process.

  19. A rapid method for determination of polar compounds in used frying fats and oils

    Directory of Open Access Journals (Sweden)

    Dobarganes, M.C.

    2007-06-01

    Full Text Available The determination of polar compounds by adsorption chromatography is the most accepted method for the analysis of used frying fats due to its high precision and accuracy. However, this method is expensive and time consuming. In this study, a rapid analytical method to determine polar compounds is proposed. Starting from milligrams of sample dissolved in a solution of hexane containing methyl oleate as internal standard, the nonpolar fraction, which comprises the non-altered triglycerides (TG and the internal standard, is obtained by solid phase extraction. Then, the non polar fraction is quantitatively analyzed in 15 min by high-performance size-exclusion chromatography (HPSEC and the polar fraction is determined by difference of weight. Response factors for pure TG and FAME were calculated. Six samples of sunflower oils of different degrees of unsaturation were analyzed in triplicate and the results were compared with those obtained by the gravimetric method based on silica classical column chromatography. Results showed no significant differences between the two methods. In addition, the repeatability of the proposed method was excellent, as the coefficient of variation ranged from 1.5 to 13% depending on the contents of polar compounds.La determinación de compuestos polares mediante cromatografía de adsorción es el método más aceptado en el análisis de aceites y grasas de fritura debido a su elevada exactitud y precisión. Sin embargo, la determinación es costosa, debido al elevado consumo de sílice y disolventes, y son necesarias varias horas para la obtención del resultado. En este estudio se propone una determinación alternativa rápida. Partiendo de miligramos de muestra disueltos en una solución de hexano con oleato de metilo como patrón interno, la fracción no polar, que contiene los triglicéridos no alterados y el patrón interno, es aislada mediante extracción en fase sólida. Posteriormente, la fracción no polar se

  20. Distribution of conductive minerals as associated with uranium minerals at Dendang Arai sector by induced polarization method

    International Nuclear Information System (INIS)

    Nurdin, M.; Nikijuluw, N.; Subardjo; Sudarto, S.

    2000-01-01

    Based on previous investigation results, a favourable zone of 20-80 meters in wide, 80-240 meters in length and in the direction of East-West to Northwest-Southeast was found. The favourable zone is conductor, associated with sulfide. Induced polarization method has been applied to find vertical and horizontal sulfide distribution. The measurement was conducted in perpendicular to lateral direction of the conductive zone in an interval of 20 meters. Properties measured are apparent resistivity and charge ability. Measurement results indicated the presence of sulfide zone with the position and dip are sub-vertical. Sulfide zones were found on the fault cross-point with the directions being East-West to East South East-West North West by fault is North-South. This anomalies were then represented in 3 (three) dimension tomographic model. (author)

  1. Methods of Attenuation Correction for Dual-Wavelength and Dual-Polarization Weather Radar Data

    Science.gov (United States)

    Meneghini, R.; Liao, L.

    2007-01-01

    In writing the integral equations for the median mass diameter and number concentration, or comparable parameters of the raindrop size distribution, it is apparent that the forms of the equations for dual-polarization and dual-wavelength radar data are identical when attenuation effects are included. The differential backscattering and extinction coefficients appear in both sets of equations: for the dual-polarization equations, the differences are taken with respect to polarization at a fixed frequency while for the dual-wavelength equations, the differences are taken with respect to frequency at a fixed polarization. An alternative to the integral equation formulation is that based on the k-Z (attenuation coefficient-radar reflectivity factor) parameterization. This-technique was originally developed for attenuating single-wavelength radars, a variation of which has been applied to the TRMM Precipitation Radar data (PR). Extensions of this method have also been applied to dual-polarization data. In fact, it is not difficult to show that nearly identical equations are applicable as well to dualwavelength radar data. In this case, the equations for median mass diameter and number concentration take the form of coupled, but non-integral equations. Differences between this and the integral equation formulation are a consequence of the different ways in which attenuation correction is performed under the two formulations. For both techniques, the equations can be solved either forward from the radar outward or backward from the final range gate toward the radar. Although the forward-going solutions tend to be unstable as the attenuation out to the range of interest becomes large in some sense, an independent estimate of path attenuation is not required. This is analogous to the case of an attenuating single-wavelength radar where the forward solution to the Hitschfeld-Bordan equation becomes unstable as the attenuation increases. To circumvent this problem, the

  2. Using polarized Raman spectroscopy and the pseudospectral method to characterize molecular structure and function

    Science.gov (United States)

    Weisman, Andrew L.

    Electronic structure calculation is an essential approach for determining the structure and function of molecules and is therefore of critical interest to physics, chemistry, and materials science. Of the various algorithms for calculating electronic structure, the pseudospectral method is among the fastest. However, the trade-off for its speed is more up-front programming and testing, and as a result, applications using the pseudospectral method currently lag behind those using other methods. In Part I of this dissertation, we first advance the pseudospectral method by optimizing it for an important application, polarized Raman spectroscopy, which is a well-established tool used to characterize molecular properties. This is an application of particular importance because often the easiest and most economical way to obtain the polarized Raman spectrum of a material is to simulate it; thus, utilization of the pseudospectral method for this purpose will accelerate progress in the determination of molecular properties. We demonstrate that our implementation of Raman spectroscopy using the pseudospectral method results in spectra that are just as accurate as those calculated using the traditional analytic method, and in the process, we derive the most comprehensive formulation to date of polarized Raman intensity formulas, applicable to both crystalline and isotropic systems. Next, we apply our implementation to determine the orientations of crystalline oligothiophenes -- a class of materials important in the field of organic electronics -- achieving excellent agreement with experiment and demonstrating the general utility of polarized Raman spectroscopy for the determination of crystal orientation. In addition, we derive from first-principles a method for using polarized Raman spectra to establish unambiguously whether a uniform region of a material is crystalline or isotropic. Finally, we introduce free, open-source software that allows a user to determine any of a

  3. General method for calculating polarization electric fields produced by auroral Cowling mechanism and application examples

    Science.gov (United States)

    Vanhamäki, Heikki; Amm, Olaf; Fujii, Ryo; Yoshikawa, Aki; Ieda, Aki

    2013-04-01

    The Cowling mechanism is characterized by the generation of polarization space charges in the ionosphere in consequence of a partial or total blockage of FAC flowing between the ionosphere and the magnetosphere. Thus a secondary polarization electric field builds up in the ionosphere, which guarantees that the whole (primary + secondary) ionospheric current system is again in balance with the FAC. In the Earth's ionosphere the Cowling mechanism is long known to operate in the equatorial electrojet, and several studies indicate that it is important also in auroral current systems. We present a general method for calculate the secondary polarization electric field, when the ionospheric conductances, the primary (modeled) or the total (measured) electric field, and the Cowling efficiency are given. Here the Cowling efficiency is defined as the fraction of the divergent Hall current canceled by secondary Pedersen current. In contrast to previous studies, our approach is a general solution which is not limited to specific geometrical setups (like an auroral arc), and all parameters may have any kind of spatial dependence. The solution technique is based on spherical elementary current (vector) systems (SECS). This way, we avoid the need to specify explicit boundary conditions for the searched polarization electric field or its potential, which would be required if the problem was solved in a differential equation approach. Instead, we solve an algebraic matrix equation, for which the implicit boundary condition that the divergence of the polarization electric field vanishes outside our analysis area is sufficient. In order to illustrate the effect of Cowling mechanism on ionospheric current systems, we apply our method to two simple models of auroral electrodynamic situations: 1) a mesoscale strong conductance enhancement in the early morning sector within a relatively weak southward primary electric field, 2) a morning sector auroral arc with only a weak conductance

  4. The Second-Order Polarization Propagator Approximation (SOPPA) method coupled to the polarizable continuum model

    DEFF Research Database (Denmark)

    Eriksen, Janus Juul; Solanko, Lukasz Michal; Nåbo, Lina J.

    2014-01-01

    We present an implementation of the Polarizable Continuum Model (PCM) in combination with the Second–Order Polarization Propagator Approximation (SOPPA) electronic structure method. In analogy with the most common way of designing ground state calculations based on a Second–Order Møller-Plesset (MP......2) wave function coupled to PCM, we introduce dynamical PCM solvent effects only in the Random Phase Approximation (RPA) part of the SOPPA response equations while the static solvent contribution is kept in both the RPA terms as well as in the higher order correlation matrix components of the SOPPA...... response equations. By dynamic terms, we refer to contributions that describe a change in environmental polarization which, in turn, reflects a change in the core molecular charge distribution upon an electronic excitation. This new combination of methods is termed PCM-SOPPA/RPA. We apply this newly...

  5. Method for reconstructing atmospheric optical parameters from the data of polarization lidar sensing.

    Science.gov (United States)

    Samoilova, Svetlana V; Balin, Yurii S; Krekova, Margarita M; Winker, David M

    2005-06-10

    Inversion of polarization lidar sensing data based on the form of the lidar sensing equation with allowance for contributions from multiple-scattering calls for a priori information on the scattering phase matrix. In the present study the parameters of the Stokes vectors for various propagation media, including those with the scattering phase matrices that vary along the measuring range, are investigated. It is demonstrated that, in spaceborne lidar sensing, a simple parameterization of the multiple-scattering contribution is applicable and the polarization signal's characteristics depend mainly on the lidar and depolarization ratios, whereas differences in the angular dependences of the matrix components are no longer determining factors. An algorithm for simultaneous reconstruction of the profiles of the backscattering coefficient and depolarization and lidar ratios in an inhomogeneous medium is suggested. Specific features of the methods are analyzed for the examples of interpretation of lidar signal profiles calculated by the Monte Carlo method and are measured experimentally.

  6. Laser damage resistance of RbTiOPO(4): evidence of polarization dependent anisotropy.

    Science.gov (United States)

    Wagner, F R; Hildenbrand, A; Natoli, J Y; Commandré, M; Théodore, F; Albrecht, H

    2007-10-17

    Nanosecond-laser induced damage of RbTiOPO(4) crystals (RTP) has been studied at 1064 nm as a function of propagation direction and polarization orientation. A significant difference in the Laser Induced Damage Threshold (LIDT) was observed for x-cut and y-cut crystals in Pockels cell configuration, where the light propagation direction is along the x and y axes of the crystal respectively. In Pockels cell configuration the polarization is oriented at 45? with respect to the z-axis of the crystal. Experiments with the polarization oriented parallel to the principal axes of the crystal pointed out the importance of the polarization direction for the LIDT whereas the propagation direction did not significantly influence the LIDT. Comparison of the experimental data with a simple model reveals the influence of frequency doubling on the LIDT in Pockels cell configuration. In the case of the y-cut Pockels cell, the generation of frequency doubled light causes an LIDT below the LIDT of x and z-polarized light at the fundamental wavelength.

  7. Application of the Ursell-Mayer method in the theory of spin-polarized atomic hydrogen

    International Nuclear Information System (INIS)

    Kilic, S.; Radelja, T.

    1981-01-01

    Employing the Ursell-Mayer method and Ljolje semi-free gas model analytic relations describing ground state properties (energy, pressure, compressibility, sound velocity, radial distribution function and one-particle density matrix) of spin-polarized atomic hydrogen were derived. The expressions are valid up to density 2 10 26 atoms/m 3 . It was found out that at density of 2 10 26 atoms/m 3 the condensation of particle in momentum space is 88% (at absolute zero). (orig.)

  8. Formal Solutions for Polarized Radiative Transfer. II. High-order Methods

    Energy Technology Data Exchange (ETDEWEB)

    Janett, Gioele; Steiner, Oskar; Belluzzi, Luca, E-mail: gioele.janett@irsol.ch [Istituto Ricerche Solari Locarno (IRSOL), 6605 Locarno-Monti (Switzerland)

    2017-08-20

    When integrating the radiative transfer equation for polarized light, the necessity of high-order numerical methods is well known. In fact, well-performing high-order formal solvers enable higher accuracy and the use of coarser spatial grids. Aiming to provide a clear comparison between formal solvers, this work presents different high-order numerical schemes and applies the systematic analysis proposed by Janett et al., emphasizing their advantages and drawbacks in terms of order of accuracy, stability, and computational cost.

  9. Apparatus and Method for Elimination of Polarization-Induced Fading in Fiber-optic Sensor System

    Science.gov (United States)

    Chan, Hon Man (Inventor); Parker, Jr., Allen R. (Inventor)

    2015-01-01

    The invention is an apparatus and method of eliminating polarization-induced fading in interferometric fiber-optic sensor system having a wavelength-swept laser optical signal. The interferometric return signal from the sensor arms are combined and provided to a multi-optical path detector assembly and ultimately to a data acquisition and processing unit by way of a switch that is time synchronized with the laser scan sweep cycle.

  10. Direct current (DC) resistivity and induced polarization (IP) monitoring of active layer dynamics at high temporal resolution

    DEFF Research Database (Denmark)

    Doetsch, Joseph; Ingeman-Nielsen, Thomas; Christiansen, Anders V.

    2015-01-01

    With permafrost thawing and changes in active layer dynamics induced by climate change, interactions between biogeochemical and thermal processes in the ground are of great importance. Here, active layer dynamics have been monitored using direct current (DC) resistivity and induced polarization (IP...... and subsurface temperatures supplemented the DC-IP measurements. A time-lapse DC-IP monitoring system has been acquiring at least six datasets per day on a 42-electrode profile with 0.5. m electrode spacing since July 2013. Remote control of the data acquisition system enables interactive adaptation...

  11. Three-dimension Cole-Cole model inversion of induced polarization data based on regularized conjugate gradient method

    Science.gov (United States)

    Xu, Zhengwei

    Modeling of induced polarization (IP) phenomena is important for developing effective methods for remote sensing of subsurface geology and is widely used in mineral exploration. However, the quantitative interpretation of IP data in a complex 3D environment is still a challenging problem of applied geophysics. In this dissertation I use the regularized conjugate gradient method to determine the 3D distribution of the four parameters of the Cole-Cole model based on surface induced polarization (IP) data. This method takes into account the nonlinear nature of both electromagnetic induction (EMI) and IP phenomena. The solution of the 3D IP inverse problem is based on the regularized smooth inversion only. The method was tested on synthetic models with DC conductivity, intrinsic chargeability, time constant, and relaxation parameters, and it was also applied to the practical 3D IP survey data. I demonstrate that the four parameters of the Cole-Cole model, DC electrical resistivity, rho 0 , chargeability, eta time constant, tau and the relaxation parameter, C, can be recovered from the observed IP data simultaneously. There are four Cole-Cole parameters involved in the inversion, in other words, within each cell, there are DC conductivity (sigma0 ), chargeability (eta), time parameters (tau), and relaxation parameters (C) compared to conductivity only, used in EM only inversion. In addition to more inversion parameters used in IP survey, dipole-dipole configuration which requires more sources and receivers. One the other hand, calculating Green tensor and Frechet matrix time consuming and storing them requires a lot of memory. So, I develop parallel computation using MATLAB parallel tool to speed up the calculation.

  12. Can Electron Propagator Methods Be Used To Improve Polarization Propagator Methods?

    DEFF Research Database (Denmark)

    Jensen, Hans Jørgen Aagaard

    2008-01-01

    Calculations of Rydberg excitation energies with the second-order polarization propagator approximation (SOPPA) often produce results which are more in error than the random phase approximation (RPA), which formally is the first-order model. This is obviously because of cancellation of errors...... at the RPA level. On the other hand, valence excitation energies behave as expected, and they are systematically improved in SOPPA compared to RPA. Note that a Rydberg series is related to one of the ionization thresholds of the molecule, and it is thus obvious that a good description of the ionization...

  13. Characterization of textural and hydric heterogeneities in argillaceous geo-materials using induced polarization method: application to the excavation damaged zone (EDZ) of the Tournemire experimental station

    International Nuclear Information System (INIS)

    Okay, Gonca

    2011-01-01

    This Ph-D thesis investigates the potential of clay rocks for deep geological disposal of radioactive waste. Underground excavations are responsible in their vicinity a region, where the clay-rock is damaged or disturbed. This region must to be characterized to ensure the safety of repositories. The extension of the excavation damaged zone (EDZ) and its evolution over time have been investigated thought electrical resistivity and induced polarization methods from three galleries belonging to the French Institute of Radioprotection and Nuclear Safety (IRSN)'s experimental underground research laboratory of Tournemire (Aveyron, France). Time domain induced polarisation indicates the presence of mineralization (e.g., especially pyrite) located in the structural discontinuities such as tectonic fractures (mm-cm), tectonic fault (m) and calcareous nodules (cm). Combined electrical resistivity and Induced Polarization methods show the possibility to delineate textural changes associated to desaturation of the clay-rock induced by the ventilation of galleries. The impact of the desaturation is particularly observed on the gallery's walls. In addition, Spectral Induced Polarization (SIP) tomography results can be used to discriminate the responses of the de-saturated zones from the fractured zones. We have performed laboratory experiments (in the range 1.4 mHz - 12 kHz) using saturated unconsolidated sand-clay mixtures. The results illustrate that the amplitude of polarization is strongly affected by the surface properties of these mixtures (e.g., cation exchange capacity, specific surface area) and by the volumetric clay content. However, the amplitude of polarization is independent of the concentration of electrolyte. The SIP response is also strongly sensitive to the mineralogy of the clays. (author)

  14. 3-D Forward modeling of Induced Polarization Effects of Transient Electromagnetic Method

    Science.gov (United States)

    Wu, Y.; Ji, Y.; Guan, S.; Li, D.; Wang, A.

    2017-12-01

    In transient electromagnetic (TEM) detection, Induced polarization (IP) effects are so important that they cannot be ignored. The authors simulate the three-dimensional (3-D) induced polarization effects in time-domain directly by applying the finite-difference time-domain method (FDTD) based on Cole-Cole model. Due to the frequency dispersion characteristics of the electrical conductivity, the computations of convolution in the generalized Ohm's law of fractional order system makes the forward modeling particularly complicated. Firstly, we propose a method to approximate the fractional order function of Cole-Cole model using a lower order rational transfer function based on error minimum theory in the frequency domain. In this section, two auxiliary variables are introduced to transform nonlinear least square fitting problem of the fractional order system into a linear programming problem, thus avoiding having to solve a system of equations and nonlinear problems. Secondly, the time-domain expression of Cole-Cole model is obtained by using Inverse Laplace transform. Then, for the calculation of Ohm's law, we propose an e-index auxiliary equation of conductivity to transform the convolution to non-convolution integral; in this section, the trapezoid rule is applied to compute the integral. We then substitute the recursion equation into Maxwell's equations to derive the iterative equations of electromagnetic field using the FDTD method. Finally, we finish the stimulation of 3-D model and evaluate polarization parameters. The results are compared with those obtained from the digital filtering solution of the analytical equation in the homogeneous half space, as well as with the 3-D model results from the auxiliary ordinary differential equation method (ADE). Good agreements are obtained across the three methods. In terms of the 3-D model, the proposed method has higher efficiency and lower memory requirements as execution times and memory usage were reduced by 20

  15. METHODS TO ASSESS THE RESISTANCE TO CHANGE

    Directory of Open Access Journals (Sweden)

    Getuta Camelia STOICA

    2013-12-01

    Full Text Available In an era of speed and turbulences, a significant aspect in any organisation is the management of emergencies occurred as large-scale change challenges by implementing new cost reduction development and reorganisation strategies (J. P. Kotter, 2010, p. 11. The common practice proves that many organisations register failures. In relation to this aspect, J. P. Kotter (2010, p. 12 supports the idea that biggest mistake made by any organisation when trying to change themselves is their failure to create a sense of emergency among a sufficient number of people in order to prepare the change. The assurance that the change solution will be accepted and implemented by the employees reveals the resistance to change.

  16. Nanofiltration and Tight Ultrafiltration Membranes for Natural Organic Matter Removal—Contribution of Fouling and Concentration Polarization to Filtration Resistance

    Directory of Open Access Journals (Sweden)

    Joerg Winter

    2017-07-01

    Full Text Available Nanofiltration (NF and tight ultrafiltration (tight UF membranes are a viable treatment option for high quality drinking water production from sources with high concentrations of contaminants. To date, there is limited knowledge regarding the contribution of concentration polarization (CP and fouling to the increase in resistance during filtration of natural organic matter (NOM with NF and tight UF. Filtration tests were conducted with NF and tight UF membranes with molecular weight cut offs (MWCOs of 300, 2000 and 8000 Da, and model raw waters containing different constituents of NOM. When filtering model raw waters containing high concentrations of polysaccharides (i.e., higher molecular weight NOM, the increase in resistance was dominated by fouling. When filtering model raw waters containing humic substances (i.e., lower molecular weight NOM, the increase in filtration resistance was dominated by CP. The results indicate that low MWCO membranes are better suited for NOM removal, because most of the NOM in surface waters consist mainly of humic substances, which were only effectively rejected by the lower MWCO membranes. However, when humic substances are effectively rejected, CP can become extensive, leading to a significant increase in filtration resistance by the formation of a cake/gel layer at the membrane surface. For this reason, cross-flow operation, which reduces CP, is recommended.

  17. Nanofiltration and Tight Ultrafiltration Membranes for Natural Organic Matter Removal-Contribution of Fouling and Concentration Polarization to Filtration Resistance.

    Science.gov (United States)

    Winter, Joerg; Barbeau, Benoit; Bérubé, Pierre

    2017-07-02

    Nanofiltration (NF) and tight ultrafiltration (tight UF) membranes are a viable treatment option for high quality drinking water production from sources with high concentrations of contaminants. To date, there is limited knowledge regarding the contribution of concentration polarization (CP) and fouling to the increase in resistance during filtration of natural organic matter (NOM) with NF and tight UF. Filtration tests were conducted with NF and tight UF membranes with molecular weight cut offs (MWCOs) of 300, 2000 and 8000 Da, and model raw waters containing different constituents of NOM. When filtering model raw waters containing high concentrations of polysaccharides (i.e., higher molecular weight NOM), the increase in resistance was dominated by fouling. When filtering model raw waters containing humic substances (i.e., lower molecular weight NOM), the increase in filtration resistance was dominated by CP. The results indicate that low MWCO membranes are better suited for NOM removal, because most of the NOM in surface waters consist mainly of humic substances, which were only effectively rejected by the lower MWCO membranes. However, when humic substances are effectively rejected, CP can become extensive, leading to a significant increase in filtration resistance by the formation of a cake/gel layer at the membrane surface. For this reason, cross-flow operation, which reduces CP, is recommended.

  18. A new measurement method for the dynamic resistance signal during the resistance spot welding process

    International Nuclear Information System (INIS)

    Wang, Lijing; Hou, Yanyan; Zhao, Jian; Zhang, Hongjie; Xi, Tao; Qi, Xiangyang; Li, Yafeng

    2016-01-01

    To measure the dynamic resistance signal during the resistance spot welding process, some original work was carried out and a new measurement method was developed. Compared with the traditional method, using the instantaneous electrode voltage and welding current at peak current point in each half cycle, the resistance curve from the newly proposed method can provide more details of the dynamic resistance changes over time. To test the specific performance of the proposed method, a series of welding experiments were carried out and the tensile shear strengths of the weld samples were measured. Then, the measurement error of the proposed method was evaluated. Several features were extracted from the dynamic resistance curves. The correlations between the extracted features and weld strength were analyzed and the results show that these features are closely related to the weld strength and they can be used for welding quality monitoring. Moreover, the dynamic resistance curve from the newly proposed method can also be used to monitor some abnormal welding conditions. (paper)

  19. Determination of slope failure using 2-D resistivity method

    Science.gov (United States)

    Muztaza, Nordiana Mohd; Saad, Rosli; Ismail, Nur Azwin; Bery, Andy Anderson

    2017-07-01

    Landslides and slope failure may give negative economic effects including the cost to repair structures, loss of property value and medical costs in the event of injury. To avoid landslide, slope failure and disturbance of the ecosystem, good and detailed planning must be done when developing hilly area. Slope failure classification and various factors contributing to the instability using 2-D resistivity survey conducted in Selangor, Malaysia are described. The study on landslide and slope failure was conducted at Site A and Site B, Selangor using 2-D resistivity method. The implications of the anticipated ground conditions as well as the field observation of the actual conditions are discussed. Nine 2-D resistivity survey lines were conducted in Site A and six 2-D resistivity survey lines with 5 m minimum electrode spacing using Pole-dipole array were performed in Site B. The data were processed using Res2Dinv and Surfer10 software to evaluate the subsurface characteristics. 2-D resistivity results from both locations show that the study areas consist of two main zones. The first zone is alluvium or highly weathered with the resistivity of 100-1000 Ωm at 20-70 m depth. This zone consists of saturated area (1-100 Ωm) and boulders with resistivity value of 1200-3000 Ωm. The second zone with resistivity values of > 3000 Ωm was interpreted as granitic bedrock. The study area was characterized by saturated zones, highly weathered zone, highly contain of sand and boulders that will trigger slope failure in the survey area. Based on the results obtained from the study findings, it can be concluded that 2-D resistivity method is useful method in determination of slope failure.

  20. Stokes vector based interpolation method to improve the efficiency of bio-inspired polarization-difference imaging in turbid media

    Science.gov (United States)

    Guan, Jinge; Ren, Wei; Cheng, Yaoyu

    2018-04-01

    We demonstrate an efficient polarization-difference imaging system in turbid conditions by using the Stokes vector of light. The interaction of scattered light with the polarizer is analyzed by the Stokes-Mueller formalism. An interpolation method is proposed to replace the mechanical rotation of the polarization axis of the analyzer theoretically, and its performance is verified by the experiment at different turbidity levels. We show that compared with direct imaging, the Stokes vector based imaging method can effectively reduce the effect of light scattering and enhance the image contrast.

  1. Full-Stokes polarization imaging method based on the self-organized grating array in fused silica.

    Science.gov (United States)

    Xu, Canhua; Ke, Chaozhen; Ma, Jing; Huang, Yantang; Zeng, Zhiping

    2018-02-05

    A full-Stokes polarization imaging method based on the self-organized grating array was presented. By focusing the ultra-fast laser with moderate fluence into fused silica, the self-organized grating array was fabricated, featuring the optical properties similar to wave plates. A set of four independent polarization measurements were simultaneously acquired with designed grating array mounted in the focal plane of an imaging detector. Experimental results including the device fabrication, calibration and optimization were presented. Finally, a principle verification experiment was implemented for our polarization imaging method.

  2. A Novel Method for Performance Analysis of OFDM Polarization Diversity System in Ricean Fading Environment

    DEFF Research Database (Denmark)

    Ilic-Delibasic, M.; Pejanovic-Djurisic, M.; Prasad, R.

    2012-01-01

    OFDM (Orthogonal Frequency Division Multiplexing) is proven to be a very effective modulation and multiple access technique that enables high data rate transmission. Due to its good performance it is already implemented in several standardized technologies, and it is very promising technique...... conditions. In order to calculate BER (Bit Error Rate) for the considered OFDM polarization diversity system with a certain level of the received signals correlation, we propose a novel analytical method. The obtained results are compared with the ones attained by simulation....

  3. Evaluation of polarization of embedded piezoelectrics by the thermal wave method.

    Science.gov (United States)

    Suchaneck, Gunnar; Eydam, Agnes; Hu, Wenguo; Kranz, Burkhart; Drossel, Welf-Guntram; Gerlach, Gerald

    2012-09-01

    This work demonstrates the benefit of the thermal wave method for the evaluation of the polarization state of embedded piezoelectrics. Two types of samples were investigated: A low-temperature co-fired ceramics (LTCC)/lead zirconate titanate (PZT) sensor-actuator and a macro-fiber composite (MFC) actuator. At modulation frequencies below 10 Hz, the pyroelectric response was governed by thermal losses to the embedding layers. Here, the sample behavior was described by a harmonically heated piezoelectric plate exhibiting heat losses to the environment characterized by a single thermal relaxation time.

  4. Large 3D resistivity and induced polarization acquisition using the Fullwaver system: towards an adapted processing methodology

    Science.gov (United States)

    Truffert, Catherine; Leite, Orlando; Gance, Julien; Texier, Benoît; Bernard, Jean

    2017-04-01

    Driven by needs in the mineral exploration market for ever faster and ever easier set-up of large 3D resistivity and induced polarization, autonomous and cableless recorded systems come to the forefront. Opposite to the traditional centralized acquisition, this new system permits a complete random distribution of receivers on the survey area allowing to obtain a real 3D imaging. This work presents the results of a 3 km2 large experiment up to 600m of depth performed with a new type of autonomous distributed receivers: the I&V-Fullwaver. With such system, all usual drawbacks induced by long cable set up over large 3D areas - time consuming, lack of accessibility, heavy weight, electromagnetic induction, etc. - disappear. The V-Fullwavers record the entire time series of voltage on two perpendicular axes, for a good determination of the data quality although I-Fullwaver records injected current simultaneously. For this survey, despite good assessment of each individual signal quality, on each channel of the set of Fullwaver systems, a significant number of negative apparent resistivity and chargeability remains present in the dataset (around 15%). These values are commonly not taken into account in the inversion software although they may be due to complex geological structure of interest (e.g. linked to the presence of sulfides in the earth). Taking into account that such distributed recording system aims to restitute the best 3D resistivity and IP tomography, how can 3D inversion be improved? In this work, we present the dataset, the processing chain and quality control of a large 3D survey. We show that the quality of the data selected is good enough to include it into the inversion processing. We propose a second way of processing based on the modulus of the apparent resistivity that stabilizes the inversion. We then discuss the results of both processing. We conclude that an effort could be made on the inclusion of negative apparent resistivity in the inversion

  5. Efficiency of a Marine Towed Electrical Resistivity Method

    Directory of Open Access Journals (Sweden)

    Chih-Wen Chiang

    2011-01-01

    Full Text Available In contrast to marine sediments, because of large electrical resistivity anomalies found in sulfide deposits and methane hydrates, resistivity measurements such as marine towed electrical resistivity (MTER might be a feasible method for discovering those natural minerals. To determine the feasibility of the MTER method we examined arrays consisting of a pole electrical dipole (PED, vertical electrical dipole (VED and horizontal electrical dipole (HED. The VED array showed a maximum difference in electric fields of 36 o/o and 105 o/o in the resistive and conductive models, respectively, while the PED and HED arrays yielded worse results of around 13 o/o to 19 o/o, respectively. The VED array showed a higher difference in electric fields than both the HED and PED arrays in the two models. Therefore, we suggest that a VED array with a large electrical current would be most conducive leading to the discovery of such minerals during MTER surveys.

  6. Analysis of Resistive-Vee Dipole Antennas for Producing Polarization Diversity

    Science.gov (United States)

    2014-08-01

    wooden block and wire is shown in Figure 56. The results for this experiment are shown in Figure 57. The wire target ap- pears as a strong blue on...flat surface, it should have a low co-polarization response and ap- pear red on the false color maps. The wire targets appear very similar with the Kim...radars,” IEEE Transactions on Electromagnetic Compatibility , vol. 36, no. 1, February 1994. [34] M. McFadden, “Analysis of the equiangular spiral antenna

  7. Method of separate determination of high-ohmic sample resistance and contact resistance

    Directory of Open Access Journals (Sweden)

    Vadim A. Golubiatnikov

    2015-09-01

    Full Text Available A method of separate determination of two-pole sample volume resistance and contact resistance is suggested. The method is applicable to high-ohmic semiconductor samples: semi-insulating gallium arsenide, detector cadmium-zinc telluride (CZT, etc. The method is based on near-contact region illumination by monochromatic radiation of variable intensity from light emitting diodes with quantum energies exceeding the band gap of the material. It is necessary to obtain sample photo-current dependence upon light emitting diode current and to find the linear portion of this dependence. Extrapolation of this linear portion to the Y-axis gives the cut-off current. As the bias voltage is known, it is easy to calculate sample volume resistance. Then, using dark current value, one can determine the total contact resistance. The method was tested for n-type semi-insulating GaAs. The contact resistance value was shown to be approximately equal to the sample volume resistance. Thus, the influence of contacts must be taken into account when electrophysical data are analyzed.

  8. Method of stimulus combination impacts resistance to extinction.

    Science.gov (United States)

    Podlesnik, Christopher A; Bai, John Y H

    2015-07-01

    Reinforcing an alternative response in the presence of the stimuli governing a target response increases resistance to extinction of target responding, relative to training target responding on its own. Conversely, training alternative and target responses in the presence of different stimuli and combining those stimuli only decreases resistance to extinction of target responding, relative to target responding on its own. The present study assessed how different methods of combining discriminative stimuli influence resistance to extinction of responding in pigeons. As in previous studies, combining stimuli across different keys only decreased resistance to extinction of target responding relative to target responding on its own. In comparison, combining stimuli on the same key initially increased resistance to extinction of target responding, but repeated tests resulted in similar levels of responding as target responding with stimuli combined on separate keys. Moreover, greater overall reinforcement rates produced greater resistance to extinction with both methods of combining stimuli, consistent with behavioral momentum theory. These findings reveal several behavioral processes influence the outcome of combining stimuli--including perceptual processes, discriminative control by contingencies, response competition, and behavioral momentum. © Society for the Experimental Analysis of Behavior.

  9. Host antitumor resistance improved by the macrophage polarization in a chimera model of patients with HCC.

    Science.gov (United States)

    Asai, Akira; Tsuchimoto, Yusuke; Ohama, Hideko; Fukunishi, Shinya; Tsuda, Yasuhiro; Kobayashi, Makiko; Higuchi, Kazuhide; Suzuki, Fujio

    2017-01-01

    Despite major advances in curative and palliative approaches, hepatocellular carcinoma (HCC) is still the third leading cause of cancer-related death worldwide. M1 macrophages (Mϕ) play a key role in host antitumor defenses in HCC. In our study, CD14 + cells were isolated from the peripheral blood of four groups of HCC patients (group-1, patients with stage 0 HCC; group-2, patients with stage A HCC; group-3, patients with stage B HCC; and group-4, patients with stage C HCC) and characterized phenotypically. Then, CD14 + cells from group-2 and group-3 HCC patients were induced to polarize and tested for their antitumor abilities in a chimera model of HCC patients. Human HCCs (HepG2 solid tumors) grew in a chimera model of group-3 patients (group-3 HCC chimeras) but not in a chimera model of group-2 patients (group-2 HCC chimeras). In response to HCC antigens, the majority of CD14 + cells from group-2 patients (group-2 CD14 + cells) switched to the M1 phenotype (IL-12 + IL-10 - iNOS + cells), whereas the majority of CD14 + cells from group-3 patients (group-3 CD14 + cells) did not switch to the M1 phenotype and continued to express M2b phenotypic properties (IL-12 - IL-10 + CCL1 + iNOS - cells). Group-3 CD14 + cells showed M1Mϕ polarization after treatment with CCL1 antisense oligodeoxynucleotide (ODN). Therefore, our study indicates that anti-HCC defenses of group-3 HCC chimeras are improved after CCL1 antisense ODN treatment.

  10. A novel method for analysing key corticosteroids in polar bear (Ursus maritimus) hair using liquid chromatography tandem mass spectrometry

    DEFF Research Database (Denmark)

    Weisser, Johan; Hansen, Martin; Björklund, Erland

    2016-01-01

    This paper presents the development and evaluation of a methodology for extraction, clean-up and analysis of three key corticosteroids (aldosterone, cortisol and corticosterone) in polar bear hair. Such a methodology can be used to monitor stress biomarkers in polar bears and may provide....... This procedure allows for the simultaneous determination of multiple steroids, which is in contrast to previous polar bear studies based on ELISA techniques. Absolute method recoveries were 81%, 75% and 60% for cortisol, corticosterone and aldosterone, respectively. We applied the developed method on a hair...... sample pooled from four East Greenland polar bears. Herein cortisol and corticosterone were successfully determined in levels of 0.32±0.02ng/g hair and 0.13±0.02ng/g hair, respectively. Aldosterone was below limit of detection (LOD

  11. Application of vertical electrical sounding combined with induced polarization method in ground water exploration; IP koka wo koryoshita hiteikoho suichoku tansa no chikasui chosa eno tekiyo

    Energy Technology Data Exchange (ETDEWEB)

    Kondo, M.; Sakurada, H. [Sumiko Consultants Co. Ltd., Tokyo (Japan); Suzuki, T. [Hokkaido Development Bureau, Hokkaido Development Agency, Sapporo (Japan)

    1996-10-01

    For ground water exploration using vertical Schlumberger exploration method, measurement and analysis combined with induced polarization (IP) effect were conducted as trial. For the Schlumberger method, potential is measured at the center between potential electrodes during flow of dc current between current electrodes. In the case of vertical exploration, measurements are repeated with fixed potential electrodes by extending the distance between current electrodes. Ground water exploration was conducted using this method at Otaki village, Hokkaido. Geology of surveyed plateau consists of a basement of Pliocene tuffs and Quaternary Pleistocene sediments covering on the surface. For the results of analysis, four to seven beds were detected from the resistivity. The depth up to the lowest bed was between 25 and 85 m, the resistivity of each bed was between 9 and 8,000 ohm{times}m, and the polarizability was between 1 and 15 mV/V. Among these resistivity zones, it was judged that zones satisfying following three conditions correspond to coarse grain sediments saturated with ground water, and can be expected as aquifers; having resistivity ranging between 100 and 1,000 ohm{times}m, polarizability higher than 10 mV/V, and relatively large thickness. 11 refs., 6 figs.

  12. Pulsed Polarization-Based NOx Sensors of YSZ Films Produced by the Aerosol Deposition Method and by Screen-Printing.

    Science.gov (United States)

    Exner, Jörg; Albrecht, Gaby; Schönauer-Kamin, Daniela; Kita, Jaroslaw; Moos, Ralf

    2017-07-26

    The pulsed polarization technique on solid electrolytes is based on alternating potential pulses interrupted by self-discharge pauses. Since even small concentrations of nitrogen oxides (NO x ) in the ppm range significantly change the polarization and discharge behavior, pulsed polarization sensors are well suited to measure low amounts of NO x . In contrast to all previous investigations, planar pulsed polarization sensors were built using an electrolyte thick film and platinum interdigital electrodes on alumina substrates. Two different sensor layouts were investigated, the first with buried Pt electrodes under the electrolyte and the second one with conventional overlying Pt electrodes. Electrolyte thick films were either formed by aerosol deposition or by screen-printing, therefore exhibiting a dense or porous microstructure, respectively. For screen-printed electrolytes, the influence of the electrolyte resistance on the NO x sensing ability was investigated as well. Sensors with buried electrodes showed little to no response even at higher NO x concentrations, in good agreement with the intended sensor mechanism. Electrolyte films with overlying electrodes, however, allowed the quantitative detection of NO x . In particular, aerosol deposited electrolytes exhibited high sensitivities with a sensor output signal Δ U of 50 mV and 75 mV for 3 ppm of NO and NO₂, respectively. For screen-printed electrolytes, a clear trend indicated a decrease in sensitivity with increased electrolyte resistance.

  13. Hyperhomocysteinemia Promotes Insulin Resistance and Adipose Tissue Inflammation in PCOS Mice Through Modulating M2 Macrophage Polarization via Estrogen Suppression.

    Science.gov (United States)

    Qi, Xinyu; Zhang, Bochun; Zhao, Yue; Li, Rong; Chang, Hsun-Ming; Pang, Yanli; Qiao, Jie

    2017-05-01

    It has been shown that serum homocysteine (Hcy) levels are higher in women with polycystic ovary syndrome (PCOS). However, the specific role of hyperhomocysteinemia (HHcy) in the development of PCOS has never been reported. Adipose tissue inflammation is featured by the infiltration of macrophages, which plays a critical role in the pathogenesis of glucose and insulin intolerance. In this study, C57BL/6 mice were treated with dehydroepiandrosterone (DHEA) and/or a high methionine diet to induce PCOS and HHcy mice models. We showed that DHEA induced a PCOS-like phenotypes, irregular estrous cycles, weight gain, abnormal sex hormone production, glucose and insulin resistance, and polycystic ovaries. HHcy further intensified the effects DHEA on the metabolic, endocrinal, hormonal, and morphological changes in PCOS-like mice. In addition, HHcy attenuated the DHEA-induced increase in serum estrogen levels in mice. Furthermore, HHcy may exacerbate the insulin resistance in PCOS-like mice, most likely through modulating the macrophage M1/M2 polarization pathways via the suppression of estrogen. Most important, our clinical data showed that there were increases in serum Hcy levels in patients with PCOS. These findings deepen our understanding of the pathological roles of HHcy in the development of PCOS and provide a promising target for PCOS therapy in clinical application. Copyright © 2017 Endocrine Society.

  14. 3D inversion of magnetic and electrical resistivity-induced polarization data for an epithermal Au-Ag and underlying porphyry deposit: A case study from British Columbia, Canada

    Science.gov (United States)

    Abbassi, B.; Huebert, J.; Liu, L.; Lee, B.; Cheng, L.; Richards, J. P.; Unsworth, M. J.; Oldenburg, D.

    2013-12-01

    The Newton property is an epithermal Au-Ag deposit containing precious metals in association with disseminated sulfide minerals such as pyrite. This type of deposit often shows variable geological patterns, so it is important to find fast and cost-efficient methods for their exploration. Aeromagnetic surveys and ground electrical resistivity-induced polarization methods were applied over the Newton property. From preliminary 3D inversion of ZTEM and aeromagnetic data, and joint 3D inversion of electrical resistivity-induced polarization data, we show that low-resistivity and high-chargeability regions are signatures of disseminated sulfide mineralization. Potassic alteration, characterized by hydrothermal biotite (now mostly chloritized) and magnetite is also present locally, and may be related to underlying porphyry-type mineralization. This type of alteration can be identified from its magnetic signature, but the occurrence of other magnetic formations in the deposit area made interpretations of magnetic data difficult. We show that filtering geological noises related to background magnetic anomalies is an essential step in focusing on potassic alteration zones. We used electrical resistivity and induced polarization chargeability models to remove the signals of barren magnetic zones to focus on the susceptibilities pertaining to deep potassic alterations. In order to test the credibility of these interpretations, extensive petrophysical measurements (magnetic susceptibility, electrical resistivity, and gamma ray spectra) were collected on drill-core samples. We show that potassic alteration can also be characterized accurately from high levels of potassium to thorium ratio (K/Th) in gamma ray spectrometric measurements, and that this correlation is stronger than the magnetic signal (likely because hydrothermal magnetite is variable in abundance). Therefore, we focused on magnetic susceptibility values correlated with high K/Th ratios in order to reduce the

  15. Evaluation of Unknown Tube Well Depth Using Electrical Resistivity Method

    Directory of Open Access Journals (Sweden)

    Zainal Abidin Mohd Hazreek

    2017-01-01

    Full Text Available Electrical resistivity method has increasingly adopted in engineering, environmental, mining and archaeological studies. Systematic and proper studies of unknown civil engineering structure evaluation particularly on tube well depth was rarely being established. Conventionally, camera test or string with weight approach has been used to evaluate unknown tube well depth thus exposed to several restriction due to its expensive and time consuming. Hence, this study focused on evaluation of unknown tube well depth using indirect test with particular reference to electrical resistivity method (ERM.A single spread line of electrical resistivity survey was performed using ABEM SAS 4000 equipment set based on Wenner and Pole-dipole array in line with the tube well position. Electrical resistivity raw data was processed using RES2DINV software producing electrical resistivity tomography (ERT of the subsurface profile studied. Then, electrical resistivity value (ERV obtained from RES2DINV analyses (ERT was extracted and analysed using plotted graph (depth versus ERV specifically at tube well position based on electrical resistivity spread line performed. It was found that both array have shown some good similarity results in term of tube well depth (20 m thus able to verify the result interpreted. Both array have shown some good similarity of ERV representing groundwater (ERV = 10 – 100 Ωm and soil with water (ERV > 100 Ωm at depth of 0 – 20 m and >20 m respectively. All those interpretation have shown good agreement based on verification thru established ERV of earth materials references, geological map and nearest available boreholes data. Hence, this study has shown that the application of ERM was applicable in evaluation of unknown tube well depth which efficient in term of cost, time and environmental sustainable.

  16. Protein expression on Cr resistant microorganism using electrophoresis method

    Directory of Open Access Journals (Sweden)

    SAJIDAN

    2009-01-01

    Full Text Available Fatmawati U, Suranto, Sajidan. 2009. Protein expression on Cr resistant microorganism using electrophoresis method. Nusantara Bioscience 1: 31-37. Hexavalent chromium (Cr(VI is known as toxic heavy metals, so the need is reduced to Cr(III is much less toxicity. Pseudomonas aeruginosa, Pseudomonas putida, Klebsiella pneumoniae, Pantoea sp. and Saccharomyces cerevisiae are resistant Cr(VI microorganism and have ability to reduce Cr(VI. The aim of this research is to know ability of microorganism to reduce Cr(VI and to know protein band pattern between Cr(VI resistant microorganism and non resistant microorganism which inoculated on LB broth. SDS-PAGE was used to indentify protein expression. While, Cr(VI concentration was identified by 1.5 diphenylcarbazide method. The quantitative data was analyzed by two factorial ANOVA that continued with DMRT at 1% level test. The qualitative data i.e. protein expression analyzed by relative mobility (Rf. The results showed that the ability of microorganisms to reduce Cr(VI at initial concentration of 0.5 ppm, 1 ppm, 5 ppm and 10 ppm may vary, the average percentage of the ability of each microorganism in reducing Cr(VI is P. putida (65% > S. cerevisiae (64.45% >. P. aeruginosa (60.73% > Pantoea sp. (50.22% > K. pneumoniae (47.82% > without microorganisms (34.25%. The adding microorganisms have significantly influenced toward reduction of Cr(VI. The SDS-PAGE shows that protein expression between resistant and not resistant microorganisms are no different, but resistant microorganisms have more protein (protein band is thicker.

  17. Laboratory methods for diagnosis and detection of drug resistant ...

    African Journals Online (AJOL)

    Data source: Published series of peer reviewed journals and manuals written on laboratory methods that are currently used for diagnosis and detection of drug resistance of Mycobacterium tuberculosis complex were reviewed using the index medicus, pubmed and medline search. Conventional bacteriological microscopy ...

  18. Formation water resistivity (R w )determination: The SP method ...

    African Journals Online (AJOL)

    uncontaminated by drilling mud) that saturates the porous formation. It is also referred to as connate water or interstitial water. Its resistivity can be determined by a number of methods, one of which is by the SP curve discussed in this work. Analysis of ...

  19. An Image Matching Method Based on Fourier and LOG-Polar Transform

    Directory of Open Access Journals (Sweden)

    Zhijia Zhang

    2014-04-01

    Full Text Available This Traditional template matching methods are not appropriate for the situation of large angle rotation between two images in the online detection for industrial production. Aiming at this problem, Fourier transform algorithm was introduced to correct image rotation angle based on its rotatary invariance in time-frequency domain, orienting image under test in the same direction with reference image, and then match these images using matching algorithm based on log-polar transform. Compared with the current matching algorithms, experimental results show that the proposed algorithm can not only match two images with rotation of arbitrary angle, but also possess a high matching accuracy and applicability. In addition, the validity and reliability of algorithm was verified by simulated matching experiment targeting circular images.

  20. Transfer of polarized light in planetary atmospheres basic concepts and practical methods

    CERN Document Server

    Hovenier, Joop W; Domke, Helmut

    2004-01-01

    The principal elements of the theory of polarized light transfer in planetary atmospheres are expounded in a systematic but concise way. Basic concepts and practical methods are emphasized, both for single and multiple scattering of electromagnetic radiation by molecules and particles in the atmospheres of planets in the Solar System, including the Earth, and beyond. A large part of the book is also useful for studies of light scattering by particles in comets, the interplanetary and interstellar medium, circumstellar disks, reflection nebulae, water bodies like oceans and suspensions of particles in a gas or liquid in the laboratory. Throughout the book symmetry principles, such as the reciprocity principle and the mirror symmetry principle, are employed. In this way the theory is made more transparent and easier to understand than in most papers on the subject. In addition, significant computational reductions, resulting from symmetry principles, are presented. Hundreds of references to relevant literature ...

  1. Chemical passivation as a method of improving the electrochemical corrosion resistance of Co-Cr-based dental alloy.

    Science.gov (United States)

    Rylska, Dorota; Sokołowski, Grzegorz; Sokołowski, Jerzy; Łukomska-Szymańska, Monika

    2017-01-01

    The purpose of the study was to evaluate corrosion resistance of Wirobond C® alloy after chemical passivation treatment. The alloy surface undergone chemical passivation treatment in four different media. Corrosion studies were carried out by means of electrochemical methods in saline solution. Corrosion effects were determined using SEM. The greatest increase in the alloy polarization resistance was observed for passive layer produced in Na2SO4 solution with graphite. The same layer caused the highest increase in corrosion current. Generally speaking, the alloy passivation in Na2SO4 solution with graphite caused a substantial improvement of the corrosion resistance. The sample after passivation in Na2SO4 solution without graphite, contrary to others, lost its protective properties along with successive anodic polarization cycles. The alloy passivation in Na3PO4 solution with graphite was the only one that caused a decrease in the alloy corrosion properties. The SEM studies of all samples after chemical passivation revealed no pit corrosion - in contrast to the sample without any modification. Every successive polarization cycle in anodic direction of pure Wirobond C® alloy enhances corrosion resistance shifting corrosion potential in the positive direction and decreasing corrosion current value. The chemical passivation in solutions with low pH values decreases susceptibility to electrochemical corrosion of Co-Cr dental alloy. The best protection against corrosion was obtained after chemical passivation of Wirobond C® in Na2SO4 solution with graphite. Passivation with Na2SO4 in solution of high pH does not cause an increase in corrosion resistance of WIROBOND C. Passivation process increases alloy resistance to pit corrosion.

  2. Compensating for Electrode Polarization in Dielectric Spectroscopy Studies of Colloidal Suspensions: Theoretical Assessment of Existing Methods

    Science.gov (United States)

    Chassagne, Claire; Dubois, Emmanuelle; Jiménez, María L.; van der Ploeg, J. P. M; van Turnhout, Jan

    2016-01-01

    Dielectric spectroscopy can be used to determine the dipole moment of colloidal particles from which important interfacial electrokinetic properties, for instance their zeta potential, can be deduced. Unfortunately, dielectric spectroscopy measurements are hampered by electrode polarization (EP). In this article, we review several procedures to compensate for this effect. First EP in electrolyte solutions is described: the complex conductivity is derived as function of frequency, for two cell geometries (planar and cylindrical) with blocking electrodes. The corresponding equivalent circuit for the electrolyte solution is given for each geometry. This equivalent circuit model is extended to suspensions. The complex conductivity of a suspension, in the presence of EP, is then calculated from the impedance. Different methods for compensating for EP are critically assessed, with the help of the theoretical findings. Their limit of validity is given in terms of characteristic frequencies. We can identify with one of these frequencies the frequency range within which data uncorrected for EP may be used to assess the dipole moment of colloidal particles. In order to extract this dipole moment from the measured data, two methods are reviewed: one is based on the use of existing models for the complex conductivity of suspensions, the other is the logarithmic derivative method. An extension to multiple relaxations of the logarithmic derivative method is proposed. PMID:27486575

  3. Retrieve polarization aberration from image degradation: a new measurement method in DUV lithography

    Science.gov (United States)

    Xiang, Zhongbo; Li, Yanqiu

    2017-10-01

    Detailed knowledge of polarization aberration (PA) of projection lens in higher-NA DUV lithographic imaging is necessary due to its impact to imaging degradations, and precise measurement of PA is conductive to computational lithography techniques such as RET and OPC. Current in situ measurement method of PA thorough the detection of degradations of aerial images need to do linear approximation and apply the assumption of 3-beam/2-beam interference condition. The former approximation neglects the coupling effect of the PA coefficients, which would significantly influence the accuracy of PA retrieving. The latter assumption restricts the feasible pitch of test masks in higher-NA system, conflicts with the Kirhhoff diffraction model of test mask used in retrieving model, and introduces 3D mask effect as a source of retrieving error. In this paper, a new in situ measurement method of PA is proposed. It establishes the analytical quadratic relation between the PA coefficients and the degradations of aerial images of one-dimensional dense lines in coherent illumination through vector aerial imaging, which does not rely on the assumption of 3-beam/2- beam interference and linear approximation. In this case, the retrieval of PA from image degradation can be convert from the nonlinear system of m-quadratic equations to a multi-objective quadratic optimization problem, and finally be solved by nonlinear least square method. Some preliminary simulation results are given to demonstrate the correctness and accuracy of the new PA retrieving model.

  4. Defect-Resistant Radiative Performance of m-Plane Immiscible Al1-xInxN Epitaxial Nanostructures for Deep-Ultraviolet and Visible Polarized Light Emitters.

    Science.gov (United States)

    Chichibu, Shigefusa F; Kojima, Kazunobu; Uedono, Akira; Sato, Yoshitaka

    2017-02-01

    Planar vacuum-fluorescent-display devices emitting polarized UV-C, blue, and green light are demonstrated using immiscible Al 1- x In x N nanostructures grown in nonpolar m-directions. Despite the presence of high concentration of nonradiative recombination centers, the Al 1- x In x N nanostructures emit polarized light with the luminescence lifetimes of 22-32 ps at 300 K. This defect-resistant radiative performance suggests supernormal localized characteristics of electron-hole pairs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Method of making sulfur-resistant composite metal membranes

    Science.gov (United States)

    Way, J Douglas [Boulder, CO; Lusk, Mark [Golden, CO; Thoen, Paul [Littleton, CO

    2012-01-24

    The invention provides thin, hydrogen-permeable, sulfur-resistant membranes formed from palladium or palladium-alloy coatings on porous, ceramic or metal supports. Also disclosed are methods of making these membranes via sequential electroless plating techniques, wherein the method of making the membrane includes decomposing any organic ligands present on the substrate, reducing the palladium crystallites on the substrate to reduced palladium crystallites, depositing a film of palladium metal on the substrate and then depositing a second, gold film on the palladium film. These two metal films are then annealed at a temperature between about 200.degree. C. and about 1200.degree. C. to form a sulfur-resistant, composite PdAu alloy membrane.

  6. A New Method for Simulating Power Flow Density Focused by a Silicon Lens Antenna Irradiated with Linearly Polarized THz Wave

    Directory of Open Access Journals (Sweden)

    Catur Apriono

    2015-08-01

    Full Text Available A terahertz system uses dielectric lens antennas for focusing and collimating beams of terahertz wave radiation. Linearly polarized terahertz wave radiation has been widely applied in the terahertz system. Therefore, an accurate method for analyzing the power flow density in the dielectric lens antenna irradiated with the linearly polarized terahertz wave radiation is important to design the terahertz systems. In optics, ray-tracing method has been used to calculate the power flow density by a number density of rays. In this study, we propose a method of ray-tracing combined with Fresnel’s transmission, including transmittance and polarization of the terahertz wave radiation to calculate power flow density in a Silicon lens antenna. We compare power flow density calculated by the proposed method with the regular ray-tracing method. When the Silicon lens antenna is irradiated with linearly polarized terahertz wave radiation, the proposed method calculates the power flow density more accurately than the regular ray-tracing.

  7. OPTIMIZATION OF LAMBLIASIS MICROSCOPIC DIAGNOSTICS BY THE METHOD OF POLARIZED FLUORESCENCE FOR PATIENTS WITH ROSACEA AND URTICARIAL

    Directory of Open Access Journals (Sweden)

    Maryana Kovalchuk

    2013-07-01

    Full Text Available Introduction: There is little information about diagnosis of concurrent lambliasis in patients with rosacea and urticaria. We used method of polarized fluorescence to diagnose liambliasis, taking into account belonging of macromolecular structures of unicellular parasites Giardia lamblia to the optically active substances with the properties of liquid crystals. Material and Methods: Lambliasis was diagnosed on the basis of feces parasitological research and duodenal contents by methods of light and optic microscopy and polarized fluorescence in 105 patients with rosacea and urticaria. Research results were processed by the method of variation statistics in the Statgraf program by using Student’s criterion. Results: Search results of lamblia in patients with rosacea and urticaria depended on the conditions of its holding, patients’ preparation and from the previously received basic therapy if it consisted absorbents. Due to the fact that the fluorescence polarization as a physical method does not require the use of any generally toxic, dye- fluorochromes, qualitative cyto fluorescent analysis of lamblia in greeting microdrugs enables to distinguish vegetative forms of cysts. Conclussions: Polarized fluorescence method allows optimize the microscopic diagnosis of lambliasis, increasing its sensitivity. Previous preparation for the laboratory examination of Giardia lamblia is needed for the best exposure of vermin for patients with rosacea and urticaria.

  8. An Objective Prototype-Based Method for Dual-Polarization Radar Clutter Identification

    Directory of Open Access Journals (Sweden)

    Guang Wen

    2017-04-01

    Full Text Available A prototype-based method is developed to discriminate different types of clutter (ground clutter, sea clutter, and insects from weather echoes using polarimetric measurements and their textures. This method employs a clustering algorithm to generate data groups from the training dataset, each of which is modeled as a weighted Gaussian distribution called a “prototype.” Two classification algorithms are proposed based on the prototypes, namely maximum prototype likelihood classifier (MPLC and Bayesian classifier (BC. In the MPLC, the probability of a data point with respect to each prototype is estimated to retrieve the final class label under the maximum likelihood criterion. The BC models the probability density function as a Gaussian mixture composed by the prototypes. The class label is obtained under the maximum a posterior criterion. The two algorithms are applied to S-band dual-polarization CP-2 weather radar data in Southeast Queensland, Australia. The classification results for the test dataset are compared with the NCAR fuzzy-logic particle identification algorithm. Generally good agreement is found for weather echo and ground clutter; however, the confusion matrix indicates that the techniques tend to differ from each other on the recognition of insects.

  9. Multi-layer solid-phase extraction and evaporation-enrichment methods for polar organic chemicals from aqueous matrices.

    Science.gov (United States)

    Köke, Niklas; Zahn, Daniel; Knepper, Thomas P; Frömel, Tobias

    2018-03-01

    Analysis of polar organic chemicals in the aquatic environment is exacerbated by the lack of suitable and widely applicable enrichment methods. In this work, we assessed the suitability of a novel combination of well-known solid-phase extraction (SPE) materials in one cartridge as well as an evaporation method and for the enrichment of 26 polar model substances (predominantly log D evaporation method were investigated for the recovery and matrix effects of the model substances and analyzed with hydrophilic interaction liquid chromatography-tandem mass spectrometry (HILIC-MS/MS). In total, 65% of the model substances were amenable (> 10% recovery) to the mlSPE method with a mean recovery of 76% while 73% of the model substances were enriched with the evaporation method achieving a mean recovery of 78%. Target and non-target screening comparison of both methods with a frequently used reversed-phase SPE method utilizing "hydrophilic and lipophilic balanced" (HLB) material was performed. Target analysis showed that the mlSPE and evaporation method have pronounced advantages over the HLB method since the HLB material retained only 30% of the model substances. Non-target screening of a ground water sample with the investigated enrichment methods showed that the median retention time of all detected features on a HILIC system decreased in the order mlSPE (3641 features, median t R 9.7 min), evaporation (1391, 9.3 min), HLB (4414, 7.2 min), indicating a higher potential of the described methods to enrich polar analytes from water compared with HLB-SPE. Graphical abstract Schematic of the method evaluation (recovery and matrix effects) and method comparison (target and non-target analysis) of the two investigated enrichment methods for very polar chemicals in aqueousmatrices.

  10. THE EXPERIMENTAL VALIDATION OF THE GROUNDING DEVICE RESISTANCE MEASUREMENT METHOD

    Directory of Open Access Journals (Sweden)

    I. V. Nizhevskyi

    2016-12-01

    Full Text Available Purpose. The paper considers experimental research of three-electrode units for measuring the resistance of grounding devices for different purposes. Methodology. The experimental study of the method of resistance measurement of grounding devices for any design in any soil structure using the method of physical modeling is presented. Results. By results of model operation the set of equations of the sixth order is solved. It allowed to determine the own and mutual impedance in the three-electrode unit with high accuracy without searching the point of zero potential. Features of measuring and defining the own and relative resistances of various combinations of electrodes for three-electrode measuring unit are considered. Originality. The necessity of finding a zero potential point is excluded. Practical value. The proposed method provides the smallest possible spacing of potential electrodes outside the grounding devices. This reduces the wiring length measurement circuit in several times, increases the ratio «signal – noise», removes the restrictions on building of the territory outside the test grounding device.

  11. Possibility of cereals protection against rusts by resistant breeding method

    Directory of Open Access Journals (Sweden)

    Czesław Zamorski

    2013-12-01

    Full Text Available In the years 1999-2001 field trials were run on susceptibility of wheat and triticale genotypes to infection by three rust fungi (Puccinia recondita, Puccinia graminis, Puccinia striiformis. The results of the observation of the infection level in following years have been similar. Among genotypes of winter wheat, breeding lines susceptible to Puccinia striiformis infection were rare, but among spring wheat 50% of genotypes were susceptible to yellow rust infection. A much higher level of sensitivity than in the case of winter wheat has been found in winter triticale genotypes. Wheat genotypes were distinguished by the high sensitivity to Puccinia graminis infection, only a few breeding lines were resistant to stem rust. The susceptibility of wheat to brown rust (Puccinia recondita was a common feature. Triticale genotypes compared to wheat were affected significantly less and majority of them exhibited high level of resistant to brown rust. The use of the breeding method has justification in control yellow rust of winter wheat. Recommended cultivars are almost all fully resistant to Puccinia striiformis infection. The application of this method in selection of spring wheat and triticale is in large past limited. Some of the registered cultivars of spring wheat and triticale are very susceptible to yellow rust. Using the breeding method to protect wheat from stem rust and brown rust is of little practical benefit in our county at this moment. But it can be effecive to control stem and brown rusts of triticale.

  12. Comparison of electrochemical noise with impedance and polarization resistance techniques in the steel/concrete system

    International Nuclear Information System (INIS)

    Bautista, A.; Gonzalez, J.A.; Vergara, A.; Davila, J.V.; Mariaca, L.

    1997-01-01

    This paper studies the corrosion rates of active and passive rebars embedded in concrete in various degrees of wetness using different electrochemical techniques. The ability of the electrochemical noise to quantificate the intensity of the attack and the advantages of this method are stressed. Data that prove that the corrosion rate is proportional to the current noise and independent to the potential noise in this system are also shown. (Author) 23 refs

  13. Evaluation of direct analysis in real time for the determination of highly polar pesticides in lettuce and celery using modified Quick Polar Pesticides Extraction method.

    Science.gov (United States)

    Lara, Francisco J; Chan, Danny; Dickinson, Michael; Lloyd, Antony S; Adams, Stuart J

    2017-05-05

    Direct analysis in real time (DART) was evaluated for the determination of a number of highly polar pesticides using the Quick Polar Pesticides Extraction (QuPPe) method. DART was hyphenated to high resolution mass spectrometry (HRMS) in order to get the required selectivity that allows the determination of these compounds in complex samples such as lettuce and celery. Experimental parameters such as desorption temperature, scanning speed, and distances between the DART ion source and MS inlet were optimized. Two different mass analyzers (Orbitrap and QTOF) and two accessories for sample introduction (Dip-it ® tips and QuickStrip™ sample cards) were evaluated. An extra clean-up step using primary-secondary amine (PSA) was included in the QuPPe method to improve sensitivity. The main limitation found was in-source fragmentation, nevertheless QuPPe-DART-HRMS proved to be a fast and reliable tool with quantitative capabilities for at least seven compounds: amitrole, cyromazine, propamocarb, melamine, diethanolamine, triethanolamine and 1,2,4-triazole. The limits of detection ranged from 20 to 60μg/kg. Recoveries for fortified samples ranged from 71 to 115%, with relative standard deviations <18%. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. A novel method for analysing key corticosteroids in polar bear (Ursus maritimus) hair using liquid chromatography tandem mass spectrometry.

    Science.gov (United States)

    Weisser, Johan J; Hansen, Martin; Björklund, Erland; Sonne, Christian; Dietz, Rune; Styrishave, Bjarne

    2016-04-01

    This paper presents the development and evaluation of a methodology for extraction, clean-up and analysis of three key corticosteroids (aldosterone, cortisol and corticosterone) in polar bear hair. Such a methodology can be used to monitor stress biomarkers in polar bears and may provide as a useful tool for long-term and retrospective information. We developed a combined pressurized liquid extraction (PLE)-solid phase extraction (SPE) procedure for corticosteroid extraction and clean-up followed by high pressure liquid chromatography tandem mass spectrometry (HPLC-MS/MS) analysis. This procedure allows for the simultaneous determination of multiple steroids, which is in contrast to previous polar bear studies based on ELISA techniques. Absolute method recoveries were 81%, 75% and 60% for cortisol, corticosterone and aldosterone, respectively. We applied the developed method on a hair sample pooled from four East Greenland polar bears. Herein cortisol and corticosterone were successfully determined in levels of 0.32±0.02ng/g hair and 0.13±0.02ng/g hair, respectively. Aldosterone was below limit of detection (LOD<0.17ng/g). The cortisol hair concentration found in these East Greenland polar bears was consistent with cortisol levels previously determined in the Southern Hudson Bay and James Bay in Canada using ELISA kits. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Detection of graves using the micro-resistivity method

    Directory of Open Access Journals (Sweden)

    R. Luzio

    2006-06-01

    Full Text Available This paper describes a case history of the application of resistivity methods on the detection of a tomb tentatively associated with Damião de Goes, a prominent Portuguese humanist who lived in the XVI century. The survey carried out inside Varzea Church comprised dipole-dipole, gradient and pole-pole arrays. The results obtained from the 2D inversion of dipole-dipole data and 3D inversion of the gradient array have shown high resistivity anomalies that were assigned to the walls of the tomb. The low resistivity anomalies observed in between were interpreted as due to the presence of water enriched by ions from the decomposition of human bodies. This result is corroborated by the imaging obtained using the 3D probability tomography of the gradient and pole-pole data. Excavation works, carried out in accordance with the results of the geoelectrical investigation, successfully found a 2.7×0.8×1.7 m tomb, where several human bones have been collected. A 3D resistivity model incorporating the main features of the tomb was built after the excavation. The pole-pole model responses calculated from this model reproduce the main features observed in the data.

  16. A novel method to detect bacterial resistance to disinfectants

    Directory of Open Access Journals (Sweden)

    Xiao-Feng He

    2017-09-01

    Full Text Available In clinical practice, the important hygienic prevention of bacterial pathogen spread is disinfection of potentially contaminated area. Benzalkonium bromide and chlorhexidine acetate are commonly used disinfectants with a broad spectrum of anti-microbial effect. It is vital to inhibit the spread of pathogen in hospital. However, a large number of pathogens with the decreased antiseptic susceptibility have been isolated from clinical samples which showed an increased minimal inhibitory concentration (MIC against those antiseptics. These resistant pathogens are the major causes for nosocomial cross-infections in hospital. The present study demonstrated the utility of Oxford plate assay system in determining the potential disinfectant resistance of bacteria. The microbiological assay is based on the inhibitory effect of tested disinfectants upon the strains of Staphylococcus aureus and Escherichia coli. Statistical analysis of the bioassay results indicated the linear correlation (r = 0.87–0.99, P < 0.01 between the diameter of growth inhibition zone and the log dosage of the tested disinfectants. Moreover, comparison of inhibitory efficacy of benzalkonium bromide upon 29 S. aureus strains isolated from clinical samples by both Oxford plate method and broth dilution method showed that the diameter of growth inhibition zone has significantly negative correlation with the minimal inhibitory concentration (MIC (r = −0.574, P < 0.001. These results suggest that the Oxford plate is a simple and time-saving method in detecting potential clinical disinfectant resistance and its usefulness for routine surveillance of pathogenic resistance to disinfectants warrants further investigation.

  17. Electrochemical Cathodic Polarization, a Simplified Method That Can Modified and Increase the Biological Activity of Titanium Surfaces: A Systematic Review.

    Directory of Open Access Journals (Sweden)

    Jose Carlos Bernedo Alcazar

    Full Text Available The cathodic polarization seems to be an electrochemical method capable of modifying and coat biomolecules on titanium surfaces, improving the surface activity and promoting better biological responses.The aim of the systematic review is to assess the scientific literature to evaluate the cellular response produced by treatment of titanium surfaces by applying the cathodic polarization technique.The literature search was performed in several databases including PubMed, Web of Science, Scopus, Science Direct, Scielo and EBSCO Host, until June 2016, with no limits used. Eligibility criteria were used and quality assessment was performed following slightly modified ARRIVE and SYRCLE guidelines for cellular studies and animal research.Thirteen studies accomplished the inclusion criteria and were considered in the review. The quality of reporting studies in animal models was low and for the in vitro studies it was high. The in vitro and in vivo results reported that the use of cathodic polarization promoted hydride surfaces, effective deposition, and adhesion of the coated biomolecules. In the experimental groups that used the electrochemical method, cellular viability, proliferation, adhesion, differentiation, or bone growth were better or comparable with the control groups.The use of the cathodic polarization method to modify titanium surfaces seems to be an interesting method that could produce active layers and consequently enhance cellular response, in vitro and in vivo animal model studies.

  18. Method of manufacturing a shapeable short-resistant capacitor

    Science.gov (United States)

    Taylor, Ralph S.; Myers, John D.; Baney, William J.

    2013-04-02

    A method that employs a novel combination of conventional fabrication techniques provides a ceramic short-resistant capacitor that is bendable and/or shapeable to provide a multiple layer capacitor that is extremely compact and amenable to desirable geometries. The method allows thinner and more flexible ceramic capacitors to be made. The method includes forming a first thin metal layer on a substrate; depositing a thin, ceramic dielectric layer over the metal layer; depositing a second thin metal layer over the dielectric layer to form a capacitor exhibiting a benign failure mode; and separating the capacitor from the substrate. The method may also include bending the resulting capacitor into a serpentine arrangement with gaps between the layers that allow venting of evaporated electrode material in the event of a benign failure.

  19. Calculation of the QED correction to the recoil proton polarization by the electron structure function method

    International Nuclear Information System (INIS)

    Afanasev, A.V.; Akushevich, I.; Merenkov, N.P.

    2000-01-01

    The recoil proton polarization for the quasielastic electron-proton scattering is represented as a contraction of the electron structure and the hard part of the polarization dependent contribution into cross-section. The calculation of the hard part with first order radiative correction is performed. The obtained representation includes the leading radiative corrections in all orders of perturbation theory and the main part of the second order next-to-leading ones

  20. Application of the Normalized Full Gradient (NFG) Method to Resistivity Data

    OpenAIRE

    AYDIN, ALİ

    2010-01-01

    This paper proposes the application of the normalized full gradient (NFG) method to resistivity studies and illustrates that the method can greatly reduce the time and work load needed in detecting buried bodies using resistivity measurement. The NFG method calculates resistivity values at desired electrode offsets by extrapolation of a function of resistivity measurements (i.e. the gradient) to other depth levels using resistivity measurements done at one electrode offset only. The performan...

  1. Standard test method for measurement of soil resistivity using the two-electrode soil box method

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers the equipment and a procedure for the measurement of soil resistivity, for samples removed from the ground, for use in the control of corrosion of buried structures. 1.2 Procedures allow for this test method to be used n the field or in the laboratory. 1.3 The test method procedures are for the resistivity measurement of soil samples in the saturated condition and in the as-received condition. 1.4 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information only. Soil resistivity values are reported in ohm-centimeter. This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and to determine the applicability of regulatory limitations prior to use.

  2. Theoretical investigation into negative differential resistance characteristics of resonant tunneling diodes based on lattice-matched and polarization-matched AlInN/GaN heterostructures

    Science.gov (United States)

    Rong, Taotao; Yang, Lin-An; Yang, Lin; Hao, Yue

    2018-01-01

    In this work, we report an investigation of resonant tunneling diodes (RTDs) with lattice-matched and polarization-matched AlInN/GaN heterostructures using the numerical simulation. Compared with the lattice-matched AlInN/GaN RTDs, the RTDs based on polarization-matched AlInN/GaN hetero-structures exhibit symmetrical conduction band profiles due to eliminating the polarization charge discontinuity, which achieve the equivalence of double barrier transmission coefficients, thereby the relatively high driving current, the high symmetry of current density, and the high peak-to-valley current ratio (PVCR) under the condition of the positive and the negative sweeping voltages. Simulations show that the peak current density approaches 1.2 × 107 A/cm2 at the bias voltage of 0.72 V and the PVCR approaches 1.37 at both sweeping voltages. It also shows that under the condition of the same shallow energy level, when the trap density reaches 1 × 1019 cm-3, the polarization-matched RTDs still have acceptable negative differential resistance (NDR) characteristics, while the NDR characteristics of lattice-matched RTDs become irregular. After introducing the deeper energy level of 1 eV into the polarization-matched and lattice-matched RTDs, 60 scans are performed under the same trap density. Simulation results show that the degradation of the polarization-matched RTDs is 22%, while lattice-matched RTDs have a degradation of 55%. It can be found that the polarization-matched RTDs have a greater defect tolerance than the lattice-matched RTDs, which is beneficial to the available manufacture of actual terahertz RTD devices.

  3. USING SESSION RPE TO MONITOR DIFFERENT METHODS OF RESISTANCE EXERCISE

    Directory of Open Access Journals (Sweden)

    Alison D. Egan

    2006-06-01

    Full Text Available The purpose of this study was to compare session rating of perceived exertion for different resistance training techniques in the squat exercise. These techniques included traditional resistance training, super slow, and maximal power training. Fourteen college-age women (Mean ± SD; age = 22 ± 3 years; height = 1.68 ± 0. 07 m completed three experimental trials in a randomized crossover design. The traditional resistance training protocol consisted of 6 sets of 6 repetitions of squats using 80% of 1-RM. The super slow protocol consisted of 6 sets of 6 repetitions using 55% of 1-RM. The maximal power protocol consisted of 6 sets of 6 repetitions using 30% of 1-RM. Rating of perceived exertion (RPE measures were obtained following each set using Borg's CR-10 scale. In addition, a session RPE value was obtained 30 minutes following each exercise session. When comparing average RPE and session RPE, no significant difference was found. However, power training had significantly lower (p < 0.05 average and session RPE (4.50 ± 1.9 and 4.5 ± 2.1 compared to both super slow training (7.81 ± 1.75 and 7.43 ± 1.73 and traditional training (7.33 ± 1.52 and 7.13 ± 1.73. The results indicate that session RPE values are not significantly different from the more traditional methods of measuring RPE during exercise bouts. It does appear that the resistance training mode that is used results in differences in perceived exertion that does not relate directly to the loading that is used. Using session RPE provides practitioners with the same information about perceived exertion as the traditional RPE measures. Taking a single measure following a training session would appear to be much easier than using multiple measures of RPE throughout a resistance training workout. However, practitioners should also be aware that the RPE does not directly relate to the relative intensity used and appears to be dependent on the mode of resistance exercise that is used

  4. Standard Test Method for Abrasive Wear Resistance of Cemented

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2005-01-01

    1.1 This test method covers the determination of abrasive wear resistance of cemented carbides. 1.2 The values stated in inch-pound units are to be regarded as the standard. The SI equivalents of inch-pound units are in parentheses and may be approximate. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  5. Mycobacteria: laboratory methods for testing drug sensitivity and resistance

    Science.gov (United States)

    Canetti, G.; Froman, S.; Grosset, J.; Hauduroy, P.; Langerová, Miloslava; Mahler, H. T.; Meissner, Gertrud; Mitchison, D. A.; Šula, L.

    1963-01-01

    In its seventh report, published in 1960, the WHO Expert Committee on Tuberculosis “noted the need for international standards for the definition and determination of drug resistance which will permit comparisons to be made from one area to another, and recommended that the World Health Organization take appropriate steps to establish such standards”.10 Acting on this recommendation, WHO took the first step towards standardization by convening in Geneva, in December 1961, an informal international meeting of specialists in the bacteriology of tuberculosis. At this meeting an attempt was made to formulate prerequisites for reliable sensitivity tests and to specify the technical procedures for them. The first part of the present paper is a joint contribution by the participants in the meeting, summarizing the general conclusions reached and recommendations made with regard to tests of sensitivity to the three main antituberculosis drugs—isoniazid, streptomycin and p-aminosalicylic acid. The other three parts describe, in turn, three different tests for determining drug sensitivity—the absolute-concentration method, the resistance-ratio method and the proportion method—that are generally considered to give reasonably accurate results. PMID:14102034

  6. SGLT2 Inhibition by Empagliflozin Promotes Fat Utilization and Browning and Attenuates Inflammation and Insulin Resistance by Polarizing M2 Macrophages in Diet-induced Obese Mice.

    Science.gov (United States)

    Xu, Liang; Nagata, Naoto; Nagashimada, Mayumi; Zhuge, Fen; Ni, Yinhua; Chen, Guanliang; Mayoux, Eric; Kaneko, Shuichi; Ota, Tsuguhito

    2017-06-01

    Sodium-glucose cotransporter (SGLT) 2 inhibitors increase urinary glucose excretion (UGE), leading to blood glucose reductions and weight loss. However, the impacts of SGLT2 inhibition on energy homeostasis and obesity-induced insulin resistance are less well known. Here, we show that empagliflozin, a SGLT2 inhibitor, enhanced energy expenditure and attenuated inflammation and insulin resistance in high-fat-diet-induced obese (DIO) mice. C57BL/6J mice were pair-fed a high-fat diet (HFD) or a HFD with empagliflozin for 16weeks. Empagliflozin administration increased UGE in the DIO mice, whereas it suppressed HFD-induced weight gain, insulin resistance, and hepatic steatosis. Moreover, empagliflozin shifted energy metabolism towards fat utilization, elevated AMP-activated protein kinase and acetyl-CoA carbolxylase phosphorylation in skeletal muscle, and increased hepatic and plasma fibroblast growth factor 21 levels. Importantly, empagliflozin increased energy expenditure, heat production, and the expression of uncoupling protein 1 in brown fat and in inguinal and epididymal white adipose tissue (WAT). Furthermore, empagliflozin reduced M1-polarized macrophage accumulation while inducing the anti-inflammatory M2 phenotype of macrophages within WAT and liver, lowering plasma TNFα levels and attenuating obesity-related chronic inflammation. Thus, empagliflozin suppressed weight gain by enhancing fat utilization and browning and attenuated obesity-induced inflammation and insulin resistance by polarizing M2 macrophages in WAT and liver. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  7. SGLT2 Inhibition by Empagliflozin Promotes Fat Utilization and Browning and Attenuates Inflammation and Insulin Resistance by Polarizing M2 Macrophages in Diet-induced Obese Mice

    Directory of Open Access Journals (Sweden)

    Liang Xu

    2017-06-01

    Full Text Available Sodium-glucose cotransporter (SGLT 2 inhibitors increase urinary glucose excretion (UGE, leading to blood glucose reductions and weight loss. However, the impacts of SGLT2 inhibition on energy homeostasis and obesity-induced insulin resistance are less well known. Here, we show that empagliflozin, a SGLT2 inhibitor, enhanced energy expenditure and attenuated inflammation and insulin resistance in high-fat-diet-induced obese (DIO mice. C57BL/6J mice were pair-fed a high-fat diet (HFD or a HFD with empagliflozin for 16 weeks. Empagliflozin administration increased UGE in the DIO mice, whereas it suppressed HFD-induced weight gain, insulin resistance, and hepatic steatosis. Moreover, empagliflozin shifted energy metabolism towards fat utilization, elevated AMP-activated protein kinase and acetyl-CoA carbolxylase phosphorylation in skeletal muscle, and increased hepatic and plasma fibroblast growth factor 21 levels. Importantly, empagliflozin increased energy expenditure, heat production, and the expression of uncoupling protein 1 in brown fat and in inguinal and epididymal white adipose tissue (WAT. Furthermore, empagliflozin reduced M1-polarized macrophage accumulation while inducing the anti-inflammatory M2 phenotype of macrophages within WAT and liver, lowering plasma TNFα levels and attenuating obesity-related chronic inflammation. Thus, empagliflozin suppressed weight gain by enhancing fat utilization and browning and attenuated obesity-induced inflammation and insulin resistance by polarizing M2 macrophages in WAT and liver.

  8. TX-RX isolation method based on polarization diversity, spatial diversity and TX beamforming

    DEFF Research Database (Denmark)

    Foroozanfard, Ehsan; Carvalho, Elisabeth De; Pedersen, Gert F.

    2016-01-01

    In this paper, the feasibility of an antenna isolation technique based on null-steer beamforming, polarization diversity and spatial diversity is investigated. The proposed system consists of six patch antennas which are fed by a feeding network to obtain a null-steer beamformer. To achieve spatial...... diversity, antenna elements are located on two layers, facing in a different direction. Moreover, the antenna elements in two layers use different polarization. The measured results of the antenna system present a high TX-RX isolation in the order of 70 dB which shows the feasibility of such a system...

  9. Experimental measurement of effective refractive index difference for few mode polarization maintaining fibers using S2 method

    Science.gov (United States)

    Guo, Wenting; Li, Yan; Zeng, Xinglin; Mo, Qi; Li, Wei; Liu, Zhijian; Wu, Jian

    2016-10-01

    Polarization maintaining fibers (PMFs) can keep linear polarization state against external perturbations by inducing a high effective refractive index difference (Δneff) along one polarization axis. For few mode polarization maintaining fibers (FM-PMFs), Δneff is applicable between both orthogonal linear polarization modes (e.g. LP01x and LP01y) and orthogonal degenerated modes (e.g. LP11a and LP11b), which can enable advanced functionalities in multiple-input multiple- output-free spatial division multiplexing systems and optical fiber sensing systems. Therefore, the measurement of Δneff for polarization modes and degenerated modes is very important for determining the quality of a FM-PMF. However, measurement of the Δneff for FM-PMFs can be complicated due to the requirement for generating and demultiplexing of the higher order modes (HOMs). In this paper, we propose to measure the Δneff of FM-PMFs using Spatially and Spectrally resolved imaging (S2) method for the first time. The presented method is simply by employing a tunable laser and an IR CCD camera, can avoid any mode converter or mode multiplexer/demultiplexer, featuring a rapid testing speed. A proof-of-concept experiment is carried out to measure FM-PMFs with a length of 1.1m and 5m. The Δneff between the orthogonal polarization modes (i.e. LP11ax-11ay, LP11bx-11by, LP21ax-21ay, and LP21bx-21by) are characterized as 7.05×10-4, 6.91×10-4, 1.02×10-3 and 1.04×10-3 respectively. The Δneff of the orthogonal degenerated modes (i.e. LP11ax-11bx, LP11ay-11by, LP21ax-21bx and LP21ay-21by) are also characterized to be 1.39×10-4, 1.24×10-4, 5.61×10-5 and 6.53×10-5 respectively.

  10. A Monte Carlo method for calculating the energy response of plastic scintillators to polarized photons below 100 keV

    International Nuclear Information System (INIS)

    Mizuno, T.; Kanai, Y.; Kataoka, J.; Kiss, M.; Kurita, K.; Pearce, M.; Tajima, H.; Takahashi, H.; Tanaka, T.; Ueno, M.; Umeki, Y.; Yoshida, H.; Arimoto, M.; Axelsson, M.; Marini Bettolo, C.; Bogaert, G.; Chen, P.; Craig, W.; Fukazawa, Y.; Gunji, S.

    2009-01-01

    The energy response of plastic scintillators (Eljen Technology EJ-204) to polarized soft gamma-ray photons below 100 keV has been studied, primarily for the balloon-borne polarimeter, PoGOLite. The response calculation includes quenching effects due to low-energy recoil electrons and the position dependence of the light collection efficiency in a 20 cm long scintillator rod. The broadening of the pulse-height spectrum, presumably caused by light transportation processes inside the scintillator, as well as the generation and multiplication of photoelectrons in the photomultiplier tube, were studied experimentally and have also been taken into account. A Monte Carlo simulation based on the Geant4 toolkit was used to model photon interactions in the scintillators. When using the polarized Compton/Rayleigh scattering processes previously corrected by the authors, scintillator spectra and angular distributions of scattered polarized photons could clearly be reproduced, in agreement with the results obtained at a synchrotron beam test conducted at the KEK Photon Factory. Our simulation successfully reproduces the modulation factor, defined as the ratio of the amplitude to the mean of the distribution of the azimuthal scattering angles, within ∼5% (relative). Although primarily developed for the PoGOLite mission, the method presented here is also relevant for other missions aiming to measure polarization from astronomical objects using plastic scintillator scatterers.

  11. A Monte Carlo method for calculating the energy response of plastic scintillators to polarized photons below 100 keV

    Science.gov (United States)

    Mizuno, T.; Kanai, Y.; Kataoka, J.; Kiss, M.; Kurita, K.; Pearce, M.; Tajima, H.; Takahashi, H.; Tanaka, T.; Ueno, M.; Umeki, Y.; Yoshida, H.; Arimoto, M.; Axelsson, M.; Marini Bettolo, C.; Bogaert, G.; Chen, P.; Craig, W.; Fukazawa, Y.; Gunji, S.; Kamae, T.; Katsuta, J.; Kawai, N.; Kishimoto, S.; Klamra, W.; Larsson, S.; Madejski, G.; Ng, J. S. T.; Ryde, F.; Rydström, S.; Takahashi, T.; Thurston, T. S.; Varner, G.

    2009-03-01

    The energy response of plastic scintillators (Eljen Technology EJ-204) to polarized soft gamma-ray photons below 100 keV has been studied, primarily for the balloon-borne polarimeter, PoGOLite. The response calculation includes quenching effects due to low-energy recoil electrons and the position dependence of the light collection efficiency in a 20 cm long scintillator rod. The broadening of the pulse-height spectrum, presumably caused by light transportation processes inside the scintillator, as well as the generation and multiplication of photoelectrons in the photomultiplier tube, were studied experimentally and have also been taken into account. A Monte Carlo simulation based on the Geant4 toolkit was used to model photon interactions in the scintillators. When using the polarized Compton/Rayleigh scattering processes previously corrected by the authors, scintillator spectra and angular distributions of scattered polarized photons could clearly be reproduced, in agreement with the results obtained at a synchrotron beam test conducted at the KEK Photon Factory. Our simulation successfully reproduces the modulation factor, defined as the ratio of the amplitude to the mean of the distribution of the azimuthal scattering angles, within ˜5% (relative). Although primarily developed for the PoGOLite mission, the method presented here is also relevant for other missions aiming to measure polarization from astronomical objects using plastic scintillator scatterers.

  12. Method to locate the polar cap boundary in the nightside ionosphere and application to a substorm event

    Directory of Open Access Journals (Sweden)

    A. T. Aikio

    2006-08-01

    Full Text Available In this paper we describe a new method to be used for the polar cap boundary (PCB determination in the nightside ionosphere by using the EISCAT Svalbard radar (ESR field-aligned measurements by the 42-m antenna and southward directed low-elevation measurements by the ESR 32 m antenna or northward directed low-elevation measurements by the EISCAT VHF radar at Tromsø. The method is based on increased electron temperature (Te caused by precipitating particles on closed field lines. Since the Svalbard field-aligned measurement provides the reference polar cap Te height profile, the method can be utilised only when the PCB is located between Svalbard and the mainland. Comparison with the Polar UVI images shows that the radar-based method is generally in agreement with the PAE (poleward auroral emission boundary from Polar UVI. The new technique to map the polar cap boundary was applied to a substorm event on 6 November 2002. Simultaneous measurements by the MIRACLE magnetometers enabled us to put the PCB location in the framework of ionospheric electrojets. During the substorm growth phase, the polar cap expands and the region of the westward electrojet shifts gradually more apart from the PCB. The substorm onset takes place deep within the region of closed magnetic field region, separated by about 6–7° in latitude from the PCB in the ionosphere. We interpret the observations in the framework of the near-Earth neutral line (NENL model of substorms. After the substorm onset, the reconnection at the NENL reaches within 3 min the open-closed field line boundary and then the PCB moves poleward together with the poleward boundary of the substorm current wedge. The poleward expansion occurs in the form of individual bursts, which are separated by 2–10 min, indicating that the reconnection in the magnetotail neutral line is impulsive. The poleward expansions of the PCB are followed by latitude dispersed intensifications in the westward electrojet

  13. Applying the polarity rapid assessment method to characterize nitrosamine precursors and to understand their removal by drinking water treatment processes.

    Science.gov (United States)

    Liao, Xiaobin; Bei, Er; Li, Shixiang; Ouyang, Yueying; Wang, Jun; Chen, Chao; Zhang, Xiaojian; Krasner, Stuart W; Suffet, I H Mel

    2015-12-15

    Some N-nitrosamines (NAs) have been identified as emerging disinfection by-products during water treatment. Thus, it is essential to understand the characteristics of the NA precursors. In this study, the polarity rapid assessment method (PRAM) and the classical resin fractionation method were studied as methods to fractionate the NA precursors during drinking water treatment. The results showed that PRAM has much higher selectivity for NA precursors than the resin approach. The normalized N-nitrosodimethylamine formation potential (NDMA FP) and N-nitrosodiethylamine (NDEA) FP of four resin fractions was at the same level as the average yield of the bulk organic matter whereas that of the cationic fraction by PRAM showed 50 times the average. Thus, the cationic fraction was shown to be the most important NDMA precursor contributor. The PRAM method also helped understand which portions of the NA precursor were removed by different water treatment processes. Activated carbon (AC) adsorption removed over 90% of the non-polar PRAM fraction (that sorbs onto the C18 solid phase extraction [SPE] cartridge) of NDMA and NDEA precursors. Bio-treatment removed 80-90% of the cationic fraction of PRAM (that is retained on the cation exchange SPE cartridge) and 40-60% of the non-cationic fractions. Ozonation removed 50-60% of the non-polar PRAM fraction of NA precursors and transformed part of them into the polar fraction. Coagulation and sedimentation had very limited removal of various PRAM fractions of NA precursors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Geophysical methods in protected environments. Electrical resistivity tomography

    International Nuclear Information System (INIS)

    Rubio Sánchez-Aguililla, F.M.; Ramiro-Camacho, A.; Ibarra Torre, P.

    2017-01-01

    There is a strong interest in protecting the environment with the aim of its long term preservation. Sometimes the heritage value of these natural areas is related to their biodiversity as there are restricted ecosystems that depend directly on them. In other cases there a singular geological record might exist, essential for the understanding of certain processes affecting the planet, such as volcanic events or glacial periods. To achieve the protection and conservation of these areas it is necessary to generate knowledge about the distribution of geological materials and groundwater masses, to study the parameters that dominate the behaviour of these systems and then define those elements that require special protection or attention. In these protected environments, research methods with a minimal environmental impact should be used. Therefore, indirect methods, such as geophysical techniques, are reliable and complementary tools with a minimum environmental impact and are therefore useful for research these unique areas. The IGME has conducted several geophysical surveys in different protected environments in Spain with the aim of achieving a better understanding, and thus facilitate their preservation and exploitation in a sustainable manner. In this paper we present a review of some case studies where geophysical methods have been used. In all the cases electrical resistivity tomography has been the axis of the geophysical research and stands out due to its great effectiveness. The main objective of this communication is to divulgate and increase awareness of the important role that these geophysical methods can play in the sustainable study of these unique places. [es

  15. A new surface resistance measurement method with ultrahigh sensitivity

    International Nuclear Information System (INIS)

    Liang, Changnian.

    1993-01-01

    A superconducting niobium triaxial cavity has been designed and fabricated to study residual surface resistance of planar superconducting materials. The edge of a 25.4 mm or larger diameter sample in the triaxial cavity is located outside the strong field region. Therefore, the edge effects and possible losses between the thin film and the substrate have been minimized, ensuring that induced RF losses are intrinsic to the test material. The fundamental resonant frequency of the cavity is the same as the working frequency of CEBAF cavities. The cavity has a compact size compared to its TE 011 counterpart, which makes it more sensitive to the sample's loss. For even higher sensitivity, a calorimetry method has been used to measure the RF losses on the superconducting sample. At 2 K, a 2 μK temperature change can be resolved by using carbon resistor sensors. The temperature distribution caused by RF heating is measured by 16 carbon composition resistor sensors. A 0.05 μW heating power can be detected as such a resolution, which translates to a surface resistance of 0.02 nΩ at a surface magnetic field of 52 Oe. This is the most sensitive device for surface resistance measurements to date. In addition, losses due to the indium seal, coupling probes, field emission sites other than the sample, and all of the high field resonator surface, are excluded in the measurement. Surface resistance of both niobium and high-Tc superconducting thin films has been measured. A low R s of 35.2 μΩ was measured for a 25.4 mm diameter YBa 2 Cu 3 O 7 thin film at 1.5 GHz and at 2 K. The measurement result is the first result for a large area epitaxially grown thin film sample at such a low RF frequency. The abrupt disappearance of multipacting between two parallel plates has been observed and monitored with the 16 temperature mapping sensors. Field emission or some field dependent anomalous RF losses on the niobium plate have also been observed

  16. QSPR studies for predicting polarity parameter of organic compounds in methanol using support vector machine and enhanced replacement method.

    Science.gov (United States)

    Golmohammadi, H; Dashtbozorgi, Z

    2016-12-01

    In the present work, enhanced replacement method (ERM) and support vector machine (SVM) were used for quantitative structure-property relationship (QSPR) studies of polarity parameter (p) of various organic compounds in methanol in reversed phase liquid chromatography based on molecular descriptors calculated from the optimized structures. Diverse kinds of molecular descriptors were calculated to encode the molecular structures of compounds, such as geometric, thermodynamic, electrostatic and quantum mechanical descriptors. The variable selection method of ERM was employed to select an optimum subset of descriptors. The five descriptors selected using ERM were used as inputs of SVM to predict the polarity parameter of organic compounds in methanol. The coefficient of determination, r 2 , between experimental and predicted polarity parameters for the prediction set by ERM and SVM were 0.952 and 0.982, respectively. Acceptable results specified that the ERM approach is a very effective method for variable selection and the predictive aptitude of the SVM model is superior to those obtained by ERM. The obtained results demonstrate that SVM can be used as a substitute influential modeling tool for QSPR studies.

  17. Standard Test Method for Thermal Oxidative Resistance of Carbon Fibers

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1982-01-01

    1.1 This test method covers the apparatus and procedure for the determination of the weight loss of carbon fibers, exposed to ambient hot air, as a means of characterizing their oxidative resistance. 1.2 The values stated in SI units are to be regarded as standard. The values given in parentheses are mathematical conversions to inch-pound units which are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. For specific hazard information, see Section 8.

  18. Corrosion and wear resistant metallic layers produced by electrochemical methods

    DEFF Research Database (Denmark)

    Christoffersen, Lasse; Maahn, Ernst Emanuel

    1999-01-01

    Corrosion and wear-corrosion properties of novel nickel alloy coatings with promising production characteristics have been compared with conventional bulk materials and hard platings. Corrosion properties in neutral and acidic environments have been investigated with electrochemical methods....... Determination of polarisation resistance during 100 hours followed by stepwise anodic polarisation seems to be a promising technique to obtain steady state data on slowly corroding coatings with transient kinetics. A slurry test enables determination of simultaneous corrosion and abrasive wear. Comparison...... of AISI 316, hard chromium and hardened Ni-P shows that there is no universal correlation between surface hardness and wear-corrosion loss. The possible relation between questionable passivity of Ni-P coatings and their high wear-corrosion loss rate compared to hard chromium is discussed....

  19. Detection of Ground Clutter from Weather Radar Using a Dual-Polarization and Dual-Scan Method

    Directory of Open Access Journals (Sweden)

    Mohammad-Hossein Golbon-Haghighi

    2016-06-01

    Full Text Available A novel dual-polarization and dual-scan (DPDS classification algorithm is developed for clutter detection in weather radar observations. Two consecutive scans of dual-polarization radar echoes are jointly processed to estimate auto- and cross-correlation functions. Discriminants are then defined and estimated in order to separate clutter from weather based on their physical and statistical properties. An optimal Bayesian classifier is used to make a decision on clutter presence from the estimated discriminant functions. The DPDS algorithm is applied to the data collected with the KOUN polarimetric radar and compared with the existing detection methods. It is shown that the DPDS algorithm yields a higher probability of detection and lower false alarm rate in clutter detection.

  20. Dynamic nuclear polarization of irradiated target materials

    International Nuclear Information System (INIS)

    Seely, M.L.

    1982-01-01

    Polarized nucleon targets used in high energy physics experiments usually employ the method of dynamic nuclear polarization (DNP) to polarize the protons or deuterons in an alcohol. DNP requires the presence of paramagnetic centers, which are customarily provided by a chemical dopant. These chemically doped targets have a relatively low polarizable nucleon content and suffer from loss of polarization when subjected to high doses of ionizing radiation. If the paramagnetic centers formed when the target is irradiated can be used in the DNP process, it becomes possible to produce targets using materials which have a relatively high polarizable nucleon content, but which are not easily doped by chemical means. Furthermore, the polarization of such targets may be much more radiation resistant. Dynamic nuclear polarization in ammonia, deuterated ammonia, ammonium hydroxide, methylamine, borane ammonia, butonal, ethane and lithium borohydride has been studied. These studies were conducted at the Stanford Linear Accelerator Center using the Yale-SLAC polarized target system. Results indicate that the use of ammonia and deuterated ammonia as polarized target materials would make significant increases in polarized target performance possible

  1. Ion implantation method for preparing polymers having oxygen erosion resistant surfaces

    Science.gov (United States)

    Lee, Eal H.; Mansur, Louis K.; Heatherly, Jr., Lee

    1995-01-01

    Hard surfaced polymers and the method for making them are generally described. Polymers are subjected to simultaneous multiple ion beam bombardment, that results in a hardening of the surface, improved wear resistance, and improved oxygen erosion resistance.

  2. Spin-polarized relativistic linear-muffin-tin-orbital method: Volume-dependent electronic structure and magnetic moment of plutonium

    International Nuclear Information System (INIS)

    Solovyev, I.V.; Liechtenstein, A.I.; Gubanov, V.A.; Antropov, V.P.; Andersen, O.K.

    1991-01-01

    The linear-muffin-tin-orbital method is generalized to the case of relativistic and spin-polarized self-consistent band calculations. Our formalism is analogous to the standard orthogonal--linear-muffin-tin-orbital formalism, except that the potential functions and the potential parameters are now matrices. The method is used to perform density-functional calculations for fcc plutonium with different atomic volumes. The formation of spin and orbital magnetic moments, as well as the changes in the energy bands for volume changes corresponding to the α-δ transition, are investigated. The calculated magnetic moments agree quite well with the experimental ones

  3. A method for increase abrasive wear resistance parts by obtaining on methods casting on gasifying models

    Science.gov (United States)

    Sedukhin, V. V.; Anikeev, A. N.; Chumanov, I. V.

    2017-11-01

    Method optimizes hardening working layer parts’, working in high-abrasive conditions looks in this work: bland refractory particles WC and TiC in respect of 70/30 wt. % prepared by beforehand is applied on polystyrene model in casting’ mould. After metal poured in mould, withstand for crystallization, and then a study is carried out. Study macro- and microstructure received samples allows to say that thickness and structure received hardened layer depends on duration interactions blend harder carbides and liquid metal. Different character interactions various dispersed particles and matrix metal observed under the same conditions. Tests abrasive wear resistance received materials of method calculating residual masses was conducted in laboratory’ conditions. Results research wear resistance showed about that method obtaining harder coating of blend carbide tungsten and carbide titanium by means of drawing on surface foam polystyrene model before moulding, allows receive details with surface has wear resistance in 2.5 times higher, than details of analogy steel uncoated. Wherein energy costs necessary for transformation units mass’ substances in powder at obtained harder layer in 2.06 times higher, than materials uncoated.

  4. Polarization Optics

    OpenAIRE

    Fressengeas, Nicolas

    2010-01-01

    The physics of polarization optics *Polarized light propagation *Partially polarized light; DEA; After a brief introduction to polarization optics, this lecture reviews the basic formalisms for dealing with it: Jones Calculus for totally polarized light and Stokes parameters associated to Mueller Calculus for partially polarized light.

  5. New method for preparing a liquid crystal polymer that exhibits linearly polarized white fluorescence

    International Nuclear Information System (INIS)

    Zheng Shijun; Kun, Wang; Kobayashi, Takaomi

    2011-01-01

    With the aim of developing a single-chain white-light-emitting polymer, liquid crystal (LC) polymers with a shish-kebab-type moiety on their cross-conjugated (p-phenylene)s-poly(p-phenylenevinylene)s main chain were synthesized by Gilch polymerization. They were characterized by nuclear magnetic resonance (NMR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC), X-ray diffraction (XRD), and polarizing optical microscopy (POM). 1 H-NMR indicated that the polymers had a shish-kebab structure, which strongly suppressed the formation of structural defects in the polymers. DSC revealed that the polymers had thermotropic LC properties, indicating that the LC polymers were enantiotropic. XRD showed that the polymers had a mesophase, which implies that they were in a smectic LC phase. A polymer with 'kebabs' of 2,5-bis(4'-alkoxyphenyl)benzene was combined with an aligned polyimide film with orientated microgrooves. The polymer main chain was aligned due to the orientation of the 'kebabs' of the uniform cross-conjugated structure. It lay between the kebabs and the 'shish' of the polymer main chains. The aligned polymer main chain emitted yellow light while and the oriented LC side chains emitted blue light emission. These two emissions resulted in linearly polarized white fluorescence.

  6. Method for preventing and/or treating insulin resistance

    NARCIS (Netherlands)

    Nieuwdorp, M.; Vos, de W.M.

    2013-01-01

    The present invention describes use of Eubacterium hallii et rel. and/or Alcaligenes faecalis et rel., as well as pharmaceutical, food, or feed compositions comprising these bacteria, as a medicament, in particular for preventing and/or treating insulin resistance and/or insulin resistance-related

  7. Molecular detection methods of resistance to antituberculosis drugs in Mycobacterium tuberculosis.

    Science.gov (United States)

    Brossier, F; Sougakoff, W

    2017-09-01

    Molecular methods predict drug resistance several weeks before phenotypic methods and enable rapid implementation of appropriate therapeutic treatment. We aimed to detail the most representative molecular tools used in routine practice for the rapid detection of resistance to antituberculosis drugs among Mycobacterium tuberculosis strains. The molecular diagnosis of resistance to antituberculosis drugs in clinical samples or from in vitro cultures is based on the detection of the most common mutations in the genes involved in the development of resistance in M. tuberculosis strains (encoding either protein targets of antibiotics, or antibiotic activating enzymes) by commercial molecular kits or by sequencing. Three hypotheses could explain the discrepancies between the genotypic results and the phenotypic drug susceptibility testing results: a low percentage of resistant mutants precluding the detection by genotypic methods on the primary culture; a low level of resistance not detected by phenotypic testing; and other resistance mechanisms not yet characterized. Molecular methods have varying sensitivity with regards to detecting antituberculosis drug resistance; that is why phenotypic susceptibility testing methods are mandatory for detecting antituberculosis drug-resistant isolates that have not been detected by molecular methods. The questionable ability of existing phenotypic and genotypic drug susceptibility testing to properly classify strains as susceptible or resistant, and at what level of resistance, was raised for several antituberculosis agents. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  8. Methicillin Resistant Staphylococcus aureus: Inconsistencies in Vancomycin Susceptibility Testing Methods, Limitations and Advantages of each Method.

    Science.gov (United States)

    Himani; Agrawal, Charu; Madan, Molly; Pandey, Anita; Thakuria, Bhaskar

    2015-10-01

    Vancomycin may be ineffective against an increasing proportion of methicillin resistant Staphylococcus aureus (MRSA) with minimum inhibitory concentrations (MICs) well within the susceptible range. On the other hand it is common knowledge that determination of vancomycin MICs is method dependent. Therefore, given the apparent variability in vancomycin MIC results obtained with the different methods, the use of the vancomycin MIC to predict the outcome of serious S. aureus infections needs to take into account the method used and the results of studies using that particular method. Comparative study was carried out to evaluate the MICs obtained by BMD method, E-test, and Vitek 2 method and to detect inconsistencies in these vancomycin for 66 MRSA isolates obtained from various samples of patients attending the OPDs & IPDs within a period of one year. A comparative study was carried out to evaluate the MICs obtained by BMD method, E-test, and Vitek 2 method to detect vancomycin susceptibility in 66 clinical isolates of MRSA obtained from various samples of patients attending the OPDs & IPDs within a period of one year. The study was conducted in Department of Microbiology, Subharti Medical College, Meerut from January to December 2012. On determination of MICs for vancomycin for the MRSA isolates, all were identified as VSSA by BMD, E-Test & Vitek 2 methods. However, the vancomycin MIC values obtained by E-test correlated better with BMD method (correlation factor= 0.6727) than Vitek 2 (correlation factor=0.5316), indicating E-Test to be a better method for determination of vancomycin MICs as compared to Vitek 2. MRSA isolates with higher vancomycin MICs, even within the susceptibility range, are being observed more frequently which result in treatment failures with vancomycin. Because of the discrepancy that exists in vancomycin MIC results from different methods, the prediction of outcome of serious S.aureus infections should take into account the method used

  9. Robust, cross-laboratory validated PCR methods to track antibiotic resistance in agricultural settings

    Science.gov (United States)

    In order to make informed decisions on how best to manage agricultural antibiotics, we need to be able to track and quantify the antibiotic resistant bacteria, and antibiotic resistance genes. PCR-based methods are widely used to both detect and quantify antibiotic resistance genes, however there ar...

  10. [A non-invasive glucose measurement method based on orthogonal twin-polarized light and its pilot experimental investigation].

    Science.gov (United States)

    Wang, Hong; Wu, Baoming; Liu, Ding

    2010-04-01

    In order to overcome the existing shortcomings of the non-invasive blood glucose polarized light measurement methods of optical heterodyne detection and direct detection, we present in this paper a new orthogonal twin-polarized light (OTPL) non-invasive blood glucose measurement method, which converts the micro-angle rotated by an optical active substance such as glucose to the energy difference of OTPL, amplifies the signals by the high-sensitivity lock-in amplifier made of relevant principle, controls Faraday coil current to compensate the changes in deflection angle caused by blood glucose, and makes use of the linear relationship between blood glucose concentration and Faraday coil current to calculate blood glucose concentration. In our comparative experiment using the data measured by LX-20 automatic biochemical analyzer as a standard, a 0.9777 correlation coefficient is obtained in glucose concentration experiment, and a 0.952 in serum experiment. The result shows that this method has higher detection sensitivity and accuracy and lays a foundation for the development of practical new type of non-invasive blood glucose tester for diabetic patients.

  11. A new detection method for a newly revealed mechanism of pyrethroid resistance development in Varroa destructor.

    Science.gov (United States)

    Strachecka, Aneta; Borsuk, Grzegorz; Olszewski, Krzysztof; Paleolog, Jerzy

    2015-11-01

    The Varroa destructor mite has recently displayed an ever increasing resistance to new drugs, contributing to CCD proliferation. This work was aimed at determining new viable methods for identifying the pyrethroid resistance of V. destructor and DNA methylation in resistant and sensitive mites. DNA was extracted from Varroa mites. Nucleotide changes in the DNA of pyrethroid-resistant, pyrethroid-sensitive, and control mites were identified with polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) in the case of five mitochondrial gene fragments. More bands were observed in the drug-resistant mites than in the other two groups. Sequencing confirmed these observations. Decreased global DNA methylation levels were observed in the pyrethroid-resistant mites. There exists a previously undescribed mechanism of pyrethroid resistance development in Varroa mites. The PCR-SSCP methods can be considered and further developed as useful tools for detecting V. destructor resistance.

  12. Myeloid Sirtuin 6 Deficiency Causes Insulin Resistance in High-Fat Diet-Fed Mice by Eliciting Macrophage Polarization Toward an M1 Phenotype.

    Science.gov (United States)

    Lee, Youngyi; Ka, Sun-O; Cha, Hye-Na; Chae, Yu-Na; Kim, Mi-Kyung; Park, So-Young; Bae, Eun Ju; Park, Byung-Hyun

    2017-10-01

    Obesity-related insulin resistance is closely associated with macrophage accumulation and subsequent cytokine release in local tissues. Sirtuin 6 (Sirt6) is known to exert an anti-inflammatory function, but its role in macrophages in the context of obesity has not been investigated. We generated myeloid-specific Sirt6 knockout (mS6KO) mice and investigated the metabolic characteristics after high-fat diet (HFD) feeding for 16 weeks. Compared with their wild-type littermates, HFD-fed mS6KO mice exhibited greater increases in body weight, fasting blood glucose and insulin levels, hepatic steatosis, glucose intolerance, and insulin resistance. Gene expression, histology, and flow cytometric analyses demonstrated that liver and adipose tissue inflammation were elevated in HFD-fed mS6KO mice relative to wild type, with a greater accumulation of F4/80 + CD11b + CD11c + adipose tissue macrophages. Myeloid Sirt6 deletion facilitated proinflammatory M1 polarization of bone marrow macrophages and augmented the migration potential of macrophages toward adipose-derived chemoattractants. Mechanistically, Sirt6 deletion in macrophages promoted the activation of nuclear factor-κB (NF-κB) and endogenous production of interleukin-6, which led to STAT3 activation and the positive feedback circuits for NF-κB stimulation; this cross talk expedited an M1 polarization. We conclude that Sirt6 in macrophages is required for the prevention of obesity-associated tissue inflammation and insulin resistance. © 2017 by the American Diabetes Association.

  13. Entropy resistance minimization: An alternative method for heat exchanger analyses

    International Nuclear Information System (INIS)

    Cheng, XueTao

    2013-01-01

    In this paper, the concept of entropy resistance is proposed based on the entropy generation analyses of heat transfer processes. It is shown that smaller entropy resistance leads to larger heat transfer rate with fixed thermodynamic force difference and smaller thermodynamic force difference with fixed heat transfer rate, respectively. For the discussed two-stream heat exchangers in which the heat transfer rates are not given and the three-stream heat exchanger with prescribed heat capacity flow rates and inlet temperatures of the streams, smaller entropy resistance leads to larger heat transfer rate. For the two-stream heat exchangers with fixed heat transfer rate, smaller entropy resistance leads to larger effectiveness. Furthermore, it is shown that smaller values of the concepts of entropy generation numbers and modified entropy generation number do not always correspond to better performance of the discussed heat exchangers. - Highlights: • The concept of entropy resistance is defined for heat exchangers. • The concepts based on entropy generation are used to analyze heat exchangers. • Smaller entropy resistance leads to better performance of heat exchangers. • The applicability of entropy generation minimization is conditional

  14. Polarity-Free Resistive Switching Characteristics of CuxO Films for Non-volatile Memory Applications

    International Nuclear Information System (INIS)

    Hang-Bing, Lv; Peng, Zhou; Xiu-Feng, Fu; Ming, Yin; Ya-Li, Song; Li, Tang; Ting-Ao, Tang; Yin-Yin, Lin

    2008-01-01

    Resistive switching characteristics of Cu x O films grown by plasma oxidation process at room temperature are investigated. Both bipolar and unipolar stable resistive switching behaviours are observed and confirmed by repeated current–voltage measurements. It is found that the RESET current is dependent on SET compliance current. The mechanism behind this new phenomenon can be understood in terms of conductive filaments formation/rupture with the contribution of Joule heating

  15. Arctic (and Antarctic) Observing Experiment - an Assessment of Methods to Measure Temperature over Polar Environments

    Science.gov (United States)

    Rigor, I. G.; Clemente-Colon, P.; Nghiem, S. V.; Hall, D. K.; Woods, J. E.; Henderson, G. R.; Zook, J.; Marshall, C.; Gallage, C.

    2014-12-01

    The Arctic environment has been undergoing profound changes; the most visible is the dramatic decrease in Arctic sea ice extent (SIE). These changes pose a challenge to our ability to measure surface temperature across the Polar Regions. Traditionally, the International Arctic Buoy Programme (IABP) and International Programme for Antarctic Buoys (IPAB) have measured surface air temperature (SAT) at 2-m height, which minimizes the ambiguity of measurements near of the surface. Specifically, is the temperature sensor measuring open water, snow, sea ice, or air? But now, with the dramatic decrease in Arctic SIE, increase in open water during summer, and the frailty of the younger sea ice pack, the IABP has had to deploy and develop new instruments to measure temperature. These instruments include Surface Velocity Program (SVP) buoys, which are commonly deployed on the world's ice-free oceans and typically measure sea surface temperature (SST), and the new robust Airborne eXpendable Ice Beacons (AXIB), which measure both SST and SAT. "Best Practice" requires that these instruments are inter-compared, and early results showing differences in collocated temperature measurements of over 2°C prompted the establishment of the IABP Arctic Observing Experiment (AOX) buoy test site at the US Department of Energy (DOE) Atmospheric Radiation Measurement (ARM) site in Barrow, Alaska. Preliminary results showed that the color of the hull of SVP buoys introduces a bias due to solar heating of the buoy. Since then, we have recommended that buoys should be painted white to reduce biases in temperature measurements due to different colors of the buoys deployed in different regions of the Arctic or the Antarctic. Measurements of SAT are more robust, but some of the temperature shields are susceptible to frosting. During our presentation we will provide an intercomparison of the temperature measurements at the AOX test site (i.e. high quality DOE/ARM observations compared with

  16. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data

    DEFF Research Database (Denmark)

    Clausen, Philip T. L. C.; Zankari, Ea; Aarestrup, Frank Møller

    2016-01-01

    with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance...... to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared...... was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads...

  17. Fast and Simple Method for Evaluation of Polarization Correction to Propagation Constant of Arbitrary Order Guided Modes in Optical Fibers with Arbitrary Refractive Index Profile

    Directory of Open Access Journals (Sweden)

    Anton Bourdine

    2015-01-01

    Full Text Available This work presents fast and simple method for evaluation of polarization correction to scalar propagation constant of arbitrary order guided modes propagating over weakly guiding optical fibers. Proposed solution is based on earlier on developed modified Gaussian approximation extended for analysis of weakly guiding optical fibers with arbitrary refractive index profile in the core region bounded by single solid outer cladding. Some results are presented that illustrate the decreasing of computational error during the estimation of propagation constant when polarization corrections are taken into account. Analytical expressions for the first and second derivatives of polarization correction are derived and presented.

  18. Optimal design and fabrication method for antireflection coatings for P-polarized 193 nm laser beam at large angles of incidence (68°-74°).

    Science.gov (United States)

    Jin, Jingcheng; Jin, Chunshui; Li, Chun; Deng, Wenyuan; Chang, Yanhe

    2013-09-01

    Most of the optical axes in modern systems are bent for optomechanical considerations. Antireflection (AR) coatings for polarized light at oblique incidence are widely used in optical surfaces like prisms or multiform lenses to suppress undesirable reflections. The optimal design and fabrication method for AR coatings with large-angle range (68°-74°) for a P-polarized 193 nm laser beam is discussed in detail. Experimental results showed that after coating, the reflection loss of a P-polarized laser beam at large angles of incidence on the optical surfaces is reduced dramatically, which could greatly improve the output efficiency of the optical components in the deep ultraviolet vacuum range.

  19. A Novel Ship Detection Method Based on Gradient and Integral Feature for Single-Polarization Synthetic Aperture Radar Imagery

    Directory of Open Access Journals (Sweden)

    Hao Shi

    2018-02-01

    Full Text Available With the rapid development of remote sensing technologies, SAR satellites like China’s Gaofen-3 satellite have more imaging modes and higher resolution. With the availability of high-resolution SAR images, automatic ship target detection has become an important topic in maritime research. In this paper, a novel ship detection method based on gradient and integral features is proposed. This method is mainly composed of three steps. First, in the preprocessing step, a filter is employed to smooth the clutters and the smoothing effect can be adaptive adjusted according to the statistics information of the sub-window. Thus, it can retain details while achieving noise suppression. Second, in the candidate area extraction, a sea-land segmentation method based on gradient enhancement is presented. The integral image method is employed to accelerate computation. Finally, in the ship target identification step, a feature extraction strategy based on Haar-like gradient information and a Radon transform is proposed. This strategy decreases the number of templates found in traditional Haar-like methods. Experiments were performed using Gaofen-3 single-polarization SAR images, and the results showed that the proposed method has high detection accuracy and rapid computational efficiency. In addition, this method has the potential for on-board processing.

  20. An improved method for the real time calculation of soil resistance during driving

    NARCIS (Netherlands)

    Foeken, R.J. van; Daniels, B.J.; Middendorp, P.

    1996-01-01

    The limited time between two successive blows during pile driving has resulted in the development of simple methods to calculate the soil resistance real time. These methods are called direct methods like the Case (Goble) method and Impedance method. Other more time consuming methods are called

  1. An innovative method for ideal and resistive MHD stability analysis of tokamaks

    International Nuclear Information System (INIS)

    Tokuda, S.

    2001-01-01

    An advanced asymptotic matching method of ideal and resistive MHD stability analysis in tokamaks is reported. A solution method for the two dimensional Newcomb equation, a dispersion relation for an unstable ideal MHD mode in tokamaks and a new scheme for solving resistive MHD inner layer equations as an initial value problem are reported. (author)

  2. An innovative method for ideal and resistive MHD stability analysis of tokamaks

    International Nuclear Information System (INIS)

    Tokuda, S.

    2001-01-01

    An advanced asymptotic matching method of ideal and resistive MHD stability analysis in tokamak is reported. The report explains a solution method of two-dimensional Newcomb equation, dispersion relation for an unstable ideal MHD mode in tokamak, and a new scheme for solving resistive MHD inner layer equations as an initial-value problem. (author)

  3. Adaptive Motor Resistance Video Game Exercise Apparatus and Method of Use Thereof

    Science.gov (United States)

    Reich, Alton (Inventor); Shaw, James (Inventor)

    2015-01-01

    The invention comprises a method and/or an apparatus using computer configured exercise equipment and an electric motor provided physical resistance in conjunction with a game system, such as a video game system, where the exercise system provides real physical resistance to a user interface. Results of user interaction with the user interface are integrated into a video game, such as running on a game console. The resistance system comprises: a subject interface, software control, a controller, an electric servo assist/resist motor, an actuator, and/or a subject sensor. The system provides actual physical interaction with a resistance device as input to the game console and game run thereon.

  4. Several methods to detect the inheritance and resistance to the ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... toxic to lepidopteran insects including diamondback moth and P. rapae (Mao et al., 1996; Cao et al., 2001). The Bt gene has already been applied to confer significant insect resistance in transgenic cotton and tobacco. Brassica vegetables are known as recalcitrant plants for genetic transformation, though ...

  5. Application Of Electrical Resistivity Method In Coastal Hydro ...

    African Journals Online (AJOL)

    ... borehole data to provide information on the freshwater-saltwater interfaces, and the depths to freshwater bearing units in the coastal areas. The results indicated that re-sistivity contrasts can be adopted for economic evaluation of groundwater development in coastal areas. Journal of Applied Science and Technology Vol.

  6. Several methods to detect the inheritance and resistance to the ...

    African Journals Online (AJOL)

    Majority of the transgenic plants had only a single copy of the inserted CryIA(c) gene. Leaf section bioassays showed that resistance against larvae of diamondback moth in CryIA(c) transgenic cabbage was significantly enhanced. The inheritance patterns of the transgene in T1 offspring of transgenic cabbage were ...

  7. Calibration of resistance factors for drilled shafts for the new FHWA design method.

    Science.gov (United States)

    2013-01-01

    The Load and Resistance Factor Design (LRFD) calibration of deep foundation in Louisiana was first completed for driven piles (LTRC Final Report 449) in May 2009 and then for drilled shafts using 1999 FHWA design method (ONeill and Reese method) (...

  8. Use of cyclic current reversal polarization voltammetry for investigating the relationship between corrosion resistance and heat-treatment induced variations in microstructures of 400 C martensitic stainless steels

    Science.gov (United States)

    Ambrose, John R.

    1992-01-01

    Software for running a cyclic current reversal polarization voltammagram has been developed for use with a EG&G Princeton Applied Research Model 273 potentiostat/galvanostat system. The program, which controls the magnitude, direction and duration of an impressed galvanostatic current, will produce data in ASCII spreadsheets (Lotus, Quattro) for graphical representation of CCRPV voltammograms. The program was used to determine differences in corrosion resistance of 440 C martenstic stainless steel produced as a result of changes in microstructure effected by tempering. It was determined that tempering at all temperatures above 400 F resulted in increased polarizability of the material, with the increased likelihood that pitting would be initiated upon exposure to marine environments. These results will be used in development of remedial procedures for lowering the susceptibility of these alloys toward the stress corrosion cracking experienced in bearings used in high pressure oxygen turbopumps used in the main engines of space shuttle orbiters.

  9. Variational Effective Index Method for 3D Vectorial Scattering Problems in Photonics: TE Polarization

    NARCIS (Netherlands)

    Ivanova, Alyona; Stoffer, Remco; Kauppinen, L.J.; Hammer, Manfred

    2009-01-01

    In order to reduce the computational effort we develop a method for 3D-to-2D dimensionality reduction of scattering problems in photonics. Contrary to the `standard' Effective Index Method the effective parameters of the reduced problem are always rigorously defined using the variational technique,

  10. A method for direct contact resistance evaluation in low voltage coplanar organic field-effect transistors

    Science.gov (United States)

    Lai, S.; Cosseddu, P.; Bonfiglio, A.

    2017-04-01

    In this paper, a method for the extrapolation of contact resistance in organic field-effect transistors (OFETs) from a single transfer characteristic curve in the linear regime is proposed. The method, namely DIrect Contact Resistance Extrapolation (DICRE), is based on the idea of making the current dependent only on contact resistance by setting the device in large over-threshold conditions. Constant contact resistance with respect to gate-to-source voltage is considered as an acceptable approximation, as confirmed by other examples in the literature. The effectiveness of the method is demonstrated by extrapolating the contact resistance of two different OFET structures (self-aligned and not self-aligned) and comparing the results with standard reference techniques, namely the Modified Transmission Line Method (M-TLM) and the Y function method. The results demonstrate that the DICRE method can be applied to low voltage devices without any damage to the gate insulator, even if the applied gate-to-source voltage drop is well beyond the values normally employed for transistor operation. The proposed method allows extrapolating a value of contact resistance comparable with the ones derived by TLM, with restrained variability. Moreover, the capability of properly recognizing the differences in contact resistance values between OFET structures with different features in terms of source/drain-gate overlap is reported. Finally, the possibility of correctly deriving the contact resistance dependence on drain-to-source voltage using DICRE is discussed.

  11. Galvanokinetic polarization method applied to the pitting corrosion study of stainless steels

    International Nuclear Information System (INIS)

    Le Xuan, Q.; Vu Quang, K.

    1992-01-01

    Galvanokinetic (GK) polarisation method was used to study the pitting corrosion of 316L stainless steel in chloride solution. Current scan rate effect on the pitting characteristic parameters was pointed out. Specific relations between current scan rate and some pitting characteristic parameters, such as critical current density I c , stable current density I s , critical time t c , stable time t s , were established. Some advantages of the GK polarisation method were discussed

  12. An Objective Prototype-Based Method for Dual-Polarization Radar Clutter Identification

    OpenAIRE

    Guang Wen; Alain Protat; Hui Xiao

    2017-01-01

    A prototype-based method is developed to discriminate different types of clutter (ground clutter, sea clutter, and insects) from weather echoes using polarimetric measurements and their textures. This method employs a clustering algorithm to generate data groups from the training dataset, each of which is modeled as a weighted Gaussian distribution called a “prototype.” Two classification algorithms are proposed based on the prototypes, namely maximum prototype likelihood classifier (MPLC) an...

  13. Characterization of textural and hydric heterogeneities in argillaceous geo-materials using induced polarization method: application to the excavation damaged zone (EDZ) of the Tournemire experimental station; Caracterisation des heterogeneites texturales et hydriques des geomateriaux argileux par la methode de Polarisation Provoquee: Application a l'EDZ de la station experimentale de Tournemire

    Energy Technology Data Exchange (ETDEWEB)

    Okay, Gonca

    2011-03-25

    This Ph-D thesis investigates the potential of clay rocks for deep geological disposal of radioactive waste. Underground excavations are responsible in their vicinity a region, where the clay-rock is damaged or disturbed. This region must to be characterized to ensure the safety of repositories. The extension of the excavation damaged zone (EDZ) and its evolution over time have been investigated thought electrical resistivity and induced polarization methods from three galleries belonging to the French Institute of Radioprotection and Nuclear Safety (IRSN)'s experimental underground research laboratory of Tournemire (Aveyron, France). Time domain induced polarisation indicates the presence of mineralization (e.g., especially pyrite) located in the structural discontinuities such as tectonic fractures (mm-cm), tectonic fault (m) and calcareous nodules (cm). Combined electrical resistivity and Induced Polarization methods show the possibility to delineate textural changes associated to desaturation of the clay-rock induced by the ventilation of galleries. The impact of the desaturation is particularly observed on the gallery's walls. In addition, Spectral Induced Polarization (SIP) tomography results can be used to discriminate the responses of the de-saturated zones from the fractured zones. We have performed laboratory experiments (in the range 1.4 mHz - 12 kHz) using saturated unconsolidated sand-clay mixtures. The results illustrate that the amplitude of polarization is strongly affected by the surface properties of these mixtures (e.g., cation exchange capacity, specific surface area) and by the volumetric clay content. However, the amplitude of polarization is independent of the concentration of electrolyte. The SIP response is also strongly sensitive to the mineralogy of the clays. (author)

  14. Facile fabrication of superhydrophobic surface with excellent mechanical abrasion and corrosion resistance on copper substrate by a novel method.

    Science.gov (United States)

    Su, Fenghua; Yao, Kai

    2014-06-11

    A novel method for controllable fabrication of a superhydrophobic surface with a water contact angle of 162 ± 1° and a sliding angle of 3 ± 0.5° on copper substrate is reported in this Research Article. The facile and low-cost fabrication process is composed from the electrodeposition in traditional Watts bath and the heat-treatment in the presence of (heptadecafluoro-1,1,2,2-tetradecyl) triethoxysilane (AC-FAS). The superhydrophobicity of the fabricated surface results from its pine-cone-like hierarchical micro-nanostructure and the assembly of low-surface-energy fluorinated components on it. The superhydrophobic surface exhibits high microhardness and excellent mechanical abrasion resistance because it maintains superhydrophobicity after mechanical abrasion against 800 grit SiC sandpaper for 1.0 m at the applied pressure of 4.80 kPa. Moreover, the superhydrophobic surface has good chemical stability in both acidic and alkaline environments. The potentiodynamic polarization and electrochemical impedance spectroscopy test shows that the as-prepared superhydrophobic surface has excellent corrosion resistance that can provide effective protection for the bare Cu substrate. In addition, the as-prepared superhydrophobic surface has self-cleaning ability. It is believed that the facile and low-cost method offer an effective strategy and promising industrial applications for fabricating superhydrophobic surfaces on various metallic materials.

  15. Burrowing as a novel voluntary strength training method for mice: A comparison of various voluntary strength or resistance exercise methods.

    Science.gov (United States)

    Roemers, P; Mazzola, P N; De Deyn, P P; Bossers, W J; van Heuvelen, M J G; van der Zee, E A

    2018-04-15

    Voluntary strength training methods for rodents are necessary to investigate the effects of strength training on cognition and the brain. However, few voluntary methods are available. The current study tested functional and muscular effects of two novel voluntary strength training methods, burrowing (digging a substrate out of a tube) and unloaded tower climbing, in male C57Bl6 mice. To compare these two novel methods with existing exercise methods, resistance running and (non-resistance) running were included. Motor coordination, grip strength and muscle fatigue were measured at baseline, halfway through and near the end of a fourteen week exercise intervention. Endurance was measured by an incremental treadmill test after twelve weeks. Both burrowing and resistance running improved forelimb grip strength as compared to controls. Running and resistance running increased endurance in the treadmill test and improved motor skills as measured by the balance beam test. Post-mortem tissue analyses revealed that running and resistance running induced Soleus muscle hypertrophy and reduced epididymal fat mass. Tower climbing elicited no functional or muscular changes. As a voluntary strength exercise method, burrowing avoids the confounding effects of stress and positive reinforcers elicited in forced strength exercise methods. Compared to voluntary resistance running, burrowing likely reduces the contribution of aerobic exercise components. Burrowing qualifies as a suitable voluntary strength training method in mice. Furthermore, resistance running shares features of strength training and endurance (aerobic) exercise and should be considered a multi-modal aerobic-strength exercise method in mice. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Estimation of the flow resistances exerted in coronary arteries using a vessel length-based method.

    Science.gov (United States)

    Lee, Kyung Eun; Kwon, Soon-Sung; Ji, Yoon Cheol; Shin, Eun-Seok; Choi, Jin-Ho; Kim, Sung Joon; Shim, Eun Bo

    2016-08-01

    Flow resistances exerted in the coronary arteries are the key parameters for the image-based computer simulation of coronary hemodynamics. The resistances depend on the anatomical characteristics of the coronary system. A simple and reliable estimation of the resistances is a compulsory procedure to compute the fractional flow reserve (FFR) of stenosed coronary arteries, an important clinical index of coronary artery disease. The cardiac muscle volume reconstructed from computed tomography (CT) images has been used to assess the resistance of the feeding coronary artery (muscle volume-based method). In this study, we estimate the flow resistances exerted in coronary arteries by using a novel method. Based on a physiological observation that longer coronary arteries have more daughter branches feeding a larger mass of cardiac muscle, the method measures the vessel lengths from coronary angiogram or CT images (vessel length-based method) and predicts the coronary flow resistances. The underlying equations are derived from the physiological relation among flow rate, resistance, and vessel length. To validate the present estimation method, we calculate the coronary flow division over coronary major arteries for 50 patients using the vessel length-based method as well as the muscle volume-based one. These results are compared with the direct measurements in a clinical study. Further proving the usefulness of the present method, we compute the coronary FFR from the images of optical coherence tomography.

  17. Verification of the Simultaneous Local Extraction Method of Base and Thermal Resistance of Bipolar Transistors

    OpenAIRE

    Robert Setekera; Luuk Tiemeijer; Ramses van der Toorn

    2014-01-01

    In this paper an extensive verification of the extraction method (published earlier) that consistently accounts for self-heating and Early effect to accurately extract both base and thermal resistance of bipolar junction transistors is presented. The method verification is demonstrated on advanced RF SiGe HBTs were the extracted results for the thermal resistance are compared with those from another published method that ignores the effect of Early effect on internal base...

  18. Development and validation of polar RP-HPLC method for screening for ectoine high-yield strains in marine bacteria with green chemistry.

    Science.gov (United States)

    Chen, Jun; Chen, Jianwei; Wang, Sijia; Zhou, Guangmin; Chen, Danqing; Zhang, Huawei; Wang, Hong

    2018-04-02

    A novel, green, rapid, and precise polar RP-HPLC method has been successfully developed and screened for ectoine high-yield strain in marine bacteria. Ectoine is a polar and extremely useful solute which allows microorganisms to survive in extreme environmental salinity. This paper describes a polar-HPLC method employed polar RP-C18 (5 μm, 250 × 4.6 mm) using pure water as the mobile phase and a column temperature of 30 °C, coupled with a flow rate at 1.0 mL/min and detected under a UV detector at wavelength of 210 nm. Our method validation demonstrates excellent linearity (R 2  = 0.9993), accuracy (100.55%), and a limit of detection LOQ and LOD of 0.372 and 0.123 μgmL -1 , respectively. These results clearly indicate that the developed polar RP-HPLC method for the separation and determination of ectoine is superior to earlier protocols.

  19. Perturbed dark and singular optical solitons in polarization preserving fibers by modified simple equation method

    Science.gov (United States)

    Yaşar, Emrullah; Yıldırım, Yakup; Zhou, Qin; Moshokoa, Seithuti P.; Ullah, Malik Zaka; Triki, Houria; Biswas, Anjan; Belic, Milivoj

    2017-11-01

    This paper obtains optical soliton solution to perturbed nonlinear Schrödinger's equation by modified simple equation method. There are four types of nonlinear fibers studied in this paper. They are Anti-cubic law, Quadratic-cubic law, Cubic-quintic-septic law and Triple-power law. Dark and singular soliton solutions are derived. Additional solutions such as singular periodic solutions also fall out of the integration scheme.

  20. A new capacitive/resistive probe method for studying magnetic surfaces

    International Nuclear Information System (INIS)

    Kitajima, Sumio; Takayama, Masakazu; Zama, Tatsuya; Takaya, Kazuhiro; Takeuchi, Nobunao; Watanabe, Hiroshige

    1991-01-01

    A new capacitive/resistive probe method for mapping the magnetic surfaces from resistance or capacitance between a magnetic surface and a vacuum vessel was developed and tested. Those resistances and capacitances can be regarded as components of a simple electrical bridge circuit. This method exploits electrical transient response of the bridge circuit for a square pulse. From equiresistance or equicapacitance points, the magnetic surface structure can be deduced. Measurements on the Tohoku University Heliac, which is a small-size standard heliac, show good agreement with numerical calculations. This method is particularly useful for pulse-operated machines. (author)

  1. Terahertz polarization imaging

    NARCIS (Netherlands)

    Van der Valk, N.C.J.; Van der Marel, W.A.M.; Planken, P.C.M.

    2005-01-01

    We present a new method to measure the polarization state of a terahertz pulse by using a modified electrooptic sampling setup. To illustrate the power of this method, we show two examples in which the knowledge of the polarization of the terahertz pulse is essential for interpreting the results:

  2. Considering the method of frost resistance determination for Winter Wheat (Triticum aestivum L. varieties

    Directory of Open Access Journals (Sweden)

    Н. І. Рябчун

    2008-04-01

    Full Text Available There is the method represented in the article for frost resistance determination for Winter Wheat (soft and hard varieties by experts’ assessment of varieties submitted for Official Variety Studying. Prescribed temperature limits for artificial freezing of the plants, example varieties for frost-resistance groups, are indicated.

  3. Test methods for on site measurement of resistivity of concrete. A RILEM TC-154 Technical Recommendation

    NARCIS (Netherlands)

    Polder, R.B.

    2000-01-01

    This paper describes methods to assess concrete resistivity on site for various purposes related to corrosion and protection of reinforcement. It is based on a first draft of a RILEM Technical Recommendation. The electrical resistivity of concrete can be related to the two processes involved in

  4. Mixed-Methods Resistance Training Increases Power and Strength of Young and Older Men.

    Science.gov (United States)

    Newton, Robert U.; Hakkinen, Keijo; Hakkinen, Arja; McCormick, Matt; Volek, Jeff; Kraemer, William J.

    2002-01-01

    Examined the effects of a 10-week, mixed-methods resistance training program on young and older men. Although results confirmed some age-related reductions in muscle strength and power, the older men demonstrated similar capacity to the younger men for increases in muscle strength and power via an appropriate, periodized resistance training…

  5. Combined DC resistivity and induced polarization (DC-IP) for mapping the internal composition of a mine waste rock pile in Nova Scotia, Canada

    Science.gov (United States)

    Power, Christopher; Tsourlos, Panagiotis; Ramasamy, Murugan; Nivorlis, Aristeidis; Mkandawire, Martin

    2018-03-01

    Mine waste rock piles (WRPs) can contain sulfidic minerals whose interaction with oxygen and water can generate acid mine drainage (AMD). Thus, WRPs can be a long-term source of environmental pollution. Since the generation of AMD and its release into the environment is dependent on the net volume and bulk composition of waste rock, effective characterization of WRPs is necessary for successful remedial design and monitoring. In this study, a combined DC resistivity and induced polarization (DC-IP) approach was employed to characterize an AMD-generating WRP in the Sydney Coalfield, Nova Scotia, Canada. Two-dimensional (2D) DC-IP imaging with 6 survey lines was performed to capture the full WRP landform. 2D DC results indicated a highly heterogeneous and moderately conductive waste rock underlain by a resistive bedrock containing numerous fractures. 2D IP (chargeability) results identified several highly-chargeable regions within the waste, with normalized chargeability delineating regions specific to waste mineralogy only. Three-dimensional (3D) DC-IP imaging, using 17 parallel lines on the plateau of the pile, was then used to focus on the composition of the waste rock. The full 3D inverted DC-IP distributions were used to identify coincident and continuous zones (isosurfaces) of low resistivity (0.4 mS/m) that were inferred as generated AMD (leachate) and stored AMD (sulfides), respectively. Integrated geological, hydrogeological and geochemical data increased confidence in the geoelectrical interpretations. Knowledge on the location of potentially more reactive waste material is extremely valuable for improved long-term AMD monitoring at the WRP.

  6. Methods comparison, transport and distribution of polar herbicides in the Baltic Sea.

    Science.gov (United States)

    Skeff, Wael; Orlikowska, Anna; Schulz-Bull, Detlef E

    2017-01-30

    Two LC-MS/MS methods including different sample preparation and quantitative processes showed a good agreement for analysis of the herbicides MCPA, mecoprop, isoproturon, bentazon and chloridazon, and the metabolite chloridazon-methyl-desphenyl (CMD) in estuarine waters. Due to different sensitivity of the methods only one could be used to analyze marine samples. The transport of these compounds to the Baltic Sea via ten German estuaries and their distribution between coastal water and sediments was studied. The results showed that all selected compounds can be transported to the Baltic Sea (0.9-747ng/L). Chloridazon, bentazon, isoproturon and CMD were detected (0.9-8.9ng/L) in the coastal waters and chloridazon and isorproturon in the sediments (5-136pg/g d.w.). Levels of contaminants in the sediments could be influenced by the total organic carbon content. Concentrations observed in the Baltic Sea are most likely not high enough to cause acute effects, but long term effect studies are strongly recommended. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Boosting Deuteron Polarization in HD Targets: Experience of moving spins between H and D with RF methods during the E06-101 experiment at Jefferson Lab

    Energy Technology Data Exchange (ETDEWEB)

    Wei, Xiangdong; Bass, Christopher; D' Angelo, Annalisa; Deur, Alexandre; Dezern, Gary; Kageya, Tsuneo; Laine, Vivien; Lowry, Michael; Sandorfi, Andrew; Teachey, Robert; Wang, Haipeng; Whisnant, Charles

    2014-06-01

    Solid HDice targets are polarized by bringing the HD crystal to thermal equilibrium at low temperature and high magnetic field, typically 10-20 mK and 15 Tesla, at Jefferson Lab. In this regime, due to its smaller magnetic moment, the resulting polarization for D is always at least three times smaller than for H. The controlled amount of polarizing catalysts, o-H2 and p-D2, used in the process of reaching a frozen-spin state, further limit the maximum achievable D polarization. Nonetheless, H and D polarizations can be transferred from one to the other by connecting the H and D sub-states of the HD system with RF. In a large target, the RF power needed for such transitions is effectively limited by non-uniformities in the RF field. High efficiency transfers can require substantial RF power levels, and a tuned-RF circuit is needed to prevent large temperature excursions of the holding cryostat. In this paper, we compare the advantages and limitations of two different RF transfer methods to increase D polarization, Forbidden Adiabatic and Saturated Forbidden RF Transitions. The experience with the HD targets used during the recently completed E06-101 experiment in Hall-B of Jefferson Lab is discussed.

  8. Optically polarized 3He

    Science.gov (United States)

    Gentile, T. R.; Nacher, P. J.; Saam, B.; Walker, T. G.

    2018-01-01

    This article reviews the physics and technology of producing large quantities of highly spin-polarized 3He nuclei using spin-exchange (SEOP) and metastability-exchange (MEOP) optical pumping. Both technical developments and deeper understanding of the physical processes involved have led to substantial improvements in the capabilities of both methods. For SEOP, the use of spectrally narrowed lasers and K-Rb mixtures has substantially increased the achievable polarization and polarizing rate. For MEOP nearly lossless compression allows for rapid production of polarized 3He and operation in high magnetic fields has likewise significantly increased the pressure at which this method can be performed, and revealed new phenomena. Both methods have benefitted from development of storage methods that allow for spin-relaxation times of hundreds of hours, and specialized precision methods for polarimetry. SEOP and MEOP are now widely applied for spin-polarized targets, neutron spin filters, magnetic resonance imaging, and precision measurements. PMID:29503479

  9. Optically polarized 3He

    Science.gov (United States)

    Gentile, T. R.; Nacher, P. J.; Saam, B.; Walker, T. G.

    2017-10-01

    This article reviews the physics and technology of producing large quantities of highly spin-polarized 3He nuclei using spin-exchange (SEOP) and metastability-exchange (MEOP) optical pumping. Both technical developments and deeper understanding of the physical processes involved have led to substantial improvements in the capabilities of both methods. For SEOP, the use of spectrally narrowed lasers and K-Rb mixtures has substantially increased the achievable polarization and polarizing rate. For MEOP nearly lossless compression allows for rapid production of polarized 3He and operation in high magnetic fields has likewise significantly increased the pressure at which this method can be performed, and revealed new phenomena. Both methods have benefitted from development of storage methods that allow for spin-relaxation times of hundreds of hours, and specialized precision methods for polarimetry. SEOP and MEOP are now widely applied for spin-polarized targets, neutron spin filters, magnetic resonance imaging, and precision measurements.

  10. Theodolite Polar measurements system and definition of the grid-lines method

    Directory of Open Access Journals (Sweden)

    Andréa de Seixas

    2004-12-01

    Full Text Available The requirements of construction quality, mainly in the car and airplane industries, accelerate the development of new 3D-Measurement Systems and Measurement Processes that make possible the automatic object recording and it’s post-processing on the basis, for example, on deformations. The geometrical reconstruction of objects or surface requires a minimal number of points, which abstracts and will be fulfill through interpolation its exact form and quality of the object in each case. The applications of the laser for the active signalization of a point object in combination with the directional measurement make possible in such way the determination of objects or surfaces, including also, places where the use of artificial targets is dangerous or impossible. This work describes the development of such measurement system based on two measurement robots or a reflector-free measuring tachymeter. The system is capable of reaching the intersections points of a grid-line that is defined in an appropriate coordinate system. The aim of this paper is to present the development of measurement methods that can reconstruct unknown three-dimensional and not signalized objects. The existing deformation-measurement, based on Pointer Theodolite and a Video Theodolite Measurement System and the other reflector-free Tachymeter Measurement System in context with the problematic analysis of deformation will be presented. The grid-lines Methods appear a solution and stand as new alternative for the geometrical reconstruction of the object surfaces. Its definition and preparations in a suitable coordinate system are discussed in detail.

  11. Determination of Resistance Levels of Myzus persicae (Sulzer by Biochemical Methods

    Directory of Open Access Journals (Sweden)

    Olivera Petrović-Obradović

    2007-01-01

    Full Text Available Peach/potato aphid Myzus persicae (Sulzer has developed three mechanisms of resistance: overproduction of one or two closely related carboxylesterases (E4 and FE4, production of modified acetylcholinesterase (MACE and knockdown resistance. Biochemicaldiagnostic methods can be used to identify levels of carboxylesterase production and sensitivity of modified acetylcholinesterase and, based on the values acquired we can classify aphids into one of the resistance cathegories. We used two tests: the total esterase activitytest and test for checking sensitivity of acetylcholinesterase (MACE. Myzus periscae persicae from peach and Myzus persicae nicotianae from tobacco were tested. The total esterase activity test showed that 65% of the aphids tested were moderately resistant and 35% were highly resistant. Resistance based on the production of modified acetylcholinesterase is less represented because 80% of the aphids tested were susceptible to pirimicarb, which was used in the experiment. Also, both tests showed that aphids from tobacco were more susceptible than aphids from peach.

  12. Selection of the appropriate method for the assessment of insulin resistance

    Directory of Open Access Journals (Sweden)

    Borai Anwar

    2011-11-01

    Full Text Available Abstract Insulin resistance is one of the major aggravating factors for metabolic syndrome. There are many methods available for estimation of insulin resistance which range from complex techniques down to simple indices. For all methods of assessing insulin resistance it is essential that their validity and reliability is established before using them as investigations. The reference techniques of hyperinsulinaemic euglycaemic clamp and its alternative the frequently sampled intravenous glucose tolerance test are the most reliable methods available for estimating insulin resistance. However, many simple methods, from which indices can be derived, have been assessed and validated e.g. homeostasis model assessment (HOMA, quantitative insulin sensitivity check index (QUICKI. Given the increasing number of simple indices of IR it may be difficult for clinicians and researchers to select the most appropriate index for their studies. This review therefore provides guidelines and advices which must be considered before proceeding with a study.

  13. Application of column tests and electrical resistivity methods for leachate transport monitoring

    Directory of Open Access Journals (Sweden)

    Wychowaniak Dorota

    2015-09-01

    Full Text Available Development of the human civilization leads to the pollution of environment. One of the contamination which are a real threat to soil and groundwater are leachates from landfills. In this paper the solute transport through soil was considered. For this purpose, the laboratory column tests of chlorides tracer and leachates transport on two soil samples have been carried out. Furthermore, the electrical resistivity method was applied as auxiliary tool to follow the movements of solute through the soil column what allowed to compare between the results obtained with column test method and electrical resistivity measurements. Breakthrough curves obtained by conductivity and resistivity methods represents similar trends which leads to the conclusion about the suitability of electrical resistivity methods for contamination transport monitoring in soil-water systems.

  14. Development of Anthelmintic Resistance Detection Methods of Gastrointestinal Nematodes on Livestock

    Directory of Open Access Journals (Sweden)

    Dyah Haryuningtyas

    2008-03-01

    Full Text Available The intensive usage of anthelmintic in most of farms led to resistances of livestock gastrointestinal nematodes against anthelmintic. Many reports of resistance that increased every year happen following the continuing helminth control programmes. The succesful implementation of helminth control programmes that designed to minimize the development of resistance in nematode populations depends on the availability of effective and sensitive method for its detection and monitoring. A variety of in vivo and in vitro tests have been developed for detecting nematode population resistance to the main anthelmintic groups. This paper will discuss the development of detection method of anthelmintic resistance based on conventional and molecular approach according to their strengths and weakness.

  15. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data.

    Science.gov (United States)

    Clausen, Philip T L C; Zankari, Ea; Aarestrup, Frank M; Lund, Ole

    2016-09-01

    Next generation sequencing (NGS) may be an alternative to phenotypic susceptibility testing for surveillance and clinical diagnosis. However, current bioinformatics methods may be associated with false positives and negatives. In this study, a novel mapping method was developed and benchmarked to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads. This indicates that information might be lost during assembly. KmerResistance performed significantly better than the other methods, when data were contaminated or only contained few sequence reads. Read mapping is superior to assembly-based methods and the new KmerResistance seemingly outperforms currently available methods particularly when including datasets with few reads. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Comparison of Several Methods for Determining the Internal Resistance of Lithium Ion Cells

    Directory of Open Access Journals (Sweden)

    Hans-Georg Schweiger

    2010-06-01

    Full Text Available The internal resistance is the key parameter for determining power, energy efficiency and lost heat of a lithium ion cell. Precise knowledge of this value is vital for designing battery systems for automotive applications. Internal resistance of a cell was determined by current step methods, AC (alternating current methods, electrochemical impedance spectroscopy and thermal loss methods. The outcomes of these measurements have been compared with each other. If charge or discharge of the cell is limited, current step methods provide the same results as energy loss methods.

  17. The Application of 2-D Resistivity and Self Potential (SP) Methods in Determining the Water Flow

    Science.gov (United States)

    Nordiana, M. M.; Tajudeen Olugbenga, Adeeko; Afiq Saharudin, Muhamad; nabila, S.; El Hidayah Ismail, Noer

    2018-04-01

    Existence of water flow at urban area will decrease the shear strength and increase hydraulic conductivity of soil which finally caused subsurface problems at this area. To avoid landslide, slope instability and disturbance of the ecosystem, good and detailed planning must be done when developing hilly area. The understanding about geological condition has to be considering before construction activities be done. Six 2-D resistivity survey lines with minimum 5 m electrode spacing were executed using Pole-dipole array. The field investigation such as borehole was carried out at multiple locations in the area where the 2-D resistivity method have been conducted. The directions and intensities of the water were evaluated with self-potential (SP) method. Subsequently, the results from borehole were used to verify the results of electrical resistivity method. Interpretation of 2-D resistivity data showed a low resistivity value (support the results of 2-D resistivity method relating a saturated zone in the survey area. There is a good correlation between the 2-D resistivity investigations and the results of borehole records.

  18. Standard test method for determining the crevice repassivation potential of corrosion-resistant alloys using a potentiodynamic-galvanostatic-potentiostatic technique

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2008-01-01

    1.1 This test method covers a procedure for conducting anodic polarization studies to determine the crevice repassivation potential for corrosion–resistant alloys. The concept of the repassivation potential is similar to that of the protection potential given in Reference Test Method G 5. 1.2 The test method consists in applying successively potentiodynamic, galvanostatic, and potentiostatic treatments for the initial formation and afterward repassivation of crevice corrosion. 1.3 This test method is a complement to Test Method G 61. 1.4 The values stated in SI units are to be regarded as the standard. The values given in parentheses are for information only. 1.5 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  19. Resazurin Microtiter Assay Plate: Simple and Inexpensive Method for Detection of Drug Resistance in Mycobacterium tuberculosis

    Science.gov (United States)

    Palomino, Juan-Carlos; Martin, Anandi; Camacho, Mirtha; Guerra, Humberto; Swings, Jean; Portaels, Françoise

    2002-01-01

    A method for detecting multidrug-resistant Mycobacterium tuberculosis by using a reduction of resazurin is described. Eighty clinical isolates were evaluated against isoniazid and rifampin; results at 7 days were compared with those of the proportion method. Specificity and sensitivity were excellent. The method is simple, inexpensive, and rapid and might be used with other antituberculosis drugs. PMID:12121966

  20. Validation of the chlorophyll fluorescence imaging method (CFI for early detection of herbicide resistance in weeds

    Directory of Open Access Journals (Sweden)

    Menegat, Alexander

    2014-02-01

    Full Text Available The increasing number of herbicide tolerant weed populations is illustrating the increasing demand for reliable methods for an accelerated detection of herbicide tolerance compared to greenhouse studies. Several methods for resistance quick detection have been published in previous years. One of the recent methods is the Chlorophyll Fluorescence Imaging Method (CFI. For this method changes in photosynthetic activity of the target organisms, caused by herbicides, are determined. General assumption of this method in terms of herbicide resistance detection is that each herbicidal compound, independent of the mode of action, will cause changes within the photosynthetic apparatus of the target organisms. This effect already could be confirmed for several modes of action (PSII, ALS, ACCase, EPSPS, synth. Auxins. Aim of this study is to validate this novel method on the basis of greenhouse experiments and single nucleotide polymorphisms (SNP analysis. The resistance profiles of 10 black-grass populations (Alopecurus myosuroides Huds. have been determined in greenhouse herbicide efficacy trials and constitutive SNP analyses of the survivors. With the CFI-method it was possible to detect the resistance profile as well as the resistance frequency within the populations. The results from the greenhouse experiments could be reproduced with conformity of 94%. This result is valid for the tested herbicides mesosulfuron, pyroxsulam as well as clodinafop and pinoxaden.

  1. Single solid phase extraction method for the simultaneous analysis of polar and non-polar pesticides in urine samples by gas chromatography and ultra high pressure liquid chromatography coupled to tandem mass spectrometry.

    Science.gov (United States)

    Cazorla-Reyes, Rocío; Fernández-Moreno, José Luis; Romero-González, Roberto; Frenich, Antonia Garrido; Vidal, José Luis Martínez

    2011-07-15

    A new multiresidue method has been developed and validated for the simultaneous extraction of more than two hundred pesticides, including non-polar and polar pesticides (carbamates, organochlorine, organophosphorous, pyrethroids, herbicides and insecticides) in urine at trace levels by gas and ultra high pressure liquid chromatography coupled to ion trap and triple quadrupole mass spectrometry, respectively (GC-IT-MS/MS, UHPLC-QqQ-MS/MS). Non-polar and polar pesticides were simultaneously extracted from urine samples by a simple and fast solid phase extraction (SPE) procedure using C(18) cartridges as sorbent, and dichloromethane as elution solvent. Recovery was in the range of 60-120%. Precision values expressed as relative standard deviation (RSD) were lower than 25%. Identification and confirmation of the compounds were performed by the use of retention time windows, comparison of spectra (GC-amenable compounds) or the estimation of the ion ratio (LC-amenable compounds). For GC-amenable pesticides, limits of detection (LODs) ranged from 0.001 to 0.436 μg L(-1) and limits of quantification (LOQs) from 0.003 to 1.452 μg L(-1). For LC-amenable pesticides, LODs ranged from 0.003 to 1.048 μg L(-1) and LOQs ranged from 0.011 to 3.494 μg L(-1). Finally, the optimized method was applied to the analysis of fourteen real samples of infants from agricultural population. Some pesticides such as methoxyfenozide, tebufenozide, piperonyl butoxide and propoxur were found at concentrations ranged from 1.61 to 24.4 μg L(-1), whereas methiocarb sulfoxide was detected at trace levels in two samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Standard method for detecting Bombyx mori nucleopolyhedrovirus disease-resistant silkworm varieties

    Directory of Open Access Journals (Sweden)

    Yang Qiong

    Full Text Available ABSTRACT Bombyx mori nucleopolyhedrovirus (BmNPV disease is one of the most serious silkworm diseases, and it has caused great economic losses to the sericulture industry. So far, the disease has not been controlled effectively by therapeutic agents. Breeding resistant silkworm varieties breeding may be an effective way to improve resistance to BmNPV and reduce economic losses. A precise resistance-detection method will help to accelerate the breeding process. For this purpose, here we described the individual inoculation method (IIM. Details of the IIM include pathogen BmNPV preparation, mulberry leaf size, pathogen volume, rearing conditions, course of infection, and breeding conditions. Finally, a resistance comparison experiment was performed using the IIM and the traditional group inoculation method (GIM. The incidence of BmNPV infection and the within-group variance results showed that the IIM was more precise and reliable than the GIM.

  3. 3D-surface reconstruction method for diffuse optical tomography phantoms and tissues using structured and polarized light

    Science.gov (United States)

    Baum, K.; Hartmann, R.; Bischoff, T.; Himmelreich, F.; Heverhagen, J. T.

    2011-07-01

    In recent years optical methods became increasingly popular for pre-clinical research and small animal imaging. One main field in biomedical optics research is the diffuse optical tomography (DOT). Many new systems were invented for small animal imaging and breast cancer detection. In combination with the progress in the development of optical markers, optical detectors and near infrared light sources, these new systems have become a formidable source of information. Most of the systems detect the transmitted light which passes through an object and one observes the intensity variations on the detector side. The biggest challenge for all diffuse optical tomography systems is the enormous scattering of light in tissues and tissue-like phantoms resulting in loss of image information. Many systems work with contact gels and optical fibers that have direct contact with the object to neglect the light path between surface and detector. Highly developed mathematic models and reconstruction algorithms based on FEM and Monte Carlo simulations describe the light transport inside tissues and determine differences in absorption and scattering coefficients inside. The proposed method allows a more exact description of the orientation of surface elements from semi-transparent objects towards the detector. Using Polarization Difference Imaging (PDI) in combination with structured light 3D-scanning, it is possible to separate information from the surface from that of the subsurface. Thus, the actual surface shape can be determined. Furthermore, overlaying byproducts caused by inter-reflections and multiple scattering can be filtered from the basic image information with this method. To enhance the image quality, the intensity dispersion between surface and camera is calculated and the creation of 3D-FEM-meshes simplified.

  4. An on-line normal-phase high performance liquid chromatography method for the rapid detection of radical scavengers in non-polar food matrixes

    NARCIS (Netherlands)

    Zhang, Q.; Klift, van der E.J.C.; Janssen, H.G.; Beek, van T.A.

    2009-01-01

    An on-line method for the rapid pinpointing of radical scavengers in non-polar mixtures like vegetable oils was developed. To avoid problems with dissolving the sample, normal-phase chromatography on bare silica gel was used with mixtures of hexane and methyl tert-butyl ether as the eluent. The high

  5. Standard Test Method for Environmental Resistance of Aerospace Transparencies

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers determination of the effects of exposure to thermal shock, condensing humidity, and simulated weather on aerospace transparent enclosures. 1.2 This test method is not recommended for quality control nor is it intended to provide a correlation to actual service life. 1.3 The values stated in SI units are to be regarded as standard. No other units of measurement are included in this standard. 1.3.1 Exceptions—Certain inch-pound units are furnished in parentheses (not mandatory) and certain temperatures in Fahrenheit associated with other standards are also furnished. 1.4 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use.

  6. Using different ELECTRE methods in strategic planning in the presence of human behavioral resistance

    Directory of Open Access Journals (Sweden)

    A. S. Milani

    2006-01-01

    Full Text Available In the multicriteria strategic planning of an organization, management should often be aware of employees' resistance to change before making new decisions; otherwise, a chosen strategy, though technologically acceptable, may not be efficient in the long term. This paper, using a sample case study within an organization, shows how different versions of ELECTRE methods can be used in choosing efficient strategies that account for both human behavioral resistance and technical elements. The effect of resistance from each subsystem of the organization is studied to ensure the reliability of the chosen strategy. The comparison of results from a select number of compensatory and noncompensatory models (ELECTRE I, III, IV, IS; TOPSIS; SAW; MaxMin suggests that when employee resistance is a decision factor in the multicriteria strategic planning problem, the models can yield low-resistance strategies; however, ELECTRE seems to show more reasonable sensitivity.

  7. Comparative Analysis of Three Methods for Determination of Imipenem Resistance in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Tanaz Zabihi

    2016-02-01

    Full Text Available "> Background: These days, the antibiotic resistance of Pseudomonas aeruginosa isolates toimipenem has significantly increased. Therefore the study of resistance to imipenem in thisorganism to imipenem in determining the appropriate treatment is crucial and necessary. The goalof this study is to compare three phenotypic methods of E-test, disk diffusion and micro brothdilution in the study of resistance to imipenem in clinical isolates of P. aeruginosa.Methods: Within a 6-month interval, 120 clinical specimens were collected and evaluated. Allisolates were identified as P. aeruginosa by standard biochemical tests and amplification of 16SrRNA gene. Three phenotypic methods of E-test, disk diffusion, and micro broth dilution wereused to determine imipenem resistance in P. aeruginosa isolates.Results: Of the 96 P. aeruginosa isolates studied for their resistance to imipenem by the use ofE-test, disk diffusion and micro broth dilution methods, 38.5% of the strains in micro broth dilutionmethod and 33.3% in the two methods of E-test and disk diffusion were resistant to imipenem. Therate of sensitivity and specificity of disk diffusion and E-test methods were 100%, 90.1%, and theywere 100% and 83.1% for micro broth dilution, respectively.Conclusions: With regard to the results obtained from the comparison of the three methods100% agreement were observed among the antimicrobial susceptibility results obtained by the Etest and disk diffusion methods (P ≥ 0.05. Therefore, the use of disk diffusion method can bean appropriate replacement for E-test method with regard to its being easy and cost-effective.

  8. Effects of scan rate on the corrosion behavior SS 304 stainless steel in the nanofluid measured by Tafel polarization methods

    Energy Technology Data Exchange (ETDEWEB)

    Prajitno, Djoko Hadi [PSTNT-BATAN Jl. Tamansari 71 Bandung 40132, Indonesia, djokohp@batan.go.id (Indonesia)

    2015-09-30

    The Effects of scan rate on the Tafel polarization curve that is obtained to determine corrosion rate are conducted. The tafel polarization curves are obtained at different scan rates for Stainless Steel 304 in nanofluids contain 0.01 gpl nano particle ZrO{sub 2}. The corrosion stainless steel in nanofluid contains adm+0.01 gpl ZrO{sub 2} nanoparticles at different scan rate was performed by Tafel polarization. The results show that according corrosion potential examination of the stainless steel in nanofluid media 0.01gpl ZrO{sub 2} nanoparticle was actively corroded. The value of cathodic Tafel slope stainless steel in nanofluid at different scan rate relatively unchanged after polarization testing. Mean while the value of anodic Tafel slope stainless steel in nanofluid increase at different scan rate. The results of Tafel polarization technique show that corrosion rate of stainless steel in nanofluid increase with increasing scan rate. X ray diffraction examination of stainless steel after Tafel polarization depict that γ Fe phase is major phase in the surface of alloy.

  9. Slope monitoring by using 2-D resistivity method at Sungai Batu, Pulau Pinang, Malaysia

    Science.gov (United States)

    Azman, Muhamad Iqbal Mubarak Faharul; Yusof, Azim Hilmy Mohd; Ismail, Nur Azwin; Ismail, Noer El Hidayah

    2017-07-01

    Slope is a dynamic system of geo-environmental phenomena that related to the movement of the soil and rock masses. In Pulau Pinang, the occurrence of slope related phenomena such as landslide and rock fall has become a huge issue especially during rainy season as the government would have to invest more for the people safety. 2-D resistivity method is one of the geophysical methods that can be applied to overcome this issue thus prepare countermeasure actions. Monitoring is one of the common acquisition technique that has been used in solving such issue. This technique was applied to identify and monitor changes at the suspected area and thus, countermeasure steps can be taken accordingly and not blindfolded. Starting from August until November 2016, a 200 m survey line of 2-D resistivity survey had been conducted monthly at Sungai Batu, Pulau Pinang slope for monitoring purpose. Three resistivity ranges were able to detect within the subsurface. Resistivity value of 250 - 400 Ωm indicated the low resistivity value and interpreted as the weak zone located at distance of 90 - 120 m with depth of 10 m. Intermediate resistivity value was interpreted as weathered granite zone with resistivity value of 400 - 1500 Ωm was found at almost along survey line. High resistivity value was > 5000 Ωm and interpreted as granitic bedrock located at depth of > 20 m. Aside from weathered granite zone and weak zone, a fracture was found develop over time at distance of 130 - 140 m. The features found have the potential to be the cause for slope failure phenomena to occur. As a conclusion, monitoring slope using 2-D resistivity method is a success and indeed helpful in overcome landslide and rock fall issue as a pre-countermeasure action.

  10. Development of Efficient Screening Method for Resistance of Cabbage to Fusarium oxysporum f. sp. conglutinans

    Directory of Open Access Journals (Sweden)

    Song-Yi Baik

    2011-04-01

    Full Text Available This study was conducted to establish the efficient screening method for resistant cabbage to Fusarium wilt caused by Fusarium oxysporum f. sp. conglutinans. The resistance degrees of nine commercial cabbage cultivars to the disease were evaluated. Among them, five cultivars (YR-honam, Ogane, Greenhot, Redmat, and Ccoccoma showing different resistance to the fungus were selected. Then development of Fusarium wilt of the cultivars according to several conditions including root wounding, dipping period of roots in spore suspension, inoculum concentration, and incubation temperature to develop the disease was investigated. Highly resistant cultivars such as ``YR-honam`` and ``Ogane`` hardly showed change of resistance to the disease by root wounding, dipping period, and inoculum concentration, while disease severity of Fusarium wilt on the cultivars was changed with incubation temperatures (20℃, 25℃ and 30℃. When the cabbage cultivars were incubated at 25℃, they represented the most difference of resistance and susceptibility to Fusarium wilt. From above results, we suggest that an efficient screening method for resistant cabbage to F. oxysporum f. sp. conglutinans is to dip the non-cut roots of 14-day-old seedlings in spore suspension of 1×107 conidia/ml for 0.5 hr and to transplant the seedlings to plastic pots with a fertilized soil, and then to cultivate the plants in a growth chamber at 25℃ for 3 weeks to develop Fusarium wilt.

  11. Study of true-remanent polarization using remanent hysteresis task and resistive leakage analysis in ferroelectric 0.64Pb(Mg1/3Nb2/3)O3-0.36PbTiO3 ceramics

    Science.gov (United States)

    Joseph, Abhilash J.; Kumar, Binay

    2018-03-01

    The conventionally reported value of remanent polarization (Pr) contains contribution from non-remanent components which are not usable for memory device applications. This report presents techniques which extract the true-remanent (intrinsic) component of polarization after eliminating the non-remanent component in ferroelectric ceramics. For this, "remanent hysteresis task" and "positive-up-negative-down technique" were performed which utilized the switchable properties of polarizations to nullify the contributions from the non-remanent (non-switchable) components. The report also addresses the time-dependent leakage behavior of the ceramics focusing on the presence of resistive leakage (a time-dependent parameter) present in the ceramics. The techniques presented here are especially useful for polycrystalline ceramics where leakage current leads to an erroneous estimation of Pr.

  12. Methods for quantifying adipose tissue insulin resistance in overweight/obese humans.

    Science.gov (United States)

    Ter Horst, K W; van Galen, K A; Gilijamse, P W; Hartstra, A V; de Groot, P F; van der Valk, F M; Ackermans, M T; Nieuwdorp, M; Romijn, J A; Serlie, M J

    2017-08-01

    Insulin resistance of adipose tissue is an important feature of obesity-related metabolic disease. However, assessment of lipolysis in humans requires labor-intensive and expensive methods, and there is limited validation of simplified measurement methods. We aimed to validate simplified methods for the quantification of adipose tissue insulin resistance against the assessment of insulin sensitivity of lipolysis suppression during hyperinsulinemic-euglycemic clamp studies. We assessed the insulin-mediated suppression of lipolysis by tracer-dilution of [1,1,2,3,3- 2 H 5 ]glycerol during hyperinsulinemic-euglycemic clamp studies in 125 overweight or obese adults (85 men, 40 women; age 50±11 years; body mass index 38±7 kg m -2 ). Seven indices of adipose tissue insulin resistance were validated against the reference measurement method. Low-dose insulin infusion resulted in suppression of the glycerol rate of appearance ranging from 4% (most resistant) to 85% (most sensitive), indicating a good range of adipose tissue insulin sensitivity in the study population. The reference method correlated with (1) insulin-mediated suppression of plasma glycerol concentrations (r=0.960, PInsulin Resistance (Adipo-IR) index (fasting plasma insulin-NEFA product; r=-0.526, Pinsulin-glycerol product (r=-0.467, PInsulin Resistance Index (fasting plasma insulin-basal lipolysis product; r=0.460, PInsulin Sensitivity Check Index (QUICKI)-NEFA index (r=0.621, Pinsulin resistance (area under the curve ⩾0.801, Pinsulin sensitivity (that is, the antilipolytic action of insulin) can be reliably quantified in overweight and obese humans by simplified index methods. The sensitivity and specificity of the Adipo-IR index and the fasting plasma insulin-glycerol product, combined with their simplicity and acceptable agreement, suggest that these may be most useful in clinical practice.

  13. METHODS FOR INOCULATION WITH Fusarium guttiforme AND GENETIC RESISTANCE OF PINEAPPLE ( Ananas comosus var. comosus )

    OpenAIRE

    WANDREILLA MOREIRA GARCIA; WILLIAN KRAUSE; DEJÂNIA VIEIRA DE ARAÚJO; ISANE VERA KARSBURG; RIVANILDO DALLACORT

    2017-01-01

    The objective of this work was to evaluate Fusarium guttiforme inoculation methods and genetic resistance of pineapple accessions. Thus, three experiments were conducted: pathogen inoculation of different leaf types ( B, D and F ) of pineapple (1), pathogen inoculation of pineapple cuttings and detached D leaves (2), and identification of resistance to fusariosis in 19 pineapple accessions (3) sampled in the State of Mato Grosso, Brazil. The cultivars Pérola (susceptible...

  14. Multilayer sulfur-resistant composite metal membranes and methods of making and repairing the same

    Science.gov (United States)

    Way, J. Douglas; Hatlevik, Oyvind

    2014-07-15

    The invention relates to thin, hydrogen-permeable, sulfur-resistant membranes formed from multi-layers of palladium or palladium-alloy coatings on porous, ceramic or metal supports, methods of making these membranes, methods of repairing layers of these membranes and devices that incorporate these membranes.

  15. Investigation of colistin sensitivity via three different methods in Acinetobacter baumannii isolates with multiple antibiotic resistance.

    Science.gov (United States)

    Sinirtaş, Melda; Akalin, Halis; Gedikoğlu, Suna

    2009-09-01

    In recent years there has been an increase in life-threatening infections caused by Acinetobacter baumannii with multiple antibiotic resistance, which has lead to the use of polymyxins, especially colistin, being reconsidered. The aim of this study was to investigate the colistin sensitivity of A. baumannii isolates with multiple antibiotic resistance via different methods, and to evaluate the disk diffusion method for colistin against multi-resistant Acinetobacter isolates, in comparison to the E-test and Phoenix system. The study was carried out on 100 strains of A. baumannii (colonization or infection) isolated from the microbiological samples of different patients followed in the clinics and intensive care units of Uludağ University Medical School between the years 2004 and 2005. Strains were identified and characterized for their antibiotic sensitivity by Phoenix system (Becton Dickinson, Sparks, MD, USA). In all studied A. baumannii strains, susceptibility to colistin was determined to be 100% with the disk diffusion, E-test, and broth microdilution methods. Results of the E-test and broth microdilution method, which are accepted as reference methods, were found to be 100% consistent with the results of the disk diffusion tests; no very major or major error was identified upon comparison of the tests. The sensitivity and the positive predictive value of the disk diffusion method were found to be 100%. Colistin resistance in A. baumannii was not detected in our region, and disk diffusion method results are in accordance with those of E-test and broth microdilution methods.

  16. Phenotypic methods for determination of methicillin resistance in Staphylococcus spp. from health care workers

    Directory of Open Access Journals (Sweden)

    Marcelle Aquino Rabelo

    2013-04-01

    Full Text Available INTRODUCTION: Staphylococcus spp. is an important healthcare-associated pathogen and the identification of methicillin-resistant strains in samples of colonization may provide data to assist in the antimicrobial therapy success. OBJECTIVES: To determine the occurrence of colonization by methicillin-resistant Staphylococcus spp. (MRS, through the detection of the mecA gene and to evaluate different phenotypic methods for the presumptive detection of methicillin resistance in samples of the anterior nasal cavity and hands of the health care personnel of a university hospital in the state of Pernambuco, Brazil. METHODS: We selected the 28 isolates of Staphylococcus spp., which showed an intermediate or resistant phenotypic profile for oxacillin, detected by the Kirby Bauer technique. The methods used were disk-diffusion tests for cefoxitin, minimal inhibitory concentration by E-test for oxacillin, screening for oxacillin resistance and mecA gene detection by polymerase chain reaction (PCR. RESULTS: About the phenotypic methods utilized, only the E-test of oxacillin did not show a statistically significant difference in relation to PCR for the mecA gene detection, considered the gold standard. CONCLUSION: The E-test of oxacillin was the best of the phenotypic methods utilized. It is necessary to correctly detect MRS in healthy individuals, because they can act as carriers and can therefore be a potential source of microorganisms involved in hospital infections.

  17. Efficient tight focusing of laser beams optimally matched to their thin-film linear-to-radial polarization conversion: Method, implementation, and field near focus

    Science.gov (United States)

    Sedukhin, Andrey G.; Poleshchuk, Alexander G.

    2018-01-01

    A method is proposed for efficient, rotationally symmetric, tight mirror focusing of laser beams that is optimally matched to their thin-film linear-to-radial polarization conversion by a constant near-Brewster angle of incidence of the beams onto a polarizing element. Two optical systems and their modifications are considered that are based on this method and on the use of Toraldo filters. If focusing components of these systems operate in media with refractive indices equal to that of the focal region, they take the form of an axicon and an annular reflector generated by the revolution of an inclined parabola around the optical axis. Vectorial formulas for calculating the diffracted field near the focus of these systems are derived. Also presented are the results of designing a thin-film obliquely illuminated polarizer and a numerical simulation of deep UV laser beams generated by one of the systems and focused in an immersion liquid. The transverse and axial sizes of a needle longitudinally polarized field generated by the system with a simplest phase Toraldo filter were found to be 0.39 λ and 10.5 λ, with λ being the wavelength in the immersion liquid.

  18. A rapid and sensitive method for the simultaneous analysis of aliphatic and polar molecules containing free carboxyl groups in plant extracts by LC-MS/MS

    Directory of Open Access Journals (Sweden)

    Bonaventure Gustavo

    2009-11-01

    Full Text Available Abstract Background Aliphatic molecules containing free carboxyl groups are important intermediates in many metabolic and signalling reactions, however, they accumulate to low levels in tissues and are not efficiently ionized by electrospray ionization (ESI compared to more polar substances. Quantification of aliphatic molecules becomes therefore difficult when small amounts of tissue are available for analysis. Traditional methods for analysis of these molecules require purification or enrichment steps, which are onerous when multiple samples need to be analyzed. In contrast to aliphatic molecules, more polar substances containing free carboxyl groups such as some phytohormones are efficiently ionized by ESI and suitable for analysis by LC-MS/MS. Thus, the development of a method with which aliphatic and polar molecules -which their unmodified forms differ dramatically in their efficiencies of ionization by ESI- can be simultaneously detected with similar sensitivities would substantially simplify the analysis of complex biological matrices. Results A simple, rapid, specific and sensitive method for the simultaneous detection and quantification of free aliphatic molecules (e.g., free fatty acids (FFA and small polar molecules (e.g., jasmonic acid (JA, salicylic acid (SA containing free carboxyl groups by direct derivatization of leaf extracts with Picolinyl reagent followed by LC-MS/MS analysis is presented. The presence of the N atom in the esterified pyridine moiety allowed the efficient ionization of 25 compounds tested irrespective of their chemical structure. The method was validated by comparing the results obtained after analysis of Nicotiana attenuata leaf material with previously described analytical methods. Conclusion The method presented was used to detect 16 compounds in leaf extracts of N. attenuata plants. Importantly, the method can be adapted based on the specific analytes of interest with the only consideration that the

  19. A rapid and sensitive method for the simultaneous analysis of aliphatic and polar molecules containing free carboxyl groups in plant extracts by LC-MS/MS.

    Science.gov (United States)

    Kallenbach, Mario; Baldwin, Ian T; Bonaventure, Gustavo

    2009-11-25

    Aliphatic molecules containing free carboxyl groups are important intermediates in many metabolic and signalling reactions, however, they accumulate to low levels in tissues and are not efficiently ionized by electrospray ionization (ESI) compared to more polar substances. Quantification of aliphatic molecules becomes therefore difficult when small amounts of tissue are available for analysis. Traditional methods for analysis of these molecules require purification or enrichment steps, which are onerous when multiple samples need to be analyzed. In contrast to aliphatic molecules, more polar substances containing free carboxyl groups such as some phytohormones are efficiently ionized by ESI and suitable for analysis by LC-MS/MS. Thus, the development of a method with which aliphatic and polar molecules -which their unmodified forms differ dramatically in their efficiencies of ionization by ESI- can be simultaneously detected with similar sensitivities would substantially simplify the analysis of complex biological matrices. A simple, rapid, specific and sensitive method for the simultaneous detection and quantification of free aliphatic molecules (e.g., free fatty acids (FFA)) and small polar molecules (e.g., jasmonic acid (JA), salicylic acid (SA)) containing free carboxyl groups by direct derivatization of leaf extracts with Picolinyl reagent followed by LC-MS/MS analysis is presented. The presence of the N atom in the esterified pyridine moiety allowed the efficient ionization of 25 compounds tested irrespective of their chemical structure. The method was validated by comparing the results obtained after analysis of Nicotiana attenuata leaf material with previously described analytical methods. The method presented was used to detect 16 compounds in leaf extracts of N. attenuata plants. Importantly, the method can be adapted based on the specific analytes of interest with the only consideration that the molecules must contain at least one free carboxyl group.

  20. Simple and efficient method of spin-polarizing a metastable helium beam by diode laser optical pumping

    International Nuclear Information System (INIS)

    Granitza, B.; Salvietti, M.; Torello, E.; Mattera, L.; Sasso, A.

    1995-01-01

    Diode laser optical pumping to produce a highly spin-polarized metastable He beam to be used in a spin-polarized metastable atom deexcitation spectroscopy experiment on magnetized surfaces is described. Efficient pumping of the beam is performed by means of an SDL-6702 distributed Bragg reflector diode laser which yields 50 mW of output power in a single longitudinal mode at 1083 nm, the resonance wavelength for the 2 3 S→2 3 P 0,1,2 (D 0 , D 1 , and D 2 ) transitions of He*. The light is circularly polarized by a quarter-wave plate, allowing easy change of the sense of atomic polarization. The laser frequency can be locked to the atomic transition for several hours by phase-sensitive detection of the saturated absorption signal in a He discharge cell. Any of the three transitions of the triplet system can be pumped with the laser but the maximum level of atomic polarization of 98.5% is found pumping the D 2 line. copyright 1995 American Institute of Physics

  1. A fully automated temperature-dependent resistance measurement setup using van der Pauw method

    Science.gov (United States)

    Pandey, Shivendra Kumar; Manivannan, Anbarasu

    2018-03-01

    The van der Pauw (VDP) method is widely used to identify the resistance of planar homogeneous samples with four contacts placed on its periphery. We have developed a fully automated thin film resistance measurement setup using the VDP method with the capability of precisely measuring a wide range of thin film resistances from few mΩ up to 10 GΩ under controlled temperatures from room-temperature up to 600 °C. The setup utilizes a robust, custom-designed switching network board (SNB) for measuring current-voltage characteristics automatically at four different source-measure configurations based on the VDP method. Moreover, SNB is connected with low noise shielded coaxial cables that reduce the effect of leakage current as well as the capacitance in the circuit thereby enhancing the accuracy of measurement. In order to enable precise and accurate resistance measurement of the sample, wide range of sourcing currents/voltages are pre-determined with the capability of auto-tuning for ˜12 orders of variation in the resistances. Furthermore, the setup has been calibrated with standard samples and also employed to investigate temperature dependent resistance (few Ω-10 GΩ) measurements for various chalcogenide based phase change thin films (Ge2Sb2Te5, Ag5In5Sb60Te30, and In3SbTe2). This setup would be highly helpful for measurement of temperature-dependent resistance of wide range of materials, i.e., metals, semiconductors, and insulators illuminating information about structural change upon temperature as reflected by change in resistances, which are useful for numerous applications.

  2. Polarization developments

    International Nuclear Information System (INIS)

    Prescott, C.Y.

    1993-07-01

    Recent developments in laser-driven photoemission sources of polarized electrons have made prospects for highly polarized electron beams in a future linear collider very promising. This talk discusses the experiences with the SLC polarized electron source, the recent progress with research into gallium arsenide and strained gallium arsenide as a photocathode material, and the suitability of these cathode materials for a future linear collider based on the parameters of the several linear collider designs that exist

  3. Method for making low-resistivity contacts to high T/sub c/ superconductors

    International Nuclear Information System (INIS)

    Ekin, J.W.; Panson, A.J.; Blankenship, B.A.

    1988-01-01

    A method for making low-resistivity contacts to high T/sub c/ superconductors has been developed, which has achieved contact surface resistivities less than 10 μΩ cm 2 at 76 K and does not require sample heating above ∼150 0 C. This is an upper limit for the contact resistivity obtained at high current densities up to 10 2 --10 3 A/cm 2 across the contact interface. At lower measuring current densities the contact resistivities were lower and the voltage-current curve was nonlinear, having a superconducting transition character. On cooling from 295 to 76 K, the contact resistivity decreased several times, in contrast to indium solder contacts where the resistivity increased on cooling. The contacts showed consistently low resistivity and little degradation when exposed to dry air over a four-month period and when repeatedly cycled between room temperature and 76 K. The contacts are formed by sputter depositing a layer of a noble metal-silver and gold were used-on a clean superconductor surface to protect the surface and serve as a contact pad. External connections to the contact pads have been made using both solder and wire-bonding techniques

  4. Method of Selection of Bacteria Antibiotic Resistance Genes Based on Clustering of Similar Nucleotide Sequences.

    Science.gov (United States)

    Balashov, I S; Naumov, V A; Borovikov, P I; Gordeev, A B; Dubodelov, D V; Lyubasovskaya, L A; Rodchenko, Yu V; Bystritskii, A A; Aleksandrova, N V; Trofimov, D Yu; Priputnevich, T V

    2017-10-01

    A new method for selection of bacterium antibiotic resistance genes is proposed and tested for solving the problems related to selection of primers for PCR assay. The method implies clustering of similar nucleotide sequences and selection of group primers for all genes of each cluster. Clustering of resistance genes for six groups of antibiotics (aminoglycosides, β-lactams, fluoroquinolones, glycopeptides, macrolides and lincosamides, and fusidic acid) was performed. The method was tested for 81 strains of bacteria of different genera isolated from patients (K. pneumoniae, Staphylococcus spp., S. agalactiae, E. faecalis, E. coli, and G. vaginalis). The results obtained by us are comparable to those in the selection of individual genes; this allows reducing the number of primers necessary for maximum coverage of the known antibiotic resistance genes during PCR analysis.

  5. A Modified Time-Delay Addition Method to Extract Resistive Leakage Current of MOSA

    Science.gov (United States)

    Khodsuz, Masume; Mirzaie, Mohammad

    2016-12-01

    Metal oxide surge arresters are one of the most important equipment for power system protection against switching and lightning over-voltages. High-energy stresses and environmental features are the main factors which degrade surge arresters. In order to verify surge arresters good condition, their monitoring is necessary. The majority of surge arrester monitoring techniques is based on total leakage current decomposition of their capacitive and resistive components. This paper introduces a new approach based on time-delay addition method to extract the resistive current from the total leakage current without measuring voltage signal. Surge arrester model for calculating leakage current has been performed in ATP-EMTP. In addition, the signal processing has been done using MATLAB software. To show the accuracy of the proposed method, experimental tests have been performed to extract resistive leakage current by the proposed method.

  6. Metabolomic method: UPLC-q-ToF polar and non-polar metabolites in the healthy rat cerebellum using an in-vial dual extraction.

    Directory of Open Access Journals (Sweden)

    Amera A Ebshiana

    Full Text Available Unbiased metabolomic analysis of biological samples is a powerful and increasingly commonly utilised tool, especially for the analysis of bio-fluids to identify candidate biomarkers. To date however only a small number of metabolomic studies have been applied to studying the metabolite composition of tissue samples, this is due, in part to a number of technical challenges including scarcity of material and difficulty in extracting metabolites. The aim of this study was to develop a method for maximising the biological information obtained from small tissue samples by optimising sample preparation, LC-MS analysis and metabolite identification. Here we describe an in-vial dual extraction (IVDE method, with reversed phase and hydrophilic liquid interaction chromatography (HILIC which reproducibly measured over 4,000 metabolite features from as little as 3mg of brain tissue. The aqueous phase was analysed in positive and negative modes following HILIC separation in which 2,838 metabolite features were consistently measured including amino acids, sugars and purine bases. The non-aqueous phase was also analysed in positive and negative modes following reversed phase separation gradients respectively from which 1,183 metabolite features were consistently measured representing metabolites such as phosphatidylcholines, sphingolipids and triacylglycerides. The described metabolomics method includes a database for 200 metabolites, retention time, mass and relative intensity, and presents the basal metabolite composition for brain tissue in the healthy rat cerebellum.

  7. Development of Convenient Screening Method for Resistant Radish to Plasmodiophora brassicae

    Directory of Open Access Journals (Sweden)

    Su-Jung Jo

    2011-08-01

    Full Text Available To establish simple and reliable screening method for resistant radish to Plasmodiophora brassicae Woron. using soil-drenching inoculation, the development of clubroot on radish seedlings inoculated with P. brassicae GN-1 isolate according to several conditions such as inoculum concentration, plant growth stage and incubation period after inoculation was studied. To select resistant radish against clubroot, 10-day-old seedlings were inoculated with P. brassicae by drenching the roots with the spore suspension of the pathogen to give 1×10(9 spores/pot. The inoculated seedlings were incubated in a growth chamber at 20℃ for 3 days then cultivated in a greenhouse (20±5℃ for 6 weeks. Under the optimum conditions, 46 commercial cultivars of radish were tested for resistance to YC-1 (infecting 15 clubroot-resistant cultivars of Chinese cabbage and GN-1 (wild type isolates of P. brassicae. Among them, thirty-five cultivars showed resistance to both isolates and one cultivar represented susceptible response to the pathogens. On the other hand, the other cultivars showed different responses against the tested P. brassicae pathogens. The results suggest that this method is an efficient system for screening radish with resistance to clubroot.

  8. Experimental Study on Electrode Method for Electrical Resistivity Survey to Detect Cavities under Road Pavements

    OpenAIRE

    Chang-Seon Park; Jin-Hoon Jeong; Hae-Won Park; Kyoungchul Kim

    2017-01-01

    There are two types of electrode methods for electrical resistivity survey (ERS): the pole electrode method (PEM) and flat electrode method (FEM). During the past few decades, most studies were conducted by using PEM for various purposes while only a few were conducted by using FEM. Laboratory and field experiments were performed in this study to investigate the advantage of FEM in detecting cavities under pavements. In the laboratory experiment, the results of PEM and FEM were compared graph...

  9. The Analysis Of Accuracy Of Selected Methods Of Measuring The Thermal Resistance Of IGBTs

    Directory of Open Access Journals (Sweden)

    Górecki Krzysztof

    2015-09-01

    Full Text Available In the paper selected methods of measuring the thermal resistance of an IGBT (Insulated Gate Bipolar Transistor are presented and the accuracy of these methods is analysed. The analysis of the measurement error is performed and operating conditions of the considered device, at which each measurement method assures the least measuring error, are pointed out. Theoretical considerations are illustrated with some results of measurements and calculations.

  10. Comparative study of on-line response time measurement methods for platinum resistance thermometer

    International Nuclear Information System (INIS)

    Zwingelstein, G.; Gopal, R.

    1979-01-01

    This study deals with the in site determination of the response time of platinum resistance sensor. In the first part of this work, two methods furnishing the reference response time of the sensors are studied. In the second part of the work, two methods obtaining the response time without dismounting of the sensor, are studied. A comparative study of the performances of these methods is included for fluid velocities varying from 0 to 10 m/sec, in both laboratory and plant conditions

  11. Parallel Polarization State Generation.

    Science.gov (United States)

    She, Alan; Capasso, Federico

    2016-05-17

    The control of polarization, an essential property of light, is of wide scientific and technological interest. The general problem of generating arbitrary time-varying states of polarization (SOP) has always been mathematically formulated by a series of linear transformations, i.e. a product of matrices, imposing a serial architecture. Here we show a parallel architecture described by a sum of matrices. The theory is experimentally demonstrated by modulating spatially-separated polarization components of a laser using a digital micromirror device that are subsequently beam combined. This method greatly expands the parameter space for engineering devices that control polarization. Consequently, performance characteristics, such as speed, stability, and spectral range, are entirely dictated by the technologies of optical intensity modulation, including absorption, reflection, emission, and scattering. This opens up important prospects for polarization state generation (PSG) with unique performance characteristics with applications in spectroscopic ellipsometry, spectropolarimetry, communications, imaging, and security.

  12. A Blast-Resistant Method Based on Wave Converters with Spring Oscillator for Underground Structures

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    2017-01-01

    Full Text Available Researches on blast-resistant measures for underground structures such as tunnels and underground shopping malls are of great importance for their significant role in economic and social development. In this paper, a new blast-resistant method based on wave converters with spring oscillator for underground structures was put forward, so as to convert the shock wave with high frequency and high peak pressure to the periodic stress wave with low frequency and low peak pressure. The conception and calculation process of this new method were introduced. The mechanical characteristics and motion evolution law of wave converters were deduced theoretically. Based on the theoretical deduction results and finite difference software FLAC3D, the dynamic responses of the new blast-resistant structure and the traditional one were both calculated. Results showed that, after the deployment of wave converters, the peak absolute values of the bending moment, shear force, and axial force of the structure decreased generally, which verified the good blast-resistant effect of the new blast-resistant method.

  13. Lembang fault plane identification using electrical resistivity method for disaster mitigation

    Science.gov (United States)

    Maulinadya, S.; Ramadhan, M. Lutfi; N. Wening, F.; Pinehas, D.; Widodo

    2017-07-01

    Lembang Fault is an active fault lies from West to East located 10 kilometers in north of Bandung. It is a normal fault that its foot wall raises 40-450 meters above the ground. Its location that is not so far from Bandung, which is densely populated and frequently visited by tourists, makes Lembang Fault a threat if it becomes suddenly active. Its movement can cause earthquakes that can result in fatalities. Therefore, act of mitigation is necessary, such as educating people about Lembang Fault and its potential to cause disaster. The objective of this study is to find Lembang Fault plane below the surface with geo electrical mapping method and vertical elect rical sounding method around Ciwarega and The Peak, Lembang (west side of Lembang Fault). Both of these methods are using electricity current to measure rock resistivity. Currents are injected to the ground and potential differences are measured. According to Ohm's Law, resistivity can be calculated so that resistivity distribution can be obtained. In this study, high resistivity contrast is obtained; it is about 1400-5000 Ohm.m. This resistivity contrast can be caused by lateral lithology difference resulted by fault existence. This proves that there is actually a fault in Lembang that potentially cause disasters like earthquakes.

  14. Pair Approximation for Polarization Interaction and Adiabatic Nuclear and Electronic Sampling Method for Fluids with Dipole Polarizability

    Czech Academy of Sciences Publication Activity Database

    Předota, Milan; Cummings, P. T.; Chialvo, A. A.

    2002-01-01

    Roč. 100, č. 16 (2002), s. 2703-2717 ISSN 0026-8976 Grant - others:DE(US) AC05-00OR22725 Keywords : polarization interaction * Monte Carlo Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.617, year: 2002

  15. Fractal analysis of polar bear hairs

    Directory of Open Access Journals (Sweden)

    Wang Qing-Li

    2015-01-01

    Full Text Available Hairs of a polar bear (Ursus maritimus are of superior properties such as the excellent thermal protection. Why do polar bears can resist such cold environment? The paper concludes that its fractal porosity plays an important role, and its fractal dimensions are very close to the golden mean, 1.618, revealing the possible optimal structure of polar bear hair.

  16. Polarization, political

    NARCIS (Netherlands)

    Wojcieszak, M.; Mazzoleni, G.; Barnhurst, K.G.; Ikeda, K.; Maia, R.C.M.; Wessler, H.

    2015-01-01

    Polarization has been studied in three different forms: on a social, group, and individual level. This entry first focuses on the undisputed phenomenon of elite polarization (i.e., increasing adherence of policy positions among the elites) and also outlines different approaches to assessing mass

  17. Resistance Torque Based Variable Duty-Cycle Control Method for a Stage II Compressor

    Science.gov (United States)

    Zhong, Meipeng; Zheng, Shuiying

    2017-07-01

    The resistance torque of a piston stage II compressor generates strenuous fluctuations in a rotational period, and this can lead to negative influences on the working performance of the compressor. To restrain the strenuous fluctuations in the piston stage II compressor, a variable duty-cycle control method based on the resistance torque is proposed. A dynamic model of a stage II compressor is set up, and the resistance torque and other characteristic parameters are acquired as the control targets. Then, a variable duty-cycle control method is applied to track the resistance torque, thereby improving the working performance of the compressor. Simulated results show that the compressor, driven by the proposed method, requires lower current, while the rotating speed and the output torque remain comparable to the traditional variable-frequency control methods. A variable duty-cycle control system is developed, and the experimental results prove that the proposed method can help reduce the specific power, input power, and working noise of the compressor to 0.97 kW·m-3·min-1, 0.09 kW and 3.10 dB, respectively, under the same conditions of discharge pressure of 2.00 MPa and a discharge volume of 0.095 m3/min. The proposed variable duty-cycle control method tracks the resistance torque dynamically, and improves the working performance of a Stage II Compressor. The proposed variable duty-cycle control method can be applied to other compressors, and can provide theoretical guidance for the compressor.

  18. TECHNICAL EVALUATION OF ELECTRICAL RESISTIVITY METHODS AT THE DEPARTMENT OF ENERGY HANFORD SITE

    International Nuclear Information System (INIS)

    PETERSEN SW

    2008-01-01

    There is a continuing need for cost-effective subsurface characterization within the vadose zone and groundwater at the U.S. Department of Energy (DOE) Hanford Site, Richland, Washington. With more than 1600 liquid and solid waste sites and 200 burial sites, contaminants have migrated to and through the vadose zone. In addition, future groundwater plumes may be generated from contaminants presently in the vadose zone. Relatively low-cost geophysical techniques can provide spatially extensive data that may provide information about the presence and extent of some contaminants. Recent electrical resistivity surveys at Hanford have provided encouraging results for mapping of some contaminants, such as nitrate, in the vadose zone. Because mobile radionuclides and trace elements may have been transported with nitrate through the vadose zone, the method may be used to map some mobile contaminants of concern, such as technetium-99 (99Tc). Validation of these recent electrical resistivity survey results remains to be completed. Electrical resistivity surveys have been conducted at various waste sites in the 200 Area of the Hanford Site: BC Cribs and Trenches (BCCT), T, S, U, C, B Tank Farms and the Purex Plant. Surveys have been completed using surface and well-to-well (WTW) array configurations. The goals of the surveys, as described by Fluor Hanford and CH2MHill Hanford staff, were to test the applicability of resistivity methods in identifying the presence of and mapping approximate extent of contaminant plumes within the vadose zone. The overall goal of the project was to evaluate the utility of electrical resistivity methods for characterizing contaminants of potential concern in the vadose zone in the 200 Area of the Hanford Site. The panel was asked to perform the following activities: (1) Evaluate recently completed and ongoing electrical resistivity projects at Hanford in terms of methodology used, results obtained, and lessons learned, with specific focus on (a

  19. A simple identification method for spore-forming bacteria showing high resistance against γ-rays

    International Nuclear Information System (INIS)

    Koshikawa, Tomihiko; Sone, Koji; Kobayashi, Toshikazu

    1993-01-01

    A simple identification method was developed for spore-forming bacteria which are highly resistant against γ-rays. Among 23 species of Bacillus studied, the spores of Bacillus megaterium, B. cereus, B. thuringiensis, B. pumilus and B. aneurinolyticus showed high resistance against γ-rays as compared with other spores of Bacillus species. Combination of the seven kinds of biochemical tests, namely, the citrate utilization test, nitrate reduction test, starch hydrolysis test, Voges-Proskauer reaction test, gelatine hydrolysis test, mannitol utilization test and xylose utilization test showed a characteristic pattern for each species of Bacillus. The combination pattern of each the above tests with a few supplementary test, if necessary, was useful to identify Bacillus species showing high radiation resistance against γ-rays. The method is specific for B. megaterium, B. thuringiensis and B. pumilus, and highly selective for B. aneurinolyticus and B. cereus. (author)

  20. Imaging geological contact utilizing 2D resistivity method for light rail transit (LRT) track alignment

    Science.gov (United States)

    Ali, Nisa'; Saad, Rosli; Muztaza, Nordiana M.; Ismail, Noer E. H.

    2013-05-01

    The purpose of this study was to locate the geological contact using 2D resistivity method for Light Rail Transit (LRT) track alignment. The resistivity method was conducted on eight survey lines with the length of line 1 was 600m. The length of line 2, 3, 4, 5, 6, and 7 were 200m each while line 8 is 115m. All the survey used minimum electrode spacing of 5m and using Pole-dipole array with minimum current is 2mA and maximum was 20mA. The result obtained from the pseudosection showed that the area generally divided into three main zones, fill materials/residual soil with a resistivity value of 2000 Ωm. Three fractured zones were detected along line L1 and a lot of boulders were detected at L1, L3, L4, L5 and L6. The geological contact was between the residual soil and granite bedrock.

  1. A rapid and sensitive method for the simultaneous analysis of aliphatic and polar molecules containing free carboxyl groups in plant extracts by LC-MS/MS

    OpenAIRE

    Kallenbach, Mario; Baldwin, Ian T; Bonaventure, Gustavo

    2009-01-01

    Abstract Background Aliphatic molecules containing free carboxyl groups are important intermediates in many metabolic and signalling reactions, however, they accumulate to low levels in tissues and are not efficiently ionized by electrospray ionization (ESI) compared to more polar substances. Quantification of aliphatic molecules becomes therefore difficult when small amounts of tissue are available for analysis. Traditional methods for analysis of these molecules require purification or enri...

  2. Polarization holography

    DEFF Research Database (Denmark)

    Nikolova, L.; Ramanujam, P.S.

    Current research into holography is concerned with applications in optically storing, retrieving, and processing information. Polarization holography has many unique properties compared to conventional holography. It gives results in high efficiency, achromaticity, and special polarization...... properties. This books reviews the research carried out in this field over the last 15 years. The authors provide basic concepts in polarization and the propagation of light through anisotropic materials, before presenting a sound theoretical basis for polarization holography. The fabrication...... and characterization of azobenzene based materials, which remain the most efficient for the purpose, is described in detail. This is followed by a description of other materials that are used in polarization holography. An in-depth description of various applications, including display holography and optical storage...

  3. Parallelized Three-Dimensional Resistivity Inversion Using Finite Elements And Adjoint State Methods

    Science.gov (United States)

    Schaa, Ralf; Gross, Lutz; Du Plessis, Jaco

    2015-04-01

    The resistivity method is one of the oldest geophysical exploration methods, which employs one pair of electrodes to inject current into the ground and one or more pairs of electrodes to measure the electrical potential difference. The potential difference is a non-linear function of the subsurface resistivity distribution described by an elliptic partial differential equation (PDE) of the Poisson type. Inversion of measured potentials solves for the subsurface resistivity represented by PDE coefficients. With increasing advances in multichannel resistivity acquisition systems (systems with more than 60 channels and full waveform recording are now emerging), inversion software require efficient storage and solver algorithms. We developed the finite element solver Escript, which provides a user-friendly programming environment in Python to solve large-scale PDE-based problems (see https://launchpad.net/escript-finley). Using finite elements, highly irregular shaped geology and topography can readily be taken into account. For the 3D resistivity problem, we have implemented the secondary potential approach, where the PDE is decomposed into a primary potential caused by the source current and the secondary potential caused by changes in subsurface resistivity. The primary potential is calculated analytically, and the boundary value problem for the secondary potential is solved using nodal finite elements. This approach removes the singularity caused by the source currents and provides more accurate 3D resistivity models. To solve the inversion problem we apply a 'first optimize then discretize' approach using the quasi-Newton scheme in form of the limited-memory Broyden-Fletcher-Goldfarb-Shanno (L-BFGS) method (see Gross & Kemp 2013). The evaluation of the cost function requires the solution of the secondary potential PDE for each source current and the solution of the corresponding adjoint-state PDE for the cost function gradients with respect to the subsurface

  4. Laboratory, greenhouse and field methods for screening rust-resistant wheat cultivars

    International Nuclear Information System (INIS)

    Mashaal, S.F.; Kiraly, Z.; Barabas, Z.; Barna, B.; Cereal Research Inst., Szeged, Hungary)

    1977-01-01

    Detached flag leaf cultures were not suitable for evaluation of stem-rust resistance in our screening programme. On the basis of yield evaluation it was possible to screen out ten stem-rust ''tolerant'' wheat lines in field experiments. Rusted and protected microplots of each line were paired within a replicate. After artificial inoculation, the protected plants were sprayed with fungicides (benomyl plus dithiocarbamate plus copper salt) at weekly intervals until maturation to keep each protected plot rust-free. The thousand-kernel weights of rusted and protected plots were compared. When the thousand-kernel weight of protected plot increased only slightly and the rust reaction type of plants was susceptible in the rusted plot, the line was screened out as putative ''tolerant''. On the basis of three-year field trial ten ''tolerant'' lines were selected. Nine out of ten lines proved to be resistant to two stem-rust races in greenhouse tests in the seedling stage, when resistance was determined on the basis of reduced spore production instead of infection types. Resistance of these seedlings related partly to the reduced number of pustules and partly to a slow rusting character of plants. It seems possible to screen resistant cultivars in the greenhouse by the method outlined in this paper, when resistance is determined on the basis of a reduced number of infection sites and/or by the slow rusting capacity. (author)

  5. Alkaline resistant phosphate glasses and method of preparation and use thereof

    Energy Technology Data Exchange (ETDEWEB)

    Brow, Richard K. (Rolla, MO); Reis, Signo T. (Rolla, MO); Velez, Mariano (Rolla, MO); Day, Delbert E. (Rolla, MO)

    2010-01-26

    A substantially alkaline resistant calcium-iron-phosphate (CFP) glass and methods of making and using thereof. In one application, the CFP glass is drawn into a fiber and dispersed in cement to produce glass fiber reinforced concrete (GFRC) articles having the high compressive strength of concrete with the high impact, flexural and tensile strength associated with glass fibers.

  6. A NEW METHOD FOR CHARACTERIZING THE KNOCK RESISTANCE OF LNG FUELS USED IN THE TRANSPORTATION MARKET

    NARCIS (Netherlands)

    Levinsky, Howard; Gersen, Sander; van Essen, Martijn; van Dijk, Gerco

    2014-01-01

    To ensure that the engines to be used in LNG-fueled vehicles are matched with the expected variations in fuel composition, the knock resistance of the fuel must be determined unambiguously. Rather than rely on empirical methods using gas mixtures and “standard” engines traditionally employed for

  7. A novel method “CHROMagar” for screening vancomycin-resistant ...

    African Journals Online (AJOL)

    Infection with vancomycin-resistant enterococci (VRE) is reported to be increasing and becoming a problem especially in health care systems with prolonged survival in the environment. In this study, we compared the performance characteristics of CHROMagar with conventional methods for detection of VRE in clinical ...

  8. Meticillin-resistant Staphylococcus aureus (MRSA) : global epidemiology and harmonisation of typing methods

    NARCIS (Netherlands)

    Stefani, Stefania; Chung, Doo Ryeon; Lindsay, Jodi A.; Friedrich, Alex W.; Kearns, Angela M.; Westh, Henrik; MacKenzie, Fiona M.

    This article reviews recent findings on the global epidemiology of healthcare-acquired/ associated (HA), community-acquired/ associated (CA) and livestock-associated (LA) meticillin-resistant Staphylococcus aureus (MRSA) and aims to reach a consensus regarding the harmonisation of typing methods for

  9. Determination of the way resistance coefficient using a trailer’s method

    Directory of Open Access Journals (Sweden)

    Ramón Pérez Gálvez

    2017-07-01

    Full Text Available Introduction: The fuel consumption of the ground vehicle transportations constitutes an important part of the total fuel consumption of the world. There are many factors related to this fuel consumption and several ways to study it. The drive cycles based on the mathematical modeling are tools to understand, to estimate and to predict the vehicle fuel consumption. Objective: Usually the simulating is most exact when the mathematical models are solved with the real profiles of way resistance coefficient. For that reason, the experimental determination of the coefficient of resistance of the road is the objective of this research. Methodology: A trailer was designed and built and statically and, in order to know the features of the systems that are involved in the coefficient measuring process, a group of experiments of static and dynamic was conducted. Later, a road sector for validation was calibrated and then others road with variation in slope and road surface was studied. Results: This method is able to measure the way resistance coefficient that corresponding with road conditions of values of rolling resistance of 0,008 - 0,02 (made of asphalt or cement and slopes of 0-12o. Conclusions: The results demonstrate that this method is accurate and precise for the determination of the way resistance coefficient.

  10. METHODS FOR INOCULATION WITH Fusarium guttiforme AND GENETIC RESISTANCE OF PINEAPPLE ( Ananas comosus var. comosus

    Directory of Open Access Journals (Sweden)

    WANDREILLA MOREIRA GARCIA

    2017-01-01

    Full Text Available The objective of this work was to evaluate Fusarium guttiforme inoculation methods and genetic resistance of pineapple accessions. Thus, three experiments were conducted: pathogen inoculation of different leaf types ( B, D and F of pineapple (1, pathogen inoculation of pineapple cuttings and detached D leaves (2, and identification of resistance to fusariosis in 19 pineapple accessions (3 sampled in the State of Mato Grosso, Brazil. The cultivars Pérola (susceptible to fusariosis and BRS - Vitória (resistant to fusariosis were used as controls. The fusariosis severity was evaluated at 10, 15, 20, 25 and 30 days after inoculation with F. guttiforme . The lesion diameters (severity level were used in order to calculate the area under the disease progress curve (AUDPC. The inoculation of detached D leaves was the most efficient, fast and inexpensive method, and the one that most satisfactorily reproduced the disease symptoms. The period of 10 to 20 days after inoculation of the D detached leaves with the pathogen is the most suitable to evaluate the resistance of pineapple accessions to fusariosis. The lowest lesion area and AUDPC was found in the accession 1, in all evaluations. Thus, the accession 1 can be used in pineapple breeding programs for resistance to fusariosis.

  11. Analysis of earth resistivity frequency dependence: Test method and its practical application

    Directory of Open Access Journals (Sweden)

    Kostić Vojin I.

    2015-01-01

    Full Text Available The first step in planning and designing of the proper grounding system, is the earth resistivity measurement. Measurements are carried out before the construction of the power facility. However, it is not an uncommon situation that during construction, subsequent leveling and raising of the ground level is performed. For this purpose, it is customary to use the land from the locations far away. Delivered soil has largely different electromagnetic characteristics (electric conductivity, permittivity and dielectric constant in relation to the soil on which the previous measurement of the earth resistivity was conducted. Since the value of the earth resistivity directly affects the grounding system electrical parameters - grounding system impedance, touch and step voltages - additional measurements are required and according to this appropriate corrections of the grounding system In this paper, we propose a practical method for earth resistivity measurement. The method is applicable in the design phase, and also for the revision of the installed grounding system. A practical example of a power facility (RP 400 kV Mladost, Elektromreža Srbije, based on laboratory measurements of the soil samples earth resistivity and grounding system impedance measurement, clearly shows what consequences might occur by leveling and raising of the ground level using ash coal dump.

  12. The application of DCPD method to evaluating dynamic J-R fracture resistance characteristics

    International Nuclear Information System (INIS)

    Yoon, Ji Hyun; Hong, Jun Hwa; Lee, Bong Sang; Chi, Se Whan; Kim, Joo Hag; Oh, Yong Jun; Kwun, Sun Chil; Oh, Jong Myung

    1999-06-01

    The reliable DCPD (Direct Current Potential Drop) test and data acquisition system were developed on the basis of analysis of various technical problems to accompanied with the application of DCPD method to J-R fracture resistance test. The test system contains electric insulation rod and high performance data acquisition system. The test and analysis method was applied to J-R fracture resistance test for SA516-Gr.70 steel for nuclear primary coolant system elbow. The reliabilities of test and analysis method were confirmed through the load-ratio method in case of dynamic loading test, and through the standard unloading compliance test in case of static loading test. (author). 17 refs., 1 tab., 18 figs

  13. A Mathematical Method for Determining Optimal Quantity of Backfill Materials Used for Grounding Resistance Reduction

    Directory of Open Access Journals (Sweden)

    Jovan Trifunovic

    2018-01-01

    Full Text Available During installation of grounding system, which represents a significant part of any electrical power system, various backfill materials are used for grounding resistance reduction. The general mathematical method for determining an optimal quantity of backfill materials used for grounding resistance reduction, based on the mathematical tools, 3D FEM modeling, numerical analysis of the obtained results, and the “knee” of the curve concept, as well as on the engineering analysis based on the designer’s experience, is developed and offered in this paper. The proposed method has been tested by applying it to a square loop enveloped by a backfill material and buried in a 2-layer soil. The results obtained by the presented method showed a good correlation with the experimentally obtained data from literature. The proposed method can help the designers to avoid the saturation areas in order to maximize efficiency of backfill material usage.

  14. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays...... for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined...... in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes...

  15. Polar Bears

    Science.gov (United States)

    Amstrup, Steven C.; Douglas, David C.; Reynolds, Patricia E.; Rhode, E.B.

    2002-01-01

    Polar bears (Ursus maritimus) are hunted throughout most of their range. In addition to hunting polar bears of the Beaufort Sea region are exposed to mineral and petroleum extraction and related human activities such as shipping road-building, and seismic testing (Stirling 1990).Little was known at the start of this project about how polar bears move about in their environment, and although it was understood that many bears travel across political borders, the boundaries of populations had not been delineated (Amstrup 1986, Amstrup et al. 1986, Amstrup and DeMaster 1988, Garner et al. 1994, Amstrup 1995, Amstrup et al. 1995, Amstrup 2000).As human populations increase and demands for polar bears and other arctic resources escalate, managers must know the sizes and distributions of the polar bear populations. Resource managers also need reliable estimates of breeding rates, reproductive intervals, litter sizes, and survival of young and adults.Our objectives for this research were 1) to determine the seasonal and annual movements of polar bears in the Beaufort Sea, 2) to define the boundaries of the population(s) using this region, 3) to determine the size and status of the Beaufort Sea polar bear population, and 4) to establish reproduction and survival rates (Amstrup 2000).

  16. A new method for calculating gas saturation of low-resistivity shale gas reservoirs

    Directory of Open Access Journals (Sweden)

    Jinyan Zhang

    2017-09-01

    Full Text Available The Jiaoshiba shale gas field is located in the Fuling area of the Sichuan Basin, with the Upper Ordovician Wufeng–Lower Silurian Longmaxi Fm as the pay zone. At the bottom of the pay zone, a high-quality shale gas reservoir about 20 m thick is generally developed with high organic contents and gas abundance, but its resistivity is relatively low. Accordingly, the gas saturation calculated by formulas (e.g. Archie using electric logging data is often much lower than the experiment-derived value. In this paper, a new method was presented for calculating gas saturation more accurately based on non-electric logging data. Firstly, the causes for the low resistivity of shale gas reservoirs in this area were analyzed. Then, the limitation of traditional methods for calculating gas saturation based on electric logging data was diagnosed, and the feasibility of the neutron–density porosity overlay method was illustrated. According to the response characteristics of neutron, density and other porosity logging in shale gas reservoirs, a model for calculating gas saturation of shale gas was established by core experimental calibration based on the density logging value, the density porosity and the difference between density porosity and neutron porosity, by means of multiple methods (e.g. the dual-porosity overlay method by optimizing the best overlay coefficient. This new method avoids the effect of low resistivity, and thus can provide normal calculated gas saturation of high-quality shale gas reservoirs. It works well in practical application. This new method provides a technical support for the calculation of shale gas reserves in this area. Keywords: Shale gas, Gas saturation, Low resistivity, Non-electric logging, Volume density, Compensated neutron, Overlay method, Reserves calculation, Sichuan Basin, Jiaoshiba shale gas field

  17. Inductive method to measure very small joint resistances of superconducting wires

    CERN Document Server

    Herzog, R

    1998-01-01

    In the Large Hadron Collider (LHC), which is currently being developed at CERN, about 50,000 connections of superconducting wire will be necessary to implement all circuits for powering 6000 corrector magnets with a maximum current of 600 A. To minimise the generation of ohmic heat in the cryogenic system, it is necessary to reduce the contact resistance of these connections as much as possible. This paper describes a method to measure contact resistances of splices of superconducting wires, which has been used to optimise such connections. Additionally we present results of a number of measurements on different types of connections. (2 refs).

  18. About the use of spatial interpolation methods to denoising Moroccan resistivity data phosphate “disturbances” map

    Directory of Open Access Journals (Sweden)

    Mahacine Amrani

    2008-06-01

    Full Text Available Several methods are currently used to optimize edges and contours of geophysical data maps. A resistivity map was expectedto allow the electrical resistivity signal to be imaged in 2D in Moroccan resistivity survey in the phosphate mining domain. Anomalouszones of phosphate deposit “disturbances” correspond to resistivity anomalies. The resistivity measurements were taken at 5151discrete locations. Much of the geophysical spatial analysis requires a continuous data set and this study is designed to create that surface. This paper identifies the best spatial interpolation method to use for the creation of continuous data for Moroccan resistivity data of phosphate “disturbances” zones. The effectiveness of our approach for successfully reducing noise has been used much successin the analysis of stationary geophysical data as resistivity data. The interpolation filtering approach methods applied to modelingsurface phosphate “disturbances” was found to be consistently useful.

  19. Experimental Study on Electrode Method for Electrical Resistivity Survey to Detect Cavities under Road Pavements

    Directory of Open Access Journals (Sweden)

    Chang-Seon Park

    2017-12-01

    Full Text Available There are two types of electrode methods for electrical resistivity survey (ERS: the pole electrode method (PEM and flat electrode method (FEM. During the past few decades, most studies were conducted by using PEM for various purposes while only a few were conducted by using FEM. Laboratory and field experiments were performed in this study to investigate the advantage of FEM in detecting cavities under pavements. In the laboratory experiment, the results of PEM and FEM were compared graphically and statistically. A significant difference between the results of PEM and FEM was observed for concrete at an age of seven days, while there was no significant difference in the results for soil materials. Electrical resistivity could not be obtained from asphalt because it is an insulator. In a field experiment, four different cases were simulated: field ground with/without cavity and concrete pavement with/without cavity. The results of PEM and FEM for these cases were compared using 2D electrical resistivity contour images. It was observed that the distribution of electrical resistivity obtained using FEM was wider than that using PEM. Moreover, the locations of the cavities artificially made in the ground and under the pavement were accurately detected using both PEM and FEM.

  20. Impact of Air Entraining Method on the Resistance of Concrete to Internal Cracking

    Science.gov (United States)

    Wawrzeńczyk, Jerzy; Molendowska, Agnieszka

    2017-10-01

    This paper presents the test results of air entrained concrete mixtures made at a constant W/C ratio of 0.44. Three different air entraining agents were used: polymer microspheres, glass microspheres and a conventional air entraining admixture. The aim of this study was to compare the effectiveness of the air entraining methods. Concrete mixture tests were performed for consistency (slump test), density and, in the case of AEA series, air content by pressure method. Hardened concrete tests were performed for compressive strength, water absorption, resistance to chloride ingress, and freeze-thaw durability - resistance to internal cracking tests were conducted in accordance with PN-88/B-06250 on cube specimens and with the modified ASTM C666 A test method on beam specimens; porosity characteristics (A, A300, \\bar L) were determined to PN-EN 480-11:1998. No significant mass and length changes were recorded for the concrete air entrained with the conventional methods or with polymer microspheres. The results indicate that polymer microspheres are a very good alternative to traditional air entraining methods for concrete, providing effective air entrainment and protection from freezing and thawing. The glass microsphere-based concretes showed insufficient freeze-thaw resistance. The test results indicate that both the conventional methods (AEA) and the air entrainment by polymer microspheres are effective air entraining methods. It has to be noted that in the case of the use of polymer microspheres, a comparable value of \\bar L and a very good freeze-thaw resistance can be achieved at a noticeably lower air and micropore contents and at lower strength loss.

  1. Resazurin tube method: rapid, simple, and inexpensive method for detection of drug resistance in the clinical isolates of mycobacterium tuberculosis.

    Science.gov (United States)

    Patil, Santosh S; Mohite, Shivajirao T; Kulkarni, Sunanda A; Udgaonkar, Usha S

    2014-10-01

    Tuberculosis (TB) remains a serious public health problem worldwide. The emergence of drug resistance and multidrug resistance (MDR) has become the main threat to TB treatment and control programs. Rapid detection is critical for the effective treatment of patients. In recent times, a new method using the colorimetric indicator resazurin has been proposed for drug susceptibility of Mycobacterium tuberculosis. In this study, the resazurin reduction assay was adapted to screw cap tubes. Using the Resazurin Tube Method (RTM), a total of 100 clinical isolates were tested against Rifampicin (RIF) and Isoniazide (INH). By visual reading, the minimum inhibitory concentrations (MICs) were obtained after eight days. The results obtained were compared with the gold standard proportion method. Excellent results were obtained for RTM with a sensitivity of 100% for both RIF and INH, with a specificity of 98.7 and 95.3%, respectively. Kappa is the measure of agreement between the RTM and proportion method (PM) for RIF and INH, which was found to be 0.972 and 0.935 for RIF and INH, respectively. The RTM appears to be a reliable method for the rapid and simultaneous detection of MDR-TB and drug susceptibility testing (DST) of M. tuberculosis. It is simple, inexpensive, and with no biohazard risk involved.

  2. Oxidation resistant nanocrystalline MCrAl(Y) coatings and methods of forming such coatings

    Science.gov (United States)

    Cheruvu, Narayana S.; Wei, Ronghua

    2014-07-29

    The present disclosure relates to an oxidation resistant nanocrystalline coating and a method of forming an oxidation resistant nanocrystalline coating. An oxidation resistant coating comprising an MCrAl(Y) alloy may be deposited on a substrate, wherein M, includes iron, nickel, cobalt, or combinations thereof present greater than 50 wt % of the MCrAl(Y) alloy, chromium is present in the range of 15 wt % to 30 wt % of the MCrAl(Y) alloy, aluminum is present in the range of 6 wt % to 12 wt % of the MCrAl(Y) alloy and yttrium, is optionally present in the range of 0.1 wt % to 0.5 wt % of the MCrAl(Y) alloy. In addition, the coating may exhibit a grain size of 200 nm or less as deposited.

  3. Sampling and Pooling Methods for Capturing Herd Level Antibiotic Resistance in Swine Feces using qPCR and CFU Approaches.

    Science.gov (United States)

    Schmidt, Gunilla Veslemøy; Mellerup, Anders; Christiansen, Lasse Engbo; Ståhl, Marie; Olsen, John Elmerdahl; Angen, Øystein

    2015-01-01

    The aim of this article was to define the sampling level and method combination that captures antibiotic resistance at pig herd level utilizing qPCR antibiotic resistance gene quantification and culture-based quantification of antibiotic resistant coliform indicator bacteria. Fourteen qPCR assays for commonly detected antibiotic resistance genes were developed, and used to quantify antibiotic resistance genes in total DNA from swine fecal samples that were obtained using different sampling and pooling methods. In parallel, the number of antibiotic resistant coliform indicator bacteria was determined in the same swine fecal samples. The results showed that the qPCR assays were capable of detecting differences in antibiotic resistance levels in individual animals that the coliform bacteria colony forming units (CFU) could not. Also, the qPCR assays more accurately quantified antibiotic resistance genes when comparing individual sampling and pooling methods. qPCR on pooled samples was found to be a good representative for the general resistance level in a pig herd compared to the coliform CFU counts. It had significantly reduced relative standard deviations compared to coliform CFU counts in the same samples, and therefore differences in antibiotic resistance levels between samples were more readily detected. To our knowledge, this is the first study to describe sampling and pooling methods for qPCR quantification of antibiotic resistance genes in total DNA extracted from swine feces.

  4. A Novel Crosstalk Suppression Method of the 2-D Networked Resistive Sensor Array

    Directory of Open Access Journals (Sweden)

    Jianfeng Wu

    2014-07-01

    Full Text Available The 2-D resistive sensor array in the row–column fashion suffered from the crosstalk problem for parasitic parallel paths. Firstly, we proposed an Improved Isolated Drive Feedback Circuit with Compensation (IIDFCC based on the voltage feedback method to suppress the crosstalk. In this method, a compensated resistor was specially used to reduce the crosstalk caused by the column multiplexer resistors and the adjacent row elements. Then, a mathematical equivalent resistance expression of the element being tested (EBT of this circuit was analytically derived and verified by the circuit simulations. The simulation results show that the measurement method can greatly reduce the influence on the EBT caused by parasitic parallel paths for the multiplexers’ channel resistor and the adjacent elements.

  5. Correction of the heat loss method for calculating clothing real evaporative resistance.

    Science.gov (United States)

    Wang, Faming; Zhang, Chengjiao; Lu, Yehu

    2015-08-01

    In the so-called isothermal condition (i.e., Tair [air temperature]=Tmanikin [manikin temperature]=Tr [radiant temperature]), the actual energy used for moisture evaporation detected by most sweating manikins was underestimated due to the uncontrolled fabric 'skin' temperature Tsk,f (i.e., Tsk,fclothing real evaporative resistance. In this study, correction of the real evaporative heat loss from the wet fabric 'skin'-clothing system was proposed and experimentally validated on a 'Newton' sweating manikin. The real evaporative resistance of five clothing ensembles and the nude fabric 'skin' calculated by the corrected heat loss method was also reported and compared with that by the mass loss method. Results revealed that, depending on the types of tested clothing, different amounts of heat were drawn from the ambient environment. In general, a greater amount of heat was drawn from the ambient environment by the wet fabric 'skin'-clothing system in lower thermal insulation clothing than that in higher insulation clothing. There were no significant differences between clothing real evaporative resistances calculated by the corrected heat loss method and those by the mass loss method. It was therefore concluded that the correction method proposed in this study has been successfully validated. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Standard test method for determination of resistance to stable crack extension under low-constraint conditions

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2006-01-01

    1.1 This standard covers the determination of the resistance to stable crack extension in metallic materials in terms of the critical crack-tip-opening angle (CTOAc), ψc and/or the crack-opening displacement (COD), δ5 resistance curve (1). This method applies specifically to fatigue pre-cracked specimens that exhibit low constraint (crack-length-to-thickness and un-cracked ligament-to-thickness ratios greater than or equal to 4) and that are tested under slowly increasing remote applied displacement. The recommended specimens are the compact-tension, C(T), and middle-crack-tension, M(T), specimens. The fracture resistance determined in accordance with this standard is measured as ψc (critical CTOA value) and/or δ5 (critical COD resistance curve) as a function of crack extension. Both fracture resistance parameters are characterized using either a single-specimen or multiple-specimen procedures. These fracture quantities are determined under the opening mode (Mode I) of loading. Influences of environment a...

  7. PEPPo: Using a Polarized Electron Beam to Produce Polarized Positrons

    Energy Technology Data Exchange (ETDEWEB)

    Adeyemi, Adeleke H. [Hampton Univ., Hampton, VA (United States); et al.

    2015-09-01

    Polarized positron beams have been identified as either an essential or a significant ingredient for the experimental program of both the present and next generation of lepton accelerators (JLab, Super KEK B, ILC, CLIC). An experiment demonstrating a new method for producing polarized positrons has been performed at the Continuous Electron Beam Accelerator Facility at Jefferson Lab. The PEPPo (Polarized Electrons for Polarized Positrons) concept relies on the production of polarized e⁻/e⁺ pairs from the bremsstrahlung radiation of a longitudinally polarized electron beam interacting within a high-Z conversion target. PEPPo demonstrated the effective transfer of spin-polarization of an 8.2 MeV/c polarized (P~85%) electron beam to positrons produced in varying thickness tungsten production targets, and collected and measured in the range of 3.1 to 6.2 MeV/c. In comparison to other methods this technique reveals a new pathway for producing either high-energy or thermal polarized positron beams using a relatively low polarized electron beam energy (~10MeV) .This presentation will describe the PEPPo concept, the motivations of the experiment and high positron polarization achieved.

  8. Fast and sensitive method to determine parabens by capillary electrophoresis using automatic reverse electrode polarity stacking mode: application to hair samples.

    Science.gov (United States)

    Sako, Alysson V F; Dolzan, Maressa D; Micke, Gustavo Amadeu

    2015-09-01

    This paper describes a fast and sensitive method for the determination of methyl, ethyl, propyl, and butylparaben in hair samples by capillary electrophoresis using automatic reverse electrode polarity stacking mode. In the proposed method, solutions are injected using the flush command of the analysis software (940 mbar) and the polarity switching is carried out automatically immediately after the sample injection. The advantages compared with conventional stacking methods are the increased analytical frequency, repeatability, and inter-day precision. All analyses were performed in a fused silica capillary (50 cm, 41.5 cm in effective length, 50 μm i.d.), and the background electrolyte was composed of 20 mmol L(-1) sodium tetraborate in 10 % of methanol, pH 9.3. For the reverse polarity, -25 kV/35 s was applied followed by application of +30 kV for the electrophoretic run. Temperature was set at 20 °C, and all analytes were monitored at 297 nm. The method showed acceptable linearity (r (2) > 0.997) in the studied range of 0.1-5.0 mg L(-1), limits of detection below 0.017 mg L(-1), and inter-day, intra-day, and instrumental precision better than 6.2, 3.6, and 4.6 %, respectively. Considering parabens is widely used as a preservative in many products and the reported possibility of damage to the hair and also to human health caused by these compounds, the proposed method was applied to evaluate the adsorption of parabens in hair samples. The results indicate that there is a greater adsorption of methylparaben compared to the other parabens tested and also dyed hairs had a greater adsorption capacity for parabens than natural hairs.

  9. Proliferation resistance assessment of various methods of spent nuclear fuel storage and disposal

    Science.gov (United States)

    Kollar, Lenka

    Many countries are planning to build or already are building new nuclear power plants to match their growing energy needs. Since all nuclear power plants handle nuclear materials that could potentially be converted and used for nuclear weapons, they each present a nuclear proliferation risk. Spent nuclear fuel presents the largest build-up of nuclear material at a power plant. This is a proliferation risk because spent fuel contains plutonium that can be chemically separated and used for a nuclear weapon. The International Atomic Energy Agency (IAEA) safeguards spent fuel in all non-nuclear weapons states that are party to the Non-Proliferation Treaty. Various safeguards methods are in use at nuclear power plants and research is underway to develop safeguards methods for spent fuel in centralized storage or underground storage and disposal. Each method of spent fuel storage presents different proliferation risks due to the nature of the storage method and the safeguards techniques that are utilized. Previous proliferation resistance and proliferation risk assessments have mainly compared nuclear material through the whole fuel cycle and not specifically focused on spent fuel storage. This project evaluates the proliferation resistance of the three main types of spent fuel storage: spent fuel pool, dry cask storage, and geological repository. The proliferation resistance assessment methodology that is used in this project is adopted from previous work and altered to be applicable to spent fuel storage. The assessment methodology utilizes various intrinsic and extrinsic proliferation-resistant attributes for each spent fuel storage type. These attributes are used to calculate a total proliferation resistant (PR) value. The maximum PR value is 1.00 and a greater number means that the facility is more proliferation resistant. Current data for spent fuel storage in the United States and around the world was collected. The PR values obtained from this data are 0.49 for

  10. Survey of anthelmintic resistance on Danish horse farms, using 5 different methods of calculating faecal egg count reduction

    DEFF Research Database (Denmark)

    Craven, J.; Bjørn, H.; Henriksen, S.A.

    1998-01-01

    This study reports on the prevalence of anthelmintic resistance in strongyles of horses in Denmark; Of 5 methods used for the calculation of faecal egg count reduction (FECR) the method recommended by the World Association for the Advancement of Veterinary Parasitology, for the detection of resis......This study reports on the prevalence of anthelmintic resistance in strongyles of horses in Denmark; Of 5 methods used for the calculation of faecal egg count reduction (FECR) the method recommended by the World Association for the Advancement of Veterinary Parasitology, for the detection...... of resistance in sheep was the most sensitive procedure for detecting resistance. Using this method benzimidazole resistance was detected on 33 of 42 farms (79%) examined. Pyrantel was tested on 15 farms and FECR tests indicate resistance on 3 (30%) farms. On 2 farms on which resistance to pyrantel was detected...... resistance to benzimidazoles was also detected. On one of 16 farms examined ivermectin resistance was indicated at Day 14 but not at Day 19. On the 15 remaining farms ivermectin was effective. Due to the high prevalence of anthelmintic resistance in Danish horse herds it is recommended that tests...

  11. Recursion-transform method for computing resistance of the complex resistor network with three arbitrary boundaries.

    Science.gov (United States)

    Tan, Zhi-Zhong

    2015-05-01

    We develop a general recursion-transform (R-T) method for a two-dimensional resistor network with a zero resistor boundary. As applications of the R-T method, we consider a significant example to illuminate the usefulness for calculating resistance of a rectangular m×n resistor network with a null resistor and three arbitrary boundaries, a problem never solved before, since Green's function techniques and Laplacian matrix approaches are invalid in this case. Looking for the exact calculation of the resistance of a binary resistor network is important but difficult in the case of an arbitrary boundary since the boundary is like a wall or trap which affects the behavior of finite network. In this paper we obtain several general formulas of resistance between any two nodes in a nonregular m×n resistor network in both finite and infinite cases. In particular, 12 special cases are given by reducing one of the general formulas to understand its applications and meanings, and an integral identity is found when we compare the equivalent resistance of two different structures of the same problem in a resistor network.

  12. Mechanisms of methicillin resistance in Staphylococcus aureus and methods for laboratory detection.

    Science.gov (United States)

    Jorgensen, J H

    1991-01-01

    Three distinctly different mechanisms of methicillin resistance have been described in Staphylococcus aureus. The best-documented and probably most important mechanism is production of a unique, low affinity penicillin-binding protein, PBP 2a. Strains possessing PBP 2a are resistant to methicillin, oxacillin, and probably all other currently available beta-lactam antibiotics. Two additional mechanisms of reduced susceptibility to methicillin have been described. Borderline resistance (BORSA) to the semi-synthetic penicillins has been attributed to the hyperproduction of normal staphylococcal beta-lactamase. A third mechanism has recently been advanced that describes an intermediate level of resistance to methicillin due to production of modified, normal PBPs with reduced affinity for beta-lactams (MODSA). Little is known regarding the prevalence or clinical significance of the BORSA and MODSA strains. The most reliable in vitro susceptibility test methods for detecting MRSA (strains possessing PBP 2a) include the microdilution minimum inhibitory concentration (MIC) test (with 2% NaCl supplemented broth), the oxacillin agar screen plate test (incorporating 6 micrograms/ml oxacillin in 4% NaCl supplemented agar), and the National Committee for Clinical Laboratory Standards (NCCLS) disk diffusion test with oxacillin. All three methods use direct inoculum preparation and incubation of tests at 35 degrees C for a full 24 hours.

  13. Normalized resistance interpretation, the NRI method: Review of NRI disc test applications and guide to calculations.

    Science.gov (United States)

    Kronvall, Göran; Smith, Peter

    2016-12-01

    The normalized resistance interpretation (NRI) method was developed in response to a call for a method to calibrate disc diffusion test results making inter-laboratory comparisons possible. The main use of NRI so far has been in individual laboratories, in medical and veterinary medicine and in the field of marine microbiology. The applications of NRI for disc diffusion tests are reviewed and, in addition, a detailed description of the calculation procedure is presented. NRI provides a fully objective method for ECOFF calculations of disc diffusion antimicrobial susceptibility test results. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  14. Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles

    Directory of Open Access Journals (Sweden)

    Yan Jiang

    2013-06-01

    Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.

  15. Ectoparasites of medical and veterinary importance: drug resistance and the need for alternative control methods.

    Science.gov (United States)

    McNair, Carol M

    2015-03-01

    Despite multiple attempts at eradication, many ectoparasites of humans and domestic livestock remain a persistent problem in the modern world. For many years, a range of pesticide drugs including organophosphates, organochlorides and synthetic pyrethroids provided effective control of these parasites; but intensive use of these drugs has led to the evolution of resistance in many target species. This paper aims to review the effectiveness of current control methods and discuss potential alternatives for the long term sustainable control of ectoparasites. Important medical ectoparasites such as scabies mites, head lice and bed bugs present a significant public health problem, and so adequate control methods are essential. Ectoparasites of domestic livestock and farmed fish (for example sheep scab mites, poultry mites and sea lice) are also of concern given the increasing strain on the world's food supply. These parasites have become resistant to several classes of pesticide, making control very difficult. Recently, an increasing amount of research has focussed on alternative control methods such as insect growth regulators, biological control using essential oils or fungi, as well as vaccine development against some ectoparasites of medical and veterinary importance. Drug resistance is prevalent in all of the ectoparasites discussed in this review. A wide variety of alternative control methods have been identified, however further research is necessary in order for these to be used to successfully control ectoparasitic diseases in the future. © 2015 Royal Pharmaceutical Society.

  16. Growth of non-polar (11-20 InGaN quantum dots by metal organic vapour phase epitaxy using a two temperature method

    Directory of Open Access Journals (Sweden)

    J. T. Griffiths

    2014-12-01

    Full Text Available Non-polar (11-20 InGaN quantum dots (QDs were grown by metal organic vapour phase epitaxy. An InGaN epilayer was grown and subjected to a temperature ramp in a nitrogen and ammonia environment before the growth of the GaN capping layer. Uncapped structures with and without the temperature ramp were grown for reference and imaged by atomic force microscopy. Micro-photoluminescence studies reveal the presence of resolution limited peaks with a linewidth of less than ∼500 μeV at 4.2 K. This linewidth is significantly narrower than that of non-polar InGaN quantum dots grown by alternate methods and may be indicative of reduced spectral diffusion. Time resolved photoluminescence studies reveal a mono-exponential exciton decay with a lifetime of 533 ps at 2.70 eV. The excitonic lifetime is more than an order of magnitude shorter than that for previously studied polar quantum dots and suggests the suppression of the internal electric field. Cathodoluminescence studies show the spatial distribution of the quantum dots and resolution limited spectral peaks at 18 K.

  17. Dynamic nuclear spin polarization

    Energy Technology Data Exchange (ETDEWEB)

    Stuhrmann, H.B. [GKSS-Forschungszentrum Geesthacht GmbH (Germany)

    1996-11-01

    Polarized neutron scattering from dynamic polarized targets has been applied to various hydrogenous materials at different laboratories. In situ structures of macromolecular components have been determined by nuclear spin contrast variation with an unprecedented precision. The experiments of selective nuclear spin depolarisation not only opened a new dimension to structural studies but also revealed phenomena related to propagation of nuclear spin polarization and the interplay of nuclear polarisation with the electronic spin system. The observation of electron spin label dependent nuclear spin polarisation domains by NMR and polarized neutron scattering opens a way to generalize the method of nuclear spin contrast variation and most importantly it avoids precontrasting by specific deuteration. It also likely might tell us more about the mechanism of dynamic nuclear spin polarisation. (author) 4 figs., refs.

  18. A Numerical Method for Modeling the Effects of Irregular Shape on Interconnect Resistance

    Science.gov (United States)

    Chen, Bao-Jun; Tang, Zhen-An; Ju, Yan-Jie

    2014-05-01

    When clock frequencies exceed gigahertz, the skin depth in analog and digital circuits greatly decreases. The irregular shape of the cross section of the interconnect plays an increasingly important role in interconnect parasitic extraction. However, existing methods only focus on the rough surface of the interconnect, while ignoring other irregular shapes, such as the trapezoidal cross section. In this work, a new simulation method is proposed for irregular interconnects, which is applicable to arbitrary irregular shapes and to a wide range of frequencies. The method involves generating a mesh information file firstly and then extracting the frequency-dependent resistance based on a numerical solution of scalar wave modeling by using the method of moments. The singularity extraction method is used to calculate the self-inductors. The data from experiments verify the accuracy of our proposed method.

  19. The polarization modulation and fabrication method of two dimensional silica photonic crystals based on UV nanoimprint lithography and hot imprint.

    Science.gov (United States)

    Guo, Shuai; Niu, Chunhui; Liang, Liang; Chai, Ke; Jia, Yaqing; Zhao, Fangyin; Li, Ya; Zou, Bingsuo; Liu, Ruibin

    2016-10-04

    Based on a silica sol-gel technique, highly-structurally ordered silica photonic structures were fabricated by UV lithography and hot manual nanoimprint efforts, which makes large-scale fabrication of silica photonic crystals easy and results in low-cost. These photonic structures show perfect periodicity, smooth and flat surfaces and consistent aspect ratios, which are checked by scanning electron microscopy (SEM) and atomic force microscopy (AFM). In addition, glass substrates with imprinted photonic nanostructures show good diffraction performance in both transmission and reflection mode. Furthermore, the reflection efficiency can be enhanced by 5 nm Au nanoparticle coating, which does not affect the original imprint structure. Also the refractive index and dielectric constant of the imprinted silica is close to that of the dielectric layer in nanodevices. In addition, the polarization characteristics of the reflected light can be modulated by stripe nanostructures through changing the incident light angle. The experimental findings match with theoretical results, making silica photonic nanostructures functional integration layers in many optical or optoelectronic devices, such as LED and microlasers to enhance the optical performance and modulate polarization properties in an economical and large-scale way.

  20. Field and greenhouse inoculation methods for assessment of sheath blight resistance in rice

    Directory of Open Access Journals (Sweden)

    Leila Garcês de Araújo

    2007-01-01

    Full Text Available Field and greenhouse inoculation methods were compared to determine the genetic variation for resistance toRhizoctonia solani in 38 somaclones of rice cultivar Metica-1. Rice plants in pots were inoculated with isolate 4F1 at the ageof sixty four days, with 2.0 g of the fungal culture, multiplied on rice grain and hull medium and placed on the soil surfacearound the plant. The differences among somaclones in relation to lesion height were significant and varied from 6.5 to 15.5cm. In the field trial of artificial inoculation with fungal culture, 52 days after planting, the lesion height varied from 6.2 to 17.7cm. The correlation between disease severity in the greenhouse and the field was positive and highly significant (r=0.44;P< 0.01, indicating the greenhouse inoculation as a safe method for screening germplasm for sheath blight resistance.

  1. A pseudo-spectral method for the simulation of poro-elastic seismic wave propagation in 2D polar coordinates using domain decomposition

    Energy Technology Data Exchange (ETDEWEB)

    Sidler, Rolf, E-mail: rsidler@gmail.com [Center for Research of the Terrestrial Environment, University of Lausanne, CH-1015 Lausanne (Switzerland); Carcione, José M. [Istituto Nazionale di Oceanografia e di Geofisica Sperimentale (OGS), Borgo Grotta Gigante 42c, 34010 Sgonico, Trieste (Italy); Holliger, Klaus [Center for Research of the Terrestrial Environment, University of Lausanne, CH-1015 Lausanne (Switzerland)

    2013-02-15

    We present a novel numerical approach for the comprehensive, flexible, and accurate simulation of poro-elastic wave propagation in 2D polar coordinates. An important application of this method and its extensions will be the modeling of complex seismic wave phenomena in fluid-filled boreholes, which represents a major, and as of yet largely unresolved, computational problem in exploration geophysics. In view of this, we consider a numerical mesh, which can be arbitrarily heterogeneous, consisting of two or more concentric rings representing the fluid in the center and the surrounding porous medium. The spatial discretization is based on a Chebyshev expansion in the radial direction and a Fourier expansion in the azimuthal direction and a Runge–Kutta integration scheme for the time evolution. A domain decomposition method is used to match the fluid–solid boundary conditions based on the method of characteristics. This multi-domain approach allows for significant reductions of the number of grid points in the azimuthal direction for the inner grid domain and thus for corresponding increases of the time step and enhancements of computational efficiency. The viability and accuracy of the proposed method has been rigorously tested and verified through comparisons with analytical solutions as well as with the results obtained with a corresponding, previously published, and independently benchmarked solution for 2D Cartesian coordinates. Finally, the proposed numerical solution also satisfies the reciprocity theorem, which indicates that the inherent singularity associated with the origin of the polar coordinate system is adequately handled.

  2. A Quantitative Method to Screen Common Bean Plants for Resistance to Bean common mosaic necrosis virus.

    Science.gov (United States)

    Strausbaugh, C A; Myers, J R; Forster, R L; McClean, P E

    2003-11-01

    ABSTRACT A quantitative method to screen common bean (Phaseolus vulgaris) plants for resistance to Bean common mosaic necrosis virus (BCMNV) is described. Four parameters were assessed in developing the quantitative method: symptoms associated with systemic virus movement, plant vigor, virus titer, and plant dry weight. Based on these parameters, two rating systems (V and VV rating) were established. Plants from 21 recombinant inbred lines (RILs) from a Sierra (susceptible) x Olathe (partially resistant) cross inoculated with the BCMNV-NL-3 K strain were used to evaluate this quantitative approach. In all, 11 RILs exhibited very susceptible reactions and 10 RILs expressed partially resistant reactions, thus fitting a 1:1 susceptible/partially resistant ratio (chi(2) = 0.048, P = 0.827) and suggesting that the response is mediated by a single gene. Using the classical qualitative approach based only on symptom expression, the RILs were difficult to separate into phenotypic groups because of a continuum of responses. By plotting mean percent reduction in either V (based on visual symptoms) or VV (based on visual symptoms and vigor) rating versus enzyme-linked immunosorbent assay (ELISA) absorbance values, RILs could be separated clearly into different phenotypic groups. The utility of this quantitative approach also was evaluated on plants from 12 cultivars or pure lines inoculated with one of three strains of BCMNV. Using the mean VV rating and ELISA absorbance values, significant differences were established not only in cultivar and pure line comparisons but also in virus strain comparisons. This quantitative system should be particularly useful for the evaluation of the independent action of bc genes, the discovery of new genes associated with partial resistance, and assessing virulence of virus strains.

  3. Measurement of inclusive quasielastic scattering of polarized electrons from polarized 3He

    International Nuclear Information System (INIS)

    Woodward, C.E.; Beise, E.J.; Belz, J.E.; Carr, R.W.; Filippone, B.W.; Lorenzon, W.B.; McKeown, R.D.; Mueller, B.; O'Neill, T.G.; Dodson, G.; Dow, K.; Farkhondeh, M.; Kowalski, S.; Lee, K.; Makins, N.; Milner, R.; Thompson, A.; Tieger, D.; van den Brand, J.; Young, A.; Yu, X.; Zumbro, J.

    1990-01-01

    We report a measurement of the asymmetry in spin-dependent quasielastic scattering of longitudinally polarized electrons from a polarized 3 He gas target. This measurement represents the first demonstration of a new method for studying electromagnetic nuclear structure: the scattering of polarized electrons from a polarized nuclear target. The measured asymmetry is in good agreement with a Faddeev calculation and supports the picture of spin-dependent quasielastic scattering from polarized 3 He as predominantly scattering from a polarized neutron

  4. A Simultaneous Analytical Method to Profile Non-Volatile Components with Low Polarity Elucidating Differences Between Tobacco Leaves Using Atmospheric Pressure Chemical Ionization Mass Spectrometry Detection

    Directory of Open Access Journals (Sweden)

    Ishida Naoyuki

    2016-04-01

    Full Text Available A comprehensive analytical method using liquid chromatography atmospheric pressure chemical ionization mass spectrometry detector (LC/APCI-MSD was developed to determine key non-volatile components with low polarity elucidating holistic difference among tobacco leaves. Nonaqueous reversed-phase chromatography (NARPC using organic solvent ensured simultaneous separation of various components with low polarity in tobacco resin. Application of full-scan mode to APCI-MSD hyphenated with NARPC enabled simultaneous detection of numerous intense product ions given by APCI interface. Parameters for data processing to filter, feature and align peaks were adjusted in order to strike a balance between comprehensiveness and reproducibility in analysis. 63 types of components such as solanesols, chlorophylls, phytosterols, triacylglycerols, solanachromene and others were determined on total ion chromatograms according to authentic components, wavelength spectrum and mass spectrum. The whole area of identified entities among the ones detected on total ion chromatogram reached to over 60% and major entities among those identified showed favorable linearity of determination coefficient of over 0.99. The developed method and data processing procedure were therefore considered feasible for subsequent multivariate analysis. Data matrix consisting of a number of entities was then subjected to principal component analysis (PCA and hierarchical clustering analysis. Cultivars of tobacco leaves were distributed far from each cultivar on PCA score plot and each cluster seemed to be characterized by identified non-volatile components with low polarity. While fluecured Virginia (FCV was loaded by solanachromene, phytosterol esters and triacylglycerols, free phytosterols and chlorophylls loaded Burley (BLY and Oriental (ORI respectively. Consequently the whole methodology consisting of comprehensive method and data processing procedure proved useful to determine key

  5. 2.5-D and 3-D DC resistivity modelling using an extrapolation cascadic multigrid method

    Science.gov (United States)

    Pan, Kejia; Tang, Jingtian

    2014-06-01

    Multigrid methods are well known for their high efficiency in solving elliptic boundary value problems. In this study, an improved extrapolation cascadic multigrid (EXCMG) method is presented to solve large sparse systems of linear equations, which are discretized from both 2.5-D and 3-D DC resistivity modelling using the finite element methods. To increase the accuracy, the singularity generated by the source term is removed by reformulating the solution with the secondary potential. In addition, a set of new and efficient Fourier coefficient is presented to transform the solutions in the 2.5-D Fourier domain to the 3-D Cartesian domain. To show the efficiency and the ease-to-implement of EXCMG, we first implement the EXCMG methods to a two-layered model of both 2-D and 3-D and compare the results with the analytical solutions. It has been shown that the maximum relative error in apparent resistivity is no more than 0.4 per cent provided an appropriate grid size is chosen. Then the comparisons of EXCMG with two other iterative solvers [symmetric successive over-relaxation conjugate gradient (SSORCG) and incomplete Cholesky conjugate gradient (ICCG)] show that converging at a rate independent of the grid size, the EXCMG method is much more efficient than SSORCG and ICCG solvers. Moreover, the EXCMG method has been shown its potential for being generalized to large-scale 3-D problems, due to the fact that it becomes more efficient as the size of the problem increases.

  6. The `L' Array, a method to model 3D Electrical Resistivity Tomography (ERT) data

    Science.gov (United States)

    Chavez Segura, R. E.; Chavez-Hernandez, G.; Delgado, C.; Tejero-Andrade, A.

    2010-12-01

    The electrical resistivity tomography (ERT) is a method designed to calculate the distribution of apparent electrical resistivities in the subsoil by means of a great number of observations with the aim of determining an electrical image displaying the distribution of true resistivities in the subsoil. Such process can be carried out to define 2D or 3D models of the subsurface. For a 3D ERT, usually, the electrodes are placed in a squared grid keeping the distance between adjacent electrodes constant in the x and y directions. Another design employed, consists of a series of parallel lines whose space inter-lines must be smaller or equal to four times the electrode separation. The most common electrode arrays frequently employed for this type of studies are the pole-pole, pole-dipole and dipole-dipole. Unfortunately, ERT surface sampling schemes are limited by physical conditions or obstacles, like buildings, highly populated urban zones, and geologic/topographic features, where the lines of electrodes cannot be set. However, it is always necessary to characterize the subsoil beneath such anthropogenic or natural features. The ‘L’ shaped array has the main purpose to overcome such difficulties by surrounding the study area with a square of electrode lines. The measurements are obtained by switching automatically current and potential electrodes from one line to the other. Each observation adds a level of information, from one profile to the other. Once the total levels of data are completed, the opposite ‘L’ array can be measured following the same process. The complete square is computed after the parallel profiles are observed as well. At the end, the computed resistivities are combined to form a 3D matrix of observations. Such set of data can be inverted to obtain the true resistivity distribution at depth in the form of a working cube, which can be interpreted. The method was tested with theoretical models, which included a set of two resistive cubes

  7. H- ion current from a polarized vapor target

    International Nuclear Information System (INIS)

    Cornelius, W.D.

    1984-01-01

    A method of determining the polarization transferred to hydrogen atoms in charge-exchange reactions is outlined. The method also provides a means of determining target polarizations once the polarization transfer function is known

  8. Laboratory evaluation of phenotypic detection methods of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Kali, Arunava; Stephen, Selvaraj; Umadevi, Sivaraman

    2014-01-01

    Although conventional antibiotic susceptibility tests are most commonly performed for methicillin-resistant Staphylococcus aureus (MRSA), the results of these phenotypic tests are dependent on the standardization of the culture conditions. The aim of the study was to evaluate the conventional phenotypic screening tests in comparison to the mecA gene polymerase chain reaction (PCR). One hundred and two clinical isolates of MRSA identified by the oxacillin disk diffusion were subjected to PCR for the mecA gene and by the cefoxitin disk diffusion test and culture on oxacillin screen agar, mannitol salt agar, and methicillin-resistant Staphylococcus aureus Agar (MeReSA) selective medium, for MRSA. Although all 102 isolates were resistant in oxacillin and cefoxitin disk diffusion, 92 (90.1%) isolates were positive for the mecA gene. The sensitivities of the mannitol salt agar, MeReSA agar, and oxacillin screen agar were 89.13, 97.82, and 98.91%, respectively. The oxacillin screen agar may be recommended for confirming methicillin resistance in the disk diffusion test in resource-poor settings, where molecular methods are not available.

  9. Laboratory evaluation of phenotypic detection methods of methicillin-resistant Staphylococcus aureus

    Directory of Open Access Journals (Sweden)

    Arunava Kali

    2014-12-01

    Full Text Available Although conventional antibiotic susceptibility tests are most commonly performed for methicillin-resistant Staphylococcus aureus (MRSA, the results of these phenotypic tests are dependent on the standardization of the culture conditions. The aim of the study was to evaluate the conventional phenotypic screening tests in comparison to the mecA gene polymerase chain reaction (PCR. One hundred and two clinical isolates of MRSA identified by the oxacillin disk diffusion were subjected to PCR for the mecA gene and by the cefoxitin disk diffusion test and culture on oxacillin screen agar, mannitol salt agar, and methicillin-resistant Staphylococcus aureus Agar (MeReSA selective medium, for MRSA. Although all 102 isolates were resistant in oxacillin and cefoxitin disk diffusion, 92 (90.1% isolates were positive for the mecA gene. The sensitivities of the mannitol salt agar, MeReSA agar, and oxacillin screen agar were 89.13, 97.82, and 98.91%, respectively. The oxacillin screen agar may be recommended for confirming methicillin resistance in the disk diffusion test in resource-poor settings, where molecular methods are not available.

  10. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  11. A new quantitative evaluation method of spiral drawing for patients with Parkinson’s disease based on a polar coordinate system with varying origin

    Science.gov (United States)

    Wang, Min; Wang, Bei; Zou, Junzhong; Nakamura, Masatoshi

    2012-09-01

    Parkinson's disease (PD) is a common disease of the central nervous system among the elderly, and its complex symptoms bring up challenges for the clinical diagnosis. In this paper, a new method based on a polar coordinate system with varying origin was proposed in order to quantitatively evaluate the performance in spiral drawing tasks for patients with Parkinson's disease, since this method can assess the movement ability of spiral drawing before and after deep brain stimulation (DBS) among the patients. In this paper, three normal subjects and twelve PD patients participated in spiral drawing experiment. The hand movements of patients, before and after DBS, were recorded by a digitized tablet respectively in this experiment. And the variation of origin, radius, degree and other characteristics of hand movements were evaluated by introducing a set of parameters for feature extraction. The result showed that the proposed polar coordinate system embraced good performance in the quantitative evaluation of spiral drawing. Therefore, the proposed method overcame the limitation of data processes with fixed origin for diagnosis and evaluation, and by combining with extraction and analysis of characteristic parameters it had clinical significance in measuring the effectiveness of operation or treatment for the PD patients.

  12. Culture methods impact recovery of antibiotic-resistant Enterococci including Enterococcus cecorum from pre- and postharvest chicken.

    Science.gov (United States)

    Suyemoto, M M; Barnes, H J; Borst, L B

    2017-03-01

    Pathogenic strains of Enterococcus cecorum (EC) expressing multidrug resistance have emerged. In National Antimicrobial Resistance Monitoring System (NARMS) data, EC is rarely recovered from chickens. Two NARMS methodologies (FDA and USDA) were compared with standard culture (SC) techniques for recovery of EC. NARMS methods failed to detect EC in 58 caecal samples, 20 chicken breast or six whole broiler samples. EC was recovered from 1 of 38 (2·6%) and 2 of 38 (5·2%) preharvest spinal lesions (USDA and FDA method, respectively). In contrast, using the SC method, EC was recovered from 44 of 53 (83%) caecal samples, all 38 (100%) spinal lesions, 14 of 20 (70%) chicken breast samples, and all three spinal lesions identified in whole carcasses. Compared with other Enterococcus spp., EC isolates had a higher prevalence of resistance to macrolides. The NARMS methods significantly affected recovery of enterococcal species other than EC. When the postharvest FDA method was applied to preharvest caecal samples, isolates of Enterococcus faecium were preferentially recovered. All 11 E. faecium isolates were multidrug resistant, including resistance to penicillin, daptomycin and linezolid. These findings confirm that current methodologies may not accurately identify the amount and range of antimicrobial resistance of enterococci from chicken sources. Enterococci are an important reservoir for antimicrobial resistance. This study demonstrates how current culture methods underreport resistance to macrolides in enterococci by selecting against strains of Enterococcus cecorum in pre- and postharvest chicken. Further, the application of postharvest surveillance methods to preharvest samples resulted in selective recovery of Enterococcus faecium over Enterococcus faecalis. Isolates of E. faecium recovered exhibited multidrug resistance including penicillin, daptomycin and linezolid resistance. These findings suggest that culture methodology significantly impacts the range and

  13. Bioinspired Polarization Imaging Sensors: From Circuits and Optics to Signal Processing Algorithms and Biomedical Applications: Analysis at the focal plane emulates nature's method in sensors to image and diagnose with polarized light.

    Science.gov (United States)

    York, Timothy; Powell, Samuel B; Gao, Shengkui; Kahan, Lindsey; Charanya, Tauseef; Saha, Debajit; Roberts, Nicholas W; Cronin, Thomas W; Marshall, Justin; Achilefu, Samuel; Lake, Spencer P; Raman, Baranidharan; Gruev, Viktor

    2014-10-01

    In this paper, we present recent work on bioinspired polarization imaging sensors and their applications in biomedicine. In particular, we focus on three different aspects of these sensors. First, we describe the electro-optical challenges in realizing a bioinspired polarization imager, and in particular, we provide a detailed description of a recent low-power complementary metal-oxide-semiconductor (CMOS) polarization imager. Second, we focus on signal processing algorithms tailored for this new class of bioinspired polarization imaging sensors, such as calibration and interpolation. Third, the emergence of these sensors has enabled rapid progress in characterizing polarization signals and environmental parameters in nature, as well as several biomedical areas, such as label-free optical neural recording, dynamic tissue strength analysis, and early diagnosis of flat cancerous lesions in a murine colorectal tumor model. We highlight results obtained from these three areas and discuss future applications for these sensors.

  14. NMR dispersion measurement of dynamic nuclear polarization

    International Nuclear Information System (INIS)

    Davies, K.; Cox, S.F.J.

    1978-01-01

    The feasibility of monitoring dynamic nuclear polarization from the NMR dispersive susceptibility is examined. Two prototype instruments are tested in a polarized proton target using organic target material. The more promising employs a tunnel diode oscillator, inside the target cavity, and should provide a precise polarization measurement working at a frequency far enough from the main resonance for the disturbance of the measured polarization to be negligible. Other existing methods for measuring target polarization are briefly reviewed. (author)

  15. Estimating Penetration Resistance in Agricultural Soils of Ardabil Plain Using Artificial Neural Network and Regression Methods

    Directory of Open Access Journals (Sweden)

    Gholam Reza Sheykhzadeh

    2017-02-01

    Full Text Available Introduction: Penetration resistance is one of the criteria for evaluating soil compaction. It correlates with several soil properties such as vehicle trafficability, resistance to root penetration, seedling emergence, and soil compaction by farm machinery. Direct measurement of penetration resistance is time consuming and difficult because of high temporal and spatial variability. Therefore, many different regressions and artificial neural network pedotransfer functions have been proposed to estimate penetration resistance from readily available soil variables such as particle size distribution, bulk density (Db and gravimetric water content (θm. The lands of Ardabil Province are one of the main production regions of potato in Iran, thus, obtaining the soil penetration resistance in these regions help with the management of potato production. The objective of this research was to derive pedotransfer functions by using regression and artificial neural network to predict penetration resistance from some soil variations in the agricultural soils of Ardabil plain and to compare the performance of artificial neural network with regression models. Materials and methods: Disturbed and undisturbed soil samples (n= 105 were systematically taken from 0-10 cm soil depth with nearly 3000 m distance in the agricultural lands of the Ardabil plain ((lat 38°15' to 38°40' N, long 48°16' to 48°61' E. The contents of sand, silt and clay (hydrometer method, CaCO3 (titration method, bulk density (cylinder method, particle density (Dp (pychnometer method, organic carbon (wet oxidation method, total porosity(calculating from Db and Dp, saturated (θs and field soil water (θf using the gravimetric method were measured in the laboratory. Mean geometric diameter (dg and standard deviation (σg of soil particles were computed using the percentages of sand, silt and clay. Penetration resistance was measured in situ using cone penetrometer (analog model at 10

  16. Peculiarities of Enhancing Resistant Starch in Ruminants Using Chemical Methods: Opportunities and Challenges

    Directory of Open Access Journals (Sweden)

    Qendrim Zebeli

    2013-06-01

    Full Text Available High-producing ruminants are fed high amounts of cereal grains, at the expense of dietary fiber, to meet their high energy demands. Grains consist mainly of starch, which is easily degraded in the rumen by microbial glycosidases, providing energy for rapid growth of rumen microbes and short-chain fatty acids (SCFA as the main energy source for the host. Yet, low dietary fiber contents and the rapid accumulation of SCFA lead to rumen disorders in cattle. The chemical processing of grains has become increasingly important to confer their starch resistances against rumen microbial glycosidases, hence generating ruminally resistant starch (RRS. In ruminants, unlike monogastric species, the strategy of enhancing resistant starch is useful, not only in lowering the amount of carbohydrate substrates available for digestion in the upper gut sections, but also in enhancing the net hepatic glucose supply, which can be utilized by the host more efficiently than the hepatic gluconeogenesis of SCFA. The use of chemical methods to enhance the RRS of grains and the feeding of RRS face challenges in the practice; therefore, the present article attempts to summarize the most important achievements in the chemical processing methods used to generate RRS, and review advantages and challenges of feeding RRS to ruminants

  17. Political polarization

    OpenAIRE

    Dixit, Avinash K.; Weibull, Jörgen W.

    2007-01-01

    Failures of government policies often provoke opposite reactions from citizens; some call for a reversal of the policy, whereas others favor its continuation in stronger form. We offer an explanation of such polarization, based on a natural bimodality of preferences in political and economic contexts and consistent with Bayesian rationality.

  18. Political polarization.

    Science.gov (United States)

    Dixit, Avinash K; Weibull, Jörgen W

    2007-05-01

    Failures of government policies often provoke opposite reactions from citizens; some call for a reversal of the policy, whereas others favor its continuation in stronger form. We offer an explanation of such polarization, based on a natural bimodality of preferences in political and economic contexts and consistent with Bayesian rationality.

  19. AIROX dry pyrochemical processing of oxide fuels: a proliferation-resistant reprocessing method

    International Nuclear Information System (INIS)

    Grantham, L.F.; Clark, R.G.; Hoyt, R.C.; Miller, J.R.

    1980-01-01

    Potential diversion of nuclear material from power production to weapons production by national or subnational groups has resulted in a reevaluation of the proliferation resistance of various fuel cycles. The low-contamination fuel cycle, utilizting AIROX dry processing, is proliferation resistant due to the retention of fission products with the fuel and to the low concentration of fissile material in all process steps. In the AIROX process, UO 2 is oxidized with air to U 3 O 8 to expand the fuel volume which simultaneously declads and pulverizes the fuel; the fuel is subsequently reenriched, repelletized, and recycled to the reactor. Fuel cycles utilizing this method of reprocessing will extend our uranium reserves, decrease the spent fuel storage requirements, and decrease the amount of waste requiring storage in a Federal Repository for environmental isolation. AIROX reprocessing is applicable to both light-water reactor fuel cycles as well as fast-breeder fuel cycles

  20. Methods and apparatus for measurement of the resistivity of geological formations from within cased boreholes

    Science.gov (United States)

    Vail, III, William B.

    1989-01-01

    Methods and apparatus are disclosed which allow measurement of the resistivity of a geological formation through borehole casing which may be surrounded by brine saturated cement. A.C. current is passed from an electrode in electrical contact with the interior of the borehole casing to an electrode on the surface of the earth. The A.C. voltage difference is measured between two additional vertically disposed electrodes on the interior of the casing which provides a measure of the resistivity of the geological formation. A calibration and nulling procedure is presented which minimizes the influence of variations in the thickness of the casing. The procedure also minimizes the influence of inaccurate placements of the additional vertically disposed electrodes.

  1. Microstructure and Corrosion Resistance of Aluminium and Copper Composite Coatings Deposited by LPCS Method

    Directory of Open Access Journals (Sweden)

    Winnicki M.

    2016-12-01

    Full Text Available The paper presents the study of microstructure and corrosion resistance of composite coatings (Al+Al2O3 and Cu+Al2O3 deposited by Low Pressure Cold Spraying method (LPCS. The atmospheric corrosion resistance was examined by subjecting the samples to cyclic salt spray and Kesternich test chambers, with NaCl and SO2 atmospheres, respectively. The selected tests allowed reflecting the actual working conditions of the coatings. The analysis showed very satisfactory results for copper coatings. After eighteen cycles, with a total time of 432 hours, the samples show little signs of corrosion. Due to their greater susceptibility to chloride ions, aluminium coatings have significant corrosion losses.

  2. Methods of detection and typing of methicillin resistant Staphylococcus aureus isolated from animals

    Directory of Open Access Journals (Sweden)

    Radosavljević V.

    2014-01-01

    Full Text Available In this work there was evaluated the method of detection of methicillin resistant Staphylococcus aureus (MRSA by using two molecular and three phenotypic tests in investigation procedure of 70 strains of S.aureus isolated from animals. Recent findings of the new mecA homologue, mecALGA251, minimise the significance of mecA gene presence detection as a confirmation method of methicillin resistant Staphylococcus aureus identification. For this reason, along with multiplex PCR set of primers(165rDNK, nuc, mecA for detection mecA gene, there was also used multiplex PCR set of primers (spa, mecA, pvl, mecALGA251 for differentiation mecALGA251 from mecA, with simultaneous detection of luk-PV and spa gene fragments. In all 70 investigated isolates there was detected the presence of specific 16 SrDNK fragment and nuc gene which encodes a thermostable S. aureus nuclease, while in 5 out of 70 S. aureus isolates, there was proven mecA gene presence using two multiplex PCR tests. In the investigated strains there was determined neither mecC (mecALGA251gene presence, nor Panton Valentine Leukocidin encoding gene. By application cefoxitin disk-diffusion, latex-agglutination and two multiplex PCR tests, the identical results in identification 5 methicillin resistant out of 70 investigated S. aureus strains were obtained. In our investigation there was determined a complete correlation between the results of phenotypic and genotypic identification of methicillin resistant S. aureus. [Projekat Ministarstva nauke Republike Srbije, br. TR 31079

  3. Electrically resistive coating for remediation (regeneration) of a diesel particulate filter and method

    Science.gov (United States)

    Phelps, Amanda C [Malibu, CA; Kirby, Kevin K [Calabasas Hills, CA; Gregoire, Daniel J [Thousand Oaks, CA

    2012-02-14

    A resistively heated diesel particulate filter (DPF). The resistively heated DPF includes a DPF having an inlet surface and at least one resistive coating on the inlet surface. The at least one resistive coating is configured to substantially maintain its resistance in an operating range of the DPF. The at least one resistive coating has a first terminal and a second terminal for applying electrical power to resistively heat up the at least one resistive coating in order to increase the temperature of the DPF to a regeneration temperature. The at least one resistive coating includes metal and semiconductor constituents.

  4. A STUDY ON THE EARTHQUAKE RESPONSE AND EARTHQUAKE RESISTANT DESIGN METHOD OF AN OPEN TYPE WHARF WITH PNEUMATIC CAISSONS

    Science.gov (United States)

    Oishi, Masahiko; Nagao, Takashi; Shigeki, Kouji; Ouchi, Masatoshi; Sato, Yuske; Kinomiya, Osamu

    Seismic response of an open type wharf with pneumatic caisson was clarified using a dynamic finite element method. As a result, rocking behavior of caisson foundations were observed and applicability of a frame model analysis to the earthquake resistant design of a wharf was suggested. Authors proposed the framework of earthquake resistant design method of the wharf including the evaluation method of response acceleration of the wharf.

  5. Standard test methods for performance characteristics of metallic bonded resistance strain gages

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    1992-01-01

    1.1 The purpose of this standard is to provide uniform test methods for the determination of strain gauge performance characteristics. Suggested testing equipment designs are included. 1.2 Test Methods E 251 describes methods and procedures for determining five strain gauge parameters: Section Part I—General Requirements 7 Part II—Resistance at a Reference Temperature 8 Part III—Gauge Factor at a Reference Temperature 9 Part IV—Temperature Coefficient of Gauge Factor\t10 Part V—Transverse Sensitivity\t11 Part VI—Thermal Output\t12 1.3 Strain gauges are very sensitive devices with essentially infinite resolution. Their response to strain, however, is low and great care must be exercised in their use. The performance characteristics identified by these test methods must be known to an acceptable accuracy to obtain meaningful results in field applications. 1.3.1 Strain gauge resistance is used to balance instrumentation circuits and to provide a reference value for measurements since all data are...

  6. An educational method for evaluating the resistance to the treatment in the diagnosis of dyscalculia

    Directory of Open Access Journals (Sweden)

    Giampaolo Chiappini

    2016-04-01

    Full Text Available In this paper a didactical method that has been proven effective for evaluating the “resistance to the treatment” of the student is presented. This parameter is essential for distinguishing the learning difficulties in mathematics from the learning disorder of dyscalculia. The method is based on GimmeFive, an application that has been designed to develop skills in mental calculation of multi-digit additions and subtractions. In this paper we present the results of two experiments conducted with groups of students respectively with learning difficulties in mathematics and dyscalculia. These experiments allowed to show the effectiveness of the didactical method in the evaluation of the resistance to the treatment and to discuss the features that make it adequate for the evaluation of the learning disorder. An educational method for evaluating the resistance to the treatment in the diagnosis of dyscalculiaIn questo lavoro viene presentato un metodo didattico che si è dimostrato efficace per valutare la resistenza al trattamento dello studente che è uno dei parametri fondamentali per distinguere la difficoltà di apprendimento in matematica dal disturbo di apprendimento noto come discalculia. Il metodo si basa sull’uso dell’applicazione GimmeFive che è stata progettata per sviluppare competenze nel calcolo mentale di addizioni e sottrazioni a più cifre. In questo lavoro vengono presentati risultati di due sperimentazioni condotte con gruppi di studenti rispettivamente con difficoltà di apprendimento e con diagnosi di discalculia. Queste sperimentazioni hanno consentito di mostrare l’efficacia del metodo didattico nella valutazione della resistenza al trattamento e di discutere le caratteristiche che lo rendono adeguato per la valutazione del disturbo di apprendimento.

  7. Detection of Mycobacterium isolates with different methods and their resistance ratios against anti-tuberculosis drugs

    Directory of Open Access Journals (Sweden)

    Mustafa Altındiş, Zafer Çetinkaya, Raike Kalaycı, Ihsan H Ciftçi, Alpaslan Arslan, Orhan C. Aktepe

    2011-06-01

    Full Text Available Objectives: The aim of the present study was to evaluate the efficacy (recovery rate, time to detection and Drug SusceptibilityTests –DST- of Mycobacteria-only B460 of new colorimetric medium, Dio-TK and to compare it with routinely used conventional media, Lowenstein Jensen (LJ and Bactec 460 TB culture system.Materials and methods: Totally 901 clinic specimens were investigated for assignment of tuberculosis by Ehrlich-Ziehl-Nielsen smear strain method, Lowenstein-Jensen, BACTEC 460TB and Dio-TK medium culture systems.Results: Nineteen of 901 clinic specimens (2.1% were positive by any of these methods. 17 (89.5% of these specimens positive found by smear strain method, 17 (89.5% by Lowenstein-Jensen, 19 (100% by BACTEC 460TB and 14 (73.7% by Dio-TK medium. NAP and Niacin identification tests were applied to Mycobacterium strains. 12 (63.1% of 19 isolates were identified as M.tuberculosis complex and 7 (36.9% were identified as Mycobacterium other than tuberculosis (MOTT bacilli. 10 (83.3% of 12 M.tuberculosis complex strains were not resistant to any major drug. But one of 2 isolate was resistant to streptomycin and the other one isolate was resistant to both streptomycin and isoniazid.Conclusion: Our data suggest that some advantages (such as an early detection and differentiation mycobacterium growth from contamination of the Dio-TK CS over other mycobacterial culture systems make it a practical and rapid system for daily use, and a suitable alternative to other currently available solid media, such as LJ, for detection time of mycobacteria and DST. J Microbiol Infect Dis 2011;1 (1 :5-9.

  8. Resistance Monitoring of Four Insecticides and a Description of an Artificial Diet Incorporation Method for Chilo suppressalis (Lepidoptera: Crambidae).

    Science.gov (United States)

    Shuijin, Huang; Qiong, Chen; Wenjing, Qin; Yang, Sun; Houguo, Qin

    2017-12-05

    Chilo suppressalis (Walker; Lepidoptera: Crambidae) is one of the most damaging rice pests in China. Insecticides play a major role in its management. We describe how we monitored the resistance of C. suppressalis to four insecticides in seven field populations from Jiangxi, Hubei, and Hunan Provinces, China, in 2014-2016. The topical application method for resistance monitoring was suitable for triazophos, monosultap, and abamectin. The conventional rice seedling dipping method proved ineffective for testing chlorantraniliprole so the new artificial diet incorporation method was substituted. This new method provided more consistent results than the other methods, once baseline toxicity data had been established. All populations had moderate to high resistance to triazophos from 2014 to 2016. Monosultap resistance in two populations increased from low in 2014 to moderate in 2016 and the other five populations showed moderate to high-level resistance throughout. Abamectin resistance in three populations increased from sensitive or low in 2014 to moderate in 2015-2016, and the other populations had moderate to high levels of resistance. Resistance to chlorantraniliprole increased from sensitive or low in 2014 to moderate to high in 2016. These results suggested that resistance management strategies should be developed according to the needs of a specific location. It was suggested that, in these localities, organophosphate insecticides should be prohibited, the application of nereistoxin, macrolide antibiotic, and diamide insecticides should be limited, and other insecticides, including spinetoram and methoxyfenozide, that exhibited no resistance should be used rationally and in rotation to delay resistance development. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  9. Identification of commercially available alloys for corrosion-resistant metallic reinforcement and test methods for evaluating corrosion-resistant reinforcement.

    Science.gov (United States)

    2008-01-01

    A literature review was conducted with the goal of identifying alternative low-cost corrosion-resistant steel reinforcement materials. The most promising alternate reinforcing materials seen to date that are less expensive than 300 series stainless s...

  10. Evaluation of a microcolony growth monitoring method for the rapid determination of ethambutol resistance in Mycobacterium tuberculosis

    NARCIS (Netherlands)

    den Hertog, Alice L.; Menting, Sandra; Smienk, Ernst T.; Werngren, Jim; Hoffner, Sven; Anthony, Richard M.

    2014-01-01

    Due to the increasing prevalence of Mycobacterium tuberculosis strains resistant to one or more antibiotics, there is a need for new quantitative culture methods both for drug susceptibility testing and for validation of mutations putatively associated with drug resistance. We previously developed a

  11. Monitoring Freeze Thaw Transitions in Arctic Soils using Complex Resistivity Method

    Science.gov (United States)

    Wu, Y.; Hubbard, S. S.; Ulrich, C.; Dafflon, B.; Wullschleger, S. D.

    2012-12-01

    The Arctic region, which is a sensitive system that has emerged as a focal point for climate change studies, is characterized by a large amount of stored carbon and a rapidly changing landscape. Seasonal freeze-thaw transitions in the Arctic alter subsurface biogeochemical processes that control greenhouse gas fluxes from the subsurface. Our ability to monitor freeze thaw cycles and associated biogeochemical transformations is critical to the development of process rich ecosystem models, which are in turn important for gaining a predictive understanding of Arctic terrestrial system evolution and feedbacks with climate. In this study, we conducted both laboratory and field investigations to explore the use of the complex resistivity method to monitor freeze thaw transitions of arctic soil in Barrow, AK. In the lab studies, freeze thaw transitions were induced on soil samples having different average carbon content through exposing the arctic soil to temperature controlled environments at +4 oC and -20 oC. Complex resistivity and temperature measurements were collected using electrical and temperature sensors installed along the soil columns. During the laboratory experiments, resistivity gradually changed over two orders of magnitude as the temperature was increased or decreased between -20 oC and 0 oC. Electrical phase responses at 1 Hz showed a dramatic and immediate response to the onset of freeze and thaw. Unlike the resistivity response, the phase response was found to be exclusively related to unfrozen water in the soil matrix, suggesting that this geophysical attribute can be used as a proxy for the monitoring of the onset and progression of the freeze-thaw transitions. Spectral electrical responses contained additional information about the controls of soil grain size distribution on the freeze thaw dynamics. Based on the demonstrated sensitivity of complex resistivity signals to the freeze thaw transitions, field complex resistivity data were collected over

  12. Study of ciclosporine blood levels in patients after kidney or bone-marrow transplantation. Comparison between the two methods, fluorescence polarization immunoassay and radioimmunoassay

    International Nuclear Information System (INIS)

    Sadeg, N.; Pham Huy, C.; Claude, J.R.; Postaire, M.; Lebrec, H.; Hamon, M.; Broyer, M.; Gagnadoux, M.F.; Fischer, A.

    1989-01-01

    The apparition of ciclosporine, immunodepressive drug, has largely improved the organ transplantations. However, the range of blood concentrations must be defined to allow the efficacity of ciclosporine therapy and to avoid toxic reactions, because there are very important variations for a same dosage according to the individuals and the diseases. Relative to the low concentrations to be determined (about one hundred ng/ml), the most useful methods for ciclosporine measurement are based on immunochemical assays. This work compares the two methods: radioimmunoassay (RIA) and fluorescence polarization immunoassay (FPIA) simultaneously performed on several hundred samples. A very significant correlation exists between the two techniques (r = 0.80). The advantages of immunofluorescent assay consists in rapidity, sensibility and facility to realize emergency analysis [fr

  13. Fatigue resistance of engine-driven rotary nickel-titanium instruments produced by new manufacturing methods.

    Science.gov (United States)

    Gambarini, Gianluca; Grande, Nicola Maria; Plotino, Gianluca; Somma, Francesco; Garala, Manish; De Luca, Massimo; Testarelli, Luca

    2008-08-01

    The aim of the present study was to investigate whether cyclic fatigue resistance is increased for nickel-titanium instruments manufactured by using new processes. This was evaluated by comparing instruments produced by using the twisted method (TF; SybronEndo, Orange, CA) and those using the M-wire alloy (GTX; Dentsply Tulsa-Dental Specialties, Tulsa, OK) with instruments produced by a traditional NiTi grinding process (K3, SybronEndo). Tests were performed with a specific cyclic fatigue device that evaluated cycles to failure of rotary instruments inside curved artificial canals. Results indicated that size 06-25 TF instruments showed a significant increase (p 0.05) in the mean number of cycles to failure when compared with size 06-20 GT series X instruments. The new manufacturing process produced nickel-titanium rotary files (TF) significantly more resistant to fatigue than instruments produced with the traditional NiTi grinding process. Instruments produced with M-wire (GTX) were not found to be more resistant to fatigue than instruments produced with the traditional NiTi grinding process.

  14. 3D DC Resistivity Inversion with Topography Based on Regularized Conjugate Gradient Method

    Directory of Open Access Journals (Sweden)

    Jian-ke Qiang

    2013-01-01

    Full Text Available During the past decades, we observed a strong interest in 3D DC resistivity inversion and imaging with complex topography. In this paper, we implemented 3D DC resistivity inversion based on regularized conjugate gradient method with FEM. The Fréchet derivative is assembled with the electric potential in order to speed up the inversion process based on the reciprocity theorem. In this study, we also analyzed the sensitivity of the electric potential on the earth’s surface to the conductivity in each cell underground and introduced an optimized weighting function to produce new sensitivity matrix. The synthetic model study shows that this optimized weighting function is helpful to improve the resolution of deep anomaly. By incorporating topography into inversion, the artificial anomaly which is actually caused by topography can be eliminated. As a result, this algorithm potentially can be applied to process the DC resistivity data collected in mountain area. Our synthetic model study also shows that the convergence and computation speed are very stable and fast.

  15. DEVELOPMENT OF GEOLOGICAL DISTRIBUTION PRESUMPTION METHOD USING OIL PRESSURE RESISTANCE OF THE PLASTIC BOARD DRAIN MACHINE

    Science.gov (United States)

    Hirata, Masafumi; Shiraga, Shinichiro; Shimizu, Hideki; Fukuda, Jun; Kawanabe, Shuu; Nomura, Tadaaki

    Plastic board drain (PBD) method is a consolidation method which can accelerate consolidation by placing a lot of PBD into the soft ground. It is important for PBD method to get information about the layer thickness of soft ground and geological distribution, before designing the optimal arrangement of PBD. However, it is difficult to get the accurate information by soil exploration with an only few samples. In this paper, the simplified estimating equation is proposed that evaluates cone bearing capacity by using oil pressure resistance of placing PBD machine during operating. Furthermore, the system is proposed that can evaluate the distribution in three dimensions of ground strength by using estimated cone bearing capacity. Finally, it was confirmed that this proposed system could evaluate the layer thickness of soft ground and geological distribution accurately.

  16. DC resistivity of Ni-Zn ferrites prepared by oxalate precipitation method

    International Nuclear Information System (INIS)

    Shinde, T.J.; Gadkari, A.B.; Vasambekar, P.N.

    2008-01-01

    Polycrystalline ferrites with general formula Ni 1-x Zn x Fe 2 O 4 (x = 0, 0.2, 0.4, 0.6, 0.8, and 1.0) were prepared by oxalate precipitation method. The samples were characterized by X-ray diffraction (XRD), IR and scanning electron microscope (SEM) techniques. All compositions show cubic Spinel structure. Lattice constant increases with increase in zinc content, obeying Vegard's law. The physical densities are about 98.14% of their X-ray density. Average crystallite size lies in the range 27.59-31.49 nm. Infrared studies show two absorption bands near about 400 cm -1 and 600 cm -1 for octahedral and tetrahedral sites, respectively. The resistivity of all the samples was studied. It is observed that the resistivity of nickel-zinc ferrites prepared by oxalate precipitation method is higher than that prepared by ceramic and citrate precursor method. It is attributed to greater homogeneity and smaller grain size. Activation energy in paramagnetic region is higher than that of ferrimagnetic region

  17. A method for detection and location of high resistance earth faults

    Energy Technology Data Exchange (ETDEWEB)

    Haenninen, S.; Lehtonen, M. [VTT Energy, Espoo (Finland); Antila, E. [ABB Transmit Oy (Finland)

    1998-08-01

    In the first part of this presentation, the theory of earth faults in unearthed and compensated power systems is briefly presented. The main factors affecting the high resistance fault detection are outlined and common practices for earth fault protection in present systems are summarized. The algorithms of the new method for high resistance fault detection and location are then presented. These are based on the change of neutral voltage and zero sequence currents, measured at the high voltage / medium voltage substation and also at the distribution line locations. The performance of the method is analyzed, and the possible error sources discussed. Among these are, for instance, switching actions, thunder storms and heavy snow fall. The feasibility of the method is then verified by an analysis based both on simulated data, which was derived using an EMTP-ATP simulator, and by real system data recorded during field tests at three substations. For the error source analysis, some real case data recorded during natural power system events, is also used

  18. Evaluation of in vitro antioxidant potential of different polarities stem crude extracts by different extraction methods of Adenium obesum

    Directory of Open Access Journals (Sweden)

    Mohammad Amzad Hossain

    2014-09-01

    Full Text Available Objective: To select best extraction method for the isolated antioxidant compounds from the stems of Adenium obesum. Methods: Two methods used for the extraction are Soxhlet and maceration methods. Methanol solvent was used for both extraction method. The methanol crude extract was defatted with water and extracted successively with hexane, chloroform, ethyl acetate and butanol solvents. The antioxidant potential for all crude extracts were determined by using 1, 1-diphenyl-2- picrylhydrazyl method. Results: The percentage of extraction yield by Soxhlet method is higher compared to maceration method. The antioxidant potential for methanol and its derived fractions by Soxhlet extractor method was highest in ethyl acetate and lowest in hexane crude extracts and found in the order of ethyl acetate>butanol>water>chloroform>methanol>hexane. However, the antioxidant potential for methanol and its derived fractions by maceration method was highest in butanol and lowest in hexane followed in the order of butanol>methanol>chloroform>water>ethyl acetate>hexane. Conclusions: The results showed that isolate antioxidant compounds effected on the extraction method and condition of extraction.

  19. New high resolution Random Telegraph Noise (RTN) characterization method for resistive RAM

    Science.gov (United States)

    Maestro, M.; Diaz, J.; Crespo-Yepes, A.; Gonzalez, M. B.; Martin-Martinez, J.; Rodriguez, R.; Nafria, M.; Campabadal, F.; Aymerich, X.

    2016-01-01

    Random Telegraph Noise (RTN) is one of the main reliability problems of resistive switching-based memories. To understand the physics behind RTN, a complete and accurate RTN characterization is required. The standard equipment used to analyse RTN has a typical time resolution of ∼2 ms which prevents evaluating fast phenomena. In this work, a new RTN measurement procedure, which increases the measurement time resolution to 2 μs, is proposed. The experimental set-up, together with the recently proposed Weighted Time Lag (W-LT) method for the analysis of RTN signals, allows obtaining a more detailed and precise information about the RTN phenomenon.

  20. Resistive wall impedance of the LHC beam screen without slots calculated by boundary element method

    CERN Document Server

    Tsutsui, H

    2002-01-01

    In order to calculate the resistive wall impedance of the LHC beam screen without slots, the Boundary Element Method (BEM) is used. The result at 1 GHz is Re(ZL/L) = 6.689×10−3 Ω/m, Re(Zx/L) = 1.251 Ω/m2, Re(Zy/L) = 1.776 Ω/m2, andRe(2Z0,2 cos/kL) = −0.525 Ω/m2, assuming σ = 5.8 × 109 /Ωm.

  1. Using resistivity to measure H/Pd and D/Pd loading. Method and significance

    International Nuclear Information System (INIS)

    Mckubre, M.C.H.; Tanzella, F.L.

    2006-01-01

    The resistance ratio method is the most frequent technique used to determine the extent of interstitial loading of hydrogen or deuterium atoms into palladium electrodes, or extended structures used in electrolytic or gas phase cold fusion experiments. Specifically, advantage is taken of an empirical relationship between the measured resistance, R, normalized to that of the same body at the same temperature in the absence of hydrogen isotope, R 0 , hence R/R 0 , and the atomic fraction occupancy of octahedral interstitials, x=H/Pd or D/Pd. This method was first suggested and employed in cold fusion studies by the present authors, and received immediate and widespread acceptance because of the ease with which this experimental technique could be used to make in situ, real-time measurements of a parameter, D/Pd, anticipated or hypothesized at that time to relate to cold fusion heat excess or nuclear production. We take up this topic again 15 years later in an attempt to clear up some errors and misunderstandings regarding the resistance ratio method and its application in cold fusion studies. The relationship between R/R 0 and x is empirical. That is, calibrations are only as good as the experiments that support the shape of the curve and cannot be used outside the range (P, T, x) in which data are taken. The original calibration (unaccountably and erroneously immortalized as the 'famous Baranowski curve') involved an extrapolation of known data into the region of cold fusion interest in the D-Pd system, at x > 0.6. Present theory and results focus new attention on the very high loading region as x approaches or even exceeds unity, where double occupation of octahedral sites, tetrahedral site occupancy, new phase formation or new electrical states, may be relevant to the underlying physical process of excess heat and nuclear production. Rather than simply using the resistance ratio as a qualitative tool to determine whether an electrode is better or lesser loaded, it

  2. Polarized proton collider at RHIC

    Energy Technology Data Exchange (ETDEWEB)

    Alekseev, I.; Allgower, C.; Bai, M.; Batygin, Y.; Bozano, L.; Brown, K.; Bunce, G.; Cameron, P.; Courant, E.; Erin, S.; Escallier, J.; Fischer, W.; Gupta, R.; Hatanaka, K.; Huang, H.; Imai, K.; Ishihara, M.; Jain, A.; Lehrach, A.; Kanavets, V.; Katayama, T.; Kawaguchi, T.; Kelly, E.; Kurita, K.; Lee, S.Y.; Luccio, A.; MacKay, W.W. E-mail: mackay@bnl.govhttp://www.rhichome.bnl.gov/People/waldowaldo@bnl.gov; Mahler, G.; Makdisi, Y.; Mariam, F.; McGahern, W.; Morgan, G.; Muratore, J.; Okamura, M.; Peggs, S.; Pilat, F.; Ptitsin, V.; Ratner, L.; Roser, T.; Saito, N.; Satoh, H.; Shatunov, Y.; Spinka, H.; Syphers, M.; Tepikian, S.; Tominaka, T.; Tsoupas, N.; Underwood, D.; Vasiliev, A.; Wanderer, P.; Willen, E.; Wu, H.; Yokosawa, A.; Zelenski, A.N

    2003-03-01

    In addition to heavy ion collisions (RHIC Design Manual, Brookhaven National Laboratory), RHIC will also collide intense beams of polarized protons (I. Alekseev, et al., Design Manual Polarized Proton Collider at RHIC, Brookhaven National Laboratory, 1998, reaching transverse energies where the protons scatter as beams of polarized quarks and gluons. The study of high energy polarized protons beams has been a long term part of the program at BNL with the development of polarized beams in the Booster and AGS rings for fixed target experiments. We have extended this capability to the RHIC machine. In this paper we describe the design and methods for achieving collisions of both longitudinal and transverse polarized protons in RHIC at energies up to {radical}s=500 GeV.

  3. Why Did the Bear Cross the Road? Comparing the Performance of Multiple Resistance Surfaces and Connectivity Modeling Methods

    Directory of Open Access Journals (Sweden)

    Samuel A. Cushman

    2014-12-01

    Full Text Available There have been few assessments of the performance of alternative resistance surfaces, and little is known about how connectivity modeling approaches differ in their ability to predict organism movements. In this paper, we evaluate the performance of four connectivity modeling approaches applied to two resistance surfaces in predicting the locations of highway crossings by American black bears in the northern Rocky Mountains, USA. We found that a resistance surface derived directly from movement data greatly outperformed a resistance surface produced from analysis of genetic differentiation, despite their heuristic similarities. Our analysis also suggested differences in the performance of different connectivity modeling approaches. Factorial least cost paths appeared to slightly outperform other methods on the movement-derived resistance surface, but had very poor performance on the resistance surface obtained from multi-model landscape genetic analysis. Cumulative resistant kernels appeared to offer the best combination of high predictive performance and sensitivity to differences in resistance surface parameterization. Our analysis highlights that even when two resistance surfaces include the same variables and have a high spatial correlation of resistance values, they may perform very differently in predicting animal movement and population connectivity.

  4. Sources of polarized ions and atoms

    International Nuclear Information System (INIS)

    Cornelius, W.D.

    1988-01-01

    In this presentation we discuss methods of producing large quantities of polarized atoms and ions (Stern-Gerlach separation, optical pumping, and spin-exchange) as well as experimental methods of measuring the degree of polarization of atomic systems. The usefulness of polarized atoms in probing the microscopic magnetic surface properties of materials will also be discussed. 39 refs., 5 figs., 2 tabs

  5. Polarized light field microscopy: an analytical method using a microlens array to simultaneously capture both conoscopic and orthoscopic views of birefringent objects.

    Science.gov (United States)

    Oldenbourg, R

    2008-09-01

    For the comprehensive analysis of anisotropic materials, a new approach, called 'polarized light field microscopy' is introduced. It uses an LC-PolScope to which a microlens array was added at the image plane of the objective lens. The system is patterned after the 'light field microscope' that achieves both lateral and axial resolution in thick specimens in a single camera exposure. In polarized light field microscopy, the microlens array generates a hybrid image consisting of an array of small conoscopic images, each sampling a different object area. Analysis of the conoscopic images reveals the birefringence of each object area as a function of the propagation direction of transmitted light rays. The principles and utility of the instrument that we are calling 'light field LC-PolScope' are demonstrated with images of a thin, polycrystalline calcite film, revealing the azimuth and inclination angle of the optic axis for many crystals simultaneously, including crystals with diameters as small as 2 microm. Compared to traditional conoscopy and related methods, the vastly improved throughput and quantitative analysis afforded by the light field LC-PolScope make it the instrument of choice for measuring 3D birefringence parameters of complex structures.

  6. Polarized light field microscopy: an analytical method using a microlens array to simultaneously capture both conoscopic and orthoscopic views of birefringent objects

    Science.gov (United States)

    Oldenbourg, Rudolf

    2008-01-01

    For the comprehensive analysis of anisotropic materials, a new approach, called “polarized light field microscopy” is introduced. It uses an LC-PolScope to which a microlens array was added at the image plane of the objective lens. The system is patterned after the “light field microscope” that achieves both lateral and axial resolution in thick specimens in a single camera exposure. In polarized light field microscopy, the microlens array generates a hybrid image consisting of an array of small conoscopic images, each sampling a different object area. Analysis of the conoscopic images reveals the birefringence of each object area as a function of the propagation direction of transmitted light rays. The principles and utility of the instrument that we are calling “light field LC-PolScope” are demonstrated with images of a thin, polycrystalline calcite film, revealing the azimuth and inclination angle of the optic axis for many crystals simultaneously, including crystals with diameters as small as 2 µm. Compared to traditional conoscopy and related methods, the vastly improved throughput and quantitative analysis afforded by the light field LC-PolScope make it the instrument of choice for measuring 3-dimensional birefringence parameters of complex structures. PMID:18754996

  7. V.L. Ginzburg's elliptic screw polarization modes in an optical medium with linear birefringence and twist: Determination of their parameters by the method of Jones matrices

    Science.gov (United States)

    Malykin, G. B.; Pozdnyakova, V. I.

    2017-01-01

    Using the method of Jones matrices, we have calculated parameters of elliptic screw polarization modes (ESPMs). ESPM formalism has been proposed by V.L. Ginzburg for an optical medium with unperturbed linear birefringence and circular birefringence induced by twisting of the medium. The evolution of the polarization state of radiation (PSR) in relation to the length of the examined optical medium has been considered, which is important for twisted single-mode optical fibers and cholesteric liquid crystals. We have shown that the problem can be substantially simplified if the evolution of ESPMs is considered in a screw coordinate system comoving with the twist of the optical medium. In particular, we have shown that a curve on the Poincaré sphere mapping the evolution of the PSR for natural (normal) waves of the examined optical medium in the screw coordinate system degenerates into a point. For comparison, we have found natural waves of this medium in a fixed (laboratory) coordinate system and considered the evolution of their PSR, which is represented by a complex curve on the Poincaré sphere. Also, the evolution of the PSR of improper waves passed through the examined optical medium has been studied in both the fixed and the screw coordinate systems.

  8. A Polarized Atmospheric Radiative Transfer Model for Calculations of Spectra of the Stokes Parameters of Shortwave Radiation Based on the Line-by-Line and Monte Carlo Methods

    Directory of Open Access Journals (Sweden)

    Boris Fomin

    2012-10-01

    Full Text Available This paper presents a new version of radiative transfer model called the Fast Line-by-Line Model (FLBLM, which is based on the Line-by-Line (LbL and Monte Carlo (MC methods and rigorously treats particulate and molecular scattering alongside absorption. The advantage of this model consists in the use of the line-by-line model that allows for the computing of high-resolution spectra quite quickly. We have developed the model by taking into account the polarization state of light and carried out some validations by comparison against benchmark results. FLBLM calculates the Stokes parameters spectra of shortwave radiation in vertically inhomogeneous atmospheres. This update makes the model applicable for the assessment of cloud and aerosol influence on radiances as measured by the SW high-resolution polarization spectrometers. In sample results we demonstrate that the high-resolution spectra of the Stokes parameters contain more detailed information about clouds and aerosols than the medium- and low-resolution spectra wherein lines are not resolved. The presented model is rapid enough for many practical applications (e.g., validations and might be useful especially for the remote sensing. FLBLM is suitable for development of the reliable technique for retrieval of optical and microphysical properties of clouds and aerosols from high-resolution satellites data.

  9. Polar vessel hullform design based on the multi-objective optimization NSGA II

    Directory of Open Access Journals (Sweden)

    DUAN Fei

    2017-12-01

    Full Text Available [Objectives] With the increasing exploitation of the Arctic abundant oil and gas resources, a large number of ships which meet the polar navigational requirements are needed.[Methods] In this paper, the fast elitist Non-Dominated Sorting Genetic Algorithm (NSGA Ⅱ is applied to the hull optimization, and the multi-objective optimization method of polar vessel design is proposed. With the optimization goal of resistance and icebreaking resistance, filtering hull forms through the standard of polar vessel displacement and EEDI, fast ship hull optimization that satisfy the ice-ship dead weight and EEDI requirements has been achieved. Taking a 65 000 t shuttle tanker as an example, full parametric modeling method is adopted, the hull optimization of three different bow forms is conducted through the polar vessel multi-objective optimization method.[Results] The ship hull after optimization can satisfy the IA class navigation require, where the resistance in calm water decreases up to 12.94%, and the minimum propulsion power in ice field has a 27.36% reduction.[Conclusions] The feasibility and validity of the NSGA Ⅱ applying in polar vessel design is verified.

  10. Polar Biomedical Research - An Assessment.

    Science.gov (United States)

    1982-10-01

    to grow more crops in subpolar Alaska. The severity of the polar conditions in Antarctica allow no practical method for providing volumes of plant food...for an expanded population. Any experiments in polar regions in food production involving geothermal heat, solar energy, hydroponics , or aquaculture

  11. Create a Polarized Light Show.

    Science.gov (United States)

    Conrad, William H.

    1992-01-01

    Presents a lesson that introduces students to polarized light using a problem-solving approach. After illustrating the concept using a slinky and poster board with a vertical slot, students solve the problem of creating a polarized light show using Polya's problem-solving methods. (MDH)

  12. Imaging with Polarized Neutrons

    Directory of Open Access Journals (Sweden)

    Nikolay Kardjilov

    2018-01-01

    Full Text Available Owing to their zero charge, neutrons are able to pass through thick layers of matter (typically several centimeters while being sensitive to magnetic fields due to their intrinsic magnetic moment. Therefore, in addition to the conventional attenuation contrast image, the magnetic field inside and around a sample can be visualized by detecting changes of polarization in a transmitted beam. The method is based on the spatially resolved measurement of the cumulative precession angles of a collimated, polarized, monochromatic neutron beam that traverses a magnetic field or sample.

  13. [Resistance monitoring working group: resistance to erythromycin, ciprofloxacin, and tetracycline in human isolates of Campylobacter spp. in the Czech Republic tested by the EUCAST standard method].

    Science.gov (United States)

    Žemličková, H; Jakubů, V; Marejková, M; Urbášková, P

    2014-09-01

    To determine the frequency of Campylobacter spp. isolated from humans in the Czech Republic and to test their susceptibility to antimicrobials commonly used to treat campylobacteriosis by the standard EUCAST method. Consecutive Campylobacter isolates recovered from clinical specimens in 49 microbiological laboratories within one month in 2013 were identified using matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF MS). Susceptibility to erythromycin, ciprofloxacin, and tetracycline was tested by the microdilution method and the results were interpreted based on the EUCAST clinical breakpoints to differentiate between susceptible and resistant strains. Of the study set of 769 Campylobacter spp. strains, 90.1 % were assigned to C. jejuni, 9.8 % to C. coli, and a single strain to C. fetus (0.1 %). Except one blood isolate of C. jejuni, all other isolates were recovered from the stool. Ciprofloxacin resistance (MIC > 0.5 mg/l) was detected in 61.9 % strains of C. jejuni and in 72.0 % strains of C. coli, tetracycline resistance (MIC > 2 mg/l) was detected in 32.0 % of strains of both species, and erythromycin resistance was found in 0.3 % of strains of C. jejuni (MIC > 8 mg/l) and in 2.7 % of strains of C. coli (MIC > 4 mg/l). A C. coli strain was multidrug resistant (i.e. resistant to all three antimicrobials tested). Despite the fact that most Campylobacter infections in humans cure on their own, the resistance of the causative strains to the antimicrobials of choice and alternative agents needs to be studied because of its relevance to the treatment of severe cases that require antibiotics. Resistance to macrolides was found rather infrequently in this study in both C. jejuni (0.1 %) and C. coli (2.7 %) strains. Nevertheless, alarming is ciprofloxacin resistance confirmed in 61.9 % of C. jejuni strains and 72.0 % C. coli strains. As the species C. coli is more often resistant to antimicrobials than C. jejuni and ciprofloxacin

  14. Cost-effectiveness analysis of introduction of rapid, alternative methods to identify multidrug-resistant tuberculosis in middle-income countries

    NARCIS (Netherlands)

    Acuna-Villaorduna, Carlos; Vassall, Anna; Henostroza, German; Seas, Carlos; Guerra, Humberto; Vasquez, Lucy; Morcillo, Nora; Saravia, Juan; O'Brien, Richard; Perkins, Mark D.; Cunningham, Jane; Llanos-Zavalaga, Luis; Gotuzzo, Eduardo

    2008-01-01

    Resistance to commonly used antituberculosis drugs is emerging worldwide. Conventional drug-susceptibility testing (DST) methods are slow and demanding. Alternative, rapid DST methods would permit the early detection of drug resistance and, in turn, arrest tuberculosis transmission. A

  15. Analysis for the depth of underground resistivity structure by using MT method

    International Nuclear Information System (INIS)

    Matsuo, Koichi; Yokoi, Koichi; Negi, Tateyuki; Kasagi, Toshio; Takahashi, Takeharu; Teshima, Minoru

    2005-03-01

    The present document is to report the result of resistivity monitoring by using MT (Magnetotelluric) method near the site proposed for the Horonobe Underground Research Program at the Horonobe-cho, Hokkaido by the Japan Nuclear Cycle Development Institute. The stationary MT observation system, installed near the HDB-1 borehole on November 2002, was moved to a site at the Hokusei-en, 4 km west of the first site. This system is monitoring for the depth of underground resistivity. Observation data at the Hokusei-en from February 1st 2004 to January 31st 2005 was added to the investigation in 2004 fiscal year. But, data cannot be obtained from July 8th to November 11th of 2004 due to the disconnection trouble of the optical fiber cable for data transfer. The results were as follows; 1) Telluric and magnetic time series data measured by MT unit were transferred to a PC installed in an observation through optical fiber cable and processed and edited automatically. 2) The standard deviation of the apparent resistivity depends on range of frequency, 3% or less in the vicinity of the Schumann resonance frequency. The Standard deviation of data from 80 Hz to 0.56 Hz was less or 13%. But the standard deviation of low frequency data was more or 15%. 3) Amplitude of telluric and magnetic spectra below 1 Hz is coincident with Geomagnetic Activity K-index. Clear correlation was not admitted in resistivity and K-index. 4) Data quality was studied compared with weather data. Clear correlation was not admitted for windy day and rainy day. 5) Data was edited by the new criterion of K-index 1.3 or more, wind 6 m/s or less, precipitation 6 mm or less. As a result, the improvement of the data quality was admitted by 5 frequencies of 9 frequencies. Only one side of resistivity Rxy and Ryx was improved by 4 frequencies of the remainder. 6) In addition, data was edited by the new criterion of the coherence of the electric-magnetic amplitude. As a result, the improvement of the data quality

  16. Physics of polarized targets

    CERN Document Server

    Niinikoski, Tapio

    2014-01-01

    For developing, building and operating solid polarized targets we need to understand several fields of physics that have seen sub stantial advances during the last 50 years. W e shall briefly review a selection of those that are important today. These are: 1) quantum statistical methods to describe saturation and relaxation in magnetic resonance; 2) equal spin temperature model for dy namic nuclear polarization; 3 ) weak saturation during NMR polarization measurement; 4 ) refrigeration using the quantum fluid properties of helium isotopes. These, combined with superconducting magnet technologies, permit today to reach nearly complete pola rization of almost any nuclear spins. Targets can be operated in frozen spin mode in rather low and inhomogeneous field of any orientation, and in DNP mode in beams of high intensity. Beyond such experiments of nuclear and particle physics, applications a re also emerging in macromolecular chemistry and in magnetic resonance imaging. This talk is a tribute to Michel Borghini...

  17. Porosity determination from 2-D resistivity method in studying the slope failures

    Science.gov (United States)

    Maslinda, Umi; Nordiana, M. M.; Bery, A. A.

    2017-07-01

    Slope failures have become the main focus for infrastructures development on hilly areas in Malaysia especially the development of tourism and residential. Lack of understanding and information of the subsoil conditions and geotechnical issues are the main cause of the slope failures. The failures happened are due to a combination of few factors such as topography, climate, geology and land use. 2-D resistivity method was conducted at the collapsed area in Selangor. The 2-D resistivity was done to study the instability of the area. The collapsed occurred because of the subsurface materials was unstable. Pole-dipole array was used with 5 m minimum electrode spacing for the 2-D resistivity method. The data was processed using Res2Dinv software and the porosity was calculated using Archie's law equation. The results show that the saturated zone (1-100 Ωm), alluvium or highly weathered rock (100-1000 Ωm), boulders (1600-7000 Ωm) and granitic bedrock (>7000 Ωm). Generally, the slope failures or landslides occur during the wet season or after rainfall. It is because of the water infiltrate to the slope and cause the saturation of the slope which can lead to landslides. Then, the porosity of saturated zone is usually high because of the water content. The area of alluvium or highly weathered rock and saturated zone have high porosity (>20%) and the high porosity also dominated at almost all the collapsed area which means that the materials with porosity >20% is potential to be saturated, unstable and might trigger slope failures.

  18. Development of a test method for determining the cracking susceptibility of resistance spot welded high strength steel sheets

    OpenAIRE

    Rethmeier, Michael; Suwala, Hubert

    2014-01-01

    In this study a test method for determining the cracking susceptibility of resistance spot welded high strength steel sheets was investigated. The development of a suitable test procedure is based on the External-Loaded Hot Crack Test (PVC-Test). The test modification for resistance spot welding contains a constant tensile force load. The test method for determining the cracking susceptibility was experimentally verified for a high strength steel, a transformation induced plasticity steel (TR...

  19. Development of a Simple and Effective Bioassay Method to Evaluate Resistance of Watermelon Plants to Fusarium oxysporum f. sp. niveum

    Directory of Open Access Journals (Sweden)

    Eun Ju Jo

    2017-06-01

    Full Text Available Root-dipping inoculation method has been widely used to determine the resistance of watermelon to Fusarium oxysporum f. sp. niveum causing Fusarium wilt. Although this method leads to the precise results of plant disease responses, more rapid and efficient assay methods have been still required because the root-dipping inoculation method is labor-intensive and time-consuming. In this study, we established a simple and effective bioassay method based on the comparison of various inoculation methods and growth conditions. To develop the system, the occurrence of Fusarium wilt on four resistant and susceptible cultivars was investigated by four different inoculation methods, root-dipping, scalpel, tip and soil-drenching methods. Of these inoculation methods, scalpel method resulted in clear plant disease resistance responses with the simplicity. With the use of scalpel method, we also explored the disease development of the cultivars depending on inoculum concentration, growth stage of seedlings, and incubation temperature after inoculation. Furthermore, we found that the resistance degrees of 23 cultivars derived by scalpel inoculation method were similar to the results by root-dipping method established previously.

  20. Error free physically unclonable function with programmed resistive random access memory using reliable resistance states by specific identification-generation method

    Science.gov (United States)

    Tseng, Po-Hao; Hsu, Kai-Chieh; Lin, Yu-Yu; Lee, Feng-Min; Lee, Ming-Hsiu; Lung, Hsiang-Lan; Hsieh, Kuang-Yeu; Chung Wang, Keh; Lu, Chih-Yuan

    2018-04-01

    A high performance physically unclonable function (PUF) implemented with WO3 resistive random access memory (ReRAM) is presented in this paper. This robust ReRAM-PUF can eliminated bit flipping problem at very high temperature (up to 250 °C) due to plentiful read margin by using initial resistance state and set resistance state. It is also promised 10 years retention at the temperature range of 210 °C. These two stable resistance states enable stable operation at automotive environments from -40 to 125 °C without need of temperature compensation circuit. The high uniqueness of PUF can be achieved by implementing a proposed identification (ID)-generation method. Optimized forming condition can move 50% of the cells to low resistance state and the remaining 50% remain at initial high resistance state. The inter- and intra-PUF evaluations with unlimited separation of hamming distance (HD) are successfully demonstrated even under the corner condition. The number of reproduction was measured to exceed 107 times with 0% bit error rate (BER) at read voltage from 0.4 to 0.7 V.

  1. Anodic Concentration Polarization in SOFCs

    Energy Technology Data Exchange (ETDEWEB)

    Williford, Rick E.; Chick, Lawrence A.; Maupin, Gary D.; Simner, Steve P.; Stevenson, Jeffry W.; Khaleel, Mohammad A.; Wachsman, ED, et al

    2003-08-01

    Concentration polarization is important because it determines the maximum power output of a solid oxide fuel cell (SOFC) at high fuel utilization. Anodic concentration polarization occurs when the demand for reactants exceeds the capacity of the porous ceramic anode to supply them by gas diffusion mechanisms. High tortuosities (bulk diffusion resistances) are often assumed to explain this behavior. However, recent experiments show that anodic concentration polarization originates in the immediate vicinity of the reactive triple phase boundary (TPB) sites near the anode/electrolyte interface. A model is proposed to describe how concentration polarization is controlled by two localized phenomena: competitive adsorption of reactants in areas adjacent to the reactive TPB sites, followed by relatively slow surface diffusion to the reactive sites. Results suggest that future SOFC design improvements should focus on optimization of the reactive area, adsorption, and surface diffusion at the anode/electrolyte interface.

  2. Determination of Soft Lithology Causes The Land Subsidence in Coastal Semarang City by Resistivity Methods

    Science.gov (United States)

    Widada, Sugeng; Saputra, Sidhi; Hariadi

    2018-02-01

    Semarang City is located in the northern coastal plain of Java which is geologically composed of alluvial deposits. The process of the sediment diagenesis has caused a land subsidence. On the other hand, the development of the industrial, service, education and housing sectors has increased the number of building significantly. The number of building makes the pressure of land surface increased, and finally, this also increased the rate of land subsidence. The drilling data indicates that not all layers of lithology are soft layers supporting the land subsidence. However, vertical distribution of the soft layer is still unclear. This study used Resistivity method to map out the soft zone layers of lithology. Schlumberger electrode configuration with sounding system method was selected to find a good vertical resolution and maximum depth. The results showed that the lithology layer with resistivity less than 3 ohm is a layer of clay and sandy clay that has the low bearing capacity so easily compressed by pressure load. A high land subsidence is happening in the thick soft layer. The thickness of that layer is smaller toward the direction of avoiding the beach. The improvement of the bearing capacity of this layer is expected to be a solution to the problem of land subsidence.

  3. ASSESSMENT OF CERAMIC TILE FROST RESISTANCE BY MEANS OF THE FREQUENCY INSPECTION METHOD

    Directory of Open Access Journals (Sweden)

    MICHAL MATYSÍK

    2011-06-01

    Full Text Available The paper presents some results of our experimental analysis of ceramic cladding element frost resistance, particular attention being paid to the application of the frequency inspection method. Three different sets of ceramic tiles of the Ia class to EN 14 411 B standard made by various manufacturers have been analyzed. The ceramic tiles under investigation have been subjected to freeze-thaw-cycle-based degradation in compliance with the relevant ČSN EN ISO 10545-12 standard. Furthermore, accelerated degradation procedure has been applied to selected test specimens, consisting in reducing the temperature of water soaked ceramic tiles in the course of the degradation cycles down –70°C. To verify the correctness of the frequency inspection results, additional physical properties of the ceramic tiles under test have been measured, such as, the ceramic tile strength limit, modulus of elasticity and modulus of deformability, resulting from the flexural tensile strength tests, integrity defect and surface micro-geometry tracking. It has been proved that the acoustic method of frequency inspection is a sensitive indicator of the structure condition and can be applied to the ceramic cladding element frost resistance and service life prediction assessment.

  4. Improvement of humidity resistance of water soluble core by precipitation method

    Directory of Open Access Journals (Sweden)

    Zhang Long

    2011-05-01

    Full Text Available Water soluble core has been widely used in manufacturing complex metal components with hollow configurations or internal channels; however, the soluble core can absorb water easily from the air at room temperature. To improve the humidity resistance of the water soluble core and optimize the process parameters applied in manufacturing of the water soluble core, a precipitation method and a two-level-three-full factorial central composite design were used, respectively. The properties of the cores treated by the precipitation method were compared with that without any treatment. Through a systematical study by means of both an environmental scanning electron microscope (ESEM and an energy dispersive X-ray (EDX analyzer, the results indicate that the hygroscopicity can be reduced by 20% and the obtained optimal process conditions for three critical control factors affecting the hygroscopicity are 0.2 g·mL-1 calcium chloride concentration, 4% water concentration and 0 min ignition time. The porous surface coated by calcium chloride and the high humidity resistance products generated in the precipitation reaction between calcium chloride and potassium carbonate may contribute to the lower hygroscopicity.

  5. A method to investigate the electron scattering characteristics of ultrathin metallic films by in situ electrical resistance measurements

    Energy Technology Data Exchange (ETDEWEB)

    Trindade, I. G.; Sousa, J. B. [IFIMUP and IN, Rua do campo Alegre, 687, 4169-007 Porto (Portugal); Department of Physics, FCUP, Rua do Campo Alegre, 687, 4169-007 Porto (Portugal); Fermento, R. [Instituto de Microelectronica de Madrid, Isaac Newton 8, 28760 Tres Cantos, Madrid (Spain); Leitao, D. [IFIMUP and IN, Rua do campo Alegre, 687, 4169-007 Porto (Portugal)

    2009-07-15

    In this article, a method to measure the electrical resistivity/conductivity of metallic thin films during layer growth on specific underlayers is described. The in situ monitoring of an underlayer electrical resistance, its change upon the incoming of new material atoms/molecules, and the growth of a new layer are presented. The method is easy to implement and allows obtaining in situ experimental curves of electrical resistivity dependence upon film thickness with a subatomic resolution, providing insight in film growth microstructure characteristics, specular/diffuse electron scattering surfaces, and optimum film thicknesses.

  6. Method for forming low-resistance ohmic contacts on semiconducting oxides

    Science.gov (United States)

    Narayan, J.

    1979-10-01

    The invention provides a new method for the formation of high-quality ohmic contacts on wide-band-gap semiconducting oxides. As exemplified by the formation of an ohmic contact on n-type BaTiO/sub 3/ containing a p-n junction, the invention entails depositing a film of a metallic electroding material on the BaTiO/sub 3/ surface and irradiating the film with a Q-switched laser pulse effecting complete melting of the film and localized melting of the surface layer of oxide immediately underlying the film. The resulting solidified metallic contact is ohmic, has unusually low contact resistance, and is thermally stable, even at elevated temmperatures. The contact does not require cleaning before attachment of any suitable electrical lead. This method is safe, rapid, reproducible, and relatively inexpensive.

  7. A facile method to prepare superhydrophobic fluorinated polysiloxane/ZnO nanocomposite coatings with corrosion resistance

    Science.gov (United States)

    Qing, Yongquan; Yang, Chuanning; Hu, Chuanbo; Zheng, Yansheng; Liu, Changsheng

    2015-01-01

    In this paper, we report a simple and inexpensive method for fabricating fluorinated polysiloxane/ZnO nanocomposite coatings on the steel substrates. The surface wettability and topology of coating were characterized by contact angle measurement, scanning electron microscope and Fourier transform infrared spectrometry. The results showed that the hydrophobic sbnd CH3 and sbnd CH2sbnd groups were introduced into ZnO particles via modification, the ZnO nanoparticles were modified from hydrophilic to hydrophobic. When the weight ratio of modified-ZnO to fluorinated polysiloxane was 13:7, the contact angle of nanocomposite coating was 166°, and a sliding angle of 4°, coating surface with hierarchical micro/nano-structures. In addition, the as-prepared superhydrophobic surface has excellent durability and corrosion resistance. It is believed that the facile and low-cost method offer an effective strategy and promising industrial applications for fabricating superhydrophobic surfaces on steel materials.

  8. Ballistic resistant article, semi-finished product for and method of making a shell for a ballistic resistant article

    NARCIS (Netherlands)

    Harings, Jules; Janse, Gerardus

    2013-01-01

    The invention relates to a ballistic resistant article, such as a helmet (1), comprising a double curved shell (2) in turn comprising a stack (5) of layers (6) of an oriented anti-ballistic material, the layers (6) comprising one or more plies and having a plurality of cuts (7), the ends of which

  9. Characteristic Fingerprint Based on Low Polar Constituents for Discrimination of Wolfiporia extensa according to Geographical Origin Using UV Spectroscopy and Chemometrics Methods

    Science.gov (United States)

    Li, Yan; Zhao, Yanli; Li, Zhimin; Li, Tao

    2014-01-01

    The fungus species Wolfiporia extensa has a long history of medicinal usage and has also been commercially used to formulate nutraceuticals and functional foods in certain Asian countries. In the present study, a practical and promising method has been developed to discriminate the dried sclerotium of W. extensa collected from different geographical sites based on UV spectroscopy together with chemometrics methods. Characteristic fingerprint of low polar constituents of sample extracts that originated from chloroform has been obtained in the interval 250–400 nm. Chemometric pattern recognition methods such as partial least squares discriminant analysis (PLS-DA) and hierarchical cluster analysis (HCA) were applied to enhance the authenticity of discrimination of the specimens. The results showed that W. extensa samples were well classified according to their geographical origins. The proposed method can fully utilize diversified fingerprint characteristics of sclerotium of W. extensa and requires low-cost equipment and short-time analysis in comparison with other techniques. Meanwhile, this simple and efficient method may serve as a basis for the authentication of other medicinal fungi. PMID:25544933

  10. Characteristic Fingerprint Based on Low Polar Constituents for Discrimination of Wolfiporia extensa according to Geographical Origin Using UV Spectroscopy and Chemometrics Methods

    Directory of Open Access Journals (Sweden)

    Yan Li

    2014-01-01

    Full Text Available The fungus species Wolfiporia extensa has a long history of medicinal usage and has also been commercially used to formulate nutraceuticals and functional foods in certain Asian countries. In the present study, a practical and promising method has been developed to discriminate the dried sclerotium of W. extensa collected from different geographical sites based on UV spectroscopy together with chemometrics methods. Characteristic fingerprint of low polar constituents of sample extracts that originated from chloroform has been obtained in the interval 250–400 nm. Chemometric pattern recognition methods such as partial least squares discriminant analysis (PLS-DA and hierarchical cluster analysis (HCA were applied to enhance the authenticity of discrimination of the specimens. The results showed that W. extensa samples were well classified according to their geographical origins. The proposed method can fully utilize diversified fingerprint characteristics of sclerotium of W. extensa and requires low-cost equipment and short-time analysis in comparison with other techniques. Meanwhile, this simple and efficient method may serve as a basis for the authentication of other medicinal fungi.

  11. Effects of resistive bodies on DC electrical soundings

    Directory of Open Access Journals (Sweden)

    L. Alfano

    1996-06-01

    Full Text Available Some deep DC electrical soundings, performed in alpine and apenninic areas with the continuous polar dipole-dipole spread, show apparent resistivity curves with positive slopes. Measured values of apparent resistivity reach 30000 Wm. Applying the "surface charges" method we developed three dimensional mathematical models, by means of which we can state simple rules for determining the minimum extensions of the deep resistive bodies, fundamental information for a more precise interpretation of the field results.

  12. Comparison of the multi-drug resistant human hepatocellular carcinoma cell line Bel-7402/ADM model established by three methods

    Directory of Open Access Journals (Sweden)

    Zhong Xingguo

    2010-08-01

    Full Text Available Abstract Background To compare the biological characteristics of three types of human hepatocellular carcinoma multi-drug resistant cell sub-lines Bel-7402/ADM models established by three methods. Methods Established human hepatocellular carcinoma adriamycin (ADM multi-drug resistant cell sub-lines models Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS by three methods of in vitro concentration gradient increased induction, nude mice liver-implanted induction and subcutaneous-implanted induction respectively. Phase contrast microscopy was used to observe the cells and the MTT (methyl thiazolyl tetrazolium method was used to detect drug resistance of the three different sub-lines of cells. Results The three groups of drug resistant cells, Bel-7402/ADMV, Bel-7402/ADML and Bel-7402/ADMS generated cross-resistance to ADM and CDDP (cis-Diaminedichloroplatinum, but showed a significant difference in resistance to Bel-7402 IC50 value (P V, 46 h (Bel-7402/ADML, and 45 h (Bel-7402/ADMS. The excretion rates of ADM were significantly increased compared with the parent cell (34.14% line and were 81.06% (Bel-7402/ADMV, 66.56% (Bel-7402/ADML and 61.56% (Bel-7402/ADMS. Expression of P-gp and MRP in the three groups of resistant cells was significantly enhanced (P P > 0.05. Conclusions Stable resistance was involved in the resistant cell line model established by the above three methods. Liver implantation was a good simulation of human hepatocellular and proved to be an ideal model with characteristics similar to human hepatocellular biology and the pharmacokinetics of anticancer drugs.

  13. Sulfate resistance evaluation of the cement with fly ash (using the Koch & Steinegger method

    Directory of Open Access Journals (Sweden)

    Irassar, Edgardo F.

    1988-12-01

    Full Text Available The increase of active mineral admixtures consumption in contemporaneous cementiceous materials has stablished revision of some test methods. In the evaluation of blended cement durability, many accelerated tests of large application in portland cements become unvalid, because they don't allow to value the improvements produced by pozzolan materials. Koch-Steinegger Method appears as the most appropiate to evaluate sulfate resistance of cement with active mineral admixtures. In this paper are presented the results obtained with this test in the evaluation of an ordinary portland cement (CPN and one resisting sulfates (CPARS, with low calcium fly ash addition. Fly ash is incorporated with three fineness (280, 420 and 480 m2/Kg Blaine. The results show that this addition improves sulfate resistance of CPN and in minor way of ARS cement. Fly ash influences evolution of mechanical strength in water and chemical resistance at first ages.

    El aumento del consumo de las adiciones minerales activas en los materiales cementíceos contemporáneos ha determinado la revisión de algunos métodos de ensayo utilizados para determinar sus propiedades. En la evaluación de la durabilidad de los cementos compuestos, muchos ensayos de corta duración (de gran aplicación en cementos portland dejan de tener validez, pues no permiten evaluar las mejoras que producen los materiales puzolánicos. El método propuesto por KOCH & STEINEGGER (1960 aparece como uno de los más apropiados para determinar el comportamiento de cementos con adiciones minerales activas frente al ataque de sulfatos. En este trabajo se presentan los resultados alcanzados con ente ensayo en la determinación del comportamiento de un cemento portland normal (CRN y uno resistente a los sulfatos (CPARS, adicionados con ceniza volante de bajo contenido en óxido de calcio. La ceniza se incorpora con tres finuras (280, 420 y 480 m2/kg —Blaine—. Estos

  14. Spontaneous growth of polarizing refractory metal ‘nano-fins’

    Science.gov (United States)

    Tai, M. C.; Gentle, A. R.; Arnold, M. D.; Cortie, M. B.

    2018-03-01

    Traditional polymer polarizers degrade in harsh environments and at high temperatures, reducing the polarization effect. In contrast, polarizers produced with refractory metals have vastly improved thermal stability and resistance to harsh environments but are expensive to fabricate. Here we demonstrate prototype refractory metal wire grid polarizers produced by co-sputtering molybdenum and aluminum under specific conditions. Removal of the aluminum through selective dissolution enables the nanostructure array to transmit light. The polarization spans 500–1100 nm and the extinction ratio significantly increases to >100. Possessing broadband polarization and sufficient extinction ratios, the new polarizing film has potential applications in coatings for sunglasses, windows, pyrometers, scientific instruments, and LCD panels.

  15. Designing and comparison study of rapid detection methods of resistance to injectable drugs in clinical strains of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Fatemeh Salehi

    2012-01-01

    Full Text Available Introduction: In this study, some molecular methods were designed for rapid detection of resistance to kanamycin and amikacin.Materials and methods: Among 120 clinical isolates of mycobacterium tuberculosis, 70 strains were selected for evaluation of possible mutations. A PCR-RFLP method was designed for detection of wild type (using enzyme ajii and mutant from (BstFNI enzyme of the isolates. Furthermore, allele specific method (as PCR was designed for detection mutations in codons 1401 and 1402 gene rrs. Some selected isolates were sequenced.Results: In PCR-RFLP method, among the 70 strains examined by BstFNI enzyme, could detect 17 mutant strains among 24 phenotypicaly resistant and 44 non-mutant isolates from 46 susceptible isolates. The sensitivity of this method was %70.83 and specificity was %95.65 on the other hand, 12 mutant from 20 resistant strains and 29 non-mutant strains from 32 susceptible strains were detected by AjiI enzyme. The sensitivity and specificity of this method was 60 and %90.62, respectively. In MAS PCR, 3 mutants from 6 resistant strains and 12 non-mutants from 17 resistant strains were detected. The sensitivity of this method was 50 and specificity was 70.58. Results of sequencing method confirmed the results of molecular methods.Discussion and conclusion: PCR-RFLP method by BstFNI enzyme was the best method for rapid detection of Mycobacterium tuberculosis resistant to second-line injectable drugs and was recommended for routine use.

  16. A Class of Numerical Methods for the Solution of Fourth-Order Ordinary Differential Equations in Polar Coordinates

    Directory of Open Access Journals (Sweden)

    Jyoti Talwar

    2012-01-01

    Full Text Available In this piece of work using only three grid points, we propose two sets of numerical methods in a coupled manner for the solution of fourth-order ordinary differential equation uiv(x=f(x,u(x,u′(x,u′′(x,u′′′(x, amethod and tridiagonal solver to obtain the solution in both cases. Convergence analysis is discussed and numerical results are provided to show the accuracy and usefulness of the proposed methods.

  17. Methods for estimating the burden of antimicrobial resistance: a systematic literature review protocol

    Directory of Open Access Journals (Sweden)

    Nichola R. Naylor

    2016-11-01

    Full Text Available Abstract Background Estimates of the burden of antimicrobial resistance (AMR are needed to ascertain AMR impact, to evaluate interventions, and to allocate resources efficiently. Recent studies have estimated health, cost, and economic burden relating to AMR, with outcomes of interest ranging from drug-bug resistance impact on mortality in a hospital setting to total economic impact of AMR on the global economy. However, recent collation of this information has been largely informal, with no formal quality assessment of the current evidence base (e.g. with predefined checklists. This review therefore aims to establish what perspectives and resulting methodologies have been used in establishing the burden of AMR, whilst also ascertaining the quality of these studies. Methods The literature review will identify relevant literature using a systematic review methodology. MEDLINE, EMBASE, Scopus and EconLit will be searched utilising a predefined search string. Grey literature will be identified by searching within a predefined list of organisational websites. Independent screening of retrievals will be performed in a two-stage process (abstracts and full texts, utilising a pre-defined inclusion and exclusion criteria. Data will be extracted into a data extraction table and descriptive examination will be performed. Study quality will be assessed using the Newcastle-Ottawa scales and the Philips checklists where appropriate. A narrative synthesis of the results will be presented. Discussion This review will provide an overview of previous health, cost and economic definitions of burden and the resultant impact of these different definitions on the burden of AMR estimated. The review will also explore the methods that have been used to calculate this burden and discuss resulting study quality. This review can therefore act as a guide to methods for future research in this area. Systematic review registration PROSPERO CRD42016037510

  18. Investigating Algal Reefs in Xinwu, Taiwan, by using Electrical Resistivity Tomography Method

    Science.gov (United States)

    Wu, Ping-Yun; Chen, Chien-Chih

    2017-04-01

    The Guanxin algal reef, which is locating along the coastal line of Guanyin and Xinwu districts in the Taoyuan city, is the biggest and most complete algal reef in Taiwan. It is consisted of the calcified crustose coralline algae and is one of the most important ecosystems on the northwestern coast. Algal reefs grow extremely slow and expand only 0.1 to 80 mm annually; as a result, any investigation in the algal reef area must be implemented very carefully to reduce potential influence on the environment. Reefs have special electrical property; therefore, it is suitable for applications of electrical exploration methods. The Electrical Resistivity Tomography (ERT) is a fast, non-destructive, and inexpensive surficial geophysical survey method, and therefore it is widely used to investigate reefs. In this study, we used ERT method to investigate the location, distribution area and depth of algal reefs in order to provide a reliable reference of coastal engineering and the establishment of ecosystem refuge. The study area is from the south coast of Fulin river to the south coast of Guanyin river. There are four ERT survey lines, three of them are 960m long and parallel to the shoreline, and the other one is 240m long and perpendicular to others. According to the Archie's Law, we calculated the porosity from the resistivity profile to estimate the depth of reefs beneath each survey line and verified the estimates with the data obtained from drilling well. The results show that the upper boundary of the algal reefs is 0-1.5m deep (there are sands above), and the lower boundary is 4-6m deep (there are gravels below) in the study area. In addition, all profiles obtained from the north-south survey lines show that the depth of the algal reef becomes shallower in the range of 100m in the southernmost end, which indicate the southern boundary of the reef distribution.

  19. The dynamics of the polar ionosphere according to measurements made with the D1 method at Loparskaia

    Science.gov (United States)

    Mizun, Iu. G.; Shchegolkova, G. N.; Gorelov, V. Ia.

    The measurements were of wind and drift at the heights of the E and F regions. The method of diversity reception was used at Loparskaia, a station in the auroral zone 40 km south of Murmansk (USSR). Data from the years 1973-1979 are analyzed. The distribution of velocities during magnetospheric substorms is obtained.

  20. Strategic Polarization.

    Science.gov (United States)

    Kalai, Adam; Kalai, Ehud

    2001-08-01

    In joint decision making, similarly minded people may take opposite positions. Consider the example of a marriage in which one spouse gives generously to charity while the other donates nothing. Such "polarization" may misrepresent what is, in actuality, a small discrepancy in preferences. It may be that the donating spouse would like to see 10% of their combined income go to charity each year, while the apparently frugal spouse would like to see 8% donated. A simple game-theoretic analysis suggests that the spouses will end up donating 10% and 0%, respectively. By generalizing this argument to a larger class of games, we provide strategic justification for polarization in many situations such as debates, shared living accommodations, and disciplining children. In some of these examples, an arbitrarily small disagreement in preferences leads to an arbitrarily large loss in utility for all participants. Such small disagreements may also destabilize what, from game-theoretic point of view, is a very stable equilibrium. Copyright 2001 Academic Press.

  1. Coal Layer Identification using Electrical Resistivity Imaging Method in Sinjai Area South Sulawesi

    Science.gov (United States)

    Ilham Samanlangi, Andi

    2018-03-01

    The purpose of this research is to image subsurface resistivity for coal identification in Panaikang Village, Sinjai, South Sulawesi.Resistivity measurements were conducted in 3 lines of length 400 meters and 300 meter using resistivity imaging, dipole-dipole configuration. Resistivity data was processed using Res2DInv software to image resistivity variation and interpret lithology. The research results shown that coal resistivity in Line is about 70-200 Ωm, Line 2 is about 70-90 Ωm, and Line 3 is about 70-200 Ωm with average thickness about 10 meters and distributed to the east of research area.

  2. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-12-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  3. Towards a Scalable Fully-Implicit Fully-coupled Resistive MHD Formulation with Stabilized FE Methods

    Energy Technology Data Exchange (ETDEWEB)

    Shadid, J N; Pawlowski, R P; Banks, J W; Chacon, L; Lin, P T; Tuminaro, R S

    2009-06-03

    This paper presents an initial study that is intended to explore the development of a scalable fully-implicit stabilized unstructured finite element (FE) capability for low-Mach-number resistive MHD. The discussion considers the development of the stabilized FE formulation and the underlying fully-coupled preconditioned Newton-Krylov nonlinear iterative solver. To enable robust, scalable and efficient solution of the large-scale sparse linear systems generated by the Newton linearization, fully-coupled algebraic multilevel preconditioners are employed. Verification results demonstrate the expected order-of-acuracy for the stabilized FE discretization of a 2D vector potential form for the steady and transient solution of the resistive MHD system. In addition, this study puts forth a set of challenging prototype problems that include the solution of an MHD Faraday conduction pump, a hydromagnetic Rayleigh-Bernard linear stability calculation, and a magnetic island coalescence problem. Initial results that explore the scaling of the solution methods are presented on up to 4096 processors for problems with up to 64M unknowns on a CrayXT3/4. Additionally, a large-scale proof-of-capability calculation for 1 billion unknowns for the MHD Faraday pump problem on 24,000 cores is presented.

  4. Iron ore deposits model using geoelectrical resistivity method with dipole-dipole array

    Directory of Open Access Journals (Sweden)

    Octova Adree

    2017-01-01

    Full Text Available Mining industry is an industry with very high risk (losses. In order that mining activities can be run well, then the potential of the Earth’s resources must be known for sure. one of the Earth’s resources of high economic value is the iron ore. Iron ore is rarely found in a free state in nature, it is usually associated with other minerals and exposed randomly. With these properties, iron ore needs to be modeled before doing mining activities in order to avoid large losses. Iron ore deposits can be modeled with geoelectrical resistivity method. Dipole-dipole array will produce good imaging both vertically and laterally. From the measurement results of geoelectrical resistivity with dipole-dipole array will be obtained the value of measuring the current and potential difference. This value will generate into 2D and 3D model of the cross section of the iron ore deposits. One of the areas in West Sumatra has the potential for iron ore. Five lines were applied in this area. The result of cross section got the iron minerals associated with quartzite at 30 meters depth below the surface.

  5. On-line monitoring of resistance of aqueous solutions at high temperature

    International Nuclear Information System (INIS)

    Hu Shilin; Zhang Pingzhu; Shang Weiguo

    1999-01-01

    The coulostatic measurement is a fast speed electrochemical test method. By this technology, analyzing Δ E(t)- T curves recorded under coulostatic perturbation, the solution resistance R l , resistance of coated film R f , capacity of coated film C f , Polarization resistance R p and double layer capacity C d are obtained. The resistance variety of 0.05N KCl is measured from room temperature up to 255 deg. C under saturation steam pressure. (author)

  6. Monitoring of the Polar Stratospheric Clouds formation and evolution in Antarctica in August 2007 during IPY with the MATCH method applied to lidar data

    Science.gov (United States)

    Montoux, Nadege; David, Christine; Klekociuk, Andrew; Pitts, Michael; di Liberto, Luca; Snels, Marcel; Jumelet, Julien; Bekki, Slimane; Larsen, Niels

    2010-05-01

    The project ORACLE-O3 ("Ozone layer and UV RAdiation in a changing CLimate Evaluated during IPY") is one of the coordinated international proposals selected for the International Polar Year (IPY). As part of this global project, LOLITA-PSC ("Lagrangian Observations with Lidar Investigations and Trajectories in Antarctica and Arctic, of PSC") is devoted to Polar Stratospheric Clouds (PSC) studies. Indeed, understanding the formation and evolution of PSC is an important issue to quantify the impact of climate changes on their frequency of formation and, further, on chlorine activation and subsequent ozone depletion. In this framework, three lidar stations performed PSC observations in Antarctica during the 2006, 2007, and 2008 winters: Davis (68.58°S, 77.97°E), McMurdo (77.86°S, 166.48°E) and Dumont D'Urville (66.67°S, 140.01°E). The data are completed with the lidar data from CALIOP ("Cloud-Aerosol Lidar with Orthogonal Polarization") onboard the CALIPSO ("Cloud-Aerosol Lidar and Infrared Pathfinder Satellite Observation") satellite. Lagrangian trajectory calculations are used to identify air masses with PSCs sounded by several ground-based lidar stations with the same method, called MATCH, applied for the first time in Arctic to study the ozone depletion with radiosoundings. The evolution of the optical properties of the PSCs and thus the type of PSCs formed (supercooled ternary solution, nitric acid trihydrate particles or ice particles) could thus be linked to the thermodynamical evolution of the air mass deduced from the trajectories. A modeling with the microphysical model of the Danish Meteorological Institute allows assessing our ability to predict PSCs for various environmental conditions. Indeed, from pressure and temperature evolution, the model allows retrieving the types of particles formed as well as their mean radii, their concentrations and could also simulate the lidar signals. In a first step, a case in August 2007 around 17-18 km, involving

  7. Application of Monte Carlo Method for Evaluation of Uncertainties of ITS-90 by Standard Platinum Resistance Thermometer

    Science.gov (United States)

    Palenčár, Rudolf; Sopkuliak, Peter; Palenčár, Jakub; Ďuriš, Stanislav; Suroviak, Emil; Halaj, Martin

    2017-06-01

    Evaluation of uncertainties of the temperature measurement by standard platinum resistance thermometer calibrated at the defining fixed points according to ITS-90 is a problem that can be solved in different ways. The paper presents a procedure based on the propagation of distributions using the Monte Carlo method. The procedure employs generation of pseudo-random numbers for the input variables of resistances at the defining fixed points, supposing the multivariate Gaussian distribution for input quantities. This allows taking into account the correlations among resistances at the defining fixed points. Assumption of Gaussian probability density function is acceptable, with respect to the several sources of uncertainties of resistances. In the case of uncorrelated resistances at the defining fixed points, the method is applicable to any probability density function. Validation of the law of propagation of uncertainty using the Monte Carlo method is presented on the example of specific data for 25 Ω standard platinum resistance thermometer in the temperature range from 0 to 660 °C. Using this example, we demonstrate suitability of the method by validation of its results.

  8. Reliability of the virtual elevation method to evaluate rolling resistance of different mountain bike cross-country tyres.

    Science.gov (United States)

    Maier, Thomas; Müller, Beat; Schmid, Lucas; Steiner, Thomas; Wehrlin, Jon Peter

    2018-01-01

    Although a low rolling resistance is advantageous in mountain bike cross-country racing, no studies have used the virtual elevation method to compare tyres from different manufacturers as used in international competitions so far. The aims of this study were to assess the reliability of this method, to compare the off-road rolling resistance between tyres and to calculate the influence on off-road speed. Nine 29-in. mountain bike cross-country tyres were tested on a course representing typical ground surface conditions 5 or 6 times. The coefficient of rolling resistance was estimated with the virtual elevation method by 3 investigators and corresponding off-road speeds were calculated. The virtual elevation method was highly reliable (typical error = 0.0006, 2.8%; limits of agreement <0.0005, r ≥ 0.98). The mean coefficient of rolling resistance was 0.0219 and differed from 0.0205 to 0.0237 (P < 0.001) between tyres. The calculated differences in off-road speed amounted to 2.9-3.2% (0% slope) and 2.3-2.4% (10% slope) between the slowest and the fastest tyre. The reliability of the method and the differences in rolling resistance between the tyres illustrate the value of testing tyres for important competitions on a representative ground surface using the virtual elevation method.

  9. A theoretical model for metal-graphene contact resistance using a DFT-NEGF method.

    Science.gov (United States)

    Ji, Xiang; Zhang, Jinyu; Wang, Yan; Qian, He; Yu, Zhiping

    2013-11-07

    The contact resistance (R(c)) between graphene and metal electrodes is of crucial importance for achieving potentially high performances for graphene devices. However, previous analytical models based on Landauer's approach have failed to include the Fermi velocity difference between the graphene under the metal and the pure graphene channel. Hereby we report a theoretical model to estimate the R(c) using density-functional theory and non-equilibrium Green's function methods. Our model not only presents a clear physical picture of the metal-graphene contacts, but also generates R(c) values which are in good agreement with the experimental results: 210 Ω μm for double-sided Pd contacts compared with 403 Ω μm for single-sided Pd contact.

  10. Method for reducing formation of electrically resistive layer on ferritic stainless steels

    Science.gov (United States)

    Rakowski, James M.

    2013-09-10

    A method of reducing the formation of electrically resistive scale on a an article comprising a silicon-containing ferritic stainless subjected to oxidizing conditions in service includes, prior to placing the article in service, subjecting the article to conditions under which silica, which includes silicon derived from the steel, forms on a surface of the steel. Optionally, at least a portion of the silica is removed from the surface to placing the article in service. A ferritic stainless steel alloy having a reduced tendency to form silica on at least a surface thereof also is provided. The steel includes a near-surface region that has been depleted of silicon relative to a remainder of the steel.

  11. Standard Test Method for Hail Impact Resistance of Aerospace Transparent Enclosures

    CERN Document Server

    American Society for Testing and Materials. Philadelphia

    2010-01-01

    1.1 This test method covers the determination of the impact resistance of an aerospace transparent enclosure, hereinafter called windshield, during hailstorm conditions using simulated hailstones consisting of ice balls molded under tightly controlled conditions. 1.2 The values stated in inch-pound units are to be regarded as standard. The values given in parentheses are mathematical conversions to SI units that are provided for information only and are not considered standard. 1.3 This standard does not purport to address all of the safety concerns, if any, associated with its use. It is the responsibility of the user of this standard to establish appropriate safety and health practices and determine the applicability of regulatory limitations prior to use. For specific hazard statements see Section 7.

  12. Remote Adaptive Motor Resistance Training Exercise Apparatus and Method of Use Thereof

    Science.gov (United States)

    Reich, Alton (Inventor); Shaw, James (Inventor)

    2017-01-01

    The invention comprises a method and/or an apparatus using a computer configured exercise system equipped with an electric motor to provide physical resistance to user motion in conjunction with means for sharing exercise system related data and/or user performance data with a secondary user, such as a medical professional, a physical therapist, a trainer, a computer generated competitor, and/or a human competitor. For example, the exercise system is used with a remote trainer to enhance exercise performance, with a remote medical professional for rehabilitation, and/or with a competitor in a competition, such as in a power/weightlifting competition or in a video game. The exercise system is optionally configured with an intelligent software assistant and knowledge navigator functioning as a personal assistant application.

  13. Alkali resistant optical coatings for alkali lasers and methods of production thereof

    Science.gov (United States)

    Soules, Thomas F; Beach, Raymond J; Mitchell, Scott C

    2014-11-18

    In one embodiment, a multilayer dielectric coating for use in an alkali laser includes two or more alternating layers of high and low refractive index materials, wherein an innermost layer includes a thicker, >500 nm, and dense, >97% of theoretical, layer of at least one of: alumina, zirconia, and hafnia for protecting subsequent layers of the two or more alternating layers of high and low index dielectric materials from alkali attack. In another embodiment, a method for forming an alkali resistant coating includes forming a first oxide material above a substrate and forming a second oxide material above the first oxide material to form a multilayer dielectric coating, wherein the second oxide material is on a side of the multilayer dielectric coating for contacting an alkali.

  14. Significance of steel electrical resistance method in the evaluation of reinforcement corrosion in cementitious systems

    Directory of Open Access Journals (Sweden)

    Krajci, L.

    2004-06-01

    Full Text Available The suitable detection system of steel reinforcement corrosion in concrete structures contributes to the reduction of their maintenance costs. Method of steel electrical resistance represents non-destructive monitoring of steel in cementitious systems. Specially prepared and arranged test specimen of steel as a corrosion sensor is embedded in mortar specimen. Verification tests of this method based on chloride corrosion of steel in mortars as well as its visual inspection are introduced. Significance of steel electrical resistance method lies in the expression of steel corrosion by these quantitative parameters: reduction of cross-section of steel, thickness of corroded layer and loss of weight of steel material. This method is an integral method that allows the indirect determination of mentioned corrosion characteristics. The comparison of verified method with gravimetric evaluation of steel corrosion gives a good correspondence. Test results on mortars with calcium chloride dosages between 0.5% and 4.0% by weight of cement prove high sensitiveness and reliability of steel electrical resistance method.

    La utilización de un sistema de detección de la corrosión de las armaduras en estructuras de hormigón puede contribuir a la reducción de sus costes de mantenimiento. El método de la resistencia eléctrica del acero consiste en la monitorización no-destructiva realizada sobre el acero en sistemas cementantes. Dentro de la muestra de mortero se coloca el sistema de detección, especialmente preparado y fijado, actuando como un sensor de la corrosión. En este trabajo se presentan ensayos de verificación de este método, junto con inspecciones visuales, en morteros sometidos a corrosión de armaduras por efecto de los cloruros. La efectividad de este método de la resistencia eléctrica del acero se expresa, en la corrosión de armaduras, de acuerdo a los siguientes parámetros cuantitativos: reducción de la sección transversal del

  15. Microwave-gated dynamic nuclear polarization

    DEFF Research Database (Denmark)

    Bornet, Aurélien; Pinon, Arthur; Jhajharia, Aditya

    2016-01-01

    Dissolution dynamic nuclear polarization (D-DNP) has become a method of choice to enhance signals in nuclear magnetic resonance (NMR). Recently, we have proposed to combine cross-polarization (CP) with D-DNP to provide high polarization P((13)C) in short build-up times. In this paper, we show...

  16. New methods for testing fire resistance of wood façade systems

    Directory of Open Access Journals (Sweden)

    Mårtensson August

    2016-01-01

    Full Text Available Arson in schools has been a huge problem in Sweden over the last fifteen years. The average amount of school arsons between 2000 and 2014 was 285 cases each year which corresponds to 50% of the total amount of reported fires in school buildings. This is a well-known problem and a lot of research has been done in this area. Investigations has been done about fire and heat detection systems, different technical factors significance in fire scenarios and how to prevent adolescents from starting fires. Another part of the problem that partly been investigated is how the schools are constructed. Roughly 50% of the arsons are outside of the school building. In Sweden one and two storey buildings are allowed to be built with wooden façades in accordance with the building code, which is one of the reasons many schools are built with wooden façade systems. The most critical part in a wood façade system from a fire safety perspective is concluded to be the eaves because of how they usually are built to let air pass through. Even though a wood façade isn't as well resistant to fire compared to a concrete façade, three versions of new test methods for combustible façades have been developed to make it possible to make sure in advance that a construction is resistant enough. The new test methods are focused on specific details and parts of a façade system to provide a more informative and useful result compared to SP Fire 105. Observations and measurements of flame spread and temperature changes in the eave, over the window joints and in the air gap are made. With these parameters in consideration criteria's has been chosen for a critical temperature of 280 ∘C at a critical time of 20 minutes.

  17. Methods for estimating the burden of antimicrobial resistance: a systematic literature review protocol.

    Science.gov (United States)

    Naylor, Nichola R; Silva, Sachin; Kulasabanathan, Kavian; Atun, Rifat; Zhu, Nina; Knight, Gwenan M; Robotham, Julie

    2016-11-08

    Estimates of the burden of antimicrobial resistance (AMR) are needed to ascertain AMR impact, to evaluate interventions, and to allocate resources efficiently. Recent studies have estimated health, cost, and economic burden relating to AMR, with outcomes of interest ranging from drug-bug resistance impact on mortality in a hospital setting to total economic impact of AMR on the global economy. However, recent collation of this information has been largely informal, with no formal quality assessment of the current evidence base (e.g. with predefined checklists). This review therefore aims to establish what perspectives and resulting methodologies have been used in establishing the burden of AMR, whilst also ascertaining the quality of these studies. The literature review will identify relevant literature using a systematic review methodology. MEDLINE, EMBASE, Scopus and EconLit will be searched utilising a predefined search string. Grey literature will be identified by searching within a predefined list of organisational websites. Independent screening of retrievals will be performed in a two-stage process (abstracts and full texts), utilising a pre-defined inclusion and exclusion criteria. Data will be extracted into a data extraction table and descriptive examination will be performed. Study quality will be assessed using the Newcastle-Ottawa scales and the Philips checklists where appropriate. A narrative synthesis of the results will be presented. This review will provide an overview of previous health, cost and economic definitions of burden and the resultant impact of these different definitions on the burden of AMR estimated. The review will also explore the methods that have been used to calculate this burden and discuss resulting study quality. This review can therefore act as a guide to methods for future research in this area. PROSPERO CRD42016037510.

  18. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  19. A J integral based method to measure fracture resistance and cohesive laws in materials exhibiting large scale plasticity

    DEFF Research Database (Denmark)

    Sørensen, Bent F.; Goutianos, Stergios

    2014-01-01

    A method is developed to extract the fracture resistance and mode I cohesive law of nonlinear elastic-plastic materials using a Double Cantilever Beam (DCB) sandwich specimen loaded with pure bending moments. The method is based on the J integral which is valid for materials having a non-linear s......A method is developed to extract the fracture resistance and mode I cohesive law of nonlinear elastic-plastic materials using a Double Cantilever Beam (DCB) sandwich specimen loaded with pure bending moments. The method is based on the J integral which is valid for materials having a non...... to measure the fracture resistance experimentally and determine the mode I cohesive law including its shape....

  20. The Use of Electrical Resistivity Method to Mapping The Migration of Heavy Metals by Electrokinetic

    Science.gov (United States)

    Azhar, A. T. S.; Ayuni, S. A.; Ezree, A. M.; Nizam, Z. M.; Aziman, M.; Hazreek, Z. A. M.; Norshuhaila, M. S.; Zaidi, E.

    2017-08-01

    The presence of heavy metals contamination in soil environment highly needs innovative remediation. Basically, this contamination was resulted from ex-mining sites, motor workshop, petrol station, landfill and industrial sites. Therefore, soil treatment is very important due to metal ions are characterized as non-biodegradable material that may be harmful to ecological system, food chain, human health and groundwater sources. There are various techniques that have been proposed to eliminate the heavy metal contamination from the soil such as bioremediation, phytoremediation, electrokinetic remediation, solidification and stabilization. The selection of treatment needs to fulfill some criteria such as cost-effective, easy to apply, green approach and high remediation efficiency. Electrokinetic remediation technique (EKR) offers those solutions in certain area where other methods are impractical. While, electrical resistivity method offers an alternative geophysical technique for soil subsurface profiling to mapping the heavy metals migration by the influece of electrical gradient. Consequently, this paper presents an overview of the use of EKR to treat contaminated soil by using ERM method to verify their effectiveness to remove heavy metals.

  1. The Comparison of Two Methods of Exercise (intense interval training and concurrent resistance- endurance training on Fasting Sugar, Insulin and Insulin Resistance in Women with Mellitus Diabetes

    Directory of Open Access Journals (Sweden)

    F Bazyar

    2016-05-01

    Full Text Available Background & aim: Exercise is an important component of health and an integral approach to the management of diabetes mellitus. The purpose of this study was to compare the effects of intense interval training and concurrent resistance- endurance training on fasting sugar, insulin and insulin resistance in women with mellitus diabetes.   Methods: Fifty-two overweight female diabetic type 2 patients (aged 45-60 years old with fasting blood glucose≥ 126 mg/dl were selected to participate in the present study. Participants were assigned to intense interval training group (N=17, concurrent resistance- endurance training group (N=17 and control group (N=18. The exercises incorporated 10 weeks of concurrent resistance- endurance training and intense interval training. Fasting blood sugar, serum insulin concentrations levels were measured. Concurrent training group trained eight weeks, three times a week of endurance training at 60% of maximum heart rate (MHR and two resistance training sessions per week with 70% of one repetition maximum (1-RM. Intense interval training group trained for eight weeks, three sessions per week for 4 to 10 repeats Wingate test on the ergometer 30s performed with maximum effort. The control group did no systematic exercise. At the end of experiment 42 subjects were succeed and completed the study period, and 10 subjects were removed due to illness and absence in the exercise sessions. Fasting blood sugar and insulin levels 24 hours before and 48 hours after the last training session was measured.   Results: The findings indicated that in periodic fasting, the blood sugar in intensive training group had a marked decrease (p= 0.000 however, the fasting blood sugar of exercise and power stamina groups reduced significantly (p=0.062. The results showed no significant difference between the groups (171/0 p =0.171. Fasting insulin (p <0.001 and insulin resistance (0001/0 = p=0.001 in periodic intensive training group were

  2. [Surveillance of Antimicrobial Resistant Esherichia coli by Rectal Swab Method--Annual Change of Prevalence of Quinolone-resistant and ESBL Producing Strains from 2009 to 2013].

    Science.gov (United States)

    Nasu, Yoshitsugu; Sako, Shinichi; Yano, Tomofumi; Kosaka, Noriko

    2015-09-01

    Although most of commonly used antimicrobial agents had been susceptible to Esherichia coli, recently there are a lot of reports concerning about community-acquired infection caused by resistant E. coli. The aim of this study is to define the prevalence of resistant E. coli in normal flora colonization by the rectal swab method. From June 2009 to December 2013, 251 male patients (50-85 year-old, median 68) planned to transrectal prostate biopsy participated in this study. Stools stuck on the glove at the digital examination were provided for culture specimen. Identification of E. coli and determination of MIC was performed by MicroScan WalkAway40plus (Siemens). Isolated E. coli were deemed quinolone-resistant strains when their MIC of levofloxacine was 4 μg/mL or above according to the breakpoint MIC by the CLSI criteria. ESBL producing ability was determined by the double disk method used by CVA contained ESBL definition disc (Eikenkagaku). Of the 251 study patients, 224 patients had positive cultures of E. coli. Twenty-four patients had quinolone-resistant strains and 9 patients had ESBL producing strains. The prevalence of quinolone-resistant strains in 2009, 2010, 2011, 2012 and 2013 were 5.9% (2 out of 34 strains), 13.5% (5 out of 37 strains), 12.5% (4 out of 32 strains), 9.0% (6 out of 67) and 13.0% (7 out of 54 strains), respectively. The prevalence of ESBL producing strains in 2009, 2010, 2011, 2012 and 2013 were 0% (0 out of 34 strains), 5.4% (2 out of 37 strains), 3.1% (1 out of 32 strains), 3.0% (2 out of 67 strains) and 7.4% (4 out of 54 strains), respectively. In 2013, the prevalence of antimicrobial resistant E. coli, both quinolone-resistant and ESBL producing strains, were increasing. We have to pay a close attention to the increase of resistant E. coli.

  3. Research on generating various polarization-modes in polarized illumination system

    Science.gov (United States)

    Huang, Jinping; Lin, Wumei; Fan, Zhenjie

    2013-08-01

    With the increase of the numerical aperture (NA), the polarization of light affects the imaging quality of projection lens more significantly. On the contrary, according to the mask pattern, the resolution of projection lens can be improved by using the polarized illumination. That is to say, using the corresponding polarized beam (or polarization-mode) along with the off-axis illumination will improve the resolution and the imaging quality of the of projection lens. Therefore, the research on the generation of various polarization modes and its conversion methods become more and more important. In order to realize various polarization modes in polarized illumination system, after read a lot of references, we provide a way that fitting for the illumination system with the wavelength of 193nm.Six polarization-modes and a depolarized mode are probably considered. Wave-plate stack is used to generate linearly polarization-mode, which have a higher degree polarization. In order to generate X-Y and Y-X polarization mode, the equipment consisting of four sectors of λ/2 wave plate was used. We combined 16 sectors of λ/2 wave plate which have different orientations of the "slow" axis to generate radial and azimuthal polarization. Finally, a multi-polarization control device was designed. Using the kind of multi-polarization control device which applying this method could help to choose the polarization modes conveniently and flexibility for the illumination system.

  4. Carbon nanotube fiber terahertz polarizer

    Energy Technology Data Exchange (ETDEWEB)

    Zubair, Ahmed [Department of Electrical and Computer Engineering, Rice University, Houston, Texas 77005 (United States); Tsentalovich, Dmitri E.; Young, Colin C. [Department of Chemical and Biomolecular Engineering, Rice University, Houston, Texas 77005 (United States); Heimbeck, Martin S. [Charles M. Bowden Laboratory, Aviation & Missile Research, Development, and Engineering Center (AMRDEC), Redstone Arsenal, Alabama 35898 (United States); Everitt, Henry O. [Department of Electrical and Computer Engineering, Rice University, Houston, Texas 77005 (United States); Charles M. Bowden Laboratory, Aviation & Missile Research, Development, and Engineering Center (AMRDEC), Redstone Arsenal, Alabama 35898 (United States); Pasquali, Matteo [Department of Chemical and Biomolecular Engineering, Rice University, Houston, Texas 77005 (United States); Department of Chemistry, Rice University, Houston, Texas 77005 (United States); Department of Materials Science and NanoEngineering, Rice University, Houston, Texas 77005 (United States); Kono, Junichiro, E-mail: kono@rice.edu [Department of Electrical and Computer Engineering, Rice University, Houston, Texas 77005 (United States); Department of Materials Science and NanoEngineering, Rice University, Houston, Texas 77005 (United States); Department of Physics and Astronomy, Rice University, Houston, Texas 77005 (United States)

    2016-04-04

    Conventional, commercially available terahertz (THz) polarizers are made of uniformly and precisely spaced metallic wires. They are fragile and expensive, with performance characteristics highly reliant on wire diameters and spacings. Here, we report a simple and highly error-tolerant method for fabricating a freestanding THz polarizer with nearly ideal performance, reliant on the intrinsically one-dimensional character of conduction electrons in well-aligned carbon nanotubes (CNTs). The polarizer was constructed on a mechanical frame over which we manually wound acid-doped CNT fibers with ultrahigh electrical conductivity. We demonstrated that the polarizer has an extinction ratio of ∼−30 dB with a low insertion loss (<0.5 dB) throughout a frequency range of 0.2–1.1 THz. In addition, we used a THz ellipsometer to measure the Müller matrix of the CNT-fiber polarizer and found comparable attenuation to a commercial metallic wire-grid polarizer. Furthermore, based on the classical theory of light transmission through an array of metallic wires, we demonstrated the most striking difference between the CNT-fiber and metallic wire-grid polarizers: the latter fails to work in the zero-spacing limit, where it acts as a simple mirror, while the former continues to work as an excellent polarizer even in that limit due to the one-dimensional conductivity of individual CNTs.

  5. Characterization of Multidrug Resistant E. faecalis Strains from Pigs of Local Origin by ADSRRS-Fingerprinting and MALDI -TOF MS; Evaluation of the Compatibility of Methods Employed for Multidrug Resistance Analysis.

    Directory of Open Access Journals (Sweden)

    Aneta Nowakiewicz

    Full Text Available The aim of this study was to characterize multidrug resistant E. faecalis strains from pigs of local origin and to analyse the relationship between resistance and genotypic and proteomic profiles by amplification of DNA fragments surrounding rare restriction sites (ADSRRS-fingerprinting and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI -TOF MS. From the total pool of Enterococcus spp. isolated from 90 pigs, we selected 36 multidrug resistant E. faecalis strains, which represented three different phenotypic resistance profiles. Phenotypic resistance to tetracycline, macrolides, phenicols, and lincomycin and high-level resistance to aminoglycosides were confirmed by the occurrence of at least one corresponding resistance gene in each strain. Based on the analysis of the genotypic and phenotypic resistance of the strains tested, five distinct resistance profiles were generated. As a complement of this analysis, profiles of virulence genes were determined and these profiles corresponded to the phenotypic resistance profiles. The demonstration of resistance to a wide panel of antimicrobials by the strains tested in this study indicates the need of typing to determine the spread of resistance also at the local level. It seems that in the case of E. faecalis, type and scope of resistance strongly determines the genotypic pattern obtained with the ADSRRS-fingerprinting method. The ADSRRS-fingerprinting analysis showed consistency of the genetic profiles with the resistance profiles, while analysis of data with the use of the MALDI- TOF MS method did not demonstrate direct reproduction of the clustering pattern obtained with this method. Our observations were confirmed by statistical analysis (Simpson's index of diversity, Rand and Wallace coefficients. Even though the MALDI -TOF MS method showed slightly higher discrimination power than ADSRRS-fingerprinting, only the latter method allowed reproduction of the

  6. Precessing deuteron polarization

    International Nuclear Information System (INIS)

    Sitnik, I.M.; Volkov, V.I.; Kirillov, D.A.; Piskunov, N.M.; Plis, Yu.A.

    2002-01-01

    The feasibility of the acceleration in the Nuclotron of deuterons polarized in the horizontal plane is considered. This horizontal polarization is named precessing polarization. The effects of the main magnetic field and synchrotron oscillations are included. The precessing polarization is supposed to be used in studying the polarization parameters of the elastic dp back-scattering and other experiments

  7. Evaluation of different methods to recover methicillin-resistant Staphylococcus aureus from hospital environmental surfaces.

    LENUS (Irish Health Repository)

    Dolan, A

    2011-11-01

    The environment is implicated as a source of healthcare-associated infections (HAIs) and there is a need for evidence-based approaches to environmental sampling to assess cleanliness and improve infection prevention and control. We assessed, in vitro, different approaches to sampling the environment for meticillin-resistant Staphylococcus aureus (MRSA). In a laboratory-based investigation, the recovery of MRSA from two common hospital environments using six different sampling methods was evaluated, with a wild-type strain of MRSA. A 100 cm(2) section of mattress and a laboratory bench surface were contaminated with known inocula of MRSA. Bacteria were recovered by sampling at 30 min after inoculation, using either saline-moistened cotton swabs, neutralising buffer swabs, eSwabs or macrofoam swabs, which were all enriched in tryptone soya broth, or by sampling with direct contact plates or chromogenic \\'sweep\\' plates. The sensitivity (i.e. the minimum number of bacteria inoculated on to a surface which subsequently produced a positive result) of each method was determined for each surface. The most sensitive methods were eSwabs and macrofoam swabs, requiring 6.1 × 10(-1) and 3.9 × 10(-1) MRSA\\/cm(2), respectively, to produce a positive result from the bench surface. The least sensitive swabbing method was saline-moistened cotton swabs, requiring 1.1 × 10(3) MRSA\\/cm(2) of mattress. The recovery of bacteria from environmental samples varies with the swabs and methodology used and negative culture results do not exclude a pathogen-free environment. Greater standardisation is required to facilitate the assessment of cleanliness of healthcare environments.

  8. Fabricating superhydrophobic polymer surfaces with excellent abrasion resistance by a simple lamination templating method.

    Science.gov (United States)

    Xu, Qian Feng; Mondal, Bikash; Lyons, Alan M

    2011-09-01

    Fabricating robust superhydrophobic surfaces for commercial applications is challenging as the fine-scale surface features, necessary to achieve superhydrophobicity, are susceptible to mechanical damage. Herein, we report a simple and inexpensive lamination templating method to create superhydrophobic polymer surfaces with excellent abrasion resistance and water pressure stability. To fabricate the surfaces, polyethylene films were laminated against woven wire mesh templates. After cooling, the mesh was peeled from the polymer creating a 3D array of ordered polymer microposts on the polymer surface. The resulting texture is monolithic with the polymer film and requires no chemical modification to exhibit superhydrophobicity. By controlling lamination parameters and mesh dimensions, polyethylene surfaces were fabricated that exhibit static contact angles of 160° and slip angles of 5°. Chemical and mechanical stability was evaluated using an array of manual tests as well as a standard reciprocating abraser test. Surfaces remained superhydrophobic after more than 5500 abrasion cycles at a pressure of 32.0 kPa. In addition, the surface remains dry after immersing into water for 5 h at 55 kPa. This method is environmental friendly, as it employs no solvents or harsh chemicals and may provide an economically viable path to manufacture large areas of mechanically robust superhydrophobic surfaces from inexpensive polymers and reusable templates.

  9. Polar stratospheric cloud observations by MIPAS on ENVISAT: detection method, validation and analysis of the northern hemisphere winter 2002/2003

    Directory of Open Access Journals (Sweden)

    R. Spang

    2005-01-01

    Full Text Available The Michelson Interferometer for Passive Atmospheric Sounding (MIPAS on ENVISAT has made extensive measurements of polar stratospheric clouds (PSCs in the northern hemisphere winter 2002/2003. A PSC detection method based on a ratio of radiances (the cloud index has been implemented for MIPAS and is validated in this study with respect to ground-based lidar and space borne occultation measurements. A very good correspondence in PSC sighting and cloud altitude between MIPAS detections and those of other instruments is found for cloud index values of less than four. Comparisons with data from the Stratospheric Aerosol and Gas Experiment (SAGE III are used to further show that the sensitivity of the MIPAS detection method for this threshold value of cloud index is approximately equivalent to an extinction limit of 10-3km-1 at 1022nm, a wavelength used by solar occultation experiments. The MIPAS cloud index data are subsequently used to examine, for the first time with any technique, the evolution of PSCs throughout the Arctic polar vortex up to a latitude close to 90° north on a near-daily basis. We find that the winter of 2002/2003 is characterised by three phases of very different PSC activity. First, an unusual, extremely cold phase in the first three weeks of December resulted in high PSC occurrence rates. This was followed by a second phase of only moderate PSC activity from 5-13 January, separated from the first phase by a minor warming event. Finally there was a third phase from February to the end of March where only sporadic and mostly weak PSC events took place. The composition of PSCs during the winter period has also been examined, exploiting in particular an infra-red spectral signature which is probably characteristic of NAT. The MIPAS observations show the presence of these particles on a number of occasions in December but very rarely in January. The PSC type differentiation from MIPAS indicates that future comparisons of PSC

  10. An NS5A single optimized method to determine genotype, subtype and resistance profiles of Hepatitis C strains.

    Directory of Open Access Journals (Sweden)

    Elisabeth Andre-Garnier

    Full Text Available The objective was to develop a method of HCV genome sequencing that allowed simultaneous genotyping and NS5A inhibitor resistance profiling. In order to validate the use of a unique RT-PCR for genotypes 1-5, 142 plasma samples from patients infected with HCV were analysed. The NS4B-NS5A partial region was successfully amplified and sequenced in all samples. In parallel, partial NS3 sequences were analyzed obtained for genotyping. Phylogenetic analysis showed concordance of genotypes and subtypes with a bootstrap >95% for each type cluster. NS5A resistance mutations were analyzed using the Geno2pheno [hcv] v0.92 tool and compared to the list of known Resistant Associated Substitutions recently published. In conclusion, this tool allows determination of HCV genotypes, subtypes and identification of NS5A resistance mutations. This single method can be used to detect pre-existing resistance mutations in NS5A before treatment and to check the emergence of resistant viruses while undergoing treatment in major HCV genotypes (G1-5 in the EU and the US.

  11. Comparison of Two Inoculation Methods for Evaluating Maize for Resistance to Aspergillus flavus Infection and Aflatoxin Accumulation

    Directory of Open Access Journals (Sweden)

    W. Paul Williams

    2013-01-01

    Full Text Available Aflatoxin, the most potent carcinogen found in nature, is produced by the fungus Aspergillus flavus and occurs naturally in maize, Zea mays L. Growing maize hybrids with genetic resistance to aflatoxin contamination are generally considered a highly desirable way to reduce losses to aflatoxin. Developing resistant hybrids requires reliable inoculation methods for screening maize germplasm for resistance to A. flavus infection and aflatoxin accumulation. The side-needle technique is a widely used inoculation technique: an A. flavus conidial suspension is injected underneath the husks into the side of the ear. This wounds the ear and limits expression of resistance associated with husk coverage, pericarp thickness, and seed coat integrity. In this investigation, the side-needle technique was compared with a second inoculation method that involved dispensing wheat kernels infected with A. flavus into plant whorls at 35 and 49 days after planting. Results showed that although the side-needle technique produced higher levels of aflatoxin accumulation, differences in A. flavus biomass produced by the two inoculation techniques were not significant. Both inoculation techniques were effective in differentiating resistant and susceptible single cross hybrids irrespective of the use of A. flavus infection or aflatoxin accumulation as a basis to define resistance.

  12. Polare maskuliniteter

    Directory of Open Access Journals (Sweden)

    Marit Anne Hauan

    2012-05-01

    Full Text Available In this paper my aim is to read and understand the journal of Gerrit de Veer from the last journey of William Barents to the Arctic Regions in 1596 and the journal of captain Junge on his hunting trip from Tromsø to Svalbard in 1834.It is nearly 240 years between this to voyages. The first journal is known as the earliest report from the arctic era. Gerrit de Veer adds instructive copper engravings to his text and give us insight in the crews meeting with this new land. Captain Junges journal is found together with his dead crew in a house in a fjord nearby Ny-Ålesund and has no drawings, but word. Both of these journals may be read as sources of the knowledge and understanding of the polar region. They might also unveil the ideas of how to deal with and survive under the challenges that is given. In addition one can ask if the sources can tell us more about how men describe their challenges. Can the way they expressed themselves in the journals give us an understanding of masculinity? And not least help us to create good questions of the change in the ideas of masculinities which is said to follow the change in understanding of the wilderness.

  13. Development of Methods for Genetic Assessment of Antibiotic Resistance In Animal Herds

    DEFF Research Database (Denmark)

    Schmidt, Gunilla Veslemøy

    should be tested in order to assist in understanding the antibiotic resistance gene variation. This study illustrates the immensity of the antibiotic resistance problem and the necessity for systematic surveillance of antibiotic consumption and resistance development at global, national, and local scales.......Antibiotic drugs are important in treating bacterial infectious diseases in humans and animals. There are severe consequences when infectious bacteria become resistant to antibiotics such as treatment failure and even death. Since antibiotics were discovered, their use has been associated...... with a parallel selection for resistant bacteria. Since the hazards related to antibiotic resistance development have been recognized, the prudent use of antibiotics has been in focus, especially concerning their use in animal production. For many years antibiotics have been, and still are, recklessly used...

  14. Resistance of the Orthodox population Sumy antireligious policy 1920 – 30`s: forms, methods and consequences

    Directory of Open Access Journals (Sweden)

    V. O. Olitskyy

    2016-06-01

    The reasons of radicalization and resistance calm in 1930 – 1935 are defined. Women riots and so-called volinky (bagpipes as a manifestation of resistance against antireligious policy are analyzed. The characteristic of period of growing cases of radical forms of resistance in 1935 – 1937 is given. However the continuity of this movement in Sumy region during the period of 1920 – 1930’s is tracked and identified.

  15. Polarimetry with azimuthally polarized light

    Science.gov (United States)

    de Sande, Juan Carlos González; Piquero, Gemma; Santarsiero, Massimo

    2018-03-01

    Nonuniformly polarized light can be used for Mueller polarimetry of homogeneous linear samples. In this work, a set up based on using azimuthally polarized input light and a modified commercial light polarimeter is proposed and developed. With this set up, a Mueller submatrix of a sample can be obtained by measuring the Stokes parameters at only three different positions across the output beam section. Symmetry constraints for linear deterministic samples allow the complete Mueller matrix to be deduced for this kind of specimens. The experimental results obtained for phase plates and for a linear polarizer confirm the validity of the proposed method.

  16. The analytical methods used in examining resistance of hydrogeological systems to anthropogenic pollution

    Science.gov (United States)

    Najman, Joanna; Bielewski, Jarosław; Śliwka, Ireneusz

    2013-04-01

    key words: gas chromatography (GC) measurement method, groundwater dating, He, SF6, F-11, F-12, Ar, Ne. In this work the method for evaluating resistance hydrogeological systems to anthropogenic pollution using environmental tracers is described. Resistance groundwater systems to anthropogenic pollution is correlated with the age of water, which can be determined by means of environmental tracers SF6, F-11, F-12 [1] and He. To correct measured values of He and SF6 the temperature of recharge and the excess air is needed and can be determined by measuring Ne and Ar concentrations in groundwater. This paper describes three measurement GC systems to determine the concentrations of greenhouse gases: sulfur hexafluoride (SF6) and chlorofluorocarbons F-11, F-12 [2], the noble gases neon (Ne), argon (Ar) [3] and helium (He) [4] in groundwater. The first system for measurements of the concentration of SF6, F-11 and F-12 consists of a gas chromatograph, type N504 is supplied with nitrogen carrier gas with a purity of 6.0. It is equipped with two packed columns K1 and K2 running at 60°C with the use of the "back-flush" column switching and electron capture detector (ECD) operating at 300°C. Second system for measuring the concentration of the noble gases argon and neon, is composed of a dual Shimadzu gas chromatograph. It is equipped with two columns K4 and K5 operating at 30°C, thermalconductivity detector (TCD) for analysis of argon and helium detector with pulse discharge (PDHID) for analysis of neon. This chromatograph is powered by helium carrier gas 6.0. The third system measures the concentration of helium, consists of a gas chromatograph equipped with a TCD detector and three packed columns filled with molecular sieve type 5A and activated carbon. The carrier gas in this system is argon 6.0. Detection limit, LOD for each measurement systems for the tested compounds are: 0,06 fmol/L for SF6, 15 fmol/L for F-11, 10 fmol/L for F-12, 1,9•10-8 cm3STP/cm3 for Ne, 3,1

  17. Simple method to determine beta-lactam resistance phenotypes in Pseudomonas aeruginosa using the disc agar diffusion test.

    Science.gov (United States)

    Vedel, G

    2005-10-01

    Pseudomonas aeruginosa is a major opportunistic bacterial pathogen in nosocomial infections because of the increasing prevalence of resistance to many of the commonly used antibiotics. To ensure optimal efficiency of antibiotic treatment against this species, antibiotic susceptibility tests must be interpreted with caution. Most microbiologists now consider it essential to characterize the antibiotic resistance expressed by isolates. Particular resistance mechanisms may be suspected when the bacterium is resistant to several antibiotics in the same family (for example beta-lactam agents). Using the disc agar diffusion test, a simple method was developed to distinguish between the common beta-lactam resistance phenotypes of P. aeruginosa and, consequently, the possible resistance mechanism(s). Over a period of 5 years, we analysed 6300 P. aeruginosa strains isolated from various pathological specimens collected from different wards of Cochin Port-Royal Hospital, and reference and collection strains. Each strain had the wild-type phenotype or an acquired resistance phenotype. Eight anti-pseudomonal beta-lactams (ticarcillin, cefotaxime or moxalactam, cefepime or cefpirome, imipenem, ceftazidime, aztreonam, cefsulodin and ticarcillin + clavulanic acid) were used as phenotypic markers. The following markers were sufficient to distinguish between the wild-type phenotype and the various acquired resistance phenotypes: beta-lactamase synthesis, reduced cell wall permeability and/or increased expression of efflux transporters (active efflux). Detection of resistance phenotypes allows 'interpretive reading' of antibiotic susceptibility tests. Clearly, improved interpretation of antibiotic susceptibility tests is important for a better appreciation of the effect of antimicrobial agents on bacteria such as P. aeruginosa.

  18. A method to improve tree water use estimates by distinguishing sapwood from heartwood using Electrical Resistivity Tomography

    Science.gov (United States)

    Guyot, A.; Ostergaard, K.; Lenkopane, M.; Fan, J.; Lockington, D. A.

    2011-12-01

    Estimating whole-plant water use in trees requires reliable and accurate methods. Measuring sap velocity and extrapolating to tree water use is seen as the most commonly used. However, deducing the tree water use from sap velocity requires an estimate of the sapwood area. This estimate is the highest cause of uncertainty, and can reach more than 50 % of the uncertainty in the estimate of water use per day. Here, we investigate the possibility of using Electrical Resistivity Tomography to evaluate the sapwood area distribution in a plantation of Pinus elliottii. Electric resistivity tomographs of Pinus elliottii show a very typical pattern of electrical resistivity, which is highly correlated to sapwood and heartwood distribution. To identify the key factors controlling the variation of electrical resistivity, cross sections at breast height for ten trees have been monitored with electrical resistivity tomography. Trees have been cut down after the experiment to identify the heartwood/sapwood boundaries and to extract wood and sap samples. pH, electrolyte concentration and wood moisture content have then been analysed for these samples. Results show that the heartwood/sapwood patterns are highly correlated with electrical resistivity, and that the wood moisture content is the most influencing factor controlling the variability of the patterns. These results show that electric resistivity tomography could be used as a powerful tool to identify the sapwood area, and thus be used in combination with sapflow sensors to map tree water use at stand scale. However, if Pinus elliottii shows typical patterns, further work is needed to identify to see if there are species - specific characterictics as shown in previous works (, electrolyte gradients from the bark to the heartwood). Also, patterns of high resistivity in between needles positions, which are not correlated with either wood moisture content or sapwood, appear to be artifacts. Thus, inversion methods have also to

  19. A simple method of extracting the polarization charge density in the AlGaN/GaN heterostructure from current-voltage and capacitance-voltage characteristics

    International Nuclear Information System (INIS)

    Lü Yuan-Jie; Lin Zhao-Jun; Yu Ying-Xia; Meng Ling-Guo; Cao Zhi-Fang; Luan Chong-Biao; Wang Zhan-Guo

    2012-01-01

    An Ni Schottky contact on the AlGaN/GaN heterostructure is fabricated. The flat-band voltage for the Schottky contact on the AlGaN/GaN heterostructure is obtained from the forward current—voltage characteristics. With the measured capacitance—voltage curve and the flat-band voltage, the polarization charge density in the AlGaN/GaN heterostructure is investigated, and a simple formula for calculating the polarization charge density is obtained and analyzed. With the approach described in this paper, the obtained polarization charge density agrees well with the one calculated by self-consistently solving Schrodinger's and Poisson's equations

  20. A new method for the measurement of the τ polarization. Application to the τ→a1ντ channel in the ALEPH experiment

    International Nuclear Information System (INIS)

    Duflot, L.

    1993-01-01

    In each decay channel, one can define from the available observables a single variable, denoted ω which contains all the information on the τ polarization. Using the ω variable allows to take into account the six available observables in the τ→a 1 ν channel and gives rise to an important improvement of the sensitivity of this channel to the τ polarization. The τ polarization is thus measured in the a 1 ν channel, with the decay of the a 1 into three charged pions. Results are given

  1. Optical asymmetric cryptography based on elliptical polarized light linear truncation and a numerical reconstruction technique.

    Science.gov (United States)

    Lin, Chao; Shen, Xueju; Wang, Zhisong; Zhao, Cheng

    2014-06-20

    We demonstrate a novel optical asymmetric cryptosystem based on the principle of elliptical polarized light linear truncation and a numerical reconstruction technique. The device of an array of linear polarizers is introduced to achieve linear truncation on the spatially resolved elliptical polarization distribution during image encryption. This encoding process can be characterized as confusion-based optical cryptography that involves no Fourier lens and diffusion operation. Based on the Jones matrix formalism, the intensity transmittance for this truncation is deduced to perform elliptical polarized light reconstruction based on two intensity measurements. Use of a quick response code makes the proposed cryptosystem practical, with versatile key sensitivity and fault tolerance. Both simulation and preliminary experimental results that support theoretical analysis are presented. An analysis of the resistance of the proposed method on a known public key attack is also provided.

  2. Determination of clothing evaporative resistance on a sweating thermal manikin in an isothermal condition: heat loss method or mass loss method?

    Science.gov (United States)

    Wang, Faming; Gao, Chuansi; Kuklane, Kalev; Holmér, Ingvar

    2011-08-01

    This paper addresses selection between two calculation options, i.e heat loss option and mass loss option, for thermal manikin measurements on clothing evaporative resistance conducted in an isothermal condition (T(manikin) = T(a) = T(r)). Five vocational clothing ensembles with a thermal insulation range of 1.05-2.58 clo were selected and measured on a sweating thermal manikin 'Tore'. The reasons why the isothermal heat loss method generates a higher evaporative resistance than that of the mass loss method were thoroughly investigated. In addition, an indirect approach was applied to determine the amount of evaporative heat energy taken from the environment. It was found that clothing evaporative resistance values by the heat loss option were 11.2-37.1% greater than those based on the mass loss option. The percentage of evaporative heat loss taken from the environment (H(e,env)) for all test scenarios ranged from 10.9 to 23.8%. The real evaporative cooling efficiency ranged from 0.762 to 0.891, respectively. Furthermore, it is evident that the evaporative heat loss difference introduced by those two options was equal to the heat energy taken from the environment. In order to eliminate the combined effects of dry heat transfer, condensation, and heat pipe on clothing evaporative resistance, it is suggested that manikin measurements on the determination of clothing evaporative resistance should be performed in an isothermal condition. Moreover, the mass loss method should be applied to calculate clothing evaporative resistance. The isothermal heat loss method would appear to overestimate heat stress and thus should be corrected before use.

  3. The method of covariant calculation of the amplitudes of processes with polarized spin 1/2 particles and its application to calculation of interference terms in cross sections of these processes

    International Nuclear Information System (INIS)

    Bondarev, A.L.

    1993-01-01

    The method of covariant calculation of the amplitudes of processes with polarized spin 1/2 particles is suggested. It can be used for calculation of interference terms in cross sections of these processes. As an illustration the expressions for the lowest order amplitudes of electron-electron scattering and for electron current with radiation of two bremsstrahlung photons in ultrarelativistic limit are presented

  4. Deletion of IL-33R (ST2 abrogates resistance to EAE in BALB/C mice by enhancing polarization of APC to inflammatory phenotype.

    Directory of Open Access Journals (Sweden)

    Marija Milovanovic

    Full Text Available The administration of interleukin 33 and deletion of IL-33 receptor, ST2 molecule, affects the induction of autoimmunity in different experimental models of human autoimmune diseases. The aim of this study was to analyze the effect of ST2 deletion on the induction of experimental autoimmune encephalomyelitis (EAE in resistant BALB/c mice. Mice were immunized with MOG(35-55 peptide or disease was induced by passive transfer of encephalitogenic singenic cells and EAE was clinically and histologically evaluated. Expression of intracellular inflammatory cytokines, markers of activation and chemokine receptors on lymphoid tissue and CNS infiltrating mononuclear cells was analyzed by flow cytometry. We report here that deletion of ST2(-/- molecule abrogates resistance of BALB/c mice to EAE induction based on clinical and histopathological findings. Brain and spinal cord infiltrates of ST2(-/- mice had significantly higher number of CD4(+ T lymphocytes containing inflammatory cytokines compared to BALB/c WT mice. Adoptive transfer of ST2(-/- primed lymphocytes induced clinical signs of the disease in ST2(-/- as well as in WT mice. MOG(35-55 restimulated ST2(-/- CD4(+ cells as well as ex vivo analyzed lymph node cells had higher expression of T-bet and IL-17, IFN-γ, TNF-α and GM-CSF in comparison with WT CD4(+ cells. ST2(-/- mice had higher percentages of CD4(+ cells expressing chemokine receptors important for migration to CNS in comparison with WT CD4(+ cells. Draining lymph nodes of ST2(-/- mice contained higher percentage of CD11c(+CD11b(+CD8(- cells containing inflammatory cytokines IL-6 and IL-12 with higher expression of activation markers. Transfer of ST2(-/- but not WT dendritic cells induced EAE in MOG(35-55 immunized WT mice. Our results indicate that ST2 deficiency attenuates inherent resistance of BALB/c mice to EAE induction by enhancing differentiation of proinflammatory antigen presenting cells and consecutive differentiation of

  5. Method for the improvement of the oxidation resistance of hydrocarbon oil, especially transformer oils by the selective removal of pro-oxidant nitrogen and sulfur compounds therefrom

    Energy Technology Data Exchange (ETDEWEB)

    Felsky, G.

    1984-02-07

    Liquid hydrocarbon streams, preferably petroleum streams, most preferably lube and specialty oil streams and in particular transformer oils are rendered resistant to oxidation by treatment with a silver salt impregnated adsorbent, preferably silver nitrate impregnated alumina by the process of contacting the hydrocarbon oil stream with the silver salt impregnated adsorbent and recovering a hydrocarbon stream of reduced pro-oxidant heteroatom compound (nitrogen compound and sulfur compound) content. The silver salt impregnated adsorbent is regenerated by sequential washing with portions of aromatic solvent and polar solvent. The aromatic solvent strips aromatic sulfides from the adsorbent. This fraction may be recombined with the hydrocarbon stream, especially in the case of transformer oils, so as to enhance the oxidation stability/resistance of the oil. The polar solvent, such as 3% methanol in toluene, strips the aliphatic sulfides from the adsorbent. The regenerated column is then ready for reuse.

  6. Simultaneous in situ measurements of properties of particulates in rf silane plasmas using a polarization-sensitive laser-light-scattering method

    Science.gov (United States)

    Shiratani, Masaharu; Kawasaki, Hiroharu; Fukuzawa, Tsuyoshi; Yoshioka, Takashi; Ueda, Yoshio; Singh, Sanjay; Watanabe, Yukio

    1996-01-01

    A polarization-sensitive laser-light-scattering method is developed for simultaneous in situ measurements of properties (size, size dispersion, density, and refractive index) of particulates formed in processing plasmas. The developed system is applied to observe the growth processes of particulates in a range of their size larger than about 10 nm in rf silane plasmas. A size, a size dispersion (logarithm of a standard deviation of size), a density, and a refractive index of particulates in the plasmas are found to be 10-200 nm, about 0.1, 107-109 cm-3 and about 3-5i, respectively. The former three of such values agree fairly well with ones deduced from scanning electron microscopic (SEM) observation. These particulates grow through three phases of nucleation and initial growth, rapid growth, and growth saturation. Coexistence of two size groups of particulates with narrow size dispersions during and after the rapid growth phase verified by the SEM observation may be explained by a model taking into account coagulation between oppositely charged particulates.

  7. Quantum confined Stark effects of single dopant in polarized hemispherical quantum dot: Two-dimensional finite difference approach and Ritz-Hassé variation method

    Science.gov (United States)

    El Harouny, El Hassan; Nakra Mohajer, Soukaina; Ibral, Asmaa; El Khamkhami, Jamal; Assaid, El Mahdi

    2018-05-01

    Eigenvalues equation of hydrogen-like off-center single donor impurity confined in polarized homogeneous hemispherical quantum dot deposited on a wetting layer, capped by insulated matrix and submitted to external uniform electric field is solved in the framework of the effective mass approximation. An infinitely deep potential is used to describe effects of quantum confinement due to conduction band offsets at surfaces where quantum dot and surrounding materials meet. Single donor ground state total and binding energies in presence of electric field are determined via two-dimensional finite difference approach and Ritz-Hassé variation principle. For the latter method, attractive coulomb correlation between electron and ionized single donor is taken into account in the expression of trial wave function. It appears that off-center single dopant binding energy, spatial extension and radial probability density are strongly dependent on hemisphere radius and single dopant position inside quantum dot. Influence of a uniform electric field is also investigated. It shows that Stark effect appears even for very small size dots and that single dopant energy shift is more significant when the single donor is near hemispherical surface.

  8. Mercury-associated DNA hypomethylation in polar bear brains via the LUminometric Methylation Assay: a sensitive method to study epigenetics in wildlife.

    Science.gov (United States)

    Pilsner, J Richard; Lazarus, Alicia L; Nam, Dong-Ha; Letcher, Robert J; Sonne, Christian; Dietz, Rune; Basu, Niladri

    2010-01-01

    In this paper we describe a novel approach that may shed light on the genomic DNA methylation of organisms with non-resolved genomes. The LUminometric Methylation Assay (LUMA) is permissive for genomic DNA methylation studies of any genome as it relies on the use of methyl-sensitive and -insensitive restriction enzymes followed by polymerase extension via Pyrosequencing technology. Here, LUMA was used to characterize genomic DNA methylation in the lower brain stem region from 47 polar bears subsistence hunted in central East Greenland between 1999 and 2001. In these samples, average genomic DNA methylation was 57.9% +/- 6.69 (SD; range was 42.0 to 72.4%). When genomic DNA methylation was related to brain mercury (Hg) exposure levels, an inverse association was seen between these two variables for the entire study population (P for trend = 0.17). After dichotomizing animals by gender and controlling for age, a negative trend was seen amongst male animals (P for trend = 0.07) but no associations were found in female bears. Such sexually dimorphic responses have been found in other toxicological studies. Our results show that genomic DNA methylation can be quantitatively studied in a highly reproducible manner in tissue samples from a wild organism with a non-resolved genome. As such, LUMA holds great promise as a novel method to explore consequential questions across the ecological sciences that may require an epigenetic understanding.

  9. Improvements in methods of analyzing dust concentrations, and influence of the storage processes on dust concentrations in polar snow and ice samples

    Directory of Open Access Journals (Sweden)

    Takayuki Miyake

    2014-07-01

    Full Text Available We sought to improve the analytical methods employed when operating a laser particle counter and to evaluate the influence of the storage processes on dust concentrations in polar snow and ice samples. We corrected the particle size ranges and threshold voltage using the new calibration curve, confirmed the analytical precision and dust concentrations of blank of wipers using in a clean room, and managed any variations in the laser sensor's sensitivity by measuring standard particles. The 15 ml glass screw bottles without packing (liner of cap of bottles yielded the lowest dust concentration of the blank among two types of bottles and nine types of packing for dust analysis. Storage of samples of the Dome Fuji ice core (Antarctica in a refrigerator for 1 year resulted in just a 4% decrease in dust concentration, which is within the analytical precision of the laser particle counter. Storage in a freezer resulted in an increase in dust concentrations and a decrease in the ratio of large particles more than 0.98 μm in particle diameter in the samples, suggesting a change in dust particle size during storage and an influence by the materials of the storage bottles. The addition of dispersants to the Antarctic snow samples is not clearly suitable when analyzing dust concentrations after sample storage by refrigeration or freezing.

  10. Method for increasing the resistance of a plant or a part thereof to a pathogen, method for screening the resistance of a plant or part thereof to a pathogen, and use thereof

    NARCIS (Netherlands)

    Wit, de P.; Stergiopoulos, I.; Kema, G.H.J.

    2011-01-01

    (EN)The present invention relates to the field of plant biotechnology. More in particular, the present invention relates to methods for increasing the resistance of a plant or part thereof that is susceptible to infection with a pathogen comprising an ortholog of the Avr4 protein of Cladosporium

  11. Finite difference method for inner-layer equations in the resistive MagnetoHydroDynamic stability analysis

    Energy Technology Data Exchange (ETDEWEB)

    Tokuda, Shinji [Japan Atomic Energy Research Inst., Naka, Ibaraki (Japan). Naka Fusion Research Establishment; Watanabe, Tomoko

    1996-08-01

    The matching problem in resistive MagnetoHydroDynamic stability analysis by the asymptotic matching method has been reformulated as an initial-boundary value problem for the inner-layer equations describing the plasma dynamics in the thin layer around a rational surface. The third boundary conditions at boundaries of a finite interval are imposed on the inner layer equations in the formulation instead of asymptotic conditions at infinities. The finite difference method for this problem has been applied to model equations whose solutions are known in a closed form. It has been shown that the initial value problem and the associated eigenvalue problem for the model equations can be solved by the finite difference method with numerical stability. The formulation presented here enables the asymptotic matching method to be a practical method for the resistive MHD stability analysis. (author)

  12. Contact angle measurement - a reliable supportive method for screening water-resistance of ultraviolet-protecting products in vivo.

    Science.gov (United States)

    Hagens, R; Mann, T; Schreiner, V; Barlag, H G; Wenck, H; Wittern, K-P; Mei, W

    2007-08-01

    Substantivity of sunscreen formulations is affected by the wash-out rate of ultraviolet-absorber and -reflector compounds in water. Water-resistance of sunscreen formulations is currently determined according to a standardized European Cosmetic Toiletry and Perfumery Association (COLIPA) protocol, encompassing the determination of a minimal erythemal dose before and after a defined immersion step in water. It can be supposed that the higher the wettability of a treated skin area, the higher is the wash-out rate of sunscreen compounds. This present report addresses the validity of determining the wettability of treated skin alone as a measure for the water-resistance of sunscreen products. The report addresses the robustness, accuracy and congruence of a recently developed wettability test, based on the measurement of the contact angle (CA) of a sessile water drop on treated skin areas. Contact angle data of 66 sunscreen formulations are compared with the corresponding results of 81 water-resistance tests, using the sun protection factor (SPF)/immersion/SPF method. Sunscreen products tested by the CA method were applied to the skin of the volar forearm of test subjects at a defined dose and drying-time, using a standardized application and recording device. Contact angles between a sessile water drop and skin were recorded by a Charge-Coupled Device (CCD) camera and subjected to automatic contour analysis. Taking the SPF/immersion/SPF method as gold standard, accuracy parameters of the CA method were determined. By using an appropriate cut-off level of CAs, the CA method has a specificity and positive-predictive value of 100%, and turns out to be a reliable screening method to identify water-resistant formulations. Based on our findings, those formulations that give CAs above 30 degrees may be categorized water-proof without further testing by the COLIPA water-resistance method.

  13. Absolute Geostrophic Velocity Inverted from the Polar Science Center Hydrographic Climatology (PHC3.0) of the Arctic Ocean with the P-Vector Method (NCEI Accession 0156425)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The dataset (called PHC-V) comprises 3D gridded climatological fields of absolute geostrophic velocity of the Arctic Ocean inverted from the Polar science center...

  14. Apparatus for measuring resistance change only in a cell analyzer and method for calibrating it

    Science.gov (United States)

    Hoffman, Robert A.

    1980-01-01

    The disclosure relates to resistance only monitoring and calibration in an electrical cell analyzer. Sample and sheath fluid flows of different salinities are utilized, the sample flow being diameter modulated to produce a selected pattern which is compared to the resistance measured across the flows.

  15. Resistive heater geometry and regeneration method for a diesel particulate filter

    Science.gov (United States)

    Phelps, Amanda [Malibu, CA; Kirby, Kevin W [Calabasas Hills, CA; Gregoir, Daniel J [Thousand Oaks, CA

    2011-10-25

    One embodiment of the invention includes a diesel particulate filter comprising a first face and a second face; a bottom electrode layer formed over the first face of the diesel particulate filter; a middle resistive layer formed over a portion of the bottom electrode layer; and a top electrode layer formed over a portion of the middle resistive layer.

  16. Modeling and Inversion Methods for the Interpretation of Resistivity Logging Tool Response

    NARCIS (Netherlands)

    Anderson, B.I.

    2001-01-01

    The electrical resistivity measured by well logging tools is one of the most important rock parameters for indicating the amount of hydrocarbons present in a reservoir. The main interpretation challenge is to invert the measured data, solving for the true resistivity values in each zone of a

  17. Slipping on pedestrian surfaces: methods for measuring and evaluating the slip resistance.

    Science.gov (United States)

    Wetzel, Christoph; Windhövel, Ulrich; Mewes, Detlef; Ceylan, Orhan

    2015-01-01

    Tripping, slipping and falling accidents are among the types of accident with a high incidence. This article describes the requirements concerning slip resistance, as well as the state of the art of slip resistance measurement standards in the European Community and the USA. The article also describes how risk assessment can be performed in the field.

  18. Incorpararion of Topography Effect Into Two-Dimensional DC Resistivity Modelling by Using Finite-Element Method

    International Nuclear Information System (INIS)

    Erdogan, E.

    2007-01-01

    In earth investigation done by using the direct current resistivity technique, impact of the change in the examined surface topography on determining the resistivity distrubition in the earth has been a frequently faced question. In order to get more fruitful results and make more correct interpretetions in earth surveying carried on the areas where topographical changes occur, modelling should be done by taking the change in surface topography into account and topography effect should be included into inversion. In this study impact of topography to the direct current resistivity method has been analysed. For this purpose, 2-D forward modeling algorithm has been developed by using finite element method. In this algorithm impact of topography can be incorporate into the model. Also the pseudo sections which is produced from the program can be imaged with topography. By using this algorithm response of models under different surface topography has been analysed and compared with the straight topography of same models

  19. Fermentation characteristics of resistant starch from maize prepared by the enzymatic method in vitro.

    Science.gov (United States)

    Zhang, Huanxin; Xu, Xueming; Jin, Zhengyu

    2012-12-01

    To investigate the fermentation characteristics of resistant starch prepared by hydrolysing maize starch with α-amylase and pullulanase, fresh faecal extracts from healthy humans and infants were used as a fermentation model of human intestines in vitro. The RS was fermented for a certain period of time under the simulated condition of the large intestines (anaerobic and 37°C). The concentration of short-chain fatty acids in the fermented product as determined by gas chromatography was used as an index to characterise the fermentation effect. The results showed that the concentration of short-chain fatty acids, especially butyric acid, in the fermented product gradually increased with increased fermentation time and RS content. However, the concentration of short-chain fatty acids in the fermented product from healthy infant faecal extracts, especially butyric acid, was much higher than that from healthy adult faecal extracts. It suggested that the model of RS-produced acids was affected by the fermentation extract source, i.e., by the existence of microbial flora. The production model of acids demonstrated that maize RS prepared by the enzymatic method can be a promising ingredient of functional foods. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Continuous monitoring of the composition of liquid Pb-17Li eutectic using electrical resistivity methods

    International Nuclear Information System (INIS)

    Hubberstey, P.; Sample, T.; Barker, M.G.

    1991-01-01

    The composition of liquid Pb-17Li alloys has been continously determined, using an electrical resistivity monitor, during their interaction with nitrogen, oxygen, hydrogen and water vapour. The operation of the monitor depends on the fact that the resistivity of liquid Pb-Li alloys is dependent on their composition. Accurate resistivity-composition isotherms have been derived from resistivity-temperature data for 15 Pb-Li alloys (0 Li -8 Ω m (mol% Li) -1 at 725 K) is such that a change of 0.05 mol% Li in the alloy composition can be measured. The addition of oxygen and water vapour resulted in a decrease in the resistivity of the liquid alloy. Neither nitrogen nor hydrogen had any effect. The observed changes were shown to be consistent with Li 2 O formation. (orig.)

  1. PILOT-SCALE FIELD VALIDATION OF THE LONG ELECTRODE ELECTRICAL RESISTIVITY TOMOGRAPHY METHOD

    Energy Technology Data Exchange (ETDEWEB)

    GLASER DR; RUCKER DF; CROOK N; LOKE MH

    2011-07-14

    Field validation for the long electrode electrical resistivity tomography (LE-ERT) method was attempted in order to demonstrate the performance of the technique in imaging a simple buried target. The experiment was an approximately 1/17 scale mock-up of a region encompassing a buried nuclear waste tank on the Hanford site. The target of focus was constructed by manually forming a simulated plume within the vadose zone using a tank waste simulant. The LE-ERT results were compared to ERT using conventional point electrodes on the surface and buried within the survey domain. Using a pole-pole array, both point and long electrode imaging techniques identified the lateral extents of the pre-formed plume with reasonable fidelity, but the LE-ERT was handicapped in reconstructing the vertical boundaries. The pole-dipole and dipole-dipole arrays were also tested with the LE-ERT method and were shown to have the least favorable target properties, including the position of the reconstructed plume relative to the known plume and the intensity of false positive targets. The poor performance of the pole-dipole and dipole-dipole arrays was attributed to an inexhaustive and non-optimal coverage of data at key electrodes, as well as an increased noise for electrode combinations with high geometric factors. However, when comparing the model resolution matrix among the different acquisition strategies, the pole-dipole and dipole-dipole arrays using long electrodes were shown to have significantly higher average and maximum values than any pole-pole array. The model resolution describes how well the inversion model resolves the subsurface. Given the model resolution performance of the pole-dipole and dipole-dipole arrays, it may be worth investing in tools to understand the optimum subset of randomly distributed electrode pairs to produce maximum performance from the inversion model.

  2. A standardized method to determine the concentration of extracellular vesicles using tunable resistive pulse sensing

    Directory of Open Access Journals (Sweden)

    Robert Vogel

    2016-09-01

    Full Text Available Background: Understanding the pathogenic role of extracellular vesicles (EVs in disease and their potential diagnostic and therapeutic utility is extremely reliant on in-depth quantification, measurement and identification of EV sub-populations. Quantification of EVs has presented several challenges, predominantly due to the small size of vesicles such as exosomes and the availability of various technologies to measure nanosized particles, each technology having its own limitations. Materials and Methods: A standardized methodology to measure the concentration of extracellular vesicles (EVs has been developed and tested. The method is based on measuring the EV concentration as a function of a defined size range. Blood plasma EVs are isolated and purified using size exclusion columns (qEV and consecutively measured with tunable resistive pulse sensing (TRPS. Six independent research groups measured liposome and EV samples with the aim to evaluate the developed methodology. Each group measured identical samples using up to 5 nanopores with 3 repeat measurements per pore. Descriptive statistics and unsupervised multivariate data analysis with principal component analysis (PCA were used to evaluate reproducibility across the groups and to explore and visualise possible patterns and outliers in EV and liposome data sets. Results: PCA revealed good reproducibility within and between laboratories, with few minor outlying samples. Measured mean liposome (not filtered with qEV and EV (filtered with qEV concentrations had coefficients of variance of 23.9% and 52.5%, respectively. The increased variance of the EV concentration measurements could be attributed to the use of qEVs and the polydisperse nature of EVs. Conclusion: The results of this study demonstrate the feasibility of this standardized methodology to facilitate comparable and reproducible EV concentration measurements.

  3. Nonlinear Gyrokinetic Theory With Polarization Drift

    International Nuclear Information System (INIS)

    Wang, L.; Hahm, T.S.

    2010-01-01

    A set of the electrostatic toroidal gyrokinetic Vlasov equation and the Poisson equation, which explicitly includes the polarization drift, is derived systematically by using Lie-transform method. The polarization drift is introduced in the gyrocenter equations of motion, and the corresponding polarization density is derived. Contrary to the wide-spread expectation, the inclusion of the polarization drift in the gyrocenter equations of motion does not affect the expression for the polarization density significantly. This is due to modification of the gyrocenter phase-space volume caused by the electrostatic potential [T. S. Hahm, Phys. Plasmas 3, 4658 (1996)].

  4. HAWC+/SOFIA Instrumental Polarization Calibration

    Science.gov (United States)

    Michail, Joseph M.; Chuss, David; Dowell, Charles D.; Santos, Fabio; Siah, Javad; Vaillancourt, John; HAWC+ Instrument Team

    2018-01-01

    HAWC+ is a new far-infrared polarimeter for the NASA/DLR SOFIA (Stratospheric Observatory for Infrared Astronomy) telescope. HAWC+ has the capability to measure the polarization of astronomical sources with unprecedented sensitivity and angular resolution in four bands from 50-250 microns. Using data obtained during commissioning flights, we implemented a calibration strategy that separates the astronomical polarization signal from the induced instrumental polarization. The result of this analysis is a map of the instrumental polarization as a function of position in the instrument's focal plane in each band. The results show consistency between bands, as well as with other methods used to determine preliminary instrumental polarization values.

  5. A new method for testing thermal shock resistance properties of soapstone – Effects of microstructures and mineralogical variables

    Directory of Open Access Journals (Sweden)

    A. Huhta

    2016-09-01

    Full Text Available Soapstone industry utilizes different types of soapstone mainly as a construction material for fireplaces. In this application soapstone has to meet different temperature requirements in different parts of fireplaces. Mineralogical and structural information is needed for placing an appropriate type of soapstone in an appropriate position in the fireplace construction. This allows employment of higher temperatures resulting in more particulate-free combustion, which makes it possible for soapstone industry to develop more efficient and environmentally friendly fireplaces. Of many soapstone types, which differ from each other in their chemical composition and thermal properties, carbonate soapstone and its microstructural variations were investigated in this study. A new method was developed to measure thermal shock resistant of natural stones. By exposing carbonate soapstone samples of different textural types to rapid temperature changes, it was possible to determine the parameters that affect the capacity of the rock to resist thermal shock. The results indicate that the type of microtexture is an important factor in controlling the thermal shock resistance of carbonate soapstone. The soapstone samples with a high thermal shock resistance show deformation textures, such as crenulation cleavage and S/C mylonite. A strong negative correlation was observed between the thermal shock resistance and length of cleavage domains in foliated rocks. Also a slight elevation in the iron concentration of talc and magnesite was discovered to improve the thermal shock resistance of carbonate soapstone. Attention should especially be paid to the length and planarity of cleavage domains of spaced foliation.

  6. Designing Predictive Diagnose Method for Insulation Resistance Degradation of the Electrical Power Cables from Neutral Insulated Power Networks

    Science.gov (United States)

    Dobra, R.; Pasculescu, D.; Risteiu, M.; Buica, G.; Jevremović, V.

    2017-06-01

    This paper describe some possibilities to minimize voltages switching-off risks from the mining power networks, in case of insulated resistance faults by using a predictive diagnose method. The cables from the neutral insulated power networks (underground mining) are designed to provide a flexible electrical connection between portable or mobile equipment and a point of supply, including main feeder cable for continuous miners, pump cable, and power supply cable. An electronic protection for insulated resistance of mining power cables can be made using this predictive strategy. The main role of electronic relays for insulation resistance degradation of the electrical power cables, from neutral insulated power networks, is to provide a permanent measurement of the insulated resistance between phases and ground, in order to switch-off voltage when the resistance value is below a standard value. The automat system of protection is able to signalize the failure and the human operator will be early informed about the switch-off power and will have time to take proper measures to fix the failure. This logic for fast and automat switch-off voltage without aprioristic announcement is suitable for the electrical installations, realizing so a protection against fires and explosion. It is presented an algorithm and an anticipative relay for insulated resistance control from three-phase low voltage installations with insulated neutral connection.

  7. Detection of Ampicillin Resistance Genes (bla in Clinical Isolates of Escherichia coli with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-09-01

    Full Text Available Escherichia coli is a rod negative Gram which could be pathogenic, if its value increases or located in outer gastrointestinal tract. Pathogenic E. coli will produce enterotoxin which will cause diarrhoea or infection in urine tract. Ampicilin was one of particular antibiotics to overcome infection. Ampicilin nowadays is no longer used as primary medicine, because of its resistance case. The aim of this research is to detect the presence of gene which is responsible to ampicilin resistant E. coli. We used isolated midstream urine from cystitis object in Hasan Sadikin Hospital (RSHS as samples. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were done to invenstigate the antibiotic resistency. Based on the result of antibiotic susceptibility testing to ampicillin, E. coli samples were resistant to ampicilin. Elektroforegram products of colony-PCR and DNA-PCR showed that the resistance case of ampicilin caused by bla gene (199 bp. Selective and rational antibiotic treatment is required to prevent ampicillin resistance in patients with symptoms

  8. Nuclear physics with polarized particles

    CERN Document Server

    Paetz gen Schieck, Hans

    2012-01-01

    The measurement of spin-polarization observables in reactions of nuclei and particles is of great utility and advantage when the effects of single-spin sub-states are to be investigated. Indeed, the unpolarized differential cross-section encompasses the averaging over the spin states of the particles, and thus loses details of the interaction process. This introductory text combines, in a single volume, course-based lecture notes on spin physics and on polarized-ion sources with the aim of providing a concise yet self-contained starting point for newcomers to the field, as well as for lecturers in search of suitable material for their courses and seminars. A significant part of the book is devoted to introducing the formal theory-a description of polarization and of nuclear reactions with polarized particles. The remainder of the text describes the physical basis of methods and devices necessary to perform experiments with polarized particles and to measure polarization and polarization effects in nuclear rea...

  9. A modified DOI-based method to statistically estimate the depth of investigation of dc resistivity surveys

    Science.gov (United States)

    Deceuster, John; Etienne, Adélaïde; Robert, Tanguy; Nguyen, Frédéric; Kaufmann, Olivier

    2014-04-01

    Several techniques are available to estimate the depth of investigation or to identify possible artifacts in dc resistivity surveys. Commonly, the depth of investigation (DOI) is mainly estimated by using an arbitrarily chosen cut-off value on a selected indicator (resolution, sensitivity or DOI index). Ranges of cut-off values are recommended in the literature for the different indicators. However, small changes in threshold values may induce strong variations in the estimated depths of investigation. To overcome this problem, we developed a new statistical method to estimate the DOI of dc resistivity surveys based on a modified DOI index approach. This method is composed of 5 successive steps. First, two inversions are performed by using different resistivity reference models for the inversion (0.1 and 10 times the arithmetic mean of the logarithm of the observed apparent resistivity values). Inversion models are extended to the edges of the survey line and to a depth range of three times the pseudodepth of investigation of the largest array spacing used. In step 2, we compute the histogram of a newly defined scaled DOI index. Step 3 consists of the fitting of the mixture of two Gaussian distributions (G1 and G2) to the cumulative distribution function of the scaled DOI index values. Based on this fitting, step 4 focuses on the computation of an interpretation index (II) defined for every cell j of the model as the relative probability density that the cell j belongs to G1, which describes the Gaussian distribution of the cells with a scaled DOI index close to 0.0. In step 5, a new inversion is performed by using a third resistivity reference model (the arithmetic mean of the logarithm of the observed apparent resistivity values). The final electrical resistivity image is produced by using II as alpha blending values allowing the visual discrimination between well-constrained areas and poorly-constrained cells.

  10. A novel, sensitive method to evaluate potato germplasm for bacterial wilt resistance using a luminescent Ralstonia solanacearum reporter strain.

    Science.gov (United States)

    Cruz, Andrea Paola Zuluaga; Ferreira, Virginia; Pianzzola, María Julia; Siri, María Inés; Coll, Núria S; Valls, Marc

    2014-03-01

    Several breeding programs are under way to introduce resistance to bacterial wilt caused by Ralstonia solanacearum in solanaceous crops. The lack of screening methods allowing easy measurement of pathogen colonization and the inability to detect latent (i.e., symptomless) infections are major limitations when evaluating resistance to this disease in plant germplasm. We describe a new method to study the interaction between R. solanacearum and potato germplasm that overcomes these restrictions. The R. solanacearum UY031 was genetically modified to constitutively generate light from a synthetic luxCDABE operon stably inserted in its chromosome. Colonization of this reporter strain on different potato accessions was followed using life imaging. Bacterial detection in planta by this nondisruptive system correlated with the development of wilting symptoms. In addition, we demonstrated that quantitative detection of the recombinant strain using a luminometer can identify latent infections on symptomless potato plants. We have developed a novel, unsophisticated, and accurate method for high-throughput evaluation of pathogen colonization in plant populations. We applied this method to compare the behavior of potato accessions with contrasting resistance to R. solanacearum. This new system will be especially useful to detect latency in symptomless parental lines before their inclusion in long-term breeding programs for disease resistance.

  11. The Dutch Measure for quantification of Treatment Resistance in Depression (DM-TRD) : an extension of the Maudsley Staging Method

    NARCIS (Netherlands)

    Peeters, Frenk P. M. L.; Ruhe, Henricus G.; Wichers, Marieke; Abidi, Latifa; Kaub, Karin; van der Lande, H. Josephine; Spijker, Jan; Huibers, Marcus J. H.; Schene, Aart H.

    2016-01-01

    Background: Treatment resistant depression (TRD) is common in daily practice. An empirical, widely accepted and applicable measure to quantify TRD is lacking. Previously, the Maudsley Staging Method (MSM) showed good validity. We aimed to improve the MSM by refining and extending its items resulting

  12. A Nondestructive Evaluation Method: Measuring the Fixed Strength of Spot-Welded Joint Points by Surface Electrical Resistivity.

    Science.gov (United States)

    Shimamoto, Akira; Yamashita, Keitaro; Inoue, Hirofumi; Yang, Sung-Mo; Iwata, Masahiro; Ike, Natsuko

    2013-04-01

    Destructive tests are generally applied to evaluate the fixed strength of spot-welding nuggets of zinc-plated steel (which is a widely used primary structural material for automobiles). These destructive tests, however, are expensive and time-consuming. This paper proposes a nondestructive method for evaluating the fixed strength of the welded joints using surface electrical resistance. A direct current nugget-tester and probes have been developed by the authors for this purpose. The proposed nondestructive method uses the relative decrease in surface electrical resistance, α . The proposed method also considers the effect of the corona bond. The nugget diameter is estimated by two factors: R Quota , which is calculated from variation of resistance, and a constant that represents the area of the corona bond. Since the maximum tensile strength is correlated with the nugget diameter, it can be inferred from the estimated nugget diameter. When appropriate measuring conditions for the surface electrical resistance are chosen, the proposed method can effectively evaluate the fixed strength of the spot-welded joints even if the steel sheet is zinc-plated.

  13. An AC Resistance Optimization Method Applicable for Inductor and Transformer Windings with Full Layers and Partial Layers

    DEFF Research Database (Denmark)

    Shen, Zhan; Li, Zhiguang; Jin, Long

    2017-01-01

    resistance of windings with partial layers is proposed. The developed analytical equation is verified by both Finite Element Method (FEM) simulations and experimental results from two transformer prototypes. A case study of a transformer design with partial layer windings for a LCC resonant circuit...

  14. Corrosion resistance assessment of Co-Cr alloy frameworks fabricated by CAD/CAM milling, laser sintering, and casting methods.

    Science.gov (United States)

    Tuna, Süleyman Hakan; Özçiçek Pekmez, Nuran; Kürkçüoğlu, Işin

    2015-11-01

    The effects of fabrication methods on the corrosion resistance of frameworks produced with Co-Cr alloys are not clear. The purpose of this in vitro study was to evaluate the electrochemical corrosion resistance of Co-Cr alloy specimens that were fabricated by conventional casting, milling, and laser sintering. The specimens fabricated with 3 different methods were investigated by potentiodynamic tests and electrochemical impedance spectroscopy in an artificial saliva. Ions released into the artificial saliva were estimated with inductively coupled plasma-mass spectrometry, and the results were statistically analyzed. The specimen surfaces were investigated with scanning electron microscopy before and after the tests. In terms of corrosion current and Rct properties, statistically significant differences were found both among the means of the methods and among the means of the material groups (Pcorrosion than those produced by milling and laser sintering. The corrosion resistance of a Co-Cr alloy specimens fabricated by milling or laser sintering was greater than that of the conventionally cast alloy specimens. The Co-Cr specimens produced by the same method also differed from one another in terms of corrosion resistance. These differences may be related to the variations in the alloy compositions. Copyright © 2015 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

  15. Resistant starch analysis of commonly consumed potatoes: Content varies by cooking method and service temperature but not by variety

    Science.gov (United States)

    Resistant starch (RS) has properties which may provide health benefits. We conducted a study to determine the contributions of cultivar, cooking method and service temperature on the RS contents of potatoes (Solanum tuberosum L.). We hypothesized that the RS content would vary by variety, cooking me...

  16. Understanding the mechanism of atovaquone drug resistance in Plasmodium falciparum cytochrome b mutation Y268S using computational methods.

    Directory of Open Access Journals (Sweden)

    Bashir A Akhoon

    Full Text Available The rapid appearance of resistant malarial parasites after introduction of atovaquone (ATQ drug has prompted the search for new drugs as even single point mutations in the active site of Cytochrome b protein can rapidly render ATQ ineffective. The presence of Y268 mutations in the Cytochrome b (Cyt b protein is previously suggested to be responsible for the ATQ resistance in Plasmodium falciparum (P. falciparum. In this study, we examined the resistance mechanism against ATQ in P. falciparum through computational methods. Here, we reported a reliable protein model of Cyt bc1 complex containing Cyt b and the Iron-Sulphur Protein (ISP of P. falciparum using composite modeling method by combining threading, ab initio modeling and atomic-level structure refinement approaches. The molecular dynamics simulations suggest that Y268S mutation causes ATQ resistance by reducing hydrophobic interactions between Cyt bc1 protein complex and ATQ. Moreover, the important histidine contact of ATQ with the ISP chain is also lost due to Y268S mutation. We noticed the induced mutation alters the arrangement of active site residues in a fashion that enforces ATQ to find its new stable binding site far away from the wild-type binding pocket. The MM-PBSA calculations also shows that the binding affinity of ATQ with Cyt bc1 complex is enough to hold it at this new site that ultimately leads to the ATQ resistance.

  17. [Analysis of lipopolysaccharide (LPS) from impermeability-type drug resistant Pseudomonas aeruginosa using new, highly-sensitive LPS staining method].

    Science.gov (United States)

    O'Hara, K; Fukuda, H; Nakahara, H; Bryan, L E

    1994-10-01

    The specific ladder pattern on polyacrylamide gel electropholesis of lipopolysaccharide (LPS) extracted from Pseudomonas aeruginosa was clearly shown by using the complex methods of the PAS staining, re-periodate oxidation and then Ag-staining method. Accordingly, it was concluded that the new method was greatly useful for a detail analysis of LPS changes in Gram-negative bacteria. And it was shown by this method that no changes in LPS occurred between the impermeability-type drug resistant P. aeruginosa mediated by R plasmid and a drug susceptible strain. The absence of changes indicated that the LPS of P. aeruginosa K-Ps102 had not role in the mechanism of the high drug resistance.

  18. Prospect of polarized targets in electron rings

    International Nuclear Information System (INIS)

    Holt, R.J.

    1984-01-01

    The feasibility of performing electron scattering experiments with polarized targets in electron storage rings is discussed. Three examples of the physics which would be accessible with this novel method are given. It is noted that this new method is compatible with recent proposals for linac-stretcher-ring accelerator designs. A new method for producing a polarized hydrogen or deuterium target is proposed and some preliminary results are described. A brief summary of laser-driven polarized targets as well as conventionally-produced polarized atomic beams is included

  19. Challenges of using electrical resistivity method to locate karst conduits-A field case in the Inner Bluegrass Region, Kentucky

    Science.gov (United States)

    Zhu, J.; Currens, J.C.; Dinger, J.S.

    2011-01-01

    Conduits serve as major pathways for groundwater flow in karst aquifers. Locating them from the surface, however, is one of the most challenging tasks in karst research. Geophysical methods are often deployed to help locate voids by mapping variations of physical properties of the subsurface. Conduits can cause significant contrasts of some physical properties that can be detected; other subsurface features such as water-bearing fractures often yield similar contrasts, which are difficult to distinguish from the effects of the conduits. This study used electrical resistivity method to search for an unmapped karst conduit that recharges Royal Spring in the Inner Bluegrass karst region, Kentucky, USA. Three types of resistivity techniques (surface 2D survey, quasi-3D survey, and time-lapse survey) were used to map and characterize resistivity anomalies. Some of the major anomalies were selected as drilling targets to verify the existence of the conduits. Drilling near an anomaly identified by an electrical resistivity profile resulted in successful penetration of a major water-filled conduit. The drilling results also suggest that, in this study area, low resistivity anomalies in general are associated with water-bearing features. However, differences in the anomaly signals between the water-filled conduit and other water-bearing features such as water-filled fracture zones were undistinguishable. The electrical resistivity method is useful in conduit detection by providing potential drilling targets. Knowledge of geology and hydrogeology about the site and professional judgment also played important roles in locating the major conduit. ?? 2011 Elsevier B.V.

  20. Comparison of Two PCR Methods in determining the Methicillin-Resistant Gene in Coagulase-Negative Staphylococci

    Directory of Open Access Journals (Sweden)

    M. Bokaeian

    2016-09-01

    Full Text Available Aims: It is very important to detect the coagulase-negative Staphylococci, which produce the hospital infections. Being one of the most expensive and time-consuming stages before the polymerase chain reaction (PCR, DNA extraction is one of the primary stages of PCR. Then, it should be noticed that the elimination of the stage might save time and costs. The aim of this study was to compare two PCR methods including the method with the utilization of the extracted DNA with the extraction kit and the direct PCR method in the detection of the methicillin-resistant genes in the coagulase-negative Staphylococci. Materials & Methods: In the descriptive cross-sectional study, 135 Staphylococcus epidermidis and 88 Staphylococcus saprophyticus samples were studied, separated from blood, wounds, urinary catheter, and urine samples of patients hospitalized in the treatment centers of Zahedan. The direct PCR was done on the Staphylococcus saprophyticus and Staphylococcus epidermidis colonies. PCR with the extracted DNA was done for mecA and 16srDNA genes using the extraction kit, and the results were compared. Findings: In both methods, mecA and 16srDNA genes were successfully amplified in 310bp and 420bp related to Staphylococcus bacteria identifying gene and methicillin resistant gene, respectively. In addition, there were approximately the same band qualities. Conclusion: In order to save time and costs, the direct PCR method can be used to detect methicillin-resistant coagulase-negative Staphylococci.

  1. Comparison of phenotypic and molecular methods in the detection of methicillin resistant Staphylococcus aureus and its implications

    Directory of Open Access Journals (Sweden)

    Poongodi Lakshmi Santhanakumarasamy

    2015-01-01

    Full Text Available Background: Globally, Staphylococcus aureus is considered the most common cause of nosocomial infections. In recent times, there is a steady rise in the number of methicillin resistant S. aureus (MRSA isolates. Aim: This study was done to find out the prevalence, antimicrobial sensitivity pattern and evaluation of different methods (cefoxitin disc diffusion [DD] method, Chrom agar and polymerase chain reaction [PCR] in the detection of MRSA. Materials and Methods: A total of 100 S. aureus isolates from pus samples were identified by standard biochemical techniques. Antimicrobial susceptibility testing was done by Kirby Bauer′s DD method as per Clinical and Laboratory Standards Institute guidelines. D test was done to detect clindamycin resistance. Methicillin resistance was evaluated by cefoxitin DD method, Chrom agar (HiCrome MeReSa agar base and selective supplement and reverse transcription-PCR. Result: Out of 100 S. aureus isolates, 34% were detected as MRSA by cefoxitin DD method. All these isolates were detected by Chrom agar within 24 h. Additional isolates were not detected even after 48 h of incubation. mecA gene was detected by PCR in all these 34 MRSA isolates. Conclusion: The early detection of MRSA is of prime importance in the prognosis of staphylococcal infections. An integrated awareness program, good hand wash technique, epidemiological studies and effective control measures are the goals for elimination of MRSA in hospitals.

  2. Alkali corrosion resistant coatings and ceramic foams having superfine open cell structure and method of processing

    Science.gov (United States)

    Brown, Jr., Jesse J.; Hirschfeld, Deidre A.; Li, Tingkai

    1993-12-07

    Alkali corrosion resistant coatings and ceramic foams having superfine open cell structure are created using sol-gel processes. The processes have particular application in creating calcium magnesium zirconium phosphate, CMZP, coatings and foams.

  3. Resistivity Imaging by CSAMT Method in Takigami Geothermal Field in Kyushu, Japan

    OpenAIRE

    Mustopa, Enjang Jaenal; Furuya, Shigetsugu; Jotaki, Hisashi; Ushijima, Keisuke

    2003-01-01

    Controlled-source audiofrequency magnetotelluric (CSAMT) survey was carried out in Takigami geothermal field. Stations were taken closely with regular grid spacing of 150 m. The purpose of the measurements is to delineate a detailed resistivity structure

  4. Calibration of Resistance Factors for Drilled Shafts for the New FHWA Design Method : Research Project Capsule

    Science.gov (United States)

    2011-02-01

    The Federal Highway Administration (FHWA) and American Association of State : Highway and Transportation Offi cials (AASHTO) require that all federally funded : bridges including substructures be designed using the load and resistance : factor design...

  5. Polarized electron sources

    Energy Technology Data Exchange (ETDEWEB)

    Prepost, R. [Univ. of Wisconsin, Madison, WI (United States)

    1994-12-01

    The fundamentals of polarized electron sources are described with particular application to the Stanford Linear Accelerator Center. The SLAC polarized electron source is based on the principle of polarized photoemission from Gallium Arsenide. Recent developments using epitaxially grown, strained Gallium Arsenide cathodes have made it possible to obtain electron polarization significantly in excess of the conventional 50% polarization limit. The basic principles for Gallium and Arsenide polarized photoemitters are reviewed, and the extension of the basic technique to strained cathode structures is described. Results from laboratory measurements of strained photocathodes as well as operational results from the SLAC polarized source are presented.

  6. Study of corrosion resistance of chromium-nickel steel in calcium - hypochlorite solution. Part 1. Steels uranus b6

    Directory of Open Access Journals (Sweden)

    Tošković D.

    2002-01-01

    Full Text Available Corrosion resistance of Cr - Ni (special steels specimen is tested by electrochemical methods, numerical method of linear polarization and polarization resistance method in calcium-hypochlorite (Ca(OCl2 solutions. With increasing of Ca(OCl2 concentration, pH value of the solution increases, as well as active chlorine concentration and corrosion activity of the medium. According to the quantitative method of the corrosion resistance determination it can be concluded that the steels tested in 1 wt % Ca(OCl2 solution are resistant, in 10 wt % solution constant, and in 50 wt % suspension less resistant. URANUS B6 showed the best corrosion resistance of all tested chromium - nickel steels in all tested corrosion mediums.

  7. High school physical educators' and sport coaches' knowledge of resistance training principles and methods.

    Science.gov (United States)

    McGladrey, Brian W; Hannon, James C; Faigenbaum, Avery D; Shultz, Barry B; Shaw, Janet M

    2014-05-01

    The purpose of this study was to determine the level of knowledge that current and preservice high school (HS) physical educators and sport coaches possess regarding the principles and methods involved in youth resistance training (RT) and to determine if that knowledge was acceptable based on a predetermined criterion (passing score). A panel of 10 experts in RT or sport pedagogy used a Delphi technique to create a 90-question assessment (examination) that was administered to 287 HS physical educators and sport coaches and 140 university physical education teacher education (PETE) students. An analysis of the results revealed that neither group demonstrated the minimal knowledge necessary to design, implement, and supervise RT programs based on a passing score of 75%: HS physical educators/coaches, mean = 59.30, SD = 14.30, 95% confidence interval (CI) = 57.64-60.96], t(286) = -18.61, p = 0.000; university PETE students, mean = 56.61, SD = 16.59, 95% CI = 53.84-59.38, t(139) = -13.12, p = 0.000. The pass rate for physical educators and sport coaches was 14.3% and for university PETE students it was 20.7%. The results of this study indicate that both current and preservice physical educators and sport coaches need additional education and training specific to the design and implementation of RT programs for HS students. Given that school districts typically require their educators attend in-service training programs, it may be advisable to develop an in-service program that allows both current and preservice HS physical educators and sport coaches to earn an RT certification that specifically addresses the unique physical and psychosocial needs of school-aged youth.

  8. A standardized method to determine the concentration of extracellular vesicles using tunable resistive pulse sensing.

    Science.gov (United States)

    Vogel, Robert; Coumans, Frank A W; Maltesen, Raluca G; Böing, Anita N; Bonnington, Katherine E; Broekman, Marike L; Broom, Murray F; Buzás, Edit I; Christiansen, Gunna; Hajji, Najat; Kristensen, Søren R; Kuehn, Meta J; Lund, Sigrid M; Maas, Sybren L N; Nieuwland, Rienk; Osteikoetxea, Xabier; Schnoor, Rosalie; Scicluna, Benjamin J; Shambrook, Mitch; de Vrij, Jeroen; Mann, Stephen I; Hill, Andrew F; Pedersen, Shona

    2016-01-01

    Understanding the pathogenic role of extracellular vesicles (EVs) in disease and their potential diagnostic and therapeutic utility is extremely reliant on in-depth quantification, measurement and identification of EV sub-populations. Quantification of EVs has presented several challenges, predominantly due to the small size of vesicles such as exosomes and the availability of various technologies to measure nanosized particles, each technology having its own limitations. A standardized methodology to measure the concentration of extracellular vesicles (EVs) has been developed and tested. The method is based on measuring the EV concentration as a function of a defined size range. Blood plasma EVs are isolated and purified using size exclusion columns (qEV) and consecutively measured with tunable resistive pulse sensing (TRPS). Six independent research groups measured liposome and EV samples with the aim to evaluate the developed methodology. Each group measured identical samples using up to 5 nanopores with 3 repeat measurements per pore. Descriptive statistics and unsupervised multivariate data analysis with principal component analysis (PCA) were used to evaluate reproducibility across the groups and to explore and visualise possible patterns and outliers in EV and liposome data sets. PCA revealed good reproducibility within and between laboratories, with few minor outlying samples. Measured mean liposome (not filtered with qEV) and EV (filtered with qEV) concentrations had coefficients of variance of 23.9% and 52.5%, respectively. The increased variance of the EV concentration measurements could be attributed to the use of qEVs and the polydisperse nature of EVs. The results of this study demonstrate the feasibility of this standardized methodology to facilitate comparable and reproducible EV concentration measurements.

  9. Oocytes Polar Body Detection for Automatic Enucleation

    Directory of Open Access Journals (Sweden)

    Di Chen

    2016-02-01

    Full Text Available Enucleation is a crucial step in cloning. In order to achieve automatic blind enucleation, we should detect the polar body of the oocyte automatically. The conventional polar body detection approaches have low success rate or low efficiency. We propose a polar body detection method based on machine learning in this paper. On one hand, the improved Histogram of Oriented Gradient (HOG algorithm is employed to extract features of polar body images, which will increase success rate. On the other hand, a position prediction method is put forward to narrow the search range of polar body, which will improve efficiency. Experiment results show that the success rate is 96% for various types of polar bodies. Furthermore, the method is applied to an enucleation experiment and improves the degree of automatic enucleation.

  10. Abrasive Wear Resistance of the Iron- and WC-based Hardfaced Coatings Evaluated with Scratch Test Method

    Directory of Open Access Journals (Sweden)

    A. Vencl

    2013-06-01

    Full Text Available Abrasive wear is one of the most common types of wear, which makesabrasive wear resistance very important in many industries. Thehard facing is considered as useful and economical way to improve theperformance of components submitted to severe abrasive wear conditions, with wide range of applicable filler materials. The abrasive wear resistance of the three different hardfaced coatings (two iron‐based and one WC‐based, which were intended to be used for reparation of the impact plates of the ventilation mill, was investigated and compared. Abrasive wear tests were carried‐out by using the scratch tester under the dry conditions. Three normal loads of 10, 50 and 100 N and the constant sliding speed of 4 mm/s were used. Scratch test was chosen as a relatively easy and quick test method. Wear mechanism analysis showed significant influence of the hardfaced coatings structure, which, along with hardness, has determined coatings abrasive wear resistance.

  11. Applying 2-D resistivity imaging and ground penetrating radar (GPR) methods to identify infiltration of water in the ground surface

    Science.gov (United States)

    Yusof, Azim Hilmy Mohamad; Azman, Muhamad Iqbal Mubarak Faharul; Ismail, Nur Azwin; Ismail, Noer El Hidayah

    2017-07-01

    Infiltration of water into the soil mostly happens in area near to the ocean or area where rain occurred frequently. This paper explains about the water infiltration process that occurred vertically and horizontally at the subsurface layer. Infiltration act as an indicator of the soil's ability to allow water movement into and through the soil profile. This research takes place at Teluk Kumbar, Pulau Pinang, area that located near to the sea. Thus, infiltration process occurs actively. The study area consists of unconsolidated marine clay, sand and gravel deposits. Furthermore, the methods used for this research is 2-D Resistivity Imaging by using Wenner-Schlumberger array with 2.5 m minimum electrode spacing, and the second method is Ground Penetrating Radar (GPR) with antenna frequency of 250MHz. 2-D Resistivity Imaging is used to investigate the subsurface layer of the soil. Other than that, this method can also be used to investigate the water infiltration that happens horizontally. GPR is used to investigate shallow subsurface layer and to investigate the water infiltration from above. The results of inversion model of 2-D Resistivity Imaging shows that the subsurface layer at distance of 0 m to 20 m are suspected to be salt water intrusion zone due to the resistivity value of 0 Ω.m to 1 Ω.m. As for the radargram results from the GPR, the anomaly seems to be blurry and unclear, and EM waves signal can only penetrate up to 1.5 m depth. This feature shows that the subsurface layer is saturated with salt water. Applying 2-D resistivity imaging and GPR method were implemented to each other in identifying infiltration of water in the ground surface.

  12. Modeling optical and UV polarization of AGNs. IV. Polarization timing

    Science.gov (United States)

    Rojas Lobos, P. A.; Goosmann, R. W.; Marin, F.; Savić, D.

    2018-03-01

    Context. Optical observations cannot resolve the structure of active galactic nuclei (AGN), and a unified model for AGN was inferred mostly from indirect methods, such as spectroscopy and variability studies. Optical reverberation mapping allowed us to constrain the spatial dimension of the broad emission line region and thereby to measure the mass of supermassive black holes. Recently, reverberation was also applied to the polarized signal emerging from different AGN components. In principle, this should allow us to measure the spatial dimensions of the sub-parsec reprocessing media. Aim. We conduct numerical modeling of polarization reverberation and provide theoretical predictions for the polarization time lag induced by different AGN components. The model parameters are adjusted to the observational appearance of the Seyfert 1 galaxy NGC 4151. Methods: We modeled scattering-induced polarization and tested different geometries for the circumnuclear dust component. Our tests included the effects of clumpiness and different dust prescriptions. To further extend the model, we also explored the effects of additional ionized winds stretched along the polar direction, and of an equatorial scattering ring that is responsible for the polarization angle observed in pole-on AGN. The simulations were run using a time-dependent version of the STOKES code. Results: Our modeling confirms the previously found polarization characteristics as a function of the observer`s viewing angle. When the dust adopts a flared-disk geometry, the lags reveal a clear difference between type 1 and type 2 AGN. This distinction is less clear for a torus geometry where the time lag is more sensitive to the geometry and optical depth of the inner surface layers of the funnel. The presence of a scattering equatorial ring and ionized outflows increased the recorded polarization time lags, and the polar outflows smooths out dependence on viewing angle, especially for the higher optical depth of the

  13. Detection of leaks in underground storage tanks using electrical resistance methods: 1996 results

    International Nuclear Information System (INIS)

    Ramirez, A.; Daily, W.

    1996-10-01

    This document provides a summary of a field experiment performed under a 15m diameter steel tank mockup located at the Hanford Reservation, Washington. The purpose of this test was to image a contaminant plume as it develops in soil under a tank already contaminated by previous leakage and to determine whether contaminant plumes can be detected without the benefit of background data. Measurements of electrical resistance were made before and during a salt water release. These measurements were made in soil which contained the remnants of salt water plumes released during previous tests in 1994 and in 1995. About 11,150 liters of saline solution were released along a portion of the tank's edge in 1996. Changes in electrical resistivity due to release of salt water conducted in 1996 were determined in two ways: (1) changes relative to the 1996 pre-spill data, and (2) changes relative to data collected near the middle of the 1996 spill after the release flow rate was increased. In both cases, the observed resistivity changes show clearly defined anomalies caused by the salt water release. These results indicate that when a plume develops over an existing plume and in a geologic environment similar to the test site environment, the resulting resistivity changes are easily detectable. Three dimensional tomographs of the resistivity of the soil under the tank show that the salt water release caused a region of low soil resistivity which can be observed directly without the benefit of comparing the tomograph to tomographs or data collected before the spill started. This means that it may be possible to infer the presence of pre-existing plumes if there is other data showing that the regions of low resistivity are correlated with the presence of contaminated soil. However, this approach does not appear reliable in defining the total extent of the plume due to the confounding effect that natural heterogeneity has on our ability to define the margins of the anomaly

  14. A reliable extraction method for source and drain series resistances in silicon nanowire metal-oxide-semiconductor field-effect-transistors (MOSFETs) based on radio-frequency analysis.

    Science.gov (United States)

    Hwa, Jae Hwa; Yoon, Young Jun; Lee, Hwan Gi; Yoo, Gwan Min; Cho, Eou-Sik; Cho, Seongjae; Lee, Jung-Hee; Kang, In Man

    2014-11-01

    This paper presents a new extraction method for source and drain (S/D) series resistances of silicon nanowire (SNW) metal-oxide-semiconductor field-effect transistors (MOSFETs) based on small-signal radio-frequency (RF) analysis. The proposed method can be applied to the extraction of S/D series resistances for SNW MOSFETs with finite off-state channel resistance as well as gate bias-dependent on-state resistive components realized by 3-dimensional (3-D) device simulation. The series resistances as a function of frequency and gate voltage are presented and compared with the results obtained by an existing method with infinite off-state channel resistance model. The accuracy of the newly proposed parameter extraction method has been successfully verified by Z22- and Y-parameters up to 100 GHz operation frequency.

  15. The retrieval of a buried cylindrical obstacle by a constrained modified gradient method in the H-polarization case and for Maxwellian materials

    Science.gov (United States)

    Lambert, M.; Lesselier, D.; Kooij, B. J.

    1998-10-01

    The retrieval of an unknown, possibly inhomogeneous, penetrable cylindrical obstacle buried entirely in a known homogeneous half-space - the constitutive material parameters of the obstacle and of its embedding obey a Maxwell model - is considered from single- or multiple-frequency aspect-limited data collected by ideal sensors located in air above the embedding half-space, when a small number of time-harmonic transverse electric (TE)-polarized line sources - the magnetic field H is directed along the axis of the cylinder - is also placed in air. The wavefield is modelled from a rigorous H-field domain integral-differential formulation which involves the dot product of the gradients of the single component of H and of the Green function of the stratified environment times a scalar-valued contrast function which contains the obstacle parameters (the frequency-independent, position-dependent relative permittivity and conductivity). A modified gradient method is developed in order to reconstruct the maps of such parameters within a prescribed search domain from the iterative minimization of a cost functional which incorporates both the error in reproducing the data and the error on the field built inside this domain. Non-physical values are excluded and convergence reached by incorporating in the solution algorithm, from a proper choice of unknowns, the condition that the relative permittivity be larger than or equal to 1, and the conductivity be non-negative. The efficiency of the constrained method is illustrated from noiseless and noisy synthetic data acquired independently. The importance of the choice of the initial values of the sought quantities, the need for a periodic refreshment of the constitutive parameters to avoid the algorithm providing inconsistent results, and the interest of a frequency-hopping strategy to obtain finer and finer features of the obstacle when the frequency is raised, are underlined. It is also shown that though either the permittivity

  16. 3-D DC resistivity modelling with arbitrary long electrode sources using finite element method on unstructured grids

    Science.gov (United States)

    Yang, Jun; Liu, Yuanying; Wu, Xiaoping

    2017-11-01

    We present a 3-D electrical resistivity modelling with long electrode sources using finite element method on unstructured tetrahedral grids. The radius and resistivity of the electrode is neglected and the electrode can be regarded as a line source with finite length in our modelling. An approximated equation for determining the current density along the electrode is derived for current density correction in heterogeneous media. Electrical fields excited by arbitrary long electrode sources in heterogeneous conductive media can be simulated. Both total- and secondary-potential methods are implemented in the simulation. The analytic electrical potentials of an arbitrary long electrode source in a conductive half-space is derived and used for accuracy analysis in the numerical simulations. The apparent resistivities for survey arrays with long electrode sources are proposed based on the analytic solution of the half-space model. The responses of electrical fields excited by point electrode and long electrode sources to resistivity anomalies are compared with ground and borehole simulations, which shows that the arrays with long electrode sources are more sensitive to the anomalies than those with point electrode sources. A time-lapsed monitoring for hydraulic fracturing in oil field using the production wells as long electrode sources is also simulated, which indicates that the borehole potential data of the long electrode source array can help assess the location of the fracture zone.

  17. Ultra-wideband polarization insensitive UT-shaped metamaterial absorber

    Science.gov (United States)

    Karampour, Nasrollah; Nozhat, Najmeh

    2017-05-01

    In this paper, an ultra-wideband metamaterial absorber (MMA) with U and T shaped resonators has been proposed. The resonators and the ground plane consist of gold (Au) and titanium (Ti) layers. The resistive sheet effect of Ti layer and the resonance elements in the structure cause a broad absorption spectrum. The simulations are based on the finite element method (FEM) and the results show that the absorption of the proposed structure is more than 90% between 150 and 300 THz that is much larger than previous works. Moreover, by applying the interference theory, we have demonstrated that the simulation results are in good agreement with the theoretical results. The primary proposed MMA is polarization sensitive. Therefore, a polarization insensitive metamaterial absorber has been suggested. Also, because of the extra resonance elements the full width at 90% absorption increases about 35 THz. This ultra-wideband MMA has various applications in microbalometer, imaging, thermal emitters, photovoltaic, and energy harvesting.

  18. LCR circuit: new simple methods for measuring the equivalent series resistance of a capacitor and inductance of a coil

    Science.gov (United States)

    Ivković, Saša S.; Marković, Marija Z.; Ivković, Dragica Ž.; Cvetanović, Nikola

    2017-09-01

    Equivalent series resistance (ESR) represents the measurement of total energy loss in a capacitor. In this paper a simple method for measuring the ESR of ceramic capacitors based on the analysis of the oscillations of an LCR circuit is proposed. It is shown that at frequencies under 3300 Hz, the ESR is directly proportional to the period of oscillations. Based on the determined dependence of the ESR on the period, a method is devised and tested for measuring coil inductance. All measurements were performed using the standard equipment found in student laboratories, which makes both methods very suitable for implementation at high school and university levels.

  19. Polarization in free electron lasers

    Energy Technology Data Exchange (ETDEWEB)

    Papadichev, V.A. [Lebedev Physical Institute, Moscow (Russian Federation)

    1995-12-31

    Polarization of electromagnetic radiation is required very often in numerous scientific and industrial applications: studying of crystals, molecules and intermolecular interaction high-temperature superconductivity, semiconductors and their transitions, polymers and liquid crystals. Using polarized radiation allows to obtain important data (otherwise inaccessible) in astrophysics, meteorology and oceanology. It is promising in chemistry and biology for selective influence on definite parts of molecules in chain synthesis reactions, precise control of various processes at cell and subcell levels, genetic engineering etc. Though polarization methods are well elaborated in optics, they can fail in far-infrared, vacuum-ultraviolet and X-ray regions because of lack of suitable non-absorbing materials and damaging of optical elements at high specific power levels. Therefore, it is of some interest to analyse polarization of untreated FEL radiation obtained with various types of undulators, with and without axial magnetic field. The polarization is studied using solutions for electron orbits in various cases: plane or helical undulator with or without axial magnetic field, two plane undulators, a combination of right- and left-handed helical undulators with equal periods, but different field amplitudes. Some examples of how a desired polarization (elliptical circular or linear) can be obtained or changed quickly, which is necessary in many experiments, are given.

  20. Pressure vessel with improved impact resistance and method of making the same

    Science.gov (United States)

    DeLay, Thomas K. (Inventor); Patterson, James E. (Inventor); Olson, Michael A. (Inventor)

    2010-01-01

    A composite overwrapped pressure vessel is provided which includes a composite overwrapping material including fibers disposed in a resin matrix. At least first and second kinds of fibers are used. These fibers typically have characteristics of high strength and high toughness to provide impact resistance with increased pressure handling capability and low weight. The fibers are applied to form a pressure vessel using wrapping or winding techniques with winding angles varied for specific performance characteristics. The fibers of different kinds are dispersed in a single layer of winding or wound in distinct separate layers. Layers of fabric comprised of such fibers are interspersed between windings for added strength or impact resistance. The weight percentages of the high toughness and high strength materials are varied to provide specified impact resistance characteristics. The resin matrix is formed with prepregnated fibers or through wet winding. The vessels are formed with or without liners.